#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AARS	16	genome.wustl.edu	37	16	70291981	70291981	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:70291981G>T	ENST00000261772.8	-	15	2275	c.2132C>A	c.(2131-2133)tCt>tAt	p.S711Y	AARS_ENST00000564359.1_Intron	NM_001605.2	NP_001596.2			alanyl-tRNA synthetase											breast(3)|cervix(2)|endometrium(5)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	27		Ovarian(137;0.0365)		BRCA - Breast invasive adenocarcinoma(221;0.161)		AGCAGGCCCAGAGGGGTCATC	0.587																																																	0													51.0	49.0	50.0					16																	70291981		2198	4300	6498	SO:0001583	missense	0			D32050	CCDS32474.1	16q22.1	2014-09-17			ENSG00000090861	ENSG00000090861	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	20	protein-coding gene	gene with protein product	"""alanine tRNA ligase 1, cytoplasmic"""	601065				8595897	Standard	NM_001605		Approved		uc002eyn.1	P49588	OTTHUMG00000177042	ENST00000261772.8:c.2132C>A	16.37:g.70291981G>T	ENSP00000261772:p.Ser711Tyr			Missense_Mutation	SNP	pfam_Ala-tRNA-synth_IIc_N,pfam_tRNA_SAD,pfam_Pesterase_DHHA1,superfamily_Ala-tRNA-ligase_IIc_anticod-bd,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,prints_Ala-tRNA-lgiase_IIc,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-lgiase_IIc	p.S711Y	ENST00000261772.8	37	c.2132	CCDS32474.1	16	.	.	.	.	.	.	.	.	.	.	g	16.22	3.060644	0.55432	.	.	ENSG00000090861	ENST00000261772	T	0.65364	-0.15	5.91	3.94	0.45596	Threonyl/alanyl tRNA synthetase, SAD (2);Alanyl-tRNA synthetase, class IIc, core domain (1);Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.450942	0.28042	N	0.016825	T	0.65852	0.2731	M	0.72353	2.195	0.09310	N	0.999999	B;P	0.34615	0.049;0.459	B;B	0.42738	0.192;0.396	T	0.60989	-0.7153	10	0.59425	D	0.04	-5.5298	10.1348	0.42699	0.0751:0.1371:0.7878:0.0	.	719;711	E7ETK8;P49588	.;SYAC_HUMAN	Y	711	ENSP00000261772:S711Y	ENSP00000261772:S711Y	S	-	2	0	AARS	68849482	1.000000	0.71417	0.519000	0.27824	0.733000	0.41908	5.866000	0.69590	0.823000	0.34589	0.655000	0.94253	TCT	AARS	-	pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,smart_tRNA_SAD,pfscan_Ala-tRNA-synth_IIc_core,tigrfam_Ala-tRNA-lgiase_IIc	ENSG00000090861		0.587	AARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AARS	HGNC	protein_coding	OTTHUMT00000435021.2		0.00	53	0	G	NM_001605		70291981	-1			no_errors	ENST00000261772	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.073	T
ABCA7	10347	genome.wustl.edu	37	19	1046962	1046962	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:1046962delG	ENST00000263094.6	+	14	2015	c.1784delG	c.(1783-1785)tggfs	p.W595fs	ABCA7_ENST00000433129.1_Frame_Shift_Del_p.W595fs|ABCA7_ENST00000533574.1_Intron|ABCA7_ENST00000435683.2_Frame_Shift_Del_p.W457fs	NM_019112.3	NP_061985.2	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 7	595					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|high-density lipoprotein particle assembly (GO:0034380)|memory (GO:0007613)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of ATPase activity (GO:0032780)|negative regulation of beta-amyloid formation (GO:1902430)|peptide cross-linking (GO:0018149)|phagocytosis (GO:0006909)|phospholipid efflux (GO:0033700)|phospholipid scrambling (GO:0017121)|positive regulation of ATPase activity (GO:0032781)|positive regulation of beta-amyloid clearance (GO:1900223)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of engulfment of apoptotic cell (GO:1901076)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phospholipid efflux (GO:1902995)|protein localization to nucleus (GO:0034504)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ATP-binding cassette (ABC) transporter complex (GO:0043190)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	apolipoprotein A-I receptor activity (GO:0034188)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phospholipid transporter activity (GO:0005548)|transporter activity (GO:0005215)			NS(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(7)|lung(22)|ovary(1)|pancreas(7)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCTAGGCTGGTTCCTCAGC	0.697																																																	0													17.0	17.0	17.0					19																	1046962		2182	4280	6462	SO:0001589	frameshift_variant	0			AF328787	CCDS12055.1	19p13.3	2012-03-14			ENSG00000064687	ENSG00000064687		"""ATP binding cassette transporters / subfamily A"""	37	protein-coding gene	gene with protein product		605414					Standard	NM_019112		Approved	ABCX	uc002lqw.4	Q8IZY2	OTTHUMG00000167547	ENST00000263094.6:c.1784delG	19.37:g.1046962delG	ENSP00000263094:p.Trp595fs		Q96S58|Q9BZC4|Q9NR73|Q9UKP8	Frame_Shift_Del	DEL	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_GroES-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.W595fs	ENST00000263094.6	37	c.1784	CCDS12055.1	19																																																																																			ABCA7	-	NULL	ENSG00000064687		0.697	ABCA7-001	KNOWN	basic|CCDS	protein_coding	ABCA7	HGNC	protein_coding	OTTHUMT00000394993.1		0.00	29	0	G	NM_019112		1046962	+1	tier1		no_errors	ENST00000263094	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
ABCG2	9429	genome.wustl.edu	37	4	89042819	89042819	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:89042819G>T	ENST00000237612.3	-	6	1202	c.657C>A	c.(655-657)agC>agA	p.S219R	ABCG2_ENST00000515655.1_Missense_Mutation_p.S219R	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	219	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	CATTTGCTGTGCTTGAGTCTA	0.398																																																	0													110.0	103.0	106.0					4																	89042819		2203	4300	6503	SO:0001583	missense	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.657C>A	4.37:g.89042819G>T	ENSP00000237612:p.Ser219Arg		A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S219R	ENST00000237612.3	37	c.657	CCDS3628.1	4	.	.	.	.	.	.	.	.	.	.	G	12.65	2.001716	0.35320	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.41065	1.01;1.01	5.54	2.86	0.33363	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.23806	0.0576	N	0.05608	-0.01	0.51767	D	0.999935	P;P;B	0.39847	0.691;0.691;0.312	B;B;B	0.40038	0.317;0.259;0.126	T	0.08680	-1.0710	10	0.44086	T	0.13	-13.0509	10.8369	0.46692	0.2003:0.0:0.7997:0.0	.	219;219;219	Q9UNQ0-2;Q9UNQ0;Q4W5I3	.;ABCG2_HUMAN;.	R	219	ENSP00000426917:S219R;ENSP00000237612:S219R	ENSP00000237612:S219R	S	-	3	2	ABCG2	89261843	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	2.179000	0.42528	1.354000	0.45846	0.650000	0.86243	AGC	ABCG2	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000118777		0.398	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1	-	0.00	62	0	G	NM_004827		89042819	-1	tier1	-	no_errors	ENST00000237612	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
ACACA	31	genome.wustl.edu	37	17	35445997	35445997	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:35445997C>T	ENST00000394406.2	-	55	6983	c.6793G>A	c.(6793-6795)Gac>Aac	p.D2265N	ACACA_ENST00000353139.5_Missense_Mutation_p.D2302N|ACACA_ENST00000360679.3_Missense_Mutation_p.D2207N|ACACA_ENST00000361253.5_Missense_Mutation_p.D391N|ACACA_ENST00000335166.5_Missense_Mutation_p.D2187N	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	2265					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	TTATTATTGTCCCAAACATAA	0.493																																					Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)												0													148.0	140.0	143.0					17																	35445997		2203	4300	6503	SO:0001583	missense	0			U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.6793G>A	17.37:g.35445997C>T	ENSP00000377928:p.Asp2265Asn		B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.D2302N	ENST00000394406.2	37	c.6904	CCDS11317.1	17	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622268	0.87460	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166;ENST00000427330;ENST00000361253	T;T;T;T;T	0.59638	0.25;0.25;0.25;0.25;0.25	5.87	5.87	0.94306	.	0.048678	0.85682	D	0.000000	T	0.75228	0.3821	M	0.80746	2.51	0.80722	D	1	P;D;B;B;B	0.58620	0.944;0.983;0.006;0.001;0.012	P;P;B;B;B	0.58266	0.798;0.836;0.047;0.011;0.024	T	0.72750	-0.4199	10	0.34782	T	0.22	-21.6169	20.2033	0.98269	0.0:1.0:0.0:0.0	.	303;964;2302;2265;2207	B4DIG6;F8W6G0;Q13085-4;Q13085;Q13085-2	.;.;.;ACACA_HUMAN;.	N	2302;2207;2265;2289;2187;964;391	ENSP00000344789:D2302N;ENSP00000353898:D2207N;ENSP00000377928:D2265N;ENSP00000335323:D2187N;ENSP00000354565:D391N	ENSP00000335323:D2187N	D	-	1	0	ACACA	32520110	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.800000	0.85949	2.779000	0.95612	0.655000	0.94253	GAC	ACACA	-	NULL	ENSG00000132142		0.493	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACA	HGNC	protein_coding	OTTHUMT00000256696.1	-	0.00	33	0	C	NM_198836		35445997	-1	tier1	-	no_errors	ENST00000353139	ensembl	human	known	74_37	missense	33.33	22	11	SNP	1.000	T
ADCY10	55811	genome.wustl.edu	37	1	167802271	167802271	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:167802271G>T	ENST00000367851.4	-	25	3731	c.3547C>A	c.(3547-3549)Cac>Aac	p.H1183N	ADCY10_ENST00000367848.1_Missense_Mutation_p.H1091N|ADCY10_ENST00000545172.1_Missense_Mutation_p.H1030N	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1183					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TAATGAAAGTGTCTGTTTTTC	0.493																																																	0													183.0	186.0	185.0					1																	167802271		2203	4300	6503	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3547C>A	1.37:g.167802271G>T	ENSP00000356825:p.His1183Asn		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.H1183N	ENST00000367851.4	37	c.3547	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	G	10.08	1.253105	0.22965	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.28895	1.59;1.59;1.59	5.48	4.55	0.56014	.	0.376715	0.25932	N	0.027364	T	0.17704	0.0425	M	0.66939	2.045	0.24686	N	0.993339	B;B	0.14438	0.01;0.003	B;B	0.11329	0.006;0.003	T	0.07654	-1.0761	9	0.45353	T	0.12	-9.2787	11.7181	0.51666	0.0:0.0:0.8114:0.1886	.	1091;1183	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	N	1030;84;1183;1091	ENSP00000441992:H1030N;ENSP00000356825:H1183N;ENSP00000356822:H1091N	ENSP00000271426:H84N	H	-	1	0	ADCY10	166068895	0.998000	0.40836	0.832000	0.32986	0.177000	0.22998	1.583000	0.36579	1.414000	0.47017	0.643000	0.83706	CAC	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.493	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	73	0	G	NM_018417		167802271	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	5.56	85	5	SNP	0.860	T
ADRA1A	148	genome.wustl.edu	37	8	26627783	26627783	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr8:26627783G>C	ENST00000380573.3	-	3	2307	c.1284C>G	c.(1282-1284)agC>agG	p.S428R	ADRA1A_ENST00000380582.3_Intron|ADRA1A_ENST00000519229.1_Intron|ADRA1A_ENST00000354550.4_Intron|ADRA1A_ENST00000276393.4_Missense_Mutation_p.S428R|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380586.1_Intron			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	0	Poly-Arg.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	CCTGCAAAAAGCTTTTACTTC	0.507																																																	0													141.0	142.0	141.0					8																	26627783		2203	4300	6503	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000380573.3:c.1284C>G	8.37:g.26627783G>C	ENSP00000369947:p.Ser428Arg		Q9NPY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRA1A_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.S428R	ENST00000380573.3	37	c.1284	CCDS6054.1	8	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188656	0.38609	.	.	ENSG00000120907	ENST00000276393;ENST00000380573	T;T	0.63744	-0.06;-0.06	5.85	3.13	0.36017	.	.	.	.	.	T	0.53126	0.1777	M	0.64997	1.995	0.80722	D	1	B	0.31227	0.314	B	0.29077	0.098	T	0.46331	-0.9199	9	0.41790	T	0.15	.	5.2835	0.15688	0.3591:0.1345:0.5064:0.0	.	428	P35348	ADA1A_HUMAN	R	428	ENSP00000276393:S428R;ENSP00000369947:S428R	ENSP00000276393:S428R	S	-	3	2	ADRA1A	26683700	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.200000	0.32247	0.399000	0.25367	-0.137000	0.14449	AGC	ADRA1A	-	NULL	ENSG00000120907		0.507	ADRA1A-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376208.1	-	0.00	71	0	G	NM_033303		26627783	-1	tier1	-	no_errors	ENST00000276393	ensembl	human	known	74_37	missense	60.61	13	20	SNP	1.000	C
AFAP1L2	84632	genome.wustl.edu	37	10	116057112	116057112	+	Frame_Shift_Del	DEL	C	C	-	rs149846490	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:116057112delC	ENST00000304129.4	-	17	2203	c.2174delG	c.(2173-2175)ggcfs	p.G725fs	AFAP1L2_ENST00000545353.1_Frame_Shift_Del_p.G778fs|AFAP1L2_ENST00000491814.1_5'UTR|AFAP1L2_ENST00000369271.3_Frame_Shift_Del_p.G725fs			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2	725					inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		GCTCTCCTCGCCCCGGCACTC	0.582																																																	0													49.0	41.0	43.0					10																	116057112		2203	4300	6503	SO:0001589	frameshift_variant	0			BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.2174delG	10.37:g.116057112delC	ENSP00000303042:p.Gly725fs		A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	Frame_Shift_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G778fs	ENST00000304129.4	37	c.2333	CCDS31286.1	10																																																																																			AFAP1L2	-	NULL	ENSG00000169129		0.582	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	HGNC	protein_coding	OTTHUMT00000050462.1		0.00	33	0	C	NM_032550		116057112	-1	tier1		no_errors	ENST00000545353	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.000	-
AKAP13	11214	genome.wustl.edu	37	15	86287894	86287894	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:86287894G>C	ENST00000394518.2	+	37	8523	c.8428G>C	c.(8428-8430)Gag>Cag	p.E2810Q	AKAP13_ENST00000361243.2_Missense_Mutation_p.E2814Q|AKAP13_ENST00000560579.1_3'UTR|RP11-158M2.3_ENST00000558375.1_RNA|AKAP13_ENST00000394510.2_Missense_Mutation_p.E1055Q	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2810	Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						AGAGGGTGAAGAGATCTTCTG	0.507																																					Melanoma(94;603 1453 3280 32295 32951)												0													126.0	128.0	127.0					15																	86287894		2202	4299	6501	SO:0001583	missense	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.8428G>C	15.37:g.86287894G>C	ENSP00000378026:p.Glu2810Gln		Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.E2814Q	ENST00000394518.2	37	c.8440	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224626	0.79576	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.48836	0.8;0.8;0.8	5.64	5.64	0.86602	.	.	.	.	.	T	0.63733	0.2536	L	0.47716	1.5	0.38712	D	0.953232	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.67421	-0.5675	9	0.87932	D	0	.	16.839	0.85963	0.0:0.0:1.0:0.0	.	2810;2814	Q12802;Q12802-2	AKP13_HUMAN;.	Q	2814;2810;2813;2789;1055	ENSP00000354718:E2814Q;ENSP00000378026:E2810Q;ENSP00000378018:E1055Q	ENSP00000354718:E2814Q	E	+	1	0	AKAP13	84088898	1.000000	0.71417	0.974000	0.42286	0.664000	0.39144	6.153000	0.71819	2.653000	0.90120	0.561000	0.74099	GAG	AKAP13	-	NULL	ENSG00000170776		0.507	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	-	0.00	34	0	G	NM_007200		86287894	+1	tier1	-	no_errors	ENST00000361243	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.999	C
ALMS1	7840	genome.wustl.edu	37	2	73800518	73800518	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:73800518G>T	ENST00000264448.6	+	16	11622	c.11511G>T	c.(11509-11511)gtG>gtT	p.V3837V	ALMS1_ENST00000409009.1_Silent_p.V3795V	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3837					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ATCCCCTAGTGACTTCTGAGC	0.448																																																	0													68.0	69.0	69.0					2																	73800518		1991	4181	6172	SO:0001819	synonymous_variant	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.11511G>T	2.37:g.73800518G>T			Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	NULL	p.V3837	ENST00000264448.6	37	c.11511	CCDS42697.1	2																																																																																			ALMS1	-	NULL	ENSG00000116127		0.448	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	-	0.00	54	0	G	NM_015120		73800518	+1	tier1	-	no_errors	ENST00000264448	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.855	T
ANKAR	150709	genome.wustl.edu	37	2	190561097	190561097	+	Splice_Site	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:190561097T>C	ENST00000520309.1	+	7	1796		c.e7+2		ANKAR_ENST00000281412.6_Splice_Site|ANKAR_ENST00000431575.2_Splice_Site|ANKAR_ENST00000313581.4_Splice_Site|ANKAR_ENST00000438402.2_Splice_Site	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TCAGCCAAGGTACCATAAAGT	0.363																																																	0													71.0	69.0	69.0					2																	190561097		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.1708+2T>C	2.37:g.190561097T>C			Q3ZCS6|Q4G0M2|Q6ZU02	Splice_Site	SNP	-	e6+2	ENST00000520309.1	37	c.1708+2	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	T	6.423	0.446128	0.12164	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	.	.	.	5.26	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.434	0.44424	0.1465:0.0:0.0:0.8535	.	.	.	.	.	-1	.	.	.	+	.	.	ANKAR	190269342	0.999000	0.42202	0.719000	0.30619	0.071000	0.16799	3.656000	0.54467	0.801000	0.34066	0.455000	0.32223	.	ANKAR	-	-	ENSG00000151687		0.363	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	-	0.00	103	0	T	NM_144708	Intron	190561097	+1	tier1	-	no_errors	ENST00000313581	ensembl	human	known	74_37	splice_site	33.96	70	36	SNP	0.909	C
ANKZF1	55139	genome.wustl.edu	37	2	220097284	220097284	+	Missense_Mutation	SNP	G	G	T	rs202012817		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:220097284G>T	ENST00000323348.5	+	5	611	c.437G>T	c.(436-438)cGg>cTg	p.R146L	ATG9A_ENST00000361242.4_5'Flank|ATG9A_ENST00000409422.1_5'Flank|ATG9A_ENST00000396761.2_5'Flank|ANKZF1_ENST00000409849.1_5'UTR|ANKZF1_ENST00000410034.3_Missense_Mutation_p.R146L	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	146						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACACTGGATCGGGAGAGGGCT	0.507																																																	0													74.0	75.0	75.0					2																	220097284		1917	4115	6032	SO:0001583	missense	0			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.437G>T	2.37:g.220097284G>T	ENSP00000321617:p.Arg146Leu		Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R146L	ENST00000323348.5	37	c.437	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372859	0.24857	.	.	ENSG00000163516	ENST00000323348;ENST00000453432;ENST00000410034	T;T	0.26660	1.72;1.72	5.53	3.05	0.35203	.	1.013140	0.07863	N	0.966713	T	0.11879	0.0289	N	0.08118	0	0.09310	N	0.999994	B;B	0.20261	0.043;0.0	B;B	0.14023	0.01;0.0	T	0.28713	-1.0035	10	0.27785	T	0.31	-8.0032	3.0115	0.06046	0.6074:0.0:0.2149:0.1777	.	90;146	B4DZT1;Q9H8Y5	.;ANKZ1_HUMAN	L	146;81;146	ENSP00000321617:R146L;ENSP00000386337:R146L	ENSP00000321617:R146L	R	+	2	0	ANKZF1	219805528	0.000000	0.05858	0.789000	0.31954	0.687000	0.40016	0.442000	0.21628	1.124000	0.41980	-0.238000	0.12139	CGG	ANKZF1	-	NULL	ENSG00000163516		0.507	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1		0.00	38	0	G	NM_018089		220097284	+1			no_errors	ENST00000323348	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.663	T
ARHGEF18	23370	genome.wustl.edu	37	19	7533811	7533811	+	Missense_Mutation	SNP	G	G	A	rs201204829	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:7533811G>A	ENST00000359920.6	+	17	3270	c.3017G>A	c.(3016-3018)cGc>cAc	p.R1006H	ARHGEF18_ENST00000319670.9_Missense_Mutation_p.R848H|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.A964T	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	1006					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				TACGCAGAGCGCCCCGAGGTG	0.701													G|||	2	0.000399361	0.0	0.0014	5008	,	,		15037	0.0		0.0	False		,,,				2504	0.001																0								G	HIS/ARG,HIS/ARG	0,4350		0,0,2175	12.0	12.0	12.0		3017,2543	4.1	0.9	19		12	4,8530		0,4,4263	yes	missense,missense	ARHGEF18	NM_001130955.1,NM_015318.3	29,29	0,4,6438	AA,AG,GG		0.0469,0.0,0.031	probably-damaging,probably-damaging	1006/1174,848/1016	7533811	4,12880	2175	4267	6442	SO:0001583	missense	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.3017G>A	19.37:g.7533811G>A	ENSP00000352995:p.Arg1006His		A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R1006H	ENST00000359920.6	37	c.3017	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349657	0.61183	0.0	4.69E-4	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.35236	1.36;1.32	5.11	4.05	0.47172	.	0.000000	0.50627	D	0.000115	T	0.36193	0.0958	M	0.66939	2.045	0.80722	D	1	D;D	0.63046	0.99;0.992	P;B	0.44673	0.457;0.363	T	0.18681	-1.0329	10	0.18276	T	0.48	-19.0292	10.5039	0.44821	0.1004:0.0:0.8996:0.0	.	848;1006	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	H	848;1006	ENSP00000319200:R848H;ENSP00000352995:R1006H	ENSP00000319200:R848H	R	+	2	0	ARHGEF18	7439811	1.000000	0.71417	0.904000	0.35570	0.423000	0.31445	5.801000	0.69115	1.096000	0.41439	0.563000	0.77884	CGC	ARHGEF18	-	NULL	ENSG00000104880		0.701	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	-	0.00	17	0	G	NM_015318		7533811	+1	tier1	rs201204829	no_errors	ENST00000359920	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.998	A
ARHGAP35	2909	genome.wustl.edu	37	19	47423600	47423600	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:47423600G>T	ENST00000404338.3	+	1	1668	c.1668G>T	c.(1666-1668)aaG>aaT	p.K556N		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	556					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										ACCCAACAAAGGAGACATGCC	0.468																																																	0													122.0	122.0	122.0					19																	47423600		2020	4191	6211	SO:0001583	missense	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.1668G>T	19.37:g.47423600G>T	ENSP00000385720:p.Lys556Asn		A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K556N	ENST00000404338.3	37	c.1668	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	14.28	2.488998	0.44249	.	.	ENSG00000160007	ENST00000317082;ENST00000501576;ENST00000404338	T	0.08896	3.04	5.95	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.22085	0.0532	M	0.68952	2.095	0.54753	D	0.999987	D	0.62365	0.991	P	0.60541	0.876	T	0.00460	-1.1726	10	0.66056	D	0.02	-37.5176	11.7764	0.51987	0.1436:0.0:0.8564:0.0	.	556	Q9NRY4-2	.	N	556	ENSP00000385720:K556N	ENSP00000324820:K556N	K	+	3	2	ARHGAP35	52115440	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	1.399000	0.34566	0.867000	0.35654	0.655000	0.94253	AAG	ARHGAP35	-	NULL	ENSG00000160007		0.468	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1		0.00	46	0	G	NM_004491		47423600	+1			no_errors	ENST00000404338	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
ARSG	22901	genome.wustl.edu	37	17	66416461	66416461	+	Silent	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:66416461C>T	ENST00000448504.2	+	12	2231	c.1435C>T	c.(1435-1437)Ctg>Ttg	p.L479L	ARSG_ENST00000452479.2_Silent_p.L315L|RP11-120M18.2_ENST00000592030.1_RNA|ARSG_ENST00000582154.1_3'UTR|WIPI1_ENST00000589459.1_5'Flank	NM_014960.4	NP_055775.2	Q96EG1	ARSG_HUMAN	arylsulfatase G	479					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sulfur compound metabolic process (GO:0006790)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular space (GO:0005615)|lysosome (GO:0005764)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	26			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCAGGCTGTGCTGCCCGAGGT	0.537																																																	0													152.0	142.0	145.0					17																	66416461		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023218	CCDS11676.1	17q24.2	2013-07-15	2006-02-15		ENSG00000141337	ENSG00000141337		"""Arylsulfatase family"""	24102	protein-coding gene	gene with protein product		610008				12461688, 16174644	Standard	NM_014960		Approved	KIAA1001	uc002jhc.2	Q96EG1	OTTHUMG00000179810	ENST00000448504.2:c.1435C>T	17.37:g.66416461C>T			Q6UXF2|Q9Y2K4	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.L479	ENST00000448504.2	37	c.1435	CCDS11676.1	17																																																																																			ARSG	-	superfamily_Alkaline_phosphatase_core	ENSG00000141337		0.537	ARSG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSG	HGNC	protein_coding	OTTHUMT00000448369.1		0.00	61	0	C	NM_014960		66416461	+1			no_errors	ENST00000448504	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.661	T
ASXL1	171023	genome.wustl.edu	37	20	31024504	31024504	+	Missense_Mutation	SNP	C	C	A	rs201002256		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr20:31024504C>A	ENST00000375687.4	+	13	4413	c.3989C>A	c.(3988-3990)cCt>cAt	p.P1330H	ASXL1_ENST00000306058.5_Missense_Mutation_p.P1325H	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1330					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P1330H(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GCTGAGATCCCTCCAGTTTTT	0.567			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	1	Substitution - Missense(1)	large_intestine(1)											42.0	45.0	44.0					20																	31024504		2203	4300	6503	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3989C>A	20.37:g.31024504C>A	ENSP00000364839:p.Pro1330His		B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.P1330H	ENST00000375687.4	37	c.3989	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452308	0.43531	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.15487	2.42;2.42	4.56	4.56	0.56223	.	0.244954	0.36268	N	0.002697	T	0.30665	0.0772	L	0.36672	1.1	0.33311	D	0.566107	D;D	0.76494	0.999;0.999	D;P	0.64042	0.921;0.894	T	0.24048	-1.0171	10	0.72032	D	0.01	-14.7772	16.7751	0.85549	0.0:1.0:0.0:0.0	.	1325;1330	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	H	1330;1330;1330;1251;1325	ENSP00000364839:P1330H;ENSP00000305119:P1325H	ENSP00000305119:P1325H	P	+	2	0	ASXL1	30488165	0.445000	0.25657	0.993000	0.49108	0.519000	0.34347	0.918000	0.28678	2.826000	0.97356	0.561000	0.74099	CCT	ASXL1	-	NULL	ENSG00000171456		0.567	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2		0.00	64	0	C	NM_015338		31024504	+1			no_errors	ENST00000375687	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.995	A
AUNIP	79000	genome.wustl.edu	37	1	26161544	26161544	+	Silent	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:26161544C>T	ENST00000374298.3	-	3	1068	c.1014G>A	c.(1012-1014)aaG>aaA	p.K338K	RP1-317E23.7_ENST00000606617.1_RNA|AUNIP_ENST00000538789.1_Silent_p.K338K|AUNIP_ENST00000481602.1_Intron	NM_024037.1	NP_076942.1	Q9H7T9	AUNIP_HUMAN	aurora kinase A and ninein interacting protein	338	Interaction with AURKA.				spindle organization (GO:0007051)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)											GCAAATCAGGCTTCAGATTTT	0.413																																																	0													211.0	226.0	221.0					1																	26161544		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS266.1, CCDS72731.1	1p36.11	2012-08-07	2012-08-07	2012-08-07	ENSG00000127423	ENSG00000127423			28363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 135"""	C1orf135		20596670	Standard	NM_001287490		Approved	MGC2603, AIBp	uc001bkw.1	Q9H7T9	OTTHUMG00000007372	ENST00000374298.3:c.1014G>A	1.37:g.26161544C>T			C9EI59|Q53F70	Silent	SNP	NULL	p.K338	ENST00000374298.3	37	c.1014	CCDS266.1	1																																																																																			AUNIP	-	NULL	ENSG00000127423		0.413	AUNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUNIP	HGNC	protein_coding	OTTHUMT00000019309.2	-	0.00	48	0	C	NM_024037		26161544	-1	tier1	-	no_errors	ENST00000538789	ensembl	human	known	74_37	silent	46.51	23	20	SNP	0.005	T
BCL11A	53335	genome.wustl.edu	37	2	60689333	60689333	+	Missense_Mutation	SNP	A	A	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:60689333A>C	ENST00000335712.6	-	4	941	c.714T>G	c.(712-714)ttT>ttG	p.F238L	BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000358510.4_Missense_Mutation_p.F204L|BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.F204L|BCL11A_ENST00000356842.4_Missense_Mutation_p.F238L	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	238					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TTAGCAGGTTAAAGGGGTTAT	0.562			T	IGH@	B-CLL																																			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0													87.0	84.0	85.0					2																	60689333		2203	4300	6503	SO:0001583	missense	0			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.714T>G	2.37:g.60689333A>C	ENSP00000338774:p.Phe238Leu		D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F238L	ENST00000335712.6	37	c.714	CCDS1862.1	2	.	.	.	.	.	.	.	.	.	.	A	20.9	4.066869	0.76301	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000335712;ENST00000358510	T;T;T;T	0.12774	2.65;2.93;2.93;2.89	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	L	0.50333	1.59	0.80722	D	1	D;B;D;P	0.55172	0.968;0.206;0.97;0.948	P;B;P;B	0.56751	0.805;0.086;0.643;0.387	T	0.00373	-1.1781	10	0.54805	T	0.06	-1.2552	16.3736	0.83374	1.0:0.0:0.0:0.0	.	204;204;238;238	F5H2Y4;Q9H165-6;Q9H165;D9YZV9	.;.;BC11A_HUMAN;.	L	238;274;204;238;204	ENSP00000349300:F238L;ENSP00000438303:F204L;ENSP00000338774:F238L;ENSP00000351307:F204L	ENSP00000338774:F238L	F	-	3	2	BCL11A	60542837	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.390000	0.79816	2.273000	0.75805	0.482000	0.46254	TTT	BCL11A	-	NULL	ENSG00000119866		0.562	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	HGNC	protein_coding	OTTHUMT00000251579.2	-	0.00	84	0	A	NM_022893		60689333	-1	tier1	-	no_errors	ENST00000335712	ensembl	human	known	74_37	missense	39.36	57	37	SNP	1.000	C
BAZ2B	29994	genome.wustl.edu	37	2	160206655	160206655	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:160206655G>A	ENST00000392783.2	-	28	4922	c.4427C>T	c.(4426-4428)gCt>gTt	p.A1476V	BAZ2B_ENST00000355831.2_Missense_Mutation_p.A1442V|BAZ2B_ENST00000343439.5_Missense_Mutation_p.A1376V|BAZ2B_ENST00000392782.1_Missense_Mutation_p.A1440V	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						AGGCATCTTAGCTACTTCCAA	0.413																																																	0													57.0	53.0	55.0					2																	160206655		1889	4122	6011	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4427C>T	2.37:g.160206655G>A	ENSP00000376534:p.Ala1476Val		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A1476V	ENST00000392783.2	37	c.4427	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628980	0.46944	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.06371	3.31;3.31;3.31;3.31	5.85	5.85	0.93711	.	0.000000	0.36555	U	0.002536	T	0.24431	0.0592	L	0.60455	1.87	0.58432	D	0.999999	D;D	0.89917	1.0;0.967	D;P	0.85130	0.997;0.637	T	0.00008	-1.2487	10	0.45353	T	0.12	-13.2313	20.542	0.99273	0.0:0.0:1.0:0.0	.	1440;1476	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	V	1440;1476;1442;1376	ENSP00000376533:A1440V;ENSP00000376534:A1476V;ENSP00000348087:A1442V;ENSP00000339670:A1376V	ENSP00000339670:A1376V	A	-	2	0	BAZ2B	159914901	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	6.705000	0.74644	2.932000	0.99384	0.643000	0.83706	GCT	BAZ2B	-	NULL	ENSG00000123636		0.413	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	-	0.00	83	0	G			160206655	-1	tier1	-	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	30.77	63	28	SNP	1.000	A
BOD1L1	259282	genome.wustl.edu	37	4	13590354	13590354	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:13590354G>T	ENST00000040738.5	-	15	8407	c.8272C>A	c.(8272-8274)Cct>Act	p.P2758T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2758						nucleus (GO:0005634)	DNA binding (GO:0003677)										ACCTCTTTAGGATCTGCTTCA	0.313																																																	0													56.0	55.0	55.0					4																	13590354		2203	4300	6503	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8272C>A	4.37:g.13590354G>T	ENSP00000040738:p.Pro2758Thr		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.P2758T	ENST00000040738.5	37	c.8272	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	G	3.553	-0.091236	0.07053	.	.	ENSG00000038219	ENST00000040738	T	0.06687	3.27	4.69	0.981	0.19756	.	0.494799	0.18830	N	0.129985	T	0.06371	0.0164	L	0.32530	0.975	0.20764	N	0.999859	B	0.24618	0.107	B	0.25759	0.063	T	0.32322	-0.9911	10	0.42905	T	0.14	-1.5407	7.2774	0.26292	0.3814:0.0:0.6186:0.0	.	2758	Q8NFC6	BOD1L_HUMAN	T	2758	ENSP00000040738:P2758T	ENSP00000040738:P2758T	P	-	1	0	BOD1L	13199452	0.001000	0.12720	0.171000	0.22900	0.080000	0.17528	0.211000	0.17474	0.019000	0.15079	-0.140000	0.14226	CCT	BOD1L1	-	NULL	ENSG00000038219		0.313	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1	-	0.00	55	0	G	NM_148894		13590354	-1	tier1	-	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	6.45	57	4	SNP	0.300	T
BOLA1	51027	genome.wustl.edu	37	1	149871973	149871973	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:149871973G>T	ENST00000369153.2	+	3	1025	c.361G>T	c.(361-363)Gac>Tac	p.D121Y	BOLA1_ENST00000369150.1_Missense_Mutation_p.D121Y|BOLA1_ENST00000369152.5_Missense_Mutation_p.D121Y|BOLA1_ENST00000476344.1_3'UTR			Q9Y3E2	BOLA1_HUMAN	bolA family member 1	121						extracellular region (GO:0005576)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)	10	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CTCTCAGCTGGACACTAGCCC	0.652																																																	0													27.0	33.0	31.0					1																	149871973		2203	4300	6503	SO:0001583	missense	0			AF151901	CCDS939.1	1q21	2013-09-02	2013-09-02		ENSG00000178096	ENSG00000178096			24263	protein-coding gene	gene with protein product		613181	"""bolA-like 1 (E. coli)"", ""bolA homolog 1 (E. coli)"""			14718656	Standard	NM_016074		Approved	CGI-143	uc001etf.3	Q9Y3E2	OTTHUMG00000012087	ENST00000369153.2:c.361G>T	1.37:g.149871973G>T	ENSP00000358149:p.Asp121Tyr		B2R7K2|D3DUZ4|Q5QNY0	Missense_Mutation	SNP	pfam_BolA,superfamily_BolA	p.D121Y	ENST00000369153.2	37	c.361	CCDS939.1	1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387103	0.61956	.	.	ENSG00000178096	ENST00000369153;ENST00000369152;ENST00000369150	T;T;T	0.45276	0.9;0.9;0.9	5.63	4.71	0.59529	.	0.063347	0.64402	D	0.000007	T	0.26521	0.0648	L	0.40543	1.245	0.45554	D	0.998504	P	0.47962	0.903	P	0.47915	0.561	T	0.13495	-1.0507	10	0.66056	D	0.02	-21.5032	8.2046	0.31446	0.0827:0.16:0.7573:0.0	.	121	Q9Y3E2	BOLA1_HUMAN	Y	121	ENSP00000358149:D121Y;ENSP00000358148:D121Y;ENSP00000358146:D121Y	ENSP00000358146:D121Y	D	+	1	0	BOLA1	148138597	1.000000	0.71417	0.678000	0.29963	0.937000	0.57800	3.935000	0.56560	1.497000	0.48584	0.561000	0.74099	GAC	BOLA1	-	NULL	ENSG00000178096		0.652	BOLA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BOLA1	HGNC	protein_coding	OTTHUMT00000033443.2		0.00	58	0	G	NM_016074		149871973	+1			no_errors	ENST00000369150	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.981	T
BRINP1	1620	genome.wustl.edu	37	9	121976407	121976407	+	Missense_Mutation	SNP	G	G	C	rs541790465		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:121976407G>C	ENST00000265922.3	-	6	1173	c.712C>G	c.(712-714)Ctg>Gtg	p.L238V	BRINP1_ENST00000373964.2_Missense_Mutation_p.L238V	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	238	MACPF.				cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TTCTCTTGCAGATACTGAGGA	0.448																																																	0													81.0	72.0	75.0					9																	121976407		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.712C>G	9.37:g.121976407G>C	ENSP00000265922:p.Leu238Val		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.L238V	ENST00000265922.3	37	c.712	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990995	0.74703	.	.	ENSG00000078725	ENST00000373969;ENST00000265922;ENST00000373964	T;T	0.61040	1.79;0.14	5.54	5.54	0.83059	Membrane attack complex component/perforin (MACPF) domain (1);	0.000000	0.64402	D	0.000001	T	0.72645	0.3486	M	0.68317	2.08	0.58432	D	0.999999	D;P	0.56035	0.974;0.956	D;P	0.67725	0.953;0.899	T	0.75025	-0.3463	10	0.87932	D	0	-11.0821	13.7534	0.62921	0.0759:0.0:0.9241:0.0	.	238;238	O60477-2;O60477	.;DBC1_HUMAN	V	238	ENSP00000265922:L238V;ENSP00000363075:L238V	ENSP00000265922:L238V	L	-	1	2	DBC1	121016228	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.049000	0.71053	2.601000	0.87937	0.655000	0.94253	CTG	BRINP1	-	smart_MACPF	ENSG00000078725		0.448	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	57	0	G	NM_014618		121976407	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	20.20	79	20	SNP	1.000	C
BZRAP1	9256	genome.wustl.edu	37	17	56389041	56389041	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:56389041G>T	ENST00000343736.4	-	18	3135	c.2972C>A	c.(2971-2973)cCc>cAc	p.P991H	BZRAP1_ENST00000268893.6_Missense_Mutation_p.P931H|BZRAP1_ENST00000355701.3_Missense_Mutation_p.P991H			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	991	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCAGGGGAGGGCCCAGGCTC	0.612																																																	0													53.0	47.0	49.0					17																	56389041		2203	4300	6503	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.2972C>A	17.37:g.56389041G>T	ENSP00000345824:p.Pro991His		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.P991H	ENST00000343736.4	37	c.2972	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178174	0.78564	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.55588	0.51;0.51;0.51	5.24	5.24	0.73138	Fibronectin, type III (3);	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	L	0.53249	1.67	0.80722	D	1	D;D;P	0.89917	1.0;1.0;0.877	D;D;P	0.97110	0.999;1.0;0.622	T	0.71869	-0.4462	10	0.87932	D	0	.	18.1821	0.89781	0.0:0.0:1.0:0.0	.	991;931;991	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	H	991;991;931	ENSP00000347929:P991H;ENSP00000345824:P991H;ENSP00000268893:P931H	ENSP00000268893:P931H	P	-	2	0	BZRAP1	53744040	1.000000	0.71417	1.000000	0.80357	0.645000	0.38454	6.650000	0.74368	2.625000	0.88918	0.455000	0.32223	CCC	BZRAP1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000005379		0.612	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1		0.00	44	0	G	NM_004758		56389041	-1			no_errors	ENST00000355701	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
C1QTNF9	338872	genome.wustl.edu	37	13	24889990	24889990	+	Intron	DEL	T	T	-	rs369100918	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:24889990delT	ENST00000382071.2	+	2	63				C1QTNF9_ENST00000332018.4_Intron|C1QTNF9-AS1_ENST00000449656.1_RNA|RP11-307N16.6_ENST00000382141.4_Intron			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GAGCCTTCTGTCCAAGTTTGT	0.537													T|T|-|deletion	422	0.0842652	0.1256	0.098	5008	,	,		20177	0.0		0.1531	False		,,,				2504	0.0348																0																																										SO:0001627	intron_variant	0			BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.-22-130T>-	13.37:g.24889990delT			A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	RNA	DEL	-	NULL	ENST00000382071.2	37	NULL	CCDS9306.1	13																																																																																			C1QTNF9-AS1	-	-	ENSG00000240868		0.537	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9-AS1	HGNC	protein_coding	OTTHUMT00000044177.1		0.00	9	0	T	NM_178540		24889990	-1	tier1		no_errors	ENST00000449656	ensembl	human	known	74_37	rna	71.43	2	5	DEL	0.019	-
ERICH3	127254	genome.wustl.edu	37	1	75086594	75086594	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:75086594G>T	ENST00000326665.5	-	8	1042	c.824C>A	c.(823-825)tCa>tAa	p.S275*	C1orf173_ENST00000420661.2_Nonsense_Mutation_p.S78*|RP4-612J11.1_ENST00000416017.1_RNA	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		275								p.S275*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AATCCTTCTTGAATCCTGAAA	0.318																																																	1	Substitution - Nonsense(1)	lung(1)											66.0	63.0	64.0					1																	75086594		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000326665.5:c.824C>A	1.37:g.75086594G>T	ENSP00000322609:p.Ser275*		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	NULL	p.S275*	ENST00000326665.5	37	c.824	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663435	0.67700	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.149	20.239	0.98366	0.0:0.0:1.0:0.0	.	.	.	.	X	275;78	.	ENSP00000322609:S275X	S	-	2	0	C1orf173	74859182	0.938000	0.31826	0.954000	0.39281	0.060000	0.15804	4.644000	0.61397	2.884000	0.98904	0.655000	0.94253	TCA	C1orf173	-	NULL	ENSG00000178965		0.318	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1		0.00	45	0	G			75086594	-1			no_errors	ENST00000326665	ensembl	human	known	74_37	nonsense	5.88	48	3	SNP	0.937	T
C2orf42	54980	genome.wustl.edu	37	2	70406666	70406666	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:70406666G>C	ENST00000264434.2	-	4	1311	c.932C>G	c.(931-933)tCt>tGt	p.S311C	C2orf42_ENST00000420306.1_Missense_Mutation_p.S311C|C2orf42_ENST00000470096.1_5'Flank	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	311										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						ACTCTTACCAGATACTTCATC	0.388																																																	0													127.0	125.0	126.0					2																	70406666		2203	4300	6503	SO:0001583	missense	0			AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.932C>G	2.37:g.70406666G>C	ENSP00000264434:p.Ser311Cys		D6W5G3|Q9H629	Missense_Mutation	SNP	NULL	p.S311C	ENST00000264434.2	37	c.932	CCDS1899.1	2	.	.	.	.	.	.	.	.	.	.	G	19.82	3.897535	0.72639	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	D;D	0.93906	-3.31;-3.31	5.09	5.09	0.68999	.	0.387436	0.30528	N	0.009424	D	0.89508	0.6735	N	0.22421	0.69	0.31320	N	0.686115	P	0.49447	0.924	B	0.43360	0.417	D	0.90015	0.4124	10	0.56958	D	0.05	-17.9615	17.2888	0.87150	0.0:0.0:1.0:0.0	.	311	Q9NWW7	CB042_HUMAN	C	311	ENSP00000264434:S311C;ENSP00000404515:S311C	ENSP00000264434:S311C	S	-	2	0	C2orf42	70260170	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	5.727000	0.68523	2.664000	0.90586	0.650000	0.86243	TCT	C2orf42	-	NULL	ENSG00000115998		0.388	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf42	HGNC	protein_coding	OTTHUMT00000251840.1	-	0.00	91	0	G	NM_017880		70406666	-1	tier1	-	no_errors	ENST00000264434	ensembl	human	known	74_37	missense	31.82	60	28	SNP	0.998	C
C7orf50	84310	genome.wustl.edu	37	7	1049737	1049737	+	Missense_Mutation	SNP	G	G	T	rs200946845		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:1049737G>T	ENST00000397098.3	-	3	1098	c.172C>A	c.(172-174)Ctg>Atg	p.L58M	C7orf50_ENST00000357429.6_Missense_Mutation_p.L58M|C7orf50_ENST00000397100.2_Missense_Mutation_p.L58M|C7orf50_ENST00000488073.1_5'UTR			Q9BRJ6	CG050_HUMAN	chromosome 7 open reading frame 50	58							poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0216)|OV - Ovarian serous cystadenocarcinoma(56;1.3e-15)		TCTGGGGACAGCTCTGGCTCT	0.612																																																	0													70.0	62.0	64.0					7																	1049737		2200	4299	6499	SO:0001583	missense	0			BC006224	CCDS5320.1	7p22.3	2011-11-25			ENSG00000146540	ENSG00000146540			22421	protein-coding gene	gene with protein product							Standard	NM_032350		Approved	MGC11257, YCR016W	uc011jvu.1	Q9BRJ6	OTTHUMG00000151477	ENST00000397098.3:c.172C>A	7.37:g.1049737G>T	ENSP00000380286:p.Leu58Met			Missense_Mutation	SNP	pfam_DUF2373	p.L58M	ENST00000397098.3	37	c.172	CCDS5320.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	7.796|7.796	0.712581|0.712581	0.15306|0.15306	.|.	.|.	ENSG00000146540|ENSG00000146540	ENST00000412051|ENST00000397100;ENST00000397098;ENST00000357429;ENST00000444428;ENST00000491163	.|.	.|.	.|.	3.51|3.51	1.59|1.59	0.23543|0.23543	.|.	.|0.102380	.|0.39834	.|N	.|0.001254	T|T	0.37461|0.37461	0.1004|0.1004	L|L	0.47190|0.47190	1.495|1.495	0.09310|0.09310	N|N	0.999999|0.999999	.|D	.|0.58970	.|0.984	.|P	.|0.54372	.|0.75	T|T	0.13255|0.13255	-1.0516|-1.0516	5|9	.|0.46703	.|T	.|0.11	-8.1158|-8.1158	5.3368|5.3368	0.15961|0.15961	0.1232:0.406:0.4707:0.0|0.1232:0.406:0.4707:0.0	.|.	.|58	.|Q9BRJ6	.|CG050_HUMAN	D|M	42|58;58;58;26;58	.|.	.|ENSP00000350011:L58M	A|L	-|-	2|1	0|2	C7orf50|C7orf50	1016263|1016263	0.197000|0.197000	0.23362|0.23362	0.332000|0.332000	0.25469|0.25469	0.125000|0.125000	0.20455|0.20455	0.919000|0.919000	0.28692|0.28692	0.268000|0.268000	0.21939|0.21939	0.457000|0.457000	0.33378|0.33378	GCT|CTG	C7orf50	-	NULL	ENSG00000146540		0.612	C7orf50-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C7orf50	HGNC	protein_coding	OTTHUMT00000322817.3	-	0.00	23	0	G	NM_032350		1049737	-1	tier1	-	no_errors	ENST00000357429	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.140	T
C9orf78	51759	genome.wustl.edu	37	9	132596000	132596001	+	Intron	INS	-	-	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:132596000_132596001insA	ENST00000372447.3	-	3	197				USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				TGAGCAAAACCAAAAAAAAAAG	0.48																																																	0																																										SO:0001627	intron_variant	0			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-12->T	9.37:g.132596010_132596010dupA			B3KPX8|Q8WVU6|Q9NT39	RNA	INS	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																			C9orf78	-	-	ENSG00000136819		0.480	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1		0.00	23	0	-	NM_016520		132596001	-1	tier1		no_errors	ENST00000461762	ensembl	human	known	74_37	rna	11.32	47	6	INS	0.062:0.115	A
CARD11	84433	genome.wustl.edu	37	7	2946383	2946383	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:2946383G>T	ENST00000396946.4	-	25	3757	c.3354C>A	c.(3352-3354)gcC>gcA	p.A1118A		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	1118	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GTTCCACCGTGGCGTACAGGC	0.647			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													68.0	52.0	58.0					7																	2946383		2203	4300	6503	SO:0001819	synonymous_variant	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.3354C>A	7.37:g.2946383G>T			A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,superfamily_PDZ,pfscan_CARD	p.A1118	ENST00000396946.4	37	c.3354	CCDS5336.2	7																																																																																			CARD11	-	superfamily_P-loop_NTPase	ENSG00000198286		0.647	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4		0.00	59	0	G	NM_032415		2946383	-1			no_errors	ENST00000396946	ensembl	human	known	74_37	silent	6.45	58	4	SNP	1.000	T
CATSPER1	117144	genome.wustl.edu	37	11	65784565	65784565	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:65784565G>A	ENST00000312106.5	-	11	2419	c.2282C>T	c.(2281-2283)gCc>gTc	p.A761V		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	761					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATCGATGACGGCTGCCTGGGA	0.642																																																	0													54.0	47.0	50.0					11																	65784565		2201	4296	6497	SO:0001583	missense	0			AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.2282C>T	11.37:g.65784565G>A	ENSP00000309052:p.Ala761Val		Q96P76	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.A761V	ENST00000312106.5	37	c.2282	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956943	0.53293	.	.	ENSG00000175294	ENST00000312106	D	0.96967	-4.19	5.39	-0.128	0.13506	.	2.222500	0.02681	U	0.109700	D	0.90021	0.6884	N	0.19112	0.55	0.09310	N	1	P	0.37864	0.61	B	0.34824	0.19	D	0.84590	0.0666	10	0.18276	T	0.48	-0.0083	2.499	0.04629	0.1624:0.2942:0.4085:0.1349	.	761	Q8NEC5	CTSR1_HUMAN	V	761	ENSP00000309052:A761V	ENSP00000309052:A761V	A	-	2	0	CATSPER1	65541141	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.637000	0.24659	-0.292000	0.08999	-0.163000	0.13421	GCC	CATSPER1	-	NULL	ENSG00000175294		0.642	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	HGNC	protein_coding	OTTHUMT00000391055.1		0.00	24	0	G	NM_053054		65784565	-1			no_errors	ENST00000312106	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.000	A
CC2D1A	54862	genome.wustl.edu	37	19	14038817	14038817	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:14038817G>C	ENST00000318003.7	+	23	2669	c.2428G>C	c.(2428-2430)Gac>Cac	p.D810H	CC2D1A_ENST00000589606.1_Missense_Mutation_p.D810H	NM_017721.4	NP_060191.3	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	810					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(2)|skin(2)	27			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			GCTGGTCATTGACCCTGTGCC	0.657																																																	0													56.0	66.0	63.0					19																	14038817		2065	4205	6270	SO:0001583	missense	0			AF536205	CCDS42512.1	19p13.12	2007-01-08				ENSG00000132024			30237	protein-coding gene	gene with protein product	"""mental retardation, nonsyndromic, autosomal recessive, 3"""	610055				12761501, 16033914	Standard	NM_017721		Approved	FLJ20241, MRT3	uc002mxo.2	Q6P1N0		ENST00000318003.7:c.2428G>C	19.37:g.14038817G>C	ENSP00000313601:p.Asp810His		Q7Z435|Q86XV0|Q8NF89|Q9H603|Q9NXI1	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_DM14,smart_C2_dom	p.D810H	ENST00000318003.7	37	c.2428	CCDS42512.1	19	.	.	.	.	.	.	.	.	.	.	g	24.7	4.559886	0.86335	.	.	ENSG00000132024	ENST00000318003;ENST00000254346	T	0.42131	0.98	5.22	5.22	0.72569	.	0.056378	0.64402	D	0.000002	T	0.66137	0.2759	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.999;0.994	T	0.70185	-0.4941	10	0.87932	D	0	-33.4617	17.5348	0.87827	0.0:0.0:1.0:0.0	.	432;810;810	Q9NX28;Q6P1N0-2;Q6P1N0	.;.;C2D1A_HUMAN	H	810;433	ENSP00000313601:D810H	ENSP00000254346:D433H	D	+	1	0	CC2D1A	13899817	1.000000	0.71417	0.962000	0.40283	0.849000	0.48306	8.508000	0.90525	2.447000	0.82792	0.491000	0.48974	GAC	CC2D1A	-	NULL	ENSG00000132024		0.657	CC2D1A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	CC2D1A	HGNC	protein_coding	OTTHUMT00000457954.1	-	0.00	171	0	G	NM_017721		14038817	+1	tier1	-	no_errors	ENST00000318003	ensembl	human	known	74_37	missense	30.49	114	50	SNP	1.000	C
CFAP58	159686	genome.wustl.edu	37	10	106139943	106139943	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:106139943C>A	ENST00000369704.3	+	9	1464	c.1330C>A	c.(1330-1332)Cgg>Agg	p.R444R	CCDC147_ENST00000369703.1_Silent_p.R66R|CCDC147_ENST00000312902.5_Silent_p.R66R	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		444						extracellular space (GO:0005615)		p.R444R(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		GGAGCGTGACCGGTACATCAA	0.493																																																	1	Substitution - coding silent(1)	lung(1)											114.0	99.0	104.0					10																	106139943		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000369704.3:c.1330C>A	10.37:g.106139943C>A			D3DRA6|Q8NA27	Silent	SNP	superfamily_Homeodomain-like	p.R444	ENST00000369704.3	37	c.1330	CCDS31282.1	10																																																																																			CCDC147	-	NULL	ENSG00000120051		0.493	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	-	0.00	99	0	C			106139943	+1	tier1	-	no_errors	ENST00000369704	ensembl	human	known	74_37	silent	37.00	63	37	SNP	1.000	A
CCT8	10694	genome.wustl.edu	37	21	30435686	30435686	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr21:30435686T>C	ENST00000286788.4	-	8	1134	c.928A>G	c.(928-930)Atc>Gtc	p.I310V	CCT8_ENST00000542732.1_Missense_Mutation_p.I291V|CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Missense_Mutation_p.I237V	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	310					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)	p.I310V(1)		breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						ACTAACATGATATTATATTTA	0.353																																																	1	Substitution - Missense(1)	prostate(1)											74.0	76.0	75.0					21																	30435686		2203	4300	6503	SO:0001583	missense	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.928A>G	21.37:g.30435686T>C	ENSP00000286788:p.Ile310Val		A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.I310V	ENST00000286788.4	37	c.928	CCDS33528.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.22|14.22	2.469237|2.469237	0.43839|0.43839	.|.	.|.	ENSG00000156261|ENSG00000156261	ENST00000431234|ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844	.|D;D;D	.|0.81996	.|-1.56;-1.56;-1.56	5.36|5.36	2.83|2.83	0.33086|0.33086	.|.	0.109676|0.109676	0.64402|0.64402	D|N	0.000006|0.000006	T|T	0.79592|0.79592	0.4472|0.4472	M|M	0.66506|0.66506	2.035|2.035	0.39067|0.39067	D|D	0.960647|0.960647	.|B;B;B;B;B	.|0.17268	.|0.013;0.019;0.003;0.002;0.021	.|B;B;B;B;B	.|0.27887	.|0.037;0.084;0.021;0.012;0.055	T|T	0.76421|0.76421	-0.2965|-0.2965	6|10	.|0.52906	.|T	.|0.07	-8.1473|-8.1473	7.1377|7.1377	0.25537|0.25537	0.0:0.087:0.3184:0.5946|0.0:0.087:0.3184:0.5946	.|.	.|237;291;310;309;310	.|B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990	.|.;.;.;.;TCPQ_HUMAN	M|V	255|309;310;291;237	.|ENSP00000286788:I310V;ENSP00000444984:I291V;ENSP00000442730:I237V	.|ENSP00000286788:I310V	I|I	-|-	3|1	3|0	CCT8|CCT8	29357557|29357557	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.904000|0.904000	0.53231|0.53231	4.506000|4.506000	0.60428|0.60428	0.979000|0.979000	0.38497|0.38497	0.383000|0.383000	0.25322|0.25322	ATA|ATC	CCT8	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,tigrfam_Chap_CCT_theta	ENSG00000156261		0.353	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	HGNC	protein_coding	OTTHUMT00000171822.1	-	0.00	42	0	T			30435686	-1	tier1	-	no_errors	ENST00000286788	ensembl	human	known	74_37	missense	35.71	17	10	SNP	0.998	C
CECR7	100130418	genome.wustl.edu	37	22	17525823	17525824	+	lincRNA	DNP	GC	GC	TT			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:17525823_17525824GC>TT	ENST00000441006.1	+	0	836_837					NR_015352.1				cat eye syndrome chromosome region, candidate 7 (non-protein coding)																		CGGGGACAGAGCAACTGTGGAT	0.535																																																	0																																												0			BC043198		22q11.2	2012-10-16	2009-08-21		ENSG00000237438	ENSG00000237438		"""Long non-coding RNAs"""	1845	non-coding RNA	RNA, long non-coding			"""cat eye syndrome chromosome region, candidate 7"""			11381032	Standard	NR_015352		Approved	SAHL1	uc002zlx.1		OTTHUMG00000150027	Exception_encountered	22.37:g.17525823_17525824delinsTT				RNA	SNP	-	NULL	ENST00000441006.1	37	NULL		22																																																																																			CECR7	-	-	ENSG00000237438		0.535	CECR7-001	KNOWN	basic|exp_conf	lincRNA	CECR7	HGNC	lincRNA	OTTHUMT00000315626.1	-	0.00	98|100	0	G|C	NR_015352		17525823|17525824	+1	tier1	-	no_errors	ENST00000414401	ensembl	human	known	74_37	rna	36.36|36.00	63|64	36	SNP	0.068|0.026	T
CEP192	55125	genome.wustl.edu	37	18	13049800	13049800	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr18:13049800G>T	ENST00000325971.8	+	15	2732	c.1139G>T	c.(1138-1140)gGc>gTc	p.G380V	CEP192_ENST00000430049.2_Missense_Mutation_p.G501V|CEP192_ENST00000506447.1_Missense_Mutation_p.G976V			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	380					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						GGTGGACGTGGCTCAGAGGAT	0.418																																																	0													102.0	100.0	101.0					18																	13049800		2203	4300	6503	SO:0001583	missense	0			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.1139G>T	18.37:g.13049800G>T	ENSP00000317156:p.Gly380Val		A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.G976V	ENST00000325971.8	37	c.2927		18	.	.	.	.	.	.	.	.	.	.	G	10.33	1.319796	0.23994	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049	T;T;T	0.76839	-1.05;-1.05;-1.05	5.76	2.92	0.33932	.	0.614375	0.15394	N	0.264650	T	0.72716	0.3495	L	0.56769	1.78	0.09310	N	0.999996	P;P;P	0.49358	0.617;0.617;0.923	B;B;P	0.46110	0.308;0.308;0.504	T	0.61372	-0.7076	10	0.33141	T	0.24	-0.6454	5.2661	0.15599	0.2193:0.0:0.6226:0.1581	.	501;976;380	C9JT09;E9PF99;Q8TEP8	.;.;CE192_HUMAN	V	976;380;380;501	ENSP00000427550:G976V;ENSP00000317156:G380V;ENSP00000389190:G501V	ENSP00000317156:G380V	G	+	2	0	CEP192	13039800	0.009000	0.17119	0.006000	0.13384	0.280000	0.26924	1.489000	0.35562	0.849000	0.35215	0.650000	0.86243	GGC	CEP192	-	NULL	ENSG00000101639		0.418	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding			0.00	52	0	G	NM_032142		13049800	+1			no_errors	ENST00000506447	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.000	T
CGGBP1	8545	genome.wustl.edu	37	3	88105058	88105058	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:88105058G>T	ENST00000398392.2	-	1	1401	c.69C>A	c.(67-69)ccC>ccA	p.P23P	CGGBP1_ENST00000462901.1_Silent_p.P23P|CGGBP1_ENST00000474441.1_5'Flank|CGGBP1_ENST00000309534.6_Silent_p.P23P|CGGBP1_ENST00000482016.1_Silent_p.P23P			Q9UFW8	CGBP1_HUMAN	CGG triplet repeat binding protein 1	23					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			kidney(1)|large_intestine(2)|lung(2)	5		Lung NSC(201;0.0283)		LUSC - Lung squamous cell carcinoma(29;0.00359)|Lung(72;0.00677)		CTCGATCCAGGGGAGTCACAT	0.443																																																	0													105.0	104.0	104.0					3																	88105058		1976	4168	6144	SO:0001819	synonymous_variant	0			AJ000258	CCDS43111.1	3p12-p11.1	2008-07-18			ENSG00000163320	ENSG00000163320			1888	protein-coding gene	gene with protein product	"""p20-CGG binding protein"""	603363				9201980, 14667814	Standard	NM_001195308		Approved	p20-CGGBP, CGGBP	uc003dqt.3	Q9UFW8	OTTHUMG00000159009	ENST00000398392.2:c.69C>A	3.37:g.88105058G>T			D3DU38|O15183	Silent	SNP	NULL	p.P23	ENST00000398392.2	37	c.69	CCDS43111.1	3																																																																																			CGGBP1	-	NULL	ENSG00000163320		0.443	CGGBP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CGGBP1	HGNC	protein_coding	OTTHUMT00000352955.1	-	0.00	50	0	G	NM_001008390		88105058	-1	tier1	-	no_errors	ENST00000309534	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.990	T
CILP	8483	genome.wustl.edu	37	15	65497712	65497712	+	Missense_Mutation	SNP	G	G	T	rs148331275		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:65497712G>T	ENST00000261883.4	-	5	683	c.517C>A	c.(517-519)Cgc>Agc	p.R173S		NM_003613.3	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein, nucleotide pyrophosphohydrolase	173	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				breast(5)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(17)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(1)	55						ATGCGTGTGCGAGTCTGGACC	0.617																																																	0													97.0	77.0	84.0					15																	65497712		2201	4299	6500	SO:0001583	missense	0			AY358904	CCDS10203.1	15q22	2013-01-14			ENSG00000138615	ENSG00000138615		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1980	protein-coding gene	gene with protein product		603489				9722584, 9722583	Standard	NM_003613		Approved	HsT18872	uc002aon.2	O75339	OTTHUMG00000133140	ENST00000261883.4:c.517C>A	15.37:g.65497712G>T	ENSP00000261883:p.Arg173Ser		B2R8F7|Q6UW99|Q8IYI5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.R173S	ENST00000261883.4	37	c.517	CCDS10203.1	15	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916694	0.92249	.	.	ENSG00000138615	ENST00000261883	T	0.80824	-1.42	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.91016	0.7174	M	0.85710	2.77	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.92033	0.5635	10	0.87932	D	0	-12.3091	18.5236	0.90963	0.0:0.0:1.0:0.0	.	173	O75339	CILP1_HUMAN	S	173	ENSP00000261883:R173S	ENSP00000261883:R173S	R	-	1	0	CILP	63284765	1.000000	0.71417	0.996000	0.52242	0.972000	0.66771	9.094000	0.94168	2.635000	0.89317	0.650000	0.86243	CGC	CILP	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000138615		0.617	CILP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CILP	HGNC	protein_coding	OTTHUMT00000256829.1	-	0.00	42	0	G	NM_003613		65497712	-1	tier1	-	no_errors	ENST00000261883	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
CLDN10	9071	genome.wustl.edu	37	13	96230262	96230262	+	Silent	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:96230262T>C	ENST00000299339.2	+	5	710	c.681T>C	c.(679-681)taT>taC	p.Y227Y	CLDN10_ENST00000376873.3_Silent_p.Y225Y	NM_006984.4	NP_008915.1	P78369	CLD10_HUMAN	claudin 10	227					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			AAAATGCTTATGTCTAAAAGA	0.403																																																	0													61.0	60.0	61.0					13																	96230262		2203	4300	6503	SO:0001819	synonymous_variant	0			U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000299339.2:c.681T>C	13.37:g.96230262T>C			Q6IBF9|Q96N78	Silent	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin10,prints_Claudin	p.Y227	ENST00000299339.2	37	c.681	CCDS9476.1	13																																																																																			CLDN10	-	NULL	ENSG00000134873		0.403	CLDN10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN10	HGNC	protein_coding	OTTHUMT00000045484.1	-	0.00	78	0	T	NM_006984		96230262	+1	tier1	-	no_errors	ENST00000299339	ensembl	human	known	74_37	silent	61.54	20	32	SNP	0.992	C
CNOT1	23019	genome.wustl.edu	37	16	58572788	58572788	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:58572788C>A	ENST00000317147.5	-	36	5355	c.5023G>T	c.(5023-5025)Ggt>Tgt	p.G1675C	CNOT1_ENST00000569240.1_Missense_Mutation_p.G1670C|CNOT1_ENST00000245138.4_Missense_Mutation_p.G526C	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1675					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCATCAGCACCACTTGTGGCA	0.507																																																	0													106.0	90.0	95.0					16																	58572788		2198	4300	6498	SO:0001583	missense	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.5023G>T	16.37:g.58572788C>A	ENSP00000320949:p.Gly1675Cys		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.G1675C	ENST00000317147.5	37	c.5023	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930748	0.92389	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T;T	0.17054	2.3;2.3	5.26	5.26	0.73747	.	0.048939	0.85682	D	0.000000	T	0.28300	0.0699	L	0.36672	1.1	0.80722	D	1	D;P;D	0.57899	0.967;0.9;0.981	B;P;P	0.55303	0.428;0.598;0.773	T	0.01065	-1.1463	10	0.56958	D	0.05	-14.4665	18.8774	0.92343	0.0:1.0:0.0:0.0	.	526;1675;1670	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	C	1675;526;1670	ENSP00000320949:G1675C;ENSP00000245138:G526C	ENSP00000245138:G526C	G	-	1	0	CNOT1	57130289	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.455000	0.83008	0.655000	0.94253	GGT	CNOT1	-	NULL	ENSG00000125107		0.507	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3	-	0.00	57	0	C	NM_016284		58572788	-1	tier1	-	no_errors	ENST00000317147	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
CNTNAP5	129684	genome.wustl.edu	37	2	125555898	125555898	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:125555898G>T	ENST00000431078.1	+	19	3578		c.e19+1			NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.G1072V(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TGCAAGAATGGTGAGTGTGAT	0.502																																																	1	Substitution - Missense(1)	lung(1)											88.0	87.0	87.0					2																	125555898		1989	4172	6161	SO:0001630	splice_region_variant	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.3214+1G>T	2.37:g.125555898G>T			Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Splice_Site	SNP	-	e19+1	ENST00000431078.1	37	c.3214+1	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812169	0.90707	.	.	ENSG00000155052	ENST00000431078	.	.	.	5.92	5.92	0.95590	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3095	0.94179	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP5	125272368	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.861000	0.92277	2.810000	0.96702	0.650000	0.86243	.	CNTNAP5	-	-	ENSG00000155052		0.502	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3		0.00	23	0	G		Intron	125555898	+1			no_errors	ENST00000431078	ensembl	human	known	74_37	splice_site	8.00	23	2	SNP	1.000	T
COL5A2	1290	genome.wustl.edu	37	2	189907496	189907496	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:189907496G>T	ENST00000374866.3	-	49	3749	c.3475C>A	c.(3475-3477)Cca>Aca	p.P1159T		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	1159					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			TCACCATTTGGACCCTAAGTA	0.378																																																	0													65.0	58.0	61.0					2																	189907496		2203	4300	6503	SO:0001583	missense	0			Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.3475C>A	2.37:g.189907496G>T	ENSP00000364000:p.Pro1159Thr		P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.P1159T	ENST00000374866.3	37	c.3475	CCDS33350.1	2	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776604	0.49786	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.96651	-4.08	5.76	5.76	0.90799	.	0.000000	0.51477	D	0.000089	D	0.95085	0.8408	M	0.69358	2.11	0.58432	D	0.999998	B;B	0.25272	0.019;0.122	B;B	0.20577	0.012;0.03	D	0.92503	0.6010	10	0.15952	T	0.53	.	20.3316	0.98722	0.0:0.0:1.0:0.0	.	799;1159	Q5PR22;P05997	.;CO5A2_HUMAN	T	1159;799	ENSP00000364000:P1159T	ENSP00000364000:P1159T	P	-	1	0	COL5A2	189615741	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.226000	0.51254	2.871000	0.98454	0.655000	0.94253	CCA	COL5A2	-	pfam_Collagen	ENSG00000204262		0.378	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A2	HGNC	protein_coding	OTTHUMT00000313523.1	-	0.00	48	0	G	NM_000393		189907496	-1	tier1	-	no_errors	ENST00000374866	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130124985	130124985	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:130124985G>T	ENST00000432398.2	+	16	4885	c.4391G>T	c.(4390-4392)gGa>gTa	p.G1464V	COL6A5_ENST00000265379.6_Missense_Mutation_p.G1464V	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1464	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						GGAGGTCATGGAGACGATGGG	0.403																																																	0													157.0	125.0	135.0					3																	130124985		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4391G>T	3.37:g.130124985G>T	ENSP00000390895:p.Gly1464Val		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1464V	ENST00000432398.2	37	c.4391		3	.	.	.	.	.	.	.	.	.	.	G	10.05	1.244970	0.22796	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.99637	-5.77;-6.29	5.86	4.98	0.66077	.	.	.	.	.	D	0.99764	0.9904	H	0.96398	3.815	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.96936	0.9684	9	0.87932	D	0	.	15.9745	0.80049	0.0:0.1353:0.8647:0.0	.	1464	A8TX70-2	.	V	1464	ENSP00000390895:G1464V;ENSP00000265379:G1464V	ENSP00000265379:G1464V	G	+	2	0	COL6A5	131607675	1.000000	0.71417	0.550000	0.28217	0.010000	0.07245	4.164000	0.58190	1.465000	0.48006	0.650000	0.86243	GGA	COL6A5	-	pfam_Collagen	ENSG00000172752		0.403	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	116	0	G	NM_153264		130124985	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.983	T
CPXM2	119587	genome.wustl.edu	37	10	125639747	125639747	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:125639747G>A	ENST00000241305.3	-	2	537	c.383C>T	c.(382-384)gCc>gTc	p.A128V	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	128					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		ATCTTCACGGGCCACACGGAC	0.552																																																	0													214.0	202.0	206.0					10																	125639747		2203	4300	6503	SO:0001583	missense	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.383C>T	10.37:g.125639747G>A	ENSP00000241305:p.Ala128Val		B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.A128V	ENST00000241305.3	37	c.383	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	G	8.072	0.770534	0.15983	.	.	ENSG00000121898	ENST00000241305;ENST00000418782	D	0.96136	-3.92	3.76	1.82	0.25136	.	0.505534	0.18647	N	0.135126	D	0.83977	0.5371	N	0.02539	-0.55	0.20873	N	0.999836	B	0.02656	0.0	B	0.01281	0.0	T	0.75365	-0.3343	10	0.37606	T	0.19	-21.7712	5.3766	0.16168	0.1176:0.2322:0.6502:0.0	.	128	Q8N436	CPXM2_HUMAN	V	128	ENSP00000241305:A128V	ENSP00000241305:A128V	A	-	2	0	CPXM2	125629737	0.368000	0.25031	0.164000	0.22755	0.527000	0.34593	0.153000	0.16323	0.507000	0.28148	0.655000	0.94253	GCC	CPXM2	-	NULL	ENSG00000121898		0.552	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1		0.00	67	0	G	NM_198148		125639747	-1			no_errors	ENST00000241305	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.174	A
CTAGE9	643854	genome.wustl.edu	37	6	132030150	132030150	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:132030150C>T	ENST00000314099.8	-	1	2056	c.2008G>A	c.(2008-2010)Gat>Aat	p.D670N	ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000414305.1_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	670						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						CCAAGATCATCTTTGGCATCA	0.433																																																	0													1.0	1.0	1.0					6																	132030150		279	755	1034	SO:0001583	missense	0				CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.2008G>A	6.37:g.132030150C>T	ENSP00000395587:p.Asp670Asn			Missense_Mutation	SNP	NULL	p.D670N	ENST00000314099.8	37	c.2008	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	11.39	1.625394	0.28889	.	.	ENSG00000236761	ENST00000314099	T	0.41065	1.01	.	.	.	.	.	.	.	.	T	0.48333	0.1494	M	0.87456	2.885	0.09310	N	1	D	0.65815	0.995	D	0.63957	0.92	T	0.25187	-1.0139	6	0.39692	T	0.17	.	.	.	.	.	670	A4FU28	CTGE9_HUMAN	N	670	ENSP00000395587:D670N	ENSP00000395587:D670N	D	-	1	0	CTAGE9	132071843	0.274000	0.24191	.	.	.	.	-0.193000	0.09573	.	.	.	.	GAT	CTAGE9	-	NULL	ENSG00000236761		0.433	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	HGNC	protein_coding	OTTHUMT00000109220.1	-	0.00	72	0	C	NM_001145659		132030150	-1	tier1	-	no_errors	ENST00000314099	ensembl	human	known	74_37	missense	43.75	36	28	SNP	0.000	T
CTTNBP2	83992	genome.wustl.edu	37	7	117365257	117365257	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:117365257T>C	ENST00000160373.3	-	18	4201	c.4110A>G	c.(4108-4110)atA>atG	p.I1370M		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1370					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CTCTTGACAATATTGCTTCTT	0.512																																																	0													211.0	203.0	206.0					7																	117365257		2203	4300	6503	SO:0001583	missense	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.4110A>G	7.37:g.117365257T>C	ENSP00000160373:p.Ile1370Met		O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I1370M	ENST00000160373.3	37	c.4110	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.72|18.72	3.684737|3.684737	0.68157|0.68157	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	D|D	0.89875|0.88896	-2.58|-2.44	5.72|5.72	3.28|3.28	0.37604|0.37604	.|.	0.136236|0.136236	0.64402|0.64402	D|D	0.000002|0.000002	D|D	0.90909|0.90909	0.7143|0.7143	M|M	0.83852|0.83852	2.665|2.665	0.43263|0.43263	D|D	0.995205|0.995205	P|.	0.52577|.	0.954|.	P|.	0.51866|.	0.682|.	D|D	0.86387|0.86387	0.1733|0.1733	10|8	0.87932|0.23891	D|T	0|0.37	-5.1134|-5.1134	8.4135|8.4135	0.32657|0.32657	0.1187:0.0:0.2765:0.6047|0.1187:0.0:0.2765:0.6047	.|.	1370|.	Q8WZ74|.	CTTB2_HUMAN|.	M|V	1370|858	ENSP00000160373:I1370M|ENSP00000389576:I858V	ENSP00000160373:I1370M|ENSP00000389576:I858V	I|I	-|-	3|1	3|0	CTTNBP2|CTTNBP2	117152493|117152493	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.993000|0.993000	0.82548|0.82548	2.917000|2.917000	0.48821|0.48821	0.486000|0.486000	0.27676|0.27676	0.533000|0.533000	0.62120|0.62120	ATA|ATT	CTTNBP2	-	NULL	ENSG00000077063		0.512	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	-	0.00	69	0	T	NM_033427		117365257	-1	tier1	-	no_errors	ENST00000160373	ensembl	human	known	74_37	missense	48.65	19	18	SNP	0.975	C
CWC22	57703	genome.wustl.edu	37	2	180810229	180810229	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:180810229G>A	ENST00000410053.3	-	20	2653	c.2354C>T	c.(2353-2355)aCa>aTa	p.T785I	CWC22_ENST00000295749.6_Missense_Mutation_p.T785I	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	785					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						TTTGTCTGATGTGTACTTTGT	0.383																																																	0													228.0	213.0	218.0					2																	180810229		1863	4112	5975	SO:0001583	missense	0				CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2354C>T	2.37:g.180810229G>A	ENSP00000387006:p.Thr785Ile		Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.T785I	ENST00000410053.3	37	c.2354	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.247035	0.01481	.	.	ENSG00000163510	ENST00000410053;ENST00000295749	T;T	0.21031	2.03;2.03	4.86	-0.737	0.11129	.	1.673430	0.02797	N	0.122801	T	0.11707	0.0285	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19614	-1.0300	10	0.21540	T	0.41	-0.0033	4.2391	0.10640	0.4508:0.1738:0.3754:0.0	.	785	Q9HCG8	CWC22_HUMAN	I	785	ENSP00000387006:T785I;ENSP00000295749:T785I	ENSP00000295749:T785I	T	-	2	0	CWC22	180518474	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-0.253000	0.08794	-0.118000	0.11851	-0.345000	0.07892	ACA	CWC22	-	NULL	ENSG00000163510		0.383	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	HGNC	protein_coding	OTTHUMT00000334537.1	-	0.00	38	0	G	NM_020943		180810229	-1	tier1	-	no_errors	ENST00000295749	ensembl	human	known	74_37	missense	37.14	44	26	SNP	0.000	A
CWH43	80157	genome.wustl.edu	37	4	48994050	48994050	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:48994050T>C	ENST00000226432.4	+	4	637	c.454T>C	c.(454-456)Tcc>Ccc	p.S152P	CWH43_ENST00000513409.1_Missense_Mutation_p.S125P	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	152					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						TTATCAGATGTCCAACAAAGT	0.393																																																	0													185.0	165.0	172.0					4																	48994050		2203	4300	6503	SO:0001583	missense	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.454T>C	4.37:g.48994050T>C	ENSP00000226432:p.Ser152Pro		B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.S152P	ENST00000226432.4	37	c.454	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	T	12.69	2.014347	0.35511	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.46451	1.47;0.87	5.24	1.4	0.22301	.	0.479462	0.19550	N	0.111582	T	0.33411	0.0862	L	0.56769	1.78	0.23568	N	0.9974	B	0.06786	0.001	B	0.09377	0.004	T	0.19910	-1.0291	9	.	.	.	.	6.7564	0.23516	0.0:0.0997:0.3767:0.5235	.	152	Q9H720	PG2IP_HUMAN	P	152;125	ENSP00000226432:S152P;ENSP00000422802:S125P	.	S	+	1	0	CWH43	48688807	0.588000	0.26799	0.841000	0.33234	0.931000	0.56810	0.051000	0.14141	0.431000	0.26258	0.402000	0.26972	TCC	CWH43	-	NULL	ENSG00000109182		0.393	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	-	0.00	65	0	T	NM_025087		48994050	+1	tier1	-	no_errors	ENST00000226432	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.365	C
CYP4F22	126410	genome.wustl.edu	37	19	15658995	15658995	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:15658995G>T	ENST00000269703.3	+	11	1412	c.1213G>T	c.(1213-1215)Gtc>Ttc	p.V405F	CYP4F22_ENST00000601005.2_Missense_Mutation_p.V405F	NM_173483.3	NP_775754.2	Q6NT55	CP4FN_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 22	405						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			endometrium(6)|large_intestine(9)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	37						TGTCACTCTTGTCTCTCGCCA	0.547																																																	0													188.0	167.0	174.0					19																	15658995		2203	4300	6503	SO:0001583	missense	0				CCDS12331.1	19p13.12	2013-11-11			ENSG00000171954	ENSG00000171954		"""Cytochrome P450s"""	26820	protein-coding gene	gene with protein product		611495				16436457	Standard	NM_173483		Approved	FLJ39501	uc002nbh.4	Q6NT55	OTTHUMG00000182451	ENST00000269703.3:c.1213G>T	19.37:g.15658995G>T	ENSP00000269703:p.Val405Phe		Q8N8H4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.V405F	ENST00000269703.3	37	c.1213	CCDS12331.1	19	.	.	.	.	.	.	.	.	.	.	G	9.710	1.156828	0.21454	.	.	ENSG00000171954	ENST00000269703	T	0.70399	-0.48	5.19	-2.96	0.05547	.	0.293059	0.32802	N	0.005639	T	0.47581	0.1453	N	0.11724	0.165	0.09310	N	0.999999	B	0.15930	0.015	B	0.26693	0.072	T	0.39231	-0.9624	10	0.33940	T	0.23	.	10.492	0.44756	0.6451:0.0:0.3549:0.0	.	405	Q6NT55	CP4FN_HUMAN	F	405	ENSP00000269703:V405F	ENSP00000269703:V405F	V	+	1	0	CYP4F22	15519995	0.072000	0.21174	0.001000	0.08648	0.202000	0.24057	0.331000	0.19733	-0.303000	0.08856	0.563000	0.77884	GTC	CYP4F22	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000171954		0.547	CYP4F22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4F22	HGNC	protein_coding	OTTHUMT00000461338.2	-	0.00	34	0	G	NM_173483		15658995	+1	tier1	-	no_errors	ENST00000269703	ensembl	human	known	74_37	missense	26.53	36	13	SNP	0.003	T
DAB1	1600	genome.wustl.edu	37	1	57489270	57489270	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:57489270G>T	ENST00000371231.1	-	12	962	c.928C>A	c.(928-930)Cag>Aag	p.Q310K	DAB1_ENST00000414851.2_Missense_Mutation_p.Q259K|DAB1_ENST00000371236.2_Missense_Mutation_p.Q277K|DAB1_ENST00000420954.2_Missense_Mutation_p.Q275K|DAB1_ENST00000371234.4_Missense_Mutation_p.Q277K|DAB1_ENST00000439789.2_Missense_Mutation_p.Q191K|DAB1_ENST00000485760.1_5'UTR			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	310					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGAAGGGTCTGAGATGAAGAT	0.532																																																	0													131.0	121.0	124.0					1																	57489270		2203	4300	6503	SO:0001583	missense	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.928C>A	1.37:g.57489270G>T	ENSP00000360275:p.Gln310Lys		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.Q310K	ENST00000371231.1	37	c.928		1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.876602	0.91664	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231;ENST00000371232	T;T;T;T;T;T;T	0.50548	0.81;0.81;0.75;0.8;1.8;0.79;0.74	5.49	5.49	0.81192	.	0.363023	0.32785	N	0.005656	T	0.61148	0.2324	M	0.64404	1.975	0.58432	D	0.999999	P;D;D;P;D	0.61080	0.841;0.966;0.989;0.949;0.989	B;P;P;P;P	0.57776	0.441;0.733;0.763;0.549;0.827	T	0.51841	-0.8654	10	0.17832	T	0.49	-12.8907	19.1647	0.93551	0.0:0.0:1.0:0.0	.	259;310;277;191;275	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	K	277;277;277;275;259;191;310;191	ENSP00000360280:Q277K;ENSP00000360278:Q277K;ENSP00000395296:Q275K;ENSP00000387581:Q259K;ENSP00000409328:Q191K;ENSP00000360275:Q310K;ENSP00000360276:Q191K	ENSP00000360275:Q310K	Q	-	1	0	DAB1	57261858	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.993000	0.88291	2.857000	0.98124	0.650000	0.86243	CAG	DAB1	-	NULL	ENSG00000173406		0.532	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1		0.00	47	0	G	NM_021080		57489270	-1			no_errors	ENST00000371231	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
DBP	1628	genome.wustl.edu	37	19	49134209	49134209	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:49134209G>T	ENST00000222122.5	-	4	1306	c.863C>A	c.(862-864)gCc>gAc	p.A288D	DBP_ENST00000599385.1_Missense_Mutation_p.A86D|DBP_ENST00000593500.1_Missense_Mutation_p.A86D	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	288	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		CTCCAGGAAGGCCGCCCGCAC	0.652																																																	0													25.0	27.0	27.0					19																	49134209		2202	4300	6502	SO:0001583	missense	0			U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.863C>A	19.37:g.49134209G>T	ENSP00000222122:p.Ala288Asp		A2I2P4	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.A288D	ENST00000222122.5	37	c.863	CCDS12728.1	19	.	.	.	.	.	.	.	.	.	.	G	23.7	4.453296	0.84209	.	.	ENSG00000105516	ENST00000222122	T	0.42900	0.96	4.81	4.81	0.61882	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.000000	0.85682	U	0.000000	T	0.54549	0.1865	L	0.48218	1.51	0.58432	D	0.999997	P	0.37083	0.581	P	0.53266	0.722	T	0.58092	-0.7697	10	0.87932	D	0	-8.6665	15.7386	0.77866	0.0:0.0:1.0:0.0	.	288	Q10586	DBP_HUMAN	D	288	ENSP00000222122:A288D	ENSP00000222122:A288D	A	-	2	0	DBP	53826021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.279000	0.72620	2.364000	0.80123	0.563000	0.77884	GCC	DBP	-	pfam_bZIP,smart_bZIP,pfscan_bZIP	ENSG00000105516		0.652	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBP	HGNC	protein_coding	OTTHUMT00000466167.1		0.00	68	0	G	NM_001352		49134209	-1			no_errors	ENST00000222122	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
DGKK	139189	genome.wustl.edu	37	X	50122993	50122993	+	RNA	SNP	G	G	A	rs370221683		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:50122993G>A	ENST00000376025.2	-	0	2799							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					AAATGCACTCGTTCTTCCAGT	0.468																																																	0								G	stop/ARG	0,3145		0,0,1287,571	140.0	121.0	127.0		2740	5.2	1.0	X		127	1,6422		0,1,2319,1783	no	stop-gained	DGKK	NM_001013742.2		0,1,3606,2354	AA,AG,GG,G		0.0156,0.0,0.0105		914/1272	50122993	1,9567	1858	4103	5961			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50122993G>A			B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.468	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	-	0.00	37	0	G	NM_001013742		50122993	-1	tier1	-	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	60.00	16	24	SNP	1.000	A
DHX34	9704	genome.wustl.edu	37	19	47870310	47870310	+	Missense_Mutation	SNP	A	A	G	rs200731942		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:47870310A>G	ENST00000328771.4	+	7	2015	c.1666A>G	c.(1666-1668)Acc>Gcc	p.T556A	DHX34_ENST00000471451.1_3'UTR	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	556					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.T556A(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CAGCCTGGAAACCGCCATCCT	0.612																																																	1	Substitution - Missense(1)	skin(1)											36.0	38.0	37.0					19																	47870310		2203	4287	6490	SO:0001583	missense	0			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1666A>G	19.37:g.47870310A>G	ENSP00000331907:p.Thr556Ala		B4DMY8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T556A	ENST00000328771.4	37	c.1666	CCDS12700.1	19	.	.	.	.	.	.	.	.	.	.	A	8.527	0.870215	0.17322	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02472	4.28	5.46	5.46	0.80206	Helicase-associated domain (1);	0.000000	0.64402	D	0.000005	T	0.03651	0.0104	L	0.31926	0.97	0.58432	D	0.999997	B	0.33171	0.4	B	0.33196	0.159	T	0.53872	-0.8377	10	0.49607	T	0.09	-21.9691	14.4994	0.67711	1.0:0.0:0.0:0.0	.	556	Q14147	DHX34_HUMAN	A	556;471	ENSP00000331907:T556A	ENSP00000257252:T471A	T	+	1	0	DHX34	52562145	1.000000	0.71417	0.392000	0.26245	0.658000	0.38924	5.824000	0.69279	2.066000	0.61787	0.459000	0.35465	ACC	DHX34	-	superfamily_P-loop_NTPase,smart_Helicase-assoc_dom	ENSG00000134815		0.612	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX34	HGNC	protein_coding	OTTHUMT00000314313.3		0.00	110	0	A	NM_014681		47870310	+1			no_errors	ENST00000328771	ensembl	human	known	74_37	missense	6.52	86	6	SNP	1.000	G
DHX57	90957	genome.wustl.edu	37	2	39090566	39090566	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:39090566T>A	ENST00000295373.6	-	3	446	c.320A>T	c.(319-321)aAt>aTt	p.N107I	DHX57_ENST00000479345.2_5'UTR|AC018693.6_ENST00000442829.1_RNA	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	107							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTTCTCTTGATTCTCAGAAGT	0.393																																					Melanoma(191;1090 2095 4375 23729 47341)												0													184.0	178.0	180.0					2																	39090566		2203	4300	6503	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.320A>T	2.37:g.39090566T>A	ENSP00000295373:p.Asn107Ile		A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_P-loop_NTPase,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N107I	ENST00000295373.6	37	c.320	CCDS1800.1	2	.	.	.	.	.	.	.	.	.	.	T	25.7	4.669308	0.88348	.	.	ENSG00000163214	ENST00000295373;ENST00000355320;ENST00000417233	T	0.03152	4.03	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000013	T	0.11537	0.0281	L	0.32530	0.975	0.58432	D	0.999999	D;D	0.76494	0.999;0.995	D;P	0.76071	0.987;0.873	T	0.03503	-1.1030	10	0.62326	D	0.03	.	15.9133	0.79488	0.0:0.0:0.0:1.0	.	107;107	Q6P158-2;Q6P158	.;DHX57_HUMAN	I	107;5;5	ENSP00000295373:N107I	ENSP00000295373:N107I	N	-	2	0	DHX57	38944070	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.996000	0.76263	2.156000	0.67533	0.459000	0.35465	AAT	DHX57	-	NULL	ENSG00000163214		0.393	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	-	0.00	118	0	T	NM_145646		39090566	-1	tier1	-	no_errors	ENST00000295373	ensembl	human	known	74_37	missense	39.55	81	53	SNP	1.000	A
DIAPH2	1730	genome.wustl.edu	37	X	96396712	96396712	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:96396712A>G	ENST00000324765.8	+	22	2985	c.2638A>G	c.(2638-2640)Att>Gtt	p.I880V	DIAPH2_ENST00000373054.4_Missense_Mutation_p.I876V|DIAPH2_ENST00000355827.4_Missense_Mutation_p.I880V|DIAPH2_ENST00000373049.4_Missense_Mutation_p.I880V|DIAPH2_ENST00000373061.3_Missense_Mutation_p.I880V			O60879	DIAP2_HUMAN	diaphanous-related formin 2	880	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						TTTGCATTTTATTGCCGACAT	0.313																																																	0													67.0	61.0	63.0					X																	96396712		2203	4299	6502	SO:0001583	missense	0			Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.2638A>G	X.37:g.96396712A>G	ENSP00000321348:p.Ile880Val		A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.I880V	ENST00000324765.8	37	c.2638	CCDS14467.1	X	.	.	.	.	.	.	.	.	.	.	A	9.141	1.013917	0.19277	.	.	ENSG00000147202	ENST00000373061;ENST00000373054;ENST00000355827;ENST00000373049;ENST00000324765;ENST00000537885	T;T;T;T;T	0.16073	2.37;2.37;2.37;2.37;2.37	5.46	-4.8	0.03190	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.549745	0.16897	N	0.195057	T	0.08044	0.0201	N	0.05177	-0.1	0.25414	N	0.988335	B;B	0.16603	0.018;0.015	B;B	0.22152	0.038;0.023	T	0.23940	-1.0174	10	0.62326	D	0.03	.	13.9641	0.64199	0.1322:0.7062:0.0:0.1616	.	880;880	O60879;O60879-2	DIAP2_HUMAN;.	V	880;876;880;880;880;887	ENSP00000362152:I880V;ENSP00000362145:I876V;ENSP00000348082:I880V;ENSP00000362140:I880V;ENSP00000321348:I880V	ENSP00000321348:I880V	I	+	1	0	DIAPH2	96283368	0.996000	0.38824	0.953000	0.39169	0.043000	0.13939	0.582000	0.23834	-0.828000	0.04273	-0.378000	0.06908	ATT	DIAPH2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000147202		0.313	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH2	HGNC	protein_coding	OTTHUMT00000058871.2	-	0.00	89	0	A	NM_006729, NM_007309		96396712	+1	tier1	-	no_errors	ENST00000324765	ensembl	human	known	74_37	missense	84.66	27	149	SNP	0.942	G
DKC1	1736	genome.wustl.edu	37	X	153994770	153994771	+	Intron	INS	-	-	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:153994770_153994771insA	ENST00000369550.5	+	5	658				SNORA36A_ENST00000384221.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin						cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TCTTCATTAAGAAAAAAAAAAA	0.421									Congenital Dyskeratosis																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.448+95->A	X.37:g.153994781_153994781dupA			F5BSB3|O43845|Q96G67|Q9Y505	RNA	INS	-	NULL	ENST00000369550.5	37	NULL	CCDS14761.1	X																																																																																			DKC1	-	-	ENSG00000130826		0.421	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	HGNC	protein_coding	OTTHUMT00000061180.5		0.00	10	0	-	NM_001363		153994771	+1	tier1		no_errors	ENST00000473552	ensembl	human	known	74_37	rna	12.00	22	3	INS	0.000:0.000	A
DLX2	1746	genome.wustl.edu	37	2	172967129	172967131	+	In_Frame_Del	DEL	GCT	GCT	-	rs376692475		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:172967129_172967131delGCT	ENST00000234198.4	-	1	497_499	c.136_138delAGC	c.(136-138)agcdel	p.S46del	DLX2_ENST00000466293.2_In_Frame_Del_p.S46del|AC104801.1_ENST00000448117.1_lincRNA	NM_004405.3	NP_004396.1	Q07687	DLX2_HUMAN	distal-less homeobox 2	46	Poly-Ser.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|cartilage development (GO:0051216)|cerebral cortex GABAergic interneuron fate commitment (GO:0021893)|embryonic cranial skeleton morphogenesis (GO:0048701)|hippocampus development (GO:0021766)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|subpallium development (GO:0021544)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded RNA binding (GO:0003727)			endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.216)			GCTTGTGGAGgctgctgctgctg	0.739																																					GBM(188;775 2993 11256 23072)												0										19,76,3319		3,0,13,8,60,1623						4.5	1.0			15	96,156,6524		10,3,73,15,123,3164	no	codingComplex	DLX2	NM_004405.3		13,3,86,23,183,4787	A1A1,A1A2,A1R,A2A2,A2R,RR		3.719,2.7827,3.4053				115,232,9843				SO:0001651	inframe_deletion	0			U51003	CCDS2248.1	2q31.1	2011-06-20	2005-12-22		ENSG00000115844	ENSG00000115844		"""Homeoboxes / ANTP class : NKL subclass"""	2915	protein-coding gene	gene with protein product		126255	"""distal-less homeo box 2"""			1354641	Standard	NM_004405		Approved	TES-1	uc002uhn.3	Q07687	OTTHUMG00000132276	ENST00000234198.4:c.136_138delAGC	2.37:g.172967138_172967140delGCT	ENSP00000234198:p.Ser46del		B4DMK4|B7ZA14	In_Frame_Del	DEL	pfam_Homeobox_dom,pfam_Distal-less_N,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.S46in_frame_del	ENST00000234198.4	37	c.138_136	CCDS2248.1	2																																																																																			DLX2	-	NULL	ENSG00000115844		0.739	DLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX2	HGNC	protein_coding	OTTHUMT00000255368.3		0.00	43	0	GCT			172967131	-1	tier1		no_errors	ENST00000234198	ensembl	human	known	74_37	in_frame_del	10.17	53	6	DEL	0.998:1.000:1.000	-
DNAH10	196385	genome.wustl.edu	37	12	124358117	124358117	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:124358117G>T	ENST00000409039.3	+	45	7469	c.7444G>T	c.(7444-7446)Gtc>Ttc	p.V2482F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2482	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TGTGTTAATGGTCAACTTCTC	0.428																																																	0													84.0	78.0	80.0					12																	124358117		1929	4142	6071	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7444G>T	12.37:g.124358117G>T	ENSP00000386770:p.Val2482Phe		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.V2482F	ENST00000409039.3	37	c.7444	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484483	0.63962	.	.	ENSG00000197653	ENST00000409039	T	0.42900	0.96	4.94	4.05	0.47172	ATPase, AAA+ type, core (1);	0.177715	0.36893	U	0.002342	T	0.38506	0.1043	L	0.39147	1.195	0.41422	D	0.987804	P	0.41188	0.741	P	0.48334	0.574	T	0.14924	-1.0455	10	0.29301	T	0.29	.	6.4551	0.21926	0.3215:0.0:0.6785:0.0	.	2482	Q8IVF4	DYH10_HUMAN	F	2482	ENSP00000386770:V2482F	ENSP00000386770:V2482F	V	+	1	0	DNAH10	122924070	1.000000	0.71417	0.200000	0.23457	0.846000	0.48090	6.261000	0.72509	1.218000	0.43458	0.561000	0.74099	GTC	DNAH10	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000197653		0.428	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	70	0	G			124358117	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.985	T
DNAJC13	23317	genome.wustl.edu	37	3	132222104	132222104	+	Missense_Mutation	SNP	G	G	T	rs145101163	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:132222104G>T	ENST00000260818.6	+	41	5011	c.4763G>T	c.(4762-4764)cGc>cTc	p.R1588L		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1588					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GCTCTGAGTCGCCTTGGAGGG	0.403																																																	0													80.0	78.0	79.0					3																	132222104		2203	4300	6503	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.4763G>T	3.37:g.132222104G>T	ENSP00000260818:p.Arg1588Leu		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.R1588L	ENST00000260818.6	37	c.4763	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218875	0.79464	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	T	0.20463	2.07	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	M	0.76574	2.34	0.80722	D	1	D	0.57899	0.981	P	0.47206	0.541	T	0.13495	-1.0507	10	0.41790	T	0.15	.	19.3832	0.94545	0.0:0.0:1.0:0.0	.	1588	O75165	DJC13_HUMAN	L	1588;235	ENSP00000260818:R1588L	ENSP00000260818:R1588L	R	+	2	0	DNAJC13	133704794	1.000000	0.71417	0.997000	0.53966	0.862000	0.49288	9.310000	0.96267	2.587000	0.87381	0.555000	0.69702	CGC	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.403	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2		0.00	52	0	G	NM_015268		132222104	+1			no_errors	ENST00000260818	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
DOCK7	85440	genome.wustl.edu	37	1	62941168	62941169	+	Intron	INS	-	-	A	rs572869912|rs11330816|rs398073984|rs559508807|rs397716686|rs374950418|rs541259252	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:62941168_62941169insA	ENST00000340370.5	-	46	5886				DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000489185.1_Intron	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATTCCTAAATGAAAAAAAAAAA	0.252																																																	0																																										SO:0001627	intron_variant	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5869-146->T	1.37:g.62941179_62941179dupA			Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	RNA	INS	-	NULL	ENST00000340370.5	37	NULL	CCDS30734.1	1																																																																																			DOCK7	-	-	ENSG00000116641		0.252	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1		0.00	17	0	-	NM_033407		62941169	-1	tier1		no_errors	ENST00000467758	ensembl	human	known	74_37	rna	15.79	16	3	INS	0.000:0.000	A
DPAGT1	1798	genome.wustl.edu	37	11	118971800	118971800	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:118971800G>T	ENST00000409993.2	-	4	1761	c.210C>A	c.(208-210)ctC>ctA	p.L70L	DPAGT1_ENST00000354202.4_Silent_p.L70L|DPAGT1_ENST00000445653.1_Intron|DPAGT1_ENST00000432443.2_Intron			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)	70					cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		TGAAGCAGAAGAGGATGATAA	0.567											OREG0021396	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													66.0	57.0	60.0					11																	118971800		2200	4295	6495	SO:0001819	synonymous_variant	0			Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533	ENST00000409993.2:c.210C>A	11.37:g.118971800G>T		1492	O15216|Q86WV9|Q9BWE6	Silent	SNP	pfam_Glycosyl_transferase_4	p.L70	ENST00000409993.2	37	c.210	CCDS8411.1	11																																																																																			DPAGT1	-	NULL	ENSG00000172269		0.567	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPAGT1	HGNC	protein_coding	OTTHUMT00000331527.2		0.00	43	0	G	NM_001382		118971800	-1			no_errors	ENST00000354202	ensembl	human	known	74_37	silent	11.76	30	4	SNP	1.000	T
DRP2	1821	genome.wustl.edu	37	X	100515128	100515128	+	Nonsense_Mutation	SNP	G	G	T	rs575075803		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:100515128G>T	ENST00000395209.3	+	23	3246	c.2719G>T	c.(2719-2721)Gga>Tga	p.G907*	DRP2_ENST00000538510.1_Nonsense_Mutation_p.G907*|DRP2_ENST00000402866.1_Nonsense_Mutation_p.G907*|DRP2_ENST00000541709.1_Nonsense_Mutation_p.G829*	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	907					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						CCGGGAGAAGGGACAGACTAC	0.602																																																	0													103.0	87.0	92.0					X																	100515128		2203	4300	6503	SO:0001587	stop_gained	0			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2719G>T	X.37:g.100515128G>T	ENSP00000378635:p.Gly907*		A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Nonsense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.G907*	ENST00000395209.3	37	c.2719	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	G	40	8.395949	0.98794	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	.	.	.	4.94	4.94	0.65067	.	0.274627	0.43416	D	0.000561	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-3.3733	15.5867	0.76489	0.0:0.0:1.0:0.0	.	.	.	.	X	907;907;829;907	.	ENSP00000378635:G907X	G	+	1	0	DRP2	100401784	1.000000	0.71417	0.999000	0.59377	0.919000	0.55068	5.079000	0.64431	2.037000	0.60232	0.529000	0.55759	GGA	DRP2	-	pirsf_Dystrophin-related_2	ENSG00000102385		0.602	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	HGNC	protein_coding	OTTHUMT00000057522.3		0.00	27	0	G	NM_001939		100515128	+1			no_errors	ENST00000395209	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	1.000	T
DTX1	1840	genome.wustl.edu	37	12	113533166	113533166	+	Missense_Mutation	SNP	G	G	A	rs537324019		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:113533166G>A	ENST00000257600.3	+	8	2088	c.1585G>A	c.(1585-1587)Gca>Aca	p.A529T	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	529					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						GAAGTTCACCGCAAGAGGATT	0.607													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17957	0.0		0.0	False		,,,				2504	0.0																0													72.0	76.0	75.0					12																	113533166		2203	4300	6503	SO:0001583	missense	0			AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1585G>A	12.37:g.113533166G>A	ENSP00000257600:p.Ala529Thr		O60630|Q9BS04	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.A529T	ENST00000257600.3	37	c.1585	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265069	0.80358	.	.	ENSG00000135144	ENST00000257600	T	0.59502	0.26	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.67011	0.2848	M	0.74389	2.26	0.80722	D	1	P	0.47677	0.899	P	0.48738	0.588	T	0.74084	-0.3779	10	0.87932	D	0	3.033	16.305	0.82844	0.0:0.0:1.0:0.0	.	529	Q86Y01	DTX1_HUMAN	T	529	ENSP00000257600:A529T	ENSP00000257600:A529T	A	+	1	0	DTX1	112017549	1.000000	0.71417	0.602000	0.28890	0.927000	0.56198	9.681000	0.98653	2.114000	0.64651	0.561000	0.74099	GCA	DTX1	-	NULL	ENSG00000135144		0.607	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	HGNC	protein_coding	OTTHUMT00000405045.2	-	0.00	75	0	G			113533166	+1	tier1	-	no_errors	ENST00000257600	ensembl	human	known	74_37	missense	7.06	79	6	SNP	0.999	A
DTX4	23220	genome.wustl.edu	37	11	58972233	58972233	+	Missense_Mutation	SNP	G	G	A	rs376862310		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:58972233G>A	ENST00000227451.3	+	9	1815	c.1711G>A	c.(1711-1713)Gtc>Atc	p.V571I	DTX4_ENST00000532982.1_Missense_Mutation_p.V465I	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	571					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.V465I(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				GTCAGACACCGTCATCTGGAA	0.532																																																	1	Substitution - Missense(1)	large_intestine(1)						G	ILE/VAL	0,4260		0,0,2130	76.0	77.0	77.0		1711	5.4	1.0	11		77	1,8515		0,1,4257	no	missense	DTX4	NM_015177.1	29	0,1,6387	AA,AG,GG		0.0117,0.0,0.0078	probably-damaging	571/620	58972233	1,12775	2130	4258	6388	SO:0001583	missense	0			AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.1711G>A	11.37:g.58972233G>A	ENSP00000227451:p.Val571Ile		Q0VF38	Missense_Mutation	SNP	pfam_WWE-dom,pfam_Znf_C3HC4_RING-type,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.V571I	ENST00000227451.3	37	c.1711	CCDS44612.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.425456	0.83667	0.0	1.17E-4	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.53423	0.62;0.62	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.64962	0.2646	L	0.54908	1.71	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.63532	-0.6616	10	0.46703	T	0.11	.	18.0339	0.89293	0.0:0.0:1.0:0.0	.	571	Q9Y2E6	DTX4_HUMAN	I	465;571	ENSP00000434055:V465I;ENSP00000227451:V571I	ENSP00000227451:V571I	V	+	1	0	DTX4	58728809	1.000000	0.71417	0.953000	0.39169	0.323000	0.28346	9.869000	0.99810	2.565000	0.86533	0.591000	0.81541	GTC	DTX4	-	NULL	ENSG00000110042		0.532	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX4	HGNC	protein_coding	OTTHUMT00000394228.1		0.00	34	0	G	XM_166213		58972233	+1			no_errors	ENST00000227451	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
EIF4G1	1981	genome.wustl.edu	37	3	184040687	184040687	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:184040687C>T	ENST00000346169.2	+	13	2145	c.1874C>T	c.(1873-1875)gCc>gTc	p.A625V	EIF4G1_ENST00000382330.3_Missense_Mutation_p.A632V|EIF4G1_ENST00000411531.1_Missense_Mutation_p.A585V|EIF4G1_ENST00000427845.1_Missense_Mutation_p.A538V|EIF4G1_ENST00000441154.1_Missense_Mutation_p.A461V|EIF4G1_ENST00000392537.2_Missense_Mutation_p.A538V|SNORD66_ENST00000390856.1_RNA|EIF4G1_ENST00000350481.5_Missense_Mutation_p.A461V|EIF4G1_ENST00000319274.6_Missense_Mutation_p.A625V|EIF4G1_ENST00000434061.2_Missense_Mutation_p.A429V|EIF4G1_ENST00000352767.3_Missense_Mutation_p.A632V|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000424196.1_Missense_Mutation_p.A632V|EIF4G1_ENST00000342981.4_Missense_Mutation_p.A625V|EIF4G1_ENST00000414031.1_Missense_Mutation_p.A585V|EIF4G1_ENST00000435046.2_Missense_Mutation_p.A429V	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	625	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.			AS -> CQ (in Ref. 1; BAA02185). {ECO:0000305}.	cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTCATCTTTGCCAGTATGCAG	0.478																																																	0													198.0	186.0	190.0					3																	184040687		2203	4300	6503	SO:0001583	missense	0			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1874C>T	3.37:g.184040687C>T	ENSP00000316879:p.Ala625Val		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.A632V	ENST00000346169.2	37	c.1895	CCDS3259.1	3	.	.	.	.	.	.	.	.	.	.	C	18.76	3.693144	0.68271	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.54822	0.1882	M	0.68728	2.09	0.80722	D	1	P;B;B;B	0.41131	0.739;0.199;0.199;0.199	B;B;B;B	0.38803	0.282;0.049;0.049;0.049	T	0.56938	-0.7896	10	0.39692	T	0.17	-12.7233	19.3711	0.94488	0.0:1.0:0.0:0.0	.	632;625;625;632	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	V	625;585;538;625;632;632;566;461;632;538;625;625;632;585;461;461;429;429	ENSP00000316879:A625V;ENSP00000391935:A585V;ENSP00000376320:A538V;ENSP00000391412:A625V;ENSP00000413159:A632V;ENSP00000371767:A632V;ENSP00000403269:A566V;ENSP00000317600:A461V;ENSP00000338020:A632V;ENSP00000407682:A538V;ENSP00000343450:A625V;ENSP00000323737:A625V;ENSP00000416255:A632V;ENSP00000395974:A585V;ENSP00000398145:A461V;ENSP00000399858:A461V;ENSP00000411826:A429V;ENSP00000404754:A429V	ENSP00000323737:A625V	A	+	2	0	EIF4G1	185523381	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.320000	0.79064	2.814000	0.96858	0.563000	0.77884	GCC	EIF4G1	-	NULL	ENSG00000114867		0.478	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	HGNC	protein_coding	OTTHUMT00000345733.1	-	0.00	65	0	C	NM_182917		184040687	+1	tier1	-	no_errors	ENST00000352767	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
UNC5B	219699	genome.wustl.edu	37	10	72975564	72975565	+	Intron	DEL	GT	GT	-	rs61070575|rs55848098|rs201949769|rs151276494|rs55906066|rs72091766|rs71924552		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:72975564_72975565delGT	ENST00000335350.6	+	1	495				UNC5B-AS1_ENST00000449737.1_RNA|UNC5B_ENST00000373192.4_Intron|AL359832.1_ENST00000401185.1_RNA|UNC5B-AS1_ENST00000447119.2_RNA	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						TCTCTGCTTGgtgtgtgtgtgt	0.485																																																	0																																										SO:0001627	intron_variant	0			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.79+2743GT>-	10.37:g.72975574_72975575delGT			Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	RNA	DEL	-	NULL	ENST00000335350.6	37	NULL	CCDS7309.1	10																																																																																			AL359832.1	-	-	ENSG00000216004		0.485	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216004	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000048541.1		0.00	25	0	GT	NM_170744		72975565	+1	tier1		no_errors	ENST00000401185	ensembl	human	novel	74_37	rna	14.29	24	4	DEL	0.024:0.453	-
CDC123	8872	genome.wustl.edu	37	10	12289002	12289002	+	Intron	SNP	T	T	G	rs113024795		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:12289002T>G	ENST00000281141.4	+	11	1126				RP11-186N15.3_ENST00000598961.1_RNA|RP11-186N15.3_ENST00000421657.1_RNA|CDC123_ENST00000378900.2_Intron|CDC123_ENST00000455773.3_Intron	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						TCCTCCTCTCTCACCTCCCAC	0.612																																																	0																																										SO:0001627	intron_variant	0			BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.846+726T>G	10.37:g.12289002T>G			A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	RNA	SNP	-	NULL	ENST00000281141.4	37	NULL	CCDS7090.1	10																																																																																			RP11-186N15.3	-	-	ENSG00000228302		0.612	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228302	Clone_based_vega_gene	protein_coding	OTTHUMT00000046801.1	-	0.00	13	0	T	NM_006023		12289002	-1	tier1	rs113024795	no_errors	ENST00000421657	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.004	G
RP11-403I13.8	0	genome.wustl.edu	37	1	149287545	149287545	+	lincRNA	SNP	G	G	A	rs371598228		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:149287545G>A	ENST00000433084.1	+	0	95				RNU1-143P_ENST00000516296.1_RNA|RP11-403I13.7_ENST00000424684.1_lincRNA																							GTCTCACAAGGCCGTTCACTC	0.562																																																	0																																												0																															1.37:g.149287545G>A				RNA	SNP	-	NULL	ENST00000433084.1	37	NULL		1																																																																																			RP11-403I13.8	-	-	ENSG00000235999		0.562	RP11-403I13.8-001	KNOWN	basic	lincRNA	ENSG00000235999	Clone_based_vega_gene	lincRNA	OTTHUMT00000099633.1		0.00	9	0	G			149287545	+1			no_errors	ENST00000433084	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.094	A
RP11-815J4.6	0	genome.wustl.edu	37	18	12076569	12076570	+	RNA	INS	-	-	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr18:12076569_12076570insG	ENST00000591780.1	-	0	25_26																											ccgcagccTCCcagcagcgcga	0.822																																																	0																																												0																															18.37:g.12076569_12076570insG				RNA	INS	-	NULL	ENST00000591780.1	37	NULL		18																																																																																			RP11-815J4.6	-	-	ENSG00000256616		0.822	RP11-815J4.6-002	KNOWN	basic	processed_transcript	ENSG00000256616	Clone_based_vega_gene	pseudogene	OTTHUMT00000452539.1		0.00	21	0	-			12076570	-1	tier1		no_errors	ENST00000591780	ensembl	human	known	74_37	rna	16.67	20	4	INS	0.996:0.995	G
GUSBP11	91316	genome.wustl.edu	37	22	24025972	24025972	+	RNA	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:24025972G>T	ENST00000455485.1	-	0	3163				KB-1572G7.2_ENST00000421064.1_RNA|AP000347.2_ENST00000417194.1_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										CACTGATGCCGGAAAGAAGTC	0.612																																																	0																																												0					22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.24025972G>T				RNA	SNP	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			AP000347.2	-	-	ENSG00000272578		0.612	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000272578	Clone_based_vega_gene	processed_transcript	OTTHUMT00000319697.1	-	0.00	15	0	G			24025972	-1	tier1	-	no_errors	ENST00000417194	ensembl	human	known	74_37	rna	19.05	17	4	SNP	0.993	T
EP300	2033	genome.wustl.edu	37	22	41574330	41574330	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:41574330G>T	ENST00000263253.7	+	31	7834	c.6615G>T	c.(6613-6615)atG>atT	p.M2205I	RP1-85F18.6_ENST00000415054.1_RNA|RP1-85F18.5_ENST00000420537.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	2205	Interaction with HTLV-1 Tax.|Interaction with NCOA2.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						GCCCTGGAATGGCCAACCATA	0.527			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													61.0	59.0	60.0					22																	41574330		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.6615G>T	22.37:g.41574330G>T	ENSP00000263253:p.Met2205Ile		B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.M2205I	ENST00000263253.7	37	c.6615	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	11.34	1.608613	0.28623	.	.	ENSG00000100393	ENST00000263253	D	0.82984	-1.67	5.5	4.49	0.54785	.	0.218226	0.30850	N	0.008756	T	0.73055	0.3538	L	0.29908	0.895	0.46356	D	0.999002	B	0.02656	0.0	B	0.01281	0.0	T	0.66085	-0.6011	10	0.18710	T	0.47	-1.7948	13.8478	0.63479	0.073:0.0:0.927:0.0	.	2205	Q09472	EP300_HUMAN	I	2205	ENSP00000263253:M2205I	ENSP00000263253:M2205I	M	+	3	0	EP300	39904276	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	4.328000	0.59253	1.319000	0.45190	0.655000	0.94253	ATG	EP300	-	NULL	ENSG00000100393		0.527	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1		0.00	51	0	G	NM_001429		41574330	+1			no_errors	ENST00000263253	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
EPHA2	1969	genome.wustl.edu	37	1	16475134	16475134	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:16475134A>G	ENST00000358432.5	-	3	716	c.562T>C	c.(562-564)Tgt>Cgt	p.C188R	EPHA2_ENST00000461614.1_5'UTR	NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	188	Cys-rich.|Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Mediates interaction with CLDN4.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	AGCGCCACACAGGCACCGATA	0.647																																																	0													63.0	60.0	61.0					1																	16475134		2203	4300	6503	SO:0001583	missense	0			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.562T>C	1.37:g.16475134A>G	ENSP00000351209:p.Cys188Arg		B5A968|Q8N3Z2	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.C188R	ENST00000358432.5	37	c.562	CCDS169.1	1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964594	0.74131	.	.	ENSG00000142627	ENST00000358432	T	0.68624	-0.34	5.14	5.14	0.70334	Tyrosine-protein kinase, receptor class V, conserved site (1);Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000011	D	0.84999	0.5597	M	0.93016	3.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.88451	0.3049	10	0.87932	D	0	.	12.8998	0.58119	1.0:0.0:0.0:0.0	.	188;188	B5A968;P29317	.;EPHA2_HUMAN	R	188	ENSP00000351209:C188R	ENSP00000351209:C188R	C	-	1	0	EPHA2	16347721	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.319000	0.96338	1.937000	0.56155	0.459000	0.35465	TGT	EPHA2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000142627		0.647	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	HGNC	protein_coding	OTTHUMT00000026322.1		0.00	42	0	A	NM_004431		16475134	-1			no_errors	ENST00000358432	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	G
EYS	346007	genome.wustl.edu	37	6	64791750	64791750	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:64791750G>T	ENST00000370621.3	-	32	7096	c.6570C>A	c.(6568-6570)taC>taA	p.Y2190*	EYS_ENST00000370616.2_Splice_Site_p.Y2190*|EYS_ENST00000503581.1_Splice_Site_p.Y2190*			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	2190	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AATACTCACTGTAAAGAATAG	0.299																																																	0													132.0	130.0	131.0					6																	64791750		692	1587	2279	SO:0001630	splice_region_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.6571+1C>A	6.37:g.64791750G>T			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.Y2190*	ENST00000370621.3	37	c.6570		6	.	.	.	.	.	.	.	.	.	.	G	46	12.348750	0.99659	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	.	.	.	5.52	1.99	0.26369	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3312	0.32187	0.1591:0.1703:0.6707:0.0	.	.	.	.	X	2190	.	ENSP00000359650:Y2190X	Y	-	3	2	EYS	64849709	1.000000	0.71417	0.970000	0.41538	0.735000	0.41995	2.647000	0.46639	0.527000	0.28560	0.655000	0.94253	TAC	EYS	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188107		0.299	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	71	0	G	XM_294050	Nonsense_Mutation	64791750	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	nonsense	38.37	51	33	SNP	0.998	T
FAM160A2	84067	genome.wustl.edu	37	11	6238828	6238828	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:6238828C>T	ENST00000449352.2	-	9	2251	c.1988G>A	c.(1987-1989)gGc>gAc	p.G663D	FAM160A2_ENST00000529360.1_5'Flank|FAM160A2_ENST00000265978.4_Missense_Mutation_p.G677D|FAM160A2_ENST00000524416.1_Missense_Mutation_p.G663D			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	663					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTCGGAGATGCCCTCTAGCAG	0.622																																																	0													88.0	90.0	90.0					11																	6238828		2201	4296	6497	SO:0001583	missense	0				CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1988G>A	11.37:g.6238828C>T	ENSP00000416918:p.Gly663Asp		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.G677D	ENST00000449352.2	37	c.2030	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	C	9.201	1.028464	0.19512	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.40756	1.02;1.02;1.02	5.11	4.2	0.49525	.	0.320207	0.38217	N	0.001778	T	0.22437	0.0541	N	0.08118	0	0.28890	N	0.893896	B;B;B	0.25105	0.002;0.0;0.118	B;B;B	0.30401	0.003;0.001;0.115	T	0.19712	-1.0297	10	0.12103	T	0.63	-13.2804	10.7758	0.46348	0.0:0.9115:0.0:0.0885	.	663;663;677	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	D	663;588;677;663	ENSP00000416918:G663D;ENSP00000265978:G677D;ENSP00000431773:G663D	ENSP00000265978:G677D	G	-	2	0	FAM160A2	6195404	0.807000	0.29009	0.912000	0.35992	0.678000	0.39670	2.214000	0.42853	1.392000	0.46585	0.561000	0.74099	GGC	FAM160A2	-	NULL	ENSG00000051009		0.622	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	-	0.00	56	0	C	NM_032127		6238828	-1	tier1	-	no_errors	ENST00000265978	ensembl	human	known	74_37	missense	37.14	22	13	SNP	0.926	T
FAM160B2	64760	genome.wustl.edu	37	8	21953882	21953882	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr8:21953882C>A	ENST00000289921.7	+	3	205	c.159C>A	c.(157-159)ccC>ccA	p.P53P		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	53										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						CAGACATTCCCTGGCGGCTGA	0.577																																																	0													24.0	28.0	26.0					8																	21953882		1957	4113	6070	SO:0001819	synonymous_variant	0			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.159C>A	8.37:g.21953882C>A			B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Silent	SNP	pfam_RetinoicA-induced_16-like	p.P53	ENST00000289921.7	37	c.159	CCDS6021.2	8																																																																																			FAM160B2	-	NULL	ENSG00000158863		0.577	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2		0.00	123	0	C			21953882	+1			no_errors	ENST00000289921	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	A
FAM230B	642633	genome.wustl.edu	37	22	21538128	21538128	+	RNA	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:21538128C>T	ENST00000451257.1	+	0	1114									family with sequence similarity 230, member B (non-protein coding)																		CCCACGGCATCGCCAGCGAGG	0.731																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538128C>T				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.731	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1		0.00	210	0	C	NR_108107		21538128	+1			no_errors	ENST00000451257	ensembl	human	known	74_37	rna	5.14	203	11	SNP	0.013	T
FBXL19	54620	genome.wustl.edu	37	16	30933892	30933892	+	5'Flank	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:30933892T>C	ENST00000380310.2	+	0	0				FBXL19_ENST00000471231.2_5'Flank|FBXL19-AS1_ENST00000563777.1_RNA|FBXL19_ENST00000562319.1_5'Flank|FBXL19_ENST00000338343.4_5'Flank	NM_001099784.2	NP_001093254.2	Q6PCT2	FXL19_HUMAN	F-box and leucine-rich repeat protein 19						proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)	SCF ubiquitin ligase complex (GO:0019005)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|lung(5)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						AGCGACGTCCTTTCTCTGTTG	0.567																																																	0																																										SO:0001631	upstream_gene_variant	0			AK127701	CCDS45465.1, CCDS73873.1	16p11.2	2014-02-20			ENSG00000099364	ENSG00000099364		"""F-boxes / Leucine-rich repeats"""	25300	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1C"""	609085					Standard	NM_001099784		Approved	DKFZp434K0410, Fbl19, JHDM1C, CXXC11	uc002eab.2	Q6PCT2	OTTHUMG00000132403		16.37:g.30933892T>C	Exception_encountered		A8MT10|Q8N789|Q9NT14	RNA	SNP	-	NULL	ENST00000380310.2	37	NULL	CCDS45465.1	16																																																																																			FBXL19-AS1	-	-	ENSG00000260852		0.567	FBXL19-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL19-AS1	HGNC	protein_coding		-	0.00	51	0	T	NM_019085		30933892	-1	tier1	-	no_errors	ENST00000563777	ensembl	human	known	74_37	rna	25.00	45	15	SNP	1.000	C
FCHO1	23149	genome.wustl.edu	37	19	17893856	17893856	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:17893856C>A	ENST00000596536.1	+	24	2251	c.1968C>A	c.(1966-1968)acC>acA	p.T656T	FCHO1_ENST00000539407.1_Silent_p.T656T|FCHO1_ENST00000600676.1_Silent_p.T656T|FCHO1_ENST00000595033.1_Silent_p.T606T|FCHO1_ENST00000596951.1_Silent_p.T656T|FCHO1_ENST00000594202.1_Silent_p.T656T|FCHO1_ENST00000597512.1_Silent_p.T663T|FCHO1_ENST00000252771.7_Silent_p.T656T|FCHO1_ENST00000389133.4_Silent_p.T656T	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	656	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.|Mediates interaction with AGFG1, CALM, DAB2, EPS15, EPS15R, ITSN1 and clathrin.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						GGGAGCTGACCATGACCTTCC	0.602																																																	0													137.0	104.0	115.0					19																	17893856		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1968C>A	19.37:g.17893856C>A			A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Silent	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.T656	ENST00000596536.1	37	c.1968	CCDS32955.1	19																																																																																			FCHO1	-	pfam_Muniscin_C-term_mu_dom	ENSG00000130475		0.602	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	-	0.00	62	0	C	NM_015122		17893856	+1	tier1	-	no_errors	ENST00000252771	ensembl	human	known	74_37	silent	5.71	66	4	SNP	1.000	A
FER1L6	654463	genome.wustl.edu	37	8	125076723	125076723	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr8:125076723C>T	ENST00000522917.1	+	26	3670	c.3464C>T	c.(3463-3465)gCc>gTc	p.A1155V	FER1L6_ENST00000399018.1_Missense_Mutation_p.A1155V|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1155						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GCCCAGCCGGCCATCCTGGTT	0.592																																																	0													71.0	77.0	75.0					8																	125076723		2015	4182	6197	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3464C>T	8.37:g.125076723C>T	ENSP00000428280:p.Ala1155Val			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.A1155V	ENST00000522917.1	37	c.3464	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	1.747	-0.490167	0.04322	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	T;T	0.80738	-1.41;-1.41	5.14	5.14	0.70334	.	3.045620	0.01546	N	0.019451	T	0.74397	0.3711	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.55055	-0.8200	10	0.22109	T	0.4	0.2992	14.1309	0.65253	0.0:1.0:0.0:0.0	.	1155	Q2WGJ9	FR1L6_HUMAN	V	1155	ENSP00000428280:A1155V;ENSP00000381982:A1155V	ENSP00000381982:A1155V	A	+	2	0	FER1L6	125145904	0.000000	0.05858	0.009000	0.14445	0.007000	0.05969	0.648000	0.24828	2.396000	0.81511	0.462000	0.41574	GCC	FER1L6	-	NULL	ENSG00000214814		0.592	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	-	0.00	39	0	C	NM_001039112		125076723	+1	tier1	-	no_errors	ENST00000399018	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.047	T
FGD5	152273	genome.wustl.edu	37	3	14974654	14974654	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:14974654G>T	ENST00000285046.5	+	20	4479	c.4369G>T	c.(4369-4371)Gaa>Taa	p.E1457*	FGD5_ENST00000543601.1_Nonsense_Mutation_p.E1173*|FGD5-AS1_ENST00000430166.1_RNA|FGD5_ENST00000476851.1_3'UTR	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	1457	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						CGAGGCCATGGAAGATGCGAG	0.428																																																	0													156.0	154.0	155.0					3																	14974654		1920	4131	6051	SO:0001587	stop_gained	0			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.4369G>T	3.37:g.14974654G>T	ENSP00000285046:p.Glu1457*		B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.E1457*	ENST00000285046.5	37	c.4369	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	43	10.429618	0.99403	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	.	.	.	5.01	3.92	0.45320	.	0.110878	0.39274	N	0.001401	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-24.9078	10.906	0.47079	0.1643:0.0:0.8357:0.0	.	.	.	.	X	1457;1173	.	ENSP00000285046:E1457X	E	+	1	0	FGD5	14949658	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	2.779000	0.47734	2.299000	0.77371	0.591000	0.81541	GAA	FGD5	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000154783		0.428	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1		0.00	85	0	G	NM_152536		14974654	+1			no_errors	ENST00000285046	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	1.000	T
FHL3	2275	genome.wustl.edu	37	1	38464974	38464974	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:38464974G>T	ENST00000373016.3	-	2	279	c.111C>A	c.(109-111)gcC>gcA	p.A37A	FHL3_ENST00000485803.1_Intron	NM_001243878.1|NM_004468.4	NP_001230807.1|NP_004459.2	Q13643	FHL3_HUMAN	four and a half LIM domains 3	37					actin cytoskeleton organization (GO:0030036)|muscle organ development (GO:0007517)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|stress fiber (GO:0001725)|Z disc (GO:0030018)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CACAGGTGTTGGCAAAGGTAT	0.572																																																	0													127.0	107.0	114.0					1																	38464974		2203	4300	6503	SO:0001819	synonymous_variant	0			BC011697	CCDS30678.1	1p34.3	2008-02-05			ENSG00000183386	ENSG00000183386			3704	protein-coding gene	gene with protein product		602790				8753811, 10226657	Standard	NM_004468		Approved	SLIM2	uc001cck.3	Q13643	OTTHUMG00000004434	ENST00000373016.3:c.111C>A	1.37:g.38464974G>T			D3DPT6|Q6I9T0|Q9BVA2	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A37	ENST00000373016.3	37	c.111	CCDS30678.1	1																																																																																			FHL3	-	NULL	ENSG00000183386		0.572	FHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHL3	HGNC	protein_coding	OTTHUMT00000012958.1	-	0.00	40	0	G	NM_004468		38464974	-1	tier1	-	no_errors	ENST00000373016	ensembl	human	known	74_37	silent	8.51	43	4	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152287341	152287342	+	Intron	INS	-	-	T	rs397864332|rs34224823	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:152287341_152287342insT	ENST00000368799.1	-	3	174				FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin						establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGACAAAATCTTTTTTTTTTT	0.332									Ichthyosis																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.139-118->A	1.37:g.152287352_152287352dupT			Q01720|Q5T583|Q9UC71	RNA	INS	-	NULL	ENST00000368799.1	37	NULL	CCDS30860.1	1																																																																																			FLG-AS1	-	-	ENSG00000237975		0.332	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG-AS1	HGNC	protein_coding	OTTHUMT00000033742.1		0.00	13	0	-	NM_002016		152287342	+1	tier1		no_errors	ENST00000392688	ensembl	human	known	74_37	rna	18.18	9	2	INS	0.000:0.000	T
FOXK2	3607	genome.wustl.edu	37	17	80559543	80559543	+	3'UTR	SNP	C	C	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:80559543C>G	ENST00000335255.5	+	0	2325				FOXK2_ENST00000529652.1_3'UTR|RP13-638C3.4_ENST00000576912.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			AGAAGTCACACTTGAACAAAA	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.*168C>G	17.37:g.80559543C>G			A6NEP5|Q13622|Q13623|Q13624	RNA	SNP	-	NULL	ENST00000335255.5	37	NULL	CCDS11813.1	17																																																																																			FOXK2	-	-	ENSG00000141568		0.522	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK2	HGNC	protein_coding	OTTHUMT00000277099.2	-	0.00	33	0	C	NM_181430		80559543	+1	tier1	-	no_errors	ENST00000529652	ensembl	human	known	74_37	rna	43.90	23	18	SNP	0.791	G
GALNT12	79695	genome.wustl.edu	37	9	101594127	101594127	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:101594127G>A	ENST00000375011.3	+	4	805	c.805G>A	c.(805-807)Ggg>Agg	p.G269R		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	269					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				CGAATACCTGGGGAACTCCGG	0.577																																																	0													78.0	74.0	75.0					9																	101594127		2203	4300	6503	SO:0001583	missense	0			AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.805G>A	9.37:g.101594127G>A	ENSP00000364150:p.Gly269Arg		Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G269R	ENST00000375011.3	37	c.805	CCDS6737.1	9	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998154	0.54147	.	.	ENSG00000119514	ENST00000375011	T	0.58506	0.33	5.72	5.72	0.89469	Glycosyl transferase, family 2 (1);	4.706910	0.00447	N	0.000084	T	0.75406	0.3845	L	0.47016	1.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.58244	-0.7670	10	0.20519	T	0.43	.	17.3708	0.87377	0.0:0.0:1.0:0.0	.	269	Q8IXK2	GLT12_HUMAN	R	269	ENSP00000364150:G269R	ENSP00000364150:G269R	G	+	1	0	GALNT12	100633948	1.000000	0.71417	1.000000	0.80357	0.612000	0.37316	7.927000	0.87577	2.709000	0.92574	0.561000	0.74099	GGG	GALNT12	-	pfam_Glyco_trans_2	ENSG00000119514		0.577	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	HGNC	protein_coding	OTTHUMT00000053382.1	-	0.00	107	0	G	NM_024642		101594127	+1	tier1	-	no_errors	ENST00000375011	ensembl	human	known	74_37	missense	84.71	24	133	SNP	1.000	A
GEN1	348654	genome.wustl.edu	37	2	17963086	17963086	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:17963086delT	ENST00000381254.2	+	14	2821	c.2607delT	c.(2605-2607)gatfs	p.D869fs	GEN1_ENST00000317402.7_Frame_Shift_Del_p.D869fs|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	869					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					GTTTCCCAGATTCAACAAAAA	0.368								Homologous recombination																																									0													41.0	43.0	43.0					2																	17963086		2203	4300	6503	SO:0001589	frameshift_variant	0			AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.2607delT	2.37:g.17963086delT	ENSP00000370653:p.Asp869fs		Q17RS9|Q6ZN37	Frame_Shift_Del	DEL	pfam_XPG-I_dom,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2	p.S870fs	ENST00000381254.2	37	c.2607	CCDS1691.1	2																																																																																			GEN1	-	NULL	ENSG00000178295		0.368	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GEN1	HGNC	protein_coding	OTTHUMT00000241661.2		0.00	103	0	T	NM_182625		17963086	+1	tier1		no_errors	ENST00000317402	ensembl	human	known	74_37	frame_shift_del	29.00	71	29	DEL	0.000	-
GOLGA8EP	390535	genome.wustl.edu	37	15	23436943	23436943	+	RNA	SNP	A	A	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:23436943A>C	ENST00000526079.1	+	0	149					NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		TCTGACAGTTAAAAGAATATT	0.443																																																	0																																												0					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23436943A>C				RNA	SNP	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			GOLGA8EP	-	-	ENSG00000175676		0.443	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8EP	HGNC	pseudogene	OTTHUMT00000393312.1	-	0.00	72	0	A	NR_033350.1		23436943	+1	tier1	-	no_errors	ENST00000526079	ensembl	human	known	74_37	rna	69.57	21	48	SNP	0.004	C
GPA33	10223	genome.wustl.edu	37	1	167042740	167042740	+	Missense_Mutation	SNP	G	G	T	rs187104315		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:167042740G>T	ENST00000367868.3	-	2	423	c.80C>A	c.(79-81)cCg>cAg	p.P27Q	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	27	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						AACGTCCTGCGGAGTTTCCAC	0.542																																																	0													94.0	75.0	81.0					1																	167042740		2203	4300	6503	SO:0001583	missense	0			U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.80C>A	1.37:g.167042740G>T	ENSP00000356842:p.Pro27Gln		Q5VZP6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.P27Q	ENST00000367868.3	37	c.80	CCDS1258.1	1	.	.	.	.	.	.	.	.	.	.	g	16.51	3.144709	0.57044	.	.	ENSG00000143167	ENST00000367868	T	0.66638	-0.22	5.26	4.35	0.52113	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.292594	0.38492	N	0.001663	T	0.67230	0.2871	M	0.80508	2.5	0.09310	N	1	P	0.45634	0.863	P	0.54312	0.748	T	0.64158	-0.6473	10	0.87932	D	0	.	10.081	0.42391	0.0931:0.0:0.9069:0.0	.	27	Q99795	GPA33_HUMAN	Q	27	ENSP00000356842:P27Q	ENSP00000356842:P27Q	P	-	2	0	GPA33	165309364	0.803000	0.28956	0.002000	0.10522	0.000000	0.00434	3.151000	0.50670	1.217000	0.43442	-0.119000	0.15052	CCG	GPA33	-	pfam_Ig_V-set,pfscan_Ig-like_dom	ENSG00000143167		0.542	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPA33	HGNC	protein_coding	OTTHUMT00000083245.1	-	0.00	58	0	G	NM_005814		167042740	-1	tier1	-	no_errors	ENST00000367868	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.005	T
GPR116	221395	genome.wustl.edu	37	6	46851853	46851853	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:46851853G>T	ENST00000283296.7	-	5	772	c.484C>A	c.(484-486)Cct>Act	p.P162T	GPR116_ENST00000362015.4_Missense_Mutation_p.P162T|GPR116_ENST00000478711.1_5'Flank|GPR116_ENST00000456426.2_Missense_Mutation_p.P162T|GPR116_ENST00000265417.7_Missense_Mutation_p.P162T	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	162					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			AGGCAAAAAGGTCCATTGGGA	0.493																																					NSCLC(59;410 1274 8751 36715 50546)												0													125.0	113.0	117.0					6																	46851853		2203	4300	6503	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.484C>A	6.37:g.46851853G>T	ENSP00000283296:p.Pro162Thr		O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.P162T	ENST00000283296.7	37	c.484	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434724	0.25813	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000265417	T;T;T;T	0.27256	1.74;2.11;1.68;1.74	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000016	T	0.33818	0.0876	L	0.58669	1.825	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.74674	0.984;0.953;0.984	T	0.02288	-1.1182	10	0.22109	T	0.4	-7.5711	14.5188	0.67838	0.0:0.0:1.0:0.0	.	162;162;162	A8K0D8;Q8IZF2-3;Q8IZF2	.;.;GP116_HUMAN	T	162	ENSP00000283296:P162T;ENSP00000354563:P162T;ENSP00000412866:P162T;ENSP00000265417:P162T	ENSP00000265417:P162T	P	-	1	0	GPR116	46959812	1.000000	0.71417	1.000000	0.80357	0.213000	0.24496	4.396000	0.59684	2.572000	0.86782	0.655000	0.94253	CCT	GPR116	-	prints_GPCR_2_Ig-hepta_rcpt	ENSG00000069122		0.493	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	-	0.00	48	0	G	NM_015234		46851853	-1	tier1	-	no_errors	ENST00000265417	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
GRID2	2895	genome.wustl.edu	37	4	94159522	94159522	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:94159522G>T	ENST00000282020.4	+	8	1384	c.1126G>T	c.(1126-1128)Ggt>Tgt	p.G376C	GRID2_ENST00000510992.1_Splice_Site_p.G281C	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	376					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCTCCTTTAGGGTGGAGTTAG	0.353																																																	0													73.0	73.0	73.0					4																	94159522		2203	4299	6502	SO:0001630	splice_region_variant	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1126-1G>T	4.37:g.94159522G>T			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G376C	ENST00000282020.4	37	c.1126	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	25.2	4.610899	0.87258	.	.	ENSG00000152208	ENST00000282020;ENST00000510992;ENST00000512631	D;D;D	0.83335	-1.71;-1.71;-1.71	6.03	6.03	0.97812	Extracellular ligand-binding receptor (1);	0.121322	0.53938	D	0.000051	D	0.88669	0.6499	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.86144	0.1583	9	.	.	.	.	20.1857	0.98214	0.0:0.0:1.0:0.0	.	281;376;281	E9PH24;O43424;Q4KKU8	.;GRID2_HUMAN;.	C	376;281;57	ENSP00000282020:G376C;ENSP00000421257:G281C;ENSP00000423331:G57C	.	G	+	1	0	GRID2	94378545	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.456000	0.73501	2.868000	0.98415	0.557000	0.71058	GGT	GRID2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000152208		0.353	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2		0.00	74	0	G		Missense_Mutation	94159522	+1			no_errors	ENST00000282020	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
GXYLT1	283464	genome.wustl.edu	37	12	42499824	42499824	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:42499824G>T	ENST00000398675.3	-	5	892	c.660C>A	c.(658-660)atC>atA	p.I220I	GXYLT1_ENST00000280876.6_Silent_p.I189I	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	220					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						GTAAAAAAAGGATATCAGTGT	0.323																																																	0													81.0	77.0	78.0					12																	42499824		1831	4091	5922	SO:0001819	synonymous_variant	0			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.660C>A	12.37:g.42499824G>T			B3KWJ2|Q8IXV1|Q96BH4	Silent	SNP	pfam_Glyco_trans_8	p.I220	ENST00000398675.3	37	c.660	CCDS41772.1	12																																																																																			GXYLT1	-	pfam_Glyco_trans_8	ENSG00000151233		0.323	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT1	HGNC	protein_coding	OTTHUMT00000403778.1	-	0.00	59	0	G	XM_290597		42499824	-1	tier1	-	no_errors	ENST00000398675	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.998	T
HERC2P3	283755	genome.wustl.edu	37	15	20613691	20613691	+	RNA	SNP	A	A	G	rs112355717	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:20613691A>G	ENST00000428453.1	-	0	4041							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TATCTTAATAATGAGAGGACC	0.373																																																	0																																												0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20613691A>G				RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.373	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	-	0.00	9	0	A	NG_008269		20613691	-1	tier1	rs112355717	no_errors	ENST00000430598	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.014	G
HGD	3081	genome.wustl.edu	37	3	120365828	120365828	+	Missense_Mutation	SNP	C	C	T	rs368256121		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:120365828C>T	ENST00000283871.5	-	8	1000	c.541G>A	c.(541-543)Gtc>Atc	p.V181I		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	181					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		ACCTGAATGACGCAGATCTCA	0.468																																																	0			GRCh37	CM002784	HGD	M		C	ILE/VAL	0,4406		0,0,2203	185.0	160.0	169.0		541	6.2	1.0	3		169	1,8591	1.2+/-3.3	0,1,4295	no	missense	HGD	NM_000187.3	29	0,1,6498	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	181/446	120365828	1,12997	2203	4296	6499	SO:0001583	missense	0				CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.541G>A	3.37:g.120365828C>T	ENSP00000283871:p.Val181Ile		A8K417|B2R8Z0	Missense_Mutation	SNP	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	p.V181I	ENST00000283871.5	37	c.541	CCDS3000.1	3	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006791	0.93287	0.0	1.16E-4	ENSG00000113924	ENST00000283871;ENST00000476082	D;D	0.99201	-5.55;-5.55	6.17	6.17	0.99709	Cupin, RmlC-type (1);	0.057046	0.64402	D	0.000001	D	0.97529	0.9191	L	0.56769	1.78	0.80722	D	1	P	0.38992	0.653	B	0.30316	0.114	D	0.97305	0.9933	10	0.45353	T	0.12	-13.3866	18.3732	0.90420	0.0:1.0:0.0:0.0	.	181	Q93099	HGD_HUMAN	I	181;140	ENSP00000283871:V181I;ENSP00000419560:V140I	ENSP00000283871:V181I	V	-	1	0	HGD	121848518	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.347000	0.65998	2.941000	0.99782	0.655000	0.94253	GTC	HGD	-	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	ENSG00000113924		0.468	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGD	HGNC	protein_coding	OTTHUMT00000355410.1	-	0.00	73	0	C			120365828	-1	tier1	-	no_errors	ENST00000283871	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
HORMAD2	150280	genome.wustl.edu	37	22	30572125	30572125	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:30572125C>A	ENST00000336726.6	+	11	1248	c.893C>A	c.(892-894)cCa>cAa	p.P298Q	HORMAD2_ENST00000403975.1_Missense_Mutation_p.P298Q	NM_152510.2	NP_689723.1	Q8N7B1	HORM2_HUMAN	HORMA domain containing 2	298					meiotic nuclear division (GO:0007126)|meiotic sister chromatid cohesion (GO:0051177)	chromosome (GO:0005694)|nucleus (GO:0005634)				large_intestine(1)|lung(1)	2			Epithelial(10;0.125)			GTCAGTGAACCAGTGAAGGTC	0.358																																																	0													91.0	90.0	91.0					22																	30572125		1861	4112	5973	SO:0001583	missense	0			AK098703	CCDS46683.1	22q12.2	2014-01-21			ENSG00000176635	ENSG00000176635			28383	protein-coding gene	gene with protein product						12477932	Standard	NM_152510		Approved	MGC26710, CT46.2	uc003agy.3	Q8N7B1	OTTHUMG00000150881	ENST00000336726.6:c.893C>A	22.37:g.30572125C>A	ENSP00000336984:p.Pro298Gln		B5MEB2|Q8NHR2	Missense_Mutation	SNP	pfam_HORMA_DNA-bd,superfamily_HORMA_DNA-bd,pfscan_HORMA_DNA-bd	p.P298Q	ENST00000336726.6	37	c.893	CCDS46683.1	22	.	.	.	.	.	.	.	.	.	.	C	15.23	2.772443	0.49680	.	.	ENSG00000176635	ENST00000336726;ENST00000403975	T;T	0.32023	1.47;1.47	5.86	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.36880	0.0983	N	0.24115	0.695	0.37190	D	0.903881	D	0.76494	0.999	D	0.66716	0.946	T	0.34900	-0.9810	10	0.72032	D	0.01	-5.7616	9.9085	0.41390	0.0:0.91:0.0:0.0899	.	298	Q8N7B1	HORM2_HUMAN	Q	298	ENSP00000336984:P298Q;ENSP00000385055:P298Q	ENSP00000336984:P298Q	P	+	2	0	HORMAD2	28902125	0.999000	0.42202	1.000000	0.80357	0.950000	0.60333	1.497000	0.35649	2.781000	0.95711	0.650000	0.86243	CCA	HORMAD2	-	NULL	ENSG00000176635		0.358	HORMAD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HORMAD2	HGNC	protein_coding	OTTHUMT00000320416.2	-	0.00	89	0	C	NM_152510		30572125	+1	tier1	-	no_errors	ENST00000336726	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	A
HSPB3	8988	genome.wustl.edu	37	5	53751911	53751911	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr5:53751911G>T	ENST00000302005.1	+	1	467	c.292G>T	c.(292-294)Gca>Tca	p.A98S		NM_006308.2	NP_006299.1	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	98					cell death (GO:0008219)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|large_intestine(4)|prostate(3)	8		Lung NSC(810;0.00104)				GCTGATAAAAGCACAACACGG	0.483																																																	0													122.0	113.0	116.0					5																	53751911		2203	4300	6503	SO:0001583	missense	0			Y17782	CCDS3961.1	5q11.2	2011-09-02	2002-08-29		ENSG00000169271	ENSG00000169271		"""Heat shock proteins / HSPB"""	5248	protein-coding gene	gene with protein product		604624	"""heat shock 27kD protein 3"""			8972725, 9858786	Standard	NM_006308		Approved	HSPL27	uc003jph.2	Q12988	OTTHUMG00000096995	ENST00000302005.1:c.292G>T	5.37:g.53751911G>T	ENSP00000303394:p.Ala98Ser			Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.A98S	ENST00000302005.1	37	c.292	CCDS3961.1	5	.	.	.	.	.	.	.	.	.	.	G	17.78	3.472420	0.63737	.	.	ENSG00000169271	ENST00000302005	D	0.91740	-2.9	5.67	5.67	0.87782	Heat shock protein Hsp20 (2);HSP20-like chaperone (1);	0.068270	0.56097	D	0.000039	D	0.95768	0.8623	M	0.71920	2.185	0.45791	D	0.998679	D	0.69078	0.997	D	0.68353	0.957	D	0.95804	0.8835	10	0.87932	D	0	-16.3835	19.7612	0.96319	0.0:0.0:1.0:0.0	.	98	Q12988	HSPB3_HUMAN	S	98	ENSP00000303394:A98S	ENSP00000303394:A98S	A	+	1	0	HSPB3	53787668	1.000000	0.71417	0.373000	0.26003	0.047000	0.14425	7.692000	0.84203	2.646000	0.89796	0.655000	0.94253	GCA	HSPB3	-	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom	ENSG00000169271		0.483	HSPB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB3	HGNC	protein_coding	OTTHUMT00000214074.2	-	0.00	58	0	G			53751911	+1	tier1	-	no_errors	ENST00000302005	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
HSPH1	10808	genome.wustl.edu	37	13	31725823	31725823	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:31725823G>T	ENST00000320027.5	-	6	930	c.586C>A	c.(586-588)Cgg>Agg	p.R196R	HSPH1_ENST00000429785.2_Intron|HSPH1_ENST00000380405.4_Silent_p.R196R|HSPH1_ENST00000445273.2_Silent_p.R198R|HSPH1_ENST00000380406.5_Silent_p.R155R	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	196					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		ACCACTATCCGAGGTTTCTCA	0.358																																																	0													79.0	74.0	76.0					13																	31725823		2203	4300	6503	SO:0001819	synonymous_variant	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.586C>A	13.37:g.31725823G>T			B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.R198	ENST00000320027.5	37	c.592	CCDS9340.1	13																																																																																			HSPH1	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000120694		0.358	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1		0.00	70	0	G			31725823	-1			no_errors	ENST00000445273	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.998	T
ITGA7	3679	genome.wustl.edu	37	12	56080031	56080031	+	Intron	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:56080031G>A	ENST00000555728.1	-	26	3344				ITGA7_ENST00000452168.2_Intron|ITGA7_ENST00000394229.2_Missense_Mutation_p.A1084V|ITGA7_ENST00000553804.1_Intron|ITGA7_ENST00000394230.2_Missense_Mutation_p.A1088V|ITGA7_ENST00000257879.6_Intron|ITGA7_ENST00000347027.6_Intron|ITGA7_ENST00000257880.7_Missense_Mutation_p.A1128V			Q13683	ITA7_HUMAN	integrin, alpha 7						blood vessel morphogenesis (GO:0048514)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|regulation of cell shape (GO:0008360)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integrin alpha7-beta1 complex (GO:0034677)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(16)|ovary(2)|prostate(2)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						AGGCTGCACAGCCAGACAGGC	0.547																																																	0													26.0	23.0	24.0					12																	56080031		876	1991	2867	SO:0001627	intron_variant	0				CCDS8888.1, CCDS44914.1, CCDS55832.1	12q13	2014-09-17				ENSG00000135424		"""Integrins"""	6143	protein-coding gene	gene with protein product		600536				7607681	Standard	NM_002206		Approved		uc001shh.3	Q13683		ENST00000555728.1:c.3316-959C>T	12.37:g.56080031G>A			B4E3U0|C9JMD3|C9JMZ6|O43197|Q86W93|Q9NY89|Q9UET0|Q9UEV2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.A1128V	ENST00000555728.1	37	c.3383		12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.168355	0.78339	.	.	ENSG00000135424	ENST00000257880;ENST00000394230;ENST00000394229;ENST00000353687;ENST00000557555	T;T;T	0.72051	-0.62;-0.62;-0.62	5.47	5.47	0.80525	.	.	.	.	.	T	0.69566	0.3125	.	.	.	0.24242	N	0.995357	.	.	.	.	.	.	T	0.62001	-0.6946	6	0.34782	T	0.22	.	12.5387	0.56156	0.0:0.1677:0.8323:0.0	.	.	.	.	V	1128;1088;1084;957;114	ENSP00000257880:A1128V;ENSP00000377777:A1088V;ENSP00000377776:A1084V	ENSP00000257880:A1128V	A	-	2	0	ITGA7	54366298	0.999000	0.42202	0.989000	0.46669	0.989000	0.77384	2.763000	0.47605	2.580000	0.87095	0.561000	0.74099	GCT	ITGA7	-	NULL	ENSG00000135424		0.547	ITGA7-014	KNOWN	basic	protein_coding	ITGA7	HGNC	protein_coding	OTTHUMT00000410138.1	-	0.00	58	0	G	NM_002206		56080031	-1	tier1	-	no_errors	ENST00000257880	ensembl	human	known	74_37	missense	32.14	56	27	SNP	1.000	A
ITGB1BP2	26548	genome.wustl.edu	37	X	70523687	70523687	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:70523687A>T	ENST00000373829.3	+	8	638	c.565A>T	c.(565-567)Atc>Ttc	p.I189F	ITGB1BP2_ENST00000465388.1_3'UTR|ITGB1BP2_ENST00000538820.1_Missense_Mutation_p.I171F	NM_012278.1	NP_036410.1	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein (melusin) 2	189	CHORD 2. {ECO:0000255|PROSITE- ProRule:PRU00734}.|Cys-rich.				muscle organ development (GO:0007517)|signal transduction (GO:0007165)	Z disc (GO:0030018)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)	14	Renal(35;0.156)					CTGTTGTGGCATCCAGACCCT	0.468																																																	0													52.0	47.0	49.0					X																	70523687		2203	4300	6503	SO:0001583	missense	0			AF140690	CCDS14411.1	Xq12.1-q13	2008-02-05			ENSG00000147166	ENSG00000147166			6154	protein-coding gene	gene with protein product		300332				10506186	Standard	XM_005262255		Approved	CHORDC3	uc004dzr.1	Q9UKP3	OTTHUMG00000021793	ENST00000373829.3:c.565A>T	X.37:g.70523687A>T	ENSP00000362935:p.Ile189Phe		Q32N04|Q549J7	Missense_Mutation	SNP	pfam_CHORD,pfam_CS_dom,superfamily_HSP20-like_chaperone,pfscan_CS_dom	p.I189F	ENST00000373829.3	37	c.565	CCDS14411.1	X	.	.	.	.	.	.	.	.	.	.	a	16.18	3.051160	0.55218	.	.	ENSG00000147166	ENST00000373829;ENST00000538820	.	.	.	5.17	3.98	0.46160	Cysteine/histidine-rich domain (2);	0.162160	0.52532	D	0.000067	T	0.67040	0.2851	L	0.59436	1.845	0.58432	D	0.999991	D;D	0.71674	0.993;0.998	P;D	0.72338	0.896;0.977	T	0.68157	-0.5483	9	0.59425	D	0.04	-7.2577	6.7293	0.23375	0.891:0.0:0.109:0.0	.	171;189	Q32N04;Q9UKP3	.;ITBP2_HUMAN	F	189;171	.	ENSP00000362935:I189F	I	+	1	0	ITGB1BP2	70440412	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	2.643000	0.46604	1.894000	0.54839	0.486000	0.48141	ATC	ITGB1BP2	-	pfam_CHORD	ENSG00000147166		0.468	ITGB1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB1BP2	HGNC	protein_coding	OTTHUMT00000057126.1	-	0.00	17	0	A	NM_012278		70523687	+1	tier1	-	no_errors	ENST00000373829	ensembl	human	known	74_37	missense	85.71	4	24	SNP	1.000	T
JMY	133746	genome.wustl.edu	37	5	78573804	78573804	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr5:78573804C>A	ENST00000396137.4	+	2	1566	c.1104C>A	c.(1102-1104)gcC>gcA	p.A368A		NM_152405.4	NP_689618.4	Q8N9B5	JMY_HUMAN	junction mediating and regulatory protein, p53 cofactor	368					'de novo' actin filament nucleation (GO:0070060)|actin polymerization-dependent cell motility (GO:0070358)|Arp2/3 complex-mediated actin nucleation (GO:0034314)|cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of apoptotic process (GO:0043065)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			endometrium(4)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|urinary_tract(1)	16		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;4.45e-45)|Epithelial(54;5.85e-40)|all cancers(79;2.89e-35)		AGGATGAAGCCTACAGCAGCC	0.458																																																	0													119.0	114.0	116.0					5																	78573804		1922	4132	6054	SO:0001819	synonymous_variant	0			AK095189	CCDS4047.3	5q14.1	2010-03-23			ENSG00000152409	ENSG00000152409			28916	protein-coding gene	gene with protein product		604279				10518217	Standard	NM_152405		Approved	FLJ37870	uc003kfx.4	Q8N9B5	OTTHUMG00000131301	ENST00000396137.4:c.1104C>A	5.37:g.78573804C>A			A1L4P5|B5MDS2|B5MDT0	Silent	SNP	pfscan_WH2_dom	p.A368	ENST00000396137.4	37	c.1104	CCDS4047.3	5																																																																																			JMY	-	NULL	ENSG00000152409		0.458	JMY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JMY	HGNC	protein_coding	OTTHUMT00000254070.4	-	0.00	62	0	C	NM_152405		78573804	+1	tier1	-	no_errors	ENST00000396137	ensembl	human	known	74_37	silent	71.70	15	38	SNP	0.995	A
KANK1	23189	genome.wustl.edu	37	9	711982	711982	+	Nonsense_Mutation	SNP	G	G	T	rs147714853		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:711982G>T	ENST00000382303.1	+	7	1868	c.1216G>T	c.(1216-1218)Gag>Tag	p.E406*	KANK1_ENST00000382293.3_Nonsense_Mutation_p.E248*|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382297.2_Nonsense_Mutation_p.E406*	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	406	Interaction with KIF21A.				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TGTGGGTGCCGAGGAGAACAT	0.562																																																	0													98.0	76.0	84.0					9																	711982		2203	4300	6503	SO:0001587	stop_gained	0			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.1216G>T	9.37:g.711982G>T	ENSP00000371740:p.Glu406*		A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E406*	ENST00000382303.1	37	c.1216	CCDS34976.1	9	.	.	.	.	.	.	.	.	.	.	G	44	10.791565	0.99468	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	.	.	.	5.73	2.92	0.33932	.	0.203425	0.34223	N	0.004156	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	1.4239	10.5887	0.45298	0.2094:0.0:0.7906:0.0	.	.	.	.	X	406;406;406;248	.	ENSP00000346479:E406X	E	+	1	0	KANK1	701982	0.998000	0.40836	0.011000	0.14972	0.854000	0.48673	2.584000	0.46102	0.364000	0.24374	0.655000	0.94253	GAG	KANK1	-	NULL	ENSG00000107104		0.562	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2		0.00	54	0	G	NM_015158		711982	+1			no_errors	ENST00000382297	ensembl	human	known	74_37	nonsense	11.54	23	3	SNP	0.966	T
KCNH7	90134	genome.wustl.edu	37	2	163279955	163279955	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:163279955C>T	ENST00000332142.5	-	9	2144	c.2045G>A	c.(2044-2046)cGa>cAa	p.R682Q	KCNH7_ENST00000328032.4_Missense_Mutation_p.R675Q	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	682					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)	p.R682Q(1)		NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CTCTTTTACTCGCAGCATCTG	0.448																																					GBM(196;1492 2208 17507 24132 45496)												1	Substitution - Missense(1)	skin(1)											219.0	204.0	209.0					2																	163279955		2203	4300	6503	SO:0001583	missense	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2045G>A	2.37:g.163279955C>T	ENSP00000331727:p.Arg682Gln		Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.R682Q	ENST00000332142.5	37	c.2045	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.323299	0.95708	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.96522	-4.04;-4.04	5.95	5.07	0.68467	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.97760	0.9265	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.91635	0.999;0.848	D	0.97612	1.0130	10	0.54805	T	0.06	.	15.5679	0.76309	0.0:0.9331:0.0:0.0669	.	675;682	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	Q	682;675	ENSP00000331727:R682Q;ENSP00000333781:R675Q	ENSP00000333781:R675Q	R	-	2	0	KCNH7	162988201	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	6.084000	0.71335	2.824000	0.97209	0.655000	0.94253	CGA	KCNH7	-	superfamily_cNMP-bd-like	ENSG00000184611		0.448	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1	-	0.00	114	0	C	NM_033272		163279955	-1	tier1	-	no_errors	ENST00000332142	ensembl	human	known	74_37	missense	31.78	88	41	SNP	1.000	T
KEL	3792	genome.wustl.edu	37	7	142639595	142639595	+	Missense_Mutation	SNP	G	G	A	rs370938244		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:142639595G>A	ENST00000355265.2	-	18	2437	c.1963C>T	c.(1963-1965)Cgg>Tgg	p.R655W		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	655					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.R655W(1)		central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CCATGGTGCCGTAACAGCCTC	0.597																																																	1	Substitution - Missense(1)	large_intestine(1)						G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	59.0	40.0	46.0		1963	-8.7	0.0	7		46	0,8600		0,0,4300	no	missense	KEL	NM_000420.2	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	655/733	142639595	1,13005	2203	4300	6503	SO:0001583	missense	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1963C>T	7.37:g.142639595G>A	ENSP00000347409:p.Arg655Trp		B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.R655W	ENST00000355265.2	37	c.1963	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	G	6.176	0.400625	0.11696	2.27E-4	0.0	ENSG00000197993	ENST00000355265	D	0.90788	-2.73	4.34	-8.67	0.00863	Peptidase M13, neprilysin, C-terminal (1);	3.616020	0.01020	N	0.003977	T	0.82093	0.4962	L	0.33093	0.98	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.68842	-0.5302	10	0.44086	T	0.13	-22.5163	3.9028	0.09169	0.0966:0.2072:0.4197:0.2765	.	655	P23276	KELL_HUMAN	W	655	ENSP00000347409:R655W	ENSP00000347409:R655W	R	-	1	2	KEL	142349717	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.704000	0.00822	-3.552000	0.00142	-1.446000	0.01064	CGG	KEL	-	pfam_Peptidase_M13_C	ENSG00000197993		0.597	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2		0.00	71	0	G	NM_000420		142639595	-1			no_errors	ENST00000355265	ensembl	human	known	74_37	missense	7.50	37	3	SNP	0.000	A
KIF1C	10749	genome.wustl.edu	37	17	4907862	4907862	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:4907862G>T	ENST00000320785.5	+	12	1298	c.941G>T	c.(940-942)gGg>gTg	p.G314V		NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	314	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)	p.G314E(1)|p.G314A(1)		NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						CCATTCACAGGGGGGAACTCA	0.582																																					Melanoma(96;1023 1447 10250 19259 33730)												2	Substitution - Missense(2)	NS(1)|breast(1)											117.0	113.0	114.0					17																	4907862		2203	4300	6503	SO:0001630	splice_region_variant	0			U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.941-1G>T	17.37:g.4907862G>T			D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G314V	ENST00000320785.5	37	c.941	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495725	0.64186	.	.	ENSG00000129250	ENST00000320785	D	0.90620	-2.7	4.65	4.65	0.58169	Kinesin, motor domain (4);	.	.	.	.	D	0.96781	0.8949	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97732	1.0203	8	.	.	.	.	15.4327	0.75116	0.0:0.0:1.0:0.0	.	314	O43896	KIF1C_HUMAN	V	314	ENSP00000320821:G314V	.	G	+	2	0	KIF1C	4848586	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	9.443000	0.97568	2.596000	0.87737	0.467000	0.42956	GGG	KIF1C	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000129250		0.582	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1		0.00	26	0	G		Missense_Mutation	4907862	+1			no_errors	ENST00000320785	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
KLB	152831	genome.wustl.edu	37	4	39450067	39450067	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:39450067G>T	ENST00000257408.4	+	5	2993	c.2896G>T	c.(2896-2898)Ggc>Tgc	p.G966C		NM_175737.3	NP_783864.1	Q86Z14	KLOTB_HUMAN	klotho beta	966	Glycosyl hydrolase-1 2.				carbohydrate metabolic process (GO:0005975)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor binding (GO:0017134)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|skin(6)	29						CAGCAGCAGGGGCTTCCCTTT	0.393																																																	0													74.0	75.0	75.0					4																	39450067		2203	4300	6503	SO:0001583	missense	0			AB079373	CCDS3451.1	4p14	2008-02-05			ENSG00000134962	ENSG00000134962			15527	protein-coding gene	gene with protein product		611135					Standard	NM_175737		Approved		uc003gua.3	Q86Z14	OTTHUMG00000128577	ENST00000257408.4:c.2896G>T	4.37:g.39450067G>T	ENSP00000257408:p.Gly966Cys		Q2M3K8	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.G966C	ENST00000257408.4	37	c.2896	CCDS3451.1	4	.	.	.	.	.	.	.	.	.	.	G	20.4	3.985728	0.74589	.	.	ENSG00000134962	ENST00000257408	T	0.35973	1.28	5.78	5.78	0.91487	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.048077	0.85682	D	0.000000	T	0.65626	0.2709	M	0.81942	2.565	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68239	-0.5461	10	0.87932	D	0	-25.4888	20.0143	0.97474	0.0:0.0:1.0:0.0	.	957;966	B7ZL50;Q86Z14	.;KLOTB_HUMAN	C	966	ENSP00000257408:G966C	ENSP00000257408:G966C	G	+	1	0	KLB	39126462	1.000000	0.71417	0.965000	0.40720	0.533000	0.34776	7.396000	0.79891	2.740000	0.93945	0.313000	0.20887	GGC	KLB	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000134962		0.393	KLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLB	HGNC	protein_coding	OTTHUMT00000250429.1	-	0.00	74	0	G	NM_175737		39450067	+1	tier1	-	no_errors	ENST00000257408	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
KLK8	11202	genome.wustl.edu	37	19	51503963	51503963	+	Intron	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:51503963G>T	ENST00000600767.1	-	4	560				KLK8_ENST00000593490.1_Intron|KLK8_ENST00000347619.4_Intron|KLK8_ENST00000320838.5_Intron|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000391806.2_Missense_Mutation_p.L28M|KLK8_ENST00000291726.7_Intron|KLK9_ENST00000376832.4_Intron|KLK9_ENST00000250366.6_Intron|KLK8_ENST00000598195.1_5'Flank			O60259	KLK8_HUMAN	kallikrein-related peptidase 8						cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		AGGAGGTCCAGGCTTCCACAC	0.562																																																	0													59.0	60.0	60.0					19																	51503963		2203	4300	6503	SO:0001627	intron_variant	0			AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.71-124C>A	19.37:g.51503963G>T			Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L28M	ENST00000600767.1	37	c.82	CCDS12813.1	19	.	.	.	.	.	.	.	.	.	.	G	9.600	1.128437	0.21041	.	.	ENSG00000129455	ENST00000391806	D	0.88664	-2.41	3.91	-2.25	0.06888	.	.	.	.	.	T	0.72179	0.3428	N	0.08118	0	0.09310	N	0.999999	B	0.13145	0.007	B	0.09377	0.004	T	0.57802	-0.7748	9	0.37606	T	0.19	.	3.7119	0.08423	0.3412:0.0:0.4962:0.1626	.	28	O60259-2	.	M	28	ENSP00000375682:L28M	ENSP00000375682:L28M	L	-	1	2	KLK8	56195775	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.700000	0.05081	-0.368000	0.08040	0.561000	0.74099	CTG	KLK8	-	NULL	ENSG00000129455		0.562	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	HGNC	protein_coding	OTTHUMT00000465032.2		0.00	53	0	G	NM_007196		51503963	-1			no_errors	ENST00000391806	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
L2HGDH	79944	genome.wustl.edu	37	14	50750625	50750625	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:50750625C>G	ENST00000267436.4	-	5	1064	c.667G>C	c.(667-669)Gaa>Caa	p.E223Q	L2HGDH_ENST00000555423.1_Missense_Mutation_p.E223Q|L2HGDH_ENST00000555610.1_3'UTR|L2HGDH_ENST00000421284.3_Missense_Mutation_p.E223Q|L2HGDH_ENST00000261699.4_Missense_Mutation_p.E223Q			Q9H9P8	L2HDH_HUMAN	L-2-hydroxyglutarate dehydrogenase	223					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	2-hydroxyglutarate dehydrogenase activity (GO:0047545)			kidney(1)|large_intestine(4)|lung(3)|ovary(2)	10	all_epithelial(31;0.000599)|Breast(41;0.0102)					TTAGCCATTTCAATACCTTTT	0.418																																																	0													87.0	91.0	90.0					14																	50750625		2203	4300	6503	SO:0001583	missense	0				CCDS9698.1	14q22.1	2006-04-28	2005-05-25	2005-05-25	ENSG00000087299	ENSG00000087299	1.1.99.2		20499	protein-coding gene	gene with protein product	"""2-hydroxyglutarate dehydrogenase"""	609584	"""chromosome 14 open reading frame 160"""	C14orf160		16005139	Standard	NM_024884		Approved	FLJ12618	uc001wxu.3	Q9H9P8	OTTHUMG00000140289	ENST00000267436.4:c.667G>C	14.37:g.50750625C>G	ENSP00000267436:p.Glu223Gln		Q9BRR1	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.E223Q	ENST00000267436.4	37	c.667	CCDS9698.1	14	.	.	.	.	.	.	.	.	.	.	C	9.497	1.102165	0.20632	.	.	ENSG00000087299	ENST00000261699;ENST00000267436;ENST00000421284;ENST00000555423	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.43	2.48	0.30137	FAD dependent oxidoreductase (1);	0.580051	0.20585	N	0.089457	T	0.62380	0.2423	N	0.05554	-0.025	0.80722	D	1	B;B	0.19200	0.034;0.007	B;B	0.19666	0.026;0.016	T	0.49707	-0.8911	10	0.20519	T	0.43	-16.3461	6.6055	0.22724	0.0:0.5711:0.2181:0.2107	.	223;223	C9JVN9;Q9H9P8	.;L2HDH_HUMAN	Q	223	ENSP00000261699:E223Q;ENSP00000267436:E223Q;ENSP00000405559:E223Q;ENSP00000450494:E223Q	ENSP00000261699:E223Q	E	-	1	0	L2HGDH	49820375	0.998000	0.40836	1.000000	0.80357	0.825000	0.46686	0.513000	0.22770	0.788000	0.33755	0.455000	0.32223	GAA	L2HGDH	-	pfam_FAD-dep_OxRdtase	ENSG00000087299		0.418	L2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L2HGDH	HGNC	protein_coding	OTTHUMT00000276870.2	-	0.00	92	0	C	NM_024884		50750625	-1	tier1	-	no_errors	ENST00000267436	ensembl	human	known	74_37	missense	44.35	63	51	SNP	0.985	G
AL592284.1	0	genome.wustl.edu	37	1	144470114	144470114	+	Intron	SNP	C	C	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:144470114C>G	ENST00000538264.1	+	2	661				RP11-640M9.1_ENST00000437785.1_RNA|RP11-640M9.1_ENST00000421955.1_RNA|RP11-640M9.1_ENST00000443242.1_RNA|RP11-640M9.1_ENST00000428309.1_RNA|RP11-640M9.1_ENST00000429496.1_RNA|RP11-640M9.1_ENST00000454100.1_RNA|RP11-640M9.1_ENST00000430014.1_RNA|RP11-640M9.1_ENST00000444499.2_RNA																							CTTGGAAGTTCTGTTTGCACT	0.488																																																	0																																										SO:0001627	intron_variant	0																														ENST00000538264.1:c.622-50533C>G	1.37:g.144470114C>G				RNA	SNP	-	NULL	ENST00000538264.1	37	NULL		1																																																																																			RP11-640M9.1	-	-	ENSG00000236943		0.488	AL592284.1-201	NOVEL	basic|appris_principal	protein_coding	LOC101929438	Clone_based_vega_gene	protein_coding		-	0.00	124	0	C			144470114	-1	tier1	-	no_errors	ENST00000428309	ensembl	human	known	74_37	rna	66.37	37	75	SNP	0.007	G
LAMTOR2	28956	genome.wustl.edu	37	1	156027790	156027790	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:156027790C>A	ENST00000368305.4	+	3	391	c.253C>A	c.(253-255)Cga>Aga	p.R85R	LAMTOR2_ENST00000368304.5_Intron|LAMTOR2_ENST00000368302.3_Silent_p.R85R	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2	85					activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						AGCCATCACCCGAGTGGCCAA	0.577																																																	0													203.0	151.0	169.0					1																	156027790		2203	4300	6503	SO:0001819	synonymous_variant	0			BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.253C>A	1.37:g.156027790C>A			Q5VY97|Q5VY98|Q5VY99	Silent	SNP	pfam_Dynein_light-rel,smart_Dynein_light-rel	p.R85	ENST00000368305.4	37	c.253	CCDS1128.1	1																																																																																			LAMTOR2	-	pfam_Dynein_light-rel,smart_Dynein_light-rel	ENSG00000116586		0.577	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR2	HGNC	protein_coding	OTTHUMT00000046197.1		0.00	42	0	C	NM_014017		156027790	+1			no_errors	ENST00000368302	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.899	A
POTEG	404785	genome.wustl.edu	37	14	19563655	19563655	+	Intron	SNP	C	C	G	rs566021646	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:19563655C>G	ENST00000409832.3	+	5	1107				CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GTAGTTTTCGCGTGGCAGTGA	0.373																																																	0																																										SO:0001627	intron_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1055+114C>G	14.37:g.19563655C>G			A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			CTD-2311B13.5	-	-	ENSG00000258252		0.373	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	-	0.00	101	0	C	NM_001005356		19563655	-1	tier1	-	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	26.21	76	27	SNP	0.000	G
LOC643711	643711	genome.wustl.edu	37	12	98126279	98126279	+	RNA	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:98126279G>C	ENST00000550548.1	-	0	491					NR_077240.1																						AAAGTGCTTTGAGAAAGAGAT	0.453																																																	0																																												0																															12.37:g.98126279G>C				RNA	SNP	-	NULL	ENST00000550548.1	37	NULL		12																																																																																			RP11-1016B18.1	-	-	ENSG00000257501		0.453	RP11-1016B18.1-002	KNOWN	basic	processed_transcript	LOC643711	Clone_based_vega_gene	pseudogene	OTTHUMT00000407680.1		0.00	10	0	G			98126279	-1			no_errors	ENST00000550548	ensembl	human	known	74_37	rna	40.00	3	2	SNP	0.685	C
LOC645166	645166	genome.wustl.edu	37	2	91825042	91825042	+	RNA	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:91825042G>C	ENST00000609777.1	-	0	199																											ccagtacccagtgcaactgcc	0.468																																																	0																																												0																															2.37:g.91825042G>C				RNA	SNP	-	NULL	ENST00000609777.1	37	NULL		2																																																																																			AC027612.6	-	-	ENSG00000143429		0.468	AC027612.6-002	KNOWN	basic	processed_transcript	LOC654342	Clone_based_vega_gene	pseudogene	OTTHUMT00000471986.1	-	0.00	132	0	G			91825042	-1	tier1	-	no_errors	ENST00000608018	ensembl	human	known	74_37	rna	18.18	108	24	SNP	0.005	C
LPAR3	23566	genome.wustl.edu	37	1	85279550	85279550	+	Silent	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:85279550G>A	ENST00000440886.1	-	2	1079	c.1041C>T	c.(1039-1041)gtC>gtT	p.V347V	LPAR3_ENST00000370611.3_Silent_p.V347V|LPAR3_ENST00000491034.1_5'Flank			Q9UBY5	LPAR3_HUMAN	lysophosphatidic acid receptor 3	347					activation of MAPK activity (GO:0000187)|bleb assembly (GO:0032060)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|synaptic transmission (GO:0007268)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|urinary_tract(1)	24						TTTTATTGCAGACTGCACCTT	0.522																																																	0													98.0	89.0	92.0					1																	85279550		2203	4300	6503	SO:0001819	synonymous_variant	0			AF127138	CCDS700.1	1p22.3	2012-08-08	2008-04-11	2008-04-11	ENSG00000171517	ENSG00000171517		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	14298	protein-coding gene	gene with protein product		605106	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7"""	EDG7		10488122	Standard	NM_012152		Approved	LP-A3, Edg-7, RP4-678I3, HOFNH30, LPA3	uc009wcj.1	Q9UBY5	OTTHUMG00000009925	ENST00000440886.1:c.1041C>T	1.37:g.85279550G>A			A0AVA3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG7,prints_GPCR_Rhodpsn,prints_LPA_rcpt,prints_LPA_rcpt_EDG2,prints_Melcrt_ACTH_rcpt	p.V347	ENST00000440886.1	37	c.1041	CCDS700.1	1																																																																																			LPAR3	-	prints_LPA_rcpt_EDG7	ENSG00000171517		0.522	LPAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR3	HGNC	protein_coding	OTTHUMT00000027467.1	-	0.00	46	0	G	NM_012152		85279550	-1	tier1	-	no_errors	ENST00000370611	ensembl	human	known	74_37	silent	37.25	32	19	SNP	0.623	A
LRBA	987	genome.wustl.edu	37	4	151247051	151247051	+	Splice_Site	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:151247051C>A	ENST00000357115.3	-	50	7639		c.e50-1		LRBA_ENST00000535741.1_Splice_Site|LRBA_ENST00000507224.1_Splice_Site|LRBA_ENST00000510413.1_Splice_Site|LRBA_ENST00000503716.1_Splice_Site	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CTTCAACAGCCTGAAAAGGGC	0.463																																																	0													75.0	70.0	72.0					4																	151247051		2203	4300	6503	SO:0001630	splice_region_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.7396-1G>T	4.37:g.151247051C>A			Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Splice_Site	SNP	-	e49-1	ENST00000357115.3	37	c.7396-1	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	C	20.7	4.035913	0.75617	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000509835;ENST00000507224	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRBA	151466501	1.000000	0.71417	1.000000	0.80357	0.598000	0.36846	7.770000	0.85390	2.826000	0.97356	0.655000	0.94253	.	LRBA	-	-	ENSG00000198589		0.463	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	62	0	C		Intron	151247051	-1	tier1	-	no_errors	ENST00000357115	ensembl	human	known	74_37	splice_site	5.80	64	4	SNP	1.000	A
LRP5	4041	genome.wustl.edu	37	11	68181296	68181296	+	Silent	SNP	C	C	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:68181296C>G	ENST00000294304.7	+	12	2749	c.2643C>G	c.(2641-2643)ctC>ctG	p.L881L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	881	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACCGCACCCTCATCCAGGGCC	0.582																																																	0													90.0	79.0	83.0					11																	68181296		2200	4294	6494	SO:0001819	synonymous_variant	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2643C>G	11.37:g.68181296C>G			Q96TD6|Q9UES7|Q9UP66	Silent	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.L881	ENST00000294304.7	37	c.2643	CCDS8181.1	11																																																																																			LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt	ENSG00000162337		0.582	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1	-	0.00	32	0	C	NM_002335		68181296	+1	tier1	-	no_errors	ENST00000294304	ensembl	human	known	74_37	silent	25.42	44	15	SNP	0.998	G
MCOLN2	255231	genome.wustl.edu	37	1	85422175	85422175	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:85422175G>T	ENST00000370608.3	-	4	571	c.504C>A	c.(502-504)taC>taA	p.Y168*	MCOLN2_ENST00000284027.5_Nonsense_Mutation_p.Y140*|MCOLN2_ENST00000531325.1_5'UTR	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	168					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TCCCTTTCTTGTAATGCTGCT	0.383																																																	0													225.0	212.0	216.0					1																	85422175		2203	4300	6503	SO:0001587	stop_gained	0			AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.504C>A	1.37:g.85422175G>T	ENSP00000359640:p.Tyr168*		A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Nonsense_Mutation	SNP	pfam_PKD1_2_channel	p.Y168*	ENST00000370608.3	37	c.504	CCDS30762.1	1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.452721	0.63290	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	.	.	.	5.16	1.14	0.20703	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0744	10.4484	0.44507	0.2856:0.0:0.7144:0.0	.	.	.	.	X	168;140	.	ENSP00000284027:Y140X	Y	-	3	2	MCOLN2	85194763	1.000000	0.71417	0.999000	0.59377	0.280000	0.26924	0.955000	0.29188	0.289000	0.22422	0.650000	0.86243	TAC	MCOLN2	-	NULL	ENSG00000153898		0.383	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	MCOLN2	HGNC	protein_coding	OTTHUMT00000027567.2		0.00	59	0	G	NM_153259		85422175	-1			no_errors	ENST00000370608	ensembl	human	known	74_37	nonsense	6.33	74	5	SNP	1.000	T
MEF2C	4208	genome.wustl.edu	37	5	88119631	88119631	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr5:88119631G>A	ENST00000437473.2	-	0	392				MEF2C_ENST00000510942.1_De_novo_Start_InFrame|MEF2C_ENST00000504921.2_De_novo_Start_InFrame|MEF2C_ENST00000424173.2_De_novo_Start_InFrame|MEF2C_ENST00000514015.1_De_novo_Start_InFrame|MEF2C_ENST00000508569.1_De_novo_Start_InFrame|MEF2C_ENST00000539796.1_5'Flank|MEF2C_ENST00000514028.1_De_novo_Start_InFrame|MEF2C_ENST00000506554.1_De_novo_Start_InFrame|MEF2C_ENST00000340208.5_De_novo_Start_InFrame	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		TCTCTCTCTCGTCCCTGAAAT	0.393										HNSCC(66;0.2)																																							0													251.0	247.0	248.0					5																	88119631		1828	4077	5905			0			AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634		5.37:g.88119631G>A			C9JMZ0|D7F7N5|F8W7V7	RNA	SNP	-	NULL	ENST00000437473.2	37	NULL	CCDS47245.1	5																																																																																			MEF2C	-	-	ENSG00000081189		0.393	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	-	0.00	41	0	G	NM_002397		88119631	-1	tier1	-	no_errors	ENST00000515093	ensembl	human	known	74_37	rna	59.38	13	19	SNP	1.000	A
MEGF10	84466	genome.wustl.edu	37	5	126792991	126792991	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr5:126792991G>A	ENST00000274473.6	+	26	3671	c.3404G>A	c.(3403-3405)aGc>aAc	p.S1135N	MEGF10_ENST00000503335.2_Missense_Mutation_p.S1135N	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	1135	Necessary for formation of large intracellular vacuoles.|Ser-rich.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		agcagcaacagcagcagcagc	0.512																																																	0													71.0	59.0	63.0					5																	126792991		2203	4300	6503	SO:0001583	missense	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.3404G>A	5.37:g.126792991G>A	ENSP00000274473:p.Ser1135Asn		Q68DE5|Q8WUL3	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.S1135N	ENST00000274473.6	37	c.3404	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290530	0.23564	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.80738	-1.41;-1.41	4.95	4.95	0.65309	.	0.257682	0.28016	N	0.016930	T	0.60314	0.2259	N	0.08118	0	0.09310	N	1	B	0.23650	0.089	B	0.16722	0.016	T	0.47761	-0.9092	10	0.30854	T	0.27	-4.6999	8.9521	0.35796	0.0:0.1456:0.6043:0.2501	.	1135	Q96KG7	MEG10_HUMAN	N	1135	ENSP00000423354:S1135N;ENSP00000274473:S1135N	ENSP00000274473:S1135N	S	+	2	0	MEGF10	126820890	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	2.337000	0.43947	2.679000	0.91253	0.650000	0.86243	AGC	MEGF10	-	NULL	ENSG00000145794		0.512	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2		0.00	47	0	G	NM_032446		126792991	+1			no_errors	ENST00000274473	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.251	A
MEGF11	84465	genome.wustl.edu	37	15	66274821	66274821	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:66274821C>T	ENST00000409699.2	-	6	572	c.400G>A	c.(400-402)Gac>Aac	p.D134N	MEGF11_ENST00000395625.2_Missense_Mutation_p.D59N|MEGF11_ENST00000360698.4_Missense_Mutation_p.D134N|MEGF11_ENST00000288745.3_Missense_Mutation_p.D59N|MEGF11_ENST00000422354.1_Missense_Mutation_p.D134N|MEGF11_ENST00000395614.1_5'UTR			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	134					homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						TGGTCGCTGTCGCAGCCTGCA	0.677																																																	0													5.0	7.0	6.0					15																	66274821		2003	4158	6161	SO:0001583	missense	0			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.400G>A	15.37:g.66274821C>T	ENSP00000386908:p.Asp134Asn		Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.D134N	ENST00000409699.2	37	c.400	CCDS10213.2	15	.	.	.	.	.	.	.	.	.	.	C	16.82	3.228423	0.58777	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	3.73	2.8	0.32819	.	0.449704	0.16978	U	0.191806	T	0.32763	0.0840	L	0.43646	1.37	0.37432	D	0.914062	D;D	0.61080	0.982;0.989	P;P	0.57468	0.677;0.821	T	0.12708	-1.0537	10	0.27082	T	0.32	.	10.0526	0.42225	0.0:0.8979:0.0:0.1021	.	134;59	A6BM72;A6BM72-2	MEG11_HUMAN;.	N	134;59;134;59;134	ENSP00000386908:D134N;ENSP00000288745:D59N;ENSP00000414475:D134N;ENSP00000378987:D59N;ENSP00000353919:D134N	ENSP00000288745:D59N	D	-	1	0	MEGF11	64061875	1.000000	0.71417	0.995000	0.50966	0.110000	0.19582	7.509000	0.81698	0.775000	0.33450	-0.291000	0.09656	GAC	MEGF11	-	NULL	ENSG00000157890		0.677	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2		0.00	10	0	C	NM_032445		66274821	-1			no_errors	ENST00000409699	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
MINK1	50488	genome.wustl.edu	37	17	4790980	4790982	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:4790980_4790982delGCA	ENST00000355280.6	+	12	1321_1323	c.1125_1127delGCA	c.(1123-1128)ctgcag>ctg	p.Q380del	MINK1_ENST00000453408.3_In_Frame_Del_p.Q380del|MINK1_ENST00000347992.7_In_Frame_Del_p.Q380del	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						agcagcagctgcagcagcagcag	0.606																																																	0									,,,	70,3608		15,40,1784					,,,	-3.4	1.0			8	185,7549		42,101,3724	no	coding,coding,coding,coding	MINK1	NM_170663.4,NM_153827.4,NM_015716.4,NM_001024937.3	,,,	57,141,5508	A1A1,A1R,RR		2.392,1.9032,2.2345	,,,	,,,		255,11157				SO:0001651	inframe_deletion	0			AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.1125_1127delGCA	17.37:g.4790989_4790991delGCA	ENSP00000347427:p.Gln380del			In_Frame_Del	DEL	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.Q379in_frame_del	ENST00000355280.6	37	c.1125_1127	CCDS45588.1	17																																																																																			MINK1	-	NULL	ENSG00000141503		0.606	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000439801.1		0.00	41	0	GCA	NM_015716		4790982	+1	tier1		no_errors	ENST00000355280	ensembl	human	known	74_37	in_frame_del	11.11	24	3	DEL	0.999:1.000:1.000	-
UGCG	7357	genome.wustl.edu	37	9	114694384	114694384	+	Intron	DEL	A	A	-	rs542519537	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:114694384delA	ENST00000374279.3	+	8	1274				MIR4668_ENST00000582284.1_RNA	NM_003358.1	NP_003349.1	Q16739	CEGT_HUMAN	UDP-glucose ceramide glucosyltransferase						epidermis development (GO:0008544)|glucosylceramide biosynthetic process (GO:0006679)|glycosphingolipid biosynthetic process (GO:0006688)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ceramide glucosyltransferase activity (GO:0008120)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	12				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	TATTTGAGGGAAAAAAAAAAG	0.313																																																	0																																										SO:0001627	intron_variant	0			D50840	CCDS6782.1	9q31	2014-03-13			ENSG00000148154	ENSG00000148154	2.4.1.80	"""Glycosyltransferase family 2 domain containing"""	12524	protein-coding gene	gene with protein product	"""glucosylceramide synthase"", ""ceramide glucosyltransferase"""	602874				8643456, 9605861	Standard	NM_003358		Approved	GCS	uc004bft.3	Q16739	OTTHUMG00000020498	ENST00000374279.3:c.825-66A>-	9.37:g.114694384delA			Q5T258	RNA	DEL	-	NULL	ENST00000374279.3	37	NULL	CCDS6782.1	9																																																																																			MIR4668	-	-	ENSG00000266315		0.313	UGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR4668	HGNC	protein_coding	OTTHUMT00000053661.1		0.00	35	0	A	NM_003358		114694384	+1	tier1		no_errors	ENST00000582284	ensembl	human	known	74_37	rna	12.96	47	7	DEL	0.000	-
MLLT1	4298	genome.wustl.edu	37	19	6222274	6222274	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:6222274G>A	ENST00000252674.7	-	6	1131	c.968C>T	c.(967-969)tCc>tTc	p.S323F		NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	323	Poly-Ser.				negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						GTCCGAGAAGGAGGAGGAGGA	0.652			T	MLL	AL																																			Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	0													35.0	36.0	35.0					19																	6222274		2202	4300	6502	SO:0001583	missense	0				CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.968C>T	19.37:g.6222274G>A	ENSP00000252674:p.Ser323Phe		Q14768	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.S323F	ENST00000252674.7	37	c.968	CCDS12160.1	19	.	.	.	.	.	.	.	.	.	.	G	3.673	-0.067162	0.07273	.	.	ENSG00000130382	ENST00000252674	.	.	.	.	.	.	.	0.242221	0.35151	U	0.003418	T	0.24198	0.0586	M	0.62723	1.935	0.26994	N	0.965076	P	0.40144	0.704	B	0.23419	0.046	T	0.20605	-1.0270	7	0.72032	D	0.01	-25.4423	.	.	.	.	323	Q03111	ENL_HUMAN	F	323	.	ENSP00000252674:S323F	S	-	2	0	MLLT1	6173274	0.997000	0.39634	0.882000	0.34594	0.704000	0.40688	0.089000	0.15002	0.088000	0.17205	0.089000	0.15464	TCC	MLLT1	-	NULL	ENSG00000130382		0.652	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLLT1	HGNC	protein_coding	OTTHUMT00000452909.1	-	0.00	56	0	G	NM_005934		6222274	-1	tier1	-	no_errors	ENST00000252674	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.456	A
MIR520D	574482	genome.wustl.edu	37	19	54224390	54224390	+	RNA	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:54224390G>A	ENST00000385002.1	+	0	87				MIR517B_ENST00000385102.1_RNA|RNU6-803P_ENST00000516034.1_RNA|MIR520G_ENST00000385064.1_RNA	NR_030204.1				microRNA 520d																		TCCCTTTAGAGTGTTACTGTT	0.438																																																	0													222.0	193.0	202.0					19																	54224390		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207735	ENSG00000207735		"""ncRNAs / Micro RNAs"""	32114	non-coding RNA	RNA, micro				MIRN520D			Standard	NR_030204		Approved	hsa-mir-520d	uc021vah.1				19.37:g.54224390G>A				RNA	SNP	-	NULL	ENST00000385002.1	37	NULL		19																																																																																			MIR517B	-	-	ENSG00000207837		0.438	MIR520D-201	KNOWN	basic	miRNA	MIR517B	HGNC	miRNA		-	0.00	204	0	G	NR_030204		54224390	+1	tier1	-	no_errors	ENST00000385102	ensembl	human	known	74_37	rna	51.13	65	68	SNP	0.004	A
MPHOSPH8	54737	genome.wustl.edu	37	13	20237216	20237216	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:20237216G>T	ENST00000361479.5	+	9	2037	c.1969G>T	c.(1969-1971)Gga>Tga	p.G657*	MPHOSPH8_ENST00000414242.2_Nonsense_Mutation_p.G657*	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	657					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		TTTGGAAGCAGGAGCTTTTGT	0.373																																																	0													126.0	131.0	129.0					13																	20237216		2203	4300	6503	SO:0001587	stop_gained	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.1969G>T	13.37:g.20237216G>T	ENSP00000355388:p.Gly657*		B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.G657*	ENST00000361479.5	37	c.1969	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.162857	0.97338	.	.	ENSG00000196199	ENST00000414242;ENST00000361479	.	.	.	5.33	4.48	0.54585	.	0.111123	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.9377	0.64034	0.0734:0.0:0.9266:0.0	.	.	.	.	X	657	.	ENSP00000355388:G657X	G	+	1	0	MPHOSPH8	19135216	1.000000	0.71417	0.870000	0.34147	0.467000	0.32768	9.121000	0.94375	1.239000	0.43787	0.555000	0.69702	GGA	MPHOSPH8	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196199		0.373	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	-	0.00	63	0	G	NM_017520		20237216	+1	tier1	-	no_errors	ENST00000414242	ensembl	human	known	74_37	nonsense	6.78	55	4	SNP	0.998	T
MPP7	143098	genome.wustl.edu	37	10	28348649	28348649	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:28348649G>T	ENST00000375732.1	-	14	1487	c.1228C>A	c.(1228-1230)Cag>Aag	p.Q410K	MPP7_ENST00000375719.3_Missense_Mutation_p.Q410K|MPP7_ENST00000540098.1_Missense_Mutation_p.Q410K|MPP7_ENST00000337532.5_Missense_Mutation_p.Q410K|MPP7_ENST00000445954.2_Missense_Mutation_p.Q285K			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	410	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						TCACTCTCCTGGCTTCTTCTT	0.348																																																	0													110.0	106.0	107.0					10																	28348649		2203	4299	6502	SO:0001583	missense	0			BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.1228C>A	10.37:g.28348649G>T	ENSP00000364884:p.Gln410Lys		B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_SH3_domain	p.Q410K	ENST00000375732.1	37	c.1228	CCDS7158.1	10	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191442	0.78902	.	.	ENSG00000150054	ENST00000375732;ENST00000337532;ENST00000540098;ENST00000375719;ENST00000441595;ENST00000445954	T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36	5.51	5.51	0.81932	Guanylate kinase/L-type calcium channel (1);Guanylate kinase, conserved site (1);Guanylate kinase (2);	0.112905	0.64402	D	0.000009	T	0.21590	0.0520	N	0.21142	0.635	0.80722	D	1	P	0.41848	0.763	P	0.49421	0.61	T	0.01791	-1.1273	10	0.27082	T	0.32	.	19.4309	0.94765	0.0:0.0:1.0:0.0	.	410	Q5T2T1	MPP7_HUMAN	K	410;410;410;410;171;285	ENSP00000364884:Q410K;ENSP00000337907:Q410K;ENSP00000438693:Q410K;ENSP00000364871:Q410K;ENSP00000398319:Q171K;ENSP00000405397:Q285K	ENSP00000337907:Q410K	Q	-	1	0	MPP7	28388655	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.592000	0.87571	0.650000	0.86243	CAG	MPP7	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like	ENSG00000150054		0.348	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPP7	HGNC	protein_coding	OTTHUMT00000047345.1	-	0.00	65	0	G	NM_173496		28348649	-1	tier1	-	no_errors	ENST00000337532	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	T
MTTP	4547	genome.wustl.edu	37	4	100534268	100534268	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:100534268G>T	ENST00000265517.5	+	15	2391	c.2188G>T	c.(2188-2190)Gga>Tga	p.G730*	MTTP_ENST00000457717.1_Nonsense_Mutation_p.G730*|MTTP_ENST00000511045.1_Nonsense_Mutation_p.G757*|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	730					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGTGGTGAAAGGACTTATTCT	0.403																																																	0													127.0	115.0	119.0					4																	100534268		2203	4300	6503	SO:0001587	stop_gained	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2188G>T	4.37:g.100534268G>T	ENSP00000265517:p.Gly730*		A8K428|Q08AM4|Q6P5T3	Nonsense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.G730*	ENST00000265517.5	37	c.2188	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	G	42	9.679725	0.99237	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	.	.	.	5.49	5.49	0.81192	.	0.048648	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-6.5376	19.349	0.94376	0.0:0.0:1.0:0.0	.	.	.	.	X	757;730;730	.	ENSP00000265517:G730X	G	+	1	0	MTTP	100753291	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.307000	0.96226	2.581000	0.87130	0.585000	0.79938	GGA	MTTP	-	NULL	ENSG00000138823		0.403	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3		0.00	41	0	G			100534268	+1			no_errors	ENST00000265517	ensembl	human	known	74_37	nonsense	6.38	44	3	SNP	1.000	T
MTX2	10651	genome.wustl.edu	37	2	177162615	177162615	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:177162615G>T	ENST00000249442.6	+	3	338	c.127G>T	c.(127-129)Gca>Tca	p.A43S	MTX2_ENST00000392529.2_Missense_Mutation_p.A33S|MTX2_ENST00000443241.1_Intron	NM_006554.4	NP_006545.1	O75431	MTX2_HUMAN	metaxin 2	43					cellular protein metabolic process (GO:0044267)|mitochondrial transport (GO:0006839)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			AGCTTCTCTTGCAGTGCAGGT	0.323																																																	0													60.0	62.0	62.0					2																	177162615		2201	4298	6499	SO:0001583	missense	0			AF053551	CCDS2272.1	2q31.1	2012-02-07			ENSG00000128654	ENSG00000128654			7506	protein-coding gene	gene with protein product		608555				10381257, 17624330	Standard	NM_006554		Approved		uc002ukx.3	O75431	OTTHUMG00000132514	ENST00000249442.6:c.127G>T	2.37:g.177162615G>T	ENSP00000249442:p.Ala43Ser		A8JZZ4|Q53S50|Q53SQ2|Q5M7Z6|Q8IZ68	Missense_Mutation	SNP	pfam_Sam37/metaxin,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.A43S	ENST00000249442.6	37	c.127	CCDS2272.1	2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135685	0.77662	.	.	ENSG00000128654	ENST00000249442;ENST00000392529;ENST00000452865	T;T;T	0.14144	2.53;2.53;2.53	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.27384	0.0672	L	0.54323	1.7	0.80722	D	1	P;P	0.46706	0.883;0.724	P;B	0.52554	0.702;0.19	T	0.00095	-1.2077	10	0.27082	T	0.32	-31.1573	20.244	0.98389	0.0:0.0:1.0:0.0	.	43;33	O75431;Q8IZ68	MTX2_HUMAN;.	S	43;33;43	ENSP00000249442:A43S;ENSP00000376314:A33S;ENSP00000398757:A43S	ENSP00000249442:A43S	A	+	1	0	MTX2	176870861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.603000	0.82811	2.865000	0.98341	0.655000	0.94253	GCA	MTX2	-	pfam_Sam37/metaxin,superfamily_Thioredoxin-like_fold	ENSG00000128654		0.323	MTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTX2	HGNC	protein_coding	OTTHUMT00000255695.4	-	0.00	71	0	G	NM_006554		177162615	+1	tier1	-	no_errors	ENST00000249442	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
MUC2	4583	genome.wustl.edu	37	11	1085807	1085807	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:1085807G>T	ENST00000441003.2	+	21	2755	c.2728G>T	c.(2728-2730)Ggc>Tgc	p.G910C	MUC2_ENST00000359061.5_Missense_Mutation_p.G910C	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	910	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CGTCCCCTGTGGCACTACGGG	0.642																																																	0													94.0	101.0	99.0					11																	1085807		2115	4225	6340	SO:0001583	missense	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.2728G>T	11.37:g.1085807G>T	ENSP00000415183:p.Gly910Cys		Q14878	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G910C	ENST00000441003.2	37	c.2728		11	.	.	.	.	.	.	.	.	.	.	g	15.87	2.961628	0.53400	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.61158	0.13;0.13	3.69	3.69	0.42338	.	0.384271	0.20817	N	0.085131	T	0.75889	0.3911	M	0.80616	2.505	0.48901	D	0.999724	D	0.76494	0.999	D	0.80764	0.994	T	0.78201	-0.2296	10	0.42905	T	0.14	.	15.612	0.76733	0.0:0.0:1.0:0.0	.	910	E7EUV1	.	C	910	ENSP00000415183:G910C;ENSP00000351956:G910C	ENSP00000351956:G910C	G	+	1	0	MUC2	1075807	1.000000	0.71417	0.958000	0.39756	0.772000	0.43724	9.496000	0.97967	1.914000	0.55421	0.486000	0.48141	GGC	MUC2	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000198788		0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	-	0.00	37	0	G	NM_002457		1085807	+1	tier1	-	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
MYO15A	51168	genome.wustl.edu	37	17	18030136	18030136	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:18030136G>A	ENST00000205890.5	+	6	4236	c.3898G>A	c.(3898-3900)Gcc>Acc	p.A1300T		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	1300	Myosin motor.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					TCTCGCCTTCGCCAAAATGCT	0.557																																																	0													139.0	141.0	140.0					17																	18030136		2008	4167	6175	SO:0001583	missense	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.3898G>A	17.37:g.18030136G>A	ENSP00000205890:p.Ala1300Thr		B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.A1300T	ENST00000205890.5	37	c.3898	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	G	7.934	0.741385	0.15642	.	.	ENSG00000091536	ENST00000205890	D	0.86769	-2.17	5.01	2.78	0.32641	Myosin head, motor domain (2);	.	.	.	.	T	0.55545	0.1927	N	0.01649	-0.78	0.80722	D	1	B	0.30104	0.268	B	0.13407	0.009	T	0.60193	-0.7311	9	0.02654	T	1	.	2.3463	0.04272	0.3912:0.0:0.3598:0.249	.	1300	Q9UKN7	MYO15_HUMAN	T	1300	ENSP00000205890:A1300T	ENSP00000205890:A1300T	A	+	1	0	MYO15A	17970861	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.867000	0.39499	1.107000	0.41642	-0.140000	0.14226	GCC	MYO15A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000091536		0.557	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	-	0.00	46	0	G	NM_016239		18030136	+1	tier1	-	no_errors	ENST00000205890	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	A
MYO7A	4647	genome.wustl.edu	37	11	76915260	76915260	+	Silent	SNP	C	C	T	rs548620787		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:76915260C>T	ENST00000409709.3	+	39	5738	c.5466C>T	c.(5464-5466)acC>acT	p.T1822T	MYO7A_ENST00000409619.2_Silent_p.T1773T|MYO7A_ENST00000458637.2_Silent_p.T1784T|MYO7A_ENST00000605744.1_3'UTR	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	1822	MyTH4 2. {ECO:0000255|PROSITE- ProRule:PRU00359}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						AGCAGCTGACCGACAACCACA	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		21687	0.001		0.0	False		,,,				2504	0.0																0													41.0	43.0	43.0					11																	76915260		2123	4231	6354	SO:0001819	synonymous_variant	0			U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5466C>T	11.37:g.76915260C>T			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_FERM_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.T1822	ENST00000409709.3	37	c.5466	CCDS53683.1	11																																																																																			MYO7A	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000137474		0.617	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	-	0.00	38	0	C	NM_000260		76915260	+1	tier1	-	no_errors	ENST00000409709	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.002	T
NACA	4666	genome.wustl.edu	37	12	57111653	57111653	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:57111653G>T	ENST00000454682.1	-	3	3942	c.3661C>A	c.(3661-3663)Cca>Aca	p.P1221T	NACA_ENST00000548563.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000551793.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1221	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						GTTGCAGCTGGGGTTGTGGGG	0.647			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													60.0	75.0	70.0					12																	57111653		1116	2677	3793	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3661C>A	12.37:g.57111653G>T	ENSP00000403817:p.Pro1221Thr			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.P1221T	ENST00000454682.1	37	c.3661		12	.	.	.	.	.	.	.	.	.	.	G	5.397	0.258384	0.10239	.	.	ENSG00000196531	ENST00000454682	T	0.47528	0.84	3.18	-3.18	0.05186	.	.	.	.	.	T	0.24547	0.0595	.	.	.	0.09310	N	1	B	0.25486	0.127	B	0.23275	0.045	T	0.18023	-1.0350	7	.	.	.	.	4.521	0.11959	0.3604:0.2846:0.355:0.0	.	1221	E9PAV3	.	T	1221	ENSP00000403817:P1221T	.	P	-	1	0	NACA	55397920	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-0.482000	0.06544	-0.663000	0.05331	0.186000	0.17326	CCA	NACA	-	NULL	ENSG00000196531		0.647	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		-	0.00	29	0	G	NM_005594		57111653	-1	tier1	-	no_errors	ENST00000454682	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.000	T
NADSYN1	55191	genome.wustl.edu	37	11	71185586	71185586	+	Intron	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:71185586C>T	ENST00000319023.2	+	9	986				NADSYN1_ENST00000539574.1_5'Flank	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1						NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	ATGAGCGGGCCTGGACATGCC	0.607																																					Ovarian(79;763 1781 6490 50276)												0													121.0	112.0	115.0					11																	71185586		2200	4294	6494	SO:0001627	intron_variant	0			AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.798+14C>T	11.37:g.71185586C>T			B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.P271L	ENST00000319023.2	37	c.812	CCDS8201.1	11																																																																																			NADSYN1	-	pfscan_C-N_Hydrolase	ENSG00000172890		0.607	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NADSYN1	HGNC	protein_coding	OTTHUMT00000394356.1	-	0.00	88	0	C	NM_018161		71185586	+1	tier1	-	no_errors	ENST00000528509	ensembl	human	known	74_37	missense	63.04	17	29	SNP	0.000	T
NFAT5	10725	genome.wustl.edu	37	16	69729066	69729066	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:69729066C>A	ENST00000354436.2	+	13	4706	c.4388C>A	c.(4387-4389)cCa>cAa	p.P1463Q	NFAT5_ENST00000567239.1_Missense_Mutation_p.P1480Q|NFAT5_ENST00000349945.1_Missense_Mutation_p.P1387Q|NFAT5_ENST00000393742.2_Missense_Mutation_p.P1387Q|NFAT5_ENST00000432919.1_Missense_Mutation_p.P1481Q|NFAT5_ENST00000566899.1_Missense_Mutation_p.P1387Q	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1463					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ACCTCTGGACCAGCTACATTG	0.448																																																	0													89.0	81.0	84.0					16																	69729066		2198	4300	6498	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.4388C>A	16.37:g.69729066C>A	ENSP00000346420:p.Pro1463Gln		A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.P1481Q	ENST00000354436.2	37	c.4442	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718199	0.89205	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.84	5.84	0.93424	.	0.168197	0.52532	D	0.000066	T	0.55226	0.1907	L	0.51422	1.61	0.46044	D	0.998838	D;P;P	0.56035	0.974;0.937;0.937	P;B;B	0.49140	0.601;0.367;0.367	T	0.57183	-0.7855	10	0.72032	D	0.01	-3.9176	20.1346	0.98019	0.0:1.0:0.0:0.0	.	1480;1463;1481	A2RRB4;O94916;E9PHR7	.;NFAT5_HUMAN;.	Q	1481;1480;1387;1463;1387	ENSP00000396538:P1481Q;ENSP00000338806:P1387Q;ENSP00000346420:P1463Q;ENSP00000377343:P1387Q	ENSP00000338806:P1387Q	P	+	2	0	NFAT5	68286567	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.157000	0.58144	2.763000	0.94921	0.557000	0.71058	CCA	NFAT5	-	NULL	ENSG00000102908		0.448	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2		0.00	54	0	C	NM_138714		69729066	+1			no_errors	ENST00000432919	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	A
NKTR	4820	genome.wustl.edu	37	3	42680193	42680193	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:42680193G>T	ENST00000232978.8	+	13	3185	c.2997G>T	c.(2995-2997)ggG>ggT	p.G999G	RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	999	Arg/Lys-rich (basic).				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		AATTGAAAGGGAAAAAAGACA	0.398																																																	0													61.0	64.0	63.0					3																	42680193		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.2997G>T	3.37:g.42680193G>T				Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.G999	ENST00000232978.8	37	c.2997	CCDS2702.1	3																																																																																			NKTR	-	NULL	ENSG00000114857		0.398	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	HGNC	protein_coding	OTTHUMT00000256642.2		0.00	47	0	G	NM_005385		42680193	+1			no_errors	ENST00000232978	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	T
NMT2	9397	genome.wustl.edu	37	10	15154837	15154837	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:15154837G>T	ENST00000378165.4	-	10	1376	c.1296C>A	c.(1294-1296)ccC>ccA	p.P432P	NMT2_ENST00000535341.1_Silent_p.P419P|RPP38_ENST00000451677.1_Intron|NMT2_ENST00000378150.1_Silent_p.P419P|NMT2_ENST00000540259.1_Silent_p.P244P	NM_004808.2	NP_004799.1	O60551	NMT2_HUMAN	N-myristoyltransferase 2	432					intracellular transport of virus (GO:0075733)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(3)|endometrium(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(3)	21						GGTCCAGCAGGGGCGTCTCTG	0.547																																					Melanoma(117;1345 1645 4130 12688 30625)												0													172.0	168.0	169.0					10																	15154837		2203	4300	6503	SO:0001819	synonymous_variant	0			AF043325	CCDS7109.1	10p13	2006-07-11			ENSG00000152465	ENSG00000152465			7858	protein-coding gene	gene with protein product		603801				9506952	Standard	NM_004808		Approved		uc001inz.1	O60551	OTTHUMG00000017723	ENST00000378165.4:c.1296C>A	10.37:g.15154837G>T			B0YJ49|Q53Y38|Q5VUC8|Q9BRB4	Silent	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.P432	ENST00000378165.4	37	c.1296	CCDS7109.1	10																																																																																			NMT2	-	pfam_MyristoylCoA_TrFase_C,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	ENSG00000152465		0.547	NMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT2	HGNC	protein_coding	OTTHUMT00000046958.2	-	0.00	44	0	G	NM_004808		15154837	-1	tier1	-	no_errors	ENST00000378165	ensembl	human	known	74_37	silent	7.55	49	4	SNP	0.778	T
NOLC1	9221	genome.wustl.edu	37	10	103920492	103920492	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:103920492G>T	ENST00000605788.1	+	10	1618	c.1383G>T	c.(1381-1383)caG>caT	p.Q461H	NOLC1_ENST00000603742.1_Missense_Mutation_p.Q180H|NOLC1_ENST00000405356.1_Missense_Mutation_p.Q471H|NOLC1_ENST00000477977.1_3'UTR|NOLC1_ENST00000488254.2_Missense_Mutation_p.Q462H	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	461	11 X 12 AA approximate repeats of an acidic serine cluster.				cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CTGCCAAGCAGGCTCCTCAGG	0.537																																																	0													60.0	59.0	59.0					10																	103920492		2203	4300	6503	SO:0001583	missense	0			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.1383G>T	10.37:g.103920492G>T	ENSP00000474710:p.Gln461His		Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	pfam_SRP40_C,pfscan_LisH_dimerisation	p.Q471H	ENST00000605788.1	37	c.1413	CCDS7530.1	10	.	.	.	.	.	.	.	.	.	.	G	9.933	1.215467	0.22373	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.44881	0.91	6.03	1.9	0.25705	.	0.515815	0.19022	N	0.124793	T	0.37100	0.0991	M	0.68317	2.08	0.09310	N	1	P;P;P	0.48503	0.911;0.911;0.855	P;P;B	0.44946	0.465;0.465;0.275	T	0.28902	-1.0029	10	0.42905	T	0.14	-11.6039	1.47	0.02414	0.3022:0.134:0.4256:0.1382	.	462;471;461	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	H	471;461	ENSP00000385410:Q471H	ENSP00000359024:Q461H	Q	+	3	2	NOLC1	103910482	0.000000	0.05858	0.376000	0.26042	0.577000	0.36160	-0.106000	0.10890	0.889000	0.36185	0.655000	0.94253	CAG	NOLC1	-	NULL	ENSG00000166197		0.537	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NOLC1	HGNC	protein_coding	OTTHUMT00000050012.2	-	0.00	45	0	G	NM_004741		103920492	+1	tier1	-	no_errors	ENST00000405356	ensembl	human	known	74_37	missense	28.57	30	12	SNP	0.000	T
NR1H2	7376	genome.wustl.edu	37	19	50881822	50881823	+	In_Frame_Ins	INS	-	-	CAG	rs57821899|rs61751954|rs34296657|rs66611742|rs1052533	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:50881822_50881823insCAG	ENST00000253727.5	+	6	751_752	c.516_517insCAG	c.(517-519)cag>CAGcag	p.173_173Q>QQ	NR1H2_ENST00000411902.2_In_Frame_Ins_p.76_76Q>QQ|NR1H2_ENST00000593926.1_In_Frame_Ins_p.173_173Q>QQ|NR1H2_ENST00000598168.1_In_Frame_Ins_p.173_173Q>QQ|NR1H2_ENST00000542413.1_5'UTR|NR1H2_ENST00000599105.1_In_Frame_Ins_p.173_173Q>QQ	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	173					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		AGATTCGGAAACAGCAGCAGGA	0.644														1987	0.396765	0.621	0.4294	5008	,	,		16931	0.1677		0.3161	False		,,,				2504	0.3896																0																																										SO:0001652	inframe_insertion	0			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.523_525dupCAG	19.37:g.50881829_50881831dupCAG	ENSP00000253727:p.Gln175dup		A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	In_Frame_Ins	INS	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Ecdystd_rcpt,prints_ThyrH_rcpt	p.175in_frame_insQ	ENST00000253727.5	37	c.516_517	CCDS42593.1	19																																																																																			NR1H2	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000131408		0.644	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H2	HGNC	protein_coding	OTTHUMT00000464724.2		0.00	15	0	-			50881823	+1	tier1		no_errors	ENST00000253727	ensembl	human	known	74_37	in_frame_ins	38.46	8	5	INS	0.999:1.000	CAG
NUB1	51667	genome.wustl.edu	37	7	151057290	151057290	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:151057290G>T	ENST00000355851.4	+	8	834	c.757G>T	c.(757-759)Gga>Tga	p.G253*	NUB1_ENST00000413040.2_Nonsense_Mutation_p.G277*|NUB1_ENST00000566856.1_Nonsense_Mutation_p.G253*|NUB1_ENST00000477666.1_3'UTR|NUB1_ENST00000568733.1_Nonsense_Mutation_p.G277*	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	253					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AAAAGAATATGGAATAGCCTT	0.393																																																	0													78.0	74.0	75.0					7																	151057290		1934	4161	6095	SO:0001587	stop_gained	0			AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.757G>T	7.37:g.151057290G>T	ENSP00000348110:p.Gly253*		O95422|Q75MR9|Q8IX22|Q9BXR2	Nonsense_Mutation	SNP	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.G277*	ENST00000355851.4	37	c.829		7	.	.	.	.	.	.	.	.	.	.	G	36	5.793479	0.96952	.	.	ENSG00000013374	ENST00000413040;ENST00000355851;ENST00000483358	.	.	.	5.95	5.95	0.96441	.	0.307628	0.36628	N	0.002485	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-19.4594	19.3813	0.94536	0.0:0.0:1.0:0.0	.	.	.	.	X	253	.	ENSP00000348110:G253X	G	+	1	0	NUB1	150688223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.157000	0.71846	2.824000	0.97209	0.655000	0.94253	GGA	NUB1	-	NULL	ENSG00000013374		0.393	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding		-	0.00	89	0	G	NM_016118		151057290	+1	tier1	-	no_errors	ENST00000568733	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	T
OR11H12	440153	genome.wustl.edu	37	14	19377922	19377922	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:19377922C>A	ENST00000550708.1	+	1	401	c.329C>A	c.(328-330)gCt>gAt	p.A110D		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	110						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCTCCTTTGCTGGATGTTTT	0.393																																																	0													3.0	3.0	3.0					14																	19377922		967	2292	3259	SO:0001583	missense	0				CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.329C>A	14.37:g.19377922C>A	ENSP00000449002:p.Ala110Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A110D	ENST00000550708.1	37	c.329	CCDS32017.1	14	.	.	.	.	.	.	.	.	.	.	c	9.041	0.989724	0.18966	.	.	ENSG00000257115	ENST00000550708	T	0.00397	7.57	.	.	.	GPCR, rhodopsin-like superfamily (1);	0.852275	0.09602	N	0.780095	T	0.00300	0.0009	L	0.43554	1.36	0.26015	N	0.981949	P	0.42248	0.774	B	0.41135	0.348	T	0.42666	-0.9438	8	0.48119	T	0.1	.	6.4784	0.22049	0.0:0.9998:0.0:2.0E-4	.	110	B2RN74	O11HC_HUMAN	D	110	ENSP00000449002:A110D	ENSP00000449002:A110D	A	+	2	0	CR383656.1	18447922	0.000000	0.05858	0.209000	0.23619	0.120000	0.20174	-0.305000	0.08188	0.413000	0.25759	0.064000	0.15345	GCT	OR11H12	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000257115		0.393	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H12	HGNC	protein_coding	OTTHUMT00000408402.1	-	0.00	128	0	C	NM_001013354		19377922	+1	tier1	-	no_errors	ENST00000550708	ensembl	human	known	74_37	missense	16.35	132	26	SNP	0.015	A
OR11L1	391189	genome.wustl.edu	37	1	248004325	248004325	+	Silent	SNP	A	A	G	rs184029383		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:248004325A>G	ENST00000355784.2	-	1	929	c.874T>C	c.(874-876)Ttg>Ctg	p.L292L		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	292						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTGTTCCTCAAGCTGTAGATA	0.413																																																	0													89.0	83.0	85.0					1																	248004325		2203	4300	6503	SO:0001819	synonymous_variant	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.874T>C	1.37:g.248004325A>G				Silent	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L292	ENST00000355784.2	37	c.874	CCDS31098.1	1																																																																																			OR11L1	-	prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000197591		0.413	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	-	0.00	27	0	A	NM_001001959		248004325	-1	tier1	-	no_errors	ENST00000355784	ensembl	human	known	74_37	silent	23.08	40	12	SNP	0.928	G
OR52B4	143496	genome.wustl.edu	37	11	4389279	4389279	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:4389279C>A	ENST00000408920.2	-	1	337	c.247G>T	c.(247-249)Gcc>Tcc	p.A83S		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	83					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATAGCTAAGGCCTGAGGAATG	0.527																																																	0													92.0	98.0	96.0					11																	4389279		2153	4254	6407	SO:0001583	missense	0			AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.247G>T	11.37:g.4389279C>A	ENSP00000386160:p.Ala83Ser		A6NP68|Q6IFK6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A83S	ENST00000408920.2	37	c.247	CCDS41609.1	11	.	.	.	.	.	.	.	.	.	.	C	5.828	0.337084	0.11013	.	.	ENSG00000221996	ENST00000408920	T	0.03035	4.07	5.28	1.31	0.21738	GPCR, rhodopsin-like superfamily (1);	0.550372	0.16734	N	0.201725	T	0.03564	0.0102	L	0.38838	1.175	0.09310	N	1	B	0.28378	0.209	B	0.31245	0.126	T	0.38779	-0.9645	10	0.66056	D	0.02	.	5.2358	0.15445	0.0:0.47:0.2104:0.3196	.	83	Q8NGK2	O52B4_HUMAN	S	83	ENSP00000386160:A83S	ENSP00000386160:A83S	A	-	1	0	OR52B4	4345855	0.000000	0.05858	0.004000	0.12327	0.001000	0.01503	-0.588000	0.05774	0.393000	0.25203	-0.143000	0.13931	GCC	OR52B4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221996		0.527	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52B4	HGNC	protein_coding	OTTHUMT00000334449.3	-	0.00	48	0	C	NM_001005161		4389279	-1	tier1	-	no_errors	ENST00000408920	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.000	A
OR6S1	341799	genome.wustl.edu	37	14	21109382	21109382	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:21109382G>T	ENST00000320704.3	-	1	468	c.469C>A	c.(469-471)Cct>Act	p.P157T		NM_001001968.1	NP_001001968.1	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S, member 1	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		CCAAGCACAGGGACGAGTCCC	0.612																																																	0													81.0	66.0	71.0					14																	21109382		2203	4300	6503	SO:0001583	missense	0			AL163636	CCDS32038.1	14q11.2	2013-09-24			ENSG00000181803	ENSG00000181803		"""GPCR / Class A : Olfactory receptors"""	15363	protein-coding gene	gene with protein product							Standard	NM_001001968		Approved	OR6S1Q	uc001vxv.1	Q8NH40	OTTHUMG00000171010	ENST00000320704.3:c.469C>A	14.37:g.21109382G>T	ENSP00000313110:p.Pro157Thr		Q6IFJ9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P157T	ENST00000320704.3	37	c.469	CCDS32038.1	14	.	.	.	.	.	.	.	.	.	.	G	3.411	-0.120285	0.06838	.	.	ENSG00000181803	ENST00000320704	T	0.36157	1.27	5.76	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000160	T	0.14013	0.0339	N	0.00510	-1.415	0.22253	N	0.999256	B	0.23377	0.084	B	0.29524	0.103	T	0.22521	-1.0214	10	0.30854	T	0.27	-12.1976	14.572	0.68218	0.0:0.1472:0.8528:0.0	.	157	Q8NH40	OR6S1_HUMAN	T	157	ENSP00000313110:P157T	ENSP00000313110:P157T	P	-	1	0	OR6S1	20179222	0.000000	0.05858	0.961000	0.40146	0.555000	0.35460	-0.042000	0.12063	1.412000	0.46977	0.655000	0.94253	CCT	OR6S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181803		0.612	OR6S1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR6S1	HGNC	protein_coding	OTTHUMT00000411227.1		0.00	43	0	G			21109382	-1			no_errors	ENST00000320704	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.444	T
PACSIN1	29993	genome.wustl.edu	37	6	34494065	34494065	+	5'UTR	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:34494065T>C	ENST00000538621.1	+	0	228				PACSIN1_ENST00000374043.2_5'UTR|PACSIN1_ENST00000244458.2_5'UTR|PACSIN1_ENST00000486120.1_3'UTR	NM_001199583.2	NP_001186512.1	Q9BY11	PACN1_HUMAN	protein kinase C and casein kinase substrate in neurons 1						actin filament organization (GO:0007015)|establishment of protein localization to plasma membrane (GO:0090002)|membrane tubulation (GO:0097320)|neuron projection morphogenesis (GO:0048812)|positive regulation of dendrite development (GO:1900006)|protein localization to membrane (GO:0072657)|synaptic vesicle endocytosis (GO:0048488)	axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	13						CACTTGTCCATCCCCCTGCGG	0.627																																																	0													57.0	52.0	53.0					6																	34494065		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AB037800	CCDS4793.1	6p21.3	2008-02-05			ENSG00000124507	ENSG00000124507			8570	protein-coding gene	gene with protein product	"""syndapin I"""	606512				11179684	Standard	NM_020804		Approved	SDPI	uc003ojp.4	Q9BY11	OTTHUMG00000014547	ENST00000538621.1:c.-18T>C	6.37:g.34494065T>C			Q9P2G8	RNA	SNP	-	NULL	ENST00000538621.1	37	NULL	CCDS4793.1	6																																																																																			PACSIN1	-	-	ENSG00000124507		0.627	PACSIN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN1	HGNC	protein_coding	OTTHUMT00000040236.1	-	0.00	49	0	T			34494065	+1	tier1	-	no_errors	ENST00000486120	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.000	C
PCDHB12	56124	genome.wustl.edu	37	5	140589130	140589130	+	Silent	SNP	C	C	T	rs561631495		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr5:140589130C>T	ENST00000239450.2	+	1	840	c.651C>T	c.(649-651)ggC>ggT	p.G217G	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	217	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCTGGATGGCGGGTCCCCTC	0.507													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16472	0.0		0.0	False		,,,				2504	0.0																0													66.0	67.0	67.0					5																	140589130		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.651C>T	5.37:g.140589130C>T			B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G217	ENST00000239450.2	37	c.651	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000120328		0.507	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2		0.00	55	0	C	NM_018932		140589130	+1			no_errors	ENST00000239450	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.076	T
PCLO	27445	genome.wustl.edu	37	7	82586167	82586167	+	Missense_Mutation	SNP	C	C	T	rs533061339		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:82586167C>T	ENST00000333891.9	-	5	4439	c.4102G>A	c.(4102-4104)Gat>Aat	p.D1368N	PCLO_ENST00000423517.2_Missense_Mutation_p.D1368N	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GATATTCCATCGGAAGAATAT	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		16444	0.0		0.0	False		,,,				2504	0.001																0													58.0	56.0	56.0					7																	82586167		1860	4088	5948	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4102G>A	7.37:g.82586167C>T	ENSP00000334319:p.Asp1368Asn			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.D1368N	ENST00000333891.9	37	c.4102	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	14.51	2.555658	0.45487	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.27557	1.66;1.68	5.67	5.67	0.87782	.	.	.	.	.	T	0.58481	0.2125	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.975	T	0.60835	-0.7184	9	0.87932	D	0	.	19.7654	0.96337	0.0:1.0:0.0:0.0	.	1368;1368	Q9Y6V0-5;Q9Y6V0-6	.;.	N	1299;1368;1368	ENSP00000334319:D1368N;ENSP00000388393:D1368N	ENSP00000334319:D1368N	D	-	1	0	PCLO	82424103	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.542000	0.60677	2.659000	0.90383	0.655000	0.94253	GAT	PCLO	-	NULL	ENSG00000186472		0.423	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	67	0	C	NM_014510		82586167	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	33.82	45	23	SNP	1.000	T
PCNX	22990	genome.wustl.edu	37	14	71502860	71502860	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:71502860T>A	ENST00000304743.2	+	19	4299	c.3853T>A	c.(3853-3855)Ttc>Atc	p.F1285I	PCNX_ENST00000238570.5_Missense_Mutation_p.F1285I|PCNX_ENST00000439984.3_Missense_Mutation_p.F1174I	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1285						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AAGCACAGTCTTCACAGTATT	0.413																																																	0													258.0	222.0	234.0					14																	71502860		2203	4300	6503	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3853T>A	14.37:g.71502860T>A	ENSP00000304192:p.Phe1285Ile		B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.F1285I	ENST00000304743.2	37	c.3853	CCDS9806.1	14	.	.	.	.	.	.	.	.	.	.	T	19.24	3.789463	0.70337	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.15718	2.71;2.7;2.4	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.48429	0.1499	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	0.989;1.0;0.993	D;D;D	0.85130	0.985;0.997;0.977	T	0.56902	-0.7902	10	0.72032	D	0.01	.	15.5504	0.76148	0.0:0.0:0.0:1.0	.	1285;1174;1285	Q96RV3-3;B2RTR6;Q96RV3	.;.;PCX1_HUMAN	I	1285;1285;1174	ENSP00000304192:F1285I;ENSP00000238570:F1285I;ENSP00000396617:F1174I	ENSP00000238570:F1285I	F	+	1	0	PCNX	70572613	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.577000	0.82486	2.074000	0.62210	0.383000	0.25322	TTC	PCNX	-	NULL	ENSG00000100731		0.413	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	-	0.00	62	0	T	NM_014982		71502860	+1	tier1	-	no_errors	ENST00000304743	ensembl	human	known	74_37	missense	43.14	29	22	SNP	1.000	A
PFKFB2	5208	genome.wustl.edu	37	1	207236027	207236027	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:207236027C>T	ENST00000367080.3	+	4	398	c.274C>T	c.(274-276)Cgg>Tgg	p.R92W	PFKFB2_ENST00000545806.1_Missense_Mutation_p.R59W|PFKFB2_ENST00000411990.2_5'UTR|PFKFB2_ENST00000541914.1_5'Flank|PFKFB2_ENST00000367079.2_Missense_Mutation_p.R92W	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	92	6-phosphofructo-2-kinase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CGACTTCTTTCGGCATGACAA	0.468																																																	0													233.0	234.0	234.0					1																	207236027		2203	4300	6503	SO:0001583	missense	0				CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.274C>T	1.37:g.207236027C>T	ENSP00000356047:p.Arg92Trp		O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.R92W	ENST00000367080.3	37	c.274	CCDS31004.1	1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459184	0.84317	.	.	ENSG00000123836	ENST00000367080;ENST00000367079;ENST00000545806	.	.	.	4.87	4.87	0.63330	6-phosphofructo-2-kinase (1);	0.000000	0.85682	D	0.000000	T	0.81456	0.4826	M	0.90425	3.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.916	D	0.84765	0.0764	9	0.72032	D	0.01	.	12.7898	0.57526	0.1747:0.8253:0.0:0.0	.	92;92	Q5VVQ3;O60825	.;F262_HUMAN	W	92;92;59	.	ENSP00000356046:R92W	R	+	1	2	PFKFB2	205302650	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.815000	0.27253	2.542000	0.85734	0.655000	0.94253	CGG	PFKFB2	-	pfam_6Phosfructo_kin,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000123836		0.468	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB2	HGNC	protein_coding	OTTHUMT00000087838.1	-	0.00	87	0	C			207236027	+1	tier1	-	no_errors	ENST00000367080	ensembl	human	known	74_37	missense	39.39	40	26	SNP	1.000	T
PGBD1	84547	genome.wustl.edu	37	6	28264626	28264626	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:28264626G>T	ENST00000405948.2	+	5	1096	c.676G>T	c.(676-678)Gcc>Tcc	p.A226S	PGBD1_ENST00000259883.3_Missense_Mutation_p.A226S	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	226						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						AACAGCCCAGGCCGTTGCTGC	0.463																																																	0													111.0	104.0	106.0					6																	28264626		2203	4300	6503	SO:0001583	missense	0			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.676G>T	6.37:g.28264626G>T	ENSP00000385213:p.Ala226Ser		Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,pfscan_SRCR,pfscan_Tscrpt_reg_SCAN	p.A226S	ENST00000405948.2	37	c.676	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	G	5.173	0.217534	0.09810	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.01279	5.06;5.06	3.95	1.09	0.20402	.	1.148070	0.06865	N	0.799803	T	0.00300	0.0009	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.42207	-0.9465	10	0.06365	T	0.9	-6.0791	2.4585	0.04535	0.1073:0.1904:0.5059:0.1964	.	226	Q96JS3	PGBD1_HUMAN	S	226	ENSP00000385213:A226S;ENSP00000259883:A226S	ENSP00000259883:A226S	A	+	1	0	PGBD1	28372605	0.015000	0.18098	0.001000	0.08648	0.458000	0.32498	0.581000	0.23819	0.213000	0.20722	0.655000	0.94253	GCC	PGBD1	-	superfamily_Krueppel-associated_box	ENSG00000137338		0.463	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	HGNC	protein_coding	OTTHUMT00000040188.2		0.00	74	0	G			28264626	+1			no_errors	ENST00000259883	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.001	T
PHF20	51230	genome.wustl.edu	37	20	34443234	34443234	+	Intron	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr20:34443234G>T	ENST00000374012.3	+	5	469				PHF20_ENST00000439301.1_Intron|PHF20_ENST00000481202.1_Intron|Y_RNA_ENST00000362806.1_RNA			Q9BVI0	PHF20_HUMAN	PHD finger protein 20						chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(5)|endometrium(1)|kidney(7)|large_intestine(6)|lung(11)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(12;0.00631)|all_lung(11;0.0145)					ATAAGTCATTGCTGAGCTGCC	0.368																																																	0													44.0	42.0	43.0					20																	34443234		876	1991	2867	SO:0001627	intron_variant	0			AL109965	CCDS13268.1	20q11.22-q11.23	2013-01-28	2004-12-01	2004-12-01	ENSG00000025293	ENSG00000025293		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	16098	protein-coding gene	gene with protein product	"""tudor domain containing 20A"""	610335	"""chromosome 20 open reading frame 104"""	C20orf104			Standard	NM_016436		Approved	dJ1121G12.1, TDRD20A	uc002xek.1	Q9BVI0	OTTHUMG00000032367	ENST00000374012.3:c.341-2990G>T	20.37:g.34443234G>T			A7E235|B2RB56|E1P5S3|Q566Q2|Q5JWY9|Q66K49|Q9BWV4|Q9BXA3|Q9BZW3|Q9H421|Q9H4J6|Q9NZ22	RNA	SNP	-	NULL	ENST00000374012.3	37	NULL	CCDS13268.1	20																																																																																			PHF20	-	-	ENSG00000025293		0.368	PHF20-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF20	HGNC	protein_coding	OTTHUMT00000078949.2	-	0.00	58	0	G	NM_016436		34443234	+1	tier1	-	no_errors	ENST00000496305	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.042	T
PLAG1	5324	genome.wustl.edu	37	8	57080625	57080625	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr8:57080625G>T	ENST00000316981.3	-	4	683	c.204C>A	c.(202-204)gaC>gaA	p.D68E	PLAG1_ENST00000423799.2_Intron|PLAG1_ENST00000429357.2_Missense_Mutation_p.D68E	NM_001114634.1|NM_002655.2	NP_001108106.1|NP_002646.2	Q6DJT9	PLAG1_HUMAN	pleiomorphic adenoma gene 1	68	Decreased nuclear import with localization in the nucleus but also in the cytoplasm.|Interacts with KPNA2.				gland morphogenesis (GO:0022612)|multicellular organism growth (GO:0035264)|negative regulation of gene expression (GO:0010629)|organ growth (GO:0035265)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		CTNNB1/PLAG1(60)|LIFR_ENST00000263409/PLAG1(10)|HAS2/PLAG1(10)|FGFR1_ENST00000447712/PLAG1(28)|COL1A2/PLAG1(3)|CHCHD7/PLAG1(12)|TCEA1_ENST00000521604/PLAG1(3)	breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(136;0.0548)|Lung NSC(129;0.0718)|all_epithelial(80;0.125)	Epithelial(17;0.00179)|all cancers(17;0.0125)			CCTTGGTGCAGTCTTGTTGTA	0.388			T	"""TCEA1, LIFR, CTNNB1, CHCHD7"""	salivary adenoma																																			Dom	yes		8	8q12	5324	pleiomorphic adenoma gene 1		E	0													96.0	91.0	92.0					8																	57080625		2203	4300	6503	SO:0001583	missense	0			U65002	CCDS6165.1, CCDS47860.1	8q12	2010-07-30				ENSG00000181690		"""Zinc fingers, C2H2-type"""	9045	protein-coding gene	gene with protein product		603026				9268638	Standard	NM_002655		Approved	ZNF912	uc010lyi.3	Q6DJT9		ENST00000316981.3:c.204C>A	8.37:g.57080625G>T	ENSP00000325546:p.Asp68Glu		B4DLC2|Q59GH8|Q9Y4L2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D68E	ENST00000316981.3	37	c.204	CCDS6165.1	8	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561351	0.27915	.	.	ENSG00000181690	ENST00000316981;ENST00000429357	T;T	0.17054	2.3;2.3	5.77	3.93	0.45458	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.088381	0.85682	D	0.000000	T	0.06917	0.0176	N	0.02202	-0.64	0.58432	D	0.999998	P	0.42757	0.789	B	0.41088	0.347	T	0.18681	-1.0329	10	0.02654	T	1	-24.4014	14.9253	0.70871	0.0:0.0:0.7383:0.2617	.	68	Q6DJT9	PLAG1_HUMAN	E	68	ENSP00000325546:D68E;ENSP00000416537:D68E	ENSP00000325546:D68E	D	-	3	2	PLAG1	57243179	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	7.937000	0.87672	0.723000	0.32274	-0.182000	0.12963	GAC	PLAG1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181690		0.388	PLAG1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLAG1	HGNC	protein_coding	OTTHUMT00000378212.1	-	0.00	50	0	G	NM_002655		57080625	-1	tier1	-	no_errors	ENST00000316981	ensembl	human	known	74_37	missense	8.33	66	6	SNP	1.000	T
PNCK	139728	genome.wustl.edu	37	X	152936413	152936413	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:152936413G>T	ENST00000370150.1	-	9	944	c.766C>A	c.(766-768)Cag>Aag	p.Q256K	PNCK_ENST00000340888.3_Missense_Mutation_p.Q256K|PNCK_ENST00000370145.4_Missense_Mutation_p.Q273K|PNCK_ENST00000447676.2_Missense_Mutation_p.Q339K|PNCK_ENST00000370142.1_Missense_Mutation_p.Q279K|PNCK_ENST00000393831.2_Missense_Mutation_p.Q279K|PNCK_ENST00000475172.1_5'Flank			Q6P2M8	KCC1B_HUMAN	pregnancy up-regulated nonubiquitous CaM kinase	256	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|lung(3)|skin(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AACCTCTTCTGGGGGTCTCGC	0.632																																																	0													58.0	57.0	57.0					X																	152936413		2203	4300	6503	SO:0001583	missense	0			BC033746	CCDS35503.2, CCDS48189.1	Xq28	2013-10-14	2013-10-14		ENSG00000130822	ENSG00000130822			13415	protein-coding gene	gene with protein product		300680	"""pregnancy upregulated non-ubiquitously expressed CaM kinase"", ""pregnancy up-regulated non-ubiquitously expressed CaM kinase"""			12477932	Standard	NM_001039582		Approved	MGC45419, CaMK1b	uc011myu.2	Q6P2M8	OTTHUMG00000024216	ENST00000370150.1:c.766C>A	X.37:g.152936413G>T	ENSP00000359169:p.Gln256Lys		B4DJR8|B4E1A6|B7WPG0|D3DWU7|Q8N4R0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q339K	ENST00000370150.1	37	c.1015		X	.	.	.	.	.	.	.	.	.	.	g	5.787	0.329508	0.10956	.	.	ENSG00000130822	ENST00000340888;ENST00000370150;ENST00000393831;ENST00000370142;ENST00000370145;ENST00000447676	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	4.4	3.46	0.39613	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.109095	0.37178	N	0.002217	T	0.25158	0.0611	N	0.01284	-0.91	0.28087	N	0.931965	P;B;B	0.34587	0.458;0.139;0.139	B;B;B	0.31869	0.137;0.056;0.056	T	0.39333	-0.9619	10	0.02654	T	1	-27.155	10.0389	0.42146	0.0:0.487:0.513:0.0	.	339;273;256	Q6P2M8-5;B4E1A6;Q6P2M8	.;.;KCC1B_HUMAN	K	256;256;279;279;273;339	ENSP00000340586:Q256K;ENSP00000359169:Q256K;ENSP00000377417:Q279K;ENSP00000359161:Q279K;ENSP00000359164:Q273K;ENSP00000405950:Q339K	ENSP00000340586:Q256K	Q	-	1	0	PNCK	152589607	0.070000	0.21116	0.937000	0.37676	0.962000	0.63368	0.917000	0.28665	1.924000	0.55735	0.529000	0.55759	CAG	PNCK	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130822		0.632	PNCK-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal	protein_coding	PNCK	HGNC	protein_coding	OTTHUMT00000061044.2		0.00	34	0	G	NM_198452		152936413	-1			no_errors	ENST00000447676	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.964	T
PNMAL1	55228	genome.wustl.edu	37	19	46973274	46973274	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:46973274C>A	ENST00000313683.10	-	2	1324	c.1019G>T	c.(1018-1020)gGc>gTc	p.G340V	PNMAL1_ENST00000602246.1_Intron|PNMAL1_ENST00000438932.2_Missense_Mutation_p.G340V	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	340										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		GCTTTCATGGCCACCATCTTG	0.612																																																	0													121.0	135.0	130.0					19																	46973274		2203	4300	6503	SO:0001583	missense	0			BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.1019G>T	19.37:g.46973274C>A	ENSP00000318131:p.Gly340Val		A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	NULL	p.G340V	ENST00000313683.10	37	c.1019	CCDS33059.1	19	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107357	0.56291	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.42900	0.96;0.99	3.94	3.94	0.45596	.	0.483859	0.17599	N	0.168481	T	0.47303	0.1438	L	0.34521	1.04	0.22266	N	0.999247	D;D	0.67145	0.992;0.996	P;P	0.59761	0.863;0.863	T	0.29579	-1.0007	10	0.66056	D	0.02	-11.3344	11.7787	0.52001	0.0:1.0:0.0:0.0	.	340;340	Q86V59-2;Q86V59	.;PNML1_HUMAN	V	340	ENSP00000410273:G340V;ENSP00000318131:G340V	ENSP00000318131:G340V	G	-	2	0	PNMAL1	51665114	0.000000	0.05858	0.005000	0.12908	0.015000	0.08874	0.055000	0.14229	2.491000	0.84063	0.655000	0.94253	GGC	PNMAL1	-	NULL	ENSG00000182013		0.612	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PNMAL1	HGNC	protein_coding	OTTHUMT00000403929.1	-	0.00	21	0	C	NM_018215		46973274	-1	tier1	-	no_errors	ENST00000313683	ensembl	human	known	74_37	missense	47.62	11	10	SNP	0.005	A
POR	5447	genome.wustl.edu	37	7	75609828	75609828	+	Start_Codon_SNP	SNP	A	A	G	rs72555504		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:75609828A>G	ENST00000450476.1	+	1	11	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	POR_ENST00000419840.1_Intron|POR_ENST00000394893.1_Intron|POR_ENST00000439269.1_5'Flank|POR_ENST00000545601.1_Intron|POR_ENST00000461988.1_Intron			P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase	0					carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	AGAGACTGCTATGGGCTCCCG	0.627																																																	0								A		2,4012		0,2,2005	70.0	75.0	73.0			-0.2	0.0	7	dbSNP_130	73	0,8378		0,0,4189	no	intron	POR	NM_000941.2		0,2,6194	GG,GA,AA		0.0,0.0498,0.0161			75609828	2,12390	2007	4189	6196	SO:0001582	initiator_codon_variant	0			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413	ENST00000450476.1:c.1A>G	7.37:g.75609828A>G	ENSP00000416572:p.Met1Val		Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	Missense_Mutation	SNP	pfam_FAD-binding_1,pfam_OxRdtase_FAD/NAD-bd,pfam_Flavodoxin/NO_synth,superfamily_Riboflavin_synthase-like_b-brl,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.M1V	ENST00000450476.1	37	c.1		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.008|0.008	-1.890620|-1.890620	0.00527|0.00527	4.98E-4|4.98E-4	0.0|0.0	ENSG00000127948|ENSG00000127948	ENST00000450476|ENST00000447222	T|.	0.02472|.	4.28|.	3.03|3.03	-0.251|-0.251	0.13003|0.13003	.|.	.|.	.|.	.|.	.|.	T|T	0.21550|0.21550	0.0519|0.0519	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999999|0.999999	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.24728|0.24728	-1.0152|-1.0152	8|4	0.87932|.	D|.	0|.	.|.	2.8877|2.8877	0.05667|0.05667	0.3427:0.2398:0.4175:0.0|0.3427:0.2398:0.4175:0.0	.|.	1|.	E7EVY7|.	.|.	V|C	1|152	ENSP00000416572:M1V|.	ENSP00000416572:M1V|.	M|Y	+|+	1|2	0|0	POR|POR	75447764|75447764	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.014000|0.014000	0.08584|0.08584	-2.348000|-2.348000	0.01094|0.01094	-0.192000|-0.192000	0.10432|0.10432	-0.232000|-0.232000	0.12228|0.12228	ATG|TAT	POR	-	pfscan_Flavodoxin/NO_synth	ENSG00000127948		0.627	POR-202	KNOWN	basic	protein_coding	POR	HGNC	protein_coding		-	0.00	75	0	A	NM_000941	Missense_Mutation	75609828	+1	tier1	-	no_errors	ENST00000450476	ensembl	human	known	74_37	missense	36.84	48	28	SNP	0.010	G
PSMD4	5710	genome.wustl.edu	37	1	151236431	151236431	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:151236431G>A	ENST00000368884.3	+	3	289	c.209G>A	c.(208-210)cGt>cAt	p.R70H	PSMD4_ENST00000469786.2_3'UTR|PSMD4_ENST00000368881.4_Missense_Mutation_p.R70H	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	70	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GACACTGGCCGTATCCTGTCC	0.532																																																	0													107.0	71.0	83.0					1																	151236431		2203	4298	6501	SO:0001583	missense	0			U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.209G>A	1.37:g.151236431G>A	ENSP00000357879:p.Arg70His		D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	pfam_Ubiquitin-int_motif,pfam_Ssl1-like,smart_VWF_A,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_VWF_A	p.R70H	ENST00000368884.3	37	c.209	CCDS991.1	1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.172168	0.78452	.	.	ENSG00000159352	ENST00000368884;ENST00000368881;ENST00000437736	T;T;T	0.14266	2.52;2.52;2.52	5.49	5.49	0.81192	Ssl1-like (1);von Willebrand factor, type A (2);	0.000000	0.64402	D	0.000005	T	0.09774	0.0240	L	0.41710	1.295	0.54753	D	0.999986	P;P	0.38455	0.632;0.632	B;B	0.40444	0.329;0.329	T	0.02588	-1.1137	10	0.59425	D	0.04	-9.0962	17.3319	0.87267	0.0:0.0:1.0:0.0	.	70;70	Q5VWC4;P55036	.;PSMD4_HUMAN	H	70;70;55	ENSP00000357879:R70H;ENSP00000357876:R70H;ENSP00000414499:R55H	ENSP00000357876:R70H	R	+	2	0	PSMD4	149503055	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	7.457000	0.80775	2.865000	0.98341	0.655000	0.94253	CGT	PSMD4	-	pfam_Ssl1-like,smart_VWF_A,pfscan_VWF_A	ENSG00000159352		0.532	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD4	HGNC	protein_coding	OTTHUMT00000034409.3	-	0.00	66	0	G	NM_002810		151236431	+1	tier1	-	no_errors	ENST00000368884	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	A
PTCH1	5727	genome.wustl.edu	37	9	98218645	98218645	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:98218645G>T	ENST00000331920.6	-	19	3518	c.3219C>A	c.(3217-3219)ctC>ctA	p.L1073L	PTCH1_ENST00000429896.2_Silent_p.L922L|PTCH1_ENST00000430669.2_Silent_p.L1007L|PTCH1_ENST00000375274.2_Silent_p.L1072L|PTCH1_ENST00000437951.1_Silent_p.L1007L|PTCH1_ENST00000418258.1_Silent_p.L922L|PTCH1_ENST00000421141.1_Silent_p.L922L	NM_000264.3	NP_000255.2	Q13635	PTC1_HUMAN	patched 1	1073					brain development (GO:0007420)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation involved in kidney development (GO:0061005)|cell proliferation involved in metanephros development (GO:0072203)|cellular response to cholesterol (GO:0071397)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|embryonic organ development (GO:0048568)|epidermis development (GO:0008544)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|hindlimb morphogenesis (GO:0035137)|in utero embryonic development (GO:0001701)|keratinocyte proliferation (GO:0043616)|limb morphogenesis (GO:0035108)|mammary gland duct morphogenesis (GO:0060603)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell division (GO:0051782)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate axis specification (GO:0021997)|neural tube closure (GO:0001843)|neural tube patterning (GO:0021532)|organ morphogenesis (GO:0009887)|pharyngeal system development (GO:0060037)|positive regulation of cholesterol efflux (GO:0010875)|protein processing (GO:0016485)|protein targeting to plasma membrane (GO:0072661)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein localization (GO:0032880)|regulation of smoothened signaling pathway (GO:0008589)|renal system development (GO:0072001)|response to chlorate (GO:0010157)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to mechanical stimulus (GO:0009612)|response to retinoic acid (GO:0032526)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|somite development (GO:0061053)|spinal cord motor neuron differentiation (GO:0021522)	axonal growth cone (GO:0044295)|caveola (GO:0005901)|dendritic growth cone (GO:0044294)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)	cholesterol binding (GO:0015485)|cyclin binding (GO:0030332)|hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|heparin binding (GO:0008201)|smoothened binding (GO:0005119)	p.V1057_L1102del(1)		NS(8)|bone(33)|breast(10)|central_nervous_system(95)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(8)|kidney(2)|large_intestine(18)|lung(22)|meninges(1)|oesophagus(3)|ovary(6)|prostate(2)|skin(262)|upper_aerodigestive_tract(11)|urinary_tract(2)|vulva(1)	490		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				TGATTCCGATGAGGCCCATCA	0.597																																																	1	Deletion - In frame(1)	central_nervous_system(1)											127.0	92.0	104.0					9																	98218645		2203	4300	6503	SO:0001819	synonymous_variant	0			AI494442	CCDS6714.1, CCDS43851.1, CCDS47995.1, CCDS47996.1	9q22.1-q31	2014-09-17	2010-06-24	2006-09-26	ENSG00000185920	ENSG00000185920			9585	protein-coding gene	gene with protein product		601309	"""patched (Drosophila) homolog"", ""patched homolog (Drosophila)"", ""patched homolog 1 (Drosophila)"""	NBCCS, PTCH		8658145	Standard	NM_001083603		Approved	BCNS	uc004avk.4	Q13635	OTTHUMG00000020280	ENST00000331920.6:c.3219C>A	9.37:g.98218645G>T			A3KBI9|E9PEJ8|Q13463|Q5R1U7|Q5R1U9|Q5R1V0|Q5VZC0|Q5VZC2|Q86XG7	Silent	SNP	pfam_Patched,pfscan_SSD,tigrfam_TM_rcpt_patched	p.L1073	ENST00000331920.6	37	c.3219	CCDS6714.1	9																																																																																			PTCH1	-	pfam_Patched,tigrfam_TM_rcpt_patched	ENSG00000185920		0.597	PTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCH1	HGNC	protein_coding	OTTHUMT00000053229.2		0.00	37	0	G	NM_000264		98218645	-1			no_errors	ENST00000331920	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.998	T
PTGFRN	5738	genome.wustl.edu	37	1	117491860	117491860	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:117491860G>T	ENST00000393203.2	+	4	1026	c.879G>T	c.(877-879)aaG>aaT	p.K293N		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	293	Ig-like C2-type 3.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CTGAAGGAAAGGAACTGGACC	0.502																																																	0													117.0	108.0	111.0					1																	117491860		2203	4300	6503	SO:0001583	missense	0			AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.879G>T	1.37:g.117491860G>T	ENSP00000376899:p.Lys293Asn		Q5VVU9|Q8N2K6	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.K293N	ENST00000393203.2	37	c.879	CCDS890.1	1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139379	0.37728	.	.	ENSG00000134247	ENST00000393203;ENST00000544471	T	0.29397	1.57	5.77	3.78	0.43462	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.425446	0.27922	N	0.017313	T	0.08358	0.0208	N	0.24115	0.695	0.35482	D	0.798216	B	0.09022	0.002	B	0.09377	0.004	T	0.10382	-1.0632	10	0.26408	T	0.33	-36.5665	7.8702	0.29561	0.0:0.1631:0.6449:0.192	.	293	Q9P2B2	FPRP_HUMAN	N	293;152	ENSP00000376899:K293N	ENSP00000376899:K293N	K	+	3	2	PTGFRN	117293383	1.000000	0.71417	0.998000	0.56505	0.967000	0.64934	1.300000	0.33436	2.724000	0.93272	0.561000	0.74099	AAG	PTGFRN	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000134247		0.502	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	HGNC	protein_coding	OTTHUMT00000033271.1		0.00	64	0	G	NM_020440		117491860	+1			no_errors	ENST00000393203	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.990	T
QSOX1	5768	genome.wustl.edu	37	1	180155248	180155248	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:180155248G>T	ENST00000367602.3	+	8	1022	c.948G>T	c.(946-948)gtG>gtT	p.V316V	QSOX1_ENST00000367600.5_Silent_p.V316V			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	316					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGATAGAAGTGGGCAGGTTCC	0.557																																																	0													96.0	92.0	93.0					1																	180155248		2203	4300	6503	SO:0001819	synonymous_variant	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.948G>T	1.37:g.180155248G>T			Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Silent	SNP	pfam_ERV/ALR_sulphydryl_oxidase,pfam_Thioredoxin_domain,superfamily_ERV/ALR_sulphydryl_oxidase,superfamily_Thioredoxin-like_fold	p.V316	ENST00000367602.3	37	c.948	CCDS1337.1	1																																																																																			QSOX1	-	NULL	ENSG00000116260		0.557	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1		0.00	71	0	G	NM_002826		180155248	+1			no_errors	ENST00000367602	ensembl	human	known	74_37	silent	5.56	51	3	SNP	0.999	T
RAG1	5896	genome.wustl.edu	37	11	36596847	36596847	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:36596847G>T	ENST00000299440.5	+	2	2105	c.1993G>T	c.(1993-1995)Gag>Tag	p.E665*		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	665					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E665*(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				GCTGGCAGATGAGTCTGACCA	0.478									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												1	Substitution - Nonsense(1)	large_intestine(1)											70.0	63.0	65.0					11																	36596847		2202	4298	6500	SO:0001587	stop_gained	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1993G>T	11.37:g.36596847G>T	ENSP00000299440:p.Glu665*		E9PPC4|Q8IY72|Q8NER2	Nonsense_Mutation	SNP	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.E665*	ENST00000299440.5	37	c.1993	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.492805	0.96339	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	.	.	.	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.5176	0.99214	0.0:0.0:1.0:0.0	.	.	.	.	X	665	.	ENSP00000299440:E665X	E	+	1	0	RAG1	36553423	1.000000	0.71417	0.995000	0.50966	0.493000	0.33554	9.476000	0.97823	2.852000	0.98041	0.644000	0.83932	GAG	RAG1	-	NULL	ENSG00000166349		0.478	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	HGNC	protein_coding	OTTHUMT00000389535.1		0.00	32	0	G	NM_000448		36596847	+1			no_errors	ENST00000299440	ensembl	human	known	74_37	nonsense	5.26	35	2	SNP	1.000	T
RAI1	10743	genome.wustl.edu	37	17	17697099	17697100	+	Frame_Shift_Del	DEL	GC	GC	-	rs35068024|rs587780431|rs587780429|rs398124422|rs11078398|rs144872134	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:17697099_17697100delGC	ENST00000353383.1	+	3	1306_1307	c.837_838delGC	c.(835-840)cagcagfs	p.QQ279fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.QQ279fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	279	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ATGACcagcagcagcagcagca	0.634																																																	0																																										SO:0001589	frameshift_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.837_838delGC	17.37:g.17697099_17697100delGC	ENSP00000323074:p.Gln279fs		Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	smart_Znf_PHD	p.Q280fs	ENST00000353383.1	37	c.837_838	CCDS11188.1	17																																																																																			RAI1	-	NULL	ENSG00000108557		0.634	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1		0.00	60	0	GC	NM_030665		17697100	+1	tier1		no_errors	ENST00000353383	ensembl	human	known	74_37	frame_shift_del	54.05	34	40	DEL	0.891:0.907	-
RAI1	10743	genome.wustl.edu	37	17	17697105	17697105	+	Silent	SNP	G	G	A	rs398124422|rs587780431		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:17697105G>A	ENST00000353383.1	+	3	1312	c.843G>A	c.(841-843)caG>caA	p.Q281Q	RAI1_ENST00000261641.6_Silent_p.Q281Q	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	281	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		agcagcagcagcagcagcagc	0.632																																																	0													20.0	25.0	24.0					17																	17697105		2020	4001	6021	SO:0001819	synonymous_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.843G>A	17.37:g.17697105G>A			Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	smart_Znf_PHD	p.Q281	ENST00000353383.1	37	c.843	CCDS11188.1	17																																																																																			RAI1	-	NULL	ENSG00000108557		0.632	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	-	0.00	77	0	G	NM_030665		17697105	+1	tier1	-	no_errors	ENST00000353383	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	A
RAPGEF4	11069	genome.wustl.edu	37	2	173894912	173894912	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:173894912T>G	ENST00000397081.3	+	26	2722	c.2579T>G	c.(2578-2580)cTg>cGg	p.L860R	RAPGEF4_ENST00000538974.1_Missense_Mutation_p.L689R|RAPGEF4_ENST00000535187.1_Missense_Mutation_p.L640R|RAPGEF4_ENST00000397087.3_Missense_Mutation_p.L716R|RAPGEF4_ENST00000540783.1_Missense_Mutation_p.L707R|RAPGEF4_ENST00000264111.6_Missense_Mutation_p.L859R|RAPGEF4_ENST00000409036.1_Missense_Mutation_p.L860R|RAPGEF4_ENST00000539331.1_Missense_Mutation_p.L707R	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	860	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TATAAAAATCTGAATTCCTTT	0.403																																																	0													117.0	114.0	115.0					2																	173894912		1886	4116	6002	SO:0001583	missense	0			U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.2579T>G	2.37:g.173894912T>G	ENSP00000380271:p.Leu860Arg		B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_DEP_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.L860R	ENST00000397081.3	37	c.2579	CCDS42775.1	2	.	.	.	.	.	.	.	.	.	.	T	26.5	4.748603	0.89753	.	.	ENSG00000091428	ENST00000264111;ENST00000397081;ENST00000409036;ENST00000397087;ENST00000538974;ENST00000540783;ENST00000539331;ENST00000535187;ENST00000397085	T;T;T;T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37;1.37	6.17	6.17	0.99709	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.69305	0.3096	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.991;0.998	T	0.76686	-0.2868	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	716;860	Q8WZA2-3;Q8WZA2	.;RPGF4_HUMAN	R	859;860;860;716;689;707;707;640;91	ENSP00000264111:L859R;ENSP00000380271:L860R;ENSP00000387104:L860R;ENSP00000380276:L716R;ENSP00000440135:L689R;ENSP00000440250:L707R;ENSP00000437384:L707R;ENSP00000438011:L640R;ENSP00000380274:L91R	ENSP00000264111:L859R	L	+	2	0	RAPGEF4	173603158	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	CTG	RAPGEF4	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000091428		0.403	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF4	HGNC	protein_coding	OTTHUMT00000257864.2	-	0.00	56	0	T	NM_007023		173894912	+1	tier1	-	no_errors	ENST00000397081	ensembl	human	known	74_37	missense	37.50	30	18	SNP	1.000	G
RDX	5962	genome.wustl.edu	37	11	110070376	110070376	+	Silent	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:110070376G>A	ENST00000528498.1	-	15	2085	c.1776C>T	c.(1774-1776)ttC>ttT	p.F592F	RDX_ENST00000530301.1_Silent_p.F188F|RDX_ENST00000405097.1_Silent_p.F592F|RDX_ENST00000528900.1_Silent_p.F245F	NM_001260493.1	NP_001247422.1	P35241	RADI_HUMAN	radixin	0					actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		agcgcatctggaacaatgcat	0.478																																					Esophageal Squamous(55;25 1062 11040 28755 44273)												0																																										SO:0001819	synonymous_variant	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000528498.1:c.1776C>T	11.37:g.110070376G>A			A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Silent	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.F592	ENST00000528498.1	37	c.1776	CCDS58174.1	11																																																																																			RDX	-	NULL	ENSG00000137710		0.478	RDX-006	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390531.1	-	0.00	52	0	G	NM_002906		110070376	-1	tier1	-	no_errors	ENST00000530749	ensembl	human	known	74_37	silent	51.85	13	14	SNP	1.000	A
RNF220	55182	genome.wustl.edu	37	1	44877724	44877724	+	5'UTR	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:44877724G>T	ENST00000355387.2	+	0	405				RNF220_ENST00000361799.2_5'UTR|RNF220_ENST00000372247.2_5'Flank			Q5VTB9	RN220_HUMAN	ring finger protein 220						protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(1)|large_intestine(3)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	29						CTCCCTCCCAGGGAAGACTGC	0.517																																																	0													38.0	33.0	34.0					1																	44877724		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			AK056424	CCDS510.1	1p34.1	2008-06-13	2008-06-13	2008-06-13	ENSG00000187147	ENSG00000187147		"""RING-type (C3HC4) zinc fingers"""	25552	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 164"""	C1orf164		11042152	Standard	NM_018150		Approved	FLJ10597	uc001clv.1	Q5VTB9	OTTHUMG00000007697	ENST00000355387.2:c.-46G>T	1.37:g.44877724G>T			B3KPJ3|B4DLZ9|E9PCS1|Q4KMX2|Q9NVP6	RNA	SNP	-	NULL	ENST00000355387.2	37	NULL	CCDS510.1	1																																																																																			RNF220	-	-	ENSG00000187147		0.517	RNF220-001	KNOWN	basic|CCDS	protein_coding	RNF220	HGNC	protein_coding	OTTHUMT00000020683.4	-	0.00	60	0	G	NM_018150		44877724	+1	tier1	-	no_errors	ENST00000487332	ensembl	human	known	74_37	rna	6.76	69	5	SNP	1.000	T
RNASEL	6041	genome.wustl.edu	37	1	182553281	182553281	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:182553281G>T	ENST00000367559.3	-	3	1754	c.1501C>A	c.(1501-1503)Ctg>Atg	p.L501M	RNASEL_ENST00000539397.1_Missense_Mutation_p.L501M|RNASEL_ENST00000444138.1_Missense_Mutation_p.L501M	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	501	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						AAATCTGCCAGGTGAGCAGCT	0.368																																																	0													115.0	118.0	117.0					1																	182553281		2203	4300	6503	SO:0001583	missense	0			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1501C>A	1.37:g.182553281G>T	ENSP00000356530:p.Leu501Met		Q5W0L2|Q6AI46	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.L501M	ENST00000367559.3	37	c.1501	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514268	0.44763	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.72835	-0.69;-0.69;-0.69	5.02	0.922	0.19408	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.135581	0.33235	N	0.005136	D	0.82834	0.5123	M	0.91561	3.22	0.22266	N	0.999245	D;D	0.76494	0.999;0.999	D;D	0.75020	0.985;0.985	T	0.71374	-0.4612	10	0.52906	T	0.07	-9.0488	6.0658	0.19862	0.3032:0.136:0.5608:0.0	.	501;501	Q6AI46;Q05823	.;RN5A_HUMAN	M	501	ENSP00000356530:L501M;ENSP00000411147:L501M;ENSP00000440844:L501M	ENSP00000356530:L501M	L	-	1	2	RNASEL	180819904	0.126000	0.22350	0.429000	0.26710	0.777000	0.43975	0.153000	0.16323	0.240000	0.21263	0.655000	0.94253	CTG	RNASEL	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000135828		0.368	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	HGNC	protein_coding	OTTHUMT00000085189.1	-	0.00	83	0	G	NM_021133		182553281	-1	tier1	-	no_errors	ENST00000367559	ensembl	human	known	74_37	missense	5.38	88	5	SNP	0.113	T
RPN2	6185	genome.wustl.edu	37	20	35866820	35866820	+	Intron	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr20:35866820G>T	ENST00000237530.6	+	16	2194				RPN2_ENST00000470352.1_Intron|RPN2_ENST00000373622.5_Missense_Mutation_p.Q601H	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II						aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				CTGCAGAGCAGAGCAGTAGAT	0.507																																																	0													58.0	50.0	52.0					20																	35866820		1568	3582	5150	SO:0001627	intron_variant	0			Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.1883+1708G>T	20.37:g.35866820G>T			Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Missense_Mutation	SNP	pfam_Swp1	p.Q601H	ENST00000237530.6	37	c.1803	CCDS13291.1	20	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954815	0.73902	.	.	ENSG00000118705	ENST00000373622	T	0.46451	0.87	5.39	5.39	0.77823	.	.	.	.	.	T	0.59945	0.2231	.	.	.	0.29248	N	0.872168	D	0.61697	0.99	D	0.70487	0.969	T	0.57917	-0.7728	8	0.66056	D	0.02	.	9.9575	0.41675	0.0892:0.0:0.9108:0.0	.	601	Q5JYR6	.	H	601	ENSP00000362724:Q601H	ENSP00000362724:Q601H	Q	+	3	2	RPN2	35300234	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.192000	0.50989	2.808000	0.96608	0.655000	0.94253	CAG	RPN2	-	NULL	ENSG00000118705		0.507	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPN2	HGNC	protein_coding	OTTHUMT00000079076.2	-	0.00	72	0	G	NM_002951		35866820	+1	tier1	-	no_errors	ENST00000373622	ensembl	human	novel	74_37	missense	5.41	70	4	SNP	1.000	T
RPS6KB2	6199	genome.wustl.edu	37	11	67202559	67202559	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:67202559C>A	ENST00000312629.5	+	15	1413	c.1368C>A	c.(1366-1368)ccC>ccA	p.P456P	AP003419.16_ENST00000535922.1_RNA	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	456	Pro-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			cgccgccgccctcgaccaccg	0.706																																																	0													13.0	20.0	18.0					11																	67202559		1913	4100	6013	SO:0001819	synonymous_variant	0			AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.1368C>A	11.37:g.67202559C>A			B2RMZ9|B4DML8|O94809|Q9UEC1	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase,pfscan_Prot_kinase_dom	p.P456	ENST00000312629.5	37	c.1368	CCDS41677.1	11																																																																																			RPS6KB2	-	pirsf_Ribosomal_S6_kinase	ENSG00000175634		0.706	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KB2	HGNC	protein_coding	OTTHUMT00000395508.1		0.00	33	0	C	NM_003952		67202559	+1			no_errors	ENST00000312629	ensembl	human	known	74_37	silent	8.06	57	5	SNP	0.025	A
RTN4	57142	genome.wustl.edu	37	2	55199932	55199932	+	3'UTR	DEL	T	T	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:55199932delT	ENST00000337526.6	-	0	4182				RTN4_ENST00000357376.3_3'UTR|RTN4_ENST00000317610.7_3'UTR|RTN4_ENST00000394609.2_3'UTR|RTN4_ENST00000357732.4_3'UTR|RTN4_ENST00000394611.2_3'UTR|RTN4_ENST00000405240.1_3'UTR|RTN4_ENST00000404909.1_3'UTR|RTN4_ENST00000486085.1_5'UTR	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						TGAAAAGGGCTTTTTTTTTTT	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.*360A>-	2.37:g.55199932delT			O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	RNA	DEL	-	NULL	ENST00000337526.6	37	NULL	CCDS42684.1	2																																																																																			RTN4	-	-	ENSG00000115310		0.383	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1		0.00	8	0	T			55199932	-1	tier1		no_errors	ENST00000486085	ensembl	human	known	74_37	rna	30.00	7	3	DEL	0.027	-
RYR2	6262	genome.wustl.edu	37	1	237780787	237780787	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:237780787G>T	ENST00000366574.2	+	38	6233		c.e38+1		RYR2_ENST00000542537.1_Splice_Site|RYR2_ENST00000360064.6_Splice_Site	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCAAGAACAGGTACAGAAATG	0.388																																																	0													77.0	72.0	73.0					1																	237780787		1968	4151	6119	SO:0001630	splice_region_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5916+1G>T	1.37:g.237780787G>T			Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	-	e39+1	ENST00000366574.2	37	c.5910+1	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.390036	0.82902	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.15	5.15	0.70609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6372	0.91383	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR2	235847410	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	9.813000	0.99286	2.401000	0.81631	0.650000	0.86243	.	RYR2	-	-	ENSG00000198626		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2		0.00	30	0	G	NM_001035	Intron	237780787	+1			no_errors	ENST00000360064	ensembl	human	known	74_37	splice_site	9.68	28	3	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23912853	23912853	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:23912853G>T	ENST00000382292.3	-	9	5435	c.5162C>A	c.(5161-5163)tCc>tAc	p.S1721Y	SACS_ENST00000402364.1_Missense_Mutation_p.S971Y|SACS_ENST00000382298.3_Missense_Mutation_p.S1721Y			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	1721					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.S1574F(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CAATGCTTTGGAAGAGCAGGA	0.368																																																	1	Substitution - Missense(1)	lung(1)											46.0	47.0	47.0					13																	23912853		2202	4299	6501	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.5162C>A	13.37:g.23912853G>T	ENSP00000371729:p.Ser1721Tyr		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.S1721Y	ENST00000382292.3	37	c.5162	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	17.50	3.405924	0.62288	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88354	-2.23;-2.37;-2.23	5.78	5.78	0.91487	.	0.057543	0.64402	D	0.000001	D	0.88573	0.6473	L	0.60455	1.87	0.58432	D	0.999995	B	0.15930	0.015	B	0.16722	0.016	D	0.83872	0.0274	10	0.56958	D	0.05	.	20.0067	0.97435	0.0:0.0:1.0:0.0	.	1721	Q9NZJ4	SACS_HUMAN	Y	1721;971;1721	ENSP00000371729:S1721Y;ENSP00000385844:S971Y;ENSP00000371735:S1721Y	ENSP00000371729:S1721Y	S	-	2	0	SACS	22810853	1.000000	0.71417	0.979000	0.43373	0.038000	0.13279	6.242000	0.72376	2.725000	0.93324	0.609000	0.83330	TCC	SACS	-	NULL	ENSG00000151835		0.368	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3		0.00	44	0	G	NM_014363		23912853	-1			no_errors	ENST00000382292	ensembl	human	known	74_37	missense	8.33	22	2	SNP	1.000	T
ZBED9	114821	genome.wustl.edu	37	6	28542921	28542921	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:28542921T>C	ENST00000452236.2	-	3	2178	c.1561A>G	c.(1561-1563)Agt>Ggt	p.S521G	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTAAATGCACTTTCACATGGA	0.423																																																	0													130.0	127.0	128.0					6																	28542921		2203	4300	6503	SO:0001583	missense	0																														ENST00000452236.2:c.1561A>G	6.37:g.28542921T>C	ENSP00000395259:p.Ser521Gly			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.S521G	ENST00000452236.2	37	c.1561	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.608830	0.00842	.	.	ENSG00000232040	ENST00000452236	T	0.41758	0.99	3.28	1.2	0.21068	Integrase, catalytic core (1);Ribonuclease H-like (1);	.	.	.	.	T	0.03263	0.0095	N	0.00538	-1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.42832	-0.9428	9	0.22706	T	0.39	.	4.4098	0.11427	0.0:0.6093:0.0:0.3907	.	521	Q6R2W3	SCND3_HUMAN	G	521	ENSP00000395259:S521G	ENSP00000395259:S521G	S	-	1	0	SCAND3	28650900	0.026000	0.19158	0.015000	0.15790	0.568000	0.35870	0.249000	0.18216	0.577000	0.29470	0.379000	0.24179	AGT	SCAND3	-	superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	ENSG00000232040		0.423	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3		0.00	14	0	T			28542921	-1			no_errors	ENST00000452236	ensembl	human	known	74_37	missense	21.74	18	5	SNP	0.015	C
SCIN	85477	genome.wustl.edu	37	7	12610421	12610421	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:12610421G>T	ENST00000297029.5	+	1	110	c.9G>T	c.(7-9)cgG>cgT	p.R3R	AC005281.2_ENST00000433040.1_RNA	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	3	Actin-severing. {ECO:0000255}.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CCATGGCGCGGGAGCTATACC	0.642																																																	0													15.0	22.0	20.0					7																	12610421		692	1590	2282	SO:0001819	synonymous_variant	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.9G>T	7.37:g.12610421G>T			A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Silent	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.R3	ENST00000297029.5	37	c.9	CCDS47545.1	7																																																																																			SCIN	-	NULL	ENSG00000006747		0.642	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	HGNC	protein_coding	OTTHUMT00000326041.1		0.00	74	0	G	NM_033128		12610421	+1			no_errors	ENST00000297029	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.562	T
SCN7A	6332	genome.wustl.edu	37	2	167322493	167322493	+	Silent	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:167322493C>T	ENST00000409855.1	-	7	795	c.669G>A	c.(667-669)ctG>ctA	p.L223L		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	223					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CAAGGGATTTCAGACCTGGAA	0.388																																																	0													31.0	29.0	30.0					2																	167322493		1816	4073	5889	SO:0001819	synonymous_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.669G>A	2.37:g.167322493C>T				Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L223	ENST00000409855.1	37	c.669	CCDS46442.1	2																																																																																			SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.388	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	41	0	C			167322493	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	silent	27.50	29	11	SNP	0.963	T
SDK1	221935	genome.wustl.edu	37	7	4056935	4056935	+	Silent	SNP	C	C	T	rs562967510		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr7:4056935C>T	ENST00000404826.2	+	17	2692	c.2553C>T	c.(2551-2553)gcC>gcT	p.A851A	SDK1_ENST00000389531.3_Silent_p.A851A	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	851	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACAACGGGGCCGGTCTGGGCG	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		17508	0.0		0.0	False		,,,				2504	0.001																0													74.0	68.0	70.0					7																	4056935		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2553C>T	7.37:g.4056935C>T			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A851	ENST00000404826.2	37	c.2553	CCDS34590.1	7																																																																																			SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.592	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	33	0	C	NM_152744		4056935	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	silent	39.13	28	18	SNP	0.005	T
SEC24B	10427	genome.wustl.edu	37	4	110402835	110402835	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:110402835G>T	ENST00000265175.5	+	4	1118	c.1063G>T	c.(1063-1065)Gtg>Ttg	p.V355L	SEC24B_ENST00000399100.2_Intron|SEC24B_ENST00000504968.2_Missense_Mutation_p.V386L	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	355					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)	p.V355M(1)		breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		CTTTACAGGCGTGCAGTATGG	0.413																																																	1	Substitution - Missense(1)	kidney(1)											200.0	188.0	192.0					4																	110402835		1931	4155	6086	SO:0001583	missense	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.1063G>T	4.37:g.110402835G>T	ENSP00000265175:p.Val355Leu		B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.V355L	ENST00000265175.5	37	c.1063	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	G	8.678	0.904527	0.17760	.	.	ENSG00000138802	ENST00000504968;ENST00000265175	T;T	0.76968	-0.89;-1.06	5.56	3.07	0.35406	.	0.688387	0.14930	N	0.290132	T	0.54615	0.1869	N	0.08118	0	0.22127	N	0.999348	B;B	0.13594	0.008;0.003	B;B	0.09377	0.004;0.004	T	0.30238	-0.9985	10	0.08837	T	0.75	-8.8589	10.3278	0.43805	0.8649:0.0:0.1351:0.0	.	386;355	B7ZKM8;O95487	.;SC24B_HUMAN	L	386;355	ENSP00000428564:V386L;ENSP00000265175:V355L	ENSP00000265175:V355L	V	+	1	0	SEC24B	110622284	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.609000	0.54117	0.373000	0.24621	-0.295000	0.09555	GTG	SEC24B	-	NULL	ENSG00000138802		0.413	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2		0.00	38	0	G			110402835	+1			no_errors	ENST00000265175	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
SELPLG	6404	genome.wustl.edu	37	12	109017671	109017671	+	Missense_Mutation	SNP	G	G	T	rs63748999|rs372173288	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr12:109017671G>T	ENST00000550948.1	-	2	637	c.413C>A	c.(412-414)cCc>cAc	p.P138H	SELPLG_ENST00000388962.3_Intron|SELPLG_ENST00000228463.6_Missense_Mutation_p.P154H			Q14242	SELPL_HUMAN	selectin P ligand	138	12 X 10 AA tandem repeats.		Missing (in short form; not an alternative splicing; dbSNP:rs63748999). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7505206}.		blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						TGCCTCCGTGGGCACTGGTTG	0.612																																																	0													162.0	125.0	138.0					12																	109017671		2203	4299	6502	SO:0001583	missense	0				CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.413C>A	12.37:g.109017671G>T	ENSP00000447752:p.Pro138His		A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	NULL	p.P138H	ENST00000550948.1	37	c.413	CCDS31895.2	12	.	.	.	.	.	.	.	.	.	.	G	10.75	1.437253	0.25900	.	.	ENSG00000110876	ENST00000550948;ENST00000228463	T;T	0.28895	1.59;1.59	3.23	0.162	0.14981	.	.	.	.	.	T	0.19046	0.0457	N	0.19112	0.55	0.09310	N	0.999991	B;B	0.27765	0.188;0.188	B;B	0.33392	0.163;0.163	T	0.29941	-0.9995	9	0.45353	T	0.12	-1.189	5.3531	0.16045	0.27:0.1672:0.5628:0.0	.	154;138	B7Z5C7;Q14242	.;SELPL_HUMAN	H	138;154	ENSP00000447752:P138H;ENSP00000228463:P154H	ENSP00000228463:P154H	P	-	2	0	SELPLG	107541800	0.969000	0.33509	0.000000	0.03702	0.004000	0.04260	2.524000	0.45589	0.022000	0.15160	0.491000	0.48974	CCC	SELPLG	-	NULL	ENSG00000110876		0.612	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELPLG	HGNC	protein_coding	OTTHUMT00000403904.1	-	0.00	91	0	G			109017671	-1	tier1	-	no_errors	ENST00000550948	ensembl	human	known	74_37	missense	35.29	65	36	SNP	0.007	T
SLC30A4	7782	genome.wustl.edu	37	15	45779787	45779787	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr15:45779787G>T	ENST00000261867.4	-	6	1252	c.938C>A	c.(937-939)tCa>tAa	p.S313*	RP11-519G16.3_ENST00000558536.1_RNA|RP11-519G16.3_ENST00000560647.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	313					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		CACAAGTAATGAAAATACGTA	0.308																																																	0													135.0	144.0	141.0					15																	45779787		2198	4297	6495	SO:0001587	stop_gained	0				CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.938C>A	15.37:g.45779787G>T	ENSP00000261867:p.Ser313*		Q8TC39	Nonsense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.S313*	ENST00000261867.4	37	c.938	CCDS10125.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.508226	0.98325	.	.	ENSG00000104154	ENST00000261867	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7055	19.1349	0.93424	0.0:0.0:1.0:0.0	.	.	.	.	X	313	.	ENSP00000261867:S313X	S	-	2	0	SLC30A4	43567079	1.000000	0.71417	1.000000	0.80357	0.753000	0.42808	9.386000	0.97228	2.861000	0.98227	0.655000	0.94253	TCA	SLC30A4	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000104154		0.308	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A4	HGNC	protein_coding	OTTHUMT00000254236.1		0.00	57	0	G			45779787	-1			no_errors	ENST00000261867	ensembl	human	known	74_37	nonsense	5.05	94	5	SNP	1.000	T
SLC5A2	6524	genome.wustl.edu	37	16	31500246	31500246	+	Silent	SNP	C	C	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:31500246C>A	ENST00000330498.3	+	11	1345	c.1326C>A	c.(1324-1326)ccC>ccA	p.P442P	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	442					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)	p.P442P(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	CCTGGCTTCCCGTGGTGCAGG	0.682																																																	1	Substitution - coding silent(1)	lung(1)											52.0	48.0	50.0					16																	31500246		2197	4299	6496	SO:0001819	synonymous_variant	0				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1326C>A	16.37:g.31500246C>A			A2RRD2	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.P442	ENST00000330498.3	37	c.1326	CCDS10714.1	16																																																																																			SLC5A2	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000140675		0.682	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	HGNC	protein_coding	OTTHUMT00000255627.2	-	0.00	51	0	C			31500246	+1	tier1	-	no_errors	ENST00000330498	ensembl	human	known	74_37	silent	9.30	38	4	SNP	0.541	A
SLC7A2	6542	genome.wustl.edu	37	8	17412565	17412565	+	Intron	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr8:17412565C>T	ENST00000494857.1	+	8	1413				SLC7A2_ENST00000522656.1_Intron|SLC7A2_ENST00000470360.1_Missense_Mutation_p.A429V|SLC7A2_ENST00000398090.3_Missense_Mutation_p.A429V|SLC7A2_ENST00000004531.10_Intron	NM_001008539.3	NP_001008539.3	P52569	CTR2_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 2						amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|macrophage activation (GO:0042116)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide production involved in inflammatory response (GO:0002537)|regulation of inflammatory response (GO:0050727)|regulation of macrophage activation (GO:0043030)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	basic amino acid transmembrane transporter activity (GO:0015174)|high-affinity arginine transmembrane transporter activity (GO:0005289)|L-lysine transmembrane transporter activity (GO:0015189)|L-ornithine transmembrane transporter activity (GO:0000064)	p.A429V(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(8)|ovary(2)|skin(1)|stomach(1)	25				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	L-Lysine(DB00123)|L-Ornithine(DB00129)	CCAGTTGCTGCCACGTTGACT	0.443																																																	1	Substitution - Missense(1)	endometrium(1)											162.0	149.0	153.0					8																	17412565		2203	4300	6503	SO:0001627	intron_variant	0			D29990	CCDS6002.2, CCDS34852.1, CCDS55203.1	8p22	2013-05-22			ENSG00000003989	ENSG00000003989		"""Solute carriers"""	11060	protein-coding gene	gene with protein product		601872		ATRC2		8954799	Standard	NM_001164771		Approved	CAT-2, HCAT2	uc011kye.2	P52569	OTTHUMG00000130819	ENST00000494857.1:c.1195+357C>T	8.37:g.17412565C>T			B7ZL54|O15291|O15292|Q14CQ6|Q6NSZ7|Q86TC6	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	p.A429V	ENST00000494857.1	37	c.1286	CCDS34852.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.157286	0.94686	.	.	ENSG00000003989	ENST00000470360;ENST00000398090	D;D	0.91740	-2.9;-2.9	5.15	5.15	0.70609	.	0.049960	0.85682	D	0.000000	D	0.96166	0.8750	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.96365	0.9269	9	0.66056	D	0.02	.	19.0069	0.92854	0.0:1.0:0.0:0.0	.	429	P52569-2	.	V	429	ENSP00000419873:A429V;ENSP00000381164:A429V	ENSP00000381164:A429V	A	+	2	0	SLC7A2	17456857	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.579000	0.87056	0.460000	0.39030	GCC	SLC7A2	-	pfam_AA-permease/SLC12A_dom,tigrfam_Cat_AA_permease	ENSG00000003989		0.443	SLC7A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A2	HGNC	protein_coding	OTTHUMT00000253367.3		0.00	51	0	C	NM_003046		17412565	+1			no_errors	ENST00000398090	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103124546	103124546	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:103124546G>T	ENST00000295269.4	+	5	1664	c.1207G>T	c.(1207-1209)Gct>Tct	p.A403S		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	403					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						AGGCGTATTTGCTCTCTTCTA	0.478																																																	0													140.0	143.0	142.0					2																	103124546		2203	4300	6503	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1207G>T	2.37:g.103124546G>T	ENSP00000295269:p.Ala403Ser		Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.A403S	ENST00000295269.4	37	c.1207	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	13.36	2.214383	0.39102	.	.	ENSG00000180251	ENST00000295269	T	0.16073	2.37	5.1	2.21	0.28008	Cation/H+ exchanger (1);	0.228496	0.45606	N	0.000345	T	0.05960	0.0155	N	0.05280	-0.08	0.26671	N	0.971738	B	0.16603	0.018	B	0.15870	0.014	T	0.29610	-1.0006	10	0.23891	T	0.37	.	1.9746	0.03413	0.1536:0.1347:0.435:0.2767	.	403	Q6AI14	SL9A4_HUMAN	S	403	ENSP00000295269:A403S	ENSP00000295269:A403S	A	+	1	0	SLC9A4	102490978	0.998000	0.40836	0.854000	0.33618	0.917000	0.54804	1.997000	0.40786	0.226000	0.20979	-0.136000	0.14681	GCT	SLC9A4	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000180251		0.478	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	-	0.00	62	0	G	NM_001011552.3		103124546	+1	tier1	-	no_errors	ENST00000295269	ensembl	human	known	74_37	missense	29.27	58	24	SNP	0.924	T
SLIT1	6585	genome.wustl.edu	37	10	98808867	98808867	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:98808867G>T	ENST00000266058.4	-	14	1555	c.1310C>A	c.(1309-1311)gCg>gAg	p.A437E	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.A437E	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	437					axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		AGGGTTCTGCGCCAGGTGCCT	0.617																																																	0													54.0	49.0	50.0					10																	98808867		2203	4300	6503	SO:0001583	missense	0			AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1310C>A	10.37:g.98808867G>T	ENSP00000266058:p.Ala437Glu		Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_EG-like_dom,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.A437E	ENST00000266058.4	37	c.1310	CCDS7453.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.065721	0.93898	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	T;T;T	0.52057	1.86;1.86;0.68	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.60599	0.2281	L	0.33792	1.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.64041	-0.6500	10	0.87932	D	0	.	18.6447	0.91407	0.0:0.0:1.0:0.0	.	447;437	E7EWQ8;O75093	.;SLIT1_HUMAN	E	437;447;437;430	ENSP00000266058:A437E;ENSP00000360109:A437E;ENSP00000315005:A430E	ENSP00000266058:A437E	A	-	2	0	SLIT1	98798857	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.514000	0.98013	2.626000	0.88956	0.557000	0.71058	GCG	SLIT1	-	NULL	ENSG00000187122		0.617	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT1	HGNC	protein_coding	OTTHUMT00000049636.1		0.00	23	0	G	NM_003061		98808867	-1			no_errors	ENST00000266058	ensembl	human	known	74_37	missense	12.12	28	4	SNP	1.000	T
SMARCA4	6597	genome.wustl.edu	37	19	11097213	11097213	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:11097213G>A	ENST00000429416.3	+	5	985	c.704G>A	c.(703-705)gGc>gAc	p.G235D	SMARCA4_ENST00000589677.1_Missense_Mutation_p.G235D|SMARCA4_ENST00000444061.3_Missense_Mutation_p.G235D|SMARCA4_ENST00000590574.1_Missense_Mutation_p.G235D|SMARCA4_ENST00000450717.3_Missense_Mutation_p.G235D|SMARCA4_ENST00000344626.4_Missense_Mutation_p.G235D|SMARCA4_ENST00000358026.2_Missense_Mutation_p.G235D|SMARCA4_ENST00000413806.3_Missense_Mutation_p.G235D|SMARCA4_ENST00000541122.2_Missense_Mutation_p.G235D	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	235	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				cctggccctggccctggcccc	0.692			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)											3.0	3.0	3.0					19																	11097213		1843	3626	5469	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.704G>A	19.37:g.11097213G>A	ENSP00000395654:p.Gly235Asp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.G235D	ENST00000429416.3	37	c.704	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332057	0.41297	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.86865	-2.17;-2.18;-2.17;-2.18;-2.17;-2.17;-2.18	4.83	4.83	0.62350	.	0.077437	0.49305	D	0.000147	D	0.88573	0.6473	L	0.36672	1.1	0.46586	D	0.99911	D;D;D;D;D;D;D	0.64830	0.994;0.994;0.994;0.994;0.994;0.994;0.994	D;D;D;P;D;D;D	0.65010	0.931;0.931;0.931;0.705;0.931;0.931;0.931	D	0.85029	0.0916	10	0.13470	T	0.59	-23.4097	16.7199	0.85407	0.0:0.0:1.0:0.0	.	235;235;235;235;235;235;235	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	D	235	ENSP00000395654:G235D;ENSP00000350720:G235D;ENSP00000343896:G235D;ENSP00000445036:G235D;ENSP00000392837:G235D;ENSP00000397783:G235D;ENSP00000414727:G235D	ENSP00000343896:G235D	G	+	2	0	SMARCA4	10958213	1.000000	0.71417	0.998000	0.56505	0.478000	0.33099	5.992000	0.70609	2.240000	0.73641	0.462000	0.41574	GGC	SMARCA4	-	NULL	ENSG00000127616		0.692	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	13	0	G	NM_003072		11097213	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	26.32	13	5	SNP	1.000	A
SPRY1	10252	genome.wustl.edu	37	4	124323397	124323397	+	Silent	SNP	A	A	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:124323397A>G	ENST00000394339.2	+	2	991	c.651A>G	c.(649-651)gaA>gaG	p.E217E	SPRY1_ENST00000339241.1_Silent_p.E217E	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	217	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						GCATGGTGGAATATGGAACCT	0.512																																																	0													224.0	186.0	199.0					4																	124323397		2203	4300	6503	SO:0001819	synonymous_variant	0			AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.651A>G	4.37:g.124323397A>G			D3DNX6|Q6PNE0	Silent	SNP	pfam_Sprouty	p.E217	ENST00000394339.2	37	c.651	CCDS3731.1	4																																																																																			SPRY1	-	pfam_Sprouty	ENSG00000164056		0.512	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY1	HGNC	protein_coding	OTTHUMT00000256711.1	-	0.00	58	0	A			124323397	+1	tier1	-	no_errors	ENST00000339241	ensembl	human	known	74_37	silent	33.33	34	17	SNP	0.696	G
SRPX2	27286	genome.wustl.edu	37	X	99920277	99920277	+	Silent	SNP	T	T	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:99920277T>G	ENST00000373004.3	+	6	998	c.570T>G	c.(568-570)cgT>cgG	p.R190R		NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2	190	HYR. {ECO:0000255|PROSITE- ProRule:PRU00113}.				angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						CCCACTCACGTGAGAAGATGG	0.532																																																	0													86.0	71.0	76.0					X																	99920277		2203	4300	6503	SO:0001819	synonymous_variant	0			AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.570T>G	X.37:g.99920277T>G			B3KQT3|Q8WW85	Silent	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,superfamily_Thioredoxin-like_fold,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.R190	ENST00000373004.3	37	c.570	CCDS14471.1	X																																																																																			SRPX2	-	pfam_Hyalin,pfscan_Hyalin	ENSG00000102359		0.532	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	HGNC	protein_coding	OTTHUMT00000057486.1	-	0.00	28	0	T	NM_014467		99920277	+1	tier1	-	no_errors	ENST00000373004	ensembl	human	known	74_37	silent	89.06	7	57	SNP	0.978	G
STAG1	10274	genome.wustl.edu	37	3	136082262	136082262	+	Silent	SNP	G	G	T	rs145404587	byFrequency	TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr3:136082262G>T	ENST00000383202.2	-	26	2989	c.2733C>A	c.(2731-2733)acC>acA	p.T911T	STAG1_ENST00000434713.2_Intron|STAG1_ENST00000236698.5_Silent_p.T911T|STAG1_ENST00000536929.1_Silent_p.T495T	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	911					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CAATCTGCCTGGTTTTACTCA	0.343																																																	0								G		5,4401	9.9+/-24.2	0,5,2198	172.0	163.0	166.0		2733	1.0	1.0	3	dbSNP_134	166	0,8600		0,0,4300	no	coding-synonymous	STAG1	NM_005862.2		0,5,6498	TT,TG,GG		0.0,0.1135,0.0384		911/1259	136082262	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.2733C>A	3.37:g.136082262G>T			O00539|Q6P275	Silent	SNP	pfam_STAG,superfamily_ARM-type_fold	p.T911	ENST00000383202.2	37	c.2733	CCDS3090.1	3																																																																																			STAG1	-	NULL	ENSG00000118007		0.343	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	-	0.00	98	0	G	NM_005862		136082262	-1	tier1	rs145404587	no_errors	ENST00000383202	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.999	T
STK39	27347	genome.wustl.edu	37	2	168931518	168931518	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:168931518G>T	ENST00000355999.4	-	12	1921	c.1216C>A	c.(1216-1218)Cga>Aga	p.R406R	STK39_ENST00000487143.1_5'UTR	NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39	406					cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						TTTACTCTTCGTGACTGTAAA	0.318																																																	0													126.0	124.0	125.0					2																	168931518		1833	4087	5920	SO:0001819	synonymous_variant	0			AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.1216C>A	2.37:g.168931518G>T			O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R406	ENST00000355999.4	37	c.1216	CCDS42770.1	2																																																																																			STK39	-	NULL	ENSG00000198648		0.318	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK39	HGNC	protein_coding	OTTHUMT00000258112.2	-	0.00	64	0	G	NM_013233		168931518	-1	tier1	-	no_errors	ENST00000355999	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
SUPT16H	11198	genome.wustl.edu	37	14	21840137	21840137	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:21840137T>C	ENST00000216297.2	-	3	564	c.226A>G	c.(226-228)Atg>Gtg	p.M76V		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	76					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTGCTGGCCATAAAGATGATT	0.398																																																	0													110.0	94.0	100.0					14																	21840137		2203	4300	6503	SO:0001583	missense	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.226A>G	14.37:g.21840137T>C	ENSP00000216297:p.Met76Val		Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.M76V	ENST00000216297.2	37	c.226	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	T	14.77	2.635835	0.47049	.	.	ENSG00000092201	ENST00000216297;ENST00000538230	.	.	.	5.51	5.51	0.81932	.	0.043982	0.85682	D	0.000000	T	0.41351	0.1155	N	0.16166	0.38	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.24083	-1.0170	9	0.27785	T	0.31	-23.7691	14.9059	0.70718	0.0:0.0:0.0:1.0	.	76	Q9Y5B9	SP16H_HUMAN	V	76	.	ENSP00000216297:M76V	M	-	1	0	SUPT16H	20909977	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.743000	0.62110	2.225000	0.72522	0.533000	0.62120	ATG	SUPT16H	-	NULL	ENSG00000092201		0.398	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	-	0.00	74	0	T			21840137	-1	tier1	-	no_errors	ENST00000216297	ensembl	human	known	74_37	missense	20.69	92	24	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152712639	152712639	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr6:152712639G>T	ENST00000367255.5	-	52	8378	c.7777C>A	c.(7777-7779)Cag>Aag	p.Q2593K	SYNE1_ENST00000423061.1_Missense_Mutation_p.Q2600K|SYNE1_ENST00000341594.5_Missense_Mutation_p.Q2632K|SYNE1_ENST00000265368.4_Missense_Mutation_p.Q2593K|SYNE1_ENST00000448038.1_Missense_Mutation_p.Q2600K	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2593					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CGGCCCTCCTGCCCAGCACCG	0.493										HNSCC(10;0.0054)																																							0													46.0	49.0	48.0					6																	152712639		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7777C>A	6.37:g.152712639G>T	ENSP00000356224:p.Gln2593Lys		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q2593K	ENST00000367255.5	37	c.7777	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	10.31	1.316071	0.23908	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.52526	0.75;0.73;0.66;0.73;0.85	5.91	-1.03	0.10102	.	0.199096	0.34700	N	0.003755	T	0.06325	0.0163	N	0.02011	-0.69	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.0;0.0;0.001	T	0.44590	-0.9318	10	0.05833	T	0.94	.	18.8503	0.92225	0.0:0.0:0.7279:0.2721	.	2576;2593;2593;2600	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	K	2593;2600;2593;2600;2632	ENSP00000356224:Q2593K;ENSP00000396024:Q2600K;ENSP00000265368:Q2593K;ENSP00000390975:Q2600K;ENSP00000341887:Q2632K	ENSP00000265368:Q2593K	Q	-	1	0	SYNE1	152754332	0.004000	0.15560	0.008000	0.14137	0.936000	0.57629	0.987000	0.29603	-0.385000	0.07833	0.655000	0.94253	CAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.493	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	74	0	G	NM_182961		152712639	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.000	T
SYNJ1	8867	genome.wustl.edu	37	21	34038771	34038771	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr21:34038771delT	ENST00000322229.7	-	15	1923	c.1924delA	c.(1924-1926)atcfs	p.I642fs	SYNJ1_ENST00000433931.2_Frame_Shift_Del_p.I681fs|SYNJ1_ENST00000382499.2_Frame_Shift_Del_p.I681fs|SYNJ1_ENST00000357345.3_Frame_Shift_Del_p.I642fs|SYNJ1_ENST00000382491.3_Frame_Shift_Del_p.I637fs			O43426	SYNJ1_HUMAN	synaptojanin 1	642	Catalytic. {ECO:0000255}.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						TGTGGTCTGATAAAAACAAAC	0.418																																																	0													189.0	199.0	196.0					21																	34038771		2203	4300	6503	SO:0001589	frameshift_variant	0			AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.1924delA	21.37:g.34038771delT	ENSP00000322234:p.Ile642fs		O43425|O94984|Q4KMR1	Frame_Shift_Del	DEL	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.I681fs	ENST00000322229.7	37	c.2041	CCDS54484.1	21																																																																																			SYNJ1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000159082		0.418	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	HGNC	protein_coding			0.00	78	0	T			34038771	-1	tier1		no_errors	ENST00000433931	ensembl	human	known	74_37	frame_shift_del	42.62	35	26	DEL	1.000	-
TEKT4	150483	genome.wustl.edu	37	2	95539265	95539265	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr2:95539265G>T	ENST00000295201.4	+	2	636	c.499G>T	c.(499-501)Gaa>Taa	p.E167*	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	167					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCTCCCTCAGGAAGCCGAGCT	0.602																																																	0													67.0	62.0	64.0					2																	95539265		2203	4300	6503	SO:0001630	splice_region_variant	0			AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.499-1G>T	2.37:g.95539265G>T				Nonsense_Mutation	SNP	pfam_Tektin,prints_Tektin	p.E167*	ENST00000295201.4	37	c.499	CCDS2005.1	2	.	.	.	.	.	.	.	.	.	.	.	18.09	3.547345	0.65311	.	.	ENSG00000163060	ENST00000295201	.	.	.	1.64	1.64	0.23874	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.278	6.6605	0.23011	0.0:0.0:1.0:0.0	.	.	.	.	X	167	.	ENSP00000295201:E167X	E	+	1	0	TEKT4	94902992	1.000000	0.71417	0.765000	0.31456	0.666000	0.39218	4.503000	0.60407	0.900000	0.36469	0.196000	0.17591	GAA	TEKT4	-	pfam_Tektin	ENSG00000163060		0.602	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	HGNC	protein_coding	OTTHUMT00000252777.1	-	0.00	45	0	G	NM_144705	Nonsense_Mutation	95539265	+1	tier1	-	no_errors	ENST00000295201	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
TIGD7	91151	genome.wustl.edu	37	16	3350311	3350311	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:3350311C>T	ENST00000396862.1	-	2	2132	c.304G>A	c.(304-306)Gag>Aag	p.E102K	TIGD7_ENST00000268674.2_Missense_Mutation_p.E102K|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	102	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						GCCTGAAGCTCCACGCCTCTT	0.493																																																	0													112.0	108.0	109.0					16																	3350311		2197	4300	6497	SO:0001583	missense	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.304G>A	16.37:g.3350311C>T	ENSP00000380071:p.Glu102Lys		Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E102K	ENST00000396862.1	37	c.304	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081830	0.76528	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.29917	1.55;1.55	5.22	5.22	0.72569	Homeodomain-related (1);Pogo transposase / Cenp-B / PDC2, DNA-binding HTH domain (3);Homeodomain-like (1);	0.000000	0.42682	U	0.000677	T	0.32556	0.0833	L	0.53249	1.67	0.36992	D	0.894816	P	0.38711	0.643	B	0.38921	0.285	T	0.40664	-0.9551	10	0.54805	T	0.06	.	14.2675	0.66129	0.0:1.0:0.0:0.0	.	102	Q6NT04	TIGD7_HUMAN	K	102	ENSP00000380071:E102K;ENSP00000268674:E102K	ENSP00000268674:E102K	E	-	1	0	TIGD7	3290312	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.622000	0.54217	2.442000	0.82660	0.655000	0.94253	GAG	TIGD7	-	pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom	ENSG00000140993		0.493	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	-	0.00	61	0	C	NM_033208		3350311	-1	tier1	-	no_errors	ENST00000268674	ensembl	human	known	74_37	missense	52.00	24	26	SNP	1.000	T
TOB2	10766	genome.wustl.edu	37	22	41832910	41832910	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr22:41832910T>C	ENST00000327492.3	-	2	1146	c.440A>G	c.(439-441)gAc>gGc	p.D147G		NM_016272.3	NP_057356.1	Q14106	TOB2_HUMAN	transducer of ERBB2, 2	147					female gamete generation (GO:0007292)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ossification (GO:0045778)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						CAGGGAGCTGTCCTGGCTGCC	0.622																																																	0													87.0	76.0	80.0					22																	41832910		2203	4300	6503	SO:0001583	missense	0			D64109	CCDS14015.1	22q13.2	2010-02-26			ENSG00000183864	ENSG00000183864			11980	protein-coding gene	gene with protein product		607396		TROB2		10602502, 10591208	Standard	XM_005261315		Approved	TOBL, TOB4, bK223H9	uc003azz.1	Q14106	OTTHUMG00000150970	ENST00000327492.3:c.440A>G	22.37:g.41832910T>C	ENSP00000331305:p.Asp147Gly		Q6FHR7|Q6PIT9|Q9BY97|Q9UBI0	Missense_Mutation	SNP	pfam_Anti_prolifrtn,pfam_Ataxin-2_C,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.D147G	ENST00000327492.3	37	c.440	CCDS14015.1	22	.	.	.	.	.	.	.	.	.	.	T	10.51	1.370933	0.24771	.	.	ENSG00000183864	ENST00000327492	T	0.44083	0.93	6.07	5.03	0.67393	.	0.121832	0.56097	N	0.000032	T	0.33644	0.0870	L	0.51422	1.61	0.36833	D	0.886999	B	0.25850	0.136	B	0.24006	0.05	T	0.28004	-1.0057	10	0.22109	T	0.4	.	7.9794	0.30175	0.0:0.0683:0.1369:0.7948	.	147	Q14106	TOB2_HUMAN	G	147	ENSP00000331305:D147G	ENSP00000331305:D147G	D	-	2	0	TOB2	40162856	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.921000	0.40035	1.111000	0.41721	0.533000	0.62120	GAC	TOB2	-	NULL	ENSG00000183864		0.622	TOB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOB2	HGNC	protein_coding	OTTHUMT00000320699.1	-	0.00	40	0	T	NM_016272		41832910	-1	tier1	-	no_errors	ENST00000327492	ensembl	human	known	74_37	missense	43.18	25	19	SNP	1.000	C
TOE1	114034	genome.wustl.edu	37	1	45809288	45809288	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:45809288G>C	ENST00000372090.5	+	8	2030	c.1447G>C	c.(1447-1449)Gta>Cta	p.V483L	TESK2_ENST00000486676.1_5'Flank|TOE1_ENST00000539779.1_Missense_Mutation_p.V403L|TOE1_ENST00000495703.1_3'UTR	NM_025077.3	NP_079353.3	Q96GM8	TOE1_HUMAN	target of EGR1, member 1 (nuclear)	483						nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	11	Acute lymphoblastic leukemia(166;0.155)					TGGCAAAGCTGTACCCCTCAC	0.542																																																	0													67.0	65.0	66.0					1																	45809288		2203	4300	6503	SO:0001583	missense	0				CCDS521.1	1p33	2011-02-03			ENSG00000132773	ENSG00000132773			15954	protein-coding gene	gene with protein product		613931				12562764	Standard	NM_025077		Approved		uc009vxq.3	Q96GM8	OTTHUMG00000007678	ENST00000372090.5:c.1447G>C	1.37:g.45809288G>C	ENSP00000361162:p.Val483Leu		B4DEM6|Q6IA35|Q8IWN5|Q9H846	Missense_Mutation	SNP	pfam_RNase_CAF1,pfam_Znf_CCCH,superfamily_RNaseH-like_dom	p.V483L	ENST00000372090.5	37	c.1447	CCDS521.1	1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.862334	0.51482	.	.	ENSG00000132773	ENST00000372090;ENST00000539779	T;T	0.32515	1.46;1.45	6.17	5.26	0.73747	.	0.111018	0.64402	D	0.000009	T	0.33760	0.0874	L	0.56769	1.78	0.58432	D	0.99999	P;P	0.41159	0.74;0.74	B;B	0.39904	0.313;0.212	T	0.12941	-1.0528	10	0.62326	D	0.03	-11.7773	15.01	0.71542	0.0673:0.0:0.9327:0.0	.	403;483	B4DEM6;Q96GM8	.;TOE1_HUMAN	L	483;403	ENSP00000361162:V483L;ENSP00000438900:V403L	ENSP00000361162:V483L	V	+	1	0	TOE1	45581875	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.798000	0.69095	2.941000	0.99782	0.655000	0.94253	GTA	TOE1	-	NULL	ENSG00000132773		0.542	TOE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOE1	HGNC	protein_coding	OTTHUMT00000020517.1	-	0.00	39	0	G	NM_025077		45809288	+1	tier1	-	no_errors	ENST00000372090	ensembl	human	known	74_37	missense	38.10	26	16	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577556	7577556	+	Missense_Mutation	SNP	C	C	T	rs121912655|rs397516437		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr17:7577556C>T	ENST00000269305.4	-	7	914	c.725G>A	c.(724-726)tGc>tAc	p.C242Y	TP53_ENST00000413465.2_Missense_Mutation_p.C242Y|TP53_ENST00000359597.4_Missense_Mutation_p.C242Y|TP53_ENST00000420246.2_Missense_Mutation_p.C242Y|TP53_ENST00000455263.2_Missense_Mutation_p.C242Y|TP53_ENST00000445888.2_Missense_Mutation_p.C242Y|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	242	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:16959974}.|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C242F(82)|p.C242Y(44)|p.C242S(16)|p.0?(8)|p.C149F(6)|p.?(5)|p.N239_C242delNSSC(3)|p.C149Y(2)|p.C238fs*21(1)|p.C242fs*20(1)|p.Y236_M243delYMCNSSCM(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.N239fs*4(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCGCCCATGCAGGAACTGTT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	175	Substitution - Missense(150)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(5)|Deletion - Frameshift(4)|Complex - deletion inframe(1)	lung(35)|upper_aerodigestive_tract(22)|liver(16)|oesophagus(15)|large_intestine(13)|breast(12)|central_nervous_system(11)|ovary(11)|urinary_tract(9)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(6)|stomach(5)|bone(5)|endometrium(3)|soft_tissue(1)|eye(1)|thymus(1)|kidney(1)|pancreas(1)|prostate(1)	GRCh37	CM910618	TP53	M	rs121912655						140.0	107.0	119.0					17																	7577556		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.725G>A	17.37:g.7577556C>T	ENSP00000269305:p.Cys242Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C242Y	ENST00000269305.4	37	c.725	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430778	0.83776	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99915	-7.99;-7.99;-7.99;-7.99;-7.99;-7.99;-7.99;-7.99	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99930	0.9968	M	0.92784	3.345	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95727	0.8771	10	0.87932	D	0	-27.558	15.3618	0.74483	0.0:1.0:0.0:0.0	.	242;242;149;242;242;242	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	242;242;242;242;242;242;231;149;110;149	ENSP00000410739:C242Y;ENSP00000352610:C242Y;ENSP00000269305:C242Y;ENSP00000398846:C242Y;ENSP00000391127:C242Y;ENSP00000391478:C242Y;ENSP00000425104:C110Y;ENSP00000423862:C149Y	ENSP00000269305:C242Y	C	-	2	0	TP53	7518281	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	44	0	C	NM_000546		7577556	-1	tier1	rs121912655	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	80.39	10	41	SNP	1.000	T
TRIP11	9321	genome.wustl.edu	37	14	92472172	92472172	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr14:92472172C>T	ENST00000267622.4	-	11	2521	c.2148G>A	c.(2146-2148)atG>atA	p.M716I		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	716					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTCCTTTTTCCATTTTTAGAG	0.383			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													151.0	156.0	154.0					14																	92472172		2203	4300	6503	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2148G>A	14.37:g.92472172C>T	ENSP00000267622:p.Met716Ile		B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.M716I	ENST00000267622.4	37	c.2148	CCDS9899.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.051|0.051	-1.250343|-1.250343	0.01469|0.01469	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000554357|ENST00000267622;ENST00000542257	.|T	.|0.03831	.|3.79	6.16|6.16	2.24|2.24	0.28232|0.28232	.|.	.|0.741250	.|0.13964	.|N	.|0.350640	T|T	0.04272|0.04272	0.0118|0.0118	L|L	0.40543|0.40543	1.245|1.245	0.29940|0.29940	N|N	0.821185|0.821185	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.09377	.|0.0;0.004	T|T	0.25710|0.25710	-1.0124|-1.0124	5|10	.|0.38643	.|T	.|0.18	.|.	4.143|4.143	0.10203|0.10203	0.1132:0.5962:0.1096:0.1809|0.1132:0.5962:0.1096:0.1809	.|.	.|452;716	.|F5H1Z0;Q15643	.|.;TRIPB_HUMAN	R|I	432|716;452	.|ENSP00000267622:M716I	.|ENSP00000267622:M716I	G|M	-|-	1|3	0|0	TRIP11|TRIP11	91541925|91541925	0.628000|0.628000	0.27138|0.27138	0.008000|0.008000	0.14137|0.14137	0.070000|0.070000	0.16714|0.16714	0.337000|0.337000	0.19841|0.19841	0.450000|0.450000	0.26774|0.26774	0.650000|0.650000	0.86243|0.86243	GGA|ATG	TRIP11	-	NULL	ENSG00000100815		0.383	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	-	0.00	28	0	C			92472172	-1	tier1	-	no_errors	ENST00000267622	ensembl	human	known	74_37	missense	32.76	39	19	SNP	0.765	T
TROVE2	6738	genome.wustl.edu	37	1	193045171	193045171	+	Splice_Site	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:193045171G>T	ENST00000367446.3	+	3	1011		c.e3+1		TROVE2_ENST00000416058.2_Splice_Site|TROVE2_ENST00000367441.1_Splice_Site|TROVE2_ENST00000400968.2_Splice_Site|TROVE2_ENST00000367445.3_Splice_Site|TROVE2_ENST00000460715.2_Intron|TROVE2_ENST00000367444.3_Splice_Site|TROVE2_ENST00000367443.1_Splice_Site|TROVE2_ENST00000432079.1_Splice_Site	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						GTCTAAAGAGGTGAGTGAATT	0.308																																																	0													39.0	38.0	38.0					1																	193045171		1817	4078	5895	SO:0001630	splice_region_variant	0			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.801+1G>T	1.37:g.193045171G>T			B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Splice_Site	SNP	-	e2+1	ENST00000367446.3	37	c.801+1	CCDS1379.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012785	0.75161	.	.	ENSG00000116747	ENST00000400968;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4364	0.99089	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TROVE2	191311794	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	9.272000	0.95707	2.843000	0.97960	0.585000	0.79938	.	TROVE2	-	-	ENSG00000116747		0.308	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1		0.00	51	0	G	NM_004600	Intron	193045171	+1			no_errors	ENST00000367441	ensembl	human	known	74_37	splice_site	6.25	30	2	SNP	1.000	T
TRPC5	7224	genome.wustl.edu	37	X	111078315	111078315	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chrX:111078315C>G	ENST00000262839.2	-	7	2648	c.1730G>C	c.(1729-1731)tGg>tCg	p.W577S		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	577					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AAATACAGACCAGAAGAGTGA	0.383																																																	0													199.0	197.0	198.0					X																	111078315		2203	4300	6503	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1730G>C	X.37:g.111078315C>G	ENSP00000262839:p.Trp577Ser		B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.W577S	ENST00000262839.2	37	c.1730	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523480	0.85600	.	.	ENSG00000072315	ENST00000262839	D	0.98345	-4.88	5.56	5.56	0.83823	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99233	0.9733	M	0.92367	3.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.99180	1.0867	10	0.87932	D	0	-8.0239	18.5256	0.90971	0.0:1.0:0.0:0.0	.	578;577	Q59G51;Q9UL62	.;TRPC5_HUMAN	S	577	ENSP00000262839:W577S	ENSP00000262839:W577S	W	-	2	0	TRPC5	110964971	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.773000	0.85462	2.318000	0.78349	0.544000	0.68410	TGG	TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000072315		0.383	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	-	0.00	34	0	C	NM_012471		111078315	-1	tier1	-	no_errors	ENST00000262839	ensembl	human	known	74_37	missense	31.37	35	16	SNP	1.000	G
TRPM3	80036	genome.wustl.edu	37	9	73240146	73240146	+	Silent	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr9:73240146G>A	ENST00000377111.2	-	13	1977	c.1734C>T	c.(1732-1734)cgC>cgT	p.R578R	TRPM3_ENST00000377105.1_Silent_p.R437R|TRPM3_ENST00000377110.3_Silent_p.R578R|TRPM3_ENST00000357533.2_Silent_p.R592R|TRPM3_ENST00000396285.1_Silent_p.R425R|TRPM3_ENST00000423814.3_Silent_p.R605R|TRPM3_ENST00000377106.1_Silent_p.R450R|TRPM3_ENST00000360823.2_Silent_p.R450R|TRPM3_ENST00000358082.3_Silent_p.R450R|TRPM3_ENST00000396292.4_Silent_p.R450R|TRPM3_ENST00000396280.5_Silent_p.R437R|TRPM3_ENST00000408909.2_Silent_p.R437R	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	603					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GGGTCCGGAAGCGCTTGCGCG	0.597																																																	0													39.0	40.0	40.0					9																	73240146		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1734C>T	9.37:g.73240146G>A			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	pfam_Ion_trans_dom	p.R605	ENST00000377111.2	37	c.1815		9	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408438	0.25378	.	.	ENSG00000083067	ENST00000396280	.	.	.	6.03	3.12	0.35913	.	.	.	.	.	T	0.52629	0.1746	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49331	-0.8951	4	.	.	.	-19.6504	5.0339	0.14424	0.0767:0.1637:0.5531:0.2065	.	.	.	.	F	437	.	.	L	-	1	0	TRPM3	72429966	0.925000	0.31364	1.000000	0.80357	0.995000	0.86356	-0.015000	0.12634	1.570000	0.49709	0.555000	0.69702	CTT	TRPM3	-	NULL	ENSG00000083067		0.597	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	0.00	35	0	G	NM_206945		73240146	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	silent	33.87	41	21	SNP	0.999	A
USP1	7398	genome.wustl.edu	37	1	62916244	62916244	+	Silent	SNP	A	A	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:62916244A>T	ENST00000339950.4	+	9	2765	c.1950A>T	c.(1948-1950)ggA>ggT	p.G650G	USP1_ENST00000371146.1_Silent_p.G650G	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	650	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GAGTTGGTGGAAATACACAGC	0.368																																					Ovarian(122;1846 2315 3982 19504)												0													59.0	61.0	60.0					1																	62916244		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.1950A>T	1.37:g.62916244A>T			A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.G650	ENST00000339950.4	37	c.1950	CCDS621.1	1																																																																																			USP1	-	pfscan_Peptidase_C19/C67	ENSG00000162607		0.368	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	-	0.00	54	0	A	NM_001017415		62916244	+1	tier1	-	no_errors	ENST00000339950	ensembl	human	known	74_37	silent	29.69	45	19	SNP	0.761	T
VCL	7414	genome.wustl.edu	37	10	75863596	75863596	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr10:75863596A>G	ENST00000211998.4	+	15	2135	c.2041A>G	c.(2041-2043)Atc>Gtc	p.I681V	VCL_ENST00000372755.3_Missense_Mutation_p.I681V|VCL_ENST00000417648.2_Intron|VCL_ENST00000478896.2_3'UTR	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	681	N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GGCTGCTCGTATCTTACTTAG	0.423																																																	0													189.0	151.0	164.0					10																	75863596		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2041A>G	10.37:g.75863596A>G	ENSP00000211998:p.Ile681Val		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.I681V	ENST00000211998.4	37	c.2041	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591178	0.66219	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T	0.41400	1.0;1.0;1.0	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.59376	0.2189	L	0.54323	1.7	0.80722	D	1	B;P;P	0.40032	0.254;0.564;0.699	P;P;P	0.58130	0.511;0.821;0.833	T	0.57849	-0.7740	10	0.52906	T	0.07	.	16.3083	0.82859	1.0:0.0:0.0:0.0	.	608;681;681	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	V	681;681;588;608;353	ENSP00000361841:I681V;ENSP00000211998:I681V;ENSP00000415489:I353V	ENSP00000211998:I681V	I	+	1	0	VCL	75533602	1.000000	0.71417	0.987000	0.45799	0.971000	0.66376	8.711000	0.91396	2.250000	0.74265	0.455000	0.32223	ATC	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.423	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	93	0	A	NM_003373, NM_014000		75863596	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	missense	40.59	60	41	SNP	0.999	G
WDR87	83889	genome.wustl.edu	37	19	38378577	38378577	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:38378577G>T	ENST00000303868.5	-	6	5841	c.5617C>A	c.(5617-5619)Caa>Aaa	p.Q1873K	WDR87_ENST00000447313.2_Missense_Mutation_p.Q1912K	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1873	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGCACTAATTGCTTTTTGCTG	0.418																																																	0													158.0	108.0	123.0					19																	38378577		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5617C>A	19.37:g.38378577G>T	ENSP00000368025:p.Gln1873Lys		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1912K	ENST00000303868.5	37	c.5734	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	3.243	-0.154965	0.06544	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.21191	2.02;2.02	4.72	-8.99	0.00751	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.29212	-1.0019	9	0.02654	T	1	.	3.6855	0.08327	0.0782:0.2931:0.2142:0.4146	.	1873;1912	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	K	1912;1873	ENSP00000405012:Q1912K;ENSP00000368025:Q1873K	ENSP00000368025:Q1873K	Q	-	1	0	WDR87	43070417	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.401000	0.07232	-2.154000	0.00792	-3.386000	0.00040	CAA	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.418	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	48	0	G	XM_940478		38378577	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.000	T
WHSC1	7468	genome.wustl.edu	37	4	1952910	1952910	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr4:1952910delA	ENST00000382895.3	+	12	2424	c.1993delA	c.(1993-1995)aaafs	p.K666fs	WHSC1_ENST00000382891.5_Frame_Shift_Del_p.K666fs|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000508803.1_Frame_Shift_Del_p.K666fs|WHSC1_ENST00000382888.3_5'Flank|WHSC1_ENST00000382892.2_Frame_Shift_Del_p.K666fs	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	666					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		AGTGACTGCCAAAAAGGAGTA	0.547			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													137.0	113.0	121.0					4																	1952910		2203	4300	6503	SO:0001589	frameshift_variant	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1993delA	4.37:g.1952910delA	ENSP00000372351:p.Lys666fs		A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Frame_Shift_Del	DEL	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.K666fs	ENST00000382895.3	37	c.1993	CCDS33940.1	4																																																																																			WHSC1	-	superfamily_Znf_FYVE_PHD	ENSG00000109685		0.547	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2		0.00	65	0	A	NM_133330		1952910	+1	tier1		no_errors	ENST00000382891	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	1.000	-
ZC3H13	23091	genome.wustl.edu	37	13	46559734	46559734	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:46559734G>T	ENST00000242848.4	-	10	1766	c.1418C>A	c.(1417-1419)tCc>tAc	p.S473Y	ZC3H13_ENST00000282007.3_Missense_Mutation_p.S473Y			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	473	Arg/Ser-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		CATGTCTCTGGAGTCTCTTAG	0.522																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0													202.0	196.0	198.0					13																	46559734		2203	4300	6503	SO:0001583	missense	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.1418C>A	13.37:g.46559734G>T	ENSP00000242848:p.Ser473Tyr		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S473Y	ENST00000242848.4	37	c.1418		13	.	.	.	.	.	.	.	.	.	.	G	15.17	2.752833	0.49362	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000431251	T;T	0.34859	2.34;1.34	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000009	T	0.52289	0.1725	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73380	0.956;0.98	T	0.50750	-0.8791	10	0.62326	D	0.03	.	20.099	0.97865	0.0:0.0:1.0:0.0	.	473;473	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	Y	473;473;289	ENSP00000242848:S473Y;ENSP00000282007:S473Y	ENSP00000242848:S473Y	S	-	2	0	ZC3H13	45457735	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.660000	0.83776	2.752000	0.94435	0.655000	0.94253	TCC	ZC3H13	-	NULL	ENSG00000123200		0.522	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1		0.00	53	0	G	NM_015070		46559734	-1			no_errors	ENST00000242848	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72822178	72822178	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr16:72822178G>T	ENST00000268489.5	-	10	10669	c.9997C>A	c.(9997-9999)Cag>Aag	p.Q3333K	ZFHX3_ENST00000397992.5_Missense_Mutation_p.Q2419K|RP5-991G20.4_ENST00000569195.1_RNA|RP5-991G20.1_ENST00000563328.2_RNA|AC004943.1_ENST00000584072.1_RNA	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	3333					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TACATAGGCTGCAGGTACCCG	0.582																																																	0													33.0	36.0	35.0					16																	72822178		2198	4300	6498	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.9997C>A	16.37:g.72822178G>T	ENSP00000268489:p.Gln3333Lys		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.Q3333K	ENST00000268489.5	37	c.9997	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608097	0.46527	.	.	ENSG00000140836	ENST00000268489;ENST00000397992	T;T	0.76968	-1.06;-1.02	4.94	4.94	0.65067	.	0.000000	0.47852	D	0.000219	T	0.73273	0.3566	L	0.50333	1.59	0.80722	D	1	P	0.42409	0.779	B	0.38056	0.264	T	0.75608	-0.3259	10	0.41790	T	0.15	.	17.7523	0.88438	0.0:0.0:1.0:0.0	.	3333	Q15911	ZFHX3_HUMAN	K	3333;2419	ENSP00000268489:Q3333K;ENSP00000438926:Q2419K	ENSP00000268489:Q3333K	Q	-	1	0	ZFHX3	71379679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.731000	0.98807	2.294000	0.77228	0.557000	0.71058	CAG	ZFHX3	-	NULL	ENSG00000140836		0.582	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	80	0	G	NM_006885		72822178	-1	tier1	-	no_errors	ENST00000268489	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
ZIC2	7546	genome.wustl.edu	37	13	100637594	100637594	+	Silent	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr13:100637594G>A	ENST00000376335.3	+	3	1550	c.1257G>A	c.(1255-1257)ccG>ccA	p.P419P	ZIC2_ENST00000477213.1_3'UTR	NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	419					brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGTCCTCCCCGCAGGGCTCTG	0.711																																					Pancreas(97;119 1522 31925 44771 48764)												0													13.0	17.0	16.0					13																	100637594		1962	4191	6153	SO:0001819	synonymous_variant	0			AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.1257G>A	13.37:g.100637594G>A			Q5VYA9|Q9H309	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P419	ENST00000376335.3	37	c.1257	CCDS9495.1	13																																																																																			ZIC2	-	pfscan_Znf_C2H2	ENSG00000043355		0.711	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC2	HGNC	protein_coding	OTTHUMT00000045618.2	-	0.00	44	0	G	NM_007129		100637594	+1	tier1	-	no_errors	ENST00000376335	ensembl	human	known	74_37	silent	10.00	35	4	SNP	0.534	A
ZNF202	7753	genome.wustl.edu	37	11	123600376	123600376	+	Missense_Mutation	SNP	G	G	A	rs201276058		TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr11:123600376G>A	ENST00000529691.1	-	3	779	c.560C>T	c.(559-561)cCg>cTg	p.P187L	ZNF202_ENST00000336139.4_Missense_Mutation_p.P187L|ZNF202_ENST00000530393.1_Missense_Mutation_p.P187L			O95125	ZN202_HUMAN	zinc finger protein 202	187					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		CTGCTCTGCCGGTGCCCCCAG	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		16418	0.001		0.0	False		,,,				2504	0.0																0								G	LEU/PRO	1,4403	2.1+/-5.4	0,1,2201	55.0	49.0	51.0		560	-1.4	0.0	11		51	0,8598		0,0,4299	no	missense	ZNF202	NM_003455.2	98	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	benign	187/649	123600376	1,13001	2202	4299	6501	SO:0001583	missense	0			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.560C>T	11.37:g.123600376G>A	ENSP00000433881:p.Pro187Leu		B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P187L	ENST00000529691.1	37	c.560	CCDS8443.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	3.329	-0.136981	0.06711	2.27E-4	0.0	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.06371	3.31;3.31;3.31	4.79	-1.44	0.08856	.	1.705530	0.03355	N	0.196814	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40831	-0.9542	10	0.29301	T	0.29	0.5618	3.7929	0.08728	0.4472:0.0:0.3839:0.1689	.	187	O95125	ZN202_HUMAN	L	187	ENSP00000337724:P187L;ENSP00000432504:P187L;ENSP00000433881:P187L	ENSP00000337724:P187L	P	-	2	0	ZNF202	123105586	0.000000	0.05858	0.001000	0.08648	0.289000	0.27227	-0.309000	0.08145	-0.096000	0.12329	0.557000	0.71058	CCG	ZNF202	-	NULL	ENSG00000166261		0.612	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387419.1		0.00	20	0	G	NM_003455		123600376	-1			no_errors	ENST00000336139	ensembl	human	known	74_37	missense	10.53	17	2	SNP	0.000	A
ZNF317	57693	genome.wustl.edu	37	19	9271728	9271728	+	Silent	SNP	G	G	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:9271728G>T	ENST00000247956.6	+	7	1712	c.1407G>T	c.(1405-1407)acG>acT	p.T469T	ZNF317_ENST00000360385.3_Silent_p.T437T	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						AGATACACACGCAAGAGAGAC	0.532																																																	0													54.0	50.0	51.0					19																	9271728		2203	4300	6503	SO:0001819	synonymous_variant	0			AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1407G>T	19.37:g.9271728G>T			Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T469	ENST00000247956.6	37	c.1407	CCDS12210.1	19																																																																																			ZNF317	-	pfscan_Znf_C2H2	ENSG00000130803		0.532	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	HGNC	protein_coding	OTTHUMT00000448995.1		0.00	25	0	G	NM_020933		9271728	+1			no_errors	ENST00000247956	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.091	T
ZNF324B	388569	genome.wustl.edu	37	19	58965130	58965130	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:58965130C>T	ENST00000336614.4	+	2	169	c.62C>T	c.(61-63)gCg>gTg	p.A21V	ZNF324B_ENST00000545523.1_Missense_Mutation_p.A21V|ZNF324B_ENST00000594214.1_Missense_Mutation_p.A21V|ZNF324B_ENST00000391696.1_5'UTR	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	21	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CTGGACACAGCGCAGAGGGCC	0.572																																																	0													137.0	99.0	111.0					19																	58965130		2203	4300	6503	SO:0001583	missense	0			AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.62C>T	19.37:g.58965130C>T	ENSP00000337473:p.Ala21Val		B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A21V	ENST00000336614.4	37	c.62	CCDS33138.1	19	.	.	.	.	.	.	.	.	.	.	C	5.927	0.355001	0.11239	.	.	ENSG00000249471	ENST00000336614;ENST00000545523	T;T	0.02498	4.27;4.27	2.99	1.94	0.25998	Krueppel-associated box (4);	0.925481	0.08872	N	0.881444	T	0.04634	0.0126	M	0.71296	2.17	0.09310	N	0.999997	B	0.13145	0.007	B	0.13407	0.009	T	0.40040	-0.9584	10	0.51188	T	0.08	.	4.0949	0.09986	0.0:0.6123:0.2453:0.1424	.	21	Q6AW86	Z324B_HUMAN	V	21	ENSP00000337473:A21V;ENSP00000438930:A21V	ENSP00000337473:A21V	A	+	2	0	ZNF324B	63656942	0.000000	0.05858	0.000000	0.03702	0.173000	0.22820	0.067000	0.14510	0.445000	0.26639	0.467000	0.42956	GCG	ZNF324B	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000249471		0.572	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	HGNC	protein_coding	OTTHUMT00000467038.1	-	0.00	92	0	C	NM_207395		58965130	+1	tier1	-	no_errors	ENST00000336614	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.001	T
ZNF496	84838	genome.wustl.edu	37	1	247471852	247471852	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:247471852T>C	ENST00000294753.4	-	8	1395	c.931A>G	c.(931-933)Agg>Ggg	p.R311G	ZNF496_ENST00000366498.2_Missense_Mutation_p.R347G|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	311					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			TCACGTTTCCTTCTTTCTTCT	0.522																																																	0													160.0	148.0	152.0					1																	247471852		2203	4300	6503	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.931A>G	1.37:g.247471852T>C	ENSP00000294753:p.Arg311Gly		Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R347G	ENST00000294753.4	37	c.1039	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	T	0.109	-1.141006	0.01728	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.07114	3.22;3.23	3.09	-0.7	0.11273	.	0.738449	0.11673	N	0.540627	T	0.04861	0.0131	L	0.27053	0.805	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.001	T	0.43294	-0.9400	10	0.24483	T	0.36	-9.6465	4.187	0.10402	0.0:0.1227:0.4053:0.472	.	347;311	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	G	311;347	ENSP00000294753:R311G;ENSP00000355454:R347G	ENSP00000294753:R311G	R	-	1	2	ZNF496	245538475	0.553000	0.26513	0.076000	0.20297	0.041000	0.13682	0.092000	0.15066	-0.151000	0.11176	0.379000	0.24179	AGG	ZNF496	-	NULL	ENSG00000162714		0.522	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	73	0	T	NM_032752		247471852	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	missense	31.58	52	24	SNP	0.095	C
ZNF878	729747	genome.wustl.edu	37	19	12154831	12154831	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:12154831G>A	ENST00000547628.1	-	4	1522	c.1385C>T	c.(1384-1386)tCt>tTt	p.S462F	CTD-2006C1.2_ENST00000591898.1_RNA|CTD-2006C1.2_ENST00000476474.1_RNA|CTD-2006C1.10_ENST00000547473.1_Intron|CTD-2006C1.2_ENST00000591838.1_RNA|ZNF878_ENST00000602107.1_Missense_Mutation_p.S509F	NM_001080404.2	NP_001073873.2	C9JN71	ZN878_HUMAN	zinc finger protein 878	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						AGAATTAGAAGAAATGAAGGC	0.388																																																	0													53.0	60.0	57.0					19																	12154831		2189	4293	6482	SO:0001583	missense	0				CCDS45984.1, CCDS45984.2	19p13.2	2013-01-08				ENSG00000257446		"""Zinc fingers, C2H2-type"", ""-"""	37246	protein-coding gene	gene with protein product							Standard	NM_001080404		Approved		uc021upl.1	C9JN71		ENST00000547628.1:c.1385C>T	19.37:g.12154831G>A	ENSP00000447931:p.Ser462Phe			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S509F	ENST00000547628.1	37	c.1526	CCDS45984.2	19	.	.	.	.	.	.	.	.	.	.	G	6.532	0.466338	0.12402	.	.	ENSG00000257446;ENSG00000232371	ENST00000547628;ENST00000440730	T	0.02067	4.47	1.3	0.00835	0.14074	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02727	0.0082	L	0.53617	1.68	0.09310	N	1	P	0.41947	0.766	P	0.45167	0.472	T	0.33828	-0.9853	9	0.10111	T	0.7	.	2.7175	0.05191	0.1843:0.0:0.3929:0.4228	.	462	C9JN71	ZN878_HUMAN	F	462;509	ENSP00000447931:S462F	ENSP00000447931:S462F	S	-	2	0	AC022415.4;ZNF878	12015831	0.000000	0.05858	0.002000	0.10522	0.901000	0.52897	-1.604000	0.02076	-0.149000	0.11215	0.313000	0.20887	TCT	ZNF878	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000257446		0.388	ZNF878-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF878	HGNC	protein_coding	OTTHUMT00000403723.1	-	0.00	57	0	G	NM_001080404		12154831	-1	tier1	-	no_errors	ENST00000602107	ensembl	human	known	74_37	missense	30.00	35	15	SNP	0.000	A
ZNF99	7652	genome.wustl.edu	37	19	22940806	22940806	+	Silent	SNP	G	G	A			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr19:22940806G>A	ENST00000596209.1	-	4	1995	c.1905C>T	c.(1903-1905)acC>acT	p.T635T	ZNF99_ENST00000397104.3_Silent_p.T544T	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	635					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T544T(1)		NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GTTTTCTAAGGGTTGAGGACT	0.378																																																	1	Substitution - coding silent(1)	prostate(1)											37.0	39.0	38.0					19																	22940806		1989	4186	6175	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1905C>T	19.37:g.22940806G>A			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T544	ENST00000596209.1	37	c.1632	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1		0.00	70	0	G	XM_065124		22940806	-1			no_errors	ENST00000397104	ensembl	human	known	74_37	silent	6.67	42	3	SNP	0.112	A
ZZZ3	26009	genome.wustl.edu	37	1	78030139	78030139	+	IGR	DEL	A	A	-			TCGA-IG-A6QS-01A-12D-A33E-09	TCGA-IG-A6QS-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c3694006-14cb-482e-ae99-3b3aceff2c48	7adcaf5d-39b3-438d-80e5-d9717da2d1a6	g.chr1:78030139delA	ENST00000370801.3	-	0	4328				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TAACACTGGTAAAAAAAAAAA	0.279																																																	0																																										SO:0001628	intergenic_variant	0			AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652		1.37:g.78030139delA			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	DEL	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			ZZZ3	-	-	ENSG00000036549		0.279	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1		0.00	29	0	A	NM_015534		78030139	-1	tier1		no_errors	ENST00000481346	ensembl	human	known	74_37	rna	8.70	42	4	DEL	0.000	-
