#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCG8	64241	genome.wustl.edu	37	2	44079810	44079810	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:44079810C>T	ENST00000272286.2	+	6	857	c.767C>T	c.(766-768)tCc>tTc	p.S256F		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	256	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	AAGACCTTGTCCAGGCTGGCC	0.572																																																	0													79.0	72.0	74.0					2																	44079810		2203	4300	6503	SO:0001583	missense	0			AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.767C>T	2.37:g.44079810C>T	ENSP00000272286:p.Ser256Phe		Q53QN8	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	p.S256F	ENST00000272286.2	37	c.767	CCDS1815.1	2	.	.	.	.	.	.	.	.	.	.	C	10.94	1.493554	0.26774	.	.	ENSG00000143921	ENST00000272286	T	0.42513	0.97	5.06	3.22	0.36961	ABC transporter-like (1);	0.275441	0.42682	D	0.000665	T	0.47948	0.1473	L	0.46157	1.445	0.48288	D	0.999621	D;D	0.61080	0.989;0.982	P;P	0.59643	0.861;0.729	T	0.26467	-1.0102	10	0.23302	T	0.38	.	10.203	0.43097	0.1356:0.7926:0.0:0.0718	.	256;256	Q9H221-2;Q9H221	.;ABCG8_HUMAN	F	256	ENSP00000272286:S256F	ENSP00000272286:S256F	S	+	2	0	ABCG8	43933314	1.000000	0.71417	0.196000	0.23383	0.801000	0.45260	2.939000	0.48995	0.498000	0.27948	0.561000	0.74099	TCC	ABCG8	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like	ENSG00000143921		0.572	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG8	HGNC	protein_coding	OTTHUMT00000250671.1	-	0.00	39	0	C	NM_022437		44079810	+1	tier1	-	no_errors	ENST00000272286	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	T
ACOX1	51	genome.wustl.edu	37	17	73975071	73975071	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:73975071C>T	ENST00000301608.4	-	1	144	c.84G>A	c.(82-84)gaG>gaA	p.E28E	ACOX1_ENST00000293217.5_Silent_p.E28E|TEN1_ENST00000588202.1_5'Flank|TEN1-CDK3_ENST00000567351.1_RNA|ACOX1_ENST00000591857.1_5'UTR|TEN1_ENST00000416485.1_5'Flank|ACOX1_ENST00000537812.1_5'UTR|TEN1_ENST00000397640.1_5'Flank	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	28					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	GCCGGGTTTTCTCGGGGCTGC	0.677																																																	0													43.0	51.0	49.0					17																	73975071		2203	4300	6503	SO:0001819	synonymous_variant	0			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.84G>A	17.37:g.73975071C>T			A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Silent	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	p.E28	ENST00000301608.4	37	c.84	CCDS11735.1	17																																																																																			ACOX1	-	superfamily_AcylCoA_DH/oxidase_NM_dom,pirsf_Acyl-CoA_oxidase	ENSG00000161533		0.677	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACOX1	HGNC	protein_coding	OTTHUMT00000439503.1	-	0.00	45	0	C			73975071	-1	tier1	-	no_errors	ENST00000293217	ensembl	human	known	74_37	silent	23.08	30	9	SNP	1.000	T
ADAMTSL1	92949	genome.wustl.edu	37	9	18776926	18776926	+	Missense_Mutation	SNP	C	C	T	rs376039296		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:18776926C>T	ENST00000380548.4	+	19	3038	c.2699C>T	c.(2698-2700)cCg>cTg	p.P900L		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	900	Ig-like C2-type 1.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CTGCGCTGCCCGGCGCGCAGG	0.657																																																	0								C	LEU/PRO	0,4114		0,0,2057	23.0	30.0	28.0		2699	4.6	1.0	9		28	1,8369		0,1,4184	no	missense	ADAMTSL1	NM_001040272.5	98	0,1,6241	TT,TC,CC		0.0119,0.0,0.0080	probably-damaging	900/1763	18776926	1,12483	2057	4185	6242	SO:0001583	missense	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2699C>T	9.37:g.18776926C>T	ENSP00000369921:p.Pro900Leu		A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.P900L	ENST00000380548.4	37	c.2699	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	C	15.50	2.852751	0.51270	0.0	1.19E-4	ENSG00000178031	ENST00000380548	T	0.12255	2.7	5.48	4.56	0.56223	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	100.034000	0.05078	U	0.482860	T	0.30293	0.0760	L	0.39514	1.22	0.80722	D	1	D	0.61697	0.99	P	0.58077	0.832	T	0.00317	-1.1822	10	0.72032	D	0.01	.	15.4282	0.75072	0.1402:0.8598:0.0:0.0	.	900	Q8N6G6	ATL1_HUMAN	L	900	ENSP00000369921:P900L	ENSP00000369921:P900L	P	+	2	0	ADAMTSL1	18766926	1.000000	0.71417	0.995000	0.50966	0.427000	0.31564	4.780000	0.62382	1.262000	0.44165	0.563000	0.77884	CCG	ADAMTSL1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000178031		0.657	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	-	0.00	34	0	C			18776926	+1	tier1	-	no_errors	ENST00000380548	ensembl	human	novel	74_37	missense	61.02	23	36	SNP	1.000	T
ADSL	158	genome.wustl.edu	37	22	40754947	40754947	+	Missense_Mutation	SNP	C	C	T	rs371892194		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr22:40754947C>T	ENST00000216194.7	+	5	618	c.562C>T	c.(562-564)Cgt>Tgt	p.R188C	ADSL_ENST00000454266.2_Missense_Mutation_p.R202C|ADSL_ENST00000342312.6_Missense_Mutation_p.R188C	NM_000026.2	NP_000017.1	P30566	PUR8_HUMAN	adenylosuccinate lyase	188					'de novo' AMP biosynthetic process (GO:0044208)|'de novo' IMP biosynthetic process (GO:0006189)|aerobic respiration (GO:0009060)|AMP biosynthetic process (GO:0006167)|metabolic process (GO:0008152)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	(S)-2-(5-amino-1-(5-phospho-D-ribosyl)imidazole-4-carboxamido)succinate AMP-lyase (fumarate-forming) activity (GO:0070626)|N6-(1,2-dicarboxyethyl)AMP AMP-lyase (fumarate-forming) activity (GO:0004018)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(2)|ovary(1)|prostate(1)	19						GAACTTGAAGCGTGTCCGAGA	0.517																																					Colon(4;65 130 1097 1516)												0													146.0	129.0	135.0					22																	40754947		2203	4300	6503	SO:0001583	missense	0			X65867	CCDS14001.1, CCDS46714.1	22q13.1	2011-02-17			ENSG00000239900	ENSG00000239900	4.3.2.2		291	protein-coding gene	gene with protein product		608222				8404037	Standard	NM_000026		Approved		uc003ayp.4	P30566	OTTHUMG00000166425	ENST00000216194.7:c.562C>T	22.37:g.40754947C>T	ENSP00000216194:p.Arg188Cys		B0QY76|O75495|Q5TI34	Missense_Mutation	SNP	pfam_Fumarate_lyase_N,pfam_AdenyloSucc_lyase_C,superfamily_L-Aspartase-like,prints_Fumarate_lyase_fam,tigrfam_Pur_lyase	p.R202C	ENST00000216194.7	37	c.604	CCDS14001.1	22	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332570	0.81801	.	.	ENSG00000239900	ENST00000216194;ENST00000454266;ENST00000537028;ENST00000342312	D;D;D	0.99399	-5.83;-5.83;-5.83	6.05	5.02	0.67125	Lyase 1, N-terminal (1);L-Aspartase-like (1);	0.000000	0.85682	D	0.000000	D	0.99582	0.9849	M	0.91717	3.235	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71870	0.969;0.957;0.975;0.975	D	0.98419	1.0576	10	0.42905	T	0.14	-14.0267	16.5955	0.84795	0.1313:0.8687:0.0:0.0	.	202;188;188;188	E7ERF4;P30566-2;Q71UA4;P30566	.;.;.;PUR8_HUMAN	C	188;202;8;188	ENSP00000216194:R188C;ENSP00000390107:R202C;ENSP00000341429:R188C	ENSP00000216194:R188C	R	+	1	0	ADSL	39084893	1.000000	0.71417	0.139000	0.22197	0.914000	0.54420	4.205000	0.58466	1.519000	0.48950	0.650000	0.86243	CGT	ADSL	-	pfam_Fumarate_lyase_N,superfamily_L-Aspartase-like,tigrfam_Pur_lyase	ENSG00000239900		0.517	ADSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADSL	HGNC	protein_coding	OTTHUMT00000321386.1	-	0.00	41	0	C	NM_000026		40754947	+1	tier1	-	no_errors	ENST00000454266	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	T
AGL	178	genome.wustl.edu	37	1	100316652	100316652	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:100316652G>A	ENST00000294724.4	+	2	532	c.54G>A	c.(52-54)ctG>ctA	p.L18L	AGL_ENST00000370163.3_Silent_p.L18L|AGL_ENST00000361302.3_5'UTR|AGL_ENST00000370161.2_5'Flank|AGL_ENST00000361915.3_Silent_p.L18L|AGL_ENST00000370165.3_Silent_p.L18L	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	18					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TGGAGAAACTGGAAAAGACCC	0.343																																																	0													130.0	142.0	138.0					1																	100316652		2203	4300	6503	SO:0001819	synonymous_variant	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.54G>A	1.37:g.100316652G>A			A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Silent	SNP	pfam_AGL/Gdb1,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.L18	ENST00000294724.4	37	c.54	CCDS759.1	1																																																																																			AGL	-	NULL	ENSG00000162688		0.343	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	-	0.00	44	0	G	NM_000028		100316652	+1	tier1	-	no_errors	ENST00000294724	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.995	A
AGMO	392636	genome.wustl.edu	37	7	15427133	15427133	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:15427133G>A	ENST00000342526.3	-	9	1024	c.855C>T	c.(853-855)ttC>ttT	p.F285F		NM_001004320.1	NP_001004320.1	Q6ZNB7	ALKMO_HUMAN	alkylglycerol monooxygenase	285					ether lipid metabolic process (GO:0046485)|fatty acid biosynthetic process (GO:0006633)|membrane lipid metabolic process (GO:0006643)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glyceryl-ether monooxygenase activity (GO:0050479)|iron ion binding (GO:0005506)			breast(1)|kidney(1)|large_intestine(6)|liver(1)|lung(30)|prostate(1)|skin(2)	42						GTGTGGCCCAGAATGTAGTCC	0.358																																																	0													73.0	79.0	77.0					7																	15427133		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34604.1	7p21.1	2013-03-04	2011-01-31	2011-01-31	ENSG00000187546	ENSG00000187546	1.14.16.5	"""Fatty acid hydroxylase domain containing"""	33784	protein-coding gene	gene with protein product		613738	"""transmembrane protein 195"""	TMEM195		20643956	Standard	NM_001004320		Approved	FLJ16237	uc003stb.1	Q6ZNB7	OTTHUMG00000152387	ENST00000342526.3:c.855C>T	7.37:g.15427133G>A			A4D114|A6NCH5	Silent	SNP	pfam_Fatty_acid_hydroxylase	p.F285	ENST00000342526.3	37	c.855	CCDS34604.1	7																																																																																			AGMO	-	NULL	ENSG00000187546		0.358	AGMO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMO	HGNC	protein_coding	OTTHUMT00000326049.2	-	0.00	49	0	G	NM_001004320		15427133	-1	tier1	-	no_errors	ENST00000342526	ensembl	human	known	74_37	silent	15.00	68	12	SNP	1.000	A
AKT1	207	genome.wustl.edu	37	14	105236687	105236687	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr14:105236687G>T	ENST00000554581.1	-	13	2914	c.1434C>A	c.(1432-1434)ggC>ggA	p.G478G	AKT1_ENST00000554585.1_5'UTR|AKT1_ENST00000554192.1_Silent_p.G165G|AKT1_ENST00000555528.1_Silent_p.G478G|RP11-982M15.2_ENST00000557223.1_RNA|AKT1_ENST00000555458.1_Intron|AKT1_ENST00000349310.3_Silent_p.G478G|AKT1_ENST00000402615.2_Silent_p.G478G|AKT1_ENST00000544168.1_Silent_p.G416G|AKT1_ENST00000554848.1_Silent_p.G478G|AKT1_ENST00000407796.2_Silent_p.G478G			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	478	AGC-kinase C-terminal.			G -> A (in Ref. 7; CAA43372). {ECO:0000305}.|G -> S (in Ref. 1; AAA36539, 2; AAL55732, 3; BAG36922 and 4; BAG70056/BAG70181). {ECO:0000305}.	activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	CTCAGGCCGTGCCGCTGGCCG	0.607		1	Mis		"""breast, colorectal, ovarian, NSCLC"""																																			Dom	yes		14	14q32.32	207	v-akt murine thymoma viral oncogene homolog 1		E	0													41.0	35.0	37.0					14																	105236687		2202	4300	6502	SO:0001819	synonymous_variant	0			M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.1434C>A	14.37:g.105236687G>T			B2RAM5|B7Z5R1|Q9BWB6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom	p.G478	ENST00000554581.1	37	c.1434	CCDS9994.1	14																																																																																			AKT1	-	superfamily_Kinase-like_dom	ENSG00000142208		0.607	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKT1	HGNC	protein_coding	OTTHUMT00000410418.1	-	0.00	48	0	G	NM_005163		105236687	-1	tier1	-	no_errors	ENST00000349310	ensembl	human	known	74_37	silent	8.16	45	4	SNP	1.000	T
ALDH1L2	160428	genome.wustl.edu	37	12	105459083	105459083	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:105459083C>G	ENST00000258494.9	-	6	888	c.748G>C	c.(748-750)Gat>Cat	p.D250H	ALDH1L2_ENST00000424857.2_Missense_Mutation_p.D250H	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	250					10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						GGGACTTTATCATGACCTCGA	0.473																																																	0													100.0	90.0	93.0					12																	105459083		2203	4300	6503	SO:0001583	missense	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.748G>C	12.37:g.105459083C>G	ENSP00000258494:p.Asp250His		Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.D250H	ENST00000258494.9	37	c.748	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	C	27.4	4.827602	0.90955	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.46819	0.86;0.86	5.71	5.71	0.89125	Formyl transferase, C-terminal-like (1);Formyl transferase, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.73513	0.3596	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76575	-0.2909	10	0.87932	D	0	.	19.8506	0.96738	0.0:1.0:0.0:0.0	.	250	Q3SY69	AL1L2_HUMAN	H	250	ENSP00000258494:D250H;ENSP00000389608:D250H	ENSP00000258494:D250H	D	-	1	0	ALDH1L2	103983213	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.415000	0.80131	2.686000	0.91538	0.655000	0.94253	GAT	ALDH1L2	-	pfam_Formyl_trans_C,superfamily_Formyl_transferase_C-like,pirsf_10_FTHF_DH	ENSG00000136010		0.473	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	-	0.00	19	0	C	XM_090294		105459083	-1	tier1	-	no_errors	ENST00000258494	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	G
ANGPT1	284	genome.wustl.edu	37	8	108359252	108359252	+	IGR	SNP	G	G	T	rs573252778		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:108359252G>T								ANGPT1 (10502 upstream) : RNA5SP275 (537469 downstream)																							CATGGTAGCCGTGTGGTTCTG	0.488																																																	0													171.0	151.0	158.0					8																	108359252		2203	4300	6503	SO:0001628	intergenic_variant	0																															8.37:g.108359252G>T				Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.T124K		37	c.371		8	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798133	0.70567	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520033	T;T	0.39406	1.08;1.08	5.95	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.64583	0.2611	M	0.76170	2.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67185	-0.5734	10	0.49607	T	0.09	.	15.1296	0.72511	0.0676:0.0:0.9324:0.0	.	124;124	Q5HYA0;Q15389	.;ANGP1_HUMAN	K	124;124;17	ENSP00000428340:T124K;ENSP00000297450:T124K	ENSP00000297450:T124K	T	-	2	0	ANGPT1	108428428	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	9.864000	0.99589	1.520000	0.48965	0.655000	0.94253	ACG	ANGPT1	-	NULL	ENSG00000154188	0	0.488					ANGPT1	HGNC			-	0.00	52	0	G			108359252	-1	tier1	-	no_errors	ENST00000517746	ensembl	human	known	74_37	missense	12.94	73	11	SNP	1.000	T
ANKRD30B	374860	genome.wustl.edu	37	18	14763794	14763794	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr18:14763794G>T	ENST00000358984.4	+	7	1110	c.930G>T	c.(928-930)gtG>gtT	p.V310V	ANKRD30B_ENST00000579292.1_Intron|ANKRD30B_ENST00000447268.2_Silent_p.V310V	NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	310										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CACGCTTGGTGGAGGGAACGT	0.488																																																	0													65.0	63.0	63.0					18																	14763794		692	1591	2283	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.930G>T	18.37:g.14763794G>T			B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V310	ENST00000358984.4	37	c.930	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.488	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	37	0	G	NM_001145029		14763794	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.021	T
ANKRD36BP2	645784	genome.wustl.edu	37	2	89084344	89084344	+	RNA	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:89084344A>C	ENST00000393525.3	+	0	712									ankyrin repeat domain 36B pseudogene 2																		TGTCATGTTCAGCCAAGATAG	0.403																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89084344A>C				RNA	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.403	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1	-	0.00	79	0	A			89084344	+1	tier1	-	no_errors	ENST00000393515	ensembl	human	known	74_37	rna	17.48	85	18	SNP	0.025	C
ANKRD30BL	554226	genome.wustl.edu	37	2	133015521	133015521	+	5'UTR	SNP	C	C	G	rs74212894		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:133015521C>G	ENST00000470729.1	-	0	21				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCCTCGGCGGCCGGCCGGCGC	0.677																																																	0													23.0	28.0	27.0					2																	133015521		692	1591	2283	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1404G>C	2.37:g.133015521C>G			B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1		0.00	75	0	C	NR_027019		133015521	-1			no_errors	ENST00000470729	ensembl	human	known	74_37	rna	16.13	78	15	SNP	0.006	G
ANO2	57101	genome.wustl.edu	37	12	5915251	5915251	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:5915251G>T	ENST00000356134.5	-	10	1019	c.948C>A	c.(946-948)taC>taA	p.Y316*	ANO2_ENST00000546188.1_Nonsense_Mutation_p.Y316*|ANO2_ENST00000327087.8_Nonsense_Mutation_p.Y315*	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	320					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.Y316Y(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CTGGACTATCGTATTCACCCT	0.458																																																	1	Substitution - coding silent(1)	stomach(1)											81.0	81.0	81.0					12																	5915251		1983	4158	6141	SO:0001587	stop_gained	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.948C>A	12.37:g.5915251G>T	ENSP00000348453:p.Tyr316*		C4N787|Q9H847	Nonsense_Mutation	SNP	pfam_Anoctamin	p.Y316*	ENST00000356134.5	37	c.948		12	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623494	0.66901	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	.	.	.	5.4	-0.956	0.10353	.	0.187544	0.48286	D	0.000200	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0835	0.36567	0.6435:0.0:0.3565:0.0	.	.	.	.	X	315;316;316;320	.	ENSP00000314048:Y315X	Y	-	3	2	ANO2	5785512	0.998000	0.40836	0.802000	0.32245	0.019000	0.09904	0.363000	0.20301	-0.165000	0.10908	-0.880000	0.02959	TAC	ANO2	-	NULL	ENSG00000047617		0.458	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4		0.00	27	0	G	NM_020373		5915251	-1			no_errors	ENST00000356134	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.909	T
ARMC5	79798	genome.wustl.edu	37	16	31476122	31476122	+	Missense_Mutation	SNP	G	G	T	rs368070473		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:31476122G>T	ENST00000563544.1	+	5	2324	c.1778G>T	c.(1777-1779)cGg>cTg	p.R593L	ARMC5_ENST00000408912.3_Missense_Mutation_p.R688L|ARMC5_ENST00000412665.2_Missense_Mutation_p.R237L|ARMC5_ENST00000538189.1_Missense_Mutation_p.R625L|ARMC5_ENST00000268314.4_Missense_Mutation_p.R593L|ARMC5_ENST00000457010.2_Missense_Mutation_p.R593L			Q96C12	ARMC5_HUMAN	armadillo repeat containing 5	593										central_nervous_system(1)|endometrium(4)|large_intestine(3)|liver(2)|lung(12)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						GCGCTGCTGCGGGCCTGGCTG	0.711																																																	0													10.0	12.0	11.0					16																	31476122		2141	4235	6376	SO:0001583	missense	0			AY217348	CCDS42155.1, CCDS45472.1, CCDS73874.1	16p11	2013-02-14			ENSG00000140691	ENSG00000140691		"""Armadillo repeat containing"""	25781	protein-coding gene	gene with protein product		615549					Standard	NM_024742		Approved	FLJ13063	uc002ecc.3	Q96C12	OTTHUMG00000176618	ENST00000563544.1:c.1778G>T	16.37:g.31476122G>T	ENSP00000456877:p.Arg593Leu		Q86WM9|Q9H7P8|Q9H925	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_BTB/POZ_fold,smart_Armadillo,pfscan_Armadillo,pfscan_BTB/POZ-like	p.R688L	ENST00000563544.1	37	c.2063	CCDS45472.1	16	.	.	.	.	.	.	.	.	.	.	G	20.3	3.961919	0.74016	.	.	ENSG00000140691	ENST00000408912;ENST00000538189;ENST00000268314;ENST00000457010;ENST00000412665	T;T;T;T;T	0.39056	1.94;1.94;1.94;1.94;1.1	5.74	4.73	0.59995	Armadillo-type fold (1);	0.267431	0.34932	N	0.003577	T	0.49389	0.1554	L	0.53249	1.67	0.09310	N	0.999996	P;D;D;P;D	0.57257	0.949;0.979;0.979;0.772;0.979	P;P;P;B;P	0.52856	0.553;0.569;0.569;0.28;0.711	T	0.42531	-0.9446	10	0.41790	T	0.15	-38.9492	13.9492	0.64106	0.0:0.1532:0.8468:0.0	.	625;625;688;593;593	B4DH27;F5H156;B4DIU9;Q96C12;Q96C12-4	.;.;.;ARMC5_HUMAN;.	L	688;625;593;593;237	ENSP00000386125:R688L;ENSP00000443995:R625L;ENSP00000268314:R593L;ENSP00000399561:R593L;ENSP00000400183:R237L	ENSP00000268314:R593L	R	+	2	0	ARMC5	31383623	0.999000	0.42202	0.901000	0.35422	0.631000	0.37964	4.638000	0.61353	2.721000	0.93114	0.491000	0.48974	CGG	ARMC5	-	superfamily_ARM-type_fold	ENSG00000140691		0.711	ARMC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC5	HGNC	protein_coding	OTTHUMT00000432847.1		0.00	30	0	G	NM_024742		31476122	+1			no_errors	ENST00000408912	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.178	T
ASXL1	171023	genome.wustl.edu	37	20	31024730	31024730	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:31024730C>T	ENST00000375687.4	+	13	4639	c.4215C>T	c.(4213-4215)gtC>gtT	p.V1405V	ASXL1_ENST00000306058.5_Silent_p.V1400V	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1405					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TGCCCTTTGTCATGGACTTGC	0.562			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													108.0	113.0	111.0					20																	31024730		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.4215C>T	20.37:g.31024730C>T			B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	NULL	p.V1405	ENST00000375687.4	37	c.4215	CCDS13201.1	20																																																																																			ASXL1	-	NULL	ENSG00000171456		0.562	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2		0.00	25	0	C	NM_015338		31024730	+1			no_errors	ENST00000375687	ensembl	human	known	74_37	silent	7.69	36	3	SNP	1.000	T
ATP13A2	23400	genome.wustl.edu	37	1	17322751	17322751	+	Missense_Mutation	SNP	G	G	A	rs139065780		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:17322751G>A	ENST00000326735.8	-	14	1384	c.1351C>T	c.(1351-1353)Cgg>Tgg	p.R451W	ATP13A2_ENST00000452699.1_Missense_Mutation_p.R446W|RP1-37C10.3_ENST00000446261.1_RNA|ATP13A2_ENST00000502860.1_5'UTR|ATP13A2_ENST00000341676.5_Missense_Mutation_p.R446W			Q9NQ11	AT132_HUMAN	ATPase type 13A2	451					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		AGGCTTACCCGGTTTCGGTAG	0.647																																																	0								G	TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	53.0	60.0	58.0		1336,1336,1351	2.0	0.8	1	dbSNP_134	58	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ATP13A2	NM_001141973.1,NM_001141974.1,NM_022089.2	101,101,101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	446/1176,446/1159,451/1181	17322751	2,13004	2203	4300	6503	SO:0001583	missense	0			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1351C>T	1.37:g.17322751G>A	ENSP00000327214:p.Arg451Trp		O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.R451W	ENST00000326735.8	37	c.1351	CCDS175.1	1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.517996	0.44763	2.27E-4	1.16E-4	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000503552;ENST00000506174	D;D;D;D;D	0.90676	-2.45;-2.45;-2.45;-2.45;-2.71	4.3	2.04	0.26737	ATPase, P-type, ATPase-associated domain (1);	0.705374	0.14437	N	0.319648	D	0.91216	0.7232	L	0.38175	1.15	0.34308	D	0.68507	D;D;D;D;D	0.71674	0.996;0.991;0.998;0.996;0.977	P;P;D;P;P	0.63793	0.713;0.849;0.918;0.806;0.773	D	0.91986	0.5599	10	0.87932	D	0	-10.4344	11.4188	0.49969	0.0:0.0:0.675:0.325	.	127;164;446;446;451	Q52PK6;Q6ZP48;Q5JXY1;Q6S9Z9;Q9NQ11	.;.;.;.;AT132_HUMAN	W	451;446;446;10;165	ENSP00000327214:R451W;ENSP00000341115:R446W;ENSP00000413307:R446W;ENSP00000421126:R10W;ENSP00000424393:R165W	ENSP00000327214:R451W	R	-	1	2	ATP13A2	17195338	0.833000	0.29383	0.808000	0.32385	0.437000	0.31866	1.413000	0.34725	0.765000	0.33221	0.491000	0.48974	CGG	ATP13A2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000159363		0.647	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP13A2	HGNC	protein_coding	OTTHUMT00000006617.1	-	0.00	58	0	G	NM_022089		17322751	-1	tier1	rs139065780	no_errors	ENST00000326735	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.977	A
ATP2B2	491	genome.wustl.edu	37	3	10382387	10382387	+	Splice_Site	SNP	G	G	T	rs574402898	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:10382387G>T	ENST00000352432.4	-	19	2988	c.2919C>A	c.(2917-2919)ggC>ggA	p.G973G	ATP2B2_ENST00000360273.2_Splice_Site_p.G973G|ATP2B2_ENST00000343816.4_Splice_Site_p.G959G|ATP2B2_ENST00000397077.1_Splice_Site_p.G928G|ATP2B2_ENST00000383800.4_Splice_Site_p.G928G			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	973					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)	p.G928G(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACATCTTCTCGCCTGCCAAGT	0.587																																					Ovarian(125;1619 1709 15675 19819 38835)												1	Substitution - coding silent(1)	prostate(1)											92.0	81.0	85.0					3																	10382387		2203	4300	6503	SO:0001630	splice_region_variant	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2918-1C>A	3.37:g.10382387G>T			O00766|Q12994|Q16818	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G973	ENST00000352432.4	37	c.2919	CCDS33701.1	3																																																																																			ATP2B2	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000157087		0.587	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2		0.00	29	0	G	NM_001683	Silent	10382387	-1			no_errors	ENST00000352432	ensembl	human	known	74_37	silent	7.69	24	2	SNP	0.661	T
B3GNT1	11041	genome.wustl.edu	37	11	66114251	66114251	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:66114251C>T	ENST00000311181.4	-	1	912	c.766G>A	c.(766-768)Gtg>Atg	p.V256M	BRMS1_ENST00000425825.2_5'Flank|RP11-867G23.8_ENST00000531602.1_5'Flank|BRMS1_ENST00000359957.3_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	256					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						GCAGGCACCACCAGCGCGGTG	0.617																																																	0													79.0	85.0	83.0					11																	66114251		2200	4295	6495	SO:0001583	missense	0			AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.766G>A	11.37:g.66114251C>T	ENSP00000309096:p.Val256Met		Q4TTN0	Missense_Mutation	SNP	NULL	p.V256M	ENST00000311181.4	37	c.766	CCDS8136.1	11	.	.	.	.	.	.	.	.	.	.	C	20.1	3.932358	0.73442	.	.	ENSG00000174684	ENST00000311181;ENST00000538757	T	0.36520	1.25	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.75144	-0.3421	10	0.87932	D	0	-34.1164	16.7135	0.85392	0.0:1.0:0.0:0.0	.	256	O43505	B3GN1_HUMAN	M	256;27	ENSP00000309096:V256M	ENSP00000309096:V256M	V	-	1	0	B3GNT1	65870827	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	7.360000	0.79487	2.563000	0.86464	0.563000	0.77884	GTG	B3GNT1	-	NULL	ENSG00000174684		0.617	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT1	HGNC	protein_coding	OTTHUMT00000392959.1	-	0.00	21	0	C	NM_006876		66114251	-1	tier1	-	no_errors	ENST00000311181	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
BHMT	635	genome.wustl.edu	37	5	78417107	78417107	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:78417107G>A	ENST00000274353.5	+	5	651	c.544G>A	c.(544-546)Gca>Aca	p.A182T	BHMT_ENST00000524080.1_Intron|DMGDH_ENST00000520388.1_5'UTR	NM_001713.2	NP_001704.2	Q93088	BHMT1_HUMAN	betaine--homocysteine S-methyltransferase	182	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				amino-acid betaine catabolic process (GO:0006579)|amino-acid betaine metabolic process (GO:0006577)|cellular nitrogen compound metabolic process (GO:0034641)|L-methionine salvage (GO:0071267)|protein methylation (GO:0006479)|regulation of homocysteine metabolic process (GO:0050666)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	betaine-homocysteine S-methyltransferase activity (GO:0047150)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)	29		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	TAAACCTGTGGCAGCAACCAT	0.483																																																	0													138.0	125.0	129.0					5																	78417107		2203	4300	6503	SO:0001583	missense	0			BC012616	CCDS4046.1	5q14.1	2012-09-20	2010-04-28		ENSG00000145692	ENSG00000145692	2.1.1.5		1047	protein-coding gene	gene with protein product	"""betaine homocysteine methyltransferase"""	602888				8798461, 9281325	Standard	NM_001713		Approved	BHMT1	uc003kfu.4	Q93088	OTTHUMG00000108157	ENST00000274353.5:c.544G>A	5.37:g.78417107G>A	ENSP00000274353:p.Ala182Thr		Q9UNI9	Missense_Mutation	SNP	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	p.A182T	ENST00000274353.5	37	c.544	CCDS4046.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.304119	0.95601	.	.	ENSG00000145692	ENST00000274353	T	0.30182	1.54	5.33	5.33	0.75918	Homocysteine S-methyltransferase (4);	0.045354	0.85682	D	0.000000	T	0.54935	0.1889	M	0.84219	2.685	0.80722	D	1	D	0.54964	0.969	P	0.58577	0.841	T	0.52071	-0.8624	10	0.22109	T	0.4	-13.0655	19.3886	0.94570	0.0:0.0:1.0:0.0	.	182	Q93088	BHMT1_HUMAN	T	182	ENSP00000274353:A182T	ENSP00000274353:A182T	A	+	1	0	BHMT	78452863	1.000000	0.71417	0.557000	0.28306	0.794000	0.44872	9.444000	0.97578	2.642000	0.89623	0.655000	0.94253	GCA	BHMT	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_Betaine-hCys_S-MeTrfase_BHMT,pfscan_S_MeTrfase	ENSG00000145692		0.483	BHMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BHMT	HGNC	protein_coding	OTTHUMT00000226961.1	-	0.00	45	0	G	NM_001713		78417107	+1	tier1	-	no_errors	ENST00000274353	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
BSN	8927	genome.wustl.edu	37	3	49693542	49693542	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:49693542G>C	ENST00000296452.4	+	5	6667	c.6553G>C	c.(6553-6555)Gcc>Ccc	p.A2185P		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2185					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.A2185T(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GCCGTCCACAGCCACTGTACG	0.602																																																	1	Substitution - Missense(1)	lung(1)											53.0	47.0	49.0					3																	49693542		2203	4299	6502	SO:0001583	missense	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.6553G>C	3.37:g.49693542G>C	ENSP00000296452:p.Ala2185Pro		O43161|Q7LGH3	Missense_Mutation	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.A2185P	ENST00000296452.4	37	c.6553	CCDS2800.1	3	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614585	0.46631	.	.	ENSG00000164061	ENST00000296452	T	0.26223	1.75	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.49949	0.1587	L	0.57536	1.79	0.58432	D	0.999999	D	0.89917	1.0	D	0.74674	0.984	T	0.47749	-0.9093	10	0.72032	D	0.01	-9.0022	19.454	0.94880	0.0:0.0:1.0:0.0	.	2185	Q9UPA5	BSN_HUMAN	P	2185	ENSP00000296452:A2185P	ENSP00000296452:A2185P	A	+	1	0	BSN	49668546	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.760000	0.85248	2.605000	0.88082	0.655000	0.94253	GCC	BSN	-	NULL	ENSG00000164061		0.602	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	-	0.00	30	0	G	NM_003458		49693542	+1	tier1	-	no_errors	ENST00000296452	ensembl	human	known	74_37	missense	22.58	24	7	SNP	1.000	C
BTN3A3	10384	genome.wustl.edu	37	6	26452498	26452498	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:26452498G>A	ENST00000244519.2	+	11	1857	c.1614G>A	c.(1612-1614)ccG>ccA	p.P538P	BTN3A3_ENST00000361232.3_Silent_p.P489P|BTN3A3_ENST00000339789.4_Silent_p.P496P	NM_006994.4	NP_008925.1	O00478	BT3A3_HUMAN	butyrophilin, subfamily 3, member A3	538					T cell mediated immunity (GO:0002456)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30						CACTGACCCCGGGCTTAGCTA	0.552																																																	0													48.0	47.0	47.0					6																	26452498		2203	4300	6503	SO:0001819	synonymous_variant	0			U90548	CCDS4611.1, CCDS4612.1, CCDS4612.2	6p22.1	2014-01-14			ENSG00000111801	ENSG00000111801		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1140	protein-coding gene	gene with protein product		613595				10354554, 9149941	Standard	NM_006994		Approved	BTF3, BTN3.3	uc003nhz.3	O00478	OTTHUMG00000014451	ENST00000244519.2:c.1614G>A	6.37:g.26452498G>A			B4DWI7|E9PCP5	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.P538	ENST00000244519.2	37	c.1614	CCDS4611.1	6																																																																																			BTN3A3	-	NULL	ENSG00000111801		0.552	BTN3A3-001	KNOWN	basic|CCDS	protein_coding	BTN3A3	HGNC	protein_coding	OTTHUMT00000040116.2	-	0.00	49	0	G	NM_006994		26452498	+1	tier1	-	no_errors	ENST00000244519	ensembl	human	known	74_37	silent	24.36	59	19	SNP	0.002	A
C10orf90	118611	genome.wustl.edu	37	10	128193492	128193492	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:128193492C>T	ENST00000284694.7	-	3	397	c.277G>A	c.(277-279)Gga>Aga	p.G93R	C10orf90_ENST00000356858.3_Missense_Mutation_p.G46R|C10orf90_ENST00000544758.1_Missense_Mutation_p.G190R|C10orf90_ENST00000392694.1_Missense_Mutation_p.G46R|C10orf90_ENST00000454341.1_Missense_Mutation_p.G93R|C10orf90_ENST00000368674.1_5'UTR	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	93					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		ATGTTGACTCCGCTGCGGTTA	0.552											OREG0020616	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													146.0	114.0	125.0					10																	128193492		2203	4300	6503	SO:0001583	missense	0			BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.277G>A	10.37:g.128193492C>T	ENSP00000284694:p.Gly93Arg	1563	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	NULL	p.G190R	ENST00000284694.7	37	c.568	CCDS31310.1	10	.	.	.	.	.	.	.	.	.	.	C	13.13	2.143818	0.37825	.	.	ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642;ENST00000368674;ENST00000392694	T;T;T;T;T	0.28454	1.91;1.9;1.94;1.92;1.61	4.66	-7.72	0.01250	.	1.183880	0.06089	N	0.663345	T	0.14141	0.0342	L	0.31926	0.97	0.09310	N	1	B;B;B;B;B	0.34255	0.108;0.445;0.219;0.108;0.045	B;B;B;B;B	0.23852	0.023;0.049;0.028;0.023;0.016	T	0.13737	-1.0498	10	0.45353	T	0.12	-0.1042	1.8291	0.03127	0.15:0.1538:0.2683:0.428	.	190;190;46;93;93	F5GZL2;B4DMQ6;Q5T024;Q96M02;Q96M02-2	.;.;.;CJ090_HUMAN;.	R	46;93;93;190;93;46;46	ENSP00000284694:G93R;ENSP00000398786:G93R;ENSP00000444369:G190R;ENSP00000405995:G93R;ENSP00000376459:G46R	ENSP00000284694:G93R	G	-	1	0	C10orf90	128183482	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.892000	0.04131	-1.422000	0.02004	0.561000	0.74099	GGA	C10orf90	-	NULL	ENSG00000154493		0.552	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf90	HGNC	protein_coding		-	0.00	36	0	C	NM_001004298		128193492	-1	tier1	-	no_errors	ENST00000544758	ensembl	human	known	74_37	missense	14.00	43	7	SNP	0.000	T
C14orf23	387978	genome.wustl.edu	37	14	29261273	29261273	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr14:29261273G>T	ENST00000399387.4	+	3	414	c.310G>T	c.(310-312)Gat>Tat	p.D104Y	C14orf23_ENST00000548213.1_Intron|C14orf23_ENST00000550266.1_Intron					chromosome 14 open reading frame 23											central_nervous_system(1)	1						CAGTGCTCATGATGTGTCTCC	0.373																																																	0																																										SO:0001583	missense	0					14q11.2	2013-01-15			ENSG00000186960	ENSG00000186960			19828	other	unknown							Standard	NR_026731		Approved		uc001wqf.3	Q86U37	OTTHUMG00000029410	ENST00000399387.4:c.310G>T	14.37:g.29261273G>T	ENSP00000382318:p.Asp104Tyr			Missense_Mutation	SNP	NULL	p.D104Y	ENST00000399387.4	37	c.310		14	.	.	.	.	.	.	.	.	.	.	G	9.304	1.053781	0.19907	.	.	ENSG00000186960	ENST00000399387	.	.	.	3.77	-0.896	0.10557	.	.	.	.	.	T	0.20210	0.0486	.	.	.	0.09310	N	1	B	0.33807	0.426	B	0.28385	0.089	T	0.19484	-1.0304	7	0.87932	D	0	.	1.6935	0.02857	0.1157:0.1738:0.3557:0.3547	.	104	Q86U37	CN023_HUMAN	Y	104	.	ENSP00000382318:D104Y	D	+	1	0	C14orf23	28331024	0.000000	0.05858	0.000000	0.03702	0.230000	0.25150	-0.373000	0.07494	-0.258000	0.09446	-0.463000	0.05309	GAT	C14orf23	-	NULL	ENSG00000186960		0.373	C14orf23-003	KNOWN	basic|appris_candidate_longest	protein_coding	C14orf23	HGNC	protein_coding	OTTHUMT00000134019.2	-	0.00	50	0	G	NR_026731		29261273	+1	tier1	-	no_errors	ENST00000399387	ensembl	human	known	74_37	missense	12.00	44	6	SNP	0.000	T
C4BPB	725	genome.wustl.edu	37	1	207268664	207268664	+	Intron	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:207268664G>T	ENST00000243611.5	+	4	703				C4BPB_ENST00000451804.2_Missense_Mutation_p.Q136H|C4BPB_ENST00000391923.1_Intron|C4BPB_ENST00000367076.3_Intron|C4BPB_ENST00000367078.3_Intron	NM_000716.3	NP_000707.1	P20851	C4BPB_HUMAN	complement component 4 binding protein, beta						blood coagulation (GO:0007596)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)				breast(2)|lung(1)|ovary(1)	4						TTCCCTTCCAGCCATGTTCTC	0.493																																																	0																																										SO:0001627	intron_variant	0			L11245	CCDS1476.1, CCDS31005.1	1q32	2008-07-18	2001-11-28		ENSG00000123843	ENSG00000123843			1328	protein-coding gene	gene with protein product	"""complement component 4 binding protein, beta chain"", ""C4b binding protein, beta chain"""	120831	"""complement component 4-binding protein, beta"""	C4BP		2300577, 8325877	Standard	XM_005273255		Approved		uc001hfj.3	P20851	OTTHUMG00000036035	ENST00000243611.5:c.410-1203G>T	1.37:g.207268664G>T			A5JYP8|D3DT81|Q5VVR0|Q9BS25	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q136H	ENST00000243611.5	37	c.408	CCDS1476.1	1	.	.	.	.	.	.	.	.	.	.	G	6.225	0.409740	0.11812	.	.	ENSG00000123843	ENST00000451804	T	0.27256	1.68	2.21	1.29	0.21616	.	.	.	.	.	T	0.34832	0.0911	.	.	.	0.09310	N	1	D;D	0.59357	0.969;0.985	P;P	0.60012	0.795;0.867	T	0.10894	-1.0610	8	0.39692	T	0.17	.	4.7533	0.13071	0.1826:0.0:0.8174:0.0	.	136;136	E7EQT9;B4DDY0	.;.	H	136	ENSP00000405649:Q136H	ENSP00000405649:Q136H	Q	+	3	2	C4BPB	205335287	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.223000	0.09177	0.496000	0.27904	-0.350000	0.07774	CAG	C4BPB	-	NULL	ENSG00000123843		0.493	C4BPB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C4BPB	HGNC	protein_coding	OTTHUMT00000087847.2		0.00	29	0	G	NM_000716		207268664	+1			no_errors	ENST00000451804	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.002	T
ARRDC1-AS1	85026	genome.wustl.edu	37	9	140510587	140510587	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:140510587G>A	ENST00000371417.3	-	3	605	c.65C>T	c.(64-66)tCa>tTa	p.S22L	C9orf37_ENST00000496793.1_5'UTR|EHMT1_ENST00000334856.6_5'Flank|EHMT1_ENST00000460843.1_5'Flank|EHMT1_ENST00000462484.1_5'Flank	NM_032937.4	NP_116326.2	Q9H2J1	CI037_HUMAN		22										breast(1)|large_intestine(2)	3	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000275)|Epithelial(140;0.00047)		ttgggaggctgaggcaggtgg	0.473																																																	0													20.0	21.0	21.0					9																	140510587		2040	4029	6069	SO:0001583	missense	0																														ENST00000371417.3:c.65C>T	9.37:g.140510587G>A	ENSP00000360471:p.Ser22Leu		Q17RM5|Q5T368	Missense_Mutation	SNP	NULL	p.S22L	ENST00000371417.3	37	c.65	CCDS35189.1	9	.	.	.	.	.	.	.	.	.	.	G	6.179	0.401145	0.11696	.	.	ENSG00000203993	ENST00000371417	T	0.62105	0.05	0.199	-0.397	0.12423	.	.	.	.	.	T	0.41166	0.1147	N	0.20881	0.62	0.09310	N	1	B	0.19706	0.038	B	0.25506	0.061	T	0.21861	-1.0233	8	0.33940	T	0.23	.	.	.	.	.	22	Q9H2J1	CI037_HUMAN	L	22	ENSP00000360471:S22L	ENSP00000360471:S22L	S	-	2	0	C9orf37	139630408	0.002000	0.14202	0.044000	0.18714	0.061000	0.15899	-0.227000	0.09126	-1.205000	0.02645	-1.225000	0.01585	TCA	C9orf37	-	NULL	ENSG00000203993		0.473	C9orf37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf37	HGNC	protein_coding	OTTHUMT00000055328.1		0.00	18	0	G			140510587	-1			no_errors	ENST00000371417	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.052	A
CAMKK2	10645	genome.wustl.edu	37	12	121691134	121691134	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:121691134G>A	ENST00000324774.5	-	10	1877	c.1049C>T	c.(1048-1050)aCg>aTg	p.T350M	CAMKK2_ENST00000404169.3_Missense_Mutation_p.T350M|CAMKK2_ENST00000392473.2_Missense_Mutation_p.T350M|CAMKK2_ENST00000412367.2_Missense_Mutation_p.T350M|CAMKK2_ENST00000402834.4_Missense_Mutation_p.T350M|CAMKK2_ENST00000347034.2_Missense_Mutation_p.T350M|CAMKK2_ENST00000545538.1_Missense_Mutation_p.T137M|CAMKK2_ENST00000538733.1_Missense_Mutation_p.T350M|CAMKK2_ENST00000535524.1_5'UTR|CAMKK2_ENST00000337174.3_Missense_Mutation_p.T350M|CAMKK2_ENST00000446440.2_Missense_Mutation_p.T350M|CAMKK2_ENST00000392474.2_Missense_Mutation_p.T350M	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	350	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)	p.T350M(1)		endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAAGGCGGGCGTGCCCACGGT	0.577																																																	1	Substitution - Missense(1)	liver(1)											181.0	127.0	145.0					12																	121691134		2203	4300	6503	SO:0001583	missense	0			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.1049C>T	12.37:g.121691134G>A	ENSP00000312741:p.Thr350Met		A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T350M	ENST00000324774.5	37	c.1049	CCDS9216.1	12	.	.	.	.	.	.	.	.	.	.	G	28.7	4.947233	0.92593	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000545538;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;0.06;-1.05;-1.05;-1.05;-1.05	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92662	0.7668	H	0.97564	4.03	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.998;0.998;0.998;0.999;0.998;0.999;0.999;0.998	D	0.95112	0.8239	10	0.87932	D	0	0.0958	18.062	0.89380	0.0:0.0:1.0:0.0	.	350;350;350;137;350;350;350;350	Q96RR4-6;Q96RR4-2;Q96RR4-7;F5GZ00;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;.;KKCC2_HUMAN;.	M	350;350;350;350;350;137;350;350;333;350;350	ENSP00000376266:T350M;ENSP00000321230:T350M;ENSP00000445944:T350M;ENSP00000336634:T350M;ENSP00000312741:T350M;ENSP00000441352:T137M;ENSP00000388368:T350M;ENSP00000384600:T350M;ENSP00000388273:T350M;ENSP00000376265:T350M	ENSP00000312741:T350M	T	-	2	0	CAMKK2	120175517	1.000000	0.71417	0.950000	0.38849	0.940000	0.58332	9.476000	0.97823	2.512000	0.84698	0.655000	0.94253	ACG	CAMKK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000110931		0.577	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	HGNC	protein_coding	OTTHUMT00000402563.1	-	0.00	48	0	G	NM_172226		121691134	-1	tier1	-	no_errors	ENST00000324774	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	A
CASC5	57082	genome.wustl.edu	37	15	40913867	40913867	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:40913867A>C	ENST00000346991.5	+	11	1873	c.1483A>C	c.(1483-1485)Atg>Ctg	p.M495L	CASC5_ENST00000527044.1_3'UTR|CASC5_ENST00000399668.2_Missense_Mutation_p.M469L			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	495	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TCCAGATGCTATGTCTTCTCT	0.343																																																	0													51.0	49.0	50.0					15																	40913867		1847	4082	5929	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.1483A>C	15.37:g.40913867A>C	ENSP00000335463:p.Met495Leu		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.M495L	ENST00000346991.5	37	c.1483	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	A	1.369	-0.586506	0.03827	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.04551	3.6;3.6	5.94	0.791	0.18619	.	1.061170	0.07376	N	0.886573	T	0.04092	0.0114	L	0.40543	1.245	0.09310	N	1	B;B;B	0.18968	0.032;0.032;0.006	B;B;B	0.12837	0.008;0.008;0.008	T	0.49409	-0.8943	10	0.09338	T	0.73	.	4.9985	0.14253	0.6012:0.0:0.2751:0.1237	.	469;495;469	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	L	495;469;469	ENSP00000335463:M495L;ENSP00000382576:M469L	ENSP00000260369:M469L	M	+	1	0	CASC5	38701159	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	1.506000	0.35747	-0.112000	0.11979	-0.379000	0.06801	ATG	CASC5	-	NULL	ENSG00000137812		0.343	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	-	0.00	22	0	A	NM_144508		40913867	+1	tier1	-	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.000	C
CCDC57	284001	genome.wustl.edu	37	17	80059488	80059488	+	3'UTR	SNP	G	G	A	rs532024831		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:80059488G>A	ENST00000389641.4	-	0	2857				CCDC57_ENST00000392347.1_3'UTR			Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57											endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	16	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			CCCACAACACGTAGGTGAAAG	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16649	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			BC040264		17q25.3	2006-03-08			ENSG00000176155	ENSG00000176155			27564	protein-coding gene	gene with protein product						12477932	Standard	XM_006722279		Approved	FLJ00130, FLJ23754	uc002kdx.1	Q2TAC2	OTTHUMG00000140396	ENST00000389641.4:c.*70C>T	17.37:g.80059488G>A			A6NP51|A8MQC7|Q8IWG2|Q8TER3	RNA	SNP	-	NULL	ENST00000389641.4	37	NULL		17																																																																																			CCDC57	-	-	ENSG00000176155		0.632	CCDC57-001	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC57	HGNC	protein_coding	OTTHUMT00000277182.3	-	0.00	21	0	G	NM_198082		80059488	-1	tier1	-	no_errors	ENST00000584717	ensembl	human	putative	74_37	rna	34.78	15	8	SNP	0.000	A
CD47	961	genome.wustl.edu	37	3	107764115	107764115	+	IGR	SNP	T	T	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:107764115T>G	ENST00000361309.5	-	0	1285				CD47_ENST00000355354.7_3'UTR|CD47_ENST00000471694.1_5'UTR	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TTATAAAAAATTTTACTATAA	0.303																																																	0																																										SO:0001628	intergenic_variant	0				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216		3.37:g.107764115T>G			A8K198|D3DN59|Q53Y71|Q96A60	RNA	SNP	-	NULL	ENST00000361309.5	37	NULL	CCDS43126.1	3																																																																																			CD47	-	-	ENSG00000196776		0.303	CD47-004	KNOWN	basic|CCDS	protein_coding	CD47	HGNC	protein_coding	OTTHUMT00000102793.1	-	0.00	25	0	T	NM_001777		107764115	-1	tier1	-	no_errors	ENST00000471694	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.004	G
CCNL1	57018	genome.wustl.edu	37	3	156868143	156868143	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:156868143G>T	ENST00000295926.3	-	6	820	c.702C>A	c.(700-702)acC>acA	p.T234T	CCNL1_ENST00000479052.1_5'UTR|CCNL1_ENST00000461804.1_Silent_p.T234T	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	234	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			CAAACACATTGGTTCGAAGAC	0.373																																																	0													105.0	97.0	100.0					3																	156868143		2203	4300	6503	SO:0001819	synonymous_variant	0			AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.702C>A	3.37:g.156868143G>T			B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Silent	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.T234	ENST00000295926.3	37	c.702	CCDS3178.1	3																																																																																			CCNL1	-	superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	ENSG00000163660		0.373	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL1	HGNC	protein_coding	OTTHUMT00000351859.1	-	0.00	32	0	G	NM_020307		156868143	-1	tier1	-	no_errors	ENST00000295926	ensembl	human	known	74_37	silent	8.06	57	5	SNP	1.000	T
CEP104	9731	genome.wustl.edu	37	1	3755527	3755527	+	Splice_Site	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:3755527C>A	ENST00000378230.3	-	8	1216		c.e8+1		CEP104_ENST00000460038.1_5'Flank	NM_014704.3	NP_055519.1	O60308	CE104_HUMAN	centrosomal protein 104kDa							centriole (GO:0005814)	glutamate binding (GO:0016595)|glycine binding (GO:0016594)|thienylcyclohexylpiperidine binding (GO:0016596)			breast(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(14)|lung(8)|prostate(1)|skin(3)	39						CCTGCACCCACCAGCTCGGCA	0.542																																																	0													123.0	118.0	120.0					1																	3755527		2203	4300	6503	SO:0001630	splice_region_variant	0			AB011134	CCDS30571.1	1p36.32	2014-02-20	2011-05-06	2011-05-06	ENSG00000116198	ENSG00000116198			24866	protein-coding gene	gene with protein product	"""glycine, glutamate, thienylcyclohexylpiperidine binding protein"""		"""KIAA0562"""	KIAA0562		7488117, 21399614	Standard	NM_014704		Approved	GlyBP, RP1-286D6.4	uc001aky.2	O60308	OTTHUMG00000003507	ENST00000378230.3:c.891+1G>T	1.37:g.3755527C>A			Q5JSQ3|Q5SR24|Q5SR25|Q6PKF5|Q86W32|Q86X14	Splice_Site	SNP	-	e7+1	ENST00000378230.3	37	c.891+1	CCDS30571.1	1	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641561	0.29157	.	.	ENSG00000116198	ENST00000378230;ENST00000443466	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8233	0.88656	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CEP104	3745387	1.000000	0.71417	0.946000	0.38457	0.644000	0.38419	3.126000	0.50477	2.450000	0.82876	0.655000	0.94253	.	CEP104	-	-	ENSG00000116198		0.542	CEP104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP104	HGNC	protein_coding	OTTHUMT00000009747.3	-	0.00	66	0	C	NM_014704	Intron	3755527	-1	tier1	-	no_errors	ENST00000378230	ensembl	human	known	74_37	splice_site	22.78	61	18	SNP	1.000	A
CEP170B	283638	genome.wustl.edu	37	14	105355974	105355974	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr14:105355974G>A	ENST00000414716.3	+	13	3985	c.3757G>A	c.(3757-3759)Gct>Act	p.A1253T	CEP170B_ENST00000556508.1_Missense_Mutation_p.A1218T|CEP170B_ENST00000453495.1_Missense_Mutation_p.A1289T|CEP170B_ENST00000418279.1_Missense_Mutation_p.A1183T	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1288						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACCCCGAGGGCTGGCAGCTC	0.672																																																	0													21.0	25.0	24.0					14																	105355974		1872	4065	5937	SO:0001583	missense	0			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.3757G>A	14.37:g.105355974G>A	ENSP00000404151:p.Ala1253Thr		Q2KHR7|Q86TI7	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.A1289T	ENST00000414716.3	37	c.3865	CCDS45175.1	14	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047364	0.55110	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.44881	0.91;0.94;0.91;0.94	4.15	3.17	0.36434	.	0.934920	0.08800	U	0.891936	T	0.37019	0.0988	L	0.50333	1.59	0.19775	N	0.999952	P;P;P	0.46912	0.634;0.886;0.745	B;B;B	0.43082	0.124;0.398;0.407	T	0.38286	-0.9668	10	0.62326	D	0.03	-10.4503	3.5246	0.07755	0.1024:0.1672:0.5589:0.1715	.	1253;1288;1183	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	T	1218;1253;1289;1183	ENSP00000451249:A1218T;ENSP00000404151:A1253T;ENSP00000407238:A1289T;ENSP00000415006:A1183T	ENSP00000404151:A1253T	A	+	1	0	KIAA0284	104427019	0.788000	0.28762	0.912000	0.35992	0.914000	0.54420	0.890000	0.28295	2.013000	0.59113	0.478000	0.44815	GCT	CEP170B	-	NULL	ENSG00000099814		0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP170B	HGNC	protein_coding	OTTHUMT00000410289.2	-	0.00	65	0	G	NM_001112726		105355974	+1	tier1	-	no_errors	ENST00000453495	ensembl	human	known	74_37	missense	18.82	69	16	SNP	0.550	A
CFHR3	10878	genome.wustl.edu	37	1	196762609	196762609	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:196762609G>A	ENST00000367425.4	+	6	1051	c.959G>A	c.(958-960)cGg>cAg	p.R320Q	CFHR3_ENST00000391985.3_Missense_Mutation_p.R259Q	NM_021023.5	NP_066303.2	Q02985	FHR3_HUMAN	complement factor H-related 3	320	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18						GCAGTGTGTCGGGAAGGGATA	0.378																																																	0													118.0	140.0	133.0					1																	196762609		1917	4133	6050	SO:0001583	missense	0			X68679	CCDS30958.1, CCDS53453.1	1q32	2014-09-17		2006-02-28	ENSG00000116785	ENSG00000116785		"""Complement system"""	16980	protein-coding gene	gene with protein product	"""complement factor H related 3"""	605336		CFHL3		8428964, 10380701	Standard	NM_021023		Approved	FHR-3, HLF4, FHR3, DOWN16	uc001gtl.3	Q02985	OTTHUMG00000035929	ENST00000367425.4:c.959G>A	1.37:g.196762609G>A	ENSP00000356395:p.Arg320Gln		B4DPR0|Q9UJ16	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R320Q	ENST00000367425.4	37	c.959	CCDS30958.1	1	.	.	.	.	.	.	.	.	.	.	G	10.27	1.303416	0.23736	.	.	ENSG00000116785	ENST00000367425;ENST00000391985	D;D	0.82803	-1.65;-1.65	3.24	-6.48	0.01896	Complement control module (1);	.	.	.	.	T	0.49012	0.1532	N	0.01086	-1.025	0.09310	N	1	B;B	0.12630	0.001;0.006	B;B	0.04013	0.0;0.001	T	0.42189	-0.9466	9	0.30854	T	0.27	.	3.4284	0.07420	0.3642:0.0:0.3002:0.3356	.	259;320	B4DPR0;Q02985	.;FHR3_HUMAN	Q	320;259	ENSP00000356395:R320Q;ENSP00000375845:R259Q	ENSP00000356395:R320Q	R	+	2	0	CFHR3	195029232	0.000000	0.05858	0.000000	0.03702	0.356000	0.29392	-1.997000	0.01470	-1.318000	0.02289	0.392000	0.25879	CGG	CFHR3	-	superfamily_Sushi_SCR_CCP	ENSG00000116785		0.378	CFHR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR3	HGNC	protein_coding	OTTHUMT00000087505.2	-	0.00	63	0	G	NM_021023		196762609	+1	tier1	-	no_errors	ENST00000367425	ensembl	human	known	74_37	missense	11.88	89	12	SNP	0.000	A
CHAF1A	10036	genome.wustl.edu	37	19	4409549	4409549	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:4409549G>T	ENST00000301280.5	+	3	854	c.753G>T	c.(751-753)ccG>ccT	p.P251P		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	251	Binds to CBX1 chromo shadow domain.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)	p.P251P(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGACCACCGCAAATCAAGT	0.542								Chromatin Structure																																									1	Substitution - coding silent(1)	endometrium(1)											108.0	102.0	104.0					19																	4409549		2203	4300	6503	SO:0001819	synonymous_variant	0			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.753G>T	19.37:g.4409549G>T			Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	pfam_CAF1A	p.P251	ENST00000301280.5	37	c.753	CCDS32875.1	19																																																																																			CHAF1A	-	NULL	ENSG00000167670		0.542	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2		0.00	43	0	G	NM_005483		4409549	+1			no_errors	ENST00000301280	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.000	T
CNBD1	168975	genome.wustl.edu	37	8	88297028	88297028	+	Silent	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:88297028T>C	ENST00000518476.1	+	7	945	c.894T>C	c.(892-894)taT>taC	p.Y298Y		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	298										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						CAAAGGGATATGCAAAGATAA	0.358																																																	0													45.0	42.0	43.0					8																	88297028		1829	4070	5899	SO:0001819	synonymous_variant	0			AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.894T>C	8.37:g.88297028T>C				Silent	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.Y298	ENST00000518476.1	37	c.894	CCDS55259.1	8																																																																																			CNBD1	-	superfamily_cNMP-bd-like	ENSG00000176571		0.358	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	HGNC	protein_coding	OTTHUMT00000375113.2	-	0.00	36	0	T	NM_173538		88297028	+1	tier1	-	no_errors	ENST00000518476	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.001	C
CNOT1	23019	genome.wustl.edu	37	16	58577316	58577316	+	Intron	DEL	A	A	-	rs74558612|rs201890659|rs5817153	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:58577316delA	ENST00000317147.5	-	31	4767				CNOT1_ENST00000245138.4_Intron|CNOT1_ENST00000441024.2_Frame_Shift_Del_p.F1543fs|CNOT1_ENST00000569240.1_Intron	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		aatataacagaaaaaaaaaaa	0.279																																																	0													16.0	14.0	15.0					16																	58577316		981	2088	3069	SO:0001627	intron_variant	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4434+194T>-	16.37:g.58577316delA			Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.L1544fs	ENST00000317147.5	37	c.4629	CCDS10799.1	16																																																																																			CNOT1	-	NULL	ENSG00000125107		0.279	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3		0.00	22	0	A	NM_016284		58577316	-1	tier1		no_errors	ENST00000441024	ensembl	human	known	74_37	frame_shift_del	14.81	23	4	DEL	0.000	-
CNTN6	27255	genome.wustl.edu	37	3	1427311	1427311	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:1427311A>G	ENST00000446702.2	+	20	3161	c.2534A>G	c.(2533-2535)gAt>gGt	p.D845G	CNTN6_ENST00000350110.2_Missense_Mutation_p.D845G|CNTN6_ENST00000539053.1_Missense_Mutation_p.D773G			Q9UQ52	CNTN6_HUMAN	contactin 6	845	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TACTGGACAGATGACTCCAAA	0.358																																																	0													124.0	134.0	130.0					3																	1427311		2203	4300	6503	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2534A>G	3.37:g.1427311A>G	ENSP00000407822:p.Asp845Gly		Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D845G	ENST00000446702.2	37	c.2534	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	A	13.20	2.165620	0.38217	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.57752	0.38;0.38;0.38	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.196973	0.35525	N	0.003151	T	0.57140	0.2033	L	0.51853	1.615	0.37845	D	0.929181	P	0.50819	0.939	P	0.50860	0.652	T	0.58008	-0.7712	10	0.25106	T	0.35	.	16.0681	0.80903	1.0:0.0:0.0:0.0	.	845	Q9UQ52	CNTN6_HUMAN	G	845;773;845	ENSP00000407822:D845G;ENSP00000442791:D773G;ENSP00000341882:D845G	ENSP00000341882:D845G	D	+	2	0	CNTN6	1402311	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.051000	0.64257	2.188000	0.69820	0.528000	0.53228	GAT	CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.358	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	44	0	A	NM_014461		1427311	+1	tier1	-	no_errors	ENST00000350110	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.991	G
CNTNAP5	129684	genome.wustl.edu	37	2	125175095	125175095	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:125175095C>T	ENST00000431078.1	+	4	821	c.457C>T	c.(457-459)Cgc>Tgc	p.R153C		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	153	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CCGATTTGTTCGCTTTGTGCC	0.493																																																	0													96.0	99.0	98.0					2																	125175095		1982	4168	6150	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.457C>T	2.37:g.125175095C>T	ENSP00000399013:p.Arg153Cys		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R153C	ENST00000431078.1	37	c.457	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.880435	0.91740	.	.	ENSG00000155052	ENST00000431078	D	0.99113	-5.44	6.17	6.17	0.99709	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.50627	D	0.000113	D	0.99667	0.9876	H	0.99609	4.655	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97459	1.0033	10	0.87932	D	0	.	14.3122	0.66424	0.1484:0.8516:0.0:0.0	.	153	Q8WYK1	CNTP5_HUMAN	C	153	ENSP00000399013:R153C	ENSP00000399013:R153C	R	+	1	0	CNTNAP5	124891565	1.000000	0.71417	0.970000	0.41538	0.971000	0.66376	5.489000	0.66875	2.941000	0.99782	0.655000	0.94253	CGC	CNTNAP5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000155052		0.493	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	47	0	C			125175095	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	11.86	52	7	SNP	1.000	T
CPD	1362	genome.wustl.edu	37	17	28712032	28712032	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:28712032G>A	ENST00000225719.4	+	2	848	c.772G>A	c.(772-774)Ggt>Agt	p.G258S	CPD_ENST00000543464.2_Missense_Mutation_p.G11S	NM_001304.4	NP_001295.2	O75976	CBPD_HUMAN	carboxypeptidase D	258	Carboxypeptidase-like 1.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	metallocarboxypeptidase activity (GO:0004181)|serine-type carboxypeptidase activity (GO:0004185)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(13)|skin(5)|stomach(1)|urinary_tract(1)	36						AAATCTGCATGGTGGCTCAGT	0.358																																																	0													175.0	177.0	177.0					17																	28712032		2203	4300	6503	SO:0001583	missense	0			U65090	CCDS11257.1, CCDS56025.1	17q11.2	2012-02-10			ENSG00000108582	ENSG00000108582	3.4.17.22		2301	protein-coding gene	gene with protein product	"""metallocarboxypeptidase D"""	603102				9628828, 9355738	Standard	NM_001304		Approved	GP180	uc002hfb.2	O75976	OTTHUMG00000132797	ENST00000225719.4:c.772G>A	17.37:g.28712032G>A	ENSP00000225719:p.Gly258Ser		B7Z7T9|B7ZAU4|F5GZH6|O15377|Q86SH9|Q86XE6	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.G258S	ENST00000225719.4	37	c.772	CCDS11257.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.373392	0.95923	.	.	ENSG00000108582	ENST00000225719;ENST00000543464	T;T	0.10860	4.24;2.83	5.39	5.39	0.77823	Peptidase M14, carboxypeptidase A (3);	0.000000	0.85682	D	0.000000	T	0.33585	0.0868	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.02047	-1.1223	10	0.62326	D	0.03	.	18.1448	0.89651	0.0:0.0:1.0:0.0	.	11;258	F5GZH6;O75976	.;CBPD_HUMAN	S	258;11	ENSP00000225719:G258S;ENSP00000444443:G11S	ENSP00000225719:G258S	G	+	1	0	CPD	25736158	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.411000	0.97342	2.499000	0.84300	0.591000	0.81541	GGT	CPD	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000108582		0.358	CPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPD	HGNC	protein_coding	OTTHUMT00000256214.3	-	0.00	86	0	G	NM_001304		28712032	+1	tier1	-	no_errors	ENST00000225719	ensembl	human	known	74_37	missense	12.87	88	13	SNP	1.000	A
CSF2RA	1438	genome.wustl.edu	37	X	1409284	1409284	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:1409284G>T	ENST00000381524.3	+	7	714	c.528G>T	c.(526-528)gtG>gtT	p.V176V	CSF2RA_ENST00000381509.3_Silent_p.V176V|CSF2RA_ENST00000417535.2_Silent_p.V176V|CSF2RA_ENST00000501036.2_Silent_p.V43V|CSF2RA_ENST00000355432.3_Silent_p.V176V|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_Silent_p.V176V|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000432318.2_Silent_p.V176V|CSF2RA_ENST00000381529.3_Silent_p.V176V|CSF2RA_ENST00000361536.3_Silent_p.V176V|CSF2RA_ENST00000355805.2_Silent_p.V176V|BX649553.3_ENST00000581137.1_RNA			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)	176					response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.V176V(3)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GAACCCATGTGGGATGTCACC	0.433																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												3	Substitution - coding silent(3)	lung(3)											304.0	293.0	297.0					X																	1409284		2203	4296	6499	SO:0001819	synonymous_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.528G>T	X.37:g.1409284G>T			A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Silent	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.V176	ENST00000381524.3	37	c.528	CCDS35191.1	X																																																																																			CSF2RA	-	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	ENSG00000198223		0.433	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	-	0.00	101	0	G			1409284	+1	tier1	-	no_errors	ENST00000417535	ensembl	human	known	74_37	silent	18.42	93	21	SNP	0.012	T
CTNNAL1	8727	genome.wustl.edu	37	9	111741738	111741738	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:111741738C>T	ENST00000325551.4	-	7	1010	c.924G>A	c.(922-924)gaG>gaA	p.E308E	CTNNAL1_ENST00000488130.1_5'Flank|CTNNAL1_ENST00000325580.6_Silent_p.E308E|CTNNAL1_ENST00000374595.4_Silent_p.E308E	NM_003798.2	NP_003789.1	Q9UBT7	CTNL1_HUMAN	catenin (cadherin-associated protein), alpha-like 1	308					cell adhesion (GO:0007155)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)	p.E308E(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(4)|urinary_tract(2)	25				STAD - Stomach adenocarcinoma(157;0.0768)		AATAAAGATTCTCCCGAAGAG	0.418																																																	1	Substitution - coding silent(1)	urinary_tract(1)											83.0	78.0	80.0					9																	111741738		2203	4300	6503	SO:0001819	synonymous_variant	0			AF030233	CCDS6775.1, CCDS69638.1	9q31.2	2008-07-21			ENSG00000119326	ENSG00000119326			2512	protein-coding gene	gene with protein product	"""alpha-catulin"", ""alpha2-catulin"""	604785				9806841	Standard	XM_005252291		Approved	CLLP, alpha-CATU	uc004bdo.1	Q9UBT7	OTTHUMG00000020466	ENST00000325551.4:c.924G>A	9.37:g.111741738C>T			B5BU47|O76084|Q53FQ2|Q5JTQ7|Q5JTQ8|Q9Y401	Silent	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin	p.E308	ENST00000325551.4	37	c.924	CCDS6775.1	9																																																																																			CTNNAL1	-	NULL	ENSG00000119326		0.418	CTNNAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CTNNAL1	HGNC	protein_coding	OTTHUMT00000053577.1	-	0.00	35	0	C	NM_003798		111741738	-1	tier1	-	no_errors	ENST00000325551	ensembl	human	known	74_37	silent	14.04	49	8	SNP	1.000	T
CTSH	1512	genome.wustl.edu	37	15	79220095	79220095	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:79220095T>C	ENST00000220166.5	-	9	768	c.659A>G	c.(658-660)aAg>aGg	p.K220R	CTSH_ENST00000534533.1_5'UTR	NM_004390.3	NP_004381.2	P09668	CATH_HUMAN	cathepsin H	220					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|bradykinin catabolic process (GO:0010815)|cellular response to thyroid hormone stimulus (GO:0097067)|dichotomous subdivision of terminal units involved in lung branching (GO:0060448)|ERK1 and ERK2 cascade (GO:0070371)|immune response-regulating signaling pathway (GO:0002764)|membrane protein proteolysis (GO:0033619)|metanephros development (GO:0001656)|negative regulation of apoptotic process (GO:0043066)|neuropeptide catabolic process (GO:0010813)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidase activity (GO:0010952)|protein destabilization (GO:0031648)|proteolysis (GO:0006508)|response to retinoic acid (GO:0032526)|spermatogenesis (GO:0007283)|surfactant homeostasis (GO:0043129)|T cell mediated cytotoxicity (GO:0001913)|zymogen activation (GO:0031638)	acrosomal vesicle (GO:0001669)|alveolar lamellar body (GO:0097208)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|outer dense fiber (GO:0001520)	aminopeptidase activity (GO:0004177)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)|HLA-A specific activating MHC class I receptor activity (GO:0030108)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|thyroid hormone binding (GO:0070324)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)	10						GCCGATGGCCTTTCCAGGTTG	0.517																																																	0													174.0	130.0	145.0					15																	79220095		2196	4293	6489	SO:0001583	missense	0			X07549	CCDS10308.1	15q25.1	2014-01-28			ENSG00000103811	ENSG00000103811	3.4.22.16	"""Cathepsins"""	2535	protein-coding gene	gene with protein product		116820		CPSB		2849458	Standard	NM_004390		Approved	ACC-4, ACC-5	uc021srk.1	P09668	OTTHUMG00000144171	ENST00000220166.5:c.659A>G	15.37:g.79220095T>C	ENSP00000220166:p.Lys220Arg		B2RBK0|Q96NY6|Q9BUM7	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.K220R	ENST00000220166.5	37	c.659	CCDS10308.1	15	.	.	.	.	.	.	.	.	.	.	T	8.593	0.885148	0.17540	.	.	ENSG00000103811	ENST00000220166;ENST00000394758	D	0.87650	-2.28	4.94	4.94	0.65067	Peptidase C1A, papain C-terminal (2);	0.215893	0.39341	N	0.001383	D	0.82912	0.5140	L	0.59967	1.855	0.22710	N	0.998825	B;B	0.17268	0.021;0.021	B;B	0.21546	0.035;0.017	T	0.66756	-0.5843	10	0.14656	T	0.56	.	10.9722	0.47446	0.0:0.0:0.0:1.0	.	220;208	P09668;E9PBP2	CATH_HUMAN;.	R	220;208	ENSP00000220166:K220R	ENSP00000220166:K220R	K	-	2	0	CTSH	77007150	0.884000	0.30299	0.866000	0.34008	0.066000	0.16364	2.430000	0.44766	1.868000	0.54150	0.482000	0.46254	AAG	CTSH	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000103811		0.517	CTSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSH	HGNC	protein_coding	OTTHUMT00000291370.1	-	0.00	34	0	T	NM_004390		79220095	-1	tier1	-	no_errors	ENST00000220166	ensembl	human	known	74_37	missense	13.04	40	6	SNP	0.459	C
CYP11B2	1585	genome.wustl.edu	37	8	143995794	143995794	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:143995794G>T	ENST00000323110.2	-	5	842	c.840C>A	c.(838-840)ttC>ttA	p.F280L		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	280					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GAGGGCGGTTGAAGGCCAGTT	0.547									Familial Hyperaldosteronism type I																																								0													134.0	114.0	121.0					8																	143995794		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.840C>A	8.37:g.143995794G>T	ENSP00000325822:p.Phe280Leu		B0ZBE4|Q16726	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.F280L	ENST00000323110.2	37	c.840	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	.	5.731	0.319257	0.10845	.	.	ENSG00000179142	ENST00000323110	T	0.66815	-0.23	3.96	-0.44	0.12261	.	1.404360	0.05332	N	0.528484	T	0.22551	0.0544	N	0.00092	-2.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12451	-1.0547	10	0.22706	T	0.39	.	2.7418	0.05255	0.3735:0.0:0.419:0.2075	.	280	P19099	C11B2_HUMAN	L	280	ENSP00000325822:F280L	ENSP00000325822:F280L	F	-	3	2	CYP11B2	143992796	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.189000	0.00565	0.010000	0.14839	0.462000	0.41574	TTC	CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000179142		0.547	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1		0.00	36	0	G			143995794	-1			no_errors	ENST00000323110	ensembl	human	known	74_37	missense	10.77	58	7	SNP	0.000	T
CYP11B2	1585	genome.wustl.edu	37	8	143999142	143999142	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:143999142C>G	ENST00000323110.2	-	1	117	c.115G>C	c.(115-117)Gaa>Caa	p.E39Q		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	39					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	GGCATGGCTTCAAACGGCAGC	0.642									Familial Hyperaldosteronism type I																																								0													82.0	75.0	78.0					8																	143999142		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.115G>C	8.37:g.143999142C>G	ENSP00000325822:p.Glu39Gln		B0ZBE4|Q16726	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.E39Q	ENST00000323110.2	37	c.115	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	.	9.165	1.019590	0.19355	.	.	ENSG00000179142	ENST00000323110	T	0.74947	-0.89	3.48	1.64	0.23874	.	0.170868	0.27105	U	0.020907	T	0.64875	0.2638	L	0.57536	1.79	0.31189	N	0.701137	B	0.20887	0.049	B	0.25987	0.065	T	0.62220	-0.6900	10	0.51188	T	0.08	.	3.3211	0.07050	0.0:0.5236:0.2237:0.2527	.	39	P19099	C11B2_HUMAN	Q	39	ENSP00000325822:E39Q	ENSP00000325822:E39Q	E	-	1	0	CYP11B2	143996144	0.391000	0.25221	0.999000	0.59377	0.437000	0.31866	0.416000	0.21198	0.808000	0.34231	0.655000	0.94253	GAA	CYP11B2	-	NULL	ENSG00000179142		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1		0.00	26	0	C			143999142	-1			no_errors	ENST00000323110	ensembl	human	known	74_37	missense	11.54	46	6	SNP	0.987	G
CYP2A13	1553	genome.wustl.edu	37	19	41594483	41594483	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:41594483G>T	ENST00000330436.3	+	1	107	c.107G>T	c.(106-108)gGa>gTa	p.G36V		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	36					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CTGCCTCCGGGACCCACCCCA	0.587																																																	0													87.0	77.0	81.0					19																	41594483		2203	4300	6503	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.107G>T	19.37:g.41594483G>T	ENSP00000332679:p.Gly36Val		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.G36V	ENST00000330436.3	37	c.107	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	15.98	2.992648	0.54041	.	.	ENSG00000197838	ENST00000330436	T	0.01998	4.51	3.33	3.33	0.38152	.	0.000000	0.85682	U	0.000000	T	0.16041	0.0386	M	0.92604	3.325	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.02728	-1.1118	10	0.87932	D	0	.	12.5835	0.56403	0.0:0.0:1.0:0.0	.	36	Q16696	CP2AD_HUMAN	V	36	ENSP00000332679:G36V	ENSP00000332679:G36V	G	+	2	0	CYP2A13	46286323	1.000000	0.71417	0.367000	0.25926	0.516000	0.34256	8.109000	0.89561	1.870000	0.54199	0.444000	0.29173	GGA	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.587	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	-	0.00	78	0	G	NM_000766		41594483	+1	tier1	-	no_errors	ENST00000330436	ensembl	human	known	74_37	missense	18.58	92	21	SNP	0.999	T
CYP2A13	1553	genome.wustl.edu	37	19	41597723	41597723	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:41597723C>T	ENST00000330436.3	+	5	741	c.741C>T	c.(739-741)ttC>ttT	p.F247F		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	247					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TGGAGGACTTCATCGCCAAGA	0.557																																																	0													157.0	119.0	132.0					19																	41597723		2203	4300	6503	SO:0001819	synonymous_variant	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.741C>T	19.37:g.41597723C>T			Q53YR8|Q6R569|Q6R570|Q9H2X2	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.F247	ENST00000330436.3	37	c.741	CCDS12571.1	19																																																																																			CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197838		0.557	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	-	0.00	78	0	C	NM_000766		41597723	+1	tier1	-	no_errors	ENST00000330436	ensembl	human	known	74_37	silent	13.46	90	14	SNP	1.000	T
CYP2C18	1562	genome.wustl.edu	37	10	96466623	96466623	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:96466623G>T	ENST00000285979.6	+	5	924	c.725G>T	c.(724-726)aGt>aTt	p.S242I	CYP2C18_ENST00000339022.5_Intron|CYP2C19_ENST00000464755.1_3'UTR	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	242					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	TACATTAAAAGTTATGTATTG	0.328																																																	0													59.0	62.0	61.0					10																	96466623		2203	4299	6502	SO:0001583	missense	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.725G>T	10.37:g.96466623G>T	ENSP00000285979:p.Ser242Ile		B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.S242I	ENST00000285979.6	37	c.725	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	g	10.01	1.234309	0.22626	.	.	ENSG00000108242	ENST00000285979	T	0.69306	-0.39	3.65	-5.47	0.02600	.	1.172750	0.06182	U	0.679634	T	0.67202	0.2868	M	0.82716	2.605	0.09310	N	1	P	0.40083	0.702	B	0.36959	0.237	T	0.66933	-0.5798	10	0.66056	D	0.02	.	13.543	0.61686	0.8355:0.0:0.1645:0.0	.	242	P33260	CP2CI_HUMAN	I	242	ENSP00000285979:S242I	ENSP00000285979:S242I	S	+	2	0	CYP2C18	96456613	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-2.109000	0.01335	-1.231000	0.02557	-0.676000	0.03789	AGT	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000108242		0.328	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1		0.00	23	0	G	NM_000772		96466623	+1			no_errors	ENST00000285979	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.000	T
D2HGDH	728294	genome.wustl.edu	37	2	242681932	242681932	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:242681932G>A	ENST00000321264.4	+	4	642	c.433G>A	c.(433-435)Gag>Aag	p.E145K	D2HGDH_ENST00000537090.1_Missense_Mutation_p.E145K|D2HGDH_ENST00000342518.6_Missense_Mutation_p.E145K|D2HGDH_ENST00000403782.1_Missense_Mutation_p.E11K	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	145	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		CGTCTTTGACGAGATCATCCT	0.647																																																	0													107.0	83.0	91.0					2																	242681932		2203	4296	6499	SO:0001583	missense	0			AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.433G>A	2.37:g.242681932G>A	ENSP00000315351:p.Glu145Lys		B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.E145K	ENST00000321264.4	37	c.433	CCDS33426.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.289505	0.95517	.	.	ENSG00000180902	ENST00000537090;ENST00000321264;ENST00000403782;ENST00000342518;ENST00000437164;ENST00000454048	D;D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95;-3.76	5.06	5.06	0.68205	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98960	0.9646	H	0.97852	4.09	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99453	1.0941	10	0.87932	D	0	.	18.4273	0.90613	0.0:0.0:1.0:0.0	.	145	Q8N465	D2HDH_HUMAN	K	145;145;11;145;29;15	ENSP00000442796:E145K;ENSP00000315351:E145K;ENSP00000384723:E11K;ENSP00000339536:E145K;ENSP00000412511:E29K;ENSP00000404596:E15K	ENSP00000315351:E145K	E	+	1	0	D2HGDH	242330605	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	9.020000	0.93667	2.362000	0.80069	0.555000	0.69702	GAG	D2HGDH	-	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	ENSG00000180902		0.647	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	D2HGDH	HGNC	protein_coding	OTTHUMT00000322794.2	-	0.00	14	0	G	NM_152783		242681932	+1	tier1	-	no_errors	ENST00000321264	ensembl	human	known	74_37	missense	23.08	20	6	SNP	1.000	A
DAB2IP	153090	genome.wustl.edu	37	9	124538484	124538484	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:124538484C>T	ENST00000408936.3	+	14	3310	c.3128C>T	c.(3127-3129)gCg>gTg	p.A1043V	DAB2IP_ENST00000259371.2_Missense_Mutation_p.A1015V|DAB2IP_ENST00000309989.1_Missense_Mutation_p.A919V			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	1043					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						TAGGACCTGGCGGTGCTGCAG	0.627																																																	0													29.0	24.0	26.0					9																	124538484		2197	4292	6489	SO:0001583	missense	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.3128C>T	9.37:g.124538484C>T	ENSP00000386183:p.Ala1043Val		A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.A1043V	ENST00000408936.3	37	c.3128		9	.	.	.	.	.	.	.	.	.	.	C	10.20	1.285858	0.23478	.	.	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.12147	2.71;2.71;2.71;2.71	4.99	3.97	0.46021	.	1.175700	0.05985	N	0.644974	T	0.07683	0.0193	N	0.14661	0.345	0.34741	D	0.730789	B;B	0.17268	0.006;0.021	B;B	0.12837	0.002;0.008	T	0.42965	-0.9420	10	0.14252	T	0.57	.	3.5676	0.07905	0.0:0.6506:0.0:0.3494	.	1043;1015	Q5VWQ8;G3XA90	DAB2P_HUMAN;.	V	1015;1043;952;919	ENSP00000259371:A1015V;ENSP00000386183:A1043V;ENSP00000362887:A952V;ENSP00000310827:A919V	ENSP00000259371:A1015V	A	+	2	0	DAB2IP	123578305	0.987000	0.35691	0.999000	0.59377	0.967000	0.64934	2.479000	0.45197	2.305000	0.77605	0.561000	0.74099	GCG	DAB2IP	-	pfam_DUF3498	ENSG00000136848		0.627	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1		0.00	50	0	C	NM_032552		124538484	+1			no_errors	ENST00000408936	ensembl	human	known	74_37	missense	12.50	56	8	SNP	0.991	T
DKK1	22943	genome.wustl.edu	37	10	54074591	54074591	+	Intron	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:54074591G>A	ENST00000373970.3	+	2	382				DKK1_ENST00000467359.1_3'UTR|PRKG1-AS1_ENST00000420193.1_RNA	NM_012242.2	NP_036374.1	O94907	DKK1_HUMAN	dickkopf WNT signaling pathway inhibitor 1						cell morphogenesis involved in differentiation (GO:0000904)|embryonic limb morphogenesis (GO:0030326)|endoderm formation (GO:0001706)|extracellular negative regulation of signal transduction (GO:1900116)|face morphogenesis (GO:0060325)|forebrain development (GO:0030900)|hair follicle development (GO:0001942)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:1901296)|negative regulation of cardiac muscle cell differentiation (GO:2000726)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of heart induction by negative regulation of canonical Wnt signaling pathway (GO:0090082)|regulation of endodermal cell fate specification (GO:0042663)|regulation of receptor internalization (GO:0002090)|response to retinoic acid (GO:0032526)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)|low-density lipoprotein particle receptor binding (GO:0050750)|receptor antagonist activity (GO:0048019)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(4)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	16						TGGAGAGGTGGACAGATAAGG	0.597											OREG0020191	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0				CCDS7246.1	10q11.2	2013-05-15	2013-05-15		ENSG00000107984	ENSG00000107984			2891	protein-coding gene	gene with protein product		605189	"""dickkopf (Xenopus laevis) homolog 1"", ""dickkopf 1 homolog (Xenopus laevis)"""				Standard	NM_012242		Approved	SK, DKK-1	uc001jjr.3	O94907	OTTHUMG00000018247	ENST00000373970.3:c.244-92G>A	10.37:g.54074591G>A		997	B2RC19	RNA	SNP	-	NULL	ENST00000373970.3	37	NULL	CCDS7246.1	10																																																																																			DKK1	-	-	ENSG00000107984		0.597	DKK1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DKK1	HGNC	protein_coding	OTTHUMT00000048100.1	-	0.00	48	0	G			54074591	+1	tier1	-	no_errors	ENST00000467359	ensembl	human	known	74_37	rna	16.22	31	6	SNP	0.001	A
DLGAP4	22839	genome.wustl.edu	37	20	35156429	35156429	+	3'UTR	SNP	G	G	A	rs544923981		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:35156429G>A	ENST00000339266.5	+	0	3974				DLGAP4_ENST00000401952.2_3'UTR|DLGAP4_ENST00000475894.1_3'UTR|RP5-977B1.7_ENST00000433238.1_RNA|RP5-977B1.7_ENST00000439595.1_RNA|DLGAP4_ENST00000373913.3_3'UTR|RP5-977B1.7_ENST00000425233.1_RNA			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4						cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCTGGCTCTCGGGGCACCTGG	0.473													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13332	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000339266.5:c.*995G>A	20.37:g.35156429G>A			E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	RNA	SNP	-	NULL	ENST00000339266.5	37	NULL		20																																																																																			DLGAP4	-	-	ENSG00000080845		0.473	DLGAP4-201	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding		-	0.00	97	0	G	NM_014902		35156429	+1	tier1	-	no_errors	ENST00000475894	ensembl	human	known	74_37	rna	10.73	158	19	SNP	0.998	A
DNAH5	1767	genome.wustl.edu	37	5	13776634	13776634	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:13776634C>T	ENST00000265104.4	-	55	9391	c.9287G>A	c.(9286-9288)cGa>cAa	p.R3096Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3096	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGCTCTGTTTCGAAATTTCTC	0.478									Kartagener syndrome																																								0													97.0	91.0	93.0					5																	13776634		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9287G>A	5.37:g.13776634C>T	ENSP00000265104:p.Arg3096Gln		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R3096Q	ENST00000265104.4	37	c.9287	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.139959	0.97320	.	.	ENSG00000039139	ENST00000265104	T	0.56611	0.45	5.97	5.97	0.96955	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.85682	D	0.000000	T	0.78717	0.4327	M	0.92268	3.29	0.80722	D	1	D	0.67145	0.996	P	0.60789	0.879	T	0.82837	-0.0260	10	0.72032	D	0.01	.	20.4239	0.99064	0.0:1.0:0.0:0.0	.	3096	Q8TE73	DYH5_HUMAN	Q	3096	ENSP00000265104:R3096Q	ENSP00000265104:R3096Q	R	-	2	0	DNAH5	13829634	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.684000	0.84104	2.828000	0.97474	0.655000	0.94253	CGA	DNAH5	-	superfamily_P-loop_NTPase	ENSG00000039139		0.478	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	43	0	C	NM_001369		13776634	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	17.65	42	9	SNP	1.000	T
DNAJC13	23317	genome.wustl.edu	37	3	132242519	132242519	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:132242519G>A	ENST00000260818.6	+	51	6270	c.6022G>A	c.(6022-6024)Gaa>Aaa	p.E2008K		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	2008					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TGCCCTGTTAGAAAAATTAAC	0.403																																																	0													73.0	79.0	77.0					3																	132242519		2202	4299	6501	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.6022G>A	3.37:g.132242519G>A	ENSP00000260818:p.Glu2008Lys		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.E2008K	ENST00000260818.6	37	c.6022	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	24.7	4.564809	0.86439	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.48836	0.8	5.25	4.38	0.52667	Armadillo-like helical (1);Armadillo-type fold (1);	0.106561	0.64402	N	0.000006	T	0.50854	0.1640	M	0.71036	2.16	0.58432	D	0.999998	P	0.47302	0.893	B	0.43680	0.427	T	0.55418	-0.8144	10	0.44086	T	0.13	.	14.0024	0.64442	0.0732:0.0:0.9268:0.0	.	2008	O75165	DJC13_HUMAN	K	2008;655	ENSP00000260818:E2008K	ENSP00000260818:E2008K	E	+	1	0	DNAJC13	133725209	1.000000	0.71417	0.927000	0.36925	0.957000	0.61999	9.154000	0.94694	1.345000	0.45676	0.557000	0.71058	GAA	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.403	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	26	0	G	NM_015268		132242519	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	9.43	48	5	SNP	1.000	A
DOCK8	81704	genome.wustl.edu	37	9	399175	399175	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:399175C>T	ENST00000453981.1	+	26	3262	c.3150C>T	c.(3148-3150)atC>atT	p.I1050I	DOCK8_ENST00000469391.1_Silent_p.I950I|DOCK8_ENST00000432829.2_Silent_p.I982I|DOCK8_ENST00000382329.1_Silent_p.I517I|DOCK8_ENST00000382331.1_Silent_p.I352I			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1050					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AGATGAACATCAGCCTGGCTT	0.463																																																	0													168.0	146.0	154.0					9																	399175		2203	4300	6503	SO:0001819	synonymous_variant	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.3150C>T	9.37:g.399175C>T			A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.I1050	ENST00000453981.1	37	c.3150	CCDS6440.2	9																																																																																			DOCK8	-	NULL	ENSG00000107099		0.463	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	-	0.00	53	0	C	XM_036307		399175	+1	tier1	-	no_errors	ENST00000453981	ensembl	human	known	74_37	silent	14.47	65	11	SNP	1.000	T
DQX1	165545	genome.wustl.edu	37	2	74745640	74745640	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:74745640G>T	ENST00000404568.3	-	12	2306	c.2087C>A	c.(2086-2088)gCa>gAa	p.A696E	DQX1_ENST00000393951.2_Missense_Mutation_p.A696E	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	696						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TGTAGAATCTGCCATTCCTTC	0.532																																																	0													154.0	137.0	142.0					2																	74745640		2203	4300	6503	SO:0001583	missense	0			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.2087C>A	2.37:g.74745640G>T	ENSP00000384621:p.Ala696Glu		Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.A696E	ENST00000404568.3	37	c.2087	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	G	2.289	-0.362801	0.05103	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.02863	4.13;4.13	4.91	2.97	0.34412	.	1.004810	0.08020	N	0.991778	T	0.01421	0.0046	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42849	-0.9427	10	0.10636	T	0.68	.	9.5682	0.39411	0.0:0.0:0.6183:0.3816	.	696	Q8TE96	DQX1_HUMAN	E	696	ENSP00000377523:A696E;ENSP00000384621:A696E	ENSP00000377523:A696E	A	-	2	0	DQX1	74599148	0.080000	0.21391	0.827000	0.32855	0.784000	0.44337	1.477000	0.35431	1.041000	0.40125	-0.261000	0.10672	GCA	DQX1	-	NULL	ENSG00000144045		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	-	0.00	29	0	G	NM_133637		74745640	-1	tier1	-	no_errors	ENST00000393951	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.090	T
EBLN2	55096	genome.wustl.edu	37	3	73111574	73111574	+	Silent	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:73111574A>G	ENST00000533473.1	+	1	765	c.342A>G	c.(340-342)gcA>gcG	p.A114A	PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000394284.3_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	114										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						TAGACCCAGCACATAAATCTC	0.433																																																	0													67.0	62.0	63.0					3																	73111574		1906	4104	6010	SO:0001819	synonymous_variant	0				CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.342A>G	3.37:g.73111574A>G			Q8WWH3|Q9NW89	Silent	SNP	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir	p.A114	ENST00000533473.1	37	c.342	CCDS54608.1	3																																																																																			EBLN2	-	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir	ENSG00000255423		0.433	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBLN2	HGNC	protein_coding	OTTHUMT00000386932.1	-	0.00	31	0	A	NM_018029		73111574	+1	tier1	-	no_errors	ENST00000533473	ensembl	human	known	74_37	silent	27.27	24	9	SNP	0.000	G
EDEM2	55741	genome.wustl.edu	37	20	33719587	33719587	+	Splice_Site	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:33719587C>T	ENST00000374492.3	-	7	808		c.e7-1		EDEM2_ENST00000541621.1_Splice_Site|EDEM2_ENST00000542871.1_Splice_Site|EDEM2_ENST00000374491.3_Splice_Site|EDEM2_ENST00000540582.1_Splice_Site	NM_018217.2	NP_060687.2	Q9BV94	EDEM2_HUMAN	ER degradation enhancer, mannosidase alpha-like 2						cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	22			BRCA - Breast invasive adenocarcinoma(18;0.00936)			GGTTGCCGACCTGAGAGAGAG	0.592																																					Esophageal Squamous(51;906 1021 24535 36410 39145)												0													85.0	82.0	83.0					20																	33719587		2203	4300	6503	SO:0001630	splice_region_variant	0			AK001645	CCDS13247.1, CCDS46592.1	20q11.22	2006-03-31	2006-03-31	2006-03-31	ENSG00000088298	ENSG00000088298			15877	protein-coding gene	gene with protein product		610302	"""chromosome 20 open reading frame 31"""	C20orf49, C20orf31		15537790, 15579471	Standard	NM_018217		Approved	FLJ10783, bA4204.1	uc002xbo.2	Q9BV94	OTTHUMG00000032322	ENST00000374492.3:c.703-1G>A	20.37:g.33719587C>T			B4DTG9|Q6GU33|Q6IA89|Q6UWZ4|Q9H4U0|Q9H886|Q9NTL9|Q9NVE6	Splice_Site	SNP	-	e7-1	ENST00000374492.3	37	c.703-1	CCDS13247.1	20	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498861	0.85069	.	.	ENSG00000088298	ENST00000374491;ENST00000374492;ENST00000541621;ENST00000540582	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6275	0.95684	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EDEM2	33183248	1.000000	0.71417	0.997000	0.53966	0.689000	0.40095	7.786000	0.85741	2.625000	0.88918	0.650000	0.86243	.	EDEM2	-	-	ENSG00000088298		0.592	EDEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM2	HGNC	protein_coding	OTTHUMT00000078842.2	-	0.00	34	0	C	NM_018217	Intron	33719587	-1	tier1	-	no_errors	ENST00000374492	ensembl	human	known	74_37	splice_site	11.11	48	6	SNP	1.000	T
GCC2	9648	genome.wustl.edu	37	2	109128434	109128436	+	IGR	DEL	TTC	TTC	-	rs199901241		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:109128434_109128436delTTC	ENST00000309863.6	+	0	7537				AC012487.2_ENST00000322353.3_RNA|AC012487.2_ENST00000440975.1_RNA	NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2						Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						ttggggcatgttcttcttgactg	0.389																																																	0																																										SO:0001628	intergenic_variant	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214		2.37:g.109128437_109128439delTTC			A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	RNA	DEL	-	NULL	ENST00000309863.6	37	NULL	CCDS33268.1	2																																																																																			AC012487.2	-	-	ENSG00000214184		0.389	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214184	Clone_based_vega_gene	protein_coding	OTTHUMT00000358516.3		0.00	50	0	TTC	NM_014635		109128436	-1	tier1		no_errors	ENST00000322353	ensembl	human	known	74_37	rna	17.78	37	8	DEL	0.001:0.001:0.001	-
THBS3	7059	genome.wustl.edu	37	1	155166792	155166792	+	Intron	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:155166792C>T	ENST00000368378.3	-	21	2693				RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000541576.1_Intron|THBS3_ENST00000541990.1_Intron|MIR92B_ENST00000607575.1_RNA|THBS3_ENST00000457183.2_Intron	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3						bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGGACAGGCCCGGCCTGAGTC	0.602																																																	0													30.0	29.0	29.0					1																	155166792		2203	4298	6501	SO:0001627	intron_variant	0			L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.2672+39G>A	1.37:g.155166792C>T			B1AVR8|B4DQ20|Q8WV34	RNA	SNP	-	NULL	ENST00000368378.3	37	NULL	CCDS1099.1	1																																																																																			RP11-263K19.4	-	-	ENSG00000231064		0.602	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000231064	Clone_based_vega_gene	protein_coding	OTTHUMT00000086856.1	-	0.00	27	0	C	NM_007112		155166792	+1	tier1	-	no_errors	ENST00000447623	ensembl	human	known	74_37	rna	11.86	52	7	SNP	0.000	T
RP11-467N20.5	0	genome.wustl.edu	37	15	23407518	23407518	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:23407518C>A	ENST00000558241.1	-	8	1408	c.1318G>T	c.(1318-1320)Gag>Tag	p.E440*																	endometrium(1)	1						tcctcctgctcctgcctcttc	0.537																																																	0																																										SO:0001587	stop_gained	0																														ENST00000558241.1:c.1318G>T	15.37:g.23407518C>A	ENSP00000453436:p.Glu440*			Nonsense_Mutation	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.E440*	ENST00000558241.1	37	c.1318		15																																																																																			RP11-467N20.5	-	NULL	ENSG00000259455		0.537	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000259455	Clone_based_vega_gene	protein_coding	OTTHUMT00000415942.1	-	0.00	10	0	C			23407518	-1	tier1	-	no_errors	ENST00000558241	ensembl	human	novel	74_37	nonsense	50.00	2	2	SNP	0.025	A
NCAPGP2	100421148	genome.wustl.edu	37	15	30297941	30297941	+	lincRNA	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:30297941C>G	ENST00000561392.1	-	0	189																											GTGGCAGTCTCTGTCCTCAAT	0.418																																																	0																																												0																															15.37:g.30297941C>G				RNA	SNP	-	NULL	ENST00000561392.1	37	NULL		15																																																																																			RP11-143J24.1	-	-	ENSG00000259647		0.418	RP11-143J24.1-001	KNOWN	basic	lincRNA	ENSG00000259647	Clone_based_vega_gene	lincRNA	OTTHUMT00000417288.1	-	0.00	18	0	C			30297941	-1	tier1	-	no_errors	ENST00000561392	ensembl	human	known	74_37	rna	20.69	22	6	SNP	0.662	G
DYNC1LI2	1783	genome.wustl.edu	37	16	66755236	66755236	+	3'UTR	DEL	T	T	-			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:66755236delT	ENST00000258198.2	-	0	4074				RP11-63M22.2_ENST00000569274.1_RNA	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		TTTTCTCTGATTTTTTTTTTT	0.313																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.*2389A>-	16.37:g.66755236delT			A8K6V1|B4DZP4|Q8TAT3	RNA	DEL	-	NULL	ENST00000258198.2	37	NULL	CCDS10818.1	16																																																																																			RP11-63M22.2	-	-	ENSG00000260465		0.313	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260465	Clone_based_vega_gene	protein_coding	OTTHUMT00000268846.1		0.00	30	0	T	NM_006141		66755236	+1	tier1		no_errors	ENST00000569274	ensembl	human	known	74_37	rna	7.69	24	2	DEL	0.712	-
ERVMER34-1	100288413	genome.wustl.edu	37	4	53610318	53610324	+	Frame_Shift_Del	DEL	TTAGACT	TTAGACT	-	rs369691211		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	TTAGACT	TTAGACT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:53610318_53610324delTTAGACT	ENST00000443173.1	-	3	2224_2230	c.1364_1370delAGTCTAA	c.(1363-1371)aagtctaatfs	p.KSN455fs	ERVMER34-1_ENST00000540758.1_Frame_Shift_Del_p.KSN455fs|ERVMER34-1_ENST00000440542.1_Frame_Shift_Del_p.KSN455fs|ERVMER34-1_ENST00000454756.2_Intron	NM_001242690.1	NP_001229619.1	Q9H9K5	MER34_HUMAN	endogenous retrovirus group MER34, member 1	455						integral component of membrane (GO:0016021)|viral envelope (GO:0019031)				endometrium(3)|kidney(1)	4						acgctgtatattagactttatttcttc	0.43																																																	0																																										SO:0001589	frameshift_variant	0					4q12	2011-10-20			ENSG00000226887	ENSG00000226887			42970	other	endogenous retrovirus							Standard	NM_024534		Approved		uc003gzs.3	Q9H9K5	OTTHUMG00000150366	ENST00000443173.1:c.1364_1370delAGTCTAA	4.37:g.53610318_53610324delTTAGACT	ENSP00000460602:p.Lys455fs		B3KTB4|Q0P5R3|Q6NWN0	Frame_Shift_Del	DEL	pfam_TLV/ENV_coat_polyprotein	p.K455fs	ENST00000443173.1	37	c.1370_1364		4																																																																																			ERVMER34-1	-	pfam_TLV/ENV_coat_polyprotein	ENSG00000226887		0.430	ERVMER34-1-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	ERVMER34-1	HGNC	protein_coding	OTTHUMT00000317860.2		0.00	27	0	TTAGACT	NM_024534		53610324	-1			no_errors	ENST00000440542	ensembl	human	known	74_37	frame_shift_del	11.11	40	5	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.000	0
ESR1	2099	genome.wustl.edu	37	6	152265629	152265629	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:152265629C>T	ENST00000206249.3	+	4	1444	c.1082C>T	c.(1081-1083)gCg>gTg	p.A361V	ESR1_ENST00000406599.1_Intron|ESR1_ENST00000427531.2_Missense_Mutation_p.A188V|ESR1_ENST00000443427.1_Missense_Mutation_p.A361V|ESR1_ENST00000440973.1_Missense_Mutation_p.A361V|ESR1_ENST00000456483.2_Intron|ESR1_ENST00000482101.1_3'UTR|ESR1_ENST00000338799.5_Missense_Mutation_p.A361V	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	361	Interaction with AKAP13.|Self-association.|Steroid-binding.|Transactivation AF-2.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	ATCAACTGGGCGAAGAGGGTG	0.478																																																	0													80.0	75.0	77.0					6																	152265629		2203	4300	6503	SO:0001583	missense	0			X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.1082C>T	6.37:g.152265629C>T	ENSP00000206249:p.Ala361Val		Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	pfam_Oestr_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Oestr_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A361V	ENST00000206249.3	37	c.1082	CCDS5234.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.340774|5.340774	0.95783|0.95783	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394|ENST00000427531	D;D;D;D;T|.	0.97114|.	-4.25;-4.25;-4.25;-4.25;0.26|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.87285|.	0.6139|.	H|H	0.96048|0.96048	3.76|3.76	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.995;1.0;1.0;1.0|.	D;D;P;D;D;D|.	0.85130|.	0.982;0.991;0.836;0.997;0.994;0.996|.	D|.	0.90641|.	0.4575|.	10|.	0.87932|.	D|.	0|.	.|.	19.7375|19.7375	0.96212|0.96212	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	265;142;103;360;361;361|.	B0QYW6;E7EVR3;Q9Y2W8;A8KAF4;G4XH65;P03372|.	.;.;.;.;.;ESR1_HUMAN|.	V|X	361;361;142;361;361;289;188|266	ENSP00000405330:A361V;ENSP00000342630:A361V;ENSP00000387500:A361V;ENSP00000206249:A361V;ENSP00000445454:A188V|.	ENSP00000206249:A361V|.	A|R	+|+	2|1	0|2	ESR1|ESR1	152307322|152307322	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.995000|0.995000	0.86356|0.86356	7.818000|7.818000	0.86416|0.86416	2.680000|2.680000	0.91292|0.91292	0.655000|0.655000	0.94253|0.94253	GCG|CGA	ESR1	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000091831		0.478	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR1	HGNC	protein_coding	OTTHUMT00000043308.1		0.00	14	0	C			152265629	+1			no_errors	ENST00000206249	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
ETFDH	2110	genome.wustl.edu	37	4	159605747	159605747	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:159605747C>T	ENST00000511912.1	+	4	741	c.409C>T	c.(409-411)Cca>Tca	p.P137S	ETFDH_ENST00000307738.5_Missense_Mutation_p.P90S	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	137					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		TTTCTAGGCTCCACTTAACAC	0.289																																																	0													71.0	74.0	73.0					4																	159605747		2202	4299	6501	SO:0001583	missense	0			S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.409C>T	4.37:g.159605747C>T	ENSP00000426638:p.Pro137Ser		B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	pfam_ETFD_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_Pyridine_nuc-diS_OxRdtase_2	p.P137S	ENST00000511912.1	37	c.409	CCDS3800.1	4	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853831	0.91355	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	D;D	0.95272	-3.66;-3.66	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.98220	0.9411	H	0.95260	3.645	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.71870	0.967;0.967;0.975	D	0.98982	1.0805	10	0.87932	D	0	-10.1101	19.7498	0.96263	0.0:1.0:0.0:0.0	.	90;76;137	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	S	137;90	ENSP00000426638:P137S;ENSP00000303552:P90S	ENSP00000303552:P90S	P	+	1	0	ETFDH	159825197	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.551000	0.82182	2.674000	0.91012	0.591000	0.81541	CCA	ETFDH	-	NULL	ENSG00000171503		0.289	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETFDH	HGNC	protein_coding	OTTHUMT00000365718.2		0.00	25	0	C			159605747	+1			no_errors	ENST00000511912	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	T
FABP4	2167	genome.wustl.edu	37	8	82391122	82391122	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:82391122G>A	ENST00000256104.4	-	4	472	c.377C>T	c.(376-378)aCg>aTg	p.T126M	RP11-157I4.4_ENST00000524085.2_RNA|FABP4_ENST00000518669.1_5'UTR	NM_001442.2	NP_001433.1	P15090	FABP4_HUMAN	fatty acid binding protein 4, adipocyte	126					brown fat cell differentiation (GO:0050873)|cellular response to lithium ion (GO:0071285)|cholesterol homeostasis (GO:0042632)|cytokine production (GO:0001816)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of inflammatory response (GO:0050729)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lipid particle (GO:0005811)|nucleus (GO:0005634)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|large_intestine(1)|ovary(1)|skin(1)	6			Epithelial(68;0.213)			ATAAACTCTCGTGGAAGTGAC	0.388																																					NSCLC(35;550 1252 19644 48360)												0													180.0	149.0	160.0					8																	82391122		2203	4300	6503	SO:0001583	missense	0			J02874	CCDS6230.1	8q21.13	2013-03-01			ENSG00000170323	ENSG00000170323		"""Fatty acid binding protein family"""	3559	protein-coding gene	gene with protein product		600434				2481498	Standard	NM_001442		Approved	A-FABP, aP2	uc003ycd.2	P15090	OTTHUMG00000164602	ENST00000256104.4:c.377C>T	8.37:g.82391122G>A	ENSP00000256104:p.Thr126Met		Q6IBA1	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.T126M	ENST00000256104.4	37	c.377	CCDS6230.1	8	.	.	.	.	.	.	.	.	.	.	G	11.14	1.551307	0.27739	.	.	ENSG00000170323	ENST00000256104	T	0.08807	3.05	4.93	3.16	0.36331	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.441048	0.25205	N	0.032351	T	0.21062	0.0507	M	0.85859	2.78	0.21473	N	0.999674	D	0.55385	0.971	P	0.54815	0.761	T	0.08126	-1.0737	10	0.87932	D	0	.	6.2114	0.20631	0.1613:0.0:0.6902:0.1486	.	126	P15090	FABP4_HUMAN	M	126	ENSP00000256104:T126M	ENSP00000256104:T126M	T	-	2	0	FABP4	82553677	0.903000	0.30736	0.623000	0.29173	0.014000	0.08584	1.140000	0.31516	0.805000	0.34159	-0.126000	0.14955	ACG	FABP4	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000170323		0.388	FABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP4	HGNC	protein_coding	OTTHUMT00000379368.1	-	0.00	37	0	G	NM_001442		82391122	-1	tier1	-	no_errors	ENST00000256104	ensembl	human	known	74_37	missense	20.41	38	10	SNP	0.382	A
FABP12	646486	genome.wustl.edu	37	8	82439330	82439330	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:82439330G>T	ENST00000360464.4	-	3	335	c.273C>A	c.(271-273)tcC>tcA	p.S91S	RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12	91							lipid binding (GO:0008289)|transporter activity (GO:0005215)			large_intestine(1)|lung(3)	4						CTTGAATCAGGGACTCCTTAT	0.393																																																	0													91.0	81.0	84.0					8																	82439330		1877	4120	5997	SO:0001819	synonymous_variant	0				CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679	ENST00000360464.4:c.273C>A	8.37:g.82439330G>T			B7SUN0	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.S91	ENST00000360464.4	37	c.273	CCDS47882.1	8																																																																																			FABP12	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000197416		0.393	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP12	HGNC	protein_coding	OTTHUMT00000379720.1		0.00	25	0	G	NM_001105281		82439330	-1			no_errors	ENST00000360464	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.108	T
FAM46D	169966	genome.wustl.edu	37	X	79698219	79698219	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:79698219G>A	ENST00000308293.5	+	3	420	c.181G>A	c.(181-183)Gcc>Acc	p.A61T	FAM46D_ENST00000538312.1_Missense_Mutation_p.A61T	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	61										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						TGTTAAAGATGCCAGATTGAA	0.398																																																	0													135.0	118.0	124.0					X																	79698219		2203	4300	6503	SO:0001583	missense	0			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.181G>A	X.37:g.79698219G>A	ENSP00000308575:p.Ala61Thr		B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	pfam_DUF1693	p.A61T	ENST00000308293.5	37	c.181	CCDS14446.1	X	.	.	.	.	.	.	.	.	.	.	G	2.188	-0.386019	0.04966	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.22336	1.96;1.96	4.38	-2.88	0.05682	Domain of unknown function DUF1693 (1);	0.452396	0.23356	N	0.049063	T	0.05640	0.0148	N	0.02011	-0.69	0.21020	N	0.999809	B	0.02656	0.0	B	0.04013	0.001	T	0.16837	-1.0389	10	0.52906	T	0.07	-0.7148	3.5537	0.07857	0.4312:0.0:0.1651:0.4037	.	61	Q8NEK8	FA46D_HUMAN	T	61	ENSP00000443410:A61T;ENSP00000308575:A61T	ENSP00000308575:A61T	A	+	1	0	FAM46D	79584875	0.999000	0.42202	0.044000	0.18714	0.001000	0.01503	0.957000	0.29215	-0.959000	0.03618	-2.092000	0.00371	GCC	FAM46D	-	pfam_DUF1693	ENSG00000174016		0.398	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46D	HGNC	protein_coding	OTTHUMT00000057338.1	-	0.00	24	0	G	NM_152630		79698219	+1	tier1	-	no_errors	ENST00000308293	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.812	A
FAM73B	84895	genome.wustl.edu	37	9	131823531	131823531	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:131823531G>T	ENST00000358369.4	+	9	1142	c.916G>T	c.(916-918)Gga>Tga	p.G306*	FAM73B_ENST00000406926.2_Nonsense_Mutation_p.G306*|FAM73B_ENST00000277475.5_3'UTR	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	306					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						CCTGCAGACTGGAGATTACCC	0.642											OREG0003927	type=REGULATORY REGION|Gene=FAM73B|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													47.0	35.0	39.0					9																	131823531		2203	4299	6502	SO:0001587	stop_gained	0			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.916G>T	9.37:g.131823531G>T	ENSP00000351138:p.Gly306*	1590	Q8NBM3|Q8TEJ6|Q969E6	Nonsense_Mutation	SNP	pfam_DUF2217	p.G306*	ENST00000358369.4	37	c.916	CCDS6917.1	9	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179043	0.78564	.	.	ENSG00000148343	ENST00000358369;ENST00000406926	.	.	.	4.98	3.16	0.36331	.	0.314786	0.35805	N	0.002967	.	.	.	.	.	.	0.23126	N	0.998251	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-5.7832	8.1789	0.31298	0.2444:0.0:0.7556:0.0	.	.	.	.	X	306	.	ENSP00000351138:G306X	G	+	1	0	FAM73B	130863352	1.000000	0.71417	0.008000	0.14137	0.026000	0.11368	3.945000	0.56637	0.524000	0.28502	-0.698000	0.03680	GGA	FAM73B	-	pfam_DUF2217	ENSG00000148343		0.642	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM73B	HGNC	protein_coding	OTTHUMT00000054542.7		0.00	23	0	G	NM_032809		131823531	+1			no_errors	ENST00000358369	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	0.033	T
FAM78A	286336	genome.wustl.edu	37	9	134135694	134135694	+	3'UTR	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:134135694G>T	ENST00000372271.3	-	0	1734				FAM78A_ENST00000372269.3_3'UTR|FAM78A_ENST00000247295.4_5'UTR	NM_033387.3	NP_203745.2	Q5JUQ0	FA78A_HUMAN	family with sequence similarity 78, member A											NS(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		TTTCAATTCAGCTTAAGGCAA	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095423	CCDS6941.2	9q34	2008-02-05	2005-07-18	2005-07-18	ENSG00000126882	ENSG00000126882			25465	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 59"""	C9orf59		11214971	Standard	NM_033387		Approved	FLJ00024	uc004cak.3	Q5JUQ0	OTTHUMG00000020821	ENST00000372271.3:c.*515C>A	9.37:g.134135694G>T			Q86VQ9|Q9H7P4	RNA	SNP	-	NULL	ENST00000372271.3	37	NULL	CCDS6941.2	9																																																																																			FAM78A	-	-	ENSG00000126882		0.542	FAM78A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78A	HGNC	protein_coding	OTTHUMT00000054720.1	-	0.00	59	0	G	NM_033387		134135694	-1	tier1	-	no_errors	ENST00000247295	ensembl	human	known	74_37	rna	5.63	67	4	SNP	0.991	T
FAT4	79633	genome.wustl.edu	37	4	126373683	126373683	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:126373683G>A	ENST00000394329.3	+	9	11525	c.11512G>A	c.(11512-11514)Gtg>Atg	p.V3838M	FAT4_ENST00000335110.5_Missense_Mutation_p.V2136M	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3838	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGTCATCATCGTGGCAAATGA	0.483																																																	0													100.0	99.0	99.0					4																	126373683		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11512G>A	4.37:g.126373683G>A	ENSP00000377862:p.Val3838Met		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.V3838M	ENST00000394329.3	37	c.11512	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426253	0.25726	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.78126	-0.96;-1.15	5.47	3.68	0.42216	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.232978	0.20986	U	0.082132	T	0.59972	0.2233	L	0.34521	1.04	0.54753	D	0.999981	B;P;B	0.39352	0.202;0.669;0.201	B;B;B	0.24701	0.055;0.032;0.038	T	0.54768	-0.8244	10	0.33141	T	0.24	.	9.3849	0.38336	0.3019:0.0:0.6981:0.0	.	2136;3838;3838	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	M	3838;2136	ENSP00000377862:V3838M;ENSP00000335169:V2136M	ENSP00000335169:V2136M	V	+	1	0	FAT4	126593133	0.999000	0.42202	0.106000	0.21319	0.675000	0.39556	2.897000	0.48664	0.617000	0.30160	0.561000	0.74099	GTG	FAT4	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000196159		0.483	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	49	0	G	NM_024582		126373683	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.957	A
FGFR4	2264	genome.wustl.edu	37	5	176524671	176524671	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:176524671G>T	ENST00000292408.4	+	18	2648	c.2403G>T	c.(2401-2403)caG>caT	p.Q801H	FGFR4_ENST00000292410.3_Missense_Mutation_p.Q761H|FGFR4_ENST00000502906.1_Missense_Mutation_p.Q801H|FGFR4_ENST00000393648.2_Missense_Mutation_p.Q733H|FGFR4_ENST00000393637.1_Missense_Mutation_p.Q761H	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	801					alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CTGGGGTGCAGACATGAGCAA	0.627										TSP Lung(9;0.080)																																							0													76.0	63.0	67.0					5																	176524671		2203	4300	6503	SO:0001583	missense	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2403G>T	5.37:g.176524671G>T	ENSP00000292408:p.Gln801His		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q801H	ENST00000292408.4	37	c.2403	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	G	12.32	1.902268	0.33628	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	T;T;T;T;T	0.78481	-1.18;-1.12;-1.18;-1.17;-1.17	4.34	2.49	0.30216	.	0.723557	0.10503	U	0.667071	T	0.56001	0.1956	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.46345	-0.9198	10	0.49607	T	0.09	.	4.512	0.11915	0.201:0.1861:0.6129:0.0	.	733;761;801	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	H	801;733;801;761;761;1029	ENSP00000292408:Q801H;ENSP00000377259:Q733H;ENSP00000424960:Q801H;ENSP00000292410:Q761H;ENSP00000377254:Q761H	ENSP00000292408:Q801H	Q	+	3	2	FGFR4	176457277	0.079000	0.21365	0.681000	0.30009	0.047000	0.14425	0.886000	0.28241	0.548000	0.28955	0.462000	0.41574	CAG	FGFR4	-	pirsf_FGF_rcpt_fam	ENSG00000160867		0.627	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1		0.00	28	0	G			176524671	+1			no_errors	ENST00000292408	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.110	T
FLG	2312	genome.wustl.edu	37	1	152278186	152278186	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:152278186G>T	ENST00000368799.1	-	3	9211	c.9176C>A	c.(9175-9177)tCa>tAa	p.S3059*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3059	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAAGATCCTGAATGTCCAGA	0.587									Ichthyosis																																								0													14.0	18.0	17.0					1																	152278186		1787	4035	5822	SO:0001587	stop_gained	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9176C>A	1.37:g.152278186G>T	ENSP00000357789:p.Ser3059*		Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S3059*	ENST00000368799.1	37	c.9176	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	47	13.881264	0.99768	.	.	ENSG00000143631	ENST00000368799	.	.	.	2.8	0.496	0.16896	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	3.5718	0.07920	0.1611:0.2644:0.5746:0.0	.	.	.	.	X	3059	.	ENSP00000357789:S3059X	S	-	2	0	FLG	150544810	0.008000	0.16893	0.001000	0.08648	0.002000	0.02628	0.711000	0.25764	0.471000	0.27319	0.449000	0.29647	TCA	FLG	-	NULL	ENSG00000143631		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	45	0	G	NM_002016		152278186	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	nonsense	11.94	59	8	SNP	0.001	T
LINC01567	400511	genome.wustl.edu	37	16	24676205	24676205	+	lincRNA	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:24676205G>T	ENST00000414816.1	-	0	277																											AAACGTGTTTGATTGAGGCCA	0.483																																																	0																																												0																															16.37:g.24676205G>T				RNA	SNP	-	NULL	ENST00000414816.1	37	NULL		16																																																																																			AC012317.1	-	-	ENSG00000224310		0.483	AC012317.1-001	KNOWN	basic	lincRNA	FLJ45256	Clone_based_vega_gene	lincRNA	OTTHUMT00000254547.2	-	0.00	34	0	G			24676205	-1	tier1	-	no_errors	ENST00000414816	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.000	T
FNIP2	57600	genome.wustl.edu	37	4	159789786	159789786	+	Silent	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:159789786C>A	ENST00000264433.6	+	13	2073	c.1998C>A	c.(1996-1998)ccC>ccA	p.P666P	FNIP2_ENST00000379346.3_Silent_p.P689P	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	666	Interaction with PRKAA1.				intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		CAAGACTTCCCAGCTGTGAAG	0.522																																																	0													32.0	37.0	35.0					4																	159789786		1940	4146	6086	SO:0001819	synonymous_variant	0			AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1998C>A	4.37:g.159789786C>A			Q05DC3|Q96I31|Q9H994	Silent	SNP	NULL	p.P689	ENST00000264433.6	37	c.2067	CCDS47155.1	4																																																																																			FNIP2	-	NULL	ENSG00000052795		0.522	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNIP2	HGNC	protein_coding	OTTHUMT00000366602.1	-	0.00	23	0	C	NM_020840		159789786	+1	tier1	-	no_errors	ENST00000379346	ensembl	human	known	74_37	silent	21.74	18	5	SNP	0.000	A
FSTL4	23105	genome.wustl.edu	37	5	132939673	132939673	+	Start_Codon_SNP	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:132939673A>C	ENST00000265342.7	-	2	251	c.2T>G	c.(1-3)aTg>aGg	p.M1R		NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	1						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCCTGGTTTCATTTTGATGAG	0.483																																																	0													49.0	55.0	53.0					5																	132939673		2203	4300	6503	SO:0001582	initiator_codon_variant	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.2T>G	5.37:g.132939673A>C	ENSP00000265342:p.Met1Arg		Q8TBU0|Q9UPU1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.M1R	ENST00000265342.7	37	c.2	CCDS34238.1	5	.	.	.	.	.	.	.	.	.	.	A	18.41	3.618683	0.66787	.	.	ENSG00000053108	ENST00000265342;ENST00000360575	T	0.59772	0.24	5.65	5.65	0.86999	.	0.101545	0.64402	D	0.000010	T	0.74566	0.3733	.	.	.	0.80722	D	1	D	0.61697	0.99	D	0.69142	0.962	T	0.78051	-0.2355	9	0.87932	D	0	-41.8131	12.5589	0.56269	1.0:0.0:0.0:0.0	.	1	Q6MZW2	FSTL4_HUMAN	R	1	ENSP00000265342:M1R	ENSP00000265342:M1R	M	-	2	0	FSTL4	132967572	1.000000	0.71417	0.994000	0.49952	0.938000	0.57974	4.954000	0.63631	2.279000	0.76181	0.533000	0.62120	ATG	FSTL4	-	NULL	ENSG00000053108		0.483	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1		0.00	18	0	A	XM_048786	Missense_Mutation	132939673	-1			no_errors	ENST00000265342	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	C
FUCA2	2519	genome.wustl.edu	37	6	143828412	143828412	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:143828412C>T	ENST00000002165.6	-	2	429	c.374G>A	c.(373-375)gGt>gAt	p.G125D	FUCA2_ENST00000438118.2_Missense_Mutation_p.G125D|RP1-20N2.6_ENST00000593045.1_RNA|RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|FUCA2_ENST00000367585.1_5'UTR|RP1-20N2.6_ENST00000589563.1_RNA	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	125					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		GTATTTGGCACCAGAGGCCTG	0.353																																																	0													75.0	82.0	79.0					6																	143828412		2203	4300	6503	SO:0001583	missense	0			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.374G>A	6.37:g.143828412C>T	ENSP00000002165:p.Gly125Asp		E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	p.G125D	ENST00000002165.6	37	c.374	CCDS5200.1	6	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000270	0.93227	.	.	ENSG00000001036	ENST00000002165;ENST00000438118;ENST00000367585	D;D;D	0.89196	-2.48;-2.48;-2.48	5.21	5.21	0.72293	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.97031	0.9030	H	0.98833	4.345	0.80722	D	1	D	0.69078	0.997	D	0.74023	0.982	D	0.98395	1.0565	10	0.87932	D	0	-17.8408	18.9402	0.92602	0.0:1.0:0.0:0.0	.	125	Q9BTY2	FUCO2_HUMAN	D	125	ENSP00000002165:G125D;ENSP00000394151:G125D;ENSP00000356557:G125D	ENSP00000002165:G125D	G	-	2	0	FUCA2	143870105	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.698000	0.92095	0.655000	0.94253	GGT	FUCA2	-	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub	ENSG00000001036		0.353	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUCA2	HGNC	protein_coding	OTTHUMT00000042521.2	-	0.00	45	0	C	NM_032020		143828412	-1	tier1	-	no_errors	ENST00000002165	ensembl	human	known	74_37	missense	20.29	54	14	SNP	1.000	T
GDF11	10220	genome.wustl.edu	37	12	56142696	56142696	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:56142696G>A	ENST00000257868.5	+	2	809	c.772G>A	c.(772-774)Gag>Aag	p.E258K		NM_005811.3	NP_005802.1	O95390	GDF11_HUMAN	growth differentiation factor 11	258					camera-type eye morphogenesis (GO:0048593)|cell maturation (GO:0048469)|growth (GO:0040007)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|palate development (GO:0060021)|pancreas development (GO:0031016)|skeletal system development (GO:0001501)|spinal cord anterior/posterior patterning (GO:0021512)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)|protein complex (GO:0043234)		p.E258K(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|urinary_tract(1)	12						CTGGGGCATCGAGATCAACGC	0.612																																																	1	Substitution - Missense(1)	large_intestine(1)											54.0	36.0	42.0					12																	56142696		2203	4300	6503	SO:0001583	missense	0			AF100907	CCDS8891.1	12q13.13	2008-08-01							4216	protein-coding gene	gene with protein product		603936				15988002	Standard	NM_005811		Approved	BMP-11	uc001shq.3	O95390		ENST00000257868.5:c.772G>A	12.37:g.56142696G>A	ENSP00000257868:p.Glu258Lys		Q9UID1|Q9UID2	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.E258K	ENST00000257868.5	37	c.772	CCDS8891.1	12	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898364	0.72639	.	.	ENSG00000135414	ENST00000257868	T	0.67171	-0.25	4.32	4.32	0.51571	Transforming growth factor-beta, N-terminal (1);	0.057035	0.64402	D	0.000002	T	0.64538	0.2607	M	0.72353	2.195	0.58432	D	0.999994	P	0.36412	0.552	B	0.34652	0.187	T	0.66674	-0.5864	10	0.34782	T	0.22	-16.3676	14.7037	0.69174	0.0:0.0:1.0:0.0	.	258	O95390	GDF11_HUMAN	K	258	ENSP00000257868:E258K	ENSP00000257868:E258K	E	+	1	0	GDF11	54428963	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.427000	0.82271	0.555000	0.69702	GAG	GDF11	-	pfam_TGF-b_N	ENSG00000135414		0.612	GDF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF11	HGNC	protein_coding	OTTHUMT00000407842.3		0.00	8	0	G			56142696	+1			no_errors	ENST00000257868	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	A
GGNBP2	79893	genome.wustl.edu	37	17	34937810	34937810	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:34937810G>T	ENST00000304718.4	+	9	1373	c.1057G>T	c.(1057-1059)Gaa>Taa	p.E353*		NM_024835.3	NP_079111.1	Q9H3C7	GGNB2_HUMAN	gametogenetin binding protein 2	353					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)		p.E353*(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)	38		Breast(25;0.00957)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		TAGCAGATTGGAACAACTTTG	0.348																																																	1	Substitution - Nonsense(1)	lung(1)											102.0	102.0	102.0					17																	34937810		2203	4300	6503	SO:0001587	stop_gained	0			AF126964	CCDS11314.1	17q21.1	2014-05-06	2007-08-20	2007-08-20	ENSG00000005955	ENSG00000278311			19357	protein-coding gene	gene with protein product		612275	"""zinc finger protein 403"""	ZNF403		11728448	Standard	NM_024835		Approved	ZFP403, LZK1, FLJ22561, FLJ21230, DIF-3, DIF3	uc002hnb.3	Q9H3C7	OTTHUMG00000188440	ENST00000304718.4:c.1057G>T	17.37:g.34937810G>T	ENSP00000307617:p.Glu353*		B2RPK7|Q96T90|Q9GZR8|Q9H767	Nonsense_Mutation	SNP	NULL	p.E353*	ENST00000304718.4	37	c.1057	CCDS11314.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.627126	0.97718	.	.	ENSG00000005955	ENST00000304718	.	.	.	5.48	5.48	0.80851	.	0.052711	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.9157	19.343	0.94352	0.0:0.0:1.0:0.0	.	.	.	.	X	353	.	ENSP00000307617:E353X	E	+	1	0	GGNBP2	32011923	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	8.953000	0.93041	2.572000	0.86782	0.491000	0.48974	GAA	GGNBP2	-	NULL	ENSG00000005955		0.348	GGNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGNBP2	HGNC	protein_coding	OTTHUMT00000256684.2		0.00	25	0	G	NM_024835		34937810	+1			no_errors	ENST00000304718	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	T
GLB1L3	112937	genome.wustl.edu	37	11	134179627	134179627	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:134179627G>A	ENST00000431683.2	+	11	1069	c.1069G>A	c.(1069-1071)Ggg>Agg	p.G357R		NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	357					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		CACATATTTCGGGAAGCACTC	0.498																																																	0													73.0	71.0	71.0					11																	134179627		1930	4127	6057	SO:0001583	missense	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.1069G>A	11.37:g.134179627G>A	ENSP00000396615:p.Gly357Arg		A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.G357R	ENST00000431683.2	37	c.1069	CCDS44780.1	11	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911095	0.33721	.	.	ENSG00000166105	ENST00000431683	D	0.98012	-4.66	4.76	-2.59	0.06209	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	1.446850	0.04441	N	0.370879	D	0.96947	0.9003	M	0.81614	2.55	0.09310	N	1	D;P	0.57899	0.981;0.931	P;P	0.51999	0.687;0.625	D	0.89632	0.3856	10	0.21014	T	0.42	.	1.0476	0.01573	0.2694:0.2803:0.3073:0.143	.	18;357	Q8NCI6-2;Q8NCI6	.;GLBL3_HUMAN	R	357	ENSP00000396615:G357R	ENSP00000396615:G357R	G	+	1	0	GLB1L3	133684837	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.123000	0.15708	-0.581000	0.05937	0.455000	0.32223	GGG	GLB1L3	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF	ENSG00000166105		0.498	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	-	0.00	23	0	G	NM_138416		134179627	+1	tier1	-	no_errors	ENST00000431683	ensembl	human	known	74_37	missense	24.14	22	7	SNP	0.000	A
GOLGA2	2801	genome.wustl.edu	37	9	131020815	131020815	+	Missense_Mutation	SNP	C	C	A	rs572632320|rs62587120		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:131020815C>A	ENST00000421699.2	-	21	2139	c.2127G>T	c.(2125-2127)gaG>gaT	p.E709D	GOLGA2_ENST00000609374.1_Missense_Mutation_p.E697D|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	709	Poly-Glu.			Missing (in Ref. 5; AAP35912). {ECO:0000305}.	mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)		p.E697D(1)		NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						cctcctcctcctcatcctcct	0.652																																																	1	Substitution - Missense(1)	pancreas(1)											39.0	34.0	36.0					9																	131020815		2203	4300	6503	SO:0001583	missense	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.2127G>T	9.37:g.131020815C>A	ENSP00000416097:p.Glu709Asp		Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	superfamily_CofA_tubulin-bd	p.E709D	ENST00000421699.2	37	c.2127	CCDS6896.2	9	.	.	.	.	.	.	.	.	.	.	c	3.870	-0.028197	0.07589	.	.	ENSG00000167110	ENST00000421699	D	0.90261	-2.64	.	.	.	.	0.646342	0.13374	U	0.392645	T	0.78013	0.4217	N	0.04508	-0.205	0.09310	N	1	P	0.51933	0.949	P	0.52957	0.714	T	0.73023	-0.4113	8	0.06757	T	0.87	.	.	.	.	rs62587120	709	Q08379	GOGA2_HUMAN	D	709	ENSP00000416097:E709D	ENSP00000416097:E709D	E	-	3	2	GOLGA2	130060636	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-1.406000	0.02490	-1.111000	0.02988	-1.166000	0.01754	GAG	GOLGA2	-	NULL	ENSG00000167110		0.652	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2		0.00	40	0	C	NM_004486		131020815	-1			no_errors	ENST00000421699	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.001	A
GOLGA3	2802	genome.wustl.edu	37	12	133351871	133351871	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:133351871C>G	ENST00000450791.2	-	21	4182	c.3999G>C	c.(3997-3999)gaG>gaC	p.E1333D	GOLGA3_ENST00000456883.2_Missense_Mutation_p.E1333D|GOLGA3_ENST00000204726.3_Missense_Mutation_p.E1333D			Q08378	GOGA3_HUMAN	golgin A3	1333	Gln-rich.				intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CCTGGGCCATCTCCAACTCAG	0.438																																																	0													92.0	84.0	86.0					12																	133351871		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3999G>C	12.37:g.133351871C>G	ENSP00000410378:p.Glu1333Asp		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E1333D	ENST00000450791.2	37	c.3999	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	9.010	0.982179	0.18889	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.80653	-1.4;-1.4;1.62	6.07	2.95	0.34219	.	0.044343	0.85682	D	0.000000	T	0.68366	0.2993	L	0.31664	0.95	0.80722	D	1	B;B	0.25169	0.096;0.119	B;B	0.30179	0.083;0.112	T	0.62077	-0.6930	10	0.41790	T	0.15	.	6.9849	0.24723	0.1235:0.6018:0.0:0.2747	.	1333;1333	Q08378-2;Q08378	.;GOGA3_HUMAN	D	1333	ENSP00000204726:E1333D;ENSP00000410378:E1333D;ENSP00000409303:E1333D	ENSP00000204726:E1333D	E	-	3	2	GOLGA3	131861944	0.000000	0.05858	0.734000	0.30879	0.489000	0.33432	-0.174000	0.09839	0.873000	0.35799	0.655000	0.94253	GAG	GOLGA3	-	NULL	ENSG00000090615		0.438	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	59	0	C	NM_005895		133351871	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.167	G
GPS1	2873	genome.wustl.edu	37	17	80011221	80011221	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:80011221C>T	ENST00000306823.6	+	2	128	c.105C>T	c.(103-105)taC>taT	p.Y35Y	RFNG_ENST00000310496.4_5'Flank|RFNG_ENST00000584838.1_5'Flank|GPS1_ENST00000355130.2_Silent_p.Y75Y|GPS1_ENST00000392358.2_Silent_p.Y75Y|RFNG_ENST00000429557.3_5'Flank|GPS1_ENST00000320548.4_Silent_p.Y19Y|GPS1_ENST00000578552.1_Silent_p.Y35Y			Q13098	CSN1_HUMAN	G protein pathway suppressor 1	35					cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			ACGTCAACTACGTGGTGGAGA	0.662																																																	0													83.0	75.0	77.0					17																	80011221		2201	4300	6501	SO:0001819	synonymous_variant	0				CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.105C>T	17.37:g.80011221C>T			Q8NA10|Q9BWL1	Missense_Mutation	SNP	NULL	p.T42M	ENST00000306823.6	37	c.125	CCDS32774.1	17																																																																																			GPS1	-	NULL	ENSG00000169727		0.662	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPS1	HGNC	protein_coding	OTTHUMT00000442176.1	-	0.00	26	0	C	NM_212492		80011221	+1	tier1	-	no_errors	ENST00000580627	ensembl	human	known	74_37	missense	21.05	30	8	SNP	0.982	T
GRID1	2894	genome.wustl.edu	37	10	87379698	87379698	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:87379698G>A	ENST00000327946.7	-	14	2371	c.2286C>T	c.(2284-2286)ggC>ggT	p.G762G	GRID1_ENST00000536331.1_Silent_p.G333G	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	762					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						TGATGCTGTTGCCGATGACAG	0.582										Multiple Myeloma(13;0.14)																																							0													131.0	96.0	108.0					10																	87379698		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2286C>T	10.37:g.87379698G>A			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G762	ENST00000327946.7	37	c.2286	CCDS31236.1	10																																																																																			GRID1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.582	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	48	0	G	XM_043613		87379698	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	silent	16.18	57	11	SNP	0.998	A
GSTA5	221357	genome.wustl.edu	37	6	52697688	52697688	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:52697688G>A	ENST00000370989.2	-	5	544	c.515C>T	c.(514-516)tCg>tTg	p.S172L	GSTA5_ENST00000284562.2_Missense_Mutation_p.S172L|GSTA5_ENST00000475052.1_5'UTR			Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	172	GST C-terminal.				glutathione metabolic process (GO:0006749)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	glutathione transferase activity (GO:0004364)			endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Lung NSC(77;0.0912)				Glutathione(DB00143)	GATAAGACTCGAGTCAAGCTC	0.507																																																	0													137.0	124.0	128.0					6																	52697688		2203	4300	6503	SO:0001583	missense	0			BK000212	CCDS4946.1	6p12.2	2012-06-21	2008-11-26		ENSG00000182793	ENSG00000182793	2.5.1.18	"""Glutathione S-transferases / Soluble"""	19662	protein-coding gene	gene with protein product		607605	"""glutathione S-transferase A5"""			12042665	Standard	NM_153699		Approved		uc003pba.1	Q7RTV2	OTTHUMG00000014857	ENST00000370989.2:c.515C>T	6.37:g.52697688G>A	ENSP00000360028:p.Ser172Leu		Q5SZC2	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_alpha	p.S172L	ENST00000370989.2	37	c.515	CCDS4946.1	6	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947737	0.34377	.	.	ENSG00000182793	ENST00000370989;ENST00000284562	T;T	0.01821	4.62;4.62	2.66	2.66	0.31614	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.785407	0.11562	N	0.551667	T	0.00695	0.0023	L	0.33245	0.995	0.09310	N	1	P	0.34699	0.464	B	0.30316	0.114	T	0.48692	-0.9013	10	0.72032	D	0.01	.	9.7541	0.40494	0.0:0.2127:0.7873:0.0	.	172	Q7RTV2	GSTA5_HUMAN	L	172	ENSP00000360028:S172L;ENSP00000284562:S172L	ENSP00000284562:S172L	S	-	2	0	GSTA5	52805647	0.882000	0.30256	0.071000	0.20095	0.284000	0.27059	6.034000	0.70933	1.489000	0.48450	0.306000	0.20318	TCG	GSTA5	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000182793		0.507	GSTA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTA5	HGNC	protein_coding	OTTHUMT00000040917.1	-	0.00	70	0	G	NM_153699		52697688	-1	tier1	-	no_errors	ENST00000284562	ensembl	human	known	74_37	missense	52.63	36	40	SNP	0.004	A
GUCA2B	2981	genome.wustl.edu	37	1	42620500	42620500	+	Silent	SNP	C	C	T	rs144117245		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:42620500C>T	ENST00000372581.1	+	2	270	c.240C>T	c.(238-240)tgC>tgT	p.C80C		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	80					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AGCCTGTCTGCGCCTCGCAGG	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		19178	0.001		0.0	False		,,,				2504	0.0																0								C		1,4405	2.1+/-5.4	0,1,2202	53.0	52.0	52.0		240	-2.2	0.0	1	dbSNP_134	52	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	GUCA2B	NM_007102.2		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		80/113	42620500	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.240C>T	1.37:g.42620500C>T			Q52LV0	Silent	SNP	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	p.C80	ENST00000372581.1	37	c.240	CCDS464.1	1																																																																																			GUCA2B	-	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	ENSG00000044012		0.682	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA2B	HGNC	protein_coding	OTTHUMT00000018307.1	-	0.00	11	0	C	NM_007102		42620500	+1	tier1	rs144117245	no_errors	ENST00000372581	ensembl	human	known	74_37	silent	28.57	15	6	SNP	0.011	T
GUF1	60558	genome.wustl.edu	37	4	44691414	44691414	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:44691414G>A	ENST00000281543.5	+	10	1384	c.1190G>A	c.(1189-1191)gGt>gAt	p.G397D	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						CTTGCTCTGGGTGCTGGCTGG	0.368																																																	0													128.0	132.0	131.0					4																	44691414		2203	4300	6503	SO:0001583	missense	0				CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1190G>A	4.37:g.44691414G>A	ENSP00000281543:p.Gly397Asp			Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_LepA_GTP-bd_C,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,pfam_Small_GTPase,superfamily_P-loop_NTPase,superfamily_EFG_III-V,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom,tigrfam_EF-4,tigrfam_Small_GTP-bd_dom	p.G397D	ENST00000281543.5	37	c.1190	CCDS3468.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.146781	0.94603	.	.	ENSG00000151806	ENST00000281543	T	0.73258	-0.73	5.72	5.72	0.89469	Elongation factor G/III/V (1);	0.000000	0.85682	D	0.000000	D	0.89781	0.6814	H	0.96048	3.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92507	0.6013	10	0.87932	D	0	-19.0096	18.875	0.92331	0.0:0.0:1.0:0.0	.	397	Q8N442	GUF1_HUMAN	D	397	ENSP00000281543:G397D	ENSP00000281543:G397D	G	+	2	0	GUF1	44386171	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	9.461000	0.97646	2.689000	0.91719	0.650000	0.86243	GGT	GUF1	-	superfamily_EFG_III-V,tigrfam_EF-4	ENSG00000151806		0.368	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUF1	HGNC	protein_coding	OTTHUMT00000250469.3		0.00	45	0	G	NM_021927		44691414	+1			no_errors	ENST00000281543	ensembl	human	known	74_37	missense	6.98	40	3	SNP	1.000	A
HCN1	348980	genome.wustl.edu	37	5	45262430	45262430	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:45262430G>A	ENST00000303230.4	-	8	2323	c.2266C>T	c.(2266-2268)Cag>Tag	p.Q756*		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	756	Gln-rich.				apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.Q756*(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CCAGGTGTCTGTGGCTGCGGG	0.642																																																	1	Substitution - Nonsense(1)	prostate(1)											55.0	56.0	56.0					5																	45262430		2203	4300	6503	SO:0001587	stop_gained	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2266C>T	5.37:g.45262430G>A	ENSP00000307342:p.Gln756*			Nonsense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.Q756*	ENST00000303230.4	37	c.2266	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	G	18.70	3.680081	0.68042	.	.	ENSG00000164588	ENST00000303230	.	.	.	4.4	3.51	0.40186	.	0.000000	0.46758	D	0.000273	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	10.3936	0.44188	0.0:0.1986:0.8014:0.0	.	.	.	.	X	756	.	ENSP00000307342:Q756X	Q	-	1	0	HCN1	45298187	1.000000	0.71417	0.898000	0.35279	0.360000	0.29518	6.319000	0.72871	1.180000	0.42898	0.655000	0.94253	CAG	HCN1	-	NULL	ENSG00000164588		0.642	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	-	0.00	45	0	G	NM_021072		45262430	-1	tier1	-	no_errors	ENST00000303230	ensembl	human	known	74_37	nonsense	17.78	37	8	SNP	0.991	A
HELB	92797	genome.wustl.edu	37	12	66717794	66717794	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:66717794G>T	ENST00000247815.4	+	10	2388	c.2329G>T	c.(2329-2331)Ggt>Tgt	p.G777C		NM_033647.3	NP_387467.2	Q8NG08	HELB_HUMAN	helicase (DNA) B	777					DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication, synthesis of RNA primer (GO:0006269)		ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|single-stranded DNA-dependent ATP-dependent DNA helicase activity (GO:0017116)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	40			GBM - Glioblastoma multiforme(2;0.000142)	GBM - Glioblastoma multiforme(28;0.0265)		TTTTGGAATTGGTGATAAAAT	0.348																																																	0													141.0	155.0	150.0					12																	66717794		2203	4300	6503	SO:0001583	missense	0			AF319995	CCDS8976.1	12q14.2	2009-01-15			ENSG00000127311	ENSG00000127311			17196	protein-coding gene	gene with protein product		614539				12181327	Standard	NM_033647		Approved		uc001sti.3	Q8NG08	OTTHUMG00000169006	ENST00000247815.4:c.2329G>T	12.37:g.66717794G>T	ENSP00000247815:p.Gly777Cys		A8K4C9|Q4G0T2|Q9H7L5	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.G777C	ENST00000247815.4	37	c.2329	CCDS8976.1	12	.	.	.	.	.	.	.	.	.	.	G	14.20	2.464679	0.43736	.	.	ENSG00000127311	ENST00000247815	T	0.14516	2.5	5.2	5.2	0.72013	.	0.435239	0.23836	N	0.044093	T	0.47619	0.1455	H	0.94771	3.58	0.30865	N	0.733107	D	0.89917	1.0	D	0.83275	0.996	T	0.63211	-0.6688	9	.	.	.	-14.4828	12.1616	0.54107	0.0799:0.0:0.9201:0.0	.	777	Q8NG08	HELB_HUMAN	C	777	ENSP00000247815:G777C	.	G	+	1	0	HELB	65004061	0.981000	0.34729	0.976000	0.42696	0.202000	0.24057	3.483000	0.53194	2.567000	0.86603	0.655000	0.94253	GGT	HELB	-	superfamily_P-loop_NTPase	ENSG00000127311		0.348	HELB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELB	HGNC	protein_coding	OTTHUMT00000401919.1	-	0.00	37	0	G			66717794	+1	tier1	-	no_errors	ENST00000247815	ensembl	human	known	74_37	missense	13.43	58	9	SNP	0.508	T
HECTD4	283450	genome.wustl.edu	37	12	112654172	112654172	+	Silent	SNP	G	G	A	rs372763829		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:112654172G>A	ENST00000430131.2	-	47	7268	c.6123C>T	c.(6121-6123)aaC>aaT	p.N2041N	HECTD4_ENST00000550722.1_Silent_p.N2317N|HECTD4_ENST00000377560.5_Silent_p.N2291N			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2041					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CGGCTCGGCCGTTGCTATGAA	0.517																																																	0								G		0,3706		0,0,1853	19.0	20.0	20.0		6873	-2.8	1.0	12		20	1,8079		0,1,4039	no	coding-synonymous	C12orf51	NM_001109662.2		0,1,5892	AA,AG,GG		0.0124,0.0,0.0085		2291/4247	112654172	1,11785	1853	4040	5893	SO:0001819	synonymous_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.6123C>T	12.37:g.112654172G>A			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.N2291	ENST00000430131.2	37	c.6873		12	.	.	.	.	.	.	.	.	.	.	G	0.160	-1.082255	0.01888	0.0	1.24E-4	ENSG00000173064	ENST00000550968	.	.	.	5.65	-2.84	0.05751	.	.	.	.	.	T	0.62356	0.2421	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59010	-0.7534	4	.	.	.	.	12.6568	0.56791	0.6265:0.0:0.3735:0.0	.	.	.	.	M	208	.	.	T	-	2	0	C12orf51	111138555	0.999000	0.42202	0.965000	0.40720	0.003000	0.03518	0.914000	0.28624	-0.754000	0.04715	-2.173000	0.00322	ACG	HECTD4	-	superfamily_ConA-like_lec_gl_sf	ENSG00000173064		0.517	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	16	0	G	NM_173813		112654172	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	25.00	18	6	SNP	0.991	A
HERC2	8924	genome.wustl.edu	37	15	28361836	28361836	+	Silent	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:28361836C>A	ENST00000261609.7	-	88	13692	c.13584G>T	c.(13582-13584)gtG>gtT	p.V4528V		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TGCTGCTGTGCACGGGTGCTC	0.602																																																	0													84.0	79.0	81.0					15																	28361836		2203	4300	6503	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13584G>T	15.37:g.28361836C>A				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.V4528	ENST00000261609.7	37	c.13584	CCDS10021.1	15																																																																																			HERC2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000128731		0.602	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	32	0	C	NM_004667		28361836	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	silent	18.18	36	8	SNP	1.000	A
HUNK	30811	genome.wustl.edu	37	21	33340686	33340686	+	Silent	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr21:33340686C>G	ENST00000270112.2	+	6	1359	c.999C>G	c.(997-999)acC>acG	p.T333T		NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	333					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						GTAATGTCACCTATCCCAACA	0.542																																																	0													88.0	83.0	84.0					21																	33340686		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.999C>G	21.37:g.33340686C>G				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T333	ENST00000270112.2	37	c.999	CCDS13610.1	21																																																																																			HUNK	-	superfamily_Kinase-like_dom	ENSG00000142149		0.542	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUNK	HGNC	protein_coding	OTTHUMT00000192782.1	-	0.00	36	0	C	NM_014586		33340686	+1	tier1	-	no_errors	ENST00000270112	ensembl	human	known	74_37	silent	20.00	36	9	SNP	1.000	G
IL12B	3593	genome.wustl.edu	37	5	158749446	158749446	+	Silent	SNP	C	C	T	rs569226644		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:158749446C>T	ENST00000231228.2	-	4	893	c.438G>A	c.(436-438)acG>acA	p.T146T		NM_002187.2	NP_002178.2	P29460	IL12B_HUMAN	interleukin 12B	146					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|interferon-gamma biosynthetic process (GO:0042095)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of cell adhesion (GO:0045785)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tissue remodeling (GO:0034105)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to UV-B (GO:0010224)|sensory perception of pain (GO:0019233)|sexual reproduction (GO:0019953)|T-helper 1 type immune response (GO:0042088)|T-helper cell differentiation (GO:0042093)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)|interleukin-23 complex (GO:0070743)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)|identical protein binding (GO:0042802)|interleukin-12 alpha subunit binding (GO:0042164)|interleukin-12 receptor binding (GO:0005143)|protein heterodimerization activity (GO:0046982)			cervix(1)|endometrium(1)|large_intestine(5)|lung(4)	11	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TACTGATTGTCGTCAGCCACC	0.383													C|||	1	0.000199681	0.0	0.0	5008	,	,		19944	0.0		0.0	False		,,,				2504	0.001																0													88.0	87.0	88.0					5																	158749446		2203	4300	6503	SO:0001819	synonymous_variant	0			M65290	CCDS4346.1	5q31.1-q33.1	2014-09-17	2014-04-04		ENSG00000113302	ENSG00000113302		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5970	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor-2"", ""cytotoxic lymphocyte maturation factor 2, p40"", ""interleukin 12, p40"", ""natural killer cell stimulatory factor, 40 kD subunit"", ""interleukin-12 beta chain"", ""IL12, subunit p40"""	161561	"""interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40)"""	NKSF2		1673147	Standard	NM_002187		Approved	CLMF, IL-12B, NKSF, CLMF2	uc003lxr.1	P29460	OTTHUMG00000130307	ENST00000231228.2:c.438G>A	5.37:g.158749446C>T				Silent	SNP	pirsf_IL-12_beta,pfam_IL-12_beta_cen-dom,superfamily_Fibronectin_type3,smart_Ig_sub2,prints_IL-12_beta,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T146	ENST00000231228.2	37	c.438	CCDS4346.1	5																																																																																			IL12B	-	pirsf_IL-12_beta,pfam_IL-12_beta_cen-dom,superfamily_Fibronectin_type3	ENSG00000113302		0.383	IL12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12B	HGNC	protein_coding	OTTHUMT00000252652.2	-	0.00	28	0	C	NM_002187		158749446	-1	tier1	-	no_errors	ENST00000231228	ensembl	human	known	74_37	silent	13.04	40	6	SNP	0.000	T
IL23R	149233	genome.wustl.edu	37	1	67724329	67724329	+	Missense_Mutation	SNP	G	G	A	rs375054504		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:67724329G>A	ENST00000347310.5	+	11	1579	c.1408G>A	c.(1408-1410)Gac>Aac	p.D470N	IL23R_ENST00000371002.1_3'UTR|IL23R_ENST00000473881.1_3'UTR|IL23R_ENST00000395227.1_Missense_Mutation_p.D215N	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	470					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						CTCGCTATTCGACAATACTAC	0.403																																																	0								G	ASN/ASP	0,4406		0,0,2203	94.0	96.0	95.0		1408	-2.3	0.0	1		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	IL23R	NM_144701.2	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	470/630	67724329	1,13005	2203	4300	6503	SO:0001583	missense	0			AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.1408G>A	1.37:g.67724329G>A	ENSP00000321345:p.Asp470Asn		C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.D470N	ENST00000347310.5	37	c.1408	CCDS637.1	1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.990228	0.35131	0.0	1.16E-4	ENSG00000162594	ENST00000347310;ENST00000395227	T;T	0.32023	1.47;1.56	5.71	-2.35	0.06684	.	1.035130	0.07574	N	0.919031	T	0.07098	0.0180	N	0.22421	0.69	0.09310	N	1	B;B;B;B;B	0.33904	0.29;0.431;0.431;0.431;0.335	B;B;B;B;B	0.24541	0.037;0.054;0.037;0.054;0.039	T	0.21314	-1.0249	10	0.44086	T	0.13	-25.4573	12.5328	0.56126	0.2184:0.0:0.7816:0.0	.	216;105;68;215;470	Q5VWK5-2;Q5VWK5-5;Q5VWK5-7;Q5VWK5-6;Q5VWK5	.;.;.;.;IL23R_HUMAN	N	470;215	ENSP00000321345:D470N;ENSP00000378652:D215N	ENSP00000321345:D470N	D	+	1	0	IL23R	67496917	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.073000	0.11468	-0.361000	0.08125	0.650000	0.86243	GAC	IL23R	-	NULL	ENSG00000162594		0.403	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL23R	HGNC	protein_coding	OTTHUMT00000025199.2	-	0.00	34	0	G	NM_144701		67724329	+1	tier1	-	no_errors	ENST00000347310	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.000	A
ILDR1	286676	genome.wustl.edu	37	3	121713102	121713102	+	Silent	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:121713102T>C	ENST00000344209.5	-	6	831	c.705A>G	c.(703-705)ggA>ggG	p.G235G	ILDR1_ENST00000462014.1_Intron|ILDR1_ENST00000460554.1_5'UTR|ILDR1_ENST00000393631.1_Silent_p.G146G|ILDR1_ENST00000273691.3_Intron	NM_001199799.1	NP_001186728.1	Q86SU0	ILDR1_HUMAN	immunoglobulin-like domain containing receptor 1	235					positive regulation of peptide hormone secretion (GO:0090277)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-density lipoprotein particle receptor activity (GO:0070506)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(114;0.156)		ACAGGGGTTTTCCCATCATCT	0.592																																																	0																																										SO:0001819	synonymous_variant	0			BC044240	CCDS3008.1, CCDS56270.1, CCDS56271.1	3q21.1	2013-10-11			ENSG00000145103	ENSG00000145103			28741	protein-coding gene	gene with protein product		609739	"""deafness, autosomal recessive 42"""	DFNB42		15641023, 21255762	Standard	NM_175924		Approved	MGC50831	uc003ees.3	Q86SU0	OTTHUMG00000159481	ENST00000344209.5:c.705A>G	3.37:g.121713102T>C			Q6ZP61|Q7Z578	Silent	SNP	pfam_LISCH7,smart_Ig_sub	p.G235	ENST00000344209.5	37	c.705	CCDS56271.1	3																																																																																			ILDR1	-	NULL	ENSG00000145103		0.592	ILDR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ILDR1	HGNC	protein_coding	OTTHUMT00000355666.1	-	0.00	42	0	T	NM_175924		121713102	-1	tier1	-	no_errors	ENST00000344209	ensembl	human	known	74_37	silent	29.41	48	20	SNP	0.999	C
ISLR	3671	genome.wustl.edu	37	15	74468116	74468116	+	Missense_Mutation	SNP	C	C	A	rs267604313		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:74468116C>A	ENST00000249842.3	+	2	1274	c.917C>A	c.(916-918)gCc>gAc	p.A306D	ISLR_ENST00000395118.1_Missense_Mutation_p.A306D|RP11-665J16.1_ENST00000561647.1_RNA	NM_005545.3	NP_005536.1	O14498	ISLR_HUMAN	immunoglobulin superfamily containing leucine-rich repeat	306	Ig-like.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	20						CGCTTCCAGGCCTTTGCCAAT	0.632																																																	0													46.0	49.0	48.0					15																	74468116		2198	4296	6494	SO:0001583	missense	0			AB003184	CCDS10260.1	15q23-q24	2013-01-11			ENSG00000129009	ENSG00000129009		"""Immunoglobulin superfamily / I-set domain containing"""	6133	protein-coding gene	gene with protein product		602059				9325048	Standard	NM_005545		Approved	HsT17563	uc002axh.1	O14498	OTTHUMG00000137623	ENST00000249842.3:c.917C>A	15.37:g.74468116C>A	ENSP00000249842:p.Ala306Asp			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub2,pfscan_Ig-like_dom	p.A306D	ENST00000249842.3	37	c.917	CCDS10260.1	15	.	.	.	.	.	.	.	.	.	.	C	14.60	2.583303	0.46006	.	.	ENSG00000129009	ENST00000249842;ENST00000395118	T;T	0.68181	-0.31;-0.31	4.37	4.37	0.52481	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.161688	0.28349	U	0.015670	T	0.73418	0.3584	L	0.55990	1.75	0.34576	D	0.713912	D	0.76494	0.999	D	0.71184	0.972	T	0.78585	-0.2147	10	0.41790	T	0.15	.	7.8948	0.29699	0.0:0.759:0.0:0.241	.	306	O14498	ISLR_HUMAN	D	306	ENSP00000249842:A306D;ENSP00000378550:A306D	ENSP00000249842:A306D	A	+	2	0	ISLR	72255169	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	2.597000	0.46214	1.987000	0.57996	0.313000	0.20887	GCC	ISLR	-	pfam_Ig_I-set,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000129009		0.632	ISLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISLR	HGNC	protein_coding	OTTHUMT00000269044.1		0.00	30	0	C	NM_005545		74468116	+1			no_errors	ENST00000249842	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
JDP2	122953	genome.wustl.edu	37	14	75904609	75904609	+	5'UTR	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr14:75904609G>T	ENST00000435893.2	+	0	259				JDP2_ENST00000267569.5_Missense_Mutation_p.A7S|JDP2_ENST00000419727.2_5'UTR|JDP2_ENST00000437176.1_5'UTR|JDP2_ENST00000559773.1_3'UTR	NM_001135047.1|NM_130469.3	NP_001128519.1|NP_569736.1	Q8WYK2	JDP2_HUMAN	Jun dimerization protein 2						negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone deacetylation (GO:0031065)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.0296)	Pseudoephedrine(DB00852)	AGGCTGGCCTGCCACTCCTCC	0.662																																																	0													21.0	26.0	24.0					14																	75904609		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AF111167	CCDS9842.1, CCDS45139.1	14q24.2	2013-01-10		2008-04-10				"""basic leucine zipper proteins"""	17546	protein-coding gene	gene with protein product	"""progesterone receptor co-activator"""	608657				12052888, 9154808, 17545590	Standard	NM_130469		Approved	JUNDM2	uc001xrq.3	Q8WYK2		ENST00000435893.2:c.-15G>T	14.37:g.75904609G>T			J3KN58|O95430|Q9UIE4	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.A7S	ENST00000435893.2	37	c.19	CCDS9842.1	14	.	.	.	.	.	.	.	.	.	.	G	12.91	2.080358	0.36662	.	.	ENSG00000140044	ENST00000267569	T	0.57595	0.39	5.46	2.49	0.30216	.	.	.	.	.	T	0.38665	0.1049	.	.	.	0.22330	N	0.999195	.	.	.	.	.	.	T	0.24297	-1.0164	6	0.22706	T	0.39	.	6.3828	0.21544	0.1521:0.0:0.7017:0.1462	.	.	.	.	S	7	ENSP00000267569:A7S	ENSP00000267569:A7S	A	+	1	0	JDP2	74974362	0.870000	0.30015	0.714000	0.30535	0.779000	0.44077	3.085000	0.50151	0.691000	0.31592	-0.291000	0.09656	GCC	JDP2	-	NULL	ENSG00000140044		0.662	JDP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JDP2	HGNC	protein_coding	OTTHUMT00000415505.1	-	0.00	44	0	G	NM_130469		75904609	+1	tier1	-	no_errors	ENST00000267569	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.015	T
KCNAB1	7881	genome.wustl.edu	37	3	156254522	156254522	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:156254522G>C	ENST00000490337.1	+	14	1310	c.1246G>C	c.(1246-1248)Gac>Cac	p.D416H	KCNAB1_ENST00000302490.8_Missense_Mutation_p.D398H|KCNAB1_ENST00000471742.1_Missense_Mutation_p.D405H|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000389634.5_Missense_Mutation_p.D369H|KCNAB1_ENST00000389636.5_Missense_Mutation_p.D387H	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1	416					learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CAGCAAGAAGGACTATAGATC	0.433																																																	0													148.0	129.0	135.0					3																	156254522		2203	4300	6503	SO:0001583	missense	0			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.1246G>C	3.37:g.156254522G>C	ENSP00000419952:p.Asp416His		A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.D416H	ENST00000490337.1	37	c.1246	CCDS3174.1	3	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828254	0.90955	.	.	ENSG00000169282	ENST00000490337;ENST00000389636;ENST00000471742;ENST00000302490;ENST00000389634	T;T;T;T;T	0.11385	3.0;2.78;3.02;3.07;2.8	5.6	5.6	0.85130	.	0.043325	0.85682	D	0.000000	T	0.30039	0.0752	L	0.51422	1.61	0.80722	D	1	D;D;D;D;D	0.76494	0.996;0.996;0.993;0.999;0.998	D;D;P;D;D	0.71656	0.916;0.955;0.903;0.974;0.942	T	0.00549	-1.1676	10	0.87932	D	0	-12.1993	19.6045	0.95575	0.0:0.0:1.0:0.0	.	387;369;398;405;416	B7Z8E5;F8W6W4;B3KPZ4;Q14722-3;Q14722	.;.;.;.;KCAB1_HUMAN	H	416;387;405;398;369	ENSP00000419952:D416H;ENSP00000374287:D387H;ENSP00000418956:D405H;ENSP00000305858:D398H;ENSP00000374285:D369H	ENSP00000305858:D398H	D	+	1	0	KCNAB1	157737216	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.294000	0.96088	2.623000	0.88846	0.585000	0.79938	GAC	KCNAB1	-	NULL	ENSG00000169282		0.433	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	-	0.00	64	0	G	NM_003471		156254522	+1	tier1	-	no_errors	ENST00000490337	ensembl	human	known	74_37	missense	9.45	115	12	SNP	1.000	C
KCNG1	3755	genome.wustl.edu	37	20	49626850	49626850	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:49626850G>T	ENST00000371571.4	-	2	311	c.26C>A	c.(25-27)tCt>tAt	p.S9Y	KCNG1_ENST00000506387.1_5'Flank|RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000396017.3_Missense_Mutation_p.S9Y	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	9					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GTCGTAGTCAGAATTGTCTCC	0.637																																																	0													39.0	42.0	41.0					20																	49626850		2124	4121	6245	SO:0001583	missense	0			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.26C>A	20.37:g.49626850G>T	ENSP00000360626:p.Ser9Tyr		A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.S9Y	ENST00000371571.4	37	c.26	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717924	0.89205	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216;ENST00000424171;ENST00000433903;ENST00000447736	D;D;D;D	0.98178	-4.77;-2.88;-3.45;-3.82	5.73	5.73	0.89815	.	0.239516	0.44483	D	0.000457	D	0.98817	0.9601	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.87578	0.998;0.687	D	0.99191	1.0870	9	.	.	.	.	19.9786	0.97317	0.0:0.0:1.0:0.0	.	9;9	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	Y	9	ENSP00000360626:S9Y;ENSP00000379338:S9Y;ENSP00000394075:S9Y;ENSP00000394093:S9Y	.	S	-	2	0	KCNG1	49060257	1.000000	0.71417	0.691000	0.30163	0.970000	0.65996	9.476000	0.97823	2.720000	0.93068	0.555000	0.69702	TCT	KCNG1	-	NULL	ENSG00000026559		0.637	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	-	0.00	43	0	G	NM_002237		49626850	-1	tier1	-	no_errors	ENST00000371571	ensembl	human	known	74_37	missense	7.25	64	5	SNP	1.000	T
KCNQ2	3785	genome.wustl.edu	37	20	62038650	62038650	+	Missense_Mutation	SNP	C	C	G	rs545544936	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:62038650C>G	ENST00000359125.2	-	17	2140	c.1966G>C	c.(1966-1968)Gag>Cag	p.E656Q	KCNQ2_ENST00000359689.1_Missense_Mutation_p.E656Q|KCNQ2_ENST00000354587.3_Missense_Mutation_p.E664Q|KCNQ2_ENST00000360480.3_Missense_Mutation_p.E628Q|KCNQ2_ENST00000357249.2_Missense_Mutation_p.E638Q|KCNQ2_ENST00000370224.1_Missense_Mutation_p.E664Q|KCNQ2_ENST00000344462.4_Missense_Mutation_p.E625Q	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	656					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	AAGTAGGCCTCGGTCTCTGTC	0.612																																																	0													24.0	28.0	27.0					20																	62038650		2198	4298	6496	SO:0001583	missense	0			AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.1966G>C	20.37:g.62038650C>G	ENSP00000352035:p.Glu656Gln		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.E664Q	ENST00000359125.2	37	c.1990	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993967	0.54041	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	D;D;D;D;D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29;-6.29;-6.29;-6.29;-6.29	5.06	5.06	0.68205	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.194310	0.44483	D	0.000453	D	0.99327	0.9764	L	0.51422	1.61	0.52501	D	0.999956	D;D;D;D	0.76494	0.998;0.999;0.998;0.999	D;D;D;D	0.71184	0.937;0.96;0.953;0.972	D	0.99949	1.1511	10	0.18276	T	0.48	-36.4776	18.4055	0.90535	0.0:1.0:0.0:0.0	.	628;638;625;656	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	Q	638;656;626;664;656;625;628;652;664	ENSP00000349789:E638Q;ENSP00000352035:E656Q;ENSP00000359246:E626Q;ENSP00000346601:E664Q;ENSP00000352718:E656Q;ENSP00000399612:E625Q;ENSP00000353668:E628Q;ENSP00000339611:E652Q;ENSP00000359244:E664Q	ENSP00000339611:E652Q	E	-	1	0	KCNQ2	61509094	1.000000	0.71417	0.938000	0.37757	0.419000	0.31324	5.800000	0.69108	2.359000	0.80004	0.491000	0.48974	GAG	KCNQ2	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000075043		0.612	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	-	0.00	48	0	C	NM_172109		62038650	-1	tier1	-	no_errors	ENST00000354587	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	G
KCNQ3	3786	genome.wustl.edu	37	8	133192457	133192457	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:133192457G>A	ENST00000388996.4	-	4	1144	c.724C>T	c.(724-726)Cgg>Tgg	p.R242W	KCNQ3_ENST00000521134.1_Missense_Mutation_p.R122W|KCNQ3_ENST00000519445.1_Missense_Mutation_p.R242W	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	242					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CCACCTCTCCGGTCCATCCGC	0.602																																																	0													89.0	80.0	83.0					8																	133192457		2203	4300	6503	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.724C>T	8.37:g.133192457G>A	ENSP00000373648:p.Arg242Trp		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R242W	ENST00000388996.4	37	c.724	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082828	0.76642	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98792	-5.14;-5.14;-5.14	5.66	2.51	0.30379	Ion transport (1);	0.110724	0.56097	D	0.000024	D	0.99149	0.9706	M	0.90705	3.14	0.52501	D	0.99995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99157	1.0860	10	0.87932	D	0	-11.4551	14.002	0.64439	0.0:0.0:0.6035:0.3965	.	242;242	E7ET42;O43525	.;KCNQ3_HUMAN	W	242;122;242;231;121	ENSP00000373648:R242W;ENSP00000429799:R122W;ENSP00000428790:R242W	ENSP00000373648:R242W	R	-	1	2	KCNQ3	133261639	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.793000	0.26944	1.340000	0.45581	0.561000	0.74099	CGG	KCNQ3	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000184156		0.602	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	45	0	G	NM_004519		133192457	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	A
KDM2A	22992	genome.wustl.edu	37	11	67023301	67023301	+	3'UTR	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:67023301C>T	ENST00000529006.2	+	0	4710				KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000308783.5_3'UTR|KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000398645.2_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CAAGTGGATTCTGAGACAGGC	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*775C>T	11.37:g.67023301C>T			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.512	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	45	0	C	NM_012308		67023301	+1	tier1	-	no_errors	ENST00000524657	ensembl	human	known	74_37	rna	15.91	37	7	SNP	1.000	T
KDM6A	7403	genome.wustl.edu	37	X	44950110	44950110	+	Splice_Site	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:44950110G>A	ENST00000377967.4	+	26	3919		c.e26+1		KDM6A_ENST00000543216.1_Splice_Site|KDM6A_ENST00000382899.4_Splice_Site|KDM6A_ENST00000536777.1_Splice_Site	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A						canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						AAATGATTAAGTAAGTCTTTT	0.348			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)											140.0	126.0	131.0					X																	44950110		2203	4300	6503	SO:0001630	splice_region_variant	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3878+1G>A	X.37:g.44950110G>A			Q52LL9|Q5JVQ7	Splice_Site	SNP	-	e26+1	ENST00000377967.4	37	c.3899+1	CCDS14265.1	X	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544186	0.65198	.	.	ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216;ENST00000414389;ENST00000433797;ENST00000431196	.	.	.	5.58	5.58	0.84498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6992	0.91614	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM6A	44835054	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.476000	0.97823	2.361000	0.80049	0.529000	0.55759	.	KDM6A	-	-	ENSG00000147050		0.348	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	-	0.00	36	0	G	NM_021140	Intron	44950110	+1	tier1	-	no_errors	ENST00000382899	ensembl	human	known	74_37	splice_site	48.39	16	15	SNP	1.000	A
KIF18A	81930	genome.wustl.edu	37	11	28080629	28080629	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:28080629C>T	ENST00000263181.6	-	13	2082	c.1792G>A	c.(1792-1794)Gaa>Aaa	p.E598K	MIR610_ENST00000385139.1_RNA	NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	598					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						AAGTCAGATTCAAAAGCAGCA	0.398																																																	0													154.0	155.0	154.0					11																	28080629		2202	4299	6501	SO:0001583	missense	0			AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.1792G>A	11.37:g.28080629C>T	ENSP00000263181:p.Glu598Lys		Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E598K	ENST00000263181.6	37	c.1792	CCDS7867.1	11	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258100	0.80246	.	.	ENSG00000121621	ENST00000263181	T	0.73363	-0.74	5.61	5.61	0.85477	.	0.160635	0.56097	D	0.000040	T	0.69287	0.3094	L	0.58101	1.795	0.46078	D	0.998859	P	0.47762	0.9	B	0.40199	0.322	T	0.69060	-0.5245	10	0.06236	T	0.91	.	19.6363	0.95735	0.0:1.0:0.0:0.0	.	598	Q8NI77	KI18A_HUMAN	K	598	ENSP00000263181:E598K	ENSP00000263181:E598K	E	-	1	0	KIF18A	28037205	1.000000	0.71417	0.998000	0.56505	0.648000	0.38561	5.335000	0.65929	2.648000	0.89879	0.585000	0.79938	GAA	KIF18A	-	NULL	ENSG00000121621		0.398	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF18A	HGNC	protein_coding	OTTHUMT00000388328.3	-	0.00	65	0	C	NM_031217		28080629	-1	tier1	-	no_errors	ENST00000263181	ensembl	human	known	74_37	missense	21.05	60	16	SNP	0.999	T
KIF5C	3800	genome.wustl.edu	37	2	149854940	149854940	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:149854940C>T	ENST00000435030.1	+	19	2495	c.2127C>T	c.(2125-2127)agC>agT	p.S709S	KIF5C_ENST00000397413.1_Silent_p.S477S|KIF5C_ENST00000414838.2_Silent_p.S614S|KIF5C_ENST00000464066.1_3'UTR			O60282	KIF5C_HUMAN	kinesin family member 5C	709					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGATGGAGAGCCACCGGGAAG	0.557																																																	0													20.0	23.0	22.0					2																	149854940		2094	4227	6321	SO:0001819	synonymous_variant	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.2127C>T	2.37:g.149854940C>T			O95079|Q2YDC5	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.S709	ENST00000435030.1	37	c.2127		2																																																																																			KIF5C	-	NULL	ENSG00000168280		0.557	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3	-	0.00	47	0	C	NM_004522		149854940	+1	tier1	-	no_errors	ENST00000435030	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.998	T
Unknown	0	genome.wustl.edu	37	GL000209.1	35619	35619	+	IGR	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrGL000209.1:35619G>T								None (None upstream) : None (None downstream)																							AGATGCTGCGGTAATGGACCA	0.527																																																	0																																										SO:0001628	intergenic_variant	0																															GL000209.1.37:g.35619G>T				Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.V276L		37	c.826		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.527					KIR2DL2	HGNC			-	0.00	86	0	G			35619	+1	tier1	-	no_errors	ENST00000344867	ensembl	human	known	74_37	missense	49.44	43	44	SNP	NULL	T
KLHL1	57626	genome.wustl.edu	37	13	70514337	70514337	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr13:70514337C>T	ENST00000377844.4	-	4	1608	c.849G>A	c.(847-849)gaG>gaA	p.E283E	KLHL1_ENST00000545028.1_Silent_p.E90E	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	283					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CAAGAAGGTTCTCAATGGTGT	0.388																																																	0													69.0	65.0	66.0					13																	70514337		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.849G>A	13.37:g.70514337C>T			A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.E283	ENST00000377844.4	37	c.849	CCDS9445.1	13																																																																																			KLHL1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000150361		0.388	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	-	0.00	45	0	C	NM_020866		70514337	-1	tier1	-	no_errors	ENST00000377844	ensembl	human	known	74_37	silent	38.30	29	18	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118380790	118380790	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:118380790T>G	ENST00000389506.5	+	30	11019	c.11019T>G	c.(11017-11019)atT>atG	p.I3673M	KMT2A_ENST00000354520.4_Missense_Mutation_p.I3635M|RP11-770J1.3_ENST00000532597.1_RNA|KMT2A_ENST00000534358.1_Missense_Mutation_p.I3676M			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	3673	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TTTTTGAAATTTCCAGTGATG	0.423																																																	0													123.0	123.0	123.0					11																	118380790		2200	4295	6495	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.11019T>G	11.37:g.118380790T>G	ENSP00000374157:p.Ile3673Met		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.I3673M	ENST00000389506.5	37	c.11019	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	T	15.05	2.718971	0.48622	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	T;T;T	0.56941	0.43;0.43;0.43	5.87	3.44	0.39384	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.85682	D	0.000000	T	0.65984	0.2744	M	0.79258	2.445	0.49213	D	0.999763	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68610	-0.5363	10	0.87932	D	0	.	3.3904	0.07287	0.333:0.128:0.0:0.5389	.	3676;3673	E9PQG7;Q03164	.;MLL1_HUMAN	M	3676;3673;3635;2583	ENSP00000436786:I3676M;ENSP00000374157:I3673M;ENSP00000346516:I3635M	ENSP00000346516:I3635M	I	+	3	3	MLL	117886000	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.074000	0.41529	2.247000	0.74100	0.477000	0.44152	ATT	KMT2A	-	pfam_FYrich_C,smart_FYrich_C,pirsf_MeTrfase_trithorax	ENSG00000118058		0.423	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	27	0	T	NM_005933		118380790	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	G
KRT1	3848	genome.wustl.edu	37	12	53069189	53069190	+	In_Frame_Ins	INS	-	-	GCC			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:53069189_53069190insGCC	ENST00000252244.3	-	9	1780_1781	c.1722_1723insGGC	c.(1720-1725)ggccat>ggcGGCcat	p.574_575insG		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	574	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						tagctgccatggccgccgccgc	0.748																																																	0										21,2759		2,17,1371						-0.6	0.1		dbSNP_130	5	28,5852		1,26,2913	no	coding	KRT1	NM_006121.3		3,43,4284	A1A1,A1R,RR		0.4762,0.7554,0.5658				49,8611				SO:0001652	inframe_insertion	0			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1720_1722dupGGC	12.37:g.53069196_53069198dupGCC	ENSP00000252244:p.Gly575_Gly576dup		B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	In_Frame_Ins	INS	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.574in_frame_insG	ENST00000252244.3	37	c.1723_1722	CCDS8836.1	12																																																																																			KRT1	-	NULL	ENSG00000167768		0.748	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1		0.00	37	0	-	NM_006121		53069190	-1	tier1		no_errors	ENST00000252244	ensembl	human	known	74_37	in_frame_ins	18.18	27	6	INS	0.358:0.643	GCC
KRTAP9-3	83900	genome.wustl.edu	37	17	39389161	39389161	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:39389161G>C	ENST00000411528.2	+	1	447	c.408G>C	c.(406-408)gaG>gaC	p.E136D		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	136	16 X 5 AA repeats of C-C-[RQVSHE]-[SPTN]- [TASPI].					keratin filament (GO:0045095)				breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCTGCTGTGAGACCACCTGCT	0.577																																																	0													119.0	147.0	138.0					17																	39389161		2101	4298	6399	SO:0001583	missense	0			AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.408G>C	17.37:g.39389161G>C	ENSP00000392189:p.Glu136Asp			Missense_Mutation	SNP	NULL	p.E136D	ENST00000411528.2	37	c.408	CCDS11385.1	17	.	.	.	.	.	.	.	.	.	.	.	9.990	1.230626	0.22542	.	.	ENSG00000204873	ENST00000411528	T	0.01379	4.96	1.54	-1.65	0.08291	.	.	.	.	.	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.46596	-0.9180	7	0.12766	T	0.61	.	0.8897	0.01252	0.1677:0.2275:0.3744:0.2303	.	.	.	.	D	136	ENSP00000392189:E136D	ENSP00000392189:E136D	E	+	3	2	KRTAP9-3	36642687	0.000000	0.05858	0.002000	0.10522	0.517000	0.34286	-1.951000	0.01529	-0.595000	0.05828	0.194000	0.17425	GAG	KRTAP9-3	-	NULL	ENSG00000204873		0.577	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP9-3	HGNC	protein_coding	OTTHUMT00000257290.1	-	0.00	157	0	G			39389161	+1	tier1	-	no_errors	ENST00000411528	ensembl	human	known	74_37	missense	16.48	146	29	SNP	0.119	C
LEPRE1	64175	genome.wustl.edu	37	1	43228119	43228119	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:43228119C>T	ENST00000296388.5	-	2	544	c.493G>A	c.(493-495)Gca>Aca	p.A165T	LEPRE1_ENST00000236040.4_Missense_Mutation_p.A165T|LEPRE1_ENST00000397054.3_Missense_Mutation_p.A165T			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	165					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GTGTGTGCTGCAGCAACAGCT	0.468																																																	0													133.0	128.0	130.0					1																	43228119		2203	4300	6503	SO:0001583	missense	0			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.493G>A	1.37:g.43228119C>T	ENSP00000296388:p.Ala165Thr		Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.A165T	ENST00000296388.5	37	c.493	CCDS472.2	1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.793285	0.90453	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.63255	-0.03;-0.03;-0.03	5.73	5.73	0.89815	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.81216	0.4776	M	0.84219	2.685	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.997;0.997	T	0.82474	-0.0439	10	0.56958	D	0.05	-16.6954	17.3865	0.87417	0.0:1.0:0.0:0.0	.	165;165;30;165	Q32P28-2;Q32P28-3;B4DNM8;Q32P28	.;.;.;P3H1_HUMAN	T	165;165;165;30	ENSP00000380245:A165T;ENSP00000236040:A165T;ENSP00000296388:A165T	ENSP00000236040:A165T	A	-	1	0	LEPRE1	43000706	1.000000	0.71417	0.886000	0.34754	0.441000	0.31987	5.527000	0.67123	2.709000	0.92574	0.563000	0.77884	GCA	LEPRE1	-	NULL	ENSG00000117385		0.468	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	HGNC	protein_coding	OTTHUMT00000019790.2	-	0.00	34	0	C	NM_022356		43228119	-1	tier1	-	no_errors	ENST00000236040	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.999	T
LGALS9C	654346	genome.wustl.edu	37	17	18390984	18390984	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:18390984C>T	ENST00000328114.6	+	4	438	c.357C>T	c.(355-357)ttC>ttT	p.F119F	LGALS9C_ENST00000584941.1_Silent_p.F119F|LGALS9C_ENST00000581545.1_Silent_p.F119F|LGALS9C_ENST00000412421.2_Silent_p.F31F|LGALS9C_ENST00000583322.1_Silent_p.F119F	NM_001040078.2	NP_001035167.2	Q6DKI2	LEG9C_HUMAN	lectin, galactoside-binding, soluble, 9C	119	Galectin 1. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			NS(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	7						GGAGCCTCTTCGTGCAGTACT	0.622																																																	0													25.0	18.0	20.0					17																	18390984		2192	4194	6386	SO:0001819	synonymous_variant	0				CCDS32587.1	17p11.2	2011-08-04			ENSG00000171916	ENSG00000171916		"""Lectins, galactoside-binding"""	33874	protein-coding gene	gene with protein product							Standard	NM_001040078		Approved		uc002gtw.3	Q6DKI2	OTTHUMG00000059251	ENST00000328114.6:c.357C>T	17.37:g.18390984C>T			B0AZM7	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.F119	ENST00000328114.6	37	c.357	CCDS32587.1	17																																																																																			LGALS9C	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	ENSG00000171916		0.622	LGALS9C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LGALS9C	HGNC	protein_coding	OTTHUMT00000131456.2		0.00	13	0	C	NM_001040078		18390984	+1			no_errors	ENST00000328114	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.011	T
LILRA2	11027	genome.wustl.edu	37	19	55085970	55085970	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:55085970C>T	ENST00000251377.3	+	4	406	c.273C>T	c.(271-273)caC>caT	p.H91H	LILRA2_ENST00000391737.1_Silent_p.H79H|LILRA2_ENST00000391738.3_Silent_p.H91H|LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Silent_p.H91H|LILRA2_ENST00000495786.1_3'UTR|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	91	Ig-like C2-type 1.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCTGGGAACACGCAGGGCGGT	0.527																																																	0													101.0	91.0	94.0					19																	55085970		2203	4300	6503	SO:0001819	synonymous_variant	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.273C>T	19.37:g.55085970C>T			O75020	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.H91	ENST00000251377.3	37	c.273	CCDS46179.1	19																																																																																			LILRA2	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	ENSG00000239998		0.527	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	-	0.00	90	0	C			55085970	+1	tier1	-	no_errors	ENST00000251377	ensembl	human	known	74_37	silent	10.10	89	10	SNP	0.004	T
LIMK2	3985	genome.wustl.edu	37	22	31656020	31656020	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr22:31656020G>C	ENST00000331728.4	+	5	622	c.508G>C	c.(508-510)Gag>Cag	p.E170Q	LIMK2_ENST00000340552.4_Missense_Mutation_p.E149Q|LIMK2_ENST00000333611.4_Missense_Mutation_p.E149Q|LIMK2_ENST00000406516.1_Missense_Mutation_p.E92Q|LIMK2_ENST00000444929.2_Intron	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	170	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						CGTGTCCGTGGAGAGTGCCTG	0.562																																																	0													68.0	62.0	64.0					22																	31656020		2203	4300	6503	SO:0001583	missense	0			D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.508G>C	22.37:g.31656020G>C	ENSP00000332687:p.Glu170Gln		A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E170Q	ENST00000331728.4	37	c.508	CCDS13891.1	22	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231708	0.58777	.	.	ENSG00000182541	ENST00000406516;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	T;T;T;T	0.28069	1.63;1.63;1.63;1.63	5.75	5.75	0.90469	PDZ/DHR/GLGF (4);	0.286819	0.39615	N	0.001316	T	0.35364	0.0929	L	0.36672	1.1	0.80722	D	1	B;P;B;B	0.37612	0.267;0.602;0.081;0.337	B;B;B;B	0.43103	0.213;0.408;0.221;0.141	T	0.09271	-1.0682	10	0.66056	D	0.02	-24.7515	18.9302	0.92561	0.0:0.0:1.0:0.0	.	202;149;170;92	F5GY29;Q7L3H5;P53671;B5MC51	.;.;LIMK2_HUMAN;.	Q	92;170;202;149;149	ENSP00000384602:E92Q;ENSP00000332687:E170Q;ENSP00000330470:E149Q;ENSP00000339916:E149Q	ENSP00000332687:E170Q	E	+	1	0	LIMK2	29986020	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.951000	0.56684	2.714000	0.92807	0.561000	0.74099	GAG	LIMK2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000182541		0.562	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK2	HGNC	protein_coding	OTTHUMT00000321911.1	-	0.00	25	0	G	NM_016733		31656020	+1	tier1	-	no_errors	ENST00000331728	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.999	C
LINC00671	388387	genome.wustl.edu	37	17	41031648	41031648	+	lincRNA	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:41031648C>T	ENST00000301683.3	-	0	560									long intergenic non-protein coding RNA 671																		GCCACAGACTCATCTCCACCT	0.607																																																	0													28.0	34.0	32.0					17																	41031648		692	1591	2283			0			AK055784, BC122868, DC361857		17q21.31	2012-10-12			ENSG00000213373	ENSG00000213373		"""Long non-coding RNAs"""	44339	non-coding RNA	RNA, long non-coding							Standard	NR_027254		Approved		uc010whe.1		OTTHUMG00000132654		17.37:g.41031648C>T				RNA	SNP	-	NULL	ENST00000301683.3	37	NULL		17																																																																																			LINC00671	-	-	ENSG00000213373		0.607	LINC00671-001	KNOWN	basic	lincRNA	LINC00671	HGNC	lincRNA	OTTHUMT00000255905.2	-	0.00	56	0	C	NR_027254		41031648	-1	tier1	-	no_errors	ENST00000301683	ensembl	human	known	74_37	rna	10.98	73	9	SNP	0.009	T
LINC00937	389634	genome.wustl.edu	37	12	8537891	8537891	+	lincRNA	SNP	G	G	A	rs190148889		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:8537891G>A	ENST00000544461.1	-	0	1081									long intergenic non-protein coding RNA 937																		CCTGTCTCTTGAGTTCTGTGT	0.468																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8537891G>A				RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			LINC00937	-	-	ENSG00000226091		0.468	LINC00937-001	KNOWN	basic	lincRNA	LINC00937	HGNC	lincRNA	OTTHUMT00000400511.1		0.00	27	0	G			8537891	-1			no_errors	ENST00000538304	ensembl	human	known	74_37	rna	18.52	22	5	SNP	0.001	A
LINC00969	440993	genome.wustl.edu	37	3	195393119	195393119	+	lincRNA	SNP	A	A	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:195393119A>T	ENST00000445430.1	+	0	796									long intergenic non-protein coding RNA 969																		TTTCCTTTGTAAAAATGAATA	0.378																																																	0																																												0			AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195393119A>T				RNA	SNP	-	NULL	ENST00000445430.1	37	NULL		3																																																																																			LINC00969	-	-	ENSG00000242086		0.378	LINC00969-038	KNOWN	basic	lincRNA	LINC00969	HGNC	lincRNA	OTTHUMT00000341951.1		0.00	62	0	A			195393119	+1			no_errors	ENST00000457233	ensembl	human	known	74_37	rna	6.77	124	9	SNP	0.001	T
LOC100130849	100130849	genome.wustl.edu	37	7	56945092	56945092	+	RNA	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:56945092G>T	ENST00000448242.1	-	0	345					NR_038450.1																						TAGACCTTGTGCAGGATGTCA	0.607																																																	0																																												0																															7.37:g.56945092G>T				RNA	SNP	-	NULL	ENST00000448242.1	37	NULL		7																																																																																			RP13-580B18.1	-	-	ENSG00000233437		0.607	RP13-580B18.1-001	KNOWN	basic	processed_transcript	LOC100130849	Clone_based_vega_gene	pseudogene	OTTHUMT00000343753.1	-	0.00	46	0	G			56945092	-1	tier1	-	no_errors	ENST00000448242	ensembl	human	known	74_37	rna	19.15	38	9	SNP	1.000	T
LRRC47	57470	genome.wustl.edu	37	1	3699225	3699226	+	Splice_Site	INS	-	-	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:3699225_3699226insT	ENST00000378251.1	-	5	1439_1440	c.1412_1413insA	c.(1411-1413)aag>aaAg	p.K471fs	RP1-286D6.5_ENST00000607459.1_RNA|RN7SL574P_ENST00000581512.1_RNA	NM_020710.2	NP_065761.1	Q8N1G4	LRC47_HUMAN	leucine rich repeat containing 47	471							phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|urinary_tract(1)	17	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GCCACCCTACCTTTGTCTTCTC	0.485																																																	0																																										SO:0001630	splice_region_variant	0			AB033011	CCDS51.1	1p36.32	2008-02-05			ENSG00000130764	ENSG00000130764			29207	protein-coding gene	gene with protein product						10574461	Standard	NM_020710		Approved	KIAA1185, RP1-286D6.3	uc001akx.1	Q8N1G4	OTTHUMG00000003506	ENST00000378251.1:c.1413+1->A	1.37:g.3699228_3699228dupT			Q9ULN5	Frame_Shift_Ins	INS	pfam_Leu-rich_rpt,pfam_B3/B4_tRNA-bd,smart_Leu-rich_rpt_typical-subtyp,smart_B3/B4_tRNA-bd	p.V472fs	ENST00000378251.1	37	c.1413_1412	CCDS51.1	1																																																																																			LRRC47	-	pfam_B3/B4_tRNA-bd,smart_B3/B4_tRNA-bd	ENSG00000130764		0.485	LRRC47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC47	HGNC	protein_coding	OTTHUMT00000009744.1		0.00	67	0	-	NM_020710	Frame_Shift_Ins	3699226	-1	tier1		no_errors	ENST00000378251	ensembl	human	known	74_37	frame_shift_ins	18.07	68	15	INS	1.000:1.000	T
MAB21L1	4081	genome.wustl.edu	37	13	36049877	36049877	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr13:36049877C>T	ENST00000379919.4	-	1	955	c.399G>A	c.(397-399)caG>caA	p.Q133Q	NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	133					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CCACCAGCGTCTGAAACCTGG	0.557																																																	0													49.0	50.0	50.0					13																	36049877		2203	4300	6503	SO:0001819	synonymous_variant	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.399G>A	13.37:g.36049877C>T			Q6I9T5	Silent	SNP	pfam_Mab-21_dom	p.Q133	ENST00000379919.4	37	c.399	CCDS9353.1	13																																																																																			MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.557	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3		0.00	26	0	C	NM_005584		36049877	-1			no_errors	ENST00000379919	ensembl	human	known	74_37	silent	13.64	19	3	SNP	1.000	T
MAGEL2	54551	genome.wustl.edu	37	15	23890125	23890125	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:23890125C>A	ENST00000532292.1	-	1	1050	c.956G>T	c.(955-957)tGg>tTg	p.W319L		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	202	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TTGGACCTCCCAGTCACTCAG	0.607																																																	0													56.0	63.0	61.0					15																	23890125		2017	4203	6220	SO:0001583	missense	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.956G>T	15.37:g.23890125C>A	ENSP00000433433:p.Trp319Leu			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.W319L	ENST00000532292.1	37	c.956		15	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208048	0.39003	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.94	3.94	0.45596	.	.	.	.	.	T	0.52901	0.1763	L	0.58101	1.795	0.30346	N	0.785249	.	.	.	.	.	.	T	0.52631	-0.8550	5	.	.	.	.	11.8024	0.52135	0.0:1.0:0.0:0.0	.	.	.	.	W	351	.	.	G	-	1	0	MAGEL2	21441218	0.984000	0.35163	0.998000	0.56505	0.183000	0.23260	1.559000	0.36320	2.488000	0.83962	0.655000	0.94253	GGG	MAGEL2	-	NULL	ENSG00000254585		0.607	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	46	0	C	NM_019066		23890125	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.998	A
MALAT1	378938	genome.wustl.edu	37	11	65272188	65272189	+	lincRNA	DEL	TA	TA	-			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:65272188_65272189delTA	ENST00000534336.1	+	0	6956_6957					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		TTCAAGAAATTAAACTGGCAAG	0.406																																																	0																																												0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65272188_65272189delTA				RNA	DEL	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.406	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	63	0	TA	NR_002819		65272189	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	10.48	111	13	DEL	0.115:0.326	-
MAML1	9794	genome.wustl.edu	37	5	179192752	179192752	+	Missense_Mutation	SNP	C	C	G	rs557255881		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:179192752C>G	ENST00000292599.3	+	2	1004	c.741C>G	c.(739-741)aaC>aaG	p.N247K	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCAACCTTAACGAGCAGGAGT	0.532																																																	0													90.0	74.0	80.0					5																	179192752		2203	4300	6503	SO:0001583	missense	0			D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.741C>G	5.37:g.179192752C>G	ENSP00000292599:p.Asn247Lys			Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.N247K	ENST00000292599.3	37	c.741	CCDS34315.1	5	.	.	.	.	.	.	.	.	.	.	C	16.63	3.175834	0.57692	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.47869	0.83	4.9	-2.14	0.07123	.	0.000000	0.85682	D	0.000000	T	0.64011	0.2560	M	0.77103	2.36	0.53005	D	0.999968	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.65475	-0.6159	10	0.72032	D	0.01	-20.1164	12.2773	0.54744	0.0:0.392:0.0:0.608	.	284;247	Q59GH4;Q92585	.;MAML1_HUMAN	K	247;284	ENSP00000292599:N247K	ENSP00000292599:N247K	N	+	3	2	MAML1	179125358	0.325000	0.24660	0.648000	0.29521	0.991000	0.79684	-0.372000	0.07504	-0.510000	0.06523	0.455000	0.32223	AAC	MAML1	-	NULL	ENSG00000161021		0.532	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000372316.2		0.00	27	0	C	NM_014757		179192752	+1			no_errors	ENST00000292599	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.989	G
MAML3	55534	genome.wustl.edu	37	4	140811099	140811099	+	Splice_Site	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:140811099C>T	ENST00000398940.1	-	1	107	c.108G>A	c.(106-108)caG>caA	p.Q36Q	MAML3_ENST00000327122.5_Silent_p.Q341Q|MAML3_ENST00000509479.2_Silent_p.Q497Q					mastermind-like 3 (Drosophila)									p.Q497Q(2)		breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.542																																																	2	Substitution - coding silent(2)	prostate(2)											13.0	19.0	17.0					4																	140811099		2117	4226	6343	SO:0001630	splice_region_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000398940.1:c.108+1G>A	4.37:g.140811099C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q497	ENST00000398940.1	37	c.1491		4																																																																																			MAML3	-	NULL	ENSG00000196782		0.542	MAML3-202	KNOWN	basic	protein_coding	MAML3	HGNC	protein_coding			0.00	30	0	C		Silent	140811099	-1			no_errors	ENST00000509479	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.995	T
MAPKBP1	23005	genome.wustl.edu	37	15	42116141	42116141	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:42116141G>T	ENST00000456763.2	+	30	4309	c.4113G>T	c.(4111-4113)caG>caT	p.Q1371H	MAPKBP1_ENST00000457542.2_Missense_Mutation_p.Q1365H|MAPKBP1_ENST00000514566.1_Intron|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.Q1204H|RP11-23P13.4_ENST00000512295.1_RNA|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.Q1248H|RP11-23P13.4_ENST00000510176.1_RNA	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1371										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CCTGTGCCCAGCAACTGCCAG	0.622																																																	0													53.0	61.0	59.0					15																	42116141		2203	4300	6503	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.4113G>T	15.37:g.42116141G>T	ENSP00000393099:p.Gln1371His		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1371H	ENST00000456763.2	37	c.4113	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	.	17.13	3.311308	0.60414	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763	T;T;T;T	0.42900	1.13;1.3;0.96;1.18	5.81	4.89	0.63831	.	0.599767	0.18027	N	0.154057	T	0.40839	0.1133	L	0.44542	1.39	0.26637	N	0.972367	P;P;P;P;P	0.49961	0.755;0.755;0.93;0.694;0.874	B;P;B;B;B	0.48141	0.346;0.568;0.436;0.326;0.444	T	0.26360	-1.0105	10	0.37606	T	0.19	-4.0011	9.9973	0.41907	0.0696:0.0:0.7948:0.1356	.	1204;1248;1204;1371;1365	F8WC21;O60336-3;B4DYK7;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	H	1365;1248;1204;1371	ENSP00000397570:Q1365H;ENSP00000221214:Q1248H;ENSP00000260357:Q1204H;ENSP00000393099:Q1371H	ENSP00000221214:Q1248H	Q	+	3	2	MAPKBP1	39903433	0.992000	0.36948	1.000000	0.80357	0.994000	0.84299	1.040000	0.30278	2.746000	0.94184	0.655000	0.94253	CAG	MAPKBP1	-	NULL	ENSG00000137802		0.622	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	-	0.00	69	0	G	NM_014994		42116141	+1	tier1	-	no_errors	ENST00000456763	ensembl	human	known	74_37	missense	43.75	27	21	SNP	0.989	T
MARCKSL1	65108	genome.wustl.edu	37	1	32800284	32800284	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:32800284C>G	ENST00000329421.7	-	2	847	c.502G>C	c.(502-504)Gag>Cag	p.E168Q		NM_023009.6	NP_075385.1	P49006	MRP_HUMAN	MARCKS-like 1	168					positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|large_intestine(3)|lung(1)|ovary(1)	6		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGCCCTGCCTCTTCTTCTGAG	0.662																																																	0													46.0	45.0	45.0					1																	32800284		2203	4300	6503	SO:0001583	missense	0			AF031640	CCDS361.1	1p35.1	2008-02-05	2004-11-17	2004-11-17	ENSG00000175130	ENSG00000175130			7142	protein-coding gene	gene with protein product		602940	"""MARCKS-like protein"""	MLP		9598313	Standard	NM_023009		Approved	F52, MacMARCKS, MLP1	uc001bvd.4	P49006	OTTHUMG00000007589	ENST00000329421.7:c.502G>C	1.37:g.32800284C>G	ENSP00000362638:p.Glu168Gln		D3DPQ0|Q5TEE6|Q6NXS5	Missense_Mutation	SNP	pfam_MARCKS,prints_MARCKS	p.E168Q	ENST00000329421.7	37	c.502	CCDS361.1	1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682660	0.68157	.	.	ENSG00000175130	ENST00000329421	T	0.46451	0.87	5.22	5.22	0.72569	.	0.284375	0.35320	N	0.003291	T	0.52468	0.1736	N	0.22421	0.69	0.58432	D	0.999999	D	0.89917	1.0	D	0.75020	0.985	T	0.55970	-0.8056	10	0.59425	D	0.04	-15.2273	18.8257	0.92117	0.0:1.0:0.0:0.0	.	168	P49006	MRP_HUMAN	Q	168	ENSP00000362638:E168Q	ENSP00000362638:E168Q	E	-	1	0	MARCKSL1	32572871	0.395000	0.25254	0.990000	0.47175	0.989000	0.77384	1.047000	0.30367	2.645000	0.89757	0.556000	0.70494	GAG	MARCKSL1	-	pfam_MARCKS	ENSG00000175130		0.662	MARCKSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCKSL1	HGNC	protein_coding	OTTHUMT00000020059.3	-	0.00	138	0	C	NM_023009		32800284	-1	tier1	-	no_errors	ENST00000329421	ensembl	human	known	74_37	missense	6.71	139	10	SNP	1.000	G
MCPH1	79648	genome.wustl.edu	37	8	6302198	6302198	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:6302198G>T	ENST00000344683.5	+	8	1031	c.955G>T	c.(955-957)Gca>Tca	p.A319S	MCPH1_ENST00000522905.1_Missense_Mutation_p.A271S|MCPH1_ENST00000519480.1_Missense_Mutation_p.A319S	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	319					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		AAAGCAGGCTGCAGGTATGTC	0.403																																					Colon(95;1448 1467 8277 34473 35819)												0													57.0	52.0	54.0					8																	6302198		1881	4112	5993	SO:0001583	missense	0			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.955G>T	8.37:g.6302198G>T	ENSP00000342924:p.Ala319Ser		B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	pfam_Microcephalin,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom,prints_BRCA1	p.A319S	ENST00000344683.5	37	c.955	CCDS43689.1	8	.	.	.	.	.	.	.	.	.	.	G	10.71	1.426207	0.25726	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.10192	2.9;2.9;2.9	5.36	1.47	0.22746	.	0.835632	0.11222	N	0.586552	T	0.12347	0.0300	L	0.56769	1.78	0.09310	N	1	P;B;P	0.38280	0.625;0.387;0.625	B;B;B	0.39771	0.266;0.309;0.266	T	0.26677	-1.0096	10	0.21014	T	0.42	-0.4712	8.8394	0.35133	0.0813:0.4382:0.4805:0.0	.	271;319;319	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	S	319;319;271	ENSP00000342924:A319S;ENSP00000430962:A319S;ENSP00000430768:A271S	ENSP00000342924:A319S	A	+	1	0	MCPH1	6289606	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.030000	0.12308	0.042000	0.15717	0.655000	0.94253	GCA	MCPH1	-	pfam_Microcephalin	ENSG00000147316		0.403	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCPH1	HGNC	protein_coding	OTTHUMT00000374532.2		0.00	17	0	G	NM_024596		6302198	+1			no_errors	ENST00000344683	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.000	T
MATN2	4147	genome.wustl.edu	37	8	98973737	98973737	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:98973737G>C	ENST00000520016.1	+	4	1061	c.937G>C	c.(937-939)Gag>Cag	p.E313Q	MATN2_ENST00000254898.5_Missense_Mutation_p.E313Q|MATN2_ENST00000524308.1_Missense_Mutation_p.E313Q|MATN2_ENST00000522025.2_Missense_Mutation_p.E29Q|MATN2_ENST00000521689.1_Missense_Mutation_p.E313Q			O00339	MATN2_HUMAN	matrilin 2	313	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CGCCCTGGCTGAGGATGGGAA	0.582																																																	0													91.0	94.0	93.0					8																	98973737		2057	4205	6262	SO:0001583	missense	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.937G>C	8.37:g.98973737G>C	ENSP00000430487:p.Glu313Gln		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.E313Q	ENST00000520016.1	37	c.937	CCDS55264.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.76|11.76	1.733671|1.733671	0.30684|0.30684	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000522025;ENST00000520016;ENST00000519585;ENST00000522270|ENST00000521041	D;D;D;D;D;D;T|.	0.85556|.	-2.0;-2.0;-2.0;-2.0;-2.0;-2.0;1.54|.	4.67|4.67	3.76|3.76	0.43208|0.43208	Epidermal growth factor-like (1);EGF-like region, conserved site (1);EGF-like calcium-binding (1);|.	0.223966|.	0.31156|.	N|.	0.008144|.	T|.	0.35364|.	0.0929|.	L|L	0.31476|0.31476	0.935|0.935	0.27493|0.27493	N|N	0.952215|0.952215	B;P;B|.	0.35107|.	0.429;0.484;0.008|.	B;B;B|.	0.43701|.	0.303;0.428;0.01|.	T|.	0.21008|.	-1.0258|.	10|.	0.22706|.	T|.	0.39|.	-11.3038|-11.3038	10.5752|10.5752	0.45223|0.45223	0.0:0.1957:0.8043:0.0|0.0:0.1957:0.8043:0.0	.|.	313;313;313|.	O00339-2;O00339;Q8N2G3|.	.;MATN2_HUMAN;.|.	Q|S	313;313;313;313;29;313;29;10|67	ENSP00000429977:E313Q;ENSP00000254898:E313Q;ENSP00000430221:E313Q;ENSP00000429010:E29Q;ENSP00000430487:E313Q;ENSP00000429042:E29Q;ENSP00000429825:E10Q|.	ENSP00000254898:E313Q|.	E|X	+|+	1|2	0|2	MATN2|MATN2	99042913|99042913	0.979000|0.979000	0.34478|0.34478	0.772000|0.772000	0.31596|0.31596	0.935000|0.935000	0.57460|0.57460	1.749000|1.749000	0.38319|0.38319	1.257000|1.257000	0.44085|0.44085	0.655000|0.655000	0.94253|0.94253	GAG|TGA	MATN2	-	pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom	ENSG00000132561		0.582	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	-	0.00	52	0	G			98973737	+1	tier1	-	no_errors	ENST00000254898	ensembl	human	known	74_37	missense	13.64	75	12	SNP	0.938	C
MGAT5B	146664	genome.wustl.edu	37	17	74944059	74944059	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:74944059G>T	ENST00000569840.2	+	17	2645	c.2071G>T	c.(2071-2073)Gcc>Tcc	p.A691S	MGAT5B_ENST00000428789.2_Missense_Mutation_p.A700S|RP11-87G24.3_ENST00000564292.1_RNA|MGAT5B_ENST00000301618.4_Missense_Mutation_p.A689S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	691					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CGCCCTGCGGGCCTGGCTGGC	0.701																																																	0													21.0	22.0	22.0					17																	74944059		2200	4298	6498	SO:0001583	missense	0			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.2071G>T	17.37:g.74944059G>T	ENSP00000456037:p.Ala691Ser		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.A700S	ENST00000569840.2	37	c.2098	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	G	14.49	2.549882	0.45383	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.43688	0.94;0.94	4.66	4.66	0.58398	.	0.238298	0.34411	N	0.003988	T	0.34600	0.0903	L	0.29908	0.895	0.33183	D	0.549746	P;P;P	0.41848	0.571;0.634;0.763	B;B;B	0.39119	0.163;0.085;0.291	T	0.54463	-0.8290	10	0.62326	D	0.03	-28.8763	16.5725	0.84622	0.0:0.0:1.0:0.0	.	96;700;689	Q3V5L5-4;Q3V5L5-2;Q3V5L5-5	.;.;.	S	689;700	ENSP00000301618:A689S;ENSP00000391227:A700S	ENSP00000301618:A689S	A	+	1	0	MGAT5B	72455654	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	4.928000	0.63447	2.129000	0.65627	0.557000	0.71058	GCC	MGAT5B	-	NULL	ENSG00000167889		0.701	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2		0.00	27	0	G	NM_144677		74944059	+1			no_errors	ENST00000428789	ensembl	human	known	74_37	missense	22.22	35	10	SNP	1.000	T
MIER3	166968	genome.wustl.edu	37	5	56233470	56233470	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:56233470G>T	ENST00000381199.3	-	5	381	c.371C>A	c.(370-372)gCg>gAg	p.A124E	MIER3_ENST00000381213.3_Missense_Mutation_p.A124E|MIER3_ENST00000409421.1_Missense_Mutation_p.A61E|MIER3_ENST00000381226.3_Missense_Mutation_p.A129E			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	124					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		CAGATCATCCGCAGAAGACTG	0.423																																																	0													123.0	110.0	115.0					5																	56233470		2203	4300	6503	SO:0001583	missense	0			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.371C>A	5.37:g.56233470G>T	ENSP00000370596:p.Ala124Glu		B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.A124E	ENST00000381199.3	37	c.371		5	.	.	.	.	.	.	.	.	.	.	G	35	5.505711	0.96371	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421;ENST00000336942	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	M	0.71581	2.175	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.48736	-0.9009	10	0.17369	T	0.5	-9.9882	20.6593	0.99626	0.0:0.0:1.0:0.0	.	124;129;124	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	E	129;124;124;61;97	ENSP00000370624:A129E;ENSP00000370611:A124E;ENSP00000370596:A124E;ENSP00000386584:A61E;ENSP00000337027:A97E	ENSP00000337027:A97E	A	-	2	0	MIER3	56269227	1.000000	0.71417	0.860000	0.33809	0.966000	0.64601	9.837000	0.99465	2.885000	0.99019	0.655000	0.94253	GCG	MIER3	-	NULL	ENSG00000155545		0.423	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2		0.00	18	0	G	NM_152622		56233470	-1			no_errors	ENST00000381199	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
MIR517A	574479	genome.wustl.edu	37	19	54216635	54216635	+	RNA	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:54216635C>T	ENST00000385001.1	+	0	87				MIR524_ENST00000385242.1_RNA|MIR519D_ENST00000385246.1_RNA	NR_030201.1				microRNA 517a																		GAAGCGCTTTCTGTTTGTTTT	0.438																																																	0													129.0	117.0	121.0					19																	54216635		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207734	ENSG00000207734		"""ncRNAs / Micro RNAs"""	32111	non-coding RNA	RNA, micro				MIRN517A			Standard	NR_030201		Approved	hsa-mir-517a	uc021vae.1				19.37:g.54216635C>T				RNA	SNP	-	NULL	ENST00000385001.1	37	NULL		19																																																																																			MIR519D	-	-	ENSG00000207981		0.438	MIR517A-201	KNOWN	basic	miRNA	MIR519D	HGNC	miRNA		-	0.00	92	0	C	NR_030201		54216635	+1	tier1	-	no_errors	ENST00000385246	ensembl	human	known	74_37	rna	12.50	105	15	SNP	0.016	T
MT-ND1	4535	genome.wustl.edu	37	M	709	709	+	5'Flank	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrM:709G>A	ENST00000361390.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GCAAGCATCCCCGTTCCAGTG	0.468																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.709G>A	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.468	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	208	0	G	YP_003024026		709	+1	tier1	rs2853517	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	75.85	99	311	SNP	NULL	A
MT-CO1	4512	genome.wustl.edu	37	M	5864	5864	+	5'Flank	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrM:5864G>C	ENST00000361624.2	+	0	0				MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTAGATTTACAGTCCAATGCT	0.453																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5864G>C	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TY	-	-	ENSG00000210144		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TY	HGNC	protein_coding		-	0.00	45	0	G	YP_003024028		5864	-1	tier1	-	no_errors	ENST00000387409	ensembl	human	known	74_37	rna	52.31	31	34	SNP	NULL	C
MTMR10	54893	genome.wustl.edu	37	15	31266646	31266646	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:31266646C>T	ENST00000435680.1	-	5	442	c.345G>A	c.(343-345)aaG>aaA	p.K115K	MTMR10_ENST00000563714.1_Silent_p.K33K|MTMR10_ENST00000314404.8_5'Flank|MTMR10_ENST00000425768.1_Silent_p.K115K	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	115							phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		TCTGCTTCCTCTTGTGGTCGT	0.299																																																	0													54.0	50.0	51.0					15																	31266646		1795	4058	5853	SO:0001819	synonymous_variant	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.345G>A	15.37:g.31266646C>T			Q6P4Q6	Silent	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.K115	ENST00000435680.1	37	c.345	CCDS45204.1	15																																																																																			MTMR10	-	NULL	ENSG00000166912		0.299	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	-	0.00	42	0	C	NM_017762		31266646	-1	tier1	-	no_errors	ENST00000435680	ensembl	human	known	74_37	silent	23.81	32	10	SNP	1.000	T
MYBPC3	4607	genome.wustl.edu	37	11	47372796	47372796	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:47372796C>T	ENST00000545968.1	-	2	340	c.286G>A	c.(286-288)Gag>Aag	p.E96K	MYBPC3_ENST00000399249.2_Missense_Mutation_p.E96K|MYBPC3_ENST00000256993.4_Missense_Mutation_p.E96K	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	96					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		TTACCTGCCTCTATGACCTTG	0.597																																																	0													37.0	38.0	38.0					11																	47372796		2105	4216	6321	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.286G>A	11.37:g.47372796C>T	ENSP00000442795:p.Glu96Lys		A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E96K	ENST00000545968.1	37	c.286	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855584	0.32791	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.46819	0.86;0.86;0.86	4.14	3.22	0.36961	.	.	.	.	.	T	0.25975	0.0633	N	0.08118	0	0.52099	D	0.999943	B	0.31383	0.321	B	0.23852	0.049	T	0.11372	-1.0590	9	0.54805	T	0.06	.	11.6668	0.51379	0.0:0.913:0.0:0.087	.	96	Q14896	MYPC3_HUMAN	K	96	ENSP00000442795:E96K;ENSP00000382193:E96K;ENSP00000256993:E96K	ENSP00000256993:E96K	E	-	1	0	MYBPC3	47329372	1.000000	0.71417	0.756000	0.31282	0.059000	0.15707	3.459000	0.53021	0.962000	0.38057	0.313000	0.20887	GAG	MYBPC3	-	NULL	ENSG00000134571		0.597	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	-	0.00	46	0	C			47372796	-1	tier1	-	no_errors	ENST00000399249	ensembl	human	known	74_37	missense	17.39	38	8	SNP	1.000	T
MYH10	4628	genome.wustl.edu	37	17	8380347	8380347	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:8380347C>T	ENST00000269243.4	-	40	5771	c.5633G>A	c.(5632-5634)cGg>cAg	p.R1878Q	MYH10_ENST00000379980.4_Missense_Mutation_p.R1894Q|MYH10_ENST00000396239.1_Missense_Mutation_p.R1899Q|MYH10_ENST00000360416.3_Missense_Mutation_p.R1909Q|NDEL1_ENST00000299734.7_Intron	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1878					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CTGCTTCATCCGAGCGTTGGC	0.562																																																	0													71.0	65.0	67.0					17																	8380347		2203	4300	6503	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5633G>A	17.37:g.8380347C>T	ENSP00000269243:p.Arg1878Gln		B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1899Q	ENST00000269243.4	37	c.5696	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.348270	0.95807	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34	5.06	5.06	0.68205	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.92221	0.7533	M	0.93197	3.39	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;P;D	0.68765	0.96;0.897;0.96	D	0.93845	0.7140	10	0.87932	D	0	.	18.5693	0.91129	0.0:1.0:0.0:0.0	.	1887;1909;1878	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	Q	1878;1909;1899;1894	ENSP00000269243:R1878Q;ENSP00000353590:R1909Q;ENSP00000379539:R1899Q;ENSP00000369315:R1894Q	ENSP00000269243:R1878Q	R	-	2	0	MYH10	8321072	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	7.609000	0.82925	2.782000	0.95742	0.655000	0.94253	CGG	MYH10	-	pfam_Myosin_tail,superfamily_HR1_rho-bd	ENSG00000133026		0.562	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2		0.00	30	0	C			8380347	-1			no_errors	ENST00000396239	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
MYH13	8735	genome.wustl.edu	37	17	10227347	10227347	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:10227347C>T	ENST00000418404.3	-	22	3089	c.2926G>A	c.(2926-2928)Gag>Aag	p.E976K	MYH13_ENST00000252172.4_Missense_Mutation_p.E976K|RP11-401O9.3_ENST00000577743.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	976					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.E976K(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						ACCTTGTTCTCTGTGGCATGC	0.488																																																	2	Substitution - Missense(2)	lung(2)											93.0	89.0	90.0					17																	10227347		2197	4299	6496	SO:0001583	missense	0			AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.2926G>A	17.37:g.10227347C>T	ENSP00000404570:p.Glu976Lys		O95252|Q9P0U8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E976K	ENST00000418404.3	37	c.2926	CCDS45613.1	17	.	.	.	.	.	.	.	.	.	.	C	21.1	4.101598	0.76983	.	.	ENSG00000006788	ENST00000252172;ENST00000418404	D	0.85484	-1.99	4.37	4.37	0.52481	.	.	.	.	.	D	0.93252	0.7850	M	0.90019	3.08	0.49582	D	0.999803	D;D	0.71674	0.991;0.998	P;D	0.65684	0.881;0.937	D	0.94798	0.7968	9	0.87932	D	0	.	17.4708	0.87646	0.0:1.0:0.0:0.0	.	602;976	B4DFX9;Q9UKX3	.;MYH13_HUMAN	K	976;602	ENSP00000252172:E976K	ENSP00000252172:E976K	E	-	1	0	MYH13	10168072	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.522000	0.81844	2.407000	0.81776	0.655000	0.94253	GAG	MYH13	-	NULL	ENSG00000006788		0.488	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYH13	HGNC	protein_coding	OTTHUMT00000442255.1	-	0.00	165	0	C	NM_003802		10227347	-1	tier1	-	no_errors	ENST00000252172	ensembl	human	known	74_37	missense	17.54	141	30	SNP	1.000	T
MYLK	4638	genome.wustl.edu	37	3	123453016	123453016	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:123453016G>T	ENST00000475616.1	-	7	826	c.827C>A	c.(826-828)aCc>aAc	p.T276N	MYLK_ENST00000346322.5_Missense_Mutation_p.T276N|MYLK_ENST00000359169.1_Missense_Mutation_p.T276N|MYLK_ENST00000360304.3_Missense_Mutation_p.T276N|MYLK_ENST00000360772.3_Missense_Mutation_p.T276N			Q15746	MYLK_HUMAN	myosin light chain kinase	276			T -> A. {ECO:0000269|PubMed:17344846}.		actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GATTACATTGGTCACCTCTTT	0.557																																																	0													87.0	82.0	84.0					3																	123453016		2203	4300	6503	SO:0001583	missense	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.827C>A	3.37:g.123453016G>T	ENSP00000418335:p.Thr276Asn		B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T276N	ENST00000475616.1	37	c.827	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462576	0.26248	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.67171	-0.25;-0.19;-0.25;-0.19;-0.19	5.43	3.56	0.40772	.	.	.	.	.	T	0.57272	0.2042	L	0.29908	0.895	0.42207	D	0.991799	P;B;P;B;D	0.59767	0.9;0.403;0.9;0.403;0.986	P;B;P;B;P	0.53062	0.576;0.087;0.576;0.087;0.717	T	0.53823	-0.8384	9	0.20046	T	0.44	.	4.4716	0.11715	0.0845:0.1515:0.6077:0.1563	.	276;276;276;276;276	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	N	276	ENSP00000354004:T276N;ENSP00000353452:T276N;ENSP00000352088:T276N;ENSP00000320622:T276N;ENSP00000418335:T276N	ENSP00000320622:T276N	T	-	2	0	MYLK	124935706	1.000000	0.71417	1.000000	0.80357	0.244000	0.25665	2.449000	0.44935	1.519000	0.48950	0.655000	0.94253	ACC	MYLK	-	NULL	ENSG00000065534		0.557	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1		0.00	15	0	G	NM_053025		123453016	-1			no_errors	ENST00000360304	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.685	T
N4BP2L2	10443	genome.wustl.edu	37	13	33017928	33017928	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr13:33017928G>A	ENST00000504114.1	-	6	792	c.701C>T	c.(700-702)cCa>cTa	p.P234L	N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.P249L|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.P234L			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		GTAATTCTTTGGTGTGTTGTC	0.338																																																	0													91.0	85.0	87.0					13																	33017928		1854	4094	5948	SO:0001583	missense	0			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.701C>T	13.37:g.33017928G>A	ENSP00000427477:p.Pro234Leu		A3KME8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.P249L	ENST00000504114.1	37	c.746		13	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444111	0.63067	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396;ENST00000505213	T	0.57273	0.41	5.34	5.34	0.76211	.	1.182480	0.05994	N	0.646497	T	0.70833	0.3269	M	0.62723	1.935	0.09310	N	1	D;D;D;D	0.69078	0.977;0.977;0.997;0.997	P;P;D;D	0.63957	0.656;0.656;0.92;0.92	T	0.57980	-0.7717	10	0.72032	D	0.01	-3.1909	12.8145	0.57657	0.0:0.2136:0.7863:0.0	.	234;249;132;132	B4DPY1;Q92802-3;Q96KV2;Q9Y3H6	.;.;.;.	L	132;161;234;234;249;678	ENSP00000423362:P678L	ENSP00000350104:P234L	P	-	2	0	N4BP2L2;RP11-298P3.4	31915928	0.010000	0.17322	0.013000	0.15412	0.027000	0.11550	1.154000	0.31688	2.484000	0.83849	0.655000	0.94253	CCA	N4BP2L2	-	NULL	ENSG00000244754		0.338	N4BP2L2-004	PUTATIVE	basic	protein_coding	N4BP2L2	HGNC	protein_coding	OTTHUMT00000361380.1	-	0.00	41	0	G	NM_014887		33017928	-1	tier1	-	no_errors	ENST00000399396	ensembl	human	known	74_37	missense	26.32	28	10	SNP	0.046	A
NACA2	342538	genome.wustl.edu	37	17	59668318	59668318	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:59668318C>T	ENST00000521764.1	-	1	245	c.224G>A	c.(223-225)aGg>aAg	p.R75K		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	75	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					CTTCCGTGCCCTCTTTTCACT	0.458																																																	0													246.0	229.0	234.0					17																	59668318		2203	4300	6503	SO:0001583	missense	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.224G>A	17.37:g.59668318C>T	ENSP00000427802:p.Arg75Lys		Q2VIR9	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	p.R75K	ENST00000521764.1	37	c.224	CCDS11630.1	17	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976583	0.34848	.	.	ENSG00000253506	ENST00000521764	T	0.17528	2.27	0.753	-0.748	0.11087	Nascent polypeptide-associated complex NAC (2);	0.072360	0.50627	N	0.000118	T	0.01489	0.0048	N	0.00010	-3.04	0.23577	N	0.997375	B	0.02656	0.0	B	0.01281	0.0	T	0.46076	-0.9217	9	.	.	.	.	4.0866	0.09950	0.0:0.257:0.0:0.743	.	75	Q9H009	NACA2_HUMAN	K	75	ENSP00000427802:R75K	.	R	-	2	0	NACA2	57023100	1.000000	0.71417	0.973000	0.42090	0.773000	0.43773	3.300000	0.51834	-0.188000	0.10499	-0.624000	0.04008	AGG	NACA2	-	pfam_Nas_poly-pep-assoc_cplx_dom,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	ENSG00000253506		0.458	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2	-	0.00	96	0	C	NM_199290		59668318	-1	tier1	-	no_errors	ENST00000521764	ensembl	human	known	74_37	missense	10.64	126	15	SNP	1.000	T
NACA2	342538	genome.wustl.edu	37	17	59667899	59667899	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:59667899C>T	ENST00000521764.1	-	1	664	c.643G>A	c.(643-645)Gtg>Atg	p.V215M		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	215					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					GATGGTTACACTGTTAATTCC	0.363																																																	0													188.0	170.0	176.0					17																	59667899		2203	4300	6503	SO:0001583	missense	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.643G>A	17.37:g.59667899C>T	ENSP00000427802:p.Val215Met		Q2VIR9	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	p.V215M	ENST00000521764.1	37	c.643	CCDS11630.1	17	.	.	.	.	.	.	.	.	.	.	c	4.735	0.136757	0.09032	.	.	ENSG00000253506	ENST00000521764	T	0.42131	0.98	0.753	-0.433	0.12287	.	0.054728	0.64402	N	0.000002	T	0.07683	0.0193	N	0.00214	-1.84	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36383	-0.9750	9	.	.	.	.	4.2782	0.10820	0.0:0.5276:0.0:0.4724	.	215	Q9H009	NACA2_HUMAN	M	215	ENSP00000427802:V215M	.	V	-	1	0	NACA2	57022681	0.999000	0.42202	0.154000	0.22540	0.309000	0.27889	0.800000	0.27042	-0.223000	0.09943	-0.919000	0.02742	GTG	NACA2	-	pirsf_EGD2/NACA	ENSG00000253506		0.363	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2		0.00	82	0	C	NM_199290		59667899	-1			no_errors	ENST00000521764	ensembl	human	known	74_37	missense	6.19	91	6	SNP	0.097	T
NACA2	342538	genome.wustl.edu	37	17	59668285	59668285	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:59668285A>C	ENST00000521764.1	-	1	278	c.257T>G	c.(256-258)cTa>cGa	p.L86R		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	86	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					TGTAACCTGTAGAAGACCCAG	0.468																																																	0													239.0	232.0	234.0					17																	59668285		2203	4300	6503	SO:0001583	missense	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.257T>G	17.37:g.59668285A>C	ENSP00000427802:p.Leu86Arg		Q2VIR9	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	p.L86R	ENST00000521764.1	37	c.257	CCDS11630.1	17	.	.	.	.	.	.	.	.	.	.	A	12.16	1.855090	0.32791	.	.	ENSG00000253506	ENST00000521764	T	0.39056	1.1	0.753	-0.545	0.11843	Nascent polypeptide-associated complex NAC (2);	0.076345	0.49305	N	0.000155	T	0.12050	0.0293	N	0.01576	-0.805	0.23150	N	0.998214	B	0.02656	0.0	B	0.06405	0.002	T	0.27054	-1.0085	9	.	.	.	.	5.5188	0.16921	0.3319:0.6681:0.0:0.0	.	86	Q9H009	NACA2_HUMAN	R	86	ENSP00000427802:L86R	.	L	-	2	0	NACA2	57023067	1.000000	0.71417	0.990000	0.47175	0.693000	0.40251	3.585000	0.53943	-0.160000	0.11002	-0.811000	0.03165	CTA	NACA2	-	pfam_Nas_poly-pep-assoc_cplx_dom,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	ENSG00000253506		0.468	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2		0.00	93	0	A	NM_199290		59668285	-1			no_errors	ENST00000521764	ensembl	human	known	74_37	missense	11.19	119	15	SNP	1.000	C
NACA2	342538	genome.wustl.edu	37	17	59668349	59668349	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:59668349C>T	ENST00000521764.1	-	1	214	c.193G>A	c.(193-195)Ggt>Agt	p.G65S		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	65					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					TTTGCTTTACCGACTGGTTCT	0.483																																																	0													188.0	171.0	177.0					17																	59668349		2203	4300	6503	SO:0001583	missense	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.193G>A	17.37:g.59668349C>T	ENSP00000427802:p.Gly65Ser		Q2VIR9	Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	p.G65S	ENST00000521764.1	37	c.193	CCDS11630.1	17	.	.	.	.	.	.	.	.	.	.	T	13.73	2.324349	0.41197	.	.	ENSG00000253506	ENST00000521764	T	0.39229	1.09	0.753	-0.473	0.12112	.	0.000000	0.85682	N	0.000000	T	0.06462	0.0166	N	0.00058	-2.35	0.20074	N	0.999938	B	0.02656	0.0	B	0.01281	0.0	T	0.37430	-0.9706	9	.	.	.	.	5.1442	0.14975	0.0:0.4225:0.0:0.5775	.	65	Q9H009	NACA2_HUMAN	S	65	ENSP00000427802:G65S	.	G	-	1	0	NACA2	57023131	1.000000	0.71417	0.972000	0.41901	0.763000	0.43281	2.566000	0.45948	-0.880000	0.03997	-0.684000	0.03749	GGT	NACA2	-	pirsf_EGD2/NACA	ENSG00000253506		0.483	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2	-	0.00	104	0	C	NM_199290		59668349	-1	tier1	-	no_errors	ENST00000521764	ensembl	human	known	74_37	missense	9.09	130	13	SNP	1.000	T
NACA2	342538	genome.wustl.edu	37	17	59668536	59668536	+	Silent	SNP	C	C	G	rs112308210		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:59668536C>G	ENST00000521764.1	-	1	27	c.6G>C	c.(4-6)ccG>ccC	p.P2P		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	2					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					TGGCTTCGCCCGGCATTTTGT	0.577																																																	0													51.0	48.0	49.0					17																	59668536		2203	4300	6503	SO:0001819	synonymous_variant	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.6G>C	17.37:g.59668536C>G			Q2VIR9	Silent	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pirsf_EGD2/NACA,pfscan_Nas_poly-pep-assoc_cplx_dom	p.P2	ENST00000521764.1	37	c.6	CCDS11630.1	17																																																																																			NACA2	-	NULL	ENSG00000253506		0.577	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2		0.00	51	0	C	NM_199290		59668536	-1			no_errors	ENST00000521764	ensembl	human	known	74_37	silent	6.33	74	5	SNP	0.996	G
NAV3	89795	genome.wustl.edu	37	12	78225248	78225248	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:78225248G>C	ENST00000397909.2	+	1	180	c.7G>C	c.(7-9)Gtt>Ctt	p.V3L	NAV3_ENST00000228327.6_Missense_Mutation_p.V3L|NAV3_ENST00000266692.7_Missense_Mutation_p.V3L|NAV3_ENST00000536525.2_Missense_Mutation_p.V3L			Q8IVL0	NAV3_HUMAN	neuron navigator 3	3						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						AGCCATGCCTGTTCTTGGGGT	0.443										HNSCC(70;0.22)																																							0													193.0	193.0	193.0					12																	78225248		1859	4104	5963	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.7G>C	12.37:g.78225248G>C	ENSP00000381007:p.Val3Leu		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.V3L	ENST00000397909.2	37	c.7		12	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500824	0.64298	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.60797	0.16;1.68;1.67;1.68;1.57	5.69	5.69	0.88448	Calponin homology domain (1);	.	.	.	.	T	0.65626	0.2709	N	0.19112	0.55	0.80722	D	1	D;D	0.61697	0.984;0.99	D;D	0.73380	0.956;0.98	T	0.68992	-0.5263	9	0.62326	D	0.03	-11.4444	19.8101	0.96543	0.0:0.0:1.0:0.0	.	3;3	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	L	3	ENSP00000446628:V3L;ENSP00000446132:V3L;ENSP00000381007:V3L;ENSP00000228327:V3L;ENSP00000266692:V3L	ENSP00000228327:V3L	V	+	1	0	NAV3	76749379	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.932000	0.87634	2.696000	0.92011	0.655000	0.94253	GTT	NAV3	-	superfamily_CH-domain	ENSG00000067798		0.443	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	20	0	G	NM_001024383		78225248	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	C
NLGN1	22871	genome.wustl.edu	37	3	173525560	173525560	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:173525560G>T	ENST00000457714.1	+	4	1013	c.584G>T	c.(583-585)aGt>aTt	p.S195I	NLGN1_ENST00000361589.4_Missense_Mutation_p.S195I|NLGN1_ENST00000401917.3_Missense_Mutation_p.S235I|NLGN1_ENST00000545397.1_Missense_Mutation_p.S195I	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	212					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)	p.S195N(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TATGATGGAAGTGTCTTGGCA	0.428																																																	1	Substitution - Missense(1)	lung(1)											171.0	165.0	167.0					3																	173525560		2203	4300	6503	SO:0001583	missense	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.584G>T	3.37:g.173525560G>T	ENSP00000392500:p.Ser195Ile		Q9UPT2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.S235I	ENST00000457714.1	37	c.704	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	G	29.6	5.018505	0.93404	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000415045;ENST00000545397;ENST00000401917	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.83538	0.5276	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.985;0.999	D	0.85524	0.1205	10	0.87932	D	0	.	19.2403	0.93879	0.0:0.0:1.0:0.0	.	235;195	D2X2H5;Q8N2Q7-2	.;.	I	195;195;235;195;235	ENSP00000392500:S195I;ENSP00000354541:S195I;ENSP00000410374:S235I;ENSP00000441108:S195I;ENSP00000385750:S235I	ENSP00000354541:S195I	S	+	2	0	NLGN1	175008254	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.555000	0.86185	0.557000	0.71058	AGT	NLGN1	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000169760		0.428	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3		0.00	18	0	G	NM_014932		173525560	+1			no_errors	ENST00000401917	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
NPBWR1	2831	genome.wustl.edu	37	8	53852501	53852501	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:53852501G>A	ENST00000331251.3	+	1	1511	c.34G>A	c.(34-36)Gcc>Acc	p.A12T		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	12					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GCCCTGGCCCGCCAACGCATC	0.716																																																	0													8.0	10.0	9.0					8																	53852501		2162	4238	6400	SO:0001583	missense	0			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.34G>A	8.37:g.53852501G>A	ENSP00000330284:p.Ala12Thr		Q6NTC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Opioid_rcpt	p.A12T	ENST00000331251.3	37	c.34	CCDS6151.1	8	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694991	0.30052	.	.	ENSG00000183729	ENST00000331251	T	0.36878	1.23	3.97	-2.64	0.06114	.	2.488560	0.02297	N	0.070855	T	0.15522	0.0374	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06110	-1.0845	10	0.19590	T	0.45	.	0.4992	0.00576	0.264:0.2443:0.2901:0.2016	.	12	P48145	NPBW1_HUMAN	T	12	ENSP00000330284:A12T	ENSP00000330284:A12T	A	+	1	0	NPBWR1	54015054	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.878000	0.04192	-0.563000	0.06078	-0.145000	0.13849	GCC	NPBWR1	-	NULL	ENSG00000183729		0.716	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR1	HGNC	protein_coding	OTTHUMT00000378047.1		0.00	29	0	G	NM_005285		53852501	+1			no_errors	ENST00000331251	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.000	A
NR2E3	10002	genome.wustl.edu	37	15	72105936	72105936	+	RNA	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:72105936G>A	ENST00000398840.2	+	0	1144							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GGACCCCCACGGAGTTTGCCT	0.602																																																	0													57.0	62.0	60.0					15																	72105936		2024	4170	6194			0				CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72105936G>A			B6ZGU0|Q9UHM4	RNA	SNP	-	NULL	ENST00000398840.2	37	NULL		15																																																																																			NR2E3	-	-	ENSG00000031544		0.602	NR2E3-202	KNOWN	basic	processed_transcript	NR2E3	HGNC	processed_transcript		-	0.00	26	0	G	NM_014249		72105936	+1	tier1	-	no_errors	ENST00000326995	ensembl	human	known	74_37	rna	22.86	27	8	SNP	0.004	A
NRBP1	29959	genome.wustl.edu	37	2	27662714	27662714	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:27662714G>C	ENST00000233557.3	+	12	1817	c.985G>C	c.(985-987)Gaa>Caa	p.E329Q	KRTCAP3_ENST00000407293.1_5'Flank|NRBP1_ENST00000379863.3_Missense_Mutation_p.E337Q|NRBP1_ENST00000379852.3_Missense_Mutation_p.E329Q|KRTCAP3_ENST00000288873.3_5'Flank|KRTCAP3_ENST00000543753.1_5'Flank			Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein 1	329					ER to Golgi vesicle-mediated transport (GO:0006888)|gene expression (GO:0010467)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell projection (GO:0042995)|endomembrane system (GO:0012505)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Acute lymphoblastic leukemia(172;0.155)					AGCATTGTTTGAAGTGCCCTC	0.527																																																	0													121.0	121.0	121.0					2																	27662714		2203	4300	6503	SO:0001583	missense	0			AF113249	CCDS1753.1	2p23	2008-02-05	2005-12-22	2005-12-22	ENSG00000115216	ENSG00000115216			7993	protein-coding gene	gene with protein product		606010	"""nuclear receptor binding protein"""	NRBP		10843813, 11956649	Standard	NM_013392		Approved	BCON3, MUDPNP, MADM	uc002rkp.3	Q9UHY1	OTTHUMG00000097789	ENST00000233557.3:c.985G>C	2.37:g.27662714G>C	ENSP00000233557:p.Glu329Gln		B3KV40|D6W558|Q53FZ5|Q96SU3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E329Q	ENST00000233557.3	37	c.985	CCDS1753.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.435253	0.96150	.	.	ENSG00000115216	ENST00000233557;ENST00000421823;ENST00000379852;ENST00000379863	T;T;T	0.36699	1.24;1.24;1.24	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.974;0.997;0.986	T	0.69950	-0.5006	10	0.59425	D	0.04	-9.715	18.0038	0.89204	0.0:0.0:1.0:0.0	.	309;337;329	B4DW31;F8W6G1;Q9UHY1	.;.;NRBP_HUMAN	Q	329;309;329;337	ENSP00000233557:E329Q;ENSP00000369181:E329Q;ENSP00000369192:E337Q	ENSP00000233557:E329Q	E	+	1	0	NRBP1	27516218	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.610000	0.88304	0.655000	0.94253	GAA	NRBP1	-	NULL	ENSG00000115216		0.527	NRBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRBP1	HGNC	protein_coding	OTTHUMT00000215033.1	-	0.00	39	0	G	NM_013392		27662714	+1	tier1	-	no_errors	ENST00000233557	ensembl	human	known	74_37	missense	25.00	45	15	SNP	1.000	C
NUGGC	389643	genome.wustl.edu	37	8	27898648	27898648	+	Missense_Mutation	SNP	C	C	T	rs373371560		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:27898648C>T	ENST00000413272.2	-	13	1673	c.1531G>A	c.(1531-1533)Gcc>Acc	p.A511T	NUGGC_ENST00000341513.6_Missense_Mutation_p.A511T	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	511					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A511T(2)									TCCATGCAGGCGAAGCACTGT	0.567																																																	2	Substitution - Missense(2)	lung(2)						C	THR/ALA	0,4180		0,0,2090	46.0	49.0	48.0		1531	2.8	0.8	8		48	1,8425		0,1,4212	no	missense	C8orf80	NM_001010906.1	58	0,1,6302	TT,TC,CC		0.0119,0.0,0.0079	benign	511/797	27898648	1,12605	2090	4213	6303	SO:0001583	missense	0			AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.1531G>A	8.37:g.27898648C>T	ENSP00000408697:p.Ala511Thr		Q6ZP73	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.A511T	ENST00000413272.2	37	c.1531	CCDS47833.1	8	.	.	.	.	.	.	.	.	.	.	C	5.700	0.313616	0.10789	0.0	1.19E-4	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.42131	0.98;0.98	5.65	2.78	0.32641	.	0.734765	0.13207	N	0.405455	T	0.24586	0.0596	N	0.24115	0.695	0.32186	N	0.579771	B	0.14438	0.01	B	0.08055	0.003	T	0.28396	-1.0045	10	0.15952	T	0.53	-7.8089	6.7652	0.23562	0.3111:0.6065:0.0:0.0824	.	511	Q68CJ6	SLIP_HUMAN	T	511	ENSP00000408697:A511T;ENSP00000345031:A511T	ENSP00000345031:A511T	A	-	1	0	C8orf80	27954567	0.806000	0.28996	0.849000	0.33467	0.006000	0.05464	0.052000	0.14163	0.727000	0.32360	-0.142000	0.14014	GCC	NUGGC	-	NULL	ENSG00000189233		0.567	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	HGNC	protein_coding	OTTHUMT00000342494.1		0.00	34	0	C	NM_001010906		27898648	-1			no_errors	ENST00000341513	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.911	T
NXPH1	30010	genome.wustl.edu	37	7	8791241	8791241	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:8791241C>A	ENST00000405863.1	+	3	1569	c.658C>A	c.(658-660)Cag>Aag	p.Q220K	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_Missense_Mutation_p.Q103K	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	220	V (Cys-rich).					extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		AACCTGTTACCAGGAGCAAAC	0.388																																																	0													47.0	44.0	45.0					7																	8791241		1887	4117	6004	SO:0001583	missense	0			AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.658C>A	7.37:g.8791241C>A	ENSP00000384551:p.Gln220Lys		Q8NB31	Missense_Mutation	SNP	pfam_NXPH/NXPE,pirsf_Neurexophilin	p.Q220K	ENST00000405863.1	37	c.658	CCDS47540.1	7	.	.	.	.	.	.	.	.	.	.	C	18.24	3.580338	0.65992	.	.	ENSG00000122584	ENST00000405863;ENST00000417186	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.78059	0.4224	M	0.72479	2.2	0.80722	D	1	D	0.60160	0.987	D	0.65140	0.932	T	0.76127	-0.3073	9	0.44086	T	0.13	-11.2311	19.6556	0.95837	0.0:1.0:0.0:0.0	.	220	P58417	NXPH1_HUMAN	K	220;103	.	ENSP00000384551:Q220K	Q	+	1	0	NXPH1	8757766	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.625000	0.83145	2.882000	0.98803	0.655000	0.94253	CAG	NXPH1	-	pfam_NXPH/NXPE,pirsf_Neurexophilin	ENSG00000122584		0.388	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH1	HGNC	protein_coding	OTTHUMT00000324591.1	-	0.00	34	0	C	NM_152745		8791241	+1	tier1	-	no_errors	ENST00000405863	ensembl	human	known	74_37	missense	16.67	45	9	SNP	1.000	A
ODF3L2	284451	genome.wustl.edu	37	19	472424	472424	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:472424C>T	ENST00000315489.4	-	2	440	c.205G>A	c.(205-207)Gcc>Acc	p.A69T	ODF3L2_ENST00000382696.3_Intron	NM_182577.2	NP_872383.1	Q3SX64	OD3L2_HUMAN	outer dense fiber of sperm tails 3-like 2	69						cytoplasmic microtubule (GO:0005881)				large_intestine(1)|lung(2)	3						AGCGAGTAGGCGGGACTGGCC	0.667																																																	0													29.0	21.0	24.0					19																	472424		2082	4038	6120	SO:0001583	missense	0			AK097378	CCDS12027.1	19p13.3	2010-04-23	2008-07-04	2008-07-04		ENSG00000181781			26841	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 19"""	C19orf19		14702039	Standard	NM_182577		Approved	FLJ40059	uc002lor.3	Q3SX64		ENST00000315489.4:c.205G>A	19.37:g.472424C>T	ENSP00000318029:p.Ala69Thr		Q3SX65|Q8N1L2	Missense_Mutation	SNP	pfam_SHIPPO-rpt	p.A69T	ENST00000315489.4	37	c.205	CCDS12027.1	19	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872247	0.72180	.	.	ENSG00000181781	ENST00000315489	D	0.89939	-2.59	4.64	4.64	0.57946	.	0.000000	0.85682	U	0.000000	D	0.92440	0.7600	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.92999	0.6421	10	0.72032	D	0.01	-26.994	13.0057	0.58703	0.0:1.0:0.0:0.0	.	69	Q3SX64	OD3L2_HUMAN	T	69	ENSP00000318029:A69T	ENSP00000318029:A69T	A	-	1	0	ODF3L2	423424	0.999000	0.42202	0.964000	0.40570	0.189000	0.23516	4.627000	0.61276	2.122000	0.65172	0.491000	0.48974	GCC	ODF3L2	-	NULL	ENSG00000181781		0.667	ODF3L2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ODF3L2	HGNC	protein_coding	OTTHUMT00000451849.2	-	0.00	109	0	C	NM_182577		472424	-1	tier1	-	no_errors	ENST00000315489	ensembl	human	known	74_37	missense	14.29	66	11	SNP	0.998	T
OR1L1	26737	genome.wustl.edu	37	9	125424367	125424367	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:125424367G>T	ENST00000373686.1	+	1	523	c.523G>T	c.(523-525)Gcc>Tcc	p.A175S	OR1L1_ENST00000309623.1_Missense_Mutation_p.A125S			Q8NH94	OR1L1_HUMAN	olfactory receptor, family 1, subfamily L, member 1	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)	17						CCGCTATGTGGCCATATGTAA	0.468																																																	0													276.0	248.0	257.0					9																	125424367		2203	4300	6503	SO:0001583	missense	0				CCDS35127.1, CCDS35127.2	9q33.2	2013-09-20			ENSG00000173679	ENSG00000173679		"""GPCR / Class A : Olfactory receptors"""	8213	protein-coding gene	gene with protein product				OR1L2			Standard	NM_001005236		Approved	OR9-C	uc022bmz.1	Q8NH94	OTTHUMG00000020618	ENST00000373686.1:c.523G>T	9.37:g.125424367G>T	ENSP00000362790:p.Ala175Ser		Q5T7Z3|Q6IFN2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A175S	ENST00000373686.1	37	c.523		9	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840026	0.51057	.	.	ENSG00000173679	ENST00000373686;ENST00000309623	T;T	0.01209	5.17;5.17	3.11	1.21	0.21127	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03871	0.0109	M	0.81942	2.565	0.25730	N	0.985278	P	0.47350	0.894	P	0.52267	0.694	T	0.21449	-1.0245	9	0.87932	D	0	.	8.0769	0.30722	0.2164:0.0:0.7836:0.0	.	175	Q8NH94	OR1L1_HUMAN	S	175;125	ENSP00000362790:A175S;ENSP00000310773:A125S	ENSP00000310773:A125S	A	+	1	0	OR1L1	124464188	1.000000	0.71417	0.180000	0.23079	0.019000	0.09904	5.261000	0.65496	0.158000	0.19367	-0.657000	0.03884	GCC	OR1L1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000173679		0.468	OR1L1-201	KNOWN	basic	protein_coding	OR1L1	HGNC	protein_coding		-	0.00	94	0	G			125424367	+1	tier1	-	no_errors	ENST00000373686	ensembl	human	known	74_37	missense	16.19	88	17	SNP	1.000	T
OR2D3	120775	genome.wustl.edu	37	11	6943135	6943135	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:6943135G>C	ENST00000317834.3	+	1	931	c.903G>C	c.(901-903)ttG>ttC	p.L301F		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	301						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTCCAATGTTGAACCCCATAA	0.428																																																	0													81.0	83.0	82.0					11																	6943135		2201	4296	6497	SO:0001583	missense	0			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.903G>C	11.37:g.6943135G>C	ENSP00000320560:p.Leu301Phe		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L301F	ENST00000317834.3	37	c.903	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530132	0.27387	.	.	ENSG00000178358	ENST00000317834	T	0.48522	0.81	4.95	0.683	0.17998	GPCR, rhodopsin-like superfamily (1);	0.908285	0.08905	N	0.876673	T	0.53449	0.1797	M	0.89715	3.055	0.35541	D	0.803051	P	0.40431	0.717	B	0.40134	0.32	T	0.63088	-0.6715	10	0.72032	D	0.01	-26.529	4.9735	0.14129	0.2699:0.0:0.5805:0.1496	.	301	Q8NGH3	OR2D3_HUMAN	F	301	ENSP00000320560:L301F	ENSP00000320560:L301F	L	+	3	2	OR2D3	6899711	0.976000	0.34144	0.990000	0.47175	0.632000	0.37999	0.065000	0.14466	0.363000	0.24346	0.655000	0.94253	TTG	OR2D3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000178358		0.428	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	HGNC	protein_coding	OTTHUMT00000385987.1	-	0.00	43	0	G	NM_001004684		6943135	+1	tier1	-	no_errors	ENST00000317834	ensembl	human	known	74_37	missense	14.08	61	10	SNP	0.896	C
OR2T6	254879	genome.wustl.edu	37	1	248550980	248550980	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:248550980C>T	ENST00000355728.2	+	1	71	c.71C>T	c.(70-72)tCa>tTa	p.S24L		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AATAAATGCTCAGGATTCTTT	0.433																																																	0													162.0	152.0	156.0					1																	248550980		2203	4300	6503	SO:0001583	missense	0			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.71C>T	1.37:g.248550980C>T	ENSP00000347965:p.Ser24Leu		A6NE36	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S24L	ENST00000355728.2	37	c.71	CCDS31114.1	1	.	.	.	.	.	.	.	.	.	.	C	9.809	1.182712	0.21870	.	.	ENSG00000198104	ENST00000355728	T	0.03035	4.07	4.9	3.73	0.42828	.	0.649485	0.12825	N	0.436157	T	0.03564	0.0102	L	0.44542	1.39	0.09310	N	1	B	0.25007	0.116	B	0.25614	0.062	T	0.38112	-0.9676	10	0.33141	T	0.24	.	2.9127	0.05742	0.2597:0.5514:0.0:0.1889	.	24	Q8NHC8	OR2T6_HUMAN	L	24	ENSP00000347965:S24L	ENSP00000347965:S24L	S	+	2	0	OR2T6	246617603	0.007000	0.16637	0.007000	0.13788	0.048000	0.14542	1.726000	0.38085	2.423000	0.82170	0.643000	0.83706	TCA	OR2T6	-	NULL	ENSG00000198104		0.433	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T6	HGNC	protein_coding	OTTHUMT00000097344.1	-	0.00	25	0	C	NM_001005471		248550980	+1	tier1	-	no_errors	ENST00000355728	ensembl	human	known	74_37	missense	20.41	39	10	SNP	0.000	T
OR4C5	79346	genome.wustl.edu	37	11	48387751	48387751	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:48387751G>T	ENST00000319813.3	-	1	266	c.267C>A	c.(265-267)ttC>ttA	p.F89L				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AGCCATCTATGAAGGAAAAGA	0.453																																																	0																																										SO:0001583	missense	0					11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.267C>A	11.37:g.48387751G>T	ENSP00000321338:p.Phe89Leu		Q6IFB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F89L	ENST00000319813.3	37	c.267		11	.	.	.	.	.	.	.	.	.	.	G	9.472	1.095910	0.20552	.	.	ENSG00000176540	ENST00000319813	T	0.00966	5.49	5.03	-0.502	0.12004	.	0.565621	0.17033	N	0.189628	T	0.00845	0.0028	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.50693	-0.8798	7	0.19590	T	0.45	.	8.8797	0.35367	0.4382:0.0:0.5617:0.0	.	.	.	.	L	89	ENSP00000321338:F89L	ENSP00000321338:F89L	F	-	3	2	OR4C5	48344327	0.000000	0.05858	0.914000	0.36105	0.951000	0.60555	-0.789000	0.04609	-0.034000	0.13713	0.465000	0.42564	TTC	OR4C5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176540		0.453	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	HGNC	protein_coding	OTTHUMT00000404174.1	-	0.00	33	0	G	NG_002247		48387751	-1	tier1	-	no_errors	ENST00000319813	ensembl	human	known	74_37	missense	13.95	37	6	SNP	0.035	T
OR5T3	390154	genome.wustl.edu	37	11	56020238	56020250	+	Frame_Shift_Del	DEL	TACATATAGTGGC	TACATATAGTGGC	-	rs61746551|rs530466744	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	TACATATAGTGGC	TACATATAGTGGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:56020238_56020250delTACATATAGTGGC	ENST00000303059.3	+	1	563_575	c.563_575delTACATATAGTGGC	c.(562-576)atacatatagtggctfs	p.IHIVA188fs		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					CATGCTACTATACATATAGTGGCTACATTTAGC	0.441																																																	0																																										SO:0001589	frameshift_variant	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.563_575delTACATATAGTGGC	11.37:g.56020238_56020250delTACATATAGTGGC	ENSP00000305403:p.Ile188fs		Q6IFC7	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I190fs	ENST00000303059.3	37	c.563_575	CCDS31524.1	11																																																																																			OR5T3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000172489		0.441	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1		0.00	116	0	TACATATAGTGGC	NM_001004747		56020250	+1			no_errors	ENST00000303059	ensembl	human	known	74_37	frame_shift_del	6.20	121	8	DEL	0.007:0.000:0.000:0.000:0.000:0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.000	0
OR5W2	390148	genome.wustl.edu	37	11	55681251	55681251	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:55681251G>T	ENST00000344514.1	-	1	807	c.808C>A	c.(808-810)Caa>Aaa	p.Q270K		NM_001001960.1	NP_001001960.1	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W, member 2	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(28)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATTTTATCTTGATCTAGAGAA	0.433																																					Melanoma(48;171 1190 15239 43886 49348)												0													71.0	80.0	77.0					11																	55681251		2201	4296	6497	SO:0001583	missense	0			BK004398	CCDS31513.1	11q11	2012-08-09		2004-03-10	ENSG00000187612	ENSG00000187612		"""GPCR / Class A : Olfactory receptors"""	15299	protein-coding gene	gene with protein product				OR5W2P, OR5W3P			Standard	NM_001001960		Approved		uc010rir.2	Q8NH69	OTTHUMG00000166818	ENST00000344514.1:c.808C>A	11.37:g.55681251G>T	ENSP00000342448:p.Gln270Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q270K	ENST00000344514.1	37	c.808	CCDS31513.1	11	.	.	.	.	.	.	.	.	.	.	G	7.597	0.672003	0.14776	.	.	ENSG00000187612	ENST00000344514	T	0.00137	8.68	5.01	-0.638	0.11500	GPCR, rhodopsin-like superfamily (1);	0.627848	0.13149	N	0.410070	T	0.00144	0.0004	L	0.39245	1.2	0.09310	N	1	B	0.17465	0.022	B	0.27887	0.084	T	0.11348	-1.0591	10	0.37606	T	0.19	.	12.0692	0.53607	0.0:0.4943:0.3786:0.1271	.	270	Q8NH69	OR5W2_HUMAN	K	270	ENSP00000342448:Q270K	ENSP00000342448:Q270K	Q	-	1	0	OR5W2	55437827	0.000000	0.05858	0.024000	0.17045	0.432000	0.31715	-2.799000	0.00762	-0.434000	0.07275	-0.326000	0.08463	CAA	OR5W2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000187612		0.433	OR5W2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5W2	HGNC	protein_coding	OTTHUMT00000391523.1	-	0.00	32	0	G	NM_001001960		55681251	-1	tier1	-	no_errors	ENST00000344514	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.000	T
OTOA	146183	genome.wustl.edu	37	16	21726332	21726332	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:21726332G>A	ENST00000286149.4	+	13	1390	c.1389G>A	c.(1387-1389)caG>caA	p.Q463Q	OTOA_ENST00000388958.3_Silent_p.Q449Q|OTOA_ENST00000388957.3_Silent_p.Q125Q|OTOA_ENST00000388956.4_Silent_p.Q370Q			Q7RTW8	OTOAN_HUMAN	otoancorin	463					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		ATGTCAGCCAGATGGGCGCAC	0.587																																																	0													124.0	115.0	118.0					16																	21726332		2199	4300	6499	SO:0001819	synonymous_variant	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1389G>A	16.37:g.21726332G>A			A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent	SNP	NULL	p.Q463	ENST00000286149.4	37	c.1389		16																																																																																			OTOA	-	NULL	ENSG00000155719		0.587	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	-	0.00	40	0	G			21726332	+1	tier1	-	no_errors	ENST00000286149	ensembl	human	known	74_37	silent	8.06	57	5	SNP	1.000	A
PABPC3	5042	genome.wustl.edu	37	13	25671027	25671027	+	Missense_Mutation	SNP	A	A	G	rs78826513	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr13:25671027A>G	ENST00000281589.3	+	1	728	c.691A>G	c.(691-693)Aaa>Gaa	p.K231E		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	231	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TGGAAAATCCAAAGGATTTGG	0.418																																																	0													81.0	76.0	78.0					13																	25671027		2203	4300	6503	SO:0001583	missense	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.691A>G	13.37:g.25671027A>G	ENSP00000281589:p.Lys231Glu		Q8NHV0|Q9H086	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.K231E	ENST00000281589.3	37	c.691	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	A	14.76	2.631048	0.46944	.	.	ENSG00000151846	ENST00000281589	T	0.08807	3.05	0.993	0.993	0.19825	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.49916	U	0.000136	T	0.27063	0.0663	M	0.90198	3.095	0.34162	D	0.668825	D	0.65815	0.995	D	0.67725	0.953	T	0.36553	-0.9743	10	0.87932	D	0	.	6.1165	0.20130	1.0:0.0:0.0:0.0	.	231	Q9H361	PABP3_HUMAN	E	231	ENSP00000281589:K231E	ENSP00000281589:K231E	K	+	1	0	PABPC3	24569027	0.998000	0.40836	0.994000	0.49952	0.967000	0.64934	2.374000	0.44274	0.692000	0.31613	0.374000	0.22700	AAA	PABPC3	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.418	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	-	0.00	55	0	A	NM_030979		25671027	+1	tier1	rs78826513	no_errors	ENST00000281589	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.999	G
PAPPA2	60676	genome.wustl.edu	37	1	176526316	176526316	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:176526316G>A	ENST00000367662.3	+	2	2022	c.858G>A	c.(856-858)gcG>gcA	p.A286A	PAPPA2_ENST00000367661.3_Silent_p.A286A	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	286					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCGGGAGGCGTTCACAGTGG	0.572																																																	0													20.0	21.0	21.0					1																	176526316		1953	4155	6108	SO:0001819	synonymous_variant	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.858G>A	1.37:g.176526316G>A			A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Silent	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.A286	ENST00000367662.3	37	c.858	CCDS41438.1	1																																																																																			PAPPA2	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like	ENSG00000116183		0.572	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	52	0	G			176526316	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	silent	9.41	77	8	SNP	1.000	A
PCDH15	65217	genome.wustl.edu	37	10	56077074	56077074	+	Missense_Mutation	SNP	C	C	T	rs369442293		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:56077074C>T	ENST00000320301.6	-	8	1227	c.833G>A	c.(832-834)cGt>cAt	p.R278H	PCDH15_ENST00000361849.3_Missense_Mutation_p.R278H|PCDH15_ENST00000395446.1_Missense_Mutation_p.R278H|PCDH15_ENST00000395438.1_Missense_Mutation_p.R278H|PCDH15_ENST00000395433.1_Missense_Mutation_p.R256H|PCDH15_ENST00000395445.1_Missense_Mutation_p.R278H|PCDH15_ENST00000414778.1_Missense_Mutation_p.R283H|PCDH15_ENST00000437009.1_Missense_Mutation_p.R278H|PCDH15_ENST00000395432.2_Missense_Mutation_p.R241H|PCDH15_ENST00000395442.1_Missense_Mutation_p.R278H|PCDH15_ENST00000373955.1_Missense_Mutation_p.R278H|PCDH15_ENST00000373957.3_Missense_Mutation_p.R256H|PCDH15_ENST00000395430.1_Missense_Mutation_p.R278H|PCDH15_ENST00000395440.1_Missense_Mutation_p.R278H|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.R278H	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	278	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				AGTGAGTGGACGGCAATCACG	0.448										HNSCC(58;0.16)			c|||	1	0.000199681	0.0008	0.0	5008	,	,		15100	0.0		0.0	False		,,,				2504	0.0																0									HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,4405		0,1,2202	143.0	117.0	126.0		848,833,833,833,722,767,848,833,848,833,767,833	4.8	1.0	10		126	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	PCDH15	NM_001142763.1,NM_001142764.1,NM_001142765.1,NM_001142766.1,NM_001142767.1,NM_001142768.1,NM_001142769.1,NM_001142770.1,NM_001142771.1,NM_001142772.1,NM_001142773.1,NM_033056.3	29,29,29,29,29,29,29,29,29,29,29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	283/1963,278/1958,278/1887,278/1953,241/1916,256/1936,283/1791,278/1540,283/1683,278/1678,256/1933,278/1956	56077074	1,13005	2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.833G>A	10.37:g.56077074C>T	ENSP00000322604:p.Arg278His		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R278H	ENST00000320301.6	37	c.833	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	20.4	3.982796	0.74474	2.27E-4	0.0	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57907	0.48;0.53;0.48;0.45;0.46;0.67;0.59;0.42;0.4;0.45;0.37;0.4;0.4;0.46;0.55	4.77	4.77	0.60923	Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.66056	0.2751	L	0.40543	1.245	0.26005	N	0.982064	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.997;0.997;0.997;0.998;0.997;1.0;0.988;0.997;0.997;0.993;0.993;0.996;0.993;0.997	D;P;P;P;P;P;D;P;P;P;P;P;P;P;P	0.85130	0.997;0.893;0.847;0.774;0.845;0.893;0.997;0.664;0.695;0.695;0.55;0.664;0.855;0.818;0.847	T	0.59804	-0.7385	9	0.42905	T	0.14	.	17.7447	0.88416	0.0:1.0:0.0:0.0	.	256;278;278;283;278;241;278;278;278;278;278;283;278;256;278	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	H	278;283;278;278;278;278;278;278;241;278;256;256;278;278;283;278;278	ENSP00000363076:R278H;ENSP00000410304:R283H;ENSP00000378826:R278H;ENSP00000378832:R278H;ENSP00000378833:R278H;ENSP00000378829:R278H;ENSP00000378827:R278H;ENSP00000378820:R241H;ENSP00000354950:R278H;ENSP00000378821:R256H;ENSP00000363068:R256H;ENSP00000322604:R278H;ENSP00000378818:R278H;ENSP00000412628:R278H;ENSP00000363066:R278H	ENSP00000322604:R278H	R	-	2	0	PCDH15	55747080	0.993000	0.37304	0.999000	0.59377	0.994000	0.84299	2.977000	0.49297	2.346000	0.79739	0.557000	0.71058	CGT	PCDH15	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000150275		0.448	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	45	0	C	NM_033056		56077074	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.983	T
PCDH17	27253	genome.wustl.edu	37	13	58208621	58208621	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr13:58208621G>A	ENST00000377918.3	+	1	1967	c.1941G>A	c.(1939-1941)acG>acA	p.T647T		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	647	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGATCCGCACGCTGCACCCTT	0.642																																					Melanoma(72;952 1291 1619 12849 33676)												0													99.0	99.0	99.0					13																	58208621		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1941G>A	13.37:g.58208621G>A			A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T647	ENST00000377918.3	37	c.1941	CCDS31986.1	13																																																																																			PCDH17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000118946		0.642	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	16	0	G	NM_001040429		58208621	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	silent	36.36	7	4	SNP	0.990	A
PCDHA7	56141	genome.wustl.edu	37	5	140215259	140215259	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:140215259G>T	ENST00000525929.1	+	1	1291	c.1291G>T	c.(1291-1293)Ggc>Tgc	p.G431C	PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.G431C|PCDHA3_ENST00000522353.2_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	431	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGGACGGGGGCTCGCCTTC	0.627																																					NSCLC(160;258 2013 5070 22440 28951)												0													90.0	93.0	92.0					5																	140215259		2203	4300	6503	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.1291G>T	5.37:g.140215259G>T	ENSP00000436426:p.Gly431Cys		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G431C	ENST00000525929.1	37	c.1291	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	G	16.01	3.000267	0.54147	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.03524	3.9;3.9	4.04	4.04	0.47022	Cadherin (5);Cadherin-like (1);	0.000000	0.32002	U	0.006730	T	0.33118	0.0852	H	0.98682	4.3	0.47037	D	0.999298	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.62358	-0.6871	10	0.87932	D	0	.	16.5697	0.84608	0.0:0.0:1.0:0.0	.	431;431	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	C	431	ENSP00000436426:G431C;ENSP00000367365:G431C	ENSP00000367365:G431C	G	+	1	0	PCDHA7	140195443	1.000000	0.71417	0.855000	0.33649	0.213000	0.24496	7.446000	0.80609	1.955000	0.56771	0.305000	0.20034	GGC	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000204963		0.627	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	128	0	G	NM_018910		140215259	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	16.20	150	29	SNP	0.990	T
PCDHA9	9752	genome.wustl.edu	37	5	140228251	140228251	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:140228251G>A	ENST00000532602.1	+	1	1204	c.171G>A	c.(169-171)gcG>gcA	p.A57A	PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.A57A	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	57	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGAGCTGGCGGAGCTGGTGC	0.632																																					Melanoma(55;1800 1972 14909)												0													52.0	58.0	56.0					5																	140228251		2195	4260	6455	SO:0001819	synonymous_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.171G>A	5.37:g.140228251G>A			O15053|Q2M3S5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A57	ENST00000532602.1	37	c.171	CCDS54920.1	5																																																																																			PCDHA9	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204961		0.632	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	-	0.00	74	0	G	NM_031857		140228251	+1	tier1	-	no_errors	ENST00000532602	ensembl	human	known	74_37	silent	17.48	85	18	SNP	0.005	A
PCLO	27445	genome.wustl.edu	37	7	82579600	82579600	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:82579600C>T	ENST00000333891.9	-	6	10641	c.10304G>A	c.(10303-10305)cGa>cAa	p.R3435Q	PCLO_ENST00000423517.2_Missense_Mutation_p.R3435Q|PCLO_ENST00000437081.1_Missense_Mutation_p.R155Q	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTAAAACTTCGGGGATCATC	0.423																																																	0													122.0	112.0	115.0					7																	82579600		1895	4125	6020	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.10304G>A	7.37:g.82579600C>T	ENSP00000334319:p.Arg3435Gln			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.R3435Q	ENST00000333891.9	37	c.10304	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	7.128	0.579263	0.13686	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T;T	0.34859	2.35;2.35;1.34	5.95	5.08	0.68730	.	.	.	.	.	T	0.37758	0.1015	L	0.59436	1.845	0.09310	N	1	P;D;D	0.56521	0.897;0.976;0.976	B;B;B	0.42422	0.162;0.387;0.387	T	0.35847	-0.9772	9	0.87932	D	0	.	12.17	0.54152	0.0:0.8634:0.0:0.1366	.	3366;3435;3435	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	Q	3366;3435;3435;155	ENSP00000334319:R3435Q;ENSP00000388393:R3435Q;ENSP00000393760:R155Q	ENSP00000334319:R3435Q	R	-	2	0	PCLO	82417536	0.591000	0.26824	0.306000	0.25113	0.745000	0.42441	3.092000	0.50207	1.537000	0.49254	0.655000	0.94253	CGA	PCLO	-	NULL	ENSG00000186472		0.423	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	74	0	C	NM_014510		82579600	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	11.46	85	11	SNP	0.069	T
PDE1B	5153	genome.wustl.edu	37	12	54967206	54967206	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:54967206C>T	ENST00000243052.3	+	9	1340	c.904C>T	c.(904-906)Cga>Tga	p.R302*	PDE1B_ENST00000538346.1_Nonsense_Mutation_p.R261*|PDE1B_ENST00000550620.1_Nonsense_Mutation_p.R282*|PDE1B_ENST00000394277.3_3'UTR	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	302	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTCTGTTTTCCGATTGATGCA	0.468																																																	0													153.0	134.0	140.0					12																	54967206		2203	4300	6503	SO:0001587	stop_gained	0			U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.904C>T	12.37:g.54967206C>T	ENSP00000243052:p.Arg302*		Q92825|Q96KP3	Nonsense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.R302*	ENST00000243052.3	37	c.904	CCDS8882.1	12	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842157	0.91197	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	.	.	.	4.59	4.59	0.56863	.	0.079812	0.49916	D	0.000135	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.301	0.73952	0.0:1.0:0.0:0.0	.	.	.	.	X	302;261;282	.	ENSP00000243052:R302X	R	+	1	2	PDE1B	53253473	1.000000	0.71417	0.971000	0.41717	0.404000	0.30871	2.829000	0.48128	2.543000	0.85770	0.650000	0.86243	CGA	PDE1B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000123360		0.468	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE1B	HGNC	protein_coding	OTTHUMT00000406203.1	-	0.00	30	0	C			54967206	+1	tier1	-	no_errors	ENST00000243052	ensembl	human	known	74_37	nonsense	36.11	23	13	SNP	1.000	T
PGBD5	79605	genome.wustl.edu	37	1	230468761	230468761	+	Missense_Mutation	SNP	C	C	T	rs371374137		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:230468761C>T	ENST00000525115.1	-	5	918	c.895G>A	c.(895-897)Gcg>Acg	p.A299T	PGBD5_ENST00000321327.2_Missense_Mutation_p.A398T|PGBD5_ENST00000530424.1_5'UTR|PGBD5_ENST00000391860.1_Missense_Mutation_p.A253T			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	299						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		CTCTTCCGCGCGCGGAGCAAG	0.652																																																	0									THR/ALA	0,4404		0,0,2202	45.0	44.0	45.0		895	-5.3	0.8	1		45	1,8595		0,1,4297	no	missense	PGBD5	NM_024554.3	58	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign	299/456	230468761	1,12999	2202	4298	6500	SO:0001583	missense	0			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.895G>A	1.37:g.230468761C>T	ENSP00000431404:p.Ala299Thr		A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	NULL	p.A398T	ENST00000525115.1	37	c.1192		1	.	.	.	.	.	.	.	.	.	.	-	10.34	1.323653	0.24080	0.0	1.16E-4	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.17370	2.28;2.28;2.28	5.5	-5.32	0.02722	.	0.384691	0.32357	N	0.006213	T	0.03871	0.0109	N	0.03608	-0.345	0.21841	N	0.999519	B	0.06786	0.001	B	0.04013	0.001	T	0.28073	-1.0055	10	0.13108	T	0.6	-8.0227	2.2615	0.04068	0.2885:0.293:0.2939:0.1246	.	299	Q8N414	PGBD5_HUMAN	T	253;398;299	ENSP00000375733:A253T;ENSP00000322530:A398T;ENSP00000431404:A299T	ENSP00000322530:A398T	A	-	1	0	PGBD5	228535384	0.225000	0.23685	0.807000	0.32361	0.776000	0.43924	-0.333000	0.07894	-1.466000	0.01897	-0.930000	0.02707	GCG	PGBD5	-	NULL	ENSG00000177614		0.652	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	-	0.00	71	0	C	NM_024554		230468761	-1	tier1	-	no_errors	ENST00000321327	ensembl	human	known	74_37	missense	17.27	91	19	SNP	0.644	T
PITRM1	10531	genome.wustl.edu	37	10	3212331	3212331	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:3212331G>C	ENST00000224949.4	-	2	158	c.124C>G	c.(124-126)Cta>Gta	p.L42V	PITRM1_ENST00000451104.2_Intron|PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.L42V			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	42					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						TTGTCTCCTAGTTTATACTGC	0.483																																																	0													121.0	123.0	122.0					10																	3212331		1992	4180	6172	SO:0001583	missense	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.124C>G	10.37:g.3212331G>C	ENSP00000224949:p.Leu42Val		B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	pfam_Peptidase_M16C_assoc,pfam_Peptidase_M16_C,pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16	p.L42V	ENST00000224949.4	37	c.124	CCDS59208.1	10	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.508293	0.00153	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989	T;T	0.03496	3.91;3.91	5.6	-0.757	0.11054	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.618212	0.17573	N	0.169403	T	0.00637	0.0021	N	0.00154	-1.97	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.0	T	0.43180	-0.9407	10	0.02654	T	1	.	2.3175	0.04202	0.0981:0.3062:0.2933:0.3025	.	35;42;42;42;35	E9PDX6;Q5JRX3-2;C9JSL2;Q5JRX3;B4DH07	.;.;.;PREP_HUMAN;.	V	42;35;42	ENSP00000224949:L42V;ENSP00000370377:L42V	ENSP00000224949:L42V	L	-	1	2	PITRM1	3202331	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.230000	0.17852	-0.149000	0.11215	-1.181000	0.01715	CTA	PITRM1	-	superfamily_Metalloenz_LuxS/M16	ENSG00000107959		0.483	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	-	0.00	59	0	G			3212331	-1	tier1	-	no_errors	ENST00000380989	ensembl	human	known	74_37	missense	8.86	72	7	SNP	0.000	C
PLXND1	23129	genome.wustl.edu	37	3	129290394	129290394	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:129290394C>G	ENST00000324093.4	-	17	3472	c.3294G>C	c.(3292-3294)caG>caC	p.Q1098H	PLXND1_ENST00000393239.1_Missense_Mutation_p.Q1098H	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1098	IPT/TIG 3.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						TGGACACATTCTGCACCATGT	0.662																																					Ovarian(97;366 1484 3738 22084 39045)												0													55.0	57.0	57.0					3																	129290394		2203	4300	6503	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3294G>C	3.37:g.129290394C>G	ENSP00000317128:p.Gln1098His		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Q1098H	ENST00000324093.4	37	c.3294	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758795	0.89843	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.78003	-1.14;-1.14	4.74	4.74	0.60224	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.247728	0.36893	N	0.002359	D	0.88629	0.6488	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90297	0.4327	10	0.66056	D	0.02	.	17.7426	0.88411	0.0:1.0:0.0:0.0	.	1098	Q9Y4D7	PLXD1_HUMAN	H	1098	ENSP00000317128:Q1098H;ENSP00000376931:Q1098H	ENSP00000317128:Q1098H	Q	-	3	2	PLXND1	130773084	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	6.671000	0.74472	2.196000	0.70406	0.561000	0.74099	CAG	PLXND1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000004399		0.662	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4		0.00	34	0	C	NM_015103		129290394	-1			no_errors	ENST00000324093	ensembl	human	known	74_37	missense	10.91	49	6	SNP	1.000	G
PLOD2	5352	genome.wustl.edu	37	3	145806375	145806375	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:145806375T>C	ENST00000360060.3	-	9	1180	c.1003A>G	c.(1003-1005)Aaa>Gaa	p.K335E	PLOD2_ENST00000282903.5_Missense_Mutation_p.K335E|RP11-274H2.2_ENST00000480247.1_RNA|PLOD2_ENST00000461497.1_5'Flank|PLOD2_ENST00000494950.1_Missense_Mutation_p.K280E	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	335					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	ATACTTACTTTGTTATGAATA	0.289																																																	0													49.0	49.0	49.0					3																	145806375		2200	4297	6497	SO:0001583	missense	0			U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.1003A>G	3.37:g.145806375T>C	ENSP00000353170:p.Lys335Glu		B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.K335E	ENST00000360060.3	37	c.1003	CCDS3131.1	3	.	.	.	.	.	.	.	.	.	.	T	17.70	3.453402	0.63290	.	.	ENSG00000152952	ENST00000282903;ENST00000360060;ENST00000494950	D;D;D	0.84442	-1.85;-1.85;-1.85	5.38	5.38	0.77491	.	0.289528	0.42821	D	0.000656	T	0.76579	0.4007	N	0.24115	0.695	0.37219	D	0.905188	B;B;B	0.18013	0.025;0.004;0.002	B;B;B	0.18871	0.022;0.01;0.023	T	0.73858	-0.3850	10	0.24483	T	0.36	-21.4329	15.3892	0.74729	0.0:0.0:0.0:1.0	.	280;335;335	E7ETU9;O00469;O00469-2	.;PLOD2_HUMAN;.	E	335;335;280	ENSP00000282903:K335E;ENSP00000353170:K335E;ENSP00000420094:K280E	ENSP00000282903:K335E	K	-	1	0	PLOD2	147289065	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.901000	0.69861	2.040000	0.60383	0.528000	0.53228	AAA	PLOD2	-	NULL	ENSG00000152952		0.289	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD2	HGNC	protein_coding	OTTHUMT00000355185.1	-	0.00	22	0	T	NM_000935		145806375	-1	tier1	-	no_errors	ENST00000282903	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	C
PNMAL2	57469	genome.wustl.edu	37	19	46995440	46995440	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:46995440G>A	ENST00000377655.2	-	2	738	c.739C>T	c.(739-741)Ccc>Tcc	p.P247S	PNMAL2_ENST00000594749.1_Intron|PPP5D1_ENST00000595691.1_5'Flank|AC011484.1_ENST00000377652.3_5'Flank|PNMAL2_ENST00000599531.1_3'UTR			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	247				GP -> A (in Ref. 1; BAC85931). {ECO:0000305}.						central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GTGGGGCAGGGCCCCCTGGCA	0.582																																																	0																																										SO:0001583	missense	0			AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.739C>T	19.37:g.46995440G>A	ENSP00000366883:p.Pro247Ser		C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Missense_Mutation	SNP	NULL	p.P247S	ENST00000377655.2	37	c.739		19	.	.	.	.	.	.	.	.	.	.	G	8.696	0.908524	0.17833	.	.	ENSG00000204851	ENST00000377655	T	0.22539	1.95	1.98	0.743	0.18347	.	.	.	.	.	T	0.19446	0.0467	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24190	-1.0167	6	0.42905	T	0.14	.	6.798	0.23736	0.0:0.36:0.64:0.0	.	.	.	.	S	247	ENSP00000366883:P247S	ENSP00000366883:P247S	P	-	1	0	PNMAL2	51687280	0.000000	0.05858	0.007000	0.13788	0.113000	0.19764	-0.133000	0.10451	0.331000	0.23511	0.462000	0.41574	CCC	PNMAL2	-	NULL	ENSG00000204851		0.582	PNMAL2-201	KNOWN	basic	protein_coding	PNMAL2	HGNC	protein_coding		-	0.00	48	0	G	NM_020709		46995440	-1	tier1	-	no_errors	ENST00000377655	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.007	A
PPL	5493	genome.wustl.edu	37	16	4938211	4938211	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr16:4938211C>T	ENST00000345988.2	-	20	2495	c.2406G>A	c.(2404-2406)gaG>gaA	p.E802E	PPL_ENST00000590782.2_Silent_p.E800E	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	802					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CTGCTTCTAACTCATAGTCCT	0.507																																																	0													108.0	99.0	102.0					16																	4938211		2197	4300	6497	SO:0001819	synonymous_variant	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.2406G>A	16.37:g.4938211C>T			O60314|O60454|Q14C98	Silent	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.E802	ENST00000345988.2	37	c.2406	CCDS10526.1	16																																																																																			PPL	-	smart_Spectrin/alpha-actinin	ENSG00000118898		0.507	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1	-	0.00	57	0	C	NM_002705		4938211	-1	tier1	-	no_errors	ENST00000345988	ensembl	human	known	74_37	silent	19.12	54	13	SNP	0.580	T
GRIN3A	116443	genome.wustl.edu	37	9	104356900	104356900	+	Intron	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr9:104356900C>T	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.D105N	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CCATCTTTATCCATGTCGTAA	0.532																																																	0													147.0	133.0	138.0					9																	104356900		2203	4300	6503	SO:0001627	intron_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15258G>A	9.37:g.104356900C>T			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.D105N	ENST00000361820.3	37	c.313	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	23.9	4.474478	0.84640	.	.	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.74947	-0.89	3.97	3.97	0.46021	EF-hand-like domain (1);	0.000000	0.43260	D	0.000599	T	0.67785	0.2930	N	0.16743	0.435	0.48571	D	0.999673	B	0.31879	0.344	B	0.43225	0.412	T	0.72737	-0.4203	10	0.87932	D	0	-19.1265	14.3488	0.66685	0.0:1.0:0.0:0.0	.	102	Q96LZ3	CANB2_HUMAN	N	105	ENSP00000363939:D105N	ENSP00000363939:D105N	D	-	1	0	PPP3R2	103396721	1.000000	0.71417	0.994000	0.49952	0.971000	0.66376	7.490000	0.81461	2.507000	0.84556	0.563000	0.77884	GAT	PPP3R2	-	smart_EF_hand_dom,pfscan_EF_hand_dom	ENSG00000188386		0.532	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP3R2	HGNC	protein_coding	OTTHUMT00000053453.1	-	0.00	52	0	C			104356900	-1	tier1	-	no_errors	ENST00000374806	ensembl	human	known	74_37	missense	16.00	42	8	SNP	1.000	T
PREX1	57580	genome.wustl.edu	37	20	47248873	47248873	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:47248873G>T	ENST00000371941.3	-	35	4490	c.4468C>A	c.(4468-4470)Cag>Aag	p.Q1490K	PREX1_ENST00000396220.1_Nonsense_Mutation_p.C1524*	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1490					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			ATGTCCTGCTGCAAATCCTCC	0.647																																																	0													136.0	131.0	133.0					20																	47248873		2203	4300	6503	SO:0001583	missense	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.4468C>A	20.37:g.47248873G>T	ENSP00000361009:p.Gln1490Lys		E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.C1524*	ENST00000371941.3	37	c.4572	CCDS13410.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.480410|8.480410	0.98829|0.98829	.|.	.|.	ENSG00000124126|ENSG00000124126	ENST00000396220|ENST00000371941	.|T	.|0.38077	.|1.16	4.49|4.49	3.51|3.51	0.40186|0.40186	.|.	.|0.250921	.|0.26995	.|U	.|0.021459	.|T	.|0.40694	.|0.1127	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	A|A	1|1	.|P;P	.|0.39071	.|0.658;0.604	.|B;B	.|0.38755	.|0.22;0.281	.|T	.|0.60611	.|-0.7229	.|9	0.87932|0.87932	D|D	0|0	.|.	14.2702|14.2702	0.66147|0.66147	0.0:0.1501:0.8498:0.0|0.0:0.1501:0.8498:0.0	.|.	.|1490;787	.|Q8TCU6;Q8TCU6-2	.|PREX1_HUMAN;.	X|K	1524|1490	.|ENSP00000361009:Q1490K	ENSP00000379522:C1524X|ENSP00000361009:Q1490K	C|Q	-|-	3|1	2|0	PREX1|PREX1	46682280|46682280	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.202000|0.202000	0.24057|0.24057	7.542000|7.542000	0.82095|0.82095	0.840000|0.840000	0.34995|0.34995	0.456000|0.456000	0.33151|0.33151	TGC|CAG	PREX1	-	NULL	ENSG00000124126		0.647	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	-	0.00	61	0	G	NM_020820		47248873	-1	tier1	-	no_errors	ENST00000396220	ensembl	human	known	74_37	nonsense	15.22	78	14	SNP	1.000	T
PRX	57716	genome.wustl.edu	37	19	40902249	40902249	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:40902249C>A	ENST00000324001.7	-	7	2280	c.2010G>T	c.(2008-2010)atG>atT	p.M670I	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	670	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCATCTCAGGCATTTTAGGGA	0.582																																																	0													88.0	99.0	95.0					19																	40902249		2203	4300	6503	SO:0001583	missense	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2010G>T	19.37:g.40902249C>A	ENSP00000326018:p.Met670Ile		Q9BXL9|Q9HCF2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M670I	ENST00000324001.7	37	c.2010	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	0.498	-0.872185	0.02570	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01918	4.56	4.09	0.737	0.18314	.	0.632021	0.13782	N	0.363154	T	0.01489	0.0048	N	0.22421	0.69	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.49123	-0.8972	10	0.10111	T	0.7	-2.5123	5.7756	0.18277	0.0:0.586:0.0:0.414	.	670	Q9BXM0	PRAX_HUMAN	I	670	ENSP00000326018:M670I	ENSP00000326018:M670I	M	-	3	0	PRX	45594089	0.043000	0.20138	0.120000	0.21714	0.016000	0.09150	-0.191000	0.09601	0.504000	0.28082	-0.142000	0.14014	ATG	PRX	-	NULL	ENSG00000105227		0.582	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	-	0.00	27	0	C	NM_020956		40902249	-1	tier1	-	no_errors	ENST00000324001	ensembl	human	known	74_37	missense	14.81	46	8	SNP	0.022	A
PRKCG	5582	genome.wustl.edu	37	19	54407957	54407957	+	Silent	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:54407957C>G	ENST00000263431.3	+	16	2007	c.1725C>G	c.(1723-1725)ccC>ccG	p.P575P	PRKCG_ENST00000542049.1_Intron|PRKCG_ENST00000540413.1_Silent_p.P575P	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	575	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	TCACCTACCCCAAGTCGCTTT	0.587																																																	0													105.0	76.0	86.0					19																	54407957		2203	4300	6503	SO:0001819	synonymous_variant	0			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1725C>G	19.37:g.54407957C>G			B7Z8Q0	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P575	ENST00000263431.3	37	c.1725	CCDS12867.1	19																																																																																			PRKCG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_dom	ENSG00000126583		0.587	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	-	0.00	29	0	C	NM_002739		54407957	+1	tier1	-	no_errors	ENST00000540413	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	G
PTPN5	84867	genome.wustl.edu	37	11	18751321	18751321	+	Silent	SNP	G	G	T	rs146205574		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:18751321G>T	ENST00000358540.2	-	13	1804	c.1374C>A	c.(1372-1374)tcC>tcA	p.S458S	PTPN5_ENST00000396171.4_Silent_p.S458S|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396168.1_Silent_p.S434S|PTPN5_ENST00000396170.1_Silent_p.S426S|PTPN5_ENST00000396167.2_Silent_p.S426S|PTPN5_ENST00000396166.3_Silent_p.S64S|PTPN5_ENST00000477854.1_Silent_p.S262S	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	458	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)	p.S458S(2)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GGTCGGGCCAGGATGTGAACC	0.642																																																	2	Substitution - coding silent(2)	endometrium(2)											54.0	66.0	62.0					11																	18751321		2167	4278	6445	SO:0001819	synonymous_variant	0			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1374C>A	11.37:g.18751321G>T			B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Silent	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S458	ENST00000358540.2	37	c.1374	CCDS7845.1	11																																																																																			PTPN5	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000110786		0.642	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	HGNC	protein_coding	OTTHUMT00000259196.2		0.00	34	0	G	NM_001039970		18751321	-1			no_errors	ENST00000358540	ensembl	human	known	74_37	silent	5.71	33	2	SNP	0.997	T
PVRL1	5818	genome.wustl.edu	37	11	119549379	119549379	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:119549379C>A	ENST00000264025.3	-	2	706	c.176G>T	c.(175-177)aGc>aTc	p.S59I	PVRL1_ENST00000340882.2_Missense_Mutation_p.S59I|PVRL1_ENST00000341398.2_Missense_Mutation_p.S59I|PVRL1_ENST00000524510.1_5'UTR	NM_002855.4	NP_002846.3	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 (herpesvirus entry mediator C)	59	Ig-like V-type.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|desmosome organization (GO:0002934)|enamel mineralization (GO:0070166)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|immune response (GO:0006955)|iron ion transport (GO:0006826)|lens morphogenesis in camera-type eye (GO:0002089)|regulation of synapse assembly (GO:0051963)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|viral entry into host cell (GO:0046718)	adherens junction (GO:0005912)|axon (GO:0030424)|cell-cell adherens junction (GO:0005913)|extracellular region (GO:0005576)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|protein homodimerization activity (GO:0042803)|virion binding (GO:0046790)|virus receptor activity (GO:0001618)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		GATCTTCACGCTGGGAAGCGG	0.597																																																	0													91.0	71.0	78.0					11																	119549379		2199	4295	6494	SO:0001583	missense	0			X76400	CCDS8425.1, CCDS8426.1, CCDS8427.1	11q23-q24	2013-01-29	2007-06-07		ENSG00000110400	ENSG00000110400		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9706	protein-coding gene	gene with protein product	"""nectin"""	600644		HVEC, ED4		7721102, 9616127	Standard	NM_203285		Approved	PRR, PRR1, PVRR1, SK-12, HIgR, CLPED1, CD111, OFC7	uc001pwv.3	Q15223	OTTHUMG00000166177	ENST00000264025.3:c.176G>T	11.37:g.119549379C>A	ENSP00000264025:p.Ser59Ile		O75465|Q2M3D3|Q9HBE6|Q9HBW2	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S59I	ENST00000264025.3	37	c.176	CCDS8426.1	11	.	.	.	.	.	.	.	.	.	.	C	12.85	2.060356	0.36373	.	.	ENSG00000110400	ENST00000341398;ENST00000264025;ENST00000340882	D;D;D	0.94280	-3.39;-3.39;-3.39	5.55	-4.06	0.03986	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.707152	0.15558	N	0.256089	D	0.84750	0.5541	L	0.47190	1.495	0.09310	N	0.999999	B;B;B	0.14805	0.003;0.002;0.011	B;B;B	0.09377	0.001;0.002;0.004	T	0.69884	-0.5024	9	.	.	.	.	1.0129	0.01501	0.1625:0.269:0.2594:0.3091	.	59;59;59	Q15223-3;Q15223;Q15223-2	.;PVRL1_HUMAN;.	I	59	ENSP00000344974:S59I;ENSP00000264025:S59I;ENSP00000345289:S59I	.	S	-	2	0	PVRL1	119054589	0.003000	0.15002	0.051000	0.19133	0.912000	0.54170	-0.020000	0.12525	-0.185000	0.10550	0.462000	0.41574	AGC	PVRL1	-	pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000110400		0.597	PVRL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL1	HGNC	protein_coding	OTTHUMT00000388231.1		0.00	30	0	C			119549379	-1			no_errors	ENST00000264025	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.000	A
PZP	5858	genome.wustl.edu	37	12	9354962	9354962	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:9354962A>G	ENST00000261336.2	-	4	461	c.433T>C	c.(433-435)Ttc>Ctc	p.F145L	PZP_ENST00000381997.2_Missense_Mutation_p.F14L	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	145					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ACAACACGGAATCTTACTGGA	0.443																																					Melanoma(125;1402 1695 4685 34487 38571)												0													88.0	80.0	82.0					12																	9354962		2203	4300	6503	SO:0001583	missense	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.433T>C	12.37:g.9354962A>G	ENSP00000261336:p.Phe145Leu		A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.F145L	ENST00000261336.2	37	c.433	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	A	15.51	2.856139	0.51376	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.73681	-0.77;-0.77	2.44	2.44	0.29823	Alpha-2-macroglobulin, N-terminal (1);	0.000000	0.56097	U	0.000038	T	0.79329	0.4427	M	0.74467	2.265	0.09310	N	1	P;D	0.54207	0.705;0.965	B;P	0.57057	0.196;0.812	T	0.68988	-0.5264	10	0.87932	D	0	.	6.7838	0.23662	1.0:0.0:0.0:0.0	.	14;145	P20742-2;P20742	.;PZP_HUMAN	L	145;14	ENSP00000261336:F145L;ENSP00000371427:F14L	ENSP00000261336:F145L	F	-	1	0	PZP	9246229	0.118000	0.22208	0.003000	0.11579	0.224000	0.24922	3.054000	0.49908	1.389000	0.46526	0.377000	0.23210	TTC	PZP	-	pfam_A2M_N	ENSG00000126838		0.443	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	-	0.00	57	0	A	NM_002864		9354962	-1	tier1	-	no_errors	ENST00000261336	ensembl	human	known	74_37	missense	17.74	51	11	SNP	0.004	G
QPCTL	54814	genome.wustl.edu	37	19	46196806	46196806	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:46196806G>T	ENST00000012049.5	+	2	564	c.343G>T	c.(343-345)Gtc>Ttc	p.V115F	SNRPD2_ENST00000588599.1_5'Flank|SNRPD2_ENST00000585392.1_5'Flank|SNRPD2_ENST00000590212.1_5'Flank|SNRPD2_ENST00000342669.3_5'Flank|SNRPD2_ENST00000587367.1_5'Flank|SNRPD2_ENST00000587579.1_5'Flank|SNRPD2_ENST00000391932.3_5'Flank|SNRPD2_ENST00000588301.1_5'Flank|QPCTL_ENST00000366382.4_Missense_Mutation_p.V115F	NM_017659.3	NP_060129.2	Q9NXS2	QPCTL_HUMAN	glutaminyl-peptide cyclotransferase-like	115					peptidyl-pyroglutamic acid biosynthetic process, using glutaminyl-peptide cyclotransferase (GO:0017186)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glutaminyl-peptide cyclotransferase activity (GO:0016603)|zinc ion binding (GO:0008270)	p.V115L(1)		breast(1)|cervix(2)|endometrium(1)|lung(5)|skin(1)|stomach(1)	11		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0059)|GBM - Glioblastoma multiforme(486;0.0882)|Epithelial(262;0.208)		AAATCTCCAAGTCAGAAAGGT	0.577											OREG0025560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	breast(1)											66.0	75.0	72.0					19																	46196806		2203	4300	6503	SO:0001583	missense	0			AK000091	CCDS12672.1, CCDS54282.1	19q13.32	2014-09-04			ENSG00000011478	ENSG00000011478			25952	protein-coding gene	gene with protein product	"""glutaminyl cyclase-like"""						Standard	NM_017659		Approved	FLJ20084	uc010xxr.2	Q9NXS2	OTTHUMG00000182131	ENST00000012049.5:c.343G>T	19.37:g.46196806G>T	ENSP00000012049:p.Val115Phe	937	Q53HE4|Q96F74	Missense_Mutation	SNP	pfam_Peptidase_M28	p.V115F	ENST00000012049.5	37	c.343	CCDS12672.1	19	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062238	0.55432	.	.	ENSG00000011478	ENST00000012049;ENST00000366382	T;T	0.24723	1.84;2.0	5.34	5.34	0.76211	.	0.060489	0.64402	D	0.000003	T	0.57829	0.2080	M	0.90252	3.1	0.32797	N	0.500337	D	0.89917	1.0	D	0.74023	0.982	T	0.73997	-0.3806	10	0.87932	D	0	-28.758	14.5475	0.68041	0.0:0.0:1.0:0.0	.	115	Q9NXS2	QPCTL_HUMAN	F	115	ENSP00000012049:V115F;ENSP00000387944:V115F	ENSP00000012049:V115F	V	+	1	0	QPCTL	50888646	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.230000	0.58632	2.514000	0.84764	0.462000	0.41574	GTC	QPCTL	-	NULL	ENSG00000011478		0.577	QPCTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QPCTL	HGNC	protein_coding	OTTHUMT00000459656.1		0.00	36	0	G	NM_017659		46196806	+1			no_errors	ENST00000012049	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
RAB11FIP1	80223	genome.wustl.edu	37	8	37730432	37730432	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr8:37730432A>T	ENST00000330843.4	-	4	1900	c.1888T>A	c.(1888-1890)Ttg>Atg	p.L630M	RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000523182.1_5'UTR|RAB11FIP1_ENST00000522727.1_Intron	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	630					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			TTAGGGAGCAAGGGTGGTCCT	0.517																																																	0													112.0	105.0	107.0					8																	37730432		2203	4300	6503	SO:0001583	missense	0			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1888T>A	8.37:g.37730432A>T	ENSP00000331342:p.Leu630Met		J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L630M	ENST00000330843.4	37	c.1888	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	A	16.00	2.998851	0.54147	.	.	ENSG00000156675	ENST00000330843	T	0.17854	2.25	5.49	-11.0	0.00169	.	1.902110	0.02696	N	0.111253	T	0.08133	0.0203	N	0.24115	0.695	0.09310	N	1	B	0.22003	0.063	B	0.19666	0.026	T	0.20605	-1.0270	10	0.48119	T	0.1	3.1235	1.4705	0.02414	0.4861:0.172:0.1713:0.1706	.	630	Q6WKZ4	RFIP1_HUMAN	M	630	ENSP00000331342:L630M	ENSP00000331342:L630M	L	-	1	2	RAB11FIP1	37849590	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.478000	0.06575	-2.144000	0.00802	-0.242000	0.12053	TTG	RAB11FIP1	-	NULL	ENSG00000156675		0.517	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	HGNC	protein_coding	OTTHUMT00000376816.1	-	0.00	23	0	A	NM_025151		37730432	-1	tier1	-	no_errors	ENST00000330843	ensembl	human	known	74_37	missense	38.75	49	31	SNP	0.000	T
RAD54L	8438	genome.wustl.edu	37	1	46733163	46733163	+	Silent	SNP	T	T	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:46733163T>A	ENST00000371975.4	+	9	1598	c.924T>A	c.(922-924)acT>acA	p.T308T	RAD54L_ENST00000442598.1_Silent_p.T308T|RAD54L_ENST00000473251.1_3'UTR	NM_003579.3	NP_003570.2	Q92698	RAD54_HUMAN	RAD54-like (S. cerevisiae)	308	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				chromosome organization (GO:0051276)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	25	Acute lymphoblastic leukemia(166;0.155)	Breast(1374;0.0634)		KIRC - Kidney renal clear cell carcinoma(1967;0.000896)		AGAATCAGACTTACCAAGCCC	0.493								Direct reversal of damage;Homologous recombination																																									0													96.0	91.0	93.0					1																	46733163		2203	4300	6503	SO:0001819	synonymous_variant	0			X97795	CCDS532.1	1p32	2008-02-05	2001-11-28		ENSG00000085999	ENSG00000085999			9826	protein-coding gene	gene with protein product		603615	"""RAD54 (S.cerevisiae)-like"""			8805304	Standard	NM_003579		Approved	hHR54, hRAD54, RAD54A	uc009vye.2	Q92698	OTTHUMG00000007772	ENST00000371975.4:c.924T>A	1.37:g.46733163T>A			Q5TE31|Q6IUY3	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_Rad54_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T308	ENST00000371975.4	37	c.924	CCDS532.1	1																																																																																			RAD54L	-	pfam_SNF2_N,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000085999		0.493	RAD54L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L	HGNC	protein_coding	OTTHUMT00000021272.1	-	0.00	30	0	T	NM_003579		46733163	+1	tier1	-	no_errors	ENST00000371975	ensembl	human	known	74_37	silent	29.63	19	8	SNP	0.843	A
RBBP7	5931	genome.wustl.edu	37	X	16864049	16864050	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:16864049_16864050delCT	ENST00000380087.2	-	11	1470_1471	c.1110_1111delAG	c.(1108-1113)ggaggafs	p.GG370fs	RBBP7_ENST00000380084.4_Frame_Shift_Del_p.GG414fs|RBBP7_ENST00000404022.1_Frame_Shift_Del_p.GG361fs			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	370					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					GCAGTGTGTCCTCCATGAATAA	0.366																																																	0																																										SO:0001589	frameshift_variant	0			U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.1110_1111delAG	X.37:g.16864049_16864050delCT	ENSP00000369427:p.Gly370fs		Q5JP00	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_Histone-bd_RBBP4_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G371fs	ENST00000380087.2	37	c.1111_1110	CCDS14179.1	X																																																																																			RBBP7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000102054		0.366	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	HGNC	protein_coding	OTTHUMT00000055920.2		0.00	17	0	CT	NM_002893		16864050	-1	tier1		no_errors	ENST00000380087	ensembl	human	known	74_37	frame_shift_del	23.81	16	5	DEL	1.000:1.000	-
RBM19	9904	genome.wustl.edu	37	12	114400104	114400104	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:114400104G>A	ENST00000545145.2	-	2	230	c.152C>T	c.(151-153)tCc>tTc	p.S51F	RBM19_ENST00000392561.3_Missense_Mutation_p.S51F|RBM19_ENST00000261741.5_Missense_Mutation_p.S51F	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	51	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					CTCTTCCTCGGACTTGAAGCC	0.527																																																	0													141.0	118.0	125.0					12																	114400104		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.152C>T	12.37:g.114400104G>A	ENSP00000442053:p.Ser51Phe		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.S51F	ENST00000545145.2	37	c.152	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043243	0.75732	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.77620	-1.11;-1.11;-1.11	5.07	5.07	0.68467	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.062767	0.64402	D	0.000003	D	0.88209	0.6375	M	0.80847	2.515	0.58432	D	0.999999	D	0.60160	0.987	D	0.66497	0.944	D	0.89078	0.3474	10	0.59425	D	0.04	-21.2518	18.649	0.91423	0.0:0.0:1.0:0.0	.	51	Q9Y4C8	RBM19_HUMAN	F	51	ENSP00000442053:S51F;ENSP00000376344:S51F;ENSP00000261741:S51F	ENSP00000261741:S51F	S	-	2	0	RBM19	112884487	1.000000	0.71417	0.934000	0.37439	0.485000	0.33311	7.286000	0.78671	2.631000	0.89168	0.585000	0.79938	TCC	RBM19	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122965		0.527	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	-	0.00	43	0	G	NM_016196		114400104	-1	tier1	-	no_errors	ENST00000261741	ensembl	human	known	74_37	missense	24.53	40	13	SNP	1.000	A
RBM24	221662	genome.wustl.edu	37	6	17292449	17292449	+	3'UTR	DEL	A	A	-			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:17292449delA	ENST00000379052.5	+	0	1046				RBM24_ENST00000508508.1_3'UTR|RBM24_ENST00000425446.2_3'UTR|RBM24_ENST00000318204.5_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24						cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TAACAGCTTTAAAAAAAAAAA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.*99A>-	6.37:g.17292449delA			E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	RNA	DEL	-	NULL	ENST00000379052.5	37	NULL	CCDS47378.1	6																																																																																			RBM24	-	-	ENSG00000112183		0.343	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2		0.00	14	0	A	NM_153020		17292449	+1	tier1		no_errors	ENST00000508508	ensembl	human	known	74_37	rna	23.08	10	3	DEL	0.915	-
RBMXL3	139804	genome.wustl.edu	37	X	114425871	114425871	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:114425871C>T	ENST00000424776.3	+	1	1909	c.1867C>T	c.(1867-1869)Cgc>Tgc	p.R623C	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	623	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CTGGAGCCACCGCTACGGAGG	0.672													C|||	2	0.000529801	0.0	0.0	3775	,	,		14061	0.002		0.0	False		,,,				2504	0.0																0													41.0	44.0	43.0					X																	114425871		692	1591	2283	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1867C>T	X.37:g.114425871C>T	ENSP00000417451:p.Arg623Cys		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R623C	ENST00000424776.3	37	c.1867	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	C	1.538	-0.542626	0.04053	.	.	ENSG00000175718	ENST00000424776	T	0.06142	3.34	0.853	-1.71	0.08133	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.09310	N	0.999995	B	0.17038	0.02	B	0.01281	0.0	T	0.39941	-0.9589	9	0.87932	D	0	.	5.3658	0.16113	0.5351:0.4649:0.0:0.0	.	623	Q8N7X1	RMXL3_HUMAN	C	623	ENSP00000417451:R623C	ENSP00000417451:R623C	R	+	1	0	RBMXL3	114332127	0.000000	0.05858	0.008000	0.14137	0.008000	0.06430	-3.330000	0.00509	-1.832000	0.01196	-1.872000	0.00552	CGC	RBMXL3	-	NULL	ENSG00000175718		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	62	0	C	NM_001145346		114425871	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	missense	24.39	62	20	SNP	0.094	T
RDX	5962	genome.wustl.edu	37	11	110104066	110104066	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:110104066C>G	ENST00000343115.4	-	13	1802	c.1483G>C	c.(1483-1485)Gaa>Caa	p.E495Q	RDX_ENST00000528900.1_Missense_Mutation_p.E148Q|RDX_ENST00000405097.1_Missense_Mutation_p.E495Q|RDX_ENST00000528498.1_Missense_Mutation_p.E495Q|RDX_ENST00000544551.1_Missense_Mutation_p.E359Q|RDX_ENST00000530301.1_Intron	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	495	Glu-rich.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		GCACTAGCTTCAGCATTATTC	0.438																																					Esophageal Squamous(55;25 1062 11040 28755 44273)												0													247.0	225.0	232.0					11																	110104066		2201	4298	6499	SO:0001583	missense	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1483G>C	11.37:g.110104066C>G	ENSP00000342830:p.Glu495Gln		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.E495Q	ENST00000343115.4	37	c.1483	CCDS8343.1	11	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961063	0.53400	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	D;D;D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95;-1.95;-1.95	6.01	5.1	0.69264	Moesin (1);Ezrin/radixin/moesin, C-terminal (1);	0.109000	0.64402	N	0.000007	D	0.84938	0.5583	L	0.58583	1.82	0.50313	D	0.999864	B;P;B;B	0.39424	0.066;0.673;0.046;0.006	B;B;B;B	0.42522	0.071;0.39;0.038;0.021	T	0.82790	-0.0283	10	0.26408	T	0.33	.	17.1355	0.86738	0.0:0.8664:0.1335:0.0	.	359;495;495;148	F5H1A7;A7YIJ8;P35241;A7YIK3	.;.;RADI_HUMAN;.	Q	495;495;148;495;359;165	ENSP00000432112:E495Q;ENSP00000384136:E495Q;ENSP00000433580:E148Q;ENSP00000342830:E495Q;ENSP00000445826:E359Q;ENSP00000434788:E165Q	ENSP00000342830:E495Q	E	-	1	0	RDX	109609276	0.977000	0.34250	0.904000	0.35570	0.922000	0.55478	2.410000	0.44592	1.543000	0.49345	0.650000	0.86243	GAA	RDX	-	pirsf_ERM,pfam_ERM_C_dom,superfamily_Moesin_tail	ENSG00000137710		0.438	RDX-001	KNOWN	basic|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390535.2	-	0.00	99	0	C	NM_002906		110104066	-1	tier1	-	no_errors	ENST00000530749	ensembl	human	known	74_37	missense	18.27	85	19	SNP	0.996	G
RELN	5649	genome.wustl.edu	37	7	103136182	103136182	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:103136182C>G	ENST00000428762.1	-	57	9516	c.9357G>C	c.(9355-9357)atG>atC	p.M3119I	RELN_ENST00000343529.5_Missense_Mutation_p.M3119I|CTB-107G13.1_ENST00000422488.1_RNA|RELN_ENST00000424685.2_Missense_Mutation_p.M3119I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	3119					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TAAACTGCATCATGTATCCTG	0.418																																					NSCLC(146;835 1944 15585 22231 52158)												0													179.0	165.0	170.0					7																	103136182		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.9357G>C	7.37:g.103136182C>G	ENSP00000392423:p.Met3119Ile		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.M3119I	ENST00000428762.1	37	c.9357	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	14.74	2.626404	0.46840	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000424828;ENST00000448171	T;T;T	0.23147	1.92;1.92;1.92	6.16	6.16	0.99307	Neuraminidase (2);	0.041485	0.85682	D	0.000000	T	0.33381	0.0861	N	0.12182	0.205	0.47276	D	0.99937	B;P	0.49185	0.036;0.92	B;P	0.59221	0.016;0.854	T	0.09335	-1.0679	10	0.45353	T	0.12	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	3119;3119	P78509-2;P78509	.;RELN_HUMAN	I	3119;3119;3119;636;3119	ENSP00000392423:M3119I;ENSP00000345694:M3119I;ENSP00000388446:M3119I	ENSP00000345694:M3119I	M	-	3	0	RELN	102923418	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.796000	0.55507	2.937000	0.99478	0.650000	0.86243	ATG	RELN	-	superfamily_Sialidases	ENSG00000189056		0.418	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	96	0	C	NM_005045		103136182	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	missense	7.75	250	21	SNP	1.000	G
RHOBTB3	22836	genome.wustl.edu	37	5	95128791	95128791	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:95128791C>A	ENST00000379982.3	+	12	2257	c.1749C>A	c.(1747-1749)caC>caA	p.H583Q	GLRX_ENST00000508780.1_Intron|RHOBTB3_ENST00000504179.1_Missense_Mutation_p.H214Q|GLRX_ENST00000507605.1_Intron	NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	583	Interaction with Rab9.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		TTGAAAAGCACAGATGGCCGT	0.368																																																	0													120.0	116.0	117.0					5																	95128791		2203	4300	6503	SO:0001583	missense	0			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.1749C>A	5.37:g.95128791C>A	ENSP00000369318:p.His583Gln		A0PJA4|A8K1W9|Q8IW06	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Small_GTPase,superfamily_BTB/POZ_fold,superfamily_P-loop_NTPase,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.H583Q	ENST00000379982.3	37	c.1749	CCDS4077.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.88|15.88	2.963374|2.963374	0.53507|0.53507	.|.	.|.	ENSG00000164292|ENSG00000164292	ENST00000379982;ENST00000504179;ENST00000514198|ENST00000503737	T;T|.	0.74526|.	-0.18;-0.85|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.052094|.	0.85682|.	D|.	0.000000|.	T|T	0.59662|0.59662	0.2210|0.2210	L|L	0.48877|0.48877	1.53|1.53	0.80722|0.80722	D|D	1|1	P|.	0.38565|.	0.637|.	B|.	0.37198|.	0.243|.	T|T	0.55471|0.55471	-0.8136|-0.8136	10|5	0.44086|.	T|.	0.13|.	-25.7503|-25.7503	10.7764|10.7764	0.46353|0.46353	0.0:0.8596:0.0:0.1404|0.0:0.8596:0.0:0.1404	.|.	583|.	O94955|.	RHBT3_HUMAN|.	Q|K	583;214;29|86	ENSP00000369318:H583Q;ENSP00000422360:H214Q|.	ENSP00000369318:H583Q|.	H|Q	+|+	3|1	2|0	RHOBTB3|RHOBTB3	95154547|95154547	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.191000|2.191000	0.42640|0.42640	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CAC|CAG	RHOBTB3	-	NULL	ENSG00000164292		0.368	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB3	HGNC	protein_coding	OTTHUMT00000241658.1	-	0.00	43	0	C	NM_014899		95128791	+1	tier1	-	no_errors	ENST00000379982	ensembl	human	known	74_37	missense	35.42	31	17	SNP	1.000	A
RNF19B	127544	genome.wustl.edu	37	1	33412087	33412087	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:33412087A>C	ENST00000373456.7	-	4	1064	c.1065T>G	c.(1063-1065)atT>atG	p.I355M	RNF19B_ENST00000235150.4_Missense_Mutation_p.I354M|RNF19B_ENST00000356990.5_Missense_Mutation_p.I354M	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	355					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CTGGAGCACCAATCAACGTGC	0.502																																																	0													92.0	73.0	79.0					1																	33412087		2203	4300	6503	SO:0001583	missense	0			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1065T>G	1.37:g.33412087A>C	ENSP00000362555:p.Ile355Met		B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.I355M	ENST00000373456.7	37	c.1065	CCDS372.2	1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.318257	0.60524	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.35789	1.29;1.34;1.3	5.5	0.186	0.15105	.	0.000000	0.85682	D	0.000000	T	0.43853	0.1266	L	0.52573	1.65	0.49051	D	0.999747	D;D;D	0.69078	0.997;0.997;0.97	D;D;P	0.66847	0.947;0.916;0.809	T	0.31420	-0.9944	10	0.72032	D	0.01	.	4.7016	0.12830	0.5981:0.0:0.1877:0.2142	.	354;355;354	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	M	355;354;354;253	ENSP00000362555:I355M;ENSP00000349482:I354M;ENSP00000235150:I354M	ENSP00000235150:I354M	I	-	3	3	RNF19B	33184674	0.863000	0.29885	0.997000	0.53966	0.987000	0.75469	0.072000	0.14617	-0.144000	0.11314	-0.376000	0.06991	ATT	RNF19B	-	NULL	ENSG00000116514		0.502	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF19B	HGNC	protein_coding	OTTHUMT00000011465.3	-	0.00	30	0	A	NM_153341		33412087	-1	tier1	-	no_errors	ENST00000373456	ensembl	human	known	74_37	missense	18.18	36	8	SNP	0.999	C
RPS19	6223	genome.wustl.edu	37	19	42373777	42373777	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:42373777A>G	ENST00000598742.1	+	5	737	c.365A>G	c.(364-366)aAa>aGa	p.K122R	RPS19_ENST00000593863.1_Missense_Mutation_p.K122R|RPS19_ENST00000221975.2_Missense_Mutation_p.K48R	NM_001022.3	NP_001013.1	P39019	RS19_HUMAN	ribosomal protein S19	122					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|maturation of SSU-rRNA (GO:0030490)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|monocyte chemotaxis (GO:0002548)|mRNA metabolic process (GO:0016071)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleolus organization (GO:0007000)|positive regulation of cellular component movement (GO:0051272)|positive regulation of respiratory burst involved in inflammatory response (GO:0060265)|protein tetramerization (GO:0051262)|response to extracellular stimulus (GO:0009991)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(1)|upper_aerodigestive_tract(1)	3						AGCGGCCGCAAACTGACACCT	0.607									Diamond-Blackfan Anemia																																								0													76.0	67.0	70.0					19																	42373777		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	DBA, Congenital Hypoplastic Anemia, Blackfan-Diamond Anemia, incl.: Aase syndrome	BC000023	CCDS12588.1	19q13.2	2011-04-05				ENSG00000105372		"""S ribosomal proteins"""	10402	protein-coding gene	gene with protein product	"""Diamond-Blackfan anemia"""	603474				9582194	Standard	NM_001022		Approved	DBA, S19	uc002ort.3	P39019		ENST00000598742.1:c.365A>G	19.37:g.42373777A>G	ENSP00000470972:p.Lys122Arg			Missense_Mutation	SNP	pfam_Ribosomal_S19e	p.K122R	ENST00000598742.1	37	c.365	CCDS12588.1	19	.	.	.	.	.	.	.	.	.	.	A	6.806	0.517807	0.13005	.	.	ENSG00000105372	ENST00000221975	.	.	.	5.24	5.24	0.73138	.	0.047713	0.85682	D	0.000000	T	0.27832	0.0685	N	0.04724	-0.175	0.43368	D	0.995454	B	0.06786	0.001	B	0.15052	0.012	T	0.18587	-1.0332	9	0.02654	T	1	-4.4845	13.3864	0.60799	1.0:0.0:0.0:0.0	.	122	P39019	RS19_HUMAN	R	122	.	ENSP00000221975:K122R	K	+	2	0	RPS19	47065617	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.686000	0.68211	2.111000	0.64477	0.460000	0.39030	AAA	RPS19	-	pfam_Ribosomal_S19e	ENSG00000105372		0.607	RPS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS19	HGNC	protein_coding	OTTHUMT00000463049.1	-	0.00	29	0	A	NM_001022		42373777	+1	tier1	-	no_errors	ENST00000593863	ensembl	human	known	74_37	missense	22.22	35	10	SNP	1.000	G
SERHL2	253190	genome.wustl.edu	37	22	42970598	42970598	+	IGR	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr22:42970598G>T	ENST00000327678.5	+	0	1374				RRP7B_ENST00000357802.2_RNA	NM_014509.3	NP_055324.2	Q9NQF3	SERHL_HUMAN	serine hydrolase-like 2								hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|lung(3)|skin(1)|stomach(1)	8						TGTGGACTCTGATGGGGCTGT	0.642																																																	0																																										SO:0001628	intergenic_variant	0				CCDS14037.1, CCDS63498.1	22q13	2005-08-09			ENSG00000183569	ENSG00000183569			29446	protein-coding gene	gene with protein product							Standard	NM_014509		Approved		uc003bcr.3	Q9H4I8	OTTHUMG00000150892		22.37:g.42970598G>T			Q5JZ95|Q9UH21	RNA	SNP	-	NULL	ENST00000327678.5	37	NULL	CCDS14037.1	22																																																																																			RRP7B	-	-	ENSG00000182841		0.642	SERHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP7B	HGNC	protein_coding	OTTHUMT00000320454.1		0.00	22	0	G	NM_014509		42970598	-1			no_errors	ENST00000458605	ensembl	human	known	74_37	rna	15.79	16	3	SNP	0.000	T
RYR2	6262	genome.wustl.edu	37	1	237794736	237794736	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:237794736G>C	ENST00000366574.2	+	42	6767	c.6450G>C	c.(6448-6450)atG>atC	p.M2150I	RYR2_ENST00000542537.1_Missense_Mutation_p.M2134I|RYR2_ENST00000360064.6_Missense_Mutation_p.M2148I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2150	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGGATATTATGAATAACAAAG	0.413																																																	0													85.0	85.0	85.0					1																	237794736		1956	4174	6130	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6450G>C	1.37:g.237794736G>C	ENSP00000355533:p.Met2150Ile		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.M2148I	ENST00000366574.2	37	c.6444	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510429	0.64522	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.95447	-3.71;-3.71;-3.71	5.43	5.43	0.79202	Intracellular calcium-release channel (1);	0.066142	0.56097	D	0.000028	D	0.96516	0.8863	L	0.45137	1.4	0.80722	D	1	D	0.67145	0.996	D	0.65874	0.939	D	0.96570	0.9422	10	0.56958	D	0.05	-19.5085	19.6027	0.95569	0.0:0.0:1.0:0.0	.	2150	Q92736	RYR2_HUMAN	I	2150;2148;2134	ENSP00000355533:M2150I;ENSP00000353174:M2148I;ENSP00000443798:M2134I	ENSP00000353174:M2148I	M	+	3	0	RYR2	235861359	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	9.813000	0.99286	2.703000	0.92315	0.650000	0.86243	ATG	RYR2	-	pfam_Ca-rel_channel	ENSG00000198626		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	50	0	G	NM_001035		237794736	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	7.69	96	8	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237982455	237982455	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:237982455C>A	ENST00000366574.2	+	101	14870	c.14553C>A	c.(14551-14553)ttC>ttA	p.F4851L	RYR2_ENST00000542537.1_Missense_Mutation_p.F4835L|RYR2_ENST00000360064.6_Missense_Mutation_p.F4857L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4851					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCACTTTCTTCTTCTTTGTTA	0.418																																																	0													236.0	237.0	236.0					1																	237982455		1946	4129	6075	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14553C>A	1.37:g.237982455C>A	ENSP00000355533:p.Phe4851Leu		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.F4857L	ENST00000366574.2	37	c.14571	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	30	5.053211	0.93793	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000536033	D;D;D	0.98419	-4.92;-4.92;-4.92	5.58	4.68	0.58851	Ion transport (1);	0.000000	0.64402	U	0.000005	D	0.99023	0.9666	M	0.90705	3.14	0.58432	D	0.999999	D;D	0.76494	0.999;0.979	D;D	0.74023	0.982;0.982	D	0.99445	1.0939	10	0.87932	D	0	.	14.4845	0.67606	0.0:0.9297:0.0:0.0703	.	284;4851	F5H3C7;Q92736	.;RYR2_HUMAN	L	4851;4857;4835;284	ENSP00000355533:F4851L;ENSP00000353174:F4857L;ENSP00000443798:F4835L	ENSP00000353174:F4857L	F	+	3	2	RYR2	236049078	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.050000	0.71063	1.371000	0.46172	0.655000	0.94253	TTC	RYR2	-	pfam_Ion_trans_dom	ENSG00000198626		0.418	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	95	0	C	NM_001035		237982455	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	15.48	131	24	SNP	1.000	A
SATB2	23314	genome.wustl.edu	37	2	200213692	200213692	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:200213692A>T	ENST00000417098.1	-	7	1721	c.905T>A	c.(904-906)cTt>cAt	p.L302H	SATB2_ENST00000260926.5_Missense_Mutation_p.L302H|SATB2_ENST00000457245.1_Missense_Mutation_p.L302H|SATB2_ENST00000428695.1_Missense_Mutation_p.L184H|SATB2_ENST00000443023.1_Missense_Mutation_p.L243H	NM_001172509.1	NP_001165980.1	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	302					cartilage development (GO:0051216)|cellular response to organic substance (GO:0071310)|chromatin remodeling (GO:0006338)|embryonic pattern specification (GO:0009880)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|osteoblast development (GO:0002076)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(40)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTGTGGACTAAGCTGGGGAGA	0.517																																					Colon(30;262 767 11040 24421 36230)												0													169.0	172.0	171.0					2																	200213692		2203	4300	6503	SO:0001583	missense	0			AB028957	CCDS2327.1	2q33.1	2011-06-20	2007-02-15		ENSG00000119042	ENSG00000119042		"""Homeoboxes / CUT class"""	21637	protein-coding gene	gene with protein product		608148	"""SATB family member 2"""				Standard	NM_015265		Approved	KIAA1034, FLJ21474	uc002uva.2	Q9UPW6	OTTHUMG00000132767	ENST00000417098.1:c.905T>A	2.37:g.200213692A>T	ENSP00000401112:p.Leu302His		A8K5Z8|Q3ZB87|Q4V763	Missense_Mutation	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.L302H	ENST00000417098.1	37	c.905	CCDS2327.1	2	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515181	0.85389	.	.	ENSG00000119042	ENST00000417098;ENST00000443023;ENST00000260926;ENST00000428695;ENST00000457245	T;T;T;T;T	0.58358	0.36;0.34;0.36;0.37;0.36	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.62600	0.2441	L	0.29908	0.895	0.58432	D	0.999996	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.995;0.998;0.986	T	0.66799	-0.5832	10	0.87932	D	0	-13.5544	15.7643	0.78114	1.0:0.0:0.0:0.0	.	184;50;302	Q3ZB87;Q9H726;Q9UPW6	.;.;SATB2_HUMAN	H	302;243;302;184;302	ENSP00000401112:L302H;ENSP00000388764:L243H;ENSP00000260926:L302H;ENSP00000388581:L184H;ENSP00000405420:L302H	ENSP00000260926:L302H	L	-	2	0	SATB2	199921937	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.858000	0.92256	2.190000	0.69967	0.533000	0.62120	CTT	SATB2	-	NULL	ENSG00000119042		0.517	SATB2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SATB2	HGNC	protein_coding	OTTHUMT00000256140.1	-	0.00	147	0	A	NM_015265		200213692	-1	tier1	-	no_errors	ENST00000260926	ensembl	human	known	74_37	missense	12.92	153	23	SNP	1.000	T
SCUBE3	222663	genome.wustl.edu	37	6	35211789	35211789	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:35211789G>A	ENST00000274938.7	+	17	2121	c.2121G>A	c.(2119-2121)caG>caA	p.Q707Q	SCUBE3_ENST00000394681.1_Silent_p.Q723Q	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						AGCCCTGTCAGCCATGCCCAC	0.587																																																	0													142.0	114.0	123.0					6																	35211789		2203	4300	6503	SO:0001819	synonymous_variant	0			AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.2121G>A	6.37:g.35211789G>A				Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.Q723	ENST00000274938.7	37	c.2169	CCDS4800.1	6																																																																																			SCUBE3	-	pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Growth_fac_rcpt_N_dom	ENSG00000146197		0.587	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	HGNC	protein_coding	OTTHUMT00000040275.1	-	0.00	43	0	G	NM_152753		35211789	+1	tier1	-	no_errors	ENST00000394681	ensembl	human	known	74_37	silent	17.39	38	8	SNP	1.000	A
SDK1	221935	genome.wustl.edu	37	7	4247736	4247736	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:4247736C>G	ENST00000404826.2	+	37	5359	c.5220C>G	c.(5218-5220)taC>taG	p.Y1740*	SDK1_ENST00000389531.3_Nonsense_Mutation_p.Y1720*	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1740	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AACAGATTTACTACTGGGAGG	0.567																																																	0													66.0	68.0	67.0					7																	4247736		2203	4300	6503	SO:0001587	stop_gained	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5220C>G	7.37:g.4247736C>G	ENSP00000385899:p.Tyr1740*		Q8TEN9|Q8TEP5|Q96N44	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Y1740*	ENST00000404826.2	37	c.5220	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	45	11.868869	0.99612	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	.	.	.	4.77	1.34	0.21922	.	0.095877	0.43579	D	0.000546	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8038	0.18428	0.0:0.3443:0.0:0.6557	.	.	.	.	X	1740;1720	.	ENSP00000374182:Y1720X	Y	+	3	2	SDK1	4214262	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.131000	0.31406	0.499000	0.27970	0.655000	0.94253	TAC	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.567	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	40	0	C	NM_152744		4247736	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	nonsense	12.50	90	13	SNP	1.000	G
SEC11A	23478	genome.wustl.edu	37	15	85230877	85230877	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:85230877C>T	ENST00000268220.7	-	3	930	c.290G>A	c.(289-291)cGa>cAa	p.R97Q	SEC11A_ENST00000558134.1_Missense_Mutation_p.R97Q|SEC11A_ENST00000455959.3_Missense_Mutation_p.R71Q|SEC11A_ENST00000560266.1_Missense_Mutation_p.R97Q|RP11-245C17.2_ENST00000558044.1_RNA	NM_014300.2	NP_055115.1	P67812	SC11A_HUMAN	SEC11 homolog A (S. cerevisiae)	97					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(143;0.199)			CTTCAAGACTCGGTGAACTAT	0.353																																																	0													181.0	175.0	177.0					15																	85230877		1844	4094	5938	SO:0001583	missense	0			AF061737	CCDS45340.1, CCDS61742.1, CCDS61743.1, CCDS61744.1, CCDS73776.1	15q25.2	2006-11-07	2006-11-07	2006-11-07		ENSG00000140612			17718	protein-coding gene	gene with protein product			"""SEC11-like 1 (S. cerevisiae)"""	SEC11L1			Standard	NM_001271919		Approved	SPC18, sid2895, SPCS4A	uc031qtg.1	P67812		ENST00000268220.7:c.290G>A	15.37:g.85230877C>T	ENSP00000268220:p.Arg97Gln		B2RAD7|B4DUL4|H0YK72|H0YK83|O75957|P21378|Q53FQ8	Missense_Mutation	SNP	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,prints_Peptidase_S26B,tigrfam_Peptidase_S26B	p.R97Q	ENST00000268220.7	37	c.290	CCDS45340.1	15	.	.	.	.	.	.	.	.	.	.	C	34	5.335657	0.95758	.	.	ENSG00000140612	ENST00000268220;ENST00000455959	.	.	.	5.42	5.42	0.78866	Peptidase S24/S26A/S26B/S26C (1);Peptidase S24/S26A/S26B/S26C, beta-ribbon domain (1);Peptidase S24/S26A/S26B (1);	0.000000	0.85682	D	0.000000	D	0.90662	0.7071	H	0.98818	4.34	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.94266	0.7506	9	0.87932	D	0	.	16.7174	0.85400	0.0:1.0:0.0:0.0	.	97	P67812	SC11A_HUMAN	Q	97;71	.	ENSP00000268220:R97Q	R	-	2	0	SEC11A	83031881	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.755000	0.85180	2.545000	0.85829	0.585000	0.79938	CGA	SEC11A	-	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,tigrfam_Peptidase_S26B	ENSG00000140612		0.353	SEC11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC11A	HGNC	protein_coding	OTTHUMT00000418777.1		0.00	22	0	C	NM_014300		85230877	-1			no_errors	ENST00000268220	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
SEC62	7095	genome.wustl.edu	37	3	169710777	169710777	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:169710777G>C	ENST00000337002.4	+	8	1184	c.1126G>C	c.(1126-1128)Gat>Cat	p.D376H	SEC62_ENST00000480708.1_Missense_Mutation_p.D376H	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	376					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						ACAGCAAACAGATGGGGATTG	0.398																																																	0													63.0	55.0	58.0					3																	169710777		2203	4300	6503	SO:0001583	missense	0			D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.1126G>C	3.37:g.169710777G>C	ENSP00000337688:p.Asp376His		D3DNQ0|O00682|O00729	Missense_Mutation	SNP	pfam_Sec62,superfamily_ABC1_TM_dom	p.D376H	ENST00000337002.4	37	c.1126	CCDS3210.1	3	.	.	.	.	.	.	.	.	.	.	G	12.75	2.030939	0.35797	.	.	ENSG00000008952	ENST00000337002;ENST00000537426;ENST00000544081;ENST00000480708	T;T	0.32272	1.46;1.46	5.76	5.76	0.90799	.	0.096822	0.64402	D	0.000001	T	0.33206	0.0855	N	0.24115	0.695	0.53688	D	0.999978	P	0.44578	0.838	P	0.47206	0.541	T	0.07028	-1.0794	10	0.66056	D	0.02	-10.9269	19.9658	0.97266	0.0:0.0:1.0:0.0	.	376	Q99442	SEC62_HUMAN	H	376;100;100;376	ENSP00000337688:D376H;ENSP00000420331:D376H	ENSP00000337688:D376H	D	+	1	0	SEC62	171193471	1.000000	0.71417	1.000000	0.80357	0.063000	0.16089	7.163000	0.77524	2.721000	0.93114	0.591000	0.81541	GAT	SEC62	-	NULL	ENSG00000008952		0.398	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC62	HGNC	protein_coding	OTTHUMT00000352043.1		0.00	20	0	G			169710777	+1			no_errors	ENST00000337002	ensembl	human	known	74_37	missense	9.68	56	6	SNP	1.000	C
SEPT11	55752	genome.wustl.edu	37	4	77949786	77949786	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:77949786C>T	ENST00000264893.6	+	8	1159	c.958C>T	c.(958-960)Cag>Tag	p.Q320*	SEPT11_ENST00000505788.1_Nonsense_Mutation_p.Q320*|SEPT11_ENST00000541121.1_Nonsense_Mutation_p.Q330*|SEPT11_ENST00000502584.1_Nonsense_Mutation_p.Q320*|SEPT11_ENST00000512575.1_3'UTR|SEPT11_ENST00000510515.1_Nonsense_Mutation_p.Q330*	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	320					cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						CAATAGTCTTCAGGAGACATA	0.338																																																	0													75.0	82.0	80.0					4																	77949786		2203	4300	6503	SO:0001587	stop_gained	0			AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.958C>T	4.37:g.77949786C>T	ENSP00000264893:p.Gln320*		B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Nonsense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.Q330*	ENST00000264893.6	37	c.988	CCDS34018.1	4	.	.	.	.	.	.	.	.	.	.	C	40	7.952113	0.98580	.	.	ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000541121	.	.	.	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	20.5792	0.99380	0.0:1.0:0.0:0.0	.	.	.	.	X	320;320;312;320;330;330	.	ENSP00000264893:Q320X	Q	+	1	0	SEPT11	78168810	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.380000	0.79704	2.873000	0.98535	0.561000	0.74099	CAG	SEPT11	-	pirsf_Septin	ENSG00000138758		0.338	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEPT11	HGNC	protein_coding	OTTHUMT00000362676.1	-	0.00	25	0	C	NM_018243		77949786	+1	tier1	-	no_errors	ENST00000541121	ensembl	human	known	74_37	nonsense	18.75	26	6	SNP	1.000	T
SETD1B	23067	genome.wustl.edu	37	12	122252029	122252029	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:122252029C>T	ENST00000604567.1	+	7	1976	c.1908C>T	c.(1906-1908)ggC>ggT	p.G636G	SETD1B_ENST00000542440.1_Silent_p.G636G|SETD1B_ENST00000267197.5_Silent_p.G636G			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	636	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						AGTCCTCAGGCGAGGACATGG	0.642																																																	0													4.0	6.0	5.0					12																	122252029		619	1480	2099	SO:0001819	synonymous_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.1908C>T	12.37:g.122252029C>T			F6MFW1	Silent	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.G636	ENST00000604567.1	37	c.1908		12																																																																																			SETD1B	-	NULL	ENSG00000139718		0.642	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	-	0.00	37	0	C	XM_037523		122252029	+1	tier1	-	no_errors	ENST00000267197	ensembl	human	known	74_37	silent	19.51	33	8	SNP	0.135	T
SHANK2	22941	genome.wustl.edu	37	11	70348324	70348324	+	Missense_Mutation	SNP	C	C	A	rs534324507	byFrequency	TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:70348324C>A	ENST00000423696.2	-	9	1164	c.1128G>T	c.(1126-1128)gaG>gaT	p.E376D	SHANK2_ENST00000449833.2_Missense_Mutation_p.E167D|SHANK2_ENST00000409530.1_Missense_Mutation_p.E166D|SHANK2_ENST00000409161.1_Missense_Mutation_p.E166D|SHANK2_ENST00000338508.4_Missense_Mutation_p.E756D|SHANK2_ENST00000357171.3_Missense_Mutation_p.E167D|SHANK2_ENST00000449116.2_Missense_Mutation_p.E167D			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	376					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GCTCCTCCAGCTCCGAGGTCA	0.657													C|||	68	0.0135783	0.0136	0.0029	5008	,	,		14990	0.0139		0.0199	False		,,,				2504	0.0143																0																																										SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1128G>T	11.37:g.70348324C>A	ENSP00000394536:p.Glu376Asp		C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.E756D	ENST00000423696.2	37	c.2268		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.112874|4.112874	0.77210|0.77210	.|.	.|.	ENSG00000162105|ENSG00000162105	ENST00000412252|ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018;ENST00000409530;ENST00000449116;ENST00000357171	.|T;T;T;T;T;T;T;T;T	.|0.52057	.|2.01;2.01;2.25;0.68;2.1;2.11;0.92;0.92;0.92	4.46|4.46	2.51|2.51	0.30379|0.30379	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.67608|0.67608	0.2911|0.2911	M|M	0.82323|0.82323	2.585|2.585	0.52501|0.52501	D|D	0.999953|0.999953	.|P;D;D;D	.|0.76494	.|0.757;0.989;0.999;0.964	.|P;D;D;P	.|0.81914	.|0.485;0.961;0.995;0.901	T|T	0.69273|0.69273	-0.5188|-0.5188	5|10	.|0.62326	.|D	.|0.03	.|.	11.2728|11.2728	0.49148|0.49148	0.0:0.8456:0.0:0.1544|0.0:0.8456:0.0:0.1544	.|.	.|167;376;755;167	.|B7ZKU9;Q9UPX8;Q9UPX8-3;Q9UPX8-4	.|.;SHAN2_HUMAN;.;.	S|D	166|167;166;44;756;376;390;386;166;167;167	.|ENSP00000399423:E167D;ENSP00000386491:E166D;ENSP00000402944:E44D;ENSP00000345193:E756D;ENSP00000394536:E376D;ENSP00000294018:E386D;ENSP00000387324:E166D;ENSP00000394939:E167D;ENSP00000349694:E167D	.|ENSP00000294018:E386D	A|E	-|-	1|3	0|2	SHANK2|SHANK2	70025972|70025972	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.927000|0.927000	0.56198|0.56198	1.622000|1.622000	0.36997|0.36997	0.410000|0.410000	0.25675|0.25675	0.462000|0.462000	0.41574|0.41574	GCT|GAG	SHANK2	-	NULL	ENSG00000162105		0.657	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding			0.00	12	0	C	NM_012309		70348324	-1			no_errors	ENST00000338508	ensembl	human	known	74_37	missense	8.41	97	9	SNP	1.000	A
SHROOM1	134549	genome.wustl.edu	37	5	132158683	132158683	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:132158683G>A	ENST00000378679.3	-	10	3168	c.2364C>T	c.(2362-2364)gtC>gtT	p.V788V	SHROOM1_ENST00000378676.1_Silent_p.V719V|SHROOM1_ENST00000488072.1_5'Flank|SHROOM1_ENST00000319854.3_Silent_p.V783V	NM_001172700.1	NP_001166171.1	Q2M3G4	SHRM1_HUMAN	shroom family member 1	788	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin filament bundle assembly (GO:0051017)|cell morphogenesis (GO:0000902)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|myosin II complex (GO:0016460)	actin filament binding (GO:0051015)			endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GGGCGCAATAGACGCGCAGCT	0.701																																																	0													34.0	31.0	32.0					5																	132158683		2200	4298	6498	SO:0001819	synonymous_variant	0			AF314142	CCDS4161.1, CCDS54902.1	5q31.1	2007-05-03			ENSG00000164403	ENSG00000164403			24084	protein-coding gene	gene with protein product		611179				11853319, 16615870	Standard	NM_133456		Approved	APXL2, KIAA1960	uc003kxy.2	Q2M3G4	OTTHUMG00000059835	ENST00000378679.3:c.2364C>T	5.37:g.132158683G>A			B7WP40|B7ZL01|Q8TDP0|Q8TF41	Silent	SNP	pfam_ASD2,pfam_ASD1	p.V788	ENST00000378679.3	37	c.2364	CCDS54902.1	5																																																																																			SHROOM1	-	pfam_ASD2	ENSG00000164403		0.701	SHROOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHROOM1	HGNC	protein_coding	OTTHUMT00000133033.1		0.00	13	0	G	NM_133456		132158683	-1			no_errors	ENST00000378679	ensembl	human	known	74_37	silent	16.67	15	3	SNP	0.997	A
SIGIRR	59307	genome.wustl.edu	37	11	406002	406002	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:406002G>A	ENST00000431843.2	-	10	1433	c.1127C>T	c.(1126-1128)tCg>tTg	p.S376L	SIGIRR_ENST00000531205.1_Silent_p.L472L|SIGIRR_ENST00000332725.3_Missense_Mutation_p.S376L|SIGIRR_ENST00000529486.1_5'Flank|SIGIRR_ENST00000382520.2_Silent_p.L472L|SIGIRR_ENST00000397632.3_Missense_Mutation_p.S376L	NM_001135054.1	NP_001128526.1	Q6IA17	SIGIR_HUMAN	single immunoglobulin and toll-interleukin 1 receptor (TIR) domain	376					acute-phase response (GO:0006953)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(2)|endometrium(1)|liver(1)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	13		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCTCCCAGCGAGACCCCACT	0.642																																																	0													39.0	33.0	35.0					11																	406002		2193	4290	6483	SO:0001583	missense	0				CCDS31325.1	11p15.5	2013-01-11	2005-10-10					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30575	protein-coding gene	gene with protein product	"""single immunoglobulin domain IL1R1 related"""	605478				10346978	Standard	NM_021805		Approved	TIR8	uc001lpe.1	Q6IA17		ENST00000431843.2:c.1127C>T	11.37:g.406002G>A	ENSP00000403104:p.Ser376Leu		Q3KQY2|Q6UXI3|Q9H733	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.S376L	ENST00000431843.2	37	c.1127	CCDS31325.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.83|13.83	2.354518|2.354518	0.41700|0.41700	.|.	.|.	ENSG00000185187|ENSG00000185187	ENST00000526395|ENST00000528845;ENST00000431843;ENST00000397632;ENST00000332725	.|T;T;T	.|0.03094	.|4.05;4.05;4.05	3.56|3.56	2.62|2.62	0.31277|0.31277	.|.	.|.	.|.	.|.	.|.	T|T	0.04318|0.04318	0.0119|0.0119	L|L	0.44542|0.44542	1.39|1.39	0.22571|0.22571	N|N	0.998971|0.998971	.|B	.|0.28605	.|0.217	.|B	.|0.17098	.|0.017	T|T	0.32134|0.32134	-0.9918|-0.9918	5|9	.|0.54805	.|T	.|0.06	.|.	11.2974|11.2974	0.49286|0.49286	0.0:0.1843:0.8157:0.0|0.0:0.1843:0.8157:0.0	.|.	.|376	.|Q6IA17	.|SIGIR_HUMAN	C|L	108|96;376;376;376	.|ENSP00000403104:S376L;ENSP00000380756:S376L;ENSP00000333656:S376L	.|ENSP00000333656:S376L	R|S	-|-	1|2	0|0	SIGIRR|SIGIRR	396002|396002	0.020000|0.020000	0.18652|0.18652	0.009000|0.009000	0.14445|0.14445	0.820000|0.820000	0.46376|0.46376	0.850000|0.850000	0.27737|0.27737	0.609000|0.609000	0.30018|0.30018	0.485000|0.485000	0.47835|0.47835	CGC|TCG	SIGIRR	-	NULL	ENSG00000185187		0.642	SIGIRR-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIGIRR	HGNC	protein_coding	OTTHUMT00000383884.3	-	0.00	39	0	G	NM_021805		406002	-1	tier1	-	no_errors	ENST00000332725	ensembl	human	known	74_37	missense	18.97	47	11	SNP	0.052	A
SLC17A4	10050	genome.wustl.edu	37	6	25769404	25769404	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:25769404G>T	ENST00000377905.4	+	3	402	c.283G>T	c.(283-285)Gaa>Taa	p.E95*	SLC17A4_ENST00000397076.2_Nonsense_Mutation_p.E41*|SLC17A4_ENST00000439485.2_Nonsense_Mutation_p.E95*	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	95					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AACTCTAAAAGAATTTAAAGC	0.423																																																	0													53.0	59.0	57.0					6																	25769404		2203	4300	6503	SO:0001587	stop_gained	0			AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.283G>T	6.37:g.25769404G>T	ENSP00000367137:p.Glu95*		B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Nonsense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.E95*	ENST00000377905.4	37	c.283	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	G	23.3	4.402595	0.83230	.	.	ENSG00000146039	ENST00000377905;ENST00000439485;ENST00000397076	.	.	.	4.39	2.62	0.31277	.	227.608000	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	6.8025	0.23758	0.2057:0.0:0.7943:0.0	.	.	.	.	X	95;95;41	.	ENSP00000367137:E95X	E	+	1	0	SLC17A4	25877383	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.746000	0.26275	0.796000	0.33947	0.655000	0.94253	GAA	SLC17A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146039		0.423	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	HGNC	protein_coding	OTTHUMT00000040068.1		0.00	18	0	G			25769404	+1			no_errors	ENST00000377905	ensembl	human	known	74_37	nonsense	8.33	22	2	SNP	0.001	T
SLC18A3	6572	genome.wustl.edu	37	10	50818912	50818912	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:50818912G>A	ENST00000374115.3	+	1	566	c.126G>A	c.(124-126)gcG>gcA	p.A42A	CHAT_ENST00000395559.2_5'Flank|CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	42					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						TGTGCGTGGCGCTGTTACTGG	0.701																																																	0													53.0	40.0	45.0					10																	50818912		2202	4300	6502	SO:0001819	synonymous_variant	0			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.126G>A	10.37:g.50818912G>A			B2R7S1	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A42	ENST00000374115.3	37	c.126	CCDS7231.1	10																																																																																			SLC18A3	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000187714		0.701	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	-	0.00	37	0	G	NM_003055		50818912	+1	tier1	-	no_errors	ENST00000374115	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.994	A
SLC18B1	116843	genome.wustl.edu	37	6	133108702	133108702	+	Silent	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:133108702T>C	ENST00000275227.4	-	5	468	c.372A>G	c.(370-372)ccA>ccG	p.P124P	SLC18B1_ENST00000367918.1_Intron|SLC18B1_ENST00000460518.1_5'UTR|SLC18B1_ENST00000538764.1_Intron	NM_052831.2	NP_439896.1	Q6NT16	S18B1_HUMAN	solute carrier family 18, subfamily B, member 1	124					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)		p.P124P(1)									CTGGCCCATCTGGAACTCGGT	0.373																																																	1	Substitution - coding silent(1)	lung(1)											91.0	86.0	87.0					6																	133108702		2203	4300	6503	SO:0001819	synonymous_variant	0			AK124442	CCDS5163.1	6q22.3-q23.3	2013-05-22	2012-03-09	2012-03-09	ENSG00000146409	ENSG00000146409		"""Solute carriers"""	21573	protein-coding gene	gene with protein product		613361	"""chromosome 6 open reading frame 192"""	C6orf192		19697161	Standard	XM_006715328		Approved	dJ55C23.6	uc003qdw.1	Q6NT16	OTTHUMG00000015595	ENST00000275227.4:c.372A>G	6.37:g.133108702T>C			A8K1K3|B3KW77|Q6ISF2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.P124	ENST00000275227.4	37	c.372	CCDS5163.1	6																																																																																			SLC18B1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000146409		0.373	SLC18B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18B1	HGNC	protein_coding	OTTHUMT00000042273.1		0.00	26	0	T	NM_052831		133108702	-1			no_errors	ENST00000275227	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.209	C
SLC22A6	9356	genome.wustl.edu	37	11	62751107	62751107	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:62751107G>T	ENST00000377871.3	-	3	796	c.530C>A	c.(529-531)aCc>aAc	p.T177N	SLC22A6_ENST00000458333.2_Missense_Mutation_p.T177N|SLC22A6_ENST00000360421.4_Missense_Mutation_p.T177N|SLC22A6_ENST00000537349.1_5'UTR|SLC22A6_ENST00000421062.2_Missense_Mutation_p.T177N	NM_004790.4|NM_153278.2	NP_004781.2|NP_695010.1	Q4U2R8	S22A6_HUMAN	solute carrier family 22 (organic anion transporter), member 6	177					alpha-ketoglutarate transport (GO:0015742)|organic anion transport (GO:0015711)|protein homooligomerization (GO:0051260)|renal tubular secretion (GO:0097254)|response to methotrexate (GO:0031427)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	chloride ion binding (GO:0031404)|inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(18)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36					Acetaminophen(DB00316)|Acetazolamide(DB00819)|Acetylcysteine(DB06151)|Acetylsalicylic acid(DB00945)|Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Aminohippurate(DB00345)|Aminophenazone(DB01424)|Amoxicillin(DB01060)|Antipyrine(DB01435)|Aspartame(DB00168)|Benzylpenicillin(DB01053)|Bromodiphenhydramine(DB01237)|Bumetanide(DB00887)|Captopril(DB01197)|Carbenicillin(DB00578)|Carprofen(DB00821)|Caspofungin(DB00520)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cefotiam(DB00229)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Chloramphenicol(DB00446)|Chlorothiazide(DB00880)|Chlorpropamide(DB00672)|Cidofovir(DB00369)|Cilastatin(DB01597)|Cimetidine(DB00501)|Cinoxacin(DB00827)|Cloxacillin(DB01147)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Cyclothiazide(DB00606)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Didanosine(DB00900)|Diflunisal(DB00861)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Ethacrynic acid(DB00903)|Etodolac(DB00749)|Fluorescein(DB00693)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Foscarnet(DB00529)|Furosemide(DB00695)|Ganciclovir(DB01004)|Gentamicin(DB00798)|Glyburide(DB01016)|Hydrochlorothiazide(DB00999)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Losartan(DB00678)|Meclofenamic acid(DB00939)|Methazolamide(DB00703)|Methotrexate(DB00563)|Minocycline(DB01017)|Nafcillin(DB00607)|Nalidixic Acid(DB00779)|Naproxen(DB00788)|Nateglinide(DB00731)|Norfloxacin(DB01059)|Novobiocin(DB01051)|Ofloxacin(DB01165)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piperacillin(DB00319)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Riboflavin(DB00140)|Salicylic acid(DB00936)|Stavudine(DB00649)|Streptomycin(DB01082)|Sulindac(DB00605)|Tenofovir(DB00300)|Tetracycline(DB00759)|Tolbutamide(DB01124)|Tolmetin(DB00500)|Trifluridine(DB00432)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Vancomycin(DB00512)|Zalcitabine(DB00943)|Zidovudine(DB00495)	GGCTGCGCAGGTCCCTGACAC	0.607																																																	0													72.0	63.0	66.0					11																	62751107		2201	4298	6499	SO:0001583	missense	0			AF057039	CCDS8041.1, CCDS31591.1, CCDS44631.1, CCDS44632.1	11q12.3	2013-07-15			ENSG00000197901	ENSG00000197901		"""Solute carriers"""	10970	protein-coding gene	gene with protein product		607582				9762842, 9950961	Standard	NM_004790		Approved	ROAT1, PAHT, OAT1	uc001nwk.3	Q4U2R8	OTTHUMG00000167767	ENST00000377871.3:c.530C>A	11.37:g.62751107G>T	ENSP00000367102:p.Thr177Asn		A8MY93|B2D0R6|O95187|O95742|Q7LDA0|Q8N192|Q9NQA6|Q9NQC2|Q9UBG6|Q9UEQ8	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.T177N	ENST00000377871.3	37	c.530	CCDS31591.1	11	.	.	.	.	.	.	.	.	.	.	G	24.9	4.587043	0.86851	.	.	ENSG00000197901	ENST00000360421;ENST00000394651;ENST00000377871;ENST00000458333;ENST00000421062	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.53	4.62	0.57501	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.109199	0.64402	D	0.000009	T	0.79233	0.4411	M	0.91354	3.2	0.42975	D	0.994448	D;D;D;D	0.67145	0.98;0.996;0.993;0.996	D;D;D;D	0.72982	0.965;0.965;0.979;0.965	D	0.83567	0.0110	10	0.72032	D	0.01	.	12.0331	0.53410	0.0838:0.0:0.9162:0.0	.	177;177;177;177	Q4U2R8-4;Q4U2R8-3;Q4U2R8;Q4U2R8-2	.;.;S22A6_HUMAN;.	N	177;156;177;177;177	ENSP00000353597:T177N;ENSP00000367102:T177N;ENSP00000396401:T177N;ENSP00000404441:T177N	ENSP00000353597:T177N	T	-	2	0	SLC22A6	62507683	1.000000	0.71417	0.773000	0.31616	0.973000	0.67179	4.354000	0.59417	1.318000	0.45170	0.650000	0.86243	ACC	SLC22A6	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197901		0.607	SLC22A6-002	KNOWN	basic|CCDS	protein_coding	SLC22A6	HGNC	protein_coding	OTTHUMT00000396186.1	-	0.00	52	0	G	NM_004790		62751107	-1	tier1	-	no_errors	ENST00000377871	ensembl	human	known	74_37	missense	19.15	38	9	SNP	1.000	T
SLC25A42	284439	genome.wustl.edu	37	19	19206999	19206999	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:19206999G>A	ENST00000318596.7	+	2	217	c.66G>A	c.(64-66)tcG>tcA	p.S22S		NM_178526.4	NP_848621.2	Q86VD7	S2542_HUMAN	solute carrier family 25, member 42	22					ADP transport (GO:0015866)|AMP transport (GO:0080121)|ATP transport (GO:0015867)|coenzyme A transmembrane transport (GO:0035349)|metabolic process (GO:0008152)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenosine-diphosphatase activity (GO:0043262)|ADP transmembrane transporter activity (GO:0015217)|AMP transmembrane transporter activity (GO:0080122)|ATP transmembrane transporter activity (GO:0005347)|coenzyme A transmembrane transporter activity (GO:0015228)			cervix(1)|large_intestine(2)|lung(3)	6			OV - Ovarian serous cystadenocarcinoma(5;5.4e-06)|Epithelial(12;0.000497)			TCCTGTCCTCGTCCGTCTCAT	0.647																																																	0													191.0	152.0	165.0					19																	19206999		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32966.1	19p13.11	2013-05-22			ENSG00000181035	ENSG00000181035		"""Solute carriers"""	28380	protein-coding gene	gene with protein product		610823				16949250, 19429682	Standard	NM_178526		Approved	MGC26694	uc002nlf.3	Q86VD7		ENST00000318596.7:c.66G>A	19.37:g.19206999G>A			D2T2J5|O14553|O43378	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Graves_DC	p.S22	ENST00000318596.7	37	c.66	CCDS32966.1	19																																																																																			SLC25A42	-	NULL	ENSG00000181035		0.647	SLC25A42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A42	HGNC	protein_coding	OTTHUMT00000465931.1	-	0.00	32	0	G	NM_178526		19206999	+1	tier1	-	no_errors	ENST00000318596	ensembl	human	known	74_37	silent	19.23	41	10	SNP	0.009	A
SLC47A1	55244	genome.wustl.edu	37	17	19470501	19470501	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:19470501C>T	ENST00000270570.4	+	14	1355	c.1269C>T	c.(1267-1269)atC>atT	p.I423I	RP11-1113L8.1_ENST00000574267.1_RNA|SLC47A1_ENST00000457293.1_Silent_p.I423I|SLC47A1_ENST00000436810.2_Silent_p.I400I|SLC47A1_ENST00000571335.1_Silent_p.I228I|SLC47A1_ENST00000395585.1_Silent_p.I423I|SLC47A1_ENST00000575023.1_Intron	NM_018242.2	NP_060712.2	Q96FL8	S47A1_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 1	423					organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane-bounded vesicle (GO:0031988)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|monovalent cation:proton antiporter activity (GO:0005451)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(4)|lung(5)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)				Aciclovir(DB00787)|Bromodiphenhydramine(DB01237)|Cephalexin(DB00567)|Cimetidine(DB00501)|Metformin(DB00331)|Sirolimus(DB00877)	GCCTCCCCATCGGGATCGCGC	0.557																																																	0													297.0	238.0	258.0					17																	19470501		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11209.1	17p11.2	2013-07-17	2013-07-17		ENSG00000142494	ENSG00000142494		"""Solute carriers"""	25588	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 1"""	609832				16330770, 16996621, 16928787	Standard	NM_018242		Approved	FLJ10847, MATE1	uc002gvy.1	Q96FL8	OTTHUMG00000059466	ENST00000270570.4:c.1269C>T	17.37:g.19470501C>T			Q53HF5|Q6PD77|Q86VL4|Q9NVA3	Silent	SNP	pfam_MATE,tigrfam_MATE	p.I423	ENST00000270570.4	37	c.1269	CCDS11209.1	17																																																																																			SLC47A1	-	pfam_MATE,tigrfam_MATE	ENSG00000142494		0.557	SLC47A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC47A1	HGNC	protein_coding	OTTHUMT00000132250.1	-	0.00	64	0	C	NM_018242		19470501	+1	tier1	-	no_errors	ENST00000395585	ensembl	human	known	74_37	silent	24.71	64	21	SNP	0.944	T
SLC38A10	124565	genome.wustl.edu	37	17	79254419	79254419	+	Missense_Mutation	SNP	C	C	T	rs200989047		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:79254419C>T	ENST00000374759.3	-	6	999	c.616G>A	c.(616-618)Gcc>Acc	p.A206T	SLC38A10_ENST00000546352.1_5'UTR|SLC38A10_ENST00000288439.5_Missense_Mutation_p.A206T	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	206					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GACTGGCAGGCGAAGGACATG	0.627																																																	0													64.0	53.0	56.0					17																	79254419		2203	4300	6503	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.616G>A	17.37:g.79254419C>T	ENSP00000363891:p.Ala206Thr		Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.A206T	ENST00000374759.3	37	c.616	CCDS42397.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.889179|5.889179	0.97068|0.97068	.|.	.|.	ENSG00000157637|ENSG00000157637	ENST00000374759;ENST00000288439|ENST00000543204	T;T|.	0.02015|.	4.5;4.5|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.117293|.	0.56097|.	D|.	0.000025|.	T|T	0.46190|0.46190	0.1380|0.1380	N|N	0.05534|0.05534	-0.03|-0.03	0.53005|0.53005	D|D	0.999967|0.999967	P;D|.	0.76494|.	0.55;0.999|.	B;D|.	0.67382|.	0.249;0.951|.	T|T	0.42172|0.42172	-0.9467|-0.9467	10|5	0.30854|.	T|.	0.27|.	-29.8271|-29.8271	18.6555|18.6555	0.91452|0.91452	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	206;206|.	Q9HBR0-2;Q9HBR0|.	.;S38AA_HUMAN|.	T|H	206|64	ENSP00000363891:A206T;ENSP00000288439:A206T|.	ENSP00000288439:A206T|.	A|R	-|-	1|2	0|0	SLC38A10|SLC38A10	76869014|76869014	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.969000|0.969000	0.65631|0.65631	5.525000|5.525000	0.67110|0.67110	2.469000|2.469000	0.83416|0.83416	0.585000|0.585000	0.79938|0.79938	GCC|CGC	SLC38A10	-	pfam_AA_transpt_TM	ENSG00000157637		0.627	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	-	0.00	35	0	C	NM_138570		79254419	-1	tier1	rs200989047	no_errors	ENST00000374759	ensembl	human	known	74_37	missense	15.69	41	8	SNP	1.000	T
SLC4A1AP	22950	genome.wustl.edu	37	2	27905115	27905115	+	Splice_Site	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:27905115G>A	ENST00000326019.6	+	9	2046	c.1764G>A	c.(1762-1764)aaG>aaA	p.K588K		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	588						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					TTCTTCCTAGGACTGAAACTC	0.353																																																	0													46.0	43.0	44.0					2																	27905115		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1764-1G>A	2.37:g.27905115G>A			A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Silent	SNP	pfam_FHA_dom,pfam_dsRNA-bd_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.K588	ENST00000326019.6	37	c.1764	CCDS33166.1	2																																																																																			SLC4A1AP	-	NULL	ENSG00000163798		0.353	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	-	0.00	24	0	G	NM_018158	Silent	27905115	+1	tier1	-	no_errors	ENST00000326019	ensembl	human	known	74_37	silent	16.67	30	6	SNP	1.000	A
SMC1B	27127	genome.wustl.edu	37	22	45779352	45779352	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr22:45779352G>T	ENST00000357450.4	-	12	2052	c.2053C>A	c.(2053-2055)Cta>Ata	p.L685I	SMC1B_ENST00000404354.3_Missense_Mutation_p.L685I	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	685					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TTTACCTTTAGCTCTTGGATT	0.343																																																	0													193.0	177.0	182.0					22																	45779352		1809	4066	5875	SO:0001583	missense	0			AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.2053C>A	22.37:g.45779352G>T	ENSP00000350036:p.Leu685Ile		A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,superfamily_t-SNARE,smart_SMC_hinge	p.L685I	ENST00000357450.4	37	c.2053	CCDS43027.1	22	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767867	0.69878	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	D;T	0.82167	-1.58;-1.49	5.89	3.45	0.39498	RecF/RecN/SMC (1);	0.000000	0.42172	D	0.000757	D	0.85004	0.5598	L	0.61218	1.895	0.51482	D	0.999924	P;D;D	0.59357	0.844;0.985;0.985	P;P;P	0.57846	0.557;0.828;0.828	T	0.83072	-0.0142	10	0.39692	T	0.17	.	7.6231	0.28197	0.5163:0.0:0.4837:0.0	.	685;685;685	Q8NDV3;Q8NDV3-2;Q8NDV3-3	SMC1B_HUMAN;.;.	I	685	ENSP00000350036:L685I;ENSP00000385902:L685I	ENSP00000350036:L685I	L	-	1	2	SMC1B	44158016	0.916000	0.31088	0.998000	0.56505	0.994000	0.84299	0.642000	0.24735	1.327000	0.45338	0.655000	0.94253	CTA	SMC1B	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000077935		0.343	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1B	HGNC	protein_coding	OTTHUMT00000322256.2		0.00	52	0	G	NM_148674		45779352	-1			no_errors	ENST00000357450	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.931	T
SNHG14	104472715	genome.wustl.edu	37	15	25324260	25324260	+	RNA	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:25324260G>A	ENST00000546682.1	+	0	0				SNHG14_ENST00000549804.2_RNA|SNORD116-14_ENST00000383894.1_RNA|SNORD116-15_ENST00000384445.1_RNA|SNORD116-13_ENST00000384408.1_RNA|SNORD116-12_ENST00000384468.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		AAAATGAGTGGGAACTCTGTA	0.423																																																	0													191.0	180.0	183.0					15																	25324260		876	1991	2867			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25324260G>A				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNORD116-13	-	-	ENSG00000207137		0.423	SNHG14-022	KNOWN	basic	antisense	SNORD116-13	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	70	0	G			25324260	+1	tier1	-	no_errors	ENST00000384408	ensembl	human	known	74_37	rna	11.27	63	8	SNP	0.471	A
SNX1	6642	genome.wustl.edu	37	15	64424089	64424089	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:64424089C>A	ENST00000559844.1	+	11	1233	c.1219C>A	c.(1219-1221)Cgc>Agc	p.R407S	SNX1_ENST00000559339.1_3'UTR|SNX1_ENST00000561026.1_Missense_Mutation_p.R342S|SNX1_ENST00000261889.5_Missense_Mutation_p.R407S|SNX1_ENST00000560829.1_Missense_Mutation_p.R189S|SNX1_ENST00000353874.4_Missense_Mutation_p.R407S			Q13596	SNX1_HUMAN	sorting nexin 1	407	BAR.				early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)|positive regulation of protein catabolic process (GO:0045732)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			breast(1)|endometrium(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GGCCATAGTCCGCGTAAGCTT	0.473																																																	0													105.0	96.0	99.0					15																	64424089		2203	4300	6503	SO:0001583	missense	0			BC000357	CCDS32266.1, CCDS32268.1, CCDS58371.1	15q22.31	2011-05-03			ENSG00000028528	ENSG00000028528		"""Sorting nexins"""	11172	protein-coding gene	gene with protein product		601272				8638121	Standard	NM_003099		Approved	SNX1A, MGC8664, HsT17379, Vps5	uc010uio.2	Q13596		ENST00000559844.1:c.1219C>A	15.37:g.64424089C>A	ENSP00000453785:p.Arg407Ser		A6NM19|A8K6T7|H0Y2M5|O60750|O60751|Q6ZRJ8	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Sorting_nexin_N,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R407S	ENST00000559844.1	37	c.1219	CCDS32266.1	15	.	.	.	.	.	.	.	.	.	.	C	19.51	3.841464	0.71488	.	.	ENSG00000028528	ENST00000380285;ENST00000353874;ENST00000261889	T	0.36699	1.24	5.2	4.22	0.49857	Vps5 C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.58323	0.2114	M	0.80183	2.485	0.21897	N	0.999484	D;D;D;D;D;D;D	0.71674	0.997;0.99;0.994;0.994;0.988;0.998;0.99	D;P;D;D;P;D;D	0.73380	0.98;0.876;0.963;0.963;0.853;0.979;0.946	T	0.51450	-0.8704	10	0.87932	D	0	-8.3908	10.6063	0.45396	0.3145:0.6854:0.0:0.0	.	407;317;407;407;342;407;407	Q6ZRJ8;Q59GU6;Q53HL9;Q53GY8;Q13596-2;A6NKH4;Q13596	.;.;.;.;.;.;SNX1_HUMAN	S	407;407;342	ENSP00000326668:R407S	ENSP00000261889:R342S	R	+	1	0	SNX1	62211142	1.000000	0.71417	0.998000	0.56505	0.709000	0.40893	1.904000	0.39868	2.693000	0.91896	0.561000	0.74099	CGC	SNX1	-	pfam_Vps5_C	ENSG00000028528		0.473	SNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX1	HGNC	protein_coding	OTTHUMT00000418559.1	-	0.00	33	0	C	NM_003099		64424089	+1	tier1	-	no_errors	ENST00000559844	ensembl	human	known	74_37	missense	51.43	17	18	SNP	1.000	A
SORL1	6653	genome.wustl.edu	37	11	121491881	121491881	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:121491881G>T	ENST00000260197.7	+	44	6127	c.5998G>T	c.(5998-6000)Ggg>Tgg	p.G2000W	SORL1_ENST00000525532.1_Missense_Mutation_p.G944W|SORL1_ENST00000532694.1_Missense_Mutation_p.G846W|SORL1_ENST00000534286.1_Missense_Mutation_p.G910W|SORL1_ENST00000527934.1_Missense_Mutation_p.G615W	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	2000	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GGAGCCTGGCGGGAAATACCA	0.443																																																	0													106.0	100.0	102.0					11																	121491881		2202	4299	6501	SO:0001583	missense	0			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5998G>T	11.37:g.121491881G>T	ENSP00000260197:p.Gly2000Trp		B2RNX7|Q92856	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.G2000W	ENST00000260197.7	37	c.5998	CCDS8436.1	11	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852671	0.71719	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286;ENST00000527934	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	5.49	5.49	0.81192	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.117975	0.56097	D	0.000030	T	0.65491	0.2696	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.68239	-0.5461	10	0.87932	D	0	.	19.3897	0.94576	0.0:0.0:1.0:0.0	.	615;2000	E9PKB0;Q92673	.;SORL_HUMAN	W	2000;944;846;910;615	ENSP00000260197:G2000W;ENSP00000434634:G944W;ENSP00000432131:G846W;ENSP00000436447:G910W;ENSP00000435405:G615W	ENSP00000260197:G2000W	G	+	1	0	SORL1	120997091	1.000000	0.71417	0.959000	0.39883	0.388000	0.30384	9.334000	0.96470	2.578000	0.87016	0.655000	0.94253	GGG	SORL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000137642		0.443	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	HGNC	protein_coding	OTTHUMT00000387626.2		0.00	19	0	G	NM_003105		121491881	+1			no_errors	ENST00000260197	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
SPAG6	9576	genome.wustl.edu	37	10	22634905	22634905	+	Intron	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr10:22634905C>T	ENST00000376624.3	+	2	263				SPAG6_ENST00000538630.1_Intron|SPAG6_ENST00000376601.1_Intron|SPAG6_ENST00000376603.2_Silent_p.A93A|SPAG6_ENST00000313311.6_Intron	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6						cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GGGGTCAGGCCGAGAGGGTGA	0.597																																																	0																																										SO:0001627	intron_variant	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.121+158C>T	10.37:g.22634905C>T			A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Silent	SNP	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.A93	ENST00000376624.3	37	c.279	CCDS7139.1	10																																																																																			SPAG6	-	NULL	ENSG00000077327		0.597	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1	-	0.00	65	0	C			22634905	+1	tier1	-	no_errors	ENST00000376603	ensembl	human	known	74_37	silent	10.91	49	6	SNP	0.000	T
SPECC1L	23384	genome.wustl.edu	37	22	24743079	24743079	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr22:24743079C>G	ENST00000314328.9	+	11	2963	c.2678C>G	c.(2677-2679)tCa>tGa	p.S893*	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|SPECC1L_ENST00000437398.1_Nonsense_Mutation_p.S893*|SPECC1L_ENST00000541492.1_Nonsense_Mutation_p.S893*	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	893					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						GGACCAATCTCAACATCCAAA	0.398																																																	0													113.0	105.0	108.0					22																	24743079		2203	4300	6503	SO:0001587	stop_gained	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.2678C>G	22.37:g.24743079C>G	ENSP00000325785:p.Ser893*		B7Z758|F5H1H6|O15081	Nonsense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_bHLH_dom,smart_CH-domain,pfscan_CH-domain	p.S893*	ENST00000314328.9	37	c.2678	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	c	40	8.363979	0.98779	.	.	ENSG00000100014	ENST00000437398;ENST00000314328;ENST00000541492	.	.	.	5.12	5.12	0.69794	.	0.374632	0.28273	N	0.015944	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-6.2009	14.4279	0.67227	0.0:1.0:0.0:0.0	.	.	.	.	X	893	.	ENSP00000325785:S893X	S	+	2	0	SPECC1L	23073079	0.993000	0.37304	0.739000	0.30968	0.978000	0.69477	4.525000	0.60559	2.564000	0.86499	0.313000	0.20887	TCA	SPECC1L	-	NULL	ENSG00000100014		0.398	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	-	0.00	40	0	C	NM_015330		24743079	+1	tier1	-	no_errors	ENST00000314328	ensembl	human	known	74_37	nonsense	18.64	47	11	SNP	0.406	G
ST8SIA3	51046	genome.wustl.edu	37	18	55021733	55021733	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr18:55021733C>T	ENST00000324000.3	+	2	2314	c.280C>T	c.(280-282)Cgg>Tgg	p.R94W		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	94					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GAAATTTAATCGGACAGCGTT	0.393																																																	0													106.0	105.0	106.0					18																	55021733		2203	4300	6503	SO:0001583	missense	0			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.280C>T	18.37:g.55021733C>T	ENSP00000320431:p.Arg94Trp		A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R94W	ENST00000324000.3	37	c.280	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030774	0.75504	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.48522	0.81	4.88	3.94	0.45596	.	0.174584	0.48767	D	0.000179	T	0.43986	0.1272	L	0.44542	1.39	0.53005	D	0.999963	D	0.63046	0.992	P	0.46629	0.522	T	0.47983	-0.9074	10	0.72032	D	0.01	-14.1362	11.4454	0.50120	0.2855:0.7144:0.0:0.0	.	94	O43173	SIA8C_HUMAN	W	201;94	ENSP00000320431:R94W	ENSP00000320431:R94W	R	+	1	2	ST8SIA3	53172731	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.497000	0.60367	2.409000	0.81822	0.467000	0.42956	CGG	ST8SIA3	-	pirsf_Sialyl_trans	ENSG00000177511		0.393	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	-	0.00	31	0	C	NM_015879		55021733	+1	tier1	-	no_errors	ENST00000324000	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	T
STAT2	6773	genome.wustl.edu	37	12	56739972	56739972	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:56739972C>T	ENST00000314128.4	-	22	2083	c.2060G>A	c.(2059-2061)cGg>cAg	p.R687Q	STAT2_ENST00000557235.1_Missense_Mutation_p.R683Q|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	687					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						GTATTTCCTCCGTTCCTGGAG	0.458																																																	0													183.0	161.0	169.0					12																	56739972		2203	4300	6503	SO:0001583	missense	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.2060G>A	12.37:g.56739972C>T	ENSP00000315768:p.Arg687Gln		B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.R687Q	ENST00000314128.4	37	c.2060	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	C	8.575	0.880961	0.17467	.	.	ENSG00000170581	ENST00000314128;ENST00000557235	D;D	0.85861	-2.04;-2.04	5.71	-9.95	0.00446	SH2 motif (1);	1.645410	0.03030	N	0.151962	T	0.76615	0.4012	L	0.31526	0.94	0.19575	N	0.999965	B;B	0.13594	0.006;0.008	B;B	0.13407	0.009;0.002	T	0.62812	-0.6775	10	0.11485	T	0.65	-1.8472	20.2921	0.98543	0.0:0.1859:0.0:0.8141	.	683;687	G3V2M6;P52630	.;STAT2_HUMAN	Q	687;683	ENSP00000315768:R687Q;ENSP00000450751:R683Q	ENSP00000315768:R687Q	R	-	2	0	STAT2	55026239	0.001000	0.12720	0.124000	0.21820	0.986000	0.74619	-1.862000	0.01653	-2.242000	0.00708	0.561000	0.74099	CGG	STAT2	-	NULL	ENSG00000170581		0.458	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1		0.00	19	0	C	NM_005419		56739972	-1			no_errors	ENST00000314128	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.022	T
STEAP2	261729	genome.wustl.edu	37	7	89859299	89859299	+	Silent	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:89859299T>C	ENST00000287908.3	+	4	1527	c.1134T>C	c.(1132-1134)tcT>tcC	p.S378S	STEAP2_ENST00000402625.2_Silent_p.S378S|STEAP2_ENST00000394629.2_Silent_p.S378S|STEAP2_ENST00000394621.2_Silent_p.S378S|STEAP2_ENST00000394622.2_Silent_p.S378S|STEAP2_ENST00000394632.1_Silent_p.S378S|STEAP2_ENST00000394626.1_Silent_p.S378S	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	378	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					CAGTCACTTCTATCCCTTCAG	0.403																																																	0													198.0	201.0	200.0					7																	89859299		2203	4300	6503	SO:0001819	synonymous_variant	0			AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.1134T>C	7.37:g.89859299T>C			A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Silent	SNP	pfam_Fe3_Rdtase_TM_dom	p.S378	ENST00000287908.3	37	c.1134	CCDS5615.1	7																																																																																			STEAP2	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000157214		0.403	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	HGNC	protein_coding	OTTHUMT00000059662.4	-	0.00	57	0	T	NM_152999		89859299	+1	tier1	-	no_errors	ENST00000287908	ensembl	human	known	74_37	silent	56.25	35	45	SNP	0.171	C
STIM2	57620	genome.wustl.edu	37	4	27009196	27009196	+	Silent	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:27009196G>T	ENST00000467011.1	+	8	1448	c.1023G>T	c.(1021-1023)ctG>ctT	p.L341L	STIM2_ENST00000467087.1_Silent_p.L341L|STIM2_ENST00000465503.1_Silent_p.L341L|STIM2_ENST00000237364.5_Silent_p.L428L|STIM2_ENST00000412829.2_Silent_p.L428L|STIM2_ENST00000382009.3_Silent_p.L428L	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	341					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AATTTGAACTGAGAAGCAGTT	0.403																																																	0													66.0	65.0	65.0					4																	27009196		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1023G>T	4.37:g.27009196G>T			A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.L428	ENST00000467011.1	37	c.1284	CCDS54752.1	4																																																																																			STIM2	-	NULL	ENSG00000109689		0.403	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	HGNC	protein_coding	OTTHUMT00000356861.1		0.00	23	0	G	NM_020860		27009196	+1			no_errors	ENST00000382009	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.983	T
STX6	10228	genome.wustl.edu	37	1	180953825	180953825	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:180953825G>A	ENST00000258301.5	-	7	916	c.679C>T	c.(679-681)Cat>Tat	p.H227Y	STX6_ENST00000469135.1_5'UTR|STX6_ENST00000542060.1_Missense_Mutation_p.H126Y	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	227					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						CTGGTCATATGAGATACTTTT	0.423																																																	0													102.0	97.0	98.0					1																	180953825		2203	4300	6503	SO:0001583	missense	0			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.679C>T	1.37:g.180953825G>A	ENSP00000258301:p.His227Tyr		B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	pfam_Syntaxin-6_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.H227Y	ENST00000258301.5	37	c.679	CCDS1341.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524973	0.85600	.	.	ENSG00000135823	ENST00000258301;ENST00000542060	.	.	.	5.7	5.7	0.88788	Target SNARE coiled-coil domain (1);	0.000000	0.85682	D	0.000000	D	0.84014	0.5379	M	0.83012	2.62	0.54753	D	0.999988	D;P	0.76494	0.999;0.726	D;B	0.83275	0.996;0.414	D	0.84866	0.0822	8	0.56958	D	0.05	-20.7196	19.4362	0.94796	0.0:0.0:1.0:0.0	.	126;227	B4DR17;O43752	.;STX6_HUMAN	Y	227;126	.	ENSP00000258301:H227Y	H	-	1	0	STX6	179220448	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	9.258000	0.95555	2.683000	0.91414	0.655000	0.94253	CAT	STX6	-	pfam_T_SNARE_dom	ENSG00000135823		0.423	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX6	HGNC	protein_coding	OTTHUMT00000085143.1		0.00	30	0	G	NM_005819		180953825	-1			no_errors	ENST00000258301	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
STXBP5	134957	genome.wustl.edu	37	6	147527120	147527120	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr6:147527120G>T	ENST00000321680.6	+	2	164	c.164G>T	c.(163-165)gGa>gTa	p.G55V	STXBP5-AS1_ENST00000427394.1_RNA|STXBP5_ENST00000367480.3_Missense_Mutation_p.G55V|STXBP5_ENST00000546097.1_Missense_Mutation_p.G55V|STXBP5-AS1_ENST00000367477.3_RNA|STXBP5_ENST00000367481.3_Missense_Mutation_p.G55V|STXBP5_ENST00000179882.6_5'UTR	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	55					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GTTCGCCATGGATTTCCCTAT	0.448																																																	0													174.0	157.0	162.0					6																	147527120		2203	4300	6503	SO:0001583	missense	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.164G>T	6.37:g.147527120G>T	ENSP00000321826:p.Gly55Val		Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.G55V	ENST00000321680.6	37	c.164	CCDS47499.1	6	.	.	.	.	.	.	.	.	.	.	G	33	5.256827	0.95336	.	.	ENSG00000164506	ENST00000367481;ENST00000546097;ENST00000321680;ENST00000367480	D;D;D;D	0.98120	-4.73;-4.73;-4.73;-4.73	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.99130	0.9700	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99253	1.0888	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	55;55	Q5T5C0-2;Q5T5C0	.;STXB5_HUMAN	V	55	ENSP00000356451:G55V;ENSP00000441479:G55V;ENSP00000321826:G55V;ENSP00000356450:G55V	ENSP00000321826:G55V	G	+	2	0	STXBP5	147568813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.238000	0.95380	2.941000	0.99782	0.655000	0.94253	GGA	STXBP5	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant	ENSG00000164506		0.448	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	-	0.00	33	0	G			147527120	+1	tier1	-	no_errors	ENST00000321680	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223395313	223395313	+	3'UTR	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:223395313T>C	ENST00000343846.3	-	0	2327				SUSD4_ENST00000478605.1_5'UTR|SUSD4_ENST00000484758.2_3'UTR|SUSD4_ENST00000366878.4_3'UTR|SUSD4_ENST00000494793.2_Intron			Q5VX71	SUSD4_HUMAN	sushi domain containing 4							integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		GCTGCCCCGGTTCCCCATGGG	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.*221A>G	1.37:g.223395313T>C			D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	RNA	SNP	-	NULL	ENST00000343846.3	37	NULL	CCDS41471.1	1																																																																																			SUSD4	-	-	ENSG00000143502		0.512	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	-	0.00	14	0	T	NM_017982		223395313	-1	tier1	-	no_errors	ENST00000478605	ensembl	human	known	74_37	rna	33.33	12	6	SNP	0.000	C
TAF5L	27097	genome.wustl.edu	37	1	229745865	229745865	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:229745865T>C	ENST00000366676.1	-	2	234	c.235A>G	c.(235-237)Aat>Gat	p.N79D	TAF5L_ENST00000366675.3_Missense_Mutation_p.N79D|TAF5L_ENST00000477957.1_5'UTR|TAF5L_ENST00000258281.2_Missense_Mutation_p.N79D			O75529	TAF5L_HUMAN	TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	79					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)	11	Breast(184;0.193)|Ovarian(103;0.249)	Prostate(94;0.167)				GTGAGAAAATTCCGCAGTCGT	0.453																																																	0													83.0	77.0	79.0					1																	229745865		2203	4300	6503	SO:0001583	missense	0			AF069736	CCDS1581.1, CCDS31051.1	1q42.11-q42.3	2013-01-10	2002-08-29		ENSG00000135801	ENSG00000135801		"""WD repeat domain containing"""	17304	protein-coding gene	gene with protein product	"""PCAF associated factor 65 beta"""		"""TAF5-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425, 11124703	Standard	XM_005273100		Approved	PAF65B	uc001htq.3	O75529	OTTHUMG00000039463	ENST00000366676.1:c.235A>G	1.37:g.229745865T>C	ENSP00000355636:p.Asn79Asp		Q5TDI5|Q5TDI6|Q8IW31	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TFIID-su_WD40-assoc_reg,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N79D	ENST00000366676.1	37	c.235	CCDS1581.1	1	.	.	.	.	.	.	.	.	.	.	T	10.54	1.379934	0.24944	.	.	ENSG00000135801	ENST00000366676;ENST00000258281;ENST00000366675	T;T;T	0.58652	0.32;0.32;0.94	4.88	4.88	0.63580	TFIID subunit, WD40-associated region (1);	0.319891	0.37857	N	0.001920	T	0.38506	0.1043	N	0.12182	0.205	0.27890	N	0.939382	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.13495	-1.0507	9	.	.	.	-12.4494	14.7815	0.69772	0.0:0.0:0.0:1.0	.	79;79	O75529-2;O75529	.;TAF5L_HUMAN	D	79	ENSP00000355636:N79D;ENSP00000258281:N79D;ENSP00000355635:N79D	.	N	-	1	0	TAF5L	227812488	1.000000	0.71417	0.979000	0.43373	0.991000	0.79684	3.331000	0.52075	1.960000	0.56953	0.448000	0.29417	AAT	TAF5L	-	pfam_TFIID-su_WD40-assoc_reg	ENSG00000135801		0.453	TAF5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF5L	HGNC	protein_coding	OTTHUMT00000095229.1	-	0.00	18	0	T	NM_014409		229745865	-1	tier1	-	no_errors	ENST00000258281	ensembl	human	known	74_37	missense	18.60	35	8	SNP	1.000	C
TDRD15	100129278	genome.wustl.edu	37	2	21365833	21365833	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:21365833A>C	ENST00000405799.1	+	4	5824	c.5494A>C	c.(5494-5496)Aaa>Caa	p.K1832Q				B5MCY1	TDR15_HUMAN	tudor domain containing 15	1832	Tudor 8. {ECO:0000255|PROSITE- ProRule:PRU00211}.						hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										TATAAATCTTAAAGTTGTTCC	0.328																																																	0																																										SO:0001583	missense	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.5494A>C	2.37:g.21365833A>C	ENSP00000384376:p.Lys1832Gln			Missense_Mutation	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.K1832Q	ENST00000405799.1	37	c.5494		2	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680186	0.68042	.	.	ENSG00000218819	ENST00000405799	T	0.09723	2.95	4.97	4.97	0.65823	.	.	.	.	.	T	0.19087	0.0458	.	.	.	.	.	.	.	.	.	.	.	.	T	0.14392	-1.0474	5	0.29301	T	0.29	-0.937	14.9538	0.71094	1.0:0.0:0.0:0.0	.	.	.	.	Q	1832	ENSP00000384376:K1832Q	ENSP00000384376:K1832Q	K	+	1	0	AC010872.2	21219338	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.971000	0.56831	1.988000	0.58038	0.528000	0.53228	AAA	TDRD15	-	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor	ENSG00000218819		0.328	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	21	0	A			21365833	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	32.00	17	8	SNP	0.998	C
TEX13A	56157	genome.wustl.edu	37	X	104464794	104464794	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chrX:104464794G>A	ENST00000413579.1	-	2	399	c.288C>T	c.(286-288)ttC>ttT	p.F96F	IL1RAPL2_ENST00000344799.4_Intron|TEX13A_ENST00000372575.1_Silent_p.F96F|TEX13A_ENST00000372578.3_Silent_p.F96F|IL1RAPL2_ENST00000372582.1_Intron			Q9BXU3	TX13A_HUMAN	testis expressed 13A	96							zinc ion binding (GO:0008270)			large_intestine(5)|ovary(2)|upper_aerodigestive_tract(1)	8						GCAGTTTGGCGAAGCCGTGCA	0.632													G|||	1	0.000264901	0.0	0.0	3775	,	,		11240	0.001		0.0	False		,,,				2504	0.0																0													32.0	32.0	32.0					X																	104464794		2202	4286	6488	SO:0001819	synonymous_variant	0			AF285597	CCDS76005.1	Xq28	2012-04-20	2007-03-13		ENSG00000133149	ENSG00000268629			11735	protein-coding gene	gene with protein product		300312	"""testis expressed sequence 13A"""			11279525	Standard	NM_031274		Approved		uc004ema.3	Q9BXU3	OTTHUMG00000022133	ENST00000413579.1:c.288C>T	X.37:g.104464794G>A			B1B1G8|Q32NB6	Silent	SNP	pfam_Znf_RanBP2,pfscan_Znf_RanBP2	p.F96	ENST00000413579.1	37	c.288		X																																																																																			TEX13A	-	NULL	ENSG00000133149		0.632	TEX13A-201	KNOWN	basic|appris_principal	protein_coding	TEX13A	HGNC	protein_coding			0.00	15	0	G	NM_031274		104464794	-1			no_errors	ENST00000413579	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.000	A
TEX14	56155	genome.wustl.edu	37	17	56643158	56643158	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:56643158G>A	ENST00000240361.8	-	28	4137	c.4052C>T	c.(4051-4053)tCc>tTc	p.S1351F	TEX14_ENST00000584699.1_5'Flank|TEX14_ENST00000349033.5_Missense_Mutation_p.S1305F|TEX14_ENST00000389934.3_Missense_Mutation_p.S1345F			Q8IWB6	TEX14_HUMAN	testis expressed 14	1351					attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CAACACCGTGGATGAGCCCTG	0.473																																																	0													127.0	88.0	101.0					17																	56643158		2203	4300	6503	SO:0001583	missense	0			AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.4052C>T	17.37:g.56643158G>A	ENSP00000240361:p.Ser1351Phe		A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.S1351F	ENST00000240361.8	37	c.4052	CCDS56042.1	17	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429399	0.62844	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.26223	1.75;1.75;1.75	5.35	5.35	0.76521	.	0.415392	0.23431	N	0.048247	T	0.43389	0.1245	L	0.59436	1.845	0.32477	N	0.541959	D;D;D	0.63880	0.976;0.993;0.986	P;P;P	0.59487	0.656;0.858;0.814	T	0.53947	-0.8366	10	0.87932	D	0	-1.8245	14.4328	0.67261	0.0:0.0:1.0:0.0	.	1351;1305;1345	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	F	1351;1345;1305	ENSP00000240361:S1351F;ENSP00000374584:S1345F;ENSP00000268910:S1305F	ENSP00000240361:S1351F	S	-	2	0	TEX14	53998157	0.533000	0.26354	0.482000	0.27366	0.378000	0.30076	1.108000	0.31123	2.780000	0.95670	0.655000	0.94253	TCC	TEX14	-	NULL	ENSG00000121101		0.473	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX14	HGNC	protein_coding	OTTHUMT00000445446.1		0.00	28	0	G			56643158	-1			no_errors	ENST00000240361	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.794	A
TFR2	7036	genome.wustl.edu	37	7	100238796	100238796	+	Missense_Mutation	SNP	C	C	T	rs80338877		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:100238796C>T	ENST00000462107.1	-	3	376	c.89G>A	c.(88-90)cGg>cAg	p.R30Q	TFR2_ENST00000431692.1_Missense_Mutation_p.R30Q|TFR2_ENST00000223051.3_Missense_Mutation_p.R30Q			Q9UP52	TFR2_HUMAN	transferrin receptor 2	30					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GTGCCCTTTCCGGGGGCCTTC	0.657																																																	0			GRCh37	CI011895	TFR2	I	rs80338877						10.0	11.0	11.0					7																	100238796		2188	4282	6470	SO:0001583	missense	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.89G>A	7.37:g.100238796C>T	ENSP00000420525:p.Arg30Gln		A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.R30Q	ENST00000462107.1	37	c.89	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.386978	0.01194	.	.	ENSG00000106327	ENST00000223051;ENST00000431692;ENST00000462107	T;T;T	0.51325	0.71;0.73;0.71	4.44	-6.04	0.02178	.	1.668120	0.03597	N	0.232710	T	0.19765	0.0475	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.10222	-1.0639	10	0.12766	T	0.61	-0.0168	2.057	0.03583	0.1364:0.1768:0.4186:0.2682	.	30	Q9UP52	TFR2_HUMAN	Q	30	ENSP00000223051:R30Q;ENSP00000413905:R30Q;ENSP00000420525:R30Q	ENSP00000223051:R30Q	R	-	2	0	TFR2	100076732	0.001000	0.12720	0.001000	0.08648	0.024000	0.10985	-0.201000	0.09464	-1.151000	0.02836	-1.610000	0.00802	CGG	TFR2	-	NULL	ENSG00000106327		0.657	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	-	0.00	27	0	C	NM_003227		100238796	-1	tier1	-	no_errors	ENST00000223051	ensembl	human	known	74_37	missense	9.84	55	6	SNP	0.000	T
TMBIM4	51643	genome.wustl.edu	37	12	66531894	66531894	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:66531894A>G	ENST00000358230.3	-	7	683	c.563T>C	c.(562-564)cTt>cCt	p.L188P	TMBIM4_ENST00000286424.7_Missense_Mutation_p.L235P|TMBIM4_ENST00000542724.1_Missense_Mutation_p.L157P|TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000539652.1_Silent_p.P160P|TMBIM4_ENST00000556010.1_Silent_p.P160P|TMBIM4_ENST00000544599.1_Missense_Mutation_p.L11P	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	188					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		ACAGAAAAGAAGGGCTCCTGC	0.378																																																	0													96.0	92.0	93.0					12																	66531894		1895	4121	6016	SO:0001583	missense	0			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.563T>C	12.37:g.66531894A>G	ENSP00000350965:p.Leu188Pro		Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	pfam_Bax_inhibitor_1-related	p.L188P	ENST00000358230.3	37	c.563	CCDS41805.1	12	.	.	.	.	.	.	.	.	.	.	A	24.4	4.521912	0.85600	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.81809	0.4901	H	0.95917	3.74	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.76071	0.987;0.983;0.981	D	0.87513	0.2441	9	.	.	.	-21.3592	16.8222	0.85835	1.0:0.0:0.0:0.0	.	235;157;188	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	P	188;11;235;188;233;157	ENSP00000350965:L188P;ENSP00000444639:L11P;ENSP00000286424:L235P;ENSP00000441291:L157P	.	L	-	2	0	TMBIM4	64818161	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.222000	0.89777	2.371000	0.80710	0.533000	0.62120	CTT	TMBIM4	-	pfam_Bax_inhibitor_1-related	ENSG00000155957		0.378	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	HGNC	protein_coding	OTTHUMT00000401832.2		0.00	23	0	A	NM_016056		66531894	-1			no_errors	ENST00000358230	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
TMC6	11322	genome.wustl.edu	37	17	76109657	76109657	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:76109657C>T	ENST00000590602.1	-	19	2485	c.2326G>A	c.(2326-2328)Gag>Aag	p.E776K	TNRC6C-AS1_ENST00000589217.1_RNA|TMC6_ENST00000592076.1_5'UTR|TMC6_ENST00000322914.3_Missense_Mutation_p.E776K|TMC6_ENST00000591436.1_Missense_Mutation_p.E355K|TMC6_ENST00000322933.4_Missense_Mutation_p.E355K|TMC6_ENST00000392467.3_Missense_Mutation_p.E776K|TMC6_ENST00000306591.7_Missense_Mutation_p.E425K			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	776					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TCCTTCCTCTCGTAGATGGAG	0.562																																																	0													134.0	118.0	124.0					17																	76109657		2203	4300	6503	SO:0001583	missense	0			AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.2326G>A	17.37:g.76109657C>T	ENSP00000465261:p.Glu776Lys		O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	pfam_TMC	p.E776K	ENST00000590602.1	37	c.2326	CCDS32748.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.122348	0.94429	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591;ENST00000322933	T;T;T;T	0.70869	-0.1;-0.1;0.2;-0.52	4.27	4.27	0.50696	.	0.174764	0.48767	U	0.000169	T	0.77758	0.4178	L	0.56769	1.78	0.53688	D	0.999973	D;P;D	0.69078	0.997;0.812;0.98	P;B;B	0.60789	0.879;0.12;0.441	T	0.75690	-0.3230	10	0.27785	T	0.31	-26.8678	14.8443	0.70249	0.0:1.0:0.0:0.0	.	425;776;355	Q7Z403-2;Q7Z403;Q7Z403-3	.;TMC6_HUMAN;.	K	776;776;425;355	ENSP00000313408:E776K;ENSP00000376260:E776K;ENSP00000306405:E425K;ENSP00000313479:E355K	ENSP00000306405:E425K	E	-	1	0	TMC6	73621252	0.964000	0.33143	0.969000	0.41365	0.993000	0.82548	2.467000	0.45093	2.068000	0.61886	0.650000	0.86243	GAG	TMC6	-	NULL	ENSG00000141524		0.562	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1	-	0.00	39	0	C			76109657	-1	tier1	-	no_errors	ENST00000322914	ensembl	human	known	74_37	missense	26.42	39	14	SNP	0.999	T
TMEM91	641649	genome.wustl.edu	37	19	41889782	41889782	+	3'UTR	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:41889782C>T	ENST00000392002.2	+	0	1183				TMEM91_ENST00000356385.4_3'UTR|TMEM91_ENST00000413014.2_Silent_p.C125C|TMEM91_ENST00000447302.2_Missense_Mutation_p.P122S|TMEM91_ENST00000539627.1_3'UTR|TMEM91_ENST00000436170.2_Intron|TMEM91_ENST00000542945.1_3'UTR|TMEM91_ENST00000604123.1_Silent_p.C182C|BCKDHA_ENST00000595085.1_Intron|CTC-435M10.3_ENST00000540732.1_Intron|TMEM91_ENST00000544232.1_Silent_p.C125C|CTC-435M10.3_ENST00000604424.1_Intron	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91						hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						GCCCTAGTTGCCCCTACAGCC	0.677																																																	0													23.0	27.0	26.0					19																	41889782		1980	4166	6146	SO:0001624	3_prime_UTR_variant	0			AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.*4C>T	19.37:g.41889782C>T			C9J9D1|C9JZ62|C9K046|Q6P434	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.P122S	ENST00000392002.2	37	c.364	CCDS42571.1	19	.	.	.	.	.	.	.	.	.	.	C	9.583	1.124093	0.20959	.	.	ENSG00000142046	ENST00000447302;ENST00000546050	.	.	.	3.57	2.51	0.30379	.	.	.	.	.	T	0.14830	0.0358	N	0.03608	-0.345	0.19300	N	0.999973	B	0.30851	0.297	B	0.32342	0.144	T	0.18209	-1.0344	8	0.02654	T	1	.	11.3868	0.49789	0.0:0.4866:0.5133:0.0	.	122	C9J9D1	.	S	122;58	.	ENSP00000405647:P122S	P	+	1	0	TMEM91	46581622	0.504000	0.26123	0.615000	0.29064	0.391000	0.30476	1.593000	0.36686	0.838000	0.34948	-0.304000	0.09214	CCC	TMEM91	-	NULL	ENSG00000142046		0.677	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM91	HGNC	protein_coding	OTTHUMT00000398302.2		0.00	27	0	C			41889782	+1			no_errors	ENST00000447302	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.044	T
TNRC18	84629	genome.wustl.edu	37	7	5391652	5391652	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:5391652C>T	ENST00000430969.1	-	17	5616	c.5268G>A	c.(5266-5268)ctG>ctA	p.L1756L	TNRC18_ENST00000399537.4_Silent_p.L1756L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1756							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGGAAGGCGTCAGTTTGGAGC	0.577																																																	0													36.0	34.0	35.0					7																	5391652		1568	3582	5150	SO:0001819	synonymous_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5268G>A	7.37:g.5391652C>T			A8MX41|Q96JH1|Q96K91	Silent	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.L1756	ENST00000430969.1	37	c.5268	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.577	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	16	0	C			5391652	-1			no_errors	ENST00000399537	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.054	T
TP53	7157	genome.wustl.edu	37	17	7577567	7577568	+	Frame_Shift_Del	DEL	AC	AC	-	rs193920789		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr17:7577567_7577568delAC	ENST00000269305.4	-	7	902_903	c.713_714delGT	c.(712-714)tgtfs	p.C238fs	TP53_ENST00000359597.4_Frame_Shift_Del_p.C238fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.C238fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.C238fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Frame_Shift_Del_p.C238fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.C238fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.N239fs*25(12)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145Y(5)|p.C145F(5)|p.N239fs*1(4)|p.M237_N239delMCN(4)|p.C238*(4)|p.C238W(2)|p.M144_N146delMCN(1)|p.N146fs*1(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.C238_N239insX(1)|p.C238_M246delCNSSCMGGM(1)|p.C238fs*21(1)|p.N239fs*26(1)|p.C238del(1)|p.C238C(1)|p.M237fs*1(1)|p.C145S(1)|p.H233fs*6(1)|p.H233_C242del10(1)|p.N239_C242del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGAACTGTTACACATGTAGTT	0.574		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	184	Substitution - Missense(133)|Insertion - Frameshift(18)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Substitution - Nonsense(4)|Deletion - Frameshift(4)|Insertion - In frame(1)|Substitution - coding silent(1)	breast(23)|ovary(23)|lung(16)|large_intestine(15)|haematopoietic_and_lymphoid_tissue(14)|endometrium(13)|oesophagus(11)|upper_aerodigestive_tract(10)|central_nervous_system(10)|urinary_tract(9)|pancreas(8)|soft_tissue(7)|biliary_tract(6)|stomach(5)|liver(5)|bone(5)|skin(3)|meninges(1)	GRCh37	CM034930	TP53	M																																				SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713_714delGT	17.37:g.7577569_7577570delAC	ENSP00000269305:p.Cys238fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238fs	ENST00000269305.4	37	c.714_713	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.574	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	242	0	AC	NM_000546		7577568	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	50.92	134	139	DEL	0.999:1.000	-
TRPM8	79054	genome.wustl.edu	37	2	234854530	234854530	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:234854530G>A	ENST00000324695.4	+	7	770	c.730G>A	c.(730-732)Gac>Aac	p.D244N	AC005538.5_ENST00000455991.1_RNA|TRPM8_ENST00000433712.2_5'UTR	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	244					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CCTTATGGATGACTTCACAAG	0.408																																																	0													129.0	118.0	122.0					2																	234854530		2203	4300	6503	SO:0001583	missense	0			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.730G>A	2.37:g.234854530G>A	ENSP00000323926:p.Asp244Asn		A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.D244N	ENST00000324695.4	37	c.730	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	G	18.15	3.560085	0.65538	.	.	ENSG00000144481	ENST00000324695	T	0.57595	0.39	5.72	5.72	0.89469	.	0.071876	0.56097	D	0.000023	T	0.46444	0.1393	L	0.38531	1.155	0.80722	D	1	P	0.34462	0.454	B	0.32677	0.15	T	0.42816	-0.9429	10	0.46703	T	0.11	-35.6154	18.4603	0.90736	0.0:0.0:1.0:0.0	.	244	Q7Z2W7	TRPM8_HUMAN	N	244	ENSP00000323926:D244N	ENSP00000323926:D244N	D	+	1	0	TRPM8	234519269	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	6.379000	0.73154	2.717000	0.92951	0.655000	0.94253	GAC	TRPM8	-	NULL	ENSG00000144481		0.408	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	-	0.00	41	0	G	NM_024080		234854530	+1	tier1	-	no_errors	ENST00000324695	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	A
TSSK1B	83942	genome.wustl.edu	37	5	112770525	112770525	+	Silent	SNP	A	A	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr5:112770525A>G	ENST00000390666.3	-	1	203	c.12T>C	c.(10-12)gcT>gcC	p.A4A	CTD-2201G3.1_ENST00000416046.2_RNA|MCC_ENST00000408903.3_Intron|CTD-2201G3.1_ENST00000383058.4_RNA|CTD-2201G3.1_ENST00000510381.2_RNA	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	4					multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		TGAGGACAGCAGCGTCATCCA	0.547																																																	0													40.0	43.0	42.0					5																	112770525		2130	4259	6389	SO:0001819	synonymous_variant	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.12T>C	5.37:g.112770525A>G			B2R8D9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A4	ENST00000390666.3	37	c.12	CCDS4112.1	5																																																																																			TSSK1B	-	NULL	ENSG00000212122		0.547	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	HGNC	protein_coding	OTTHUMT00000250774.2	-	0.00	20	0	A	NM_032028		112770525	-1	tier1	-	no_errors	ENST00000390666	ensembl	human	known	74_37	silent	21.74	18	5	SNP	0.994	G
TTC21A	199223	genome.wustl.edu	37	3	39172546	39172546	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:39172546A>T	ENST00000431162.2	+	19	2677	c.2543A>T	c.(2542-2544)aAg>aTg	p.K848M	TTC21A_ENST00000440121.1_Missense_Mutation_p.K800M|TTC21A_ENST00000301819.6_Missense_Mutation_p.K849M			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	848										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AAGGTTTACAAGAGCCATAAA	0.418																																																	0													77.0	72.0	74.0					3																	39172546		1881	4111	5992	SO:0001583	missense	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.2543A>T	3.37:g.39172546A>T	ENSP00000398211:p.Lys848Met		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K849M	ENST00000431162.2	37	c.2546	CCDS46800.1	3	.	.	.	.	.	.	.	.	.	.	A	12.90	2.077287	0.36662	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.64260	-0.09;-0.09;0.02	4.72	2.29	0.28610	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.326325	0.25954	N	0.027234	T	0.74733	0.3755	M	0.81112	2.525	0.25695	N	0.985645	D;P;P	0.89917	1.0;0.948;0.914	D;P;P	0.67548	0.952;0.715;0.522	T	0.64918	-0.6294	10	0.52906	T	0.07	-4.1253	8.4411	0.32816	0.8326:0.0:0.1674:0.0	.	800;849;848	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	M	849;831;848;800	ENSP00000301819:K849M;ENSP00000398211:K848M;ENSP00000410882:K800M	ENSP00000301819:K849M	K	+	2	0	TTC21A	39147550	0.788000	0.28762	0.068000	0.19968	0.166000	0.22503	1.288000	0.33296	0.268000	0.21939	0.455000	0.32223	AAG	TTC21A	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168026		0.418	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1		0.00	38	0	A	NM_145755		39172546	+1			no_errors	ENST00000301819	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.662	T
TTC31	64427	genome.wustl.edu	37	2	74717254	74717254	+	Splice_Site	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:74717254G>A	ENST00000233623.5	+	3	239	c.232G>A	c.(232-234)Gat>Aat	p.D78N	TTC31_ENST00000442235.2_Intron|TTC31_ENST00000410003.1_Splice_Site_p.D78N|TTC31_ENST00000463189.1_Intron	NM_022492.4	NP_071937.4	Q49AM3	TTC31_HUMAN	tetratricopeptide repeat domain 31	78										breast(1)|endometrium(1)|large_intestine(4)|lung(2)|skin(1)	9						GTGGCACCATGGTGGGGAGTG	0.627																																																	0													19.0	23.0	22.0					2																	74717254		2040	4203	6243	SO:0001630	splice_region_variant	0			AK026819	CCDS42701.1	2p13.1	2013-01-11			ENSG00000115282	ENSG00000115282		"""Tetratricopeptide (TTC) repeat domain containing"""	25759	protein-coding gene	gene with protein product						12477932	Standard	NM_022492		Approved	FLJ12788	uc002slt.2	Q49AM3	OTTHUMG00000152887	ENST00000233623.5:c.232+1G>A	2.37:g.74717254G>A			Q4KN40|Q53FD4|Q9H9F7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D78N	ENST00000233623.5	37	c.232	CCDS42701.1	2	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500066	0.64298	.	.	ENSG00000115282	ENST00000410003;ENST00000435361;ENST00000441635;ENST00000233623	T;T	0.55760	0.5;0.5	3.9	3.01	0.34805	.	0.196377	0.32416	N	0.006140	T	0.46698	0.1406	L	0.56769	1.78	0.80722	D	1	P	0.48162	0.906	B	0.43445	0.42	T	0.40572	-0.9556	10	0.41790	T	0.15	.	7.2817	0.26314	0.1236:0.0:0.8764:0.0	.	78	Q49AM3	TTC31_HUMAN	N	78	ENSP00000387213:D78N;ENSP00000233623:D78N	ENSP00000233623:D78N	D	+	1	0	TTC31	74570762	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.381000	0.44336	0.976000	0.38417	0.561000	0.74099	GAT	TTC31	-	NULL	ENSG00000115282		0.627	TTC31-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC31	HGNC	protein_coding	OTTHUMT00000328422.1	-	0.00	94	0	G	NM_022492	Missense_Mutation	74717254	+1	tier1	-	no_errors	ENST00000233623	ensembl	human	novel	74_37	missense	12.75	130	19	SNP	1.000	A
TTI1	9675	genome.wustl.edu	37	20	36640851	36640851	+	Silent	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr20:36640851C>G	ENST00000373448.2	-	3	1606	c.1368G>C	c.(1366-1368)ctG>ctC	p.L456L	TTI1_ENST00000487362.1_5'UTR|TTI1_ENST00000449821.1_Silent_p.L456L|TTI1_ENST00000373447.3_Silent_p.L456L	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	456					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						GAGAAGCATTCAGATCATCAG	0.498																																																	0													59.0	61.0	60.0					20																	36640851		2203	4300	6503	SO:0001819	synonymous_variant	0			BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.1368G>C	20.37:g.36640851C>G			D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	superfamily_ARM-type_fold,pirsf_UCP005250	p.L456	ENST00000373448.2	37	c.1368	CCDS13300.1	20																																																																																			TTI1	-	superfamily_ARM-type_fold,pirsf_UCP005250	ENSG00000101407		0.498	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI1	HGNC	protein_coding	OTTHUMT00000079138.2	-	0.00	36	0	C	NM_014657		36640851	-1	tier1	-	no_errors	ENST00000373447	ensembl	human	known	74_37	silent	11.43	62	8	SNP	0.256	G
TTN	7273	genome.wustl.edu	37	2	179399772	179399772	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:179399772T>C	ENST00000591111.1	-	308	96871	c.96647A>G	c.(96646-96648)cAg>cGg	p.Q32216R	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q24917R|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q24984R|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Q33857R|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q24792R|TTN-AS1_ENST00000442329.2_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q31289R|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589391.1_RNA			Q8WZ42	TITIN_HUMAN	titin	32216	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCAAAACCTGATCAGTCCC	0.378																																																	0													109.0	105.0	107.0					2																	179399772		1878	4104	5982	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.96647A>G	2.37:g.179399772T>C	ENSP00000465570:p.Gln32216Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q31289R	ENST00000591111.1	37	c.93866		2	.	.	.	.	.	.	.	.	.	.	T	15.39	2.820903	0.50633	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.62804	0.2458	N	0.10760	0.04	0.54753	D	0.999984	B;B;B;B	0.22800	0.038;0.038;0.038;0.075	B;B;B;P	0.49477	0.328;0.328;0.328;0.612	T	0.68769	-0.5321	9	0.87932	D	0	.	16.0066	0.80367	0.0:0.0:0.0:1.0	.	24792;24917;24984;32216	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	31289;24792;24984;24917;24789	ENSP00000343764:Q31289R;ENSP00000434586:Q24792R;ENSP00000340554:Q24984R;ENSP00000352154:Q24917R	ENSP00000340554:Q24984R	Q	-	2	0	TTN	179108018	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.039000	0.57325	2.178000	0.69098	0.455000	0.32223	CAG	TTN	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	48	0	T	NM_133378		179399772	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	24.14	44	14	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179518185	179518185	+	Intron	SNP	A	A	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr2:179518185A>T	ENST00000591111.1	-	157	34747				TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Silent_p.L12892L|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCTTTTTAGGAAGCACCAGTG	0.388																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34523-917T>A	2.37:g.179518185A>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L12892	ENST00000591111.1	37	c.38676		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	46	0	A	NM_133378		179518185	-1	tier1	-	no_errors	ENST00000589042	ensembl	human	putative	74_37	silent	12.00	44	6	SNP	0.007	T
TUBA1C	84790	genome.wustl.edu	37	12	49666495	49666495	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:49666495G>A	ENST00000301072.6	+	4	1110	c.835G>A	c.(835-837)Gag>Aag	p.E279K	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Missense_Mutation_p.E349K	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	279					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						CATCTCTGCTGAGAAAGCCTA	0.527																																																	0													22.0	72.0	55.0					12																	49666495		2096	4273	6369	SO:0001583	missense	0			BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.835G>A	12.37:g.49666495G>A	ENSP00000301072:p.Glu279Lys			Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.E279K	ENST00000301072.6	37	c.835	CCDS8782.1	12	.	.	.	.	.	.	.	.	.	.	G	19.75	3.886326	0.72410	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000321665	D;D	0.84516	-1.86;-1.86	5.12	5.12	0.69794	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91466	0.7306	M	0.73372	2.23	0.80722	D	1	D;D	0.67145	0.961;0.996	P;D	0.66602	0.815;0.945	D	0.92073	0.5666	10	0.87932	D	0	.	18.2765	0.90085	0.0:0.0:1.0:0.0	.	349;279	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	K	349;279;149	ENSP00000443475:E349K;ENSP00000301072:E279K	ENSP00000301072:E279K	E	+	1	0	TUBA1C	47952762	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.286000	0.95898	2.777000	0.95525	0.549000	0.68633	GAG	TUBA1C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin	ENSG00000167553		0.527	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1C	HGNC	protein_coding	OTTHUMT00000404424.1	-	0.00	62	0	G	NM_032704		49666495	+1	tier1	-	no_errors	ENST00000301072	ensembl	human	known	74_37	missense	23.73	90	28	SNP	1.000	A
TWISTNB	221830	genome.wustl.edu	37	7	19748503	19748503	+	Missense_Mutation	SNP	G	G	A	rs527876640		TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr7:19748503G>A	ENST00000222567.5	-	1	207	c.137C>T	c.(136-138)tCa>tTa	p.S46L		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	46					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CACCAGGCATGAGTAGCGACT	0.622											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													56.0	48.0	51.0					7																	19748503		2203	4300	6503	SO:0001583	missense	0			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.137C>T	7.37:g.19748503G>A	ENSP00000222567:p.Ser46Leu	735	A0PJ45|B7Z724	Missense_Mutation	SNP	pfam_RNA_pol_Rpb7_N	p.S46L	ENST00000222567.5	37	c.137	CCDS34606.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.293642	0.80914	.	.	ENSG00000105849	ENST00000222567	.	.	.	4.06	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.65322	0.2680	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.68477	-0.5398	9	0.87932	D	0	-9.5442	12.3634	0.55215	0.0866:0.0:0.9134:0.0	.	46	Q3B726	RPA43_HUMAN	L	46	.	ENSP00000222567:S46L	S	-	2	0	TWISTNB	19715028	1.000000	0.71417	1.000000	0.80357	0.554000	0.35429	6.426000	0.73374	2.246000	0.74042	0.655000	0.94253	TCA	TWISTNB	-	NULL	ENSG00000105849		0.622	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWISTNB	HGNC	protein_coding	OTTHUMT00000326463.1	-	0.00	40	0	G			19748503	-1	tier1	-	no_errors	ENST00000222567	ensembl	human	known	74_37	missense	18.75	52	12	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101683933	101683933	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr12:101683933C>A	ENST00000261637.4	+	7	790	c.616C>A	c.(616-618)Ctt>Att	p.L206I		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	206					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TAAAAACGCACTTTTCAATTT	0.289																																																	0													47.0	52.0	50.0					12																	101683933		2202	4300	6502	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.616C>A	12.37:g.101683933C>A	ENSP00000261637:p.Leu206Ile		Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.L206I	ENST00000261637.4	37	c.616	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.582616	0.86748	.	.	ENSG00000120800	ENST00000261637	T	0.66460	-0.21	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79598	0.4473	M	0.69823	2.125	0.80722	D	1	D	0.69078	0.997	D	0.63033	0.91	T	0.73799	-0.3869	10	0.20046	T	0.44	-17.5105	20.0716	0.97726	0.0:1.0:0.0:0.0	.	206	O75691	UTP20_HUMAN	I	206	ENSP00000261637:L206I	ENSP00000261637:L206I	L	+	1	0	UTP20	100208064	0.979000	0.34478	0.981000	0.43875	0.816000	0.46133	2.561000	0.45905	2.741000	0.93983	0.585000	0.79938	CTT	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.289	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	-	0.00	34	0	C	NM_014503		101683933	+1	tier1	-	no_errors	ENST00000261637	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	A
UTP3	57050	genome.wustl.edu	37	4	71555258	71555258	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr4:71555258G>C	ENST00000254803.2	+	1	1063	c.864G>C	c.(862-864)agG>agC	p.R288S		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	288					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			TGAAAGCTAGGAGAGTCCCAG	0.433																																																	0													182.0	183.0	183.0					4																	71555258		2203	4300	6503	SO:0001583	missense	0			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.864G>C	4.37:g.71555258G>C	ENSP00000254803:p.Arg288Ser		Q6FI82	Missense_Mutation	SNP	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.R288S	ENST00000254803.2	37	c.864	CCDS3546.1	4	.	.	.	.	.	.	.	.	.	.	G	12.88	2.069876	0.36566	.	.	ENSG00000132467	ENST00000254803	T	0.28454	1.61	5.21	3.46	0.39613	.	0.046252	0.85682	D	0.000000	T	0.23171	0.0560	L	0.40543	1.245	0.40632	D	0.981864	P	0.41978	0.767	B	0.43052	0.406	T	0.07404	-1.0774	10	0.02654	T	1	-3.1597	11.0745	0.48023	0.2469:0.0:0.7531:0.0	.	288	Q9NQZ2	SAS10_HUMAN	S	288	ENSP00000254803:R288S	ENSP00000254803:R288S	R	+	3	2	UTP3	71774122	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	1.438000	0.35002	1.327000	0.45338	0.655000	0.94253	AGG	UTP3	-	pfam_Sas10/Utp3/C1D	ENSG00000132467		0.433	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2	-	0.00	31	0	G	NM_020368		71555258	+1	tier1	-	no_errors	ENST00000254803	ensembl	human	known	74_37	missense	31.58	26	12	SNP	0.995	C
VPS45	11311	genome.wustl.edu	37	1	150048327	150048327	+	Silent	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:150048327C>T	ENST00000369130.3	+	4	852	c.306C>T	c.(304-306)atC>atT	p.I102I	VPS45_ENST00000535106.1_Silent_p.I102I|VPS45_ENST00000369128.5_Silent_p.I66I	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)	102					blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTAATGTGATCAGCAAGAGTG	0.408																																																	0													177.0	155.0	162.0					1																	150048327		2203	4300	6503	SO:0001819	synonymous_variant	0			U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.306C>T	1.37:g.150048327C>T			D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	Silent	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.I102	ENST00000369130.3	37	c.306	CCDS944.1	1																																																																																			VPS45	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000136631		0.408	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	HGNC	protein_coding	OTTHUMT00000034964.1	-	0.00	28	0	C	NM_007259		150048327	+1	tier1	-	no_errors	ENST00000369130	ensembl	human	known	74_37	silent	14.61	76	13	SNP	1.000	T
WDR6	11180	genome.wustl.edu	37	3	49051540	49051540	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr3:49051540C>G	ENST00000608424.1	+	2	2612	c.2573C>G	c.(2572-2574)cCa>cGa	p.P858R	WDR6_ENST00000448293.1_Missense_Mutation_p.P807R|WDR6_ENST00000415265.2_Missense_Mutation_p.P306R|WDR6_ENST00000395474.3_Missense_Mutation_p.P888R			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	858					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		AAGGTAGACCCAGAGACCAGG	0.577											OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													67.0	60.0	63.0					3																	49051540		2203	4300	6503	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.2573C>G	3.37:g.49051540C>G	ENSP00000477389:p.Pro858Arg	959	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P888R	ENST00000608424.1	37	c.2663		3	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387222	0.61956	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T	0.78364	-1.17;-1.15	5.39	5.39	0.77823	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87334	0.6151	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.992	D	0.84111	0.0401	10	0.26408	T	0.33	-14.9553	19.5197	0.95180	0.0:1.0:0.0:0.0	.	306;858;807	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	R	888;306;807	ENSP00000378857:P888R;ENSP00000413432:P807R	ENSP00000378857:P888R	P	+	2	0	WDR6	49026544	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	7.533000	0.81994	2.689000	0.91719	0.561000	0.74099	CCA	WDR6	-	superfamily_WD40_repeat_dom	ENSG00000178252		0.577	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	-	0.00	54	0	C			49051540	+1	tier1	-	no_errors	ENST00000395474	ensembl	human	known	74_37	missense	18.37	40	9	SNP	1.000	G
WDR61	80349	genome.wustl.edu	37	15	78580699	78580699	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr15:78580699C>G	ENST00000267973.2	-	8	859	c.588G>C	c.(586-588)ttG>ttC	p.L196F	WDR61_ENST00000559332.1_5'Flank|WDR61_ENST00000558311.1_Missense_Mutation_p.L196F|WDR61_ENST00000558459.1_Missense_Mutation_p.L103F			Q9GZS3	WDR61_HUMAN	WD repeat domain 61	196					histone H3-K4 trimethylation (GO:0080182)|negative regulation of myeloid cell differentiation (GO:0045638)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	9						GGGAAAAGGTCAAGGAGCGAA	0.493																																																	0													168.0	129.0	142.0					15																	78580699		2196	4293	6489	SO:0001583	missense	0				CCDS10300.1	15q25.1	2013-01-09			ENSG00000140395	ENSG00000140395		"""WD repeat domain containing"""	30300	protein-coding gene	gene with protein product		609540				12477932	Standard	NM_025234		Approved	REC14	uc002bdn.3	Q9GZS3	OTTHUMG00000143735	ENST00000267973.2:c.588G>C	15.37:g.78580699C>G	ENSP00000267973:p.Leu196Phe		D3DW84|Q6IA22|Q7Z4X4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L196F	ENST00000267973.2	37	c.588	CCDS10300.1	15	.	.	.	.	.	.	.	.	.	.	C	18.93	3.726736	0.69074	.	.	ENSG00000140395	ENST00000267973	T	0.64803	-0.12	5.88	3.9	0.45041	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.065023	0.64402	D	0.000007	T	0.76292	0.3967	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.76889	-0.2792	10	0.87932	D	0	-1.6699	9.5849	0.39510	0.0:0.6583:0.2641:0.0777	.	196	Q9GZS3	WDR61_HUMAN	F	196	ENSP00000267973:L196F	ENSP00000267973:L196F	L	-	3	2	WDR61	76367754	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.527000	0.35975	0.727000	0.32360	0.555000	0.69702	TTG	WDR61	-	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000140395		0.493	WDR61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR61	HGNC	protein_coding	OTTHUMT00000289803.3	-	0.00	41	0	C	NM_025234		78580699	-1	tier1	-	no_errors	ENST00000267973	ensembl	human	known	74_37	missense	10.00	54	6	SNP	1.000	G
XRRA1	143570	genome.wustl.edu	37	11	74638501	74638501	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr11:74638501G>C	ENST00000340360.6	-	7	764	c.433C>G	c.(433-435)Ctg>Gtg	p.L145V	XRRA1_ENST00000321448.8_5'UTR|XRRA1_ENST00000527087.1_Missense_Mutation_p.L145V|XRRA1_ENST00000533598.1_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GCGAGATCCAGTTCCTTTAGG	0.393																																																	0													96.0	90.0	92.0					11																	74638501		1862	4093	5955	SO:0001583	missense	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.433C>G	11.37:g.74638501G>C	ENSP00000339918:p.Leu145Val			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L145V	ENST00000340360.6	37	c.433	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575496	0.65878	.	.	ENSG00000166435	ENST00000340360;ENST00000344880;ENST00000398418;ENST00000527087;ENST00000525407	T;D;T	0.84070	0.34;-1.8;-0.86	5.57	2.5	0.30297	.	0.000000	0.64402	D	0.000008	D	0.88295	0.6398	M	0.76002	2.32	0.36198	D	0.850553	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.88614	0.3158	10	0.62326	D	0.03	-11.0837	7.5059	0.27545	0.3034:0.0:0.6966:0.0	.	145;145	Q6P2D8;Q6P2D8-2	XRRA1_HUMAN;.	V	145;145;145;145;153	ENSP00000339918:L145V;ENSP00000435838:L145V;ENSP00000437334:L153V	ENSP00000339918:L145V	L	-	1	2	XRRA1	74316149	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.942000	0.29017	0.612000	0.30071	0.650000	0.86243	CTG	XRRA1	-	NULL	ENSG00000166435		0.393	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	-	0.00	57	0	G	NM_182969		74638501	-1	tier1	-	no_errors	ENST00000340360	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	C
ZMYM1	79830	genome.wustl.edu	37	1	35570262	35570262	+	Silent	SNP	G	G	A			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr1:35570262G>A	ENST00000373330.1	+	7	873	c.699G>A	c.(697-699)gaG>gaA	p.E233E	ZMYM1_ENST00000359858.4_Silent_p.E233E|ZMYM1_ENST00000373329.1_3'UTR			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	233						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACTGCTGTGAGAACTGTGGCA	0.378																																																	0													91.0	87.0	89.0					1																	35570262		2071	4245	6316	SO:0001819	synonymous_variant	0			AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.699G>A	1.37:g.35570262G>A			D3DPR7|Q7Z3Q4	Silent	SNP	pfam_Znf_MYM,pfam_HATC_dom_C,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.E233	ENST00000373330.1	37	c.699	CCDS41302.1	1																																																																																			ZMYM1	-	pfam_Znf_MYM,smart_TRASH_dom	ENSG00000197056		0.378	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZMYM1	HGNC	protein_coding	OTTHUMT00000012705.1	-	0.00	36	0	G	NM_024772		35570262	+1	tier1	-	no_errors	ENST00000359858	ensembl	human	novel	74_37	silent	19.23	41	10	SNP	1.000	A
ZNF69	7620	genome.wustl.edu	37	19	12016492	12016492	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:12016492C>T	ENST00000429654.2	+	4	1420	c.1280C>T	c.(1279-1281)tCt>tTt	p.S427F	ZNF69_ENST00000340180.5_Intron			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	427					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		GCCTTCAGATCTTCCTCACAC	0.448																																																	0																																										SO:0001583	missense	0			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.1280C>T	19.37:g.12016492C>T	ENSP00000402985:p.Ser427Phe		Q86VA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S427F	ENST00000429654.2	37	c.1280		19	.	.	.	.	.	.	.	.	.	.	c	0.006	-2.022099	0.00414	.	.	ENSG00000198429	ENST00000429654	T	0.03580	3.88	1.11	-2.23	0.06930	.	.	.	.	.	T	0.01592	0.0051	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43475	-0.9389	6	0.10902	T	0.67	.	1.2138	0.01910	0.367:0.1856:0.3132:0.1342	.	.	.	.	F	427	ENSP00000402985:S427F	ENSP00000402985:S427F	S	+	2	0	ZNF69	11877492	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.358000	0.00069	-3.143000	0.00233	-1.976000	0.00459	TCT	ZNF69	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198429		0.448	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	ZNF69	HGNC	protein_coding	OTTHUMT00000344082.1	-	0.00	43	0	C	NM_021915		12016492	+1	tier1	-	no_errors	ENST00000429654	ensembl	human	known	74_37	missense	18.18	54	12	SNP	0.000	T
ZNF431	170959	genome.wustl.edu	37	19	21365980	21365980	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A51D-01A-11D-A27G-09	TCGA-IG-A51D-10A-01D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693188df-7f65-487e-bd59-ab40af89aa10	8b30e90d-07cd-49de-8dc7-4fdefd507ef0	g.chr19:21365980G>T	ENST00000311048.7	+	5	1018	c.874G>T	c.(874-876)Gaa>Taa	p.E292*	ZNF431_ENST00000594425.1_Intron|ZNF431_ENST00000600692.1_3'UTR	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	292					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)	p.E292Q(1)		breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						TAGATGTGAAGAATGTGGCAA	0.403																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											55.0	58.0	57.0					19																	21365980		2202	4298	6500	SO:0001587	stop_gained	0			AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.874G>T	19.37:g.21365980G>T	ENSP00000308578:p.Glu292*		A8KAK7|Q8IWC4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E292*	ENST00000311048.7	37	c.874	CCDS32979.1	19	.	.	.	.	.	.	.	.	.	.	.	17.90	3.502949	0.64298	.	.	ENSG00000196705	ENST00000311048	.	.	.	1.0	1.0	0.19881	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	4.5417	0.12061	0.2371:0.0:0.7629:0.0	.	.	.	.	X	292	.	ENSP00000308578:E292X	E	+	1	0	ZNF431	21157820	0.000000	0.05858	0.792000	0.32020	0.769000	0.43574	-1.368000	0.02580	0.446000	0.26666	0.449000	0.29647	GAA	ZNF431	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196705		0.403	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF431	HGNC	protein_coding	OTTHUMT00000463943.1		0.00	28	0	G	XM_086098		21365980	+1			no_errors	ENST00000311048	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.010	T
