#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA9	10350	genome.wustl.edu	37	17	67023947	67023947	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:67023947G>T	ENST00000340001.4	-	13	1836	c.1625C>A	c.(1624-1626)aCt>aAt	p.T542N	ABCA9_ENST00000370732.2_Missense_Mutation_p.T542N|ABCA9_ENST00000453985.2_Missense_Mutation_p.T542N	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	542	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					ATTATAGACAGTGACTGAACC	0.363																																																	0													73.0	73.0	73.0					17																	67023947		2202	4300	6502	SO:0001583	missense	0			AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.1625C>A	17.37:g.67023947G>T	ENSP00000342216:p.Thr542Asn		Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T542N	ENST00000340001.4	37	c.1625	CCDS11681.1	17	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547370	0.45383	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;T;D	0.94092	-3.35;-0.03;-3.35	5.34	4.32	0.51571	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49916	D	0.000133	D	0.94125	0.8116	L	0.35542	1.07	0.42504	D	0.992948	D;P	0.67145	0.996;0.949	D;P	0.74674	0.984;0.843	D	0.94477	0.7690	10	0.62326	D	0.03	.	15.4019	0.74845	0.0:0.1393:0.8607:0.0	.	542;542	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	N	542;525;542;537	ENSP00000342216:T542N;ENSP00000394264:T525N;ENSP00000359767:T542N	ENSP00000342216:T542N	T	-	2	0	ABCA9	64535542	0.040000	0.19996	1.000000	0.80357	0.171000	0.22731	0.996000	0.29719	2.666000	0.90696	0.591000	0.81541	ACT	ABCA9	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154258		0.363	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA9	HGNC	protein_coding	OTTHUMT00000277072.2	-	0.00	29	0	G	NM_172386		67023947	-1	tier1	-	no_errors	ENST00000340001	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
ABCB7	22	genome.wustl.edu	37	X	74288930	74288930	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:74288930G>T	ENST00000373394.3	-	12	1578	c.1571C>A	c.(1570-1572)cCt>cAt	p.P524H	ABCB7_ENST00000339447.4_Missense_Mutation_p.P484H|ABCB7_ENST00000534570.1_5'UTR|ABCB7_ENST00000253577.3_Missense_Mutation_p.P525H			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	524	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ACCCTTTTGAGGCTCATAGAA	0.408																																																	0													117.0	104.0	108.0					X																	74288930		2203	4300	6503	SO:0001583	missense	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.1571C>A	X.37:g.74288930G>T	ENSP00000362492:p.Pro524His		G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.P525H	ENST00000373394.3	37	c.1574		X	.	.	.	.	.	.	.	.	.	.	G	20.8	4.047621	0.75846	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.95103	-3.61;-3.61;-3.61;-3.61	5.24	5.24	0.73138	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.051031	0.85682	D	0.000000	D	0.97294	0.9115	M	0.82323	2.585	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.999;1.0;0.998;0.999	D;D;D;D;D	0.79108	0.967;0.978;0.992;0.98;0.978	D	0.98025	1.0373	10	0.72032	D	0.01	-21.5621	16.8091	0.85713	0.0:0.0:1.0:0.0	.	498;484;525;524;525	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	H	498;525;484;524;498	ENSP00000253577:P525H;ENSP00000343849:P484H;ENSP00000362492:P524H;ENSP00000436586:P498H	ENSP00000253577:P525H	P	-	2	0	ABCB7	74205655	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.209000	0.95087	2.174000	0.68829	0.594000	0.82650	CCT	ABCB7	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000131269		0.408	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	-	0.00	34	0	G	NM_004299		74288930	-1	tier1	-	no_errors	ENST00000253577	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
ABHD5	51099	genome.wustl.edu	37	3	43753309	43753309	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:43753309G>T	ENST00000458276.2	+	4	738	c.615G>T	c.(613-615)ttG>ttT	p.L205F		NM_016006.4	NP_057090.2	Q8WTS1	ABHD5_HUMAN	abhydrolase domain containing 5	205					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|negative regulation of sequestering of triglyceride (GO:0010891)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|lysophosphatidic acid acyltransferase activity (GO:0042171)			kidney(3)|large_intestine(2)|liver(2)|lung(5)|ovary(1)|skin(1)	14		Renal(3;0.0134)		KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0687)		GAGCAGCATTGACTCCCTTTA	0.463																																																	0													173.0	157.0	162.0					3																	43753309		2203	4300	6503	SO:0001583	missense	0			AF007132	CCDS2711.1	3p21.33	2012-05-16			ENSG00000011198	ENSG00000011198		"""Abhydrolase domain containing"""	21396	protein-coding gene	gene with protein product		604780				11590543, 18606822	Standard	NM_016006		Approved	CGI-58, NCIE2	uc003cmx.3	Q8WTS1	OTTHUMG00000133039	ENST00000458276.2:c.615G>T	3.37:g.43753309G>T	ENSP00000390849:p.Leu205Phe		B2R9K0|Q9Y369	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1	p.L205F	ENST00000458276.2	37	c.615	CCDS2711.1	3	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729197	0.48833	.	.	ENSG00000011198	ENST00000458276;ENST00000413300	T;D	0.84873	-0.32;-1.91	6.17	5.3	0.74995	.	0.205128	0.42294	D	0.000726	T	0.79082	0.4386	N	0.25094	0.71	0.58432	D	0.999999	B	0.24092	0.097	B	0.33254	0.16	T	0.73745	-0.3886	10	0.26408	T	0.33	-27.4581	15.327	0.74172	0.0663:0.0:0.9337:0.0	.	205	Q8WTS1	ABHD5_HUMAN	F	205;37	ENSP00000390849:L205F;ENSP00000392159:L37F	ENSP00000392159:L37F	L	+	3	2	ABHD5	43728313	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	1.989000	0.40707	1.620000	0.50308	0.655000	0.94253	TTG	ABHD5	-	NULL	ENSG00000011198		0.463	ABHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD5	HGNC	protein_coding	OTTHUMT00000256644.2	-	0.00	84	0	G	NM_016006		43753309	+1	tier1	-	no_errors	ENST00000458276	ensembl	human	known	74_37	missense	43.75	36	28	SNP	1.000	T
ACADVL	37	genome.wustl.edu	37	17	7127299	7127299	+	Nonsense_Mutation	SNP	G	G	T	rs398123081		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:7127299G>T	ENST00000356839.5	+	14	1524	c.1345G>T	c.(1345-1347)Gag>Tag	p.E449*	ACADVL_ENST00000543245.2_Nonsense_Mutation_p.E472*|ACADVL_ENST00000350303.5_Nonsense_Mutation_p.E427*|MIR324_ENST00000362183.1_RNA	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	449	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						ACCTGGAGTAGAGCGTGTGCT	0.557																																																	0													90.0	88.0	89.0					17																	7127299		2203	4300	6503	SO:0001587	stop_gained	0			BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.1345G>T	17.37:g.7127299G>T	ENSP00000349297:p.Glu449*		B4DEB6|F5H2A9|O76056|Q8WUL0	Nonsense_Mutation	SNP	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.E449*	ENST00000356839.5	37	c.1345	CCDS11090.1	17	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725824	0.69074	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000350303;ENST00000322910;ENST00000542255	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.4119	0.74933	0.0:0.0:1.0:0.0	.	.	.	.	X	472;495;427;449;495	.	ENSP00000325395:E449X	E	+	1	0	ACADVL	7068023	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	8.267000	0.89874	2.719000	0.93026	0.655000	0.94253	GAG	ACADVL	-	pfam_AcylCo_DH/oxidase_C,pfam_Acyl-CoA_DH_2_C,superfamily_AcylCo_DH/oxidase_C	ENSG00000072778		0.557	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ACADVL	HGNC	protein_coding	OTTHUMT00000220001.5		0.00	34	0	G	NM_000018		7127299	+1			no_errors	ENST00000356839	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	T
ACCSL	390110	genome.wustl.edu	37	11	44080171	44080171	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:44080171C>T	ENST00000378832.1	+	13	1602	c.1546C>T	c.(1546-1548)Cgt>Tgt	p.R516C		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	516					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						ATTGTTATCCCGTGGCAAAAC	0.517																																																	0													97.0	98.0	98.0					11																	44080171		1887	4112	5999	SO:0001583	missense	0				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1546C>T	11.37:g.44080171C>T	ENSP00000368109:p.Arg516Cys			Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R516C	ENST00000378832.1	37	c.1546	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	C	10.51	1.369558	0.24771	.	.	ENSG00000205126	ENST00000378832	T	0.22336	1.96	5.61	-11.1	0.00147	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.710899	0.14810	N	0.297115	T	0.02807	0.0084	N	0.00237	-1.79	0.09310	N	0.999996	B	0.06786	0.001	B	0.09377	0.004	T	0.41161	-0.9524	10	0.27082	T	0.32	4.3006	6.6781	0.23106	0.3414:0.1524:0.0:0.5062	.	516	Q4AC99	1A1L2_HUMAN	C	516	ENSP00000368109:R516C	ENSP00000368109:R516C	R	+	1	0	ACCSL	44036747	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.332000	0.07904	-1.850000	0.01169	-1.910000	0.00522	CGT	ACCSL	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000205126		0.517	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	-	0.00	34	0	C	NM_001031854		44080171	+1	tier1	-	no_errors	ENST00000378832	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.003	T
ADCY2	108	genome.wustl.edu	37	5	7820737	7820737	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:7820737A>T	ENST00000338316.4	+	24	3147	c.3058A>T	c.(3058-3060)Atc>Ttc	p.I1020F	ADCY2_ENST00000537121.1_Missense_Mutation_p.I840F	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1020					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACAATATGATATCTGGGGCAA	0.478																																																	0													131.0	114.0	120.0					5																	7820737		2203	4300	6503	SO:0001583	missense	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3058A>T	5.37:g.7820737A>T	ENSP00000342952:p.Ile1020Phe		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I1020F	ENST00000338316.4	37	c.3058	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	A	32	5.116514	0.94385	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.82433	-1.61;-1.61	5.39	5.39	0.77823	Adenylyl cyclase class-3/4/guanylyl cyclase, conserved site (1);Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.92786	0.7706	M	0.91300	3.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94352	0.7580	10	0.87932	D	0	.	15.4421	0.75190	1.0:0.0:0.0:0.0	.	840;1020	B7Z2C1;Q08462	.;ADCY2_HUMAN	F	1020;853;840	ENSP00000342952:I1020F;ENSP00000444803:I840F	ENSP00000342952:I1020F	I	+	1	0	ADCY2	7873737	1.000000	0.71417	0.930000	0.37139	0.986000	0.74619	9.054000	0.93866	2.054000	0.61138	0.533000	0.62120	ATC	ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000078295		0.478	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	-	0.00	38	0	A	NM_020546		7820737	+1	tier1	-	no_errors	ENST00000338316	ensembl	human	known	74_37	missense	27.91	62	24	SNP	1.000	T
AGRN	375790	genome.wustl.edu	37	1	989341	989341	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:989341C>G	ENST00000379370.2	+	34	5910	c.5860C>G	c.(5860-5862)Cgg>Ggg	p.R1954G	RP11-54O7.14_ENST00000418300.1_RNA	NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1976	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CCGCTGGTTGCGGGTCGTGGC	0.632																																																	0													38.0	31.0	34.0					1																	989341		2201	4295	6496	SO:0001583	missense	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.5860C>G	1.37:g.989341C>G	ENSP00000368678:p.Arg1954Gly		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.R1954G	ENST00000379370.2	37	c.5860	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967568	0.74131	.	.	ENSG00000188157	ENST00000379370	T	0.76709	-1.04	4.47	4.47	0.54385	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.184941	0.35235	N	0.003343	D	0.87438	0.6177	M	0.83384	2.64	0.54753	D	0.999989	D	0.63046	0.992	P	0.61800	0.894	D	0.89397	0.3693	10	0.56958	D	0.05	-25.3927	16.7343	0.85443	0.0:1.0:0.0:0.0	.	1954	O00468	AGRIN_HUMAN	G	1954	ENSP00000368678:R1954G	ENSP00000368678:R1954G	R	+	1	2	AGRN	979204	1.000000	0.71417	0.999000	0.59377	0.606000	0.37113	5.843000	0.69424	2.042000	0.60477	0.462000	0.41574	CGG	AGRN	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000188157		0.632	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	-	0.00	30	0	C	NM_198576		989341	+1	tier1	-	no_errors	ENST00000379370	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	G
AHNAK	79026	genome.wustl.edu	37	11	62284238	62284238	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:62284238G>T	ENST00000378024.4	-	5	17925	c.17651C>A	c.(17650-17652)tCa>tAa	p.S5884*	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5884					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TGTGGAAACTGACAGCTCCAC	0.463																																																	0													115.0	117.0	116.0					11																	62284238		2202	4299	6501	SO:0001587	stop_gained	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17651C>A	11.37:g.62284238G>T	ENSP00000367263:p.Ser5884*		A1A586	Nonsense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S5884*	ENST00000378024.4	37	c.17651	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	57	29.453942	0.99975	.	.	ENSG00000124942	ENST00000378024	.	.	.	5.09	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.27739	N	0.944542	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.5478	8.3638	0.32374	0.0869:0.0:0.7609:0.1522	.	.	.	.	X	5884	.	ENSP00000367263:S5884X	S	-	2	0	AHNAK	62040814	0.249000	0.23941	0.000000	0.03702	0.923000	0.55619	3.237000	0.51344	0.467000	0.27218	0.549000	0.68633	TCA	AHNAK	-	NULL	ENSG00000124942		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	44	0	G	NM_024060		62284238	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	nonsense	6.67	56	4	SNP	0.006	T
AK2	204	genome.wustl.edu	37	1	33476303	33476303	+	3'UTR	SNP	G	G	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:33476303G>C	ENST00000373449.2	-	0	867				RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000491241.1_5'UTR|AK2_ENST00000548033.1_3'UTR	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GTATTCCTCTGAGCCCCTCAC	0.488																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.*127C>G	1.37:g.33476303G>C				RNA	SNP	-	NULL	ENST00000373449.2	37	NULL	CCDS373.1	1																																																																																			AK2	-	-	ENSG00000004455		0.488	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AK2	HGNC	protein_coding	OTTHUMT00000011884.1	-	0.00	85	0	G	NM_001625		33476303	-1	tier1	-	no_errors	ENST00000491241	ensembl	human	known	74_37	rna	9.65	103	11	SNP	0.093	C
AKNA	80709	genome.wustl.edu	37	9	117106127	117106127	+	Intron	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:117106127G>T	ENST00000307564.4	-	19	3823				AKNA_ENST00000223791.3_Intron|AKNA_ENST00000374079.4_Intron|AKNA_ENST00000374088.3_Intron|AKNA_ENST00000374075.5_Intron|AKNA_ENST00000492875.1_5'UTR	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CCTGTGGATGGATGCAAAATA	0.483																																																	0													46.0	46.0	46.0					9																	117106127		2203	4300	6503	SO:0001627	intron_variant	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.3662-44C>A	9.37:g.117106127G>T			Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	RNA	SNP	-	NULL	ENST00000307564.4	37	NULL	CCDS6805.1	9																																																																																			AKNA	-	-	ENSG00000106948		0.483	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	-	0.00	30	0	G	NM_030767		117106127	-1	tier1	-	no_errors	ENST00000492875	ensembl	human	known	74_37	rna	6.56	57	4	SNP	0.000	T
ALPK1	80216	genome.wustl.edu	37	4	113352696	113352696	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:113352696C>T	ENST00000458497.1	+	11	2272	c.1993C>T	c.(1993-1995)Cca>Tca	p.P665S	ALPK1_ENST00000504176.2_Missense_Mutation_p.P587S|ALPK1_ENST00000177648.9_Missense_Mutation_p.P665S	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	665							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TCAAAATCAGCCACAGCAACA	0.493																																																	0													72.0	72.0	72.0					4																	113352696		2203	4300	6503	SO:0001583	missense	0			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.1993C>T	4.37:g.113352696C>T	ENSP00000398048:p.Pro665Ser		B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P665S	ENST00000458497.1	37	c.1993	CCDS3697.1	4	.	.	.	.	.	.	.	.	.	.	C	6.974	0.549783	0.13374	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02323	4.42;4.42;4.34	4.96	4.1	0.47936	.	2.279620	0.01654	N	0.024721	T	0.03564	0.0102	N	0.22421	0.69	0.09310	N	1	B;B;B	0.26258	0.145;0.09;0.09	B;B;B	0.21708	0.036;0.016;0.01	T	0.35226	-0.9797	10	0.66056	D	0.02	0.4611	8.2273	0.31577	0.0:0.7986:0.0:0.2014	.	587;587;665	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	S	665;665;587	ENSP00000398048:P665S;ENSP00000177648:P665S;ENSP00000426044:P587S	ENSP00000177648:P665S	P	+	1	0	ALPK1	113572145	0.002000	0.14202	0.001000	0.08648	0.008000	0.06430	1.707000	0.37888	1.287000	0.44583	0.655000	0.94253	CCA	ALPK1	-	NULL	ENSG00000073331		0.493	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	-	0.00	60	0	C	NM_025144		113352696	+1	tier1	-	no_errors	ENST00000177648	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.002	T
AMPH	273	genome.wustl.edu	37	7	38468144	38468144	+	Intron	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:38468144C>A	ENST00000356264.2	-	14	1398				AMPH_ENST00000325590.5_Intron|AMPH_ENST00000428293.2_Intron|AMPH_ENST00000471913.1_5'UTR	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						AGCATCTGTACTGTCTTGTGC	0.383																																																	0																																										SO:0001627	intron_variant	0				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1182+1297G>T	7.37:g.38468144C>A			A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	RNA	SNP	-	NULL	ENST00000356264.2	37	NULL	CCDS5456.1	7																																																																																			AMPH	-	-	ENSG00000078053		0.383	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	-	0.00	55	0	C	NM_001635		38468144	-1	tier1	-	no_errors	ENST00000471913	ensembl	human	known	74_37	rna	33.87	41	21	SNP	0.001	A
ANKRD36BP2	645784	genome.wustl.edu	37	2	89100923	89100924	+	RNA	INS	-	-	G	rs369765448		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:89100923_89100924insG	ENST00000393525.3	+	0	1397_1398									ankyrin repeat domain 36B pseudogene 2																		AATATAAAAAAGATACATATGA	0.282																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89100924_89100924dupG				RNA	INS	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.282	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1		0.00	12	0	-			89100924	+1	tier1		no_errors	ENST00000393525	ensembl	human	known	74_37	rna	30.23	30	13	INS	0.049:0.030	G
ANKRD36	375248	genome.wustl.edu	37	2	97779555	97779555	+	Missense_Mutation	SNP	C	C	T	rs542428195	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:97779555C>T	ENST00000461153.2	+	1	323	c.79C>T	c.(79-81)Ccc>Tcc	p.P27S	ANKRD36_ENST00000420699.2_Missense_Mutation_p.P27S			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	27										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						TCCCCAATACCCCATTAAACC	0.493													C|||	16	0.00319489	0.0	0.0	5008	,	,		11526	0.0149		0.0	False		,,,				2504	0.001																0													107.0	106.0	106.0					2																	97779555		1997	4180	6177	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.79C>T	2.37:g.97779555C>T	ENSP00000419530:p.Pro27Ser		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P27S	ENST00000461153.2	37	c.79	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	C	2.591	-0.295243	0.05532	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000393513;ENST00000289105;ENST00000455519	T;T	0.53423	0.62;0.62	0.74	-0.399	0.12415	.	.	.	.	.	T	0.18718	0.0449	N	0.04090	-0.28	0.09310	N	0.999996	B;P;B	0.35383	0.001;0.498;0.023	B;B;B	0.26094	0.0;0.066;0.008	T	0.12066	-1.0562	9	0.72032	D	0.01	.	3.692	0.08350	0.43:0.57:0.0:0.0	.	27;27;27	A6QL64;F2Z332;A6QL64-4	AN36A_HUMAN;.;.	S	27	ENSP00000419530:P27S;ENSP00000391950:P27S	ENSP00000289105:P27S	P	+	1	0	ANKRD36	97143282	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.791000	0.04599	-0.151000	0.11176	-0.723000	0.03601	CCC	ANKRD36	-	NULL	ENSG00000135976		0.493	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5		0.00	47	0	C			97779555	+1			no_errors	ENST00000420699	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.000	T
AP2A2	161	genome.wustl.edu	37	11	926053	926053	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:926053delG	ENST00000448903.2	+	1	173	c.32delG	c.(31-33)cggfs	p.R11fs	AP2A2_ENST00000332231.5_Frame_Shift_Del_p.R11fs|AP2A2_ENST00000534328.1_Frame_Shift_Del_p.R11fs	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	11	Lipid-binding.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GACGGGATGCGGGGCCTGGCG	0.776																																																	0													4.0	4.0	4.0					11																	926053		1644	3806	5450	SO:0001589	frameshift_variant	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.32delG	11.37:g.926053delG	ENSP00000413234:p.Arg11fs		O75403|Q53ET1|Q96SI8	Frame_Shift_Del	DEL	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.G12fs	ENST00000448903.2	37	c.32	CCDS44512.1	11																																																																																			AP2A2	-	superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000183020		0.776	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2		0.00	15	0	G	NM_012305		926053	+1	tier1		no_errors	ENST00000332231	ensembl	human	known	74_37	frame_shift_del	18.18	9	2	DEL	1.000	-
API5	8539	genome.wustl.edu	37	11	43364068	43364068	+	3'UTR	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:43364068A>G	ENST00000531273.1	+	0	1722				API5_ENST00000455725.2_3'UTR|API5_ENST00000420461.2_3'UTR|API5_ENST00000534695.1_Silent_p.T79T|API5_ENST00000378852.3_3'UTR|RP11-484D2.2_ENST00000526220.1_RNA			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TGAATAAGACATCAGCATTCT	0.468																																					Pancreas(1;98 122 5625 20895 49453)												0													44.0	46.0	45.0					11																	43364068		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.*8A>G	11.37:g.43364068A>G			B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Silent	SNP	pfam_API5,superfamily_ARM-type_fold	p.T79	ENST00000531273.1	37	c.237	CCDS44572.1	11																																																																																			API5	-	NULL	ENSG00000166181		0.468	API5-002	KNOWN	basic|CCDS	protein_coding	API5	HGNC	protein_coding	OTTHUMT00000389545.1	-	0.00	25	0	A	NM_006595		43364068	+1	tier1	-	no_errors	ENST00000534695	ensembl	human	putative	74_37	silent	29.73	26	11	SNP	0.018	G
APLNR	187	genome.wustl.edu	37	11	57004102	57004102	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:57004102T>G	ENST00000606794.1	-	1	573	c.377A>C	c.(376-378)gAc>gCc	p.D126A		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	126					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAGGTAGCGGTCGAAGCTGAG	0.632																																																	0													39.0	30.0	33.0					11																	57004102		2200	4295	6495	SO:0001583	missense	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.377A>C	11.37:g.57004102T>G	ENSP00000475344:p.Asp126Ala			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_APJ_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt	p.D126A	ENST00000606794.1	37	c.377	CCDS7950.1	11	.	.	.	.	.	.	.	.	.	.	T	22.7	4.330236	0.81690	.	.	ENSG00000134817	ENST00000257254	D	0.85702	-2.02	5.46	5.46	0.80206	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.92951	0.7757	M	0.87328	2.875	0.58432	D	0.999994	D	0.89917	1.0	D	0.75484	0.986	D	0.93662	0.6982	10	0.54805	T	0.06	-43.6	15.1943	0.73075	0.0:0.0:0.0:1.0	.	126	P35414	APJ_HUMAN	A	126	ENSP00000257254:D126A	ENSP00000257254:D126A	D	-	2	0	APLNR	56760678	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.233000	0.72320	2.068000	0.61886	0.454000	0.30748	GAC	APLNR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000134817		0.632	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	-	0.00	31	0	T	NM_005161		57004102	-1	tier1	-	no_errors	ENST00000257254	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	G
ARHGAP11B	89839	genome.wustl.edu	37	15	30918322	30918322	+	5'Flank	DEL	C	C	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:30918322delC	ENST00000428041.2	+	0	0				RP11-932O9.7_ENST00000501830.2_RNA	NM_001039841.1	NP_001034930.1	Q3KRB8	RHGBB_HUMAN	Rho GTPase activating protein 11B						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	8		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		GCGGGTGTGACCCCCCCGTGG	0.622																																																	0																																										SO:0001631	upstream_gene_variant	0			BC105788	CCDS32185.1	15q13.2	2011-07-13				ENSG00000187951		"""Rho GTPase activating proteins"""	15782	protein-coding gene	gene with protein product	"""GAP (1-8)"""		"""family with sequence similarity 7, member B1"""	FAM7B1		11829490	Standard	NM_001039841		Approved	B'-T	uc001zet.1	Q3KRB8			15.37:g.30918322delC	Exception_encountered			RNA	DEL	-	NULL	ENST00000428041.2	37	NULL	CCDS32185.1	15																																																																																			ARHGAP11B	-	-	ENSG00000187951		0.622	ARHGAP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11B	HGNC	protein_coding	OTTHUMT00000430729.1		0.00	13	0	C	NM_001039841		30918322	+1	tier1		no_errors	ENST00000567449	ensembl	human	putative	74_37	rna	12.50	14	2	DEL	0.001	-
ARHGEF15	22899	genome.wustl.edu	37	17	8215743	8215743	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:8215743C>T	ENST00000361926.3	+	2	496	c.386C>T	c.(385-387)aCg>aTg	p.T129M	ARHGEF15_ENST00000421050.1_Missense_Mutation_p.T129M	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15	129	Pro-rich.				negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCACCCTGCACGCCTCTGCTC	0.672																																																	0													68.0	70.0	69.0					17																	8215743		2203	4300	6503	SO:0001583	missense	0			AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.386C>T	17.37:g.8215743C>T	ENSP00000355026:p.Thr129Met		A8K6G1|Q8N449|Q9H8B4	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	p.T129M	ENST00000361926.3	37	c.386	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	C	0.624	-0.819827	0.02776	.	.	ENSG00000198844	ENST00000361926;ENST00000421050	T;T	0.71817	-0.6;-0.6	4.87	2.89	0.33648	.	2.365140	0.01590	N	0.021519	T	0.58018	0.2093	N	0.19112	0.55	0.09310	N	1	B;B	0.15930	0.015;0.015	B;B	0.09377	0.004;0.004	T	0.41787	-0.9489	10	0.28530	T	0.3	0.2461	7.6286	0.28226	0.0:0.8068:0.0:0.1932	.	129;129	D3DTR7;O94989	.;ARHGF_HUMAN	M	129	ENSP00000355026:T129M;ENSP00000412505:T129M	ENSP00000355026:T129M	T	+	2	0	ARHGEF15	8156468	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	0.784000	0.26816	0.672000	0.31204	-0.263000	0.10527	ACG	ARHGEF15	-	NULL	ENSG00000198844		0.672	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	HGNC	protein_coding	OTTHUMT00000226993.2		0.00	87	0	C	NM_173728		8215743	+1			no_errors	ENST00000361926	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.001	T
ARID1B	57492	genome.wustl.edu	37	6	157505527	157505527	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:157505527delG	ENST00000350026.5	+	12	3470	c.3469delG	c.(3469-3471)gggfs	p.G1157fs	ARID1B_ENST00000346085.5_Frame_Shift_Del_p.G1170fs|ARID1B_ENST00000275248.4_Frame_Shift_Del_p.G1152fs|ARID1B_ENST00000367148.1_Frame_Shift_Del_p.G1210fs	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1157					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CTTCAGCACCGGGGACACCAA	0.612																																																	0													39.0	42.0	41.0					6																	157505527		2203	4296	6499	SO:0001589	frameshift_variant	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3469delG	6.37:g.157505527delG	ENSP00000055163:p.Gly1157fs		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Frame_Shift_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D1211fs	ENST00000350026.5	37	c.3628	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.612	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1		0.00	30	0	G	NM_020732		157505527	+1	tier1		no_errors	ENST00000367148	ensembl	human	known	74_37	frame_shift_del	7.84	47	4	DEL	0.792	-
ASB6	140459	genome.wustl.edu	37	9	132400881	132400881	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:132400881G>T	ENST00000277458.4	-	5	734	c.569C>A	c.(568-570)aCt>aAt	p.T190N	ASB6_ENST00000450050.2_Missense_Mutation_p.T111N|ASB6_ENST00000277459.4_Missense_Mutation_p.L154M|RP11-483H20.4_ENST00000455074.1_RNA	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	190					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				AATGTTCTCAGTATTGTGGAT	0.602																																																	0													81.0	67.0	72.0					9																	132400881		2203	4300	6503	SO:0001583	missense	0				CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.569C>A	9.37:g.132400881G>T	ENSP00000277458:p.Thr190Asn		Q5SZB7|Q9BV15	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.T190N	ENST00000277458.4	37	c.569	CCDS6924.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.60|17.60	3.430262|3.430262	0.62844|0.62844	.|.	.|.	ENSG00000148331|ENSG00000148331	ENST00000277459|ENST00000277458;ENST00000450050	T|T;T	0.59083|0.53857	0.29|0.6;0.6	4.69|4.69	4.69|4.69	0.59074|0.59074	.|Ankyrin repeat-containing domain (4);	.|0.163751	.|0.53938	.|D	.|0.000042	T|T	0.59945|0.59945	0.2231|0.2231	.|.	.|.	.|.	0.48236|0.48236	D|D	0.999615|0.999615	P|D;D	0.41569|0.59767	0.755|0.986;0.986	B|P;P	0.41036|0.57679	0.346|0.825;0.825	T|T	0.57118|0.57118	-0.7866|-0.7866	8|9	0.66056|0.33141	D|T	0.02|0.24	-14.7358|-14.7358	10.3948|10.3948	0.44194|0.44194	0.0891:0.0:0.9109:0.0|0.0891:0.0:0.9109:0.0	.|.	154|111;190	Q9NWX5-2|B4DRC4;Q9NWX5	.|.;ASB6_HUMAN	M|N	154|190;111	ENSP00000277459:L154M|ENSP00000277458:T190N;ENSP00000416172:T111N	ENSP00000277459:L154M|ENSP00000277458:T190N	L|T	-|-	1|2	2|0	ASB6|ASB6	131440702|131440702	1.000000|1.000000	0.71417|0.71417	0.964000|0.964000	0.40570|0.40570	0.811000|0.811000	0.45836|0.45836	5.228000|5.228000	0.65310|0.65310	2.418000|2.418000	0.82041|0.82041	0.561000|0.561000	0.74099|0.74099	CTG|ACT	ASB6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148331		0.602	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB6	HGNC	protein_coding	OTTHUMT00000054594.1	-	0.00	44	0	G	NM_017873		132400881	-1	tier1	-	no_errors	ENST00000277458	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.985	T
ASPG	374569	genome.wustl.edu	37	14	104570719	104570719	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:104570719G>T	ENST00000551177.1	+	8	924	c.832G>T	c.(832-834)Gac>Tac	p.D278Y	ASPG_ENST00000546892.2_Missense_Mutation_p.D278Y|ASPG_ENST00000455920.2_Missense_Mutation_p.D278Y	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	278	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						CACCAAGCCCGACCTGCTGCA	0.672																																																	0													34.0	44.0	41.0					14																	104570719		2125	4237	6362	SO:0001583	missense	0				CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.832G>T	14.37:g.104570719G>T	ENSP00000450040:p.Asp278Tyr		B9EGQ2|Q8IV80	Missense_Mutation	SNP	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_AsnASEI	p.D278Y	ENST00000551177.1	37	c.832	CCDS45170.2	14	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346556	0.61073	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920	T;T;T	0.25085	1.82;1.82;1.82	4.1	4.1	0.47936	.	0.216900	0.45606	D	0.000348	T	0.44746	0.1308	L	0.60845	1.875	0.80722	D	1	P;D;D;D	0.64830	0.779;0.994;0.992;0.992	B;D;P;D	0.65573	0.428;0.917;0.864;0.936	T	0.46665	-0.9175	10	0.87932	D	0	-10.8209	13.8191	0.63309	0.0:0.0:1.0:0.0	.	278;278;278;306	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	Y	278;306;278;278	ENSP00000450040:D278Y;ENSP00000448911:D278Y;ENSP00000389003:D278Y	ENSP00000299234:D306Y	D	+	1	0	ASPG	103640472	0.998000	0.40836	0.300000	0.25030	0.401000	0.30781	3.641000	0.54360	1.823000	0.53134	0.462000	0.41574	GAC	ASPG	-	pfam_Asparaginase/glutaminase,superfamily_Asparaginase/glutaminase,smart_Asparaginase/glutaminase,tigrfam_AsnASEI	ENSG00000166183		0.672	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	HGNC	protein_coding	OTTHUMT00000407005.1	-	0.00	87	0	G	NM_001080464		104570719	+1	tier1	-	no_errors	ENST00000455920	ensembl	human	known	74_37	missense	43.97	64	51	SNP	0.998	T
ASRGL1	80150	genome.wustl.edu	37	11	62105564	62105564	+	Missense_Mutation	SNP	C	C	T	rs533515407		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:62105564C>T	ENST00000415229.2	+	2	330	c.115C>T	c.(115-117)Cgg>Tgg	p.R39W	ASRGL1_ENST00000301776.5_Missense_Mutation_p.R39W|ASRGL1_ENST00000535727.1_5'UTR|RP11-703H8.7_ENST00000400902.4_RNA	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1	39					asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	CGGCATCCTCCGGGAGGGCGG	0.642																																																	0													30.0	29.0	29.0					11																	62105564		2201	4298	6499	SO:0001583	missense	0				CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.115C>T	11.37:g.62105564C>T	ENSP00000400057:p.Arg39Trp		B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	Missense_Mutation	SNP	pfam_Peptidase_T2	p.R39W	ENST00000415229.2	37	c.115	CCDS8019.1	11	.	.	.	.	.	.	.	.	.	.	c	13.23	2.175698	0.38413	.	.	ENSG00000162174	ENST00000415229;ENST00000301776	D;D	0.87334	-2.24;-2.24	4.36	2.0	0.26442	.	0.598044	0.18140	N	0.150422	D	0.90535	0.7034	M	0.88181	2.935	0.20821	N	0.999841	D	0.62365	0.991	P	0.55303	0.773	T	0.82481	-0.0436	10	0.66056	D	0.02	-5.1118	4.4863	0.11792	0.6804:0.2116:0.108:0.0	.	39	Q7L266	ASGL1_HUMAN	W	39	ENSP00000400057:R39W;ENSP00000301776:R39W	ENSP00000301776:R39W	R	+	1	2	ASRGL1	61862140	0.006000	0.16342	0.423000	0.26634	0.050000	0.14768	1.768000	0.38511	0.225000	0.20959	-1.105000	0.02106	CGG	ASRGL1	-	pfam_Peptidase_T2	ENSG00000162174		0.642	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASRGL1	HGNC	protein_coding	OTTHUMT00000394865.1	-	0.00	32	0	C	NM_001083926		62105564	+1	tier1	-	no_errors	ENST00000301776	ensembl	human	known	74_37	missense	36.00	32	18	SNP	0.107	T
ATG4B	23192	genome.wustl.edu	37	2	242606219	242606219	+	Missense_Mutation	SNP	C	C	G	rs369000453		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:242606219C>G	ENST00000404914.3	+	8	801	c.698C>G	c.(697-699)aCg>aGg	p.T233R	ATG4B_ENST00000402096.1_Missense_Mutation_p.T159R|ATG4B_ENST00000474739.2_Missense_Mutation_p.T219R|ATG4B_ENST00000396411.3_Missense_Mutation_p.T159R|ATG4B_ENST00000405546.3_Missense_Mutation_p.T233R	NM_013325.4|NM_178326.2	NP_037457.3|NP_847896.1	Q9Y4P1	ATG4B_HUMAN	autophagy related 4B, cysteine peptidase	233					autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|positive regulation of autophagy (GO:0010508)|positive regulation of protein catabolic process (GO:0045732)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)|endopeptidase activity (GO:0004175)			breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		CTGGGGCTCACGGACATCAAC	0.637																																					Melanoma(78;458 1323 6342 12171 39523)												0													30.0	33.0	32.0					2																	242606219		2138	4227	6365	SO:0001583	missense	0			AB023160	CCDS46564.1, CCDS46565.1	2q37.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000168397	ENSG00000168397			20790	protein-coding gene	gene with protein product		611338	"""APG4 autophagy 4 homolog B (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog B (S. cerevisiae)"""	APG4B		12446702	Standard	NM_013325		Approved	Apg4B, KIAA0943, DKFZp586D1822, AUTL1	uc002wbv.3	Q9Y4P1	OTTHUMG00000151514	ENST00000404914.3:c.698C>G	2.37:g.242606219C>G	ENSP00000384259:p.Thr233Arg		B7WNK2|Q53NU4|Q6ZUV8|Q8WYM9|Q96K07|Q96K96|Q96SZ1|Q9Y2F2	Missense_Mutation	SNP	pfam_Peptidase_C54	p.T233R	ENST00000404914.3	37	c.698	CCDS46564.1	2	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745354	0.69418	.	.	ENSG00000168397	ENST00000405546;ENST00000337606;ENST00000402096;ENST00000404914;ENST00000474739;ENST00000396411;ENST00000400771;ENST00000311517;ENST00000428861	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.79	4.89	0.63831	.	0.147911	0.56097	D	0.000022	T	0.58637	0.2136	M	0.65975	2.015	0.49483	D	0.999795	P;D;D;B;P	0.61080	0.953;0.981;0.989;0.179;0.933	P;P;P;B;P	0.58970	0.831;0.849;0.831;0.36;0.77	T	0.63010	-0.6732	10	0.62326	D	0.03	-18.0144	15.0116	0.71555	0.0:0.8581:0.1419:0.0	.	219;350;321;233;159	F5H7P2;B4DZK0;Q9Y4P1-2;Q9Y4P1;Q9Y4P1-4	.;.;.;ATG4B_HUMAN;.	R	233;350;159;233;219;159;182;159;70	ENSP00000383964:T233R;ENSP00000384661:T159R;ENSP00000384259:T233R;ENSP00000442378:T219R;ENSP00000379692:T159R;ENSP00000383582:T182R;ENSP00000404783:T70R	ENSP00000309348:T159R	T	+	2	0	ATG4B	242254892	0.997000	0.39634	0.655000	0.29622	0.707000	0.40811	3.033000	0.49743	1.409000	0.46915	0.655000	0.94253	ACG	ATG4B	-	pfam_Peptidase_C54	ENSG00000168397		0.637	ATG4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4B	HGNC	protein_coding	OTTHUMT00000322967.3		0.00	12	0	C	NM_013325		242606219	+1			no_errors	ENST00000404914	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.932	G
ATP13A2	23400	genome.wustl.edu	37	1	17323611	17323611	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:17323611C>A	ENST00000326735.8	-	12	1132	c.1099G>T	c.(1099-1101)Gag>Tag	p.E367*	ATP13A2_ENST00000502860.1_5'UTR|ATP13A2_ENST00000452699.1_Nonsense_Mutation_p.E362*|ATP13A2_ENST00000341676.5_Nonsense_Mutation_p.E362*|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	367					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CGGTGTGTCTCTGCACAGTAG	0.652																																																	0													76.0	76.0	76.0					1																	17323611		2203	4300	6503	SO:0001587	stop_gained	0			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.1099G>T	1.37:g.17323611C>A	ENSP00000327214:p.Glu367*		O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.E367*	ENST00000326735.8	37	c.1099	CCDS175.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.019357	0.97205	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000506174	.	.	.	5.57	4.65	0.58169	.	0.140952	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-28.3915	9.8382	0.40982	0.0:0.8537:0.0:0.1463	.	.	.	.	X	367;362;362;87	.	ENSP00000327214:E367X	E	-	1	0	ATP13A2	17196198	0.777000	0.28628	1.000000	0.80357	0.235000	0.25334	2.118000	0.41949	2.627000	0.88993	0.561000	0.74099	GAG	ATP13A2	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000159363		0.652	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP13A2	HGNC	protein_coding	OTTHUMT00000006617.1		0.00	28	0	C	NM_022089		17323611	-1			no_errors	ENST00000326735	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	0.999	A
BRPF1	7862	genome.wustl.edu	37	3	9783054	9783054	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:9783054G>A	ENST00000457855.1	+	4	1796	c.1785G>A	c.(1783-1785)cgG>cgA	p.R595R	BRPF1_ENST00000424362.1_Silent_p.R595R|BRPF1_ENST00000433861.2_Silent_p.R595R|BRPF1_ENST00000302054.3_Silent_p.R595R|BRPF1_ENST00000383829.2_Silent_p.R595R			P55201	BRPF1_HUMAN	bromodomain and PHD finger containing, 1	595	Interaction with MEAF6 and ING5.|Required for RUNX1 and RUNX2 transcriptional activation.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(15)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	49	Medulloblastoma(99;0.227)					AGCGGCTCCGGCATGACTTGG	0.512																																																	0													66.0	74.0	71.0					3																	9783054		2203	4300	6503	SO:0001819	synonymous_variant	0			M91585	CCDS2575.1, CCDS33692.1	3p26-p25	2008-07-18			ENSG00000156983	ENSG00000156983			14255	protein-coding gene	gene with protein product	"""peregrin"", ""bromodomain-containing protein, 140kD"""	602410				8946209, 7906940	Standard	NM_001003694		Approved	BR140	uc003bsf.3	P55201	OTTHUMG00000097033	ENST00000457855.1:c.1785G>A	3.37:g.9783054G>A			B4DEZ6|Q7Z6E0|Q8TCM6|Q9UHI0	Silent	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP_dom,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_PHD-finger,pfscan_Znf_C2H2,pfscan_Bromodomain,prints_Bromodomain	p.R595	ENST00000457855.1	37	c.1785	CCDS2575.1	3																																																																																			BRPF1	-	NULL	ENSG00000156983		0.512	BRPF1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRPF1	HGNC	protein_coding	OTTHUMT00000338485.1	-	0.00	33	0	G	NM_001003694		9783054	+1	tier1	-	no_errors	ENST00000383829	ensembl	human	known	74_37	silent	8.89	41	4	SNP	1.000	A
BSDC1	55108	genome.wustl.edu	37	1	32841985	32841985	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:32841985C>T	ENST00000455895.2	-	9	1067	c.1034G>A	c.(1033-1035)gGc>gAc	p.G345D	BSDC1_ENST00000413080.1_Missense_Mutation_p.G284D|BSDC1_ENST00000446293.2_Missense_Mutation_p.G362D|BSDC1_ENST00000463967.1_5'Flank|BSDC1_ENST00000341071.7_Missense_Mutation_p.G362D|BSDC1_ENST00000419121.2_Missense_Mutation_p.G289D|BSDC1_ENST00000449308.1_Missense_Mutation_p.G345D|BSDC1_ENST00000526031.1_Missense_Mutation_p.G250D	NM_001143888.1|NM_018045.6	NP_001137360.1|NP_060515.3	Q9NW68	BSDC1_HUMAN	BSD domain containing 1	345										breast(1)|central_nervous_system(2)|kidney(1)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GGGCTCTGGGCCGCCGGTGTG	0.617																																																	0													63.0	71.0	68.0					1																	32841985		2203	4300	6503	SO:0001583	missense	0			BX641056	CCDS363.2, CCDS44101.1, CCDS44102.1, CCDS44103.1, CCDS72752.1	1p35.1	2008-02-05			ENSG00000160058	ENSG00000160058			25501	protein-coding gene	gene with protein product						12477932	Standard	XM_005270985		Approved	FLJ10276, RP4-811H24.7	uc010ohg.2	Q9NW68	OTTHUMG00000007588	ENST00000455895.2:c.1034G>A	1.37:g.32841985C>T	ENSP00000412173:p.Gly345Asp		B4DMS7|B4DTI7|B4DTP7|B4E2X8|Q49AT8|Q68DY6|Q6IAA3|Q6MZK1|Q6UXS1|Q9HAL9	Missense_Mutation	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.G362D	ENST00000455895.2	37	c.1085	CCDS363.2	1	.	.	.	.	.	.	.	.	.	.	C	11.25	1.583263	0.28268	.	.	ENSG00000160058	ENST00000455895;ENST00000413080;ENST00000341071;ENST00000526031;ENST00000419121;ENST00000446293;ENST00000449308	.	.	.	4.87	2.91	0.33838	.	0.479526	0.26404	N	0.024569	T	0.30448	0.0765	L	0.50333	1.59	0.09310	N	1	B;B;B;B;B	0.33266	0.404;0.001;0.052;0.071;0.009	B;B;B;B;B	0.27076	0.047;0.005;0.029;0.076;0.013	T	0.12016	-1.0564	9	0.27082	T	0.32	-1.7588	7.6063	0.28103	0.2588:0.6544:0.0:0.0868	.	250;289;362;362;345	Q9NW68-9;Q9NW68-8;Q9NW68-7;Q9NW68-3;Q9NW68	.;.;.;.;BSDC1_HUMAN	D	345;284;362;250;289;362;345	.	ENSP00000344816:G362D	G	-	2	0	BSDC1	32614572	0.007000	0.16637	0.006000	0.13384	0.783000	0.44284	0.241000	0.18065	0.671000	0.31185	0.462000	0.41574	GGC	BSDC1	-	NULL	ENSG00000160058		0.617	BSDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSDC1	HGNC	protein_coding	OTTHUMT00000020056.3	-	0.00	18	0	C	NM_018045		32841985	-1	tier1	-	no_errors	ENST00000341071	ensembl	human	known	74_37	missense	19.51	32	8	SNP	0.003	T
BVES	11149	genome.wustl.edu	37	6	105573372	105573372	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:105573372G>T	ENST00000314641.5	-	4	649	c.433C>A	c.(433-435)Cta>Ata	p.L145I	BVES_ENST00000446408.2_Missense_Mutation_p.L145I|BVES_ENST00000336775.5_Missense_Mutation_p.L145I	NM_001199563.1	NP_001186492.1	Q8NE79	POPD1_HUMAN	blood vessel epicardial substance	145					epithelial cell-cell adhesion (GO:0090136)|hematopoietic progenitor cell differentiation (GO:0002244)|muscle organ development (GO:0007517)|positive regulation of locomotion (GO:0040017)|positive regulation of receptor recycling (GO:0001921)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|regulation of Rac GTPase activity (GO:0032314)|sinoatrial node cell development (GO:0060931)|substrate adhesion-dependent cell spreading (GO:0034446)|vesicle-mediated transport (GO:0016192)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cAMP binding (GO:0030552)|structural molecule activity (GO:0005198)			NS(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|urinary_tract(1)	21		all_cancers(87;2.83e-05)|Acute lymphoblastic leukemia(125;1.95e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0101)|Colorectal(196;0.204)|Lung NSC(302;0.238)				TGTCCAGTTAGTCTTCTGAAC	0.433																																																	0													157.0	153.0	154.0					6																	105573372		2203	4300	6503	SO:0001583	missense	0			AF124512	CCDS5051.1	6q21	2008-11-25			ENSG00000112276	ENSG00000112276			1152	protein-coding gene	gene with protein product	"""popeye domain containing 1"""	604577				10441744, 10882522	Standard	NM_147147		Approved	HBVES, POP1, POPDC1	uc003pqx.3	Q8NE79	OTTHUMG00000015291	ENST00000314641.5:c.433C>A	6.37:g.105573372G>T	ENSP00000313172:p.Leu145Ile		A8K1R4|E1P5D8|Q5T550|Q5T551|Q8IWC6|Q9HBV0|Q9UNG6	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.L145I	ENST00000314641.5	37	c.433	CCDS5051.1	6	.	.	.	.	.	.	.	.	.	.	G	17.74	3.463557	0.63513	.	.	ENSG00000112276	ENST00000314641;ENST00000336775;ENST00000446408	T;T;T	0.26067	1.76;1.76;1.76	5.76	3.25	0.37280	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	T	0.20292	0.0488	L	0.29908	0.895	0.46260	D	0.998952	D	0.76494	0.999	D	0.78314	0.991	T	0.02378	-1.1168	10	0.33141	T	0.24	-26.4537	8.8599	0.35251	0.6511:0.0:0.3489:0.0	.	145	Q8NE79	POPD1_HUMAN	I	145	ENSP00000313172:L145I;ENSP00000337259:L145I;ENSP00000397310:L145I	ENSP00000313172:L145I	L	-	1	2	BVES	105680065	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	2.111000	0.41883	0.451000	0.26802	-0.290000	0.09829	CTA	BVES	-	pfam_Popeye_prot,superfamily_cNMP-bd-like	ENSG00000112276		0.433	BVES-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BVES	HGNC	protein_coding	OTTHUMT00000406075.1	-	0.00	61	0	G	NM_147147		105573372	-1	tier1	-	no_errors	ENST00000314641	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
C19orf68	374920	genome.wustl.edu	37	19	48675270	48675270	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:48675270C>T	ENST00000328759.7	+	2	243	c.211C>T	c.(211-213)Ctc>Ttc	p.L71F	LIG1_ENST00000263274.7_5'Flank|ZNF114_ENST00000597695.1_5'Flank|LIG1_ENST00000536218.1_5'Flank|C19orf68_ENST00000593921.1_3'UTR|LIG1_ENST00000427526.2_5'Flank|LIG1_ENST00000599165.1_5'Flank			Q86XI8	CS068_HUMAN	chromosome 19 open reading frame 68	71					hematopoietic progenitor cell differentiation (GO:0002244)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)											CATCGACGTGCTCAAGTACAG	0.687																																																	0																																										SO:0001583	missense	0			BC043386	CCDS74411.1	19q13.32	2008-08-06			ENSG00000185453	ENSG00000185453			34495	protein-coding gene	gene with protein product						12477932	Standard	NM_199341		Approved	LOC374920	uc002pic.3	Q86XI8		ENST00000328759.7:c.211C>T	19.37:g.48675270C>T	ENSP00000331363:p.Leu71Phe			Missense_Mutation	SNP	NULL	p.L71F	ENST00000328759.7	37	c.211		19	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783382	0.49891	.	.	ENSG00000185453	ENST00000328759	T	0.54071	0.59	5.43	1.88	0.25563	.	0.000000	0.41938	D	0.000798	T	0.35335	0.0928	L	0.32530	0.975	0.29477	N	0.856602	P	0.37101	0.582	B	0.36464	0.225	T	0.34054	-0.9844	10	0.72032	D	0.01	-0.275	3.7977	0.08746	0.1701:0.5763:0.1645:0.0891	.	71	Q86XI8	CS068_HUMAN	F	71	ENSP00000331363:L71F	ENSP00000331363:L71F	L	+	1	0	C19orf68	53367082	1.000000	0.71417	1.000000	0.80357	0.139000	0.21198	1.053000	0.30442	0.768000	0.33290	-0.181000	0.13052	CTC	C19orf68	-	NULL	ENSG00000185453		0.687	C19orf68-001	KNOWN	non_canonical_other|basic|appris_principal	protein_coding	C19orf68	HGNC	protein_coding	OTTHUMT00000465598.1	-	0.00	28	0	C	XM_001713770		48675270	+1	tier1	-	no_errors	ENST00000328759	ensembl	human	known	74_37	missense	17.86	46	10	SNP	1.000	T
ERICH3	127254	genome.wustl.edu	37	1	75037442	75037442	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:75037442C>A	ENST00000326665.5	-	14	4170	c.3952G>T	c.(3952-3954)Ggg>Tgg	p.G1318W	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1318	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TCCATGTCCCCGTCCCCTTCC	0.557																																																	0													264.0	231.0	242.0					1																	75037442		2203	4300	6503	SO:0001583	missense	0																														ENST00000326665.5:c.3952G>T	1.37:g.75037442C>A	ENSP00000322609:p.Gly1318Trp		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.G1318W	ENST00000326665.5	37	c.3952	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	11.22	1.575936	0.28092	.	.	ENSG00000178965	ENST00000326665	T	0.25414	1.8	1.58	-3.16	0.05217	.	.	.	.	.	T	0.08758	0.0217	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	P	0.55824	0.785	T	0.06625	-1.0816	9	0.66056	D	0.02	.	3.3929	0.07295	0.0:0.2397:0.2235:0.5369	.	1318	Q5RHP9	CA173_HUMAN	W	1318	ENSP00000322609:G1318W	ENSP00000322609:G1318W	G	-	1	0	C1orf173	74810030	0.000000	0.05858	0.007000	0.13788	0.008000	0.06430	-2.005000	0.01460	-0.449000	0.07117	-0.448000	0.05591	GGG	C1orf173	-	NULL	ENSG00000178965		0.557	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1		0.00	40	0	C			75037442	-1			no_errors	ENST00000326665	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.000	A
C2CD3	26005	genome.wustl.edu	37	11	73785305	73785305	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:73785305G>T	ENST00000334126.7	-	24	5170	c.4944C>A	c.(4942-4944)agC>agA	p.S1648R	C2CD3_ENST00000313663.7_Missense_Mutation_p.S1648R			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1648	C2 2.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TACCTTTCAAGCTCAAGTGCA	0.498																																																	0													90.0	74.0	80.0					11																	73785305		2200	4293	6493	SO:0001583	missense	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4944C>A	11.37:g.73785305G>T	ENSP00000334379:p.Ser1648Arg		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.S1648R	ENST00000334126.7	37	c.4944		11	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447561	0.63178	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.40756	1.02;1.02;1.02	5.68	-0.0734	0.13735	.	0.045299	0.85682	D	0.000000	T	0.52948	0.1766	M	0.62723	1.935	0.32483	N	0.541216	D	0.76494	0.999	D	0.79784	0.993	T	0.59134	-0.7511	10	0.72032	D	0.01	-10.777	6.2654	0.20924	0.3637:0.0:0.5131:0.1232	.	1648	Q4AC94-1	.	R	1648;1648;1629;456	ENSP00000334379:S1648R;ENSP00000323339:S1648R;ENSP00000388750:S456R	ENSP00000323339:S1648R	S	-	3	2	C2CD3	73462953	1.000000	0.71417	0.995000	0.50966	0.982000	0.71751	0.791000	0.26915	0.134000	0.18681	-0.140000	0.14226	AGC	C2CD3	-	superfamily_C2_dom,smart_C2_dom	ENSG00000168014		0.498	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding			0.00	36	0	G	NM_015531		73785305	-1			no_errors	ENST00000334126	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.997	T
C7	730	genome.wustl.edu	37	5	40959629	40959629	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:40959629G>T	ENST00000313164.9	+	12	1927	c.1568G>T	c.(1567-1569)tGc>tTc	p.C523F		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	523	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				AGCCGTGAATGCAATAACCCA	0.527																																																	0													60.0	68.0	65.0					5																	40959629		1928	4130	6058	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1568G>T	5.37:g.40959629G>T	ENSP00000322061:p.Cys523Phe		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.C523F	ENST00000313164.9	37	c.1568	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.504367	0.85176	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.25414	1.8	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82186	-0.0582	10	0.87932	D	0	-13.8336	19.0801	0.93178	0.0:0.0:1.0:0.0	.	523	P10643	CO7_HUMAN	F	523;363	ENSP00000322061:C523F	ENSP00000322061:C523F	C	+	2	0	C7	40995386	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	7.081000	0.76844	2.523000	0.85059	0.462000	0.41574	TGC	C7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112936		0.527	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	-	0.00	33	0	G			40959629	+1	tier1	-	no_errors	ENST00000313164	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	T
C5orf45	51149	genome.wustl.edu	37	5	179264464	179264464	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:179264464T>C	ENST00000292586.6	-	7	1049	c.959A>G	c.(958-960)gAg>gGg	p.E320G	C5orf45_ENST00000518235.1_Intron|C5orf45_ENST00000403396.2_Intron|C5orf45_ENST00000376931.2_Missense_Mutation_p.E265G|C5orf45_ENST00000518219.1_3'UTR|C5orf45_ENST00000523084.1_Missense_Mutation_p.E186G|SQSTM1_ENST00000376929.3_3'UTR|C5orf45_ENST00000523267.1_5'UTR|SQSTM1_ENST00000389805.4_3'UTR|C5orf45_ENST00000520698.1_Intron	NM_016175.3	NP_057259.2	Q6NTE8	CE045_HUMAN	chromosome 5 open reading frame 45	320										breast(2)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	12						ATTCTGTGCCTCCAGGACCAG	0.577																																																	0													164.0	167.0	166.0					5																	179264464		2203	4300	6503	SO:0001583	missense	0				CCDS34318.1, CCDS34319.1	5q35.3	2008-07-10			ENSG00000161010	ENSG00000161010			30817	protein-coding gene	gene with protein product	"""truncated calcium binding protein"""						Standard	NM_016175		Approved	MGC65027, MGC78537, DKFZp686L2452, LOC51149	uc003mla.3	Q6NTE8	OTTHUMG00000163490	ENST00000292586.6:c.959A>G	5.37:g.179264464T>C	ENSP00000292586:p.Glu320Gly		B5MD09|E9PAK6|Q7Z3D8|Q9BUC1|Q9UN54	Missense_Mutation	SNP	NULL	p.E320G	ENST00000292586.6	37	c.959	CCDS34319.1	5	.	.	.	.	.	.	.	.	.	.	T	0.178	-1.065318	0.01934	.	.	ENSG00000161010	ENST00000376931;ENST00000523084;ENST00000292586	T;T;T	0.08282	3.11;3.11;3.11	4.49	-2.81	0.05805	.	1.400360	0.04607	N	0.399580	T	0.01835	0.0058	N	0.00707	-1.245	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.39603	-0.9606	10	0.02654	T	1	-1.7387	3.6232	0.08104	0.4179:0.2443:0.0:0.3378	.	265;320	E9PAK6;Q6NTE8	.;CE045_HUMAN	G	265;186;320	ENSP00000366130:E265G;ENSP00000429107:E186G;ENSP00000292586:E320G	ENSP00000292586:E320G	E	-	2	0	C5orf45	179197070	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.163000	0.09997	-0.610000	0.05716	0.379000	0.24179	GAG	C5orf45	-	NULL	ENSG00000161010		0.577	C5orf45-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C5orf45	HGNC	protein_coding	OTTHUMT00000373760.2		0.00	29	0	T	NM_016175		179264464	-1			no_errors	ENST00000292586	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.000	C
C9orf50	375759	genome.wustl.edu	37	9	132382092	132382092	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:132382092G>T	ENST00000372478.4	-	2	727	c.526C>A	c.(526-528)Cat>Aat	p.H176N	NTMT1_ENST00000372486.1_Intron	NM_199350.3	NP_955382.3	Q5SZB4	CI050_HUMAN	chromosome 9 open reading frame 50	176										central_nervous_system(1)|endometrium(4)|large_intestine(2)|ovary(1)|skin(1)|urinary_tract(1)	10		Ovarian(14;0.00556)				CCCCTTTGATGTTGCGGTGCT	0.592																																																	0													155.0	147.0	150.0					9																	132382092		2203	4300	6503	SO:0001583	missense	0			AK093122	CCDS35159.1	9q34.2	2012-03-15			ENSG00000179058	ENSG00000179058			23677	protein-coding gene	gene with protein product							Standard	NM_199350		Approved	FLJ35803	uc004byc.4	Q5SZB4	OTTHUMG00000020786	ENST00000372478.4:c.526C>A	9.37:g.132382092G>T	ENSP00000361556:p.His176Asn		Q2M1I2|Q8NA65	Missense_Mutation	SNP	NULL	p.H176N	ENST00000372478.4	37	c.526	CCDS35159.1	9	.	.	.	.	.	.	.	.	.	.	G	9.938	1.216800	0.22373	.	.	ENSG00000179058	ENST00000372478	T	0.17691	2.26	3.57	-1.75	0.08031	.	0.928117	0.08846	N	0.885169	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	B	0.20052	0.041	B	0.23574	0.047	T	0.40136	-0.9579	10	0.07482	T	0.82	-0.8749	0.6953	0.00898	0.3047:0.1666:0.3582:0.1705	.	176	Q5SZB4	CI050_HUMAN	N	176	ENSP00000361556:H176N	ENSP00000361556:H176N	H	-	1	0	C9orf50	131421913	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.441000	0.21611	-0.365000	0.08076	0.579000	0.79373	CAT	C9orf50	-	NULL	ENSG00000179058		0.592	C9orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf50	HGNC	protein_coding	OTTHUMT00000054593.1		0.00	41	0	G	NM_199350		132382092	-1			no_errors	ENST00000372478	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
CACNA1H	8912	genome.wustl.edu	37	16	1259375	1259375	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:1259375G>T	ENST00000348261.5	+	17	3955	c.3707G>T	c.(3706-3708)cGt>cTt	p.R1236L	CACNA1H_ENST00000358590.4_Missense_Mutation_p.R1236L|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Missense_Mutation_p.R1236L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1236					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GACAGCCACCGTGAGGATGCA	0.706																																																	0													27.0	30.0	29.0					16																	1259375		2107	4180	6287	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3707G>T	16.37:g.1259375G>T	ENSP00000334198:p.Arg1236Leu		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.R1236L	ENST00000348261.5	37	c.3707	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	G	10.01	1.234674	0.22626	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96459	-4.02;-3.97	3.99	-1.31	0.09230	.	0.677303	0.13303	N	0.398118	D	0.91821	0.7412	L	0.27053	0.805	0.22001	N	0.999426	B;B	0.29612	0.185;0.251	B;B	0.36335	0.222;0.097	D	0.84339	0.0526	10	0.37606	T	0.19	.	9.0907	0.36610	0.4637:0.0:0.5363:0.0	.	1236;1236	O95180-2;O95180	.;CAC1H_HUMAN	L	1236	ENSP00000334198:R1236L;ENSP00000351401:R1236L	ENSP00000334198:R1236L	R	+	2	0	CACNA1H	1199376	0.924000	0.31332	0.965000	0.40720	0.028000	0.11728	0.400000	0.20932	-0.218000	0.10018	0.491000	0.48974	CGT	CACNA1H	-	NULL	ENSG00000196557		0.706	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1		0.00	59	0	G	NM_001005407		1259375	+1			no_errors	ENST00000348261	ensembl	human	known	74_37	missense	5.71	65	4	SNP	0.987	T
CALCOCO1	57658	genome.wustl.edu	37	12	54118467	54118467	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:54118467G>T	ENST00000550804.1	-	3	281	c.221C>A	c.(220-222)aCt>aAt	p.T74N	CALCOCO1_ENST00000548263.1_Missense_Mutation_p.T74N|CALCOCO1_ENST00000547885.1_5'UTR|CALCOCO1_ENST00000262059.4_Missense_Mutation_p.T74N|CALCOCO1_ENST00000430117.2_Missense_Mutation_p.T74N			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	74	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						GGAACCATCAGTTGTACTTTC	0.502																																																	0													72.0	63.0	66.0					12																	54118467		2203	4300	6503	SO:0001583	missense	0			AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.221C>A	12.37:g.54118467G>T	ENSP00000449960:p.Thr74Asn		B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Missense_Mutation	SNP	pfam_CoCoA	p.T74N	ENST00000550804.1	37	c.221	CCDS8864.1	12	.	.	.	.	.	.	.	.	.	.	G	11.58	1.682145	0.29872	.	.	ENSG00000012822	ENST00000430117;ENST00000262059;ENST00000413257;ENST00000548263;ENST00000550804;ENST00000549935;ENST00000551900;ENST00000546619;ENST00000547949;ENST00000553154;ENST00000549784;ENST00000549173;ENST00000548177;ENST00000552623;ENST00000549349;ENST00000549688;ENST00000547885;ENST00000548431	T;T;T;T;T;T;T;T;T;T;T;T	0.10288	2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89;2.89	5.73	4.83	0.62350	.	0.652364	0.13629	N	0.373823	T	0.07548	0.0190	N	0.14661	0.345	0.27062	N	0.963533	B;B;B;B;B	0.30937	0.301;0.007;0.087;0.02;0.106	B;B;B;B;B	0.36418	0.224;0.023;0.09;0.014;0.147	T	0.31081	-0.9956	10	0.20519	T	0.43	-0.0497	9.1537	0.36978	0.0785:0.1493:0.7722:0.0	.	74;74;74;74;74	B4DG60;E9PAU0;Q9P1Z2-3;Q9P1Z2-2;Q9P1Z2	.;.;.;.;CACO1_HUMAN	N	74	ENSP00000397189:T74N;ENSP00000262059:T74N;ENSP00000447647:T74N;ENSP00000449960:T74N;ENSP00000450083:T74N;ENSP00000448621:T74N;ENSP00000447117:T74N;ENSP00000449058:T74N;ENSP00000446820:T74N;ENSP00000448026:T74N;ENSP00000450012:T74N;ENSP00000449796:T74N	ENSP00000262059:T74N	T	-	2	0	CALCOCO1	52404734	0.043000	0.20138	0.727000	0.30756	0.995000	0.86356	1.906000	0.39887	2.882000	0.98803	0.655000	0.94253	ACT	CALCOCO1	-	pfam_CoCoA	ENSG00000012822		0.502	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CALCOCO1	HGNC	protein_coding	OTTHUMT00000407233.2	-	0.00	78	0	G	NM_020898		54118467	-1	tier1	-	no_errors	ENST00000550804	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.781	T
CAPN13	92291	genome.wustl.edu	37	2	30957354	30957354	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:30957354G>C	ENST00000295055.8	-	19	1935	c.1759C>G	c.(1759-1761)Ctc>Gtc	p.L587V	CAPN13_ENST00000534090.2_Missense_Mutation_p.L587V	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	587					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					GAGCTCAGGAGGACTCCAGGG	0.537																																																	0													75.0	80.0	79.0					2																	30957354		1901	4132	6033	SO:0001583	missense	0				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1759C>G	2.37:g.30957354G>C	ENSP00000295055:p.Leu587Val		Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L587V	ENST00000295055.8	37	c.1759	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	G	4.999	0.185592	0.09495	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.32753	1.44;1.44	4.84	2.86	0.33363	EF-hand-like domain (1);	0.319446	0.34777	N	0.003696	T	0.26882	0.0658	L	0.60455	1.87	0.36889	D	0.889775	B	0.25772	0.134	B	0.27380	0.079	T	0.16482	-1.0401	10	0.62326	D	0.03	.	4.6574	0.12624	0.374:0.0:0.626:0.0	.	587	Q6MZZ7	CAN13_HUMAN	V	587	ENSP00000295055:L587V;ENSP00000431298:L587V	ENSP00000295055:L587V	L	-	1	0	CAPN13	30810858	0.918000	0.31147	0.102000	0.21198	0.261000	0.26267	1.368000	0.34216	0.450000	0.26774	0.455000	0.32223	CTC	CAPN13	-	NULL	ENSG00000162949		0.537	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	-	0.00	43	0	G	NM_144575		30957354	-1	tier1	-	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	30.77	43	20	SNP	0.630	C
CASC5	57082	genome.wustl.edu	37	15	40914458	40914458	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:40914458A>G	ENST00000346991.5	+	11	2464	c.2074A>G	c.(2074-2076)Ata>Gta	p.I692V	CASC5_ENST00000399668.2_Missense_Mutation_p.I666V|CASC5_ENST00000527044.1_3'UTR			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	692	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TAATCAGGAGATAGCAACAAG	0.373																																																	0													77.0	75.0	76.0					15																	40914458		1821	4088	5909	SO:0001583	missense	0			AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.2074A>G	15.37:g.40914458A>G	ENSP00000335463:p.Ile692Val		Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	NULL	p.I692V	ENST00000346991.5	37	c.2074	CCDS42023.1	15	.	.	.	.	.	.	.	.	.	.	A	0.112	-1.137199	0.01742	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000399668	T;T	0.05258	3.47;3.47	3.65	2.52	0.30459	.	0.672814	0.12123	N	0.497504	T	0.05640	0.0148	L	0.44542	1.39	0.09310	N	1	B;B;B	0.16396	0.004;0.007;0.017	B;B;B	0.12156	0.007;0.005;0.005	T	0.46569	-0.9182	10	0.10636	T	0.68	.	7.4409	0.27183	0.8985:0.0:0.1015:0.0	.	666;692;666	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	V	692;666;666	ENSP00000335463:I692V;ENSP00000382576:I666V	ENSP00000260369:I666V	I	+	1	0	CASC5	38701750	0.000000	0.05858	0.017000	0.16124	0.854000	0.48673	0.163000	0.16520	0.490000	0.27771	0.455000	0.32223	ATA	CASC5	-	NULL	ENSG00000137812		0.373	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CASC5	HGNC	protein_coding	OTTHUMT00000390224.2	-	0.00	29	0	A	NM_144508		40914458	+1	tier1	-	no_errors	ENST00000346991	ensembl	human	known	74_37	missense	34.78	15	8	SNP	0.008	G
CASKIN1	57524	genome.wustl.edu	37	16	2236814	2236814	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:2236814C>T	ENST00000343516.6	-	10	1034	c.942G>A	c.(940-942)caG>caA	p.Q314Q	CASKIN1_ENST00000564289.1_5'Flank	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	314	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CATCCGGATGCTGCTCGAGGA	0.667																																																	0													31.0	34.0	33.0					16																	2236814		2012	4155	6167	SO:0001819	synonymous_variant	0			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.942G>A	16.37:g.2236814C>T			Q9P2P0	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain,prints_Ankyrin_rpt	p.Q314	ENST00000343516.6	37	c.942	CCDS42103.1	16																																																																																			CASKIN1	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000167971		0.667	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN1	HGNC	protein_coding	OTTHUMT00000435055.1	-	0.00	36	0	C	NM_020764		2236814	-1	tier1	-	no_errors	ENST00000343516	ensembl	human	known	74_37	silent	5.97	63	4	SNP	1.000	T
CBFA2T2	9139	genome.wustl.edu	37	20	32228152	32228152	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:32228152G>T	ENST00000346541.3	+	11	1867	c.1330G>T	c.(1330-1332)Gct>Tct	p.A444S	CBFA2T2_ENST00000375279.2_Missense_Mutation_p.A444S|CBFA2T2_ENST00000543126.1_5'UTR|CBFA2T2_ENST00000492345.1_Missense_Mutation_p.A415S|CBFA2T2_ENST00000342704.6_Missense_Mutation_p.A435S|CBFA2T2_ENST00000397800.1_Missense_Mutation_p.A415S|CBFA2T2_ENST00000359606.3_Missense_Mutation_p.A454S	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2	444					epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						TCTAGAAGAAGCTGTGAATAA	0.463																																					Esophageal Squamous(174;142 1955 14837 21276 28041)												0													53.0	49.0	50.0					20																	32228152		2203	4300	6503	SO:0001583	missense	0			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.1330G>T	20.37:g.32228152G>T	ENSP00000262653:p.Ala444Ser		B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTGR1	p.A444S	ENST00000346541.3	37	c.1330	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337492	0.81911	.	.	ENSG00000078699	ENST00000397803;ENST00000375279;ENST00000342704;ENST00000346541;ENST00000397800;ENST00000359606	T;T;T;T;T	0.53206	0.63;0.63;0.63;0.64;1.27	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	L	0.29908	0.895	0.80722	D	1	B;B	0.18310	0.016;0.027	B;B	0.17722	0.008;0.019	T	0.12734	-1.0536	10	0.40728	T	0.16	-21.536	20.1458	0.98076	0.0:0.0:1.0:0.0	.	444;435	O43439;F8W6D7	MTG8R_HUMAN;.	S	218;444;435;444;415;454	ENSP00000364428:A444S;ENSP00000345810:A435S;ENSP00000262653:A444S;ENSP00000380902:A415S;ENSP00000352622:A454S	ENSP00000345810:A435S	A	+	1	0	CBFA2T2	31691813	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.825000	0.99386	2.765000	0.95021	0.643000	0.83706	GCT	CBFA2T2	-	NULL	ENSG00000078699		0.463	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	-	0.00	40	0	G	NM_001032999		32228152	+1	tier1	-	no_errors	ENST00000346541	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
CCDC120	90060	genome.wustl.edu	37	X	48924907	48924908	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:48924907_48924908delTG	ENST00000376396.3	+	10	1371_1372	c.1152_1153delTG	c.(1150-1155)tctgccfs	p.A385fs	CCDC120_ENST00000597275.1_Frame_Shift_Del_p.A385fs|CCDC120_ENST00000536628.2_Frame_Shift_Del_p.A373fs|CCDC120_ENST00000603986.1_Frame_Shift_Del_p.A420fs|CCDC120_ENST00000422185.2_Frame_Shift_Del_p.A385fs|CCDC120_ENST00000496529.2_Frame_Shift_Del_p.A385fs	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	385	Pro-rich.									breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						TGGCTCCCTCTGCCTCTGGCCC	0.703																																																	0																																										SO:0001589	frameshift_variant	0			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.1152_1153delTG	X.37:g.48924907_48924908delTG	ENSP00000365577:p.Ala385fs		B4DFC1|B4DTU2|F5GZU4	Frame_Shift_Del	DEL	pfam_DUF3338	p.A420fs	ENST00000376396.3	37	c.1257_1258	CCDS14316.1	X																																																																																			CCDC120	-	NULL	ENSG00000147144		0.703	CCDC120-001	KNOWN	basic|CCDS	protein_coding	CCDC120	HGNC	protein_coding	OTTHUMT00000056528.1		0.00	9	0	TG	NM_033626		48924908	+1	tier1		no_errors	ENST00000603986	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	0.971:0.958	-
CCDC39	339829	genome.wustl.edu	37	3	180372723	180372723	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:180372723G>T	ENST00000442201.2	-	7	876	c.757C>A	c.(757-759)Cag>Aag	p.Q253K	CCDC39_ENST00000273654.4_Missense_Mutation_p.Q337K	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	253					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			CTCGTTTCCTGCTTTATCCTT	0.279																																																	0													118.0	101.0	106.0					3																	180372723		1787	4060	5847	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.757C>A	3.37:g.180372723G>T	ENSP00000405708:p.Gln253Lys		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q253K	ENST00000442201.2	37	c.757	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036632	0.54896	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.21932	1.98;1.98	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.33904	0.0879	L	0.56396	1.775	0.46011	D	0.998817	D	0.53885	0.963	P	0.52189	0.692	T	0.02004	-1.1231	10	0.15066	T	0.55	-17.7616	19.7555	0.96287	0.0:0.0:1.0:0.0	.	253	Q9UFE4	CCD39_HUMAN	K	337;253	ENSP00000273654:Q337K;ENSP00000405708:Q253K	ENSP00000273654:Q337K	Q	-	1	0	CCDC39	181855417	1.000000	0.71417	0.997000	0.53966	0.432000	0.31715	5.245000	0.65405	2.737000	0.93849	0.563000	0.77884	CAG	CCDC39	-	NULL	ENSG00000145075		0.279	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	71	0	G	XM_291028		180372723	-1	tier1	-	no_errors	ENST00000442201	ensembl	human	known	74_37	missense	25.66	84	29	SNP	1.000	T
CCHCR1	54535	genome.wustl.edu	37	6	31122386	31122386	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:31122386C>T	ENST00000376266.5	-	4	543	c.421G>A	c.(421-423)Gct>Act	p.A141T	CCHCR1_ENST00000396263.2_Missense_Mutation_p.A141T|CCHCR1_ENST00000396268.3_Missense_Mutation_p.A230T|CCHCR1_ENST00000451521.2_Missense_Mutation_p.A194T|CCHCR1_ENST00000480060.1_Intron	NM_019052.3	NP_061925.2	Q8TD31	CCHCR_HUMAN	coiled-coil alpha-helical rod protein 1	141					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein export from nucleus (GO:0006611)	centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(13)|skin(1)	23						TCAGCCTCAGCTCGGCCGGCC	0.662																																																	0													145.0	186.0	171.0					6																	31122386		1509	2709	4218	SO:0001583	missense	0			AF216493	CCDS4695.1, CCDS43445.1, CCDS47397.1	6p21.3	2007-08-01	2005-02-15	2005-02-16	ENSG00000204536	ENSG00000204536			13930	protein-coding gene	gene with protein product		605310	"""chromosome 6 open reading frame 18"""	C6orf18		10888604, 10545595	Standard	NM_019052		Approved	HCR	uc003nsp.4	Q8TD31	OTTHUMG00000031112	ENST00000376266.5:c.421G>A	6.37:g.31122386C>T	ENSP00000365442:p.Ala141Thr		A2ABH6|E9PE84|Q2TB67|Q5SQ82|Q5STE9|Q9NRK8|Q9NWY9|Q9NXJ4|Q9NXK3|Q9Y6W1|Q9Y6W2	Missense_Mutation	SNP	pfam_HCR	p.A230T	ENST00000376266.5	37	c.688	CCDS4695.1	6	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019499	0.35606	.	.	ENSG00000204536	ENST00000396268;ENST00000376266;ENST00000396263;ENST00000440185;ENST00000451521;ENST00000448141;ENST00000508683;ENST00000448162;ENST00000513222;ENST00000503420;ENST00000515274;ENST00000507751;ENST00000455279;ENST00000412245	T;T;T;T;T;T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32;3.32	5.33	4.46	0.54185	.	0.423339	0.22483	N	0.059478	T	0.08044	0.0201	M	0.70595	2.14	0.09310	N	1	D;D;D;B;D	0.64830	0.994;0.978;0.992;0.085;0.992	D;P;D;B;P	0.65773	0.938;0.829;0.916;0.059;0.898	T	0.17048	-1.0382	10	0.13108	T	0.6	-1.931	9.9505	0.41636	0.0:0.9059:0.0:0.0941	.	141;141;141;194;230	B4DIA2;A8K081;Q8TD31;E9PE84;Q8TD31-2	.;.;CCHCR_HUMAN;.;.	T	230;141;141;141;194;105;105;141;115;105;141;141;141;167	ENSP00000379566:A230T;ENSP00000365442:A141T;ENSP00000379561:A141T;ENSP00000401039:A194T;ENSP00000414323:A105T;ENSP00000421393:A105T;ENSP00000390027:A141T;ENSP00000425682:A115T;ENSP00000421992:A105T;ENSP00000420941:A141T;ENSP00000398715:A141T	ENSP00000365442:A141T	A	-	1	0	CCHCR1	31230365	0.044000	0.20184	0.573000	0.28510	0.382000	0.30200	1.511000	0.35801	1.265000	0.44215	0.638000	0.83543	GCT	CCHCR1	-	pfam_HCR	ENSG00000204536		0.662	CCHCR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCHCR1	HGNC	protein_coding	OTTHUMT00000076190.5	-	0.00	40	0	C	NM_019052		31122386	-1	tier1	-	no_errors	ENST00000396268	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.234	T
CCNB3	85417	genome.wustl.edu	37	X	50090673	50090673	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:50090673G>T	ENST00000376042.1	+	11	4157	c.3859G>T	c.(3859-3861)Gag>Tag	p.E1287*	CCNB3_ENST00000276014.7_Nonsense_Mutation_p.E1287*|CCNB3_ENST00000348603.2_Nonsense_Mutation_p.E183*|CCNB3_ENST00000376038.1_Nonsense_Mutation_p.E183*			Q8WWL7	CCNB3_HUMAN	cyclin B3	1287					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CTACATCTGCGAGATGACCCT	0.493																																																	0													122.0	89.0	100.0					X																	50090673		2203	4300	6503	SO:0001587	stop_gained	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3859G>T	X.37:g.50090673G>T	ENSP00000365210:p.Glu1287*		B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Nonsense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like	p.E1287*	ENST00000376042.1	37	c.3859	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	G	34	5.397260	0.96009	.	.	ENSG00000147082	ENST00000376042;ENST00000376038;ENST00000348603;ENST00000276014	.	.	.	4.79	4.79	0.61399	.	0.169980	0.49916	D	0.000130	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9944	0.80230	0.0:0.0:1.0:0.0	.	.	.	.	X	1287;183;183;1287	.	.	E	+	1	0	CCNB3	50107413	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	8.055000	0.89453	2.112000	0.64535	0.508000	0.49915	GAG	CCNB3	-	pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000147082		0.493	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	-	0.00	28	0	G			50090673	+1	tier1	-	no_errors	ENST00000276014	ensembl	human	known	74_37	nonsense	12.90	27	4	SNP	1.000	T
CKAP5	9793	genome.wustl.edu	37	11	46765717	46765718	+	Frame_Shift_Ins	INS	-	-	AGCA			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:46765717_46765718insAGCA	ENST00000529230.1	-	44	6000_6001	c.5954_5955insTGCT	c.(5953-5955)ctcfs	p.-1985fs	CKAP5_ENST00000312055.5_Frame_Shift_Ins_p.-1925fs|CKAP5_ENST00000354558.3_Frame_Shift_Ins_p.-1925fs|CKAP5_ENST00000415402.1_Frame_Shift_Ins_p.-1992fs			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5						centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						GTGACTCCCGGAGCTGAGAGAG	0.535																																					Ovarian(4;85 273 2202 4844 13323)												0																																										SO:0001589	frameshift_variant	0				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5954_5955insTGCT	11.37:g.46765717_46765718insAGCA	ENSP00000432768:p.Leu1985fs		Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Frame_Shift_Ins	INS	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,superfamily_Homing_endonucl,pfscan_HEAT_type_2	p.R1993fs	ENST00000529230.1	37	c.5976_5975	CCDS31477.1	11																																																																																			CKAP5	-	NULL	ENSG00000175216		0.535	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1		0.00	36	0	-	NM_014756		46765718	-1	tier1		no_errors	ENST00000415402	ensembl	human	known	74_37	frame_shift_ins	17.65	42	9	INS	1.000:1.000	AGCA
CHEK1	1111	genome.wustl.edu	37	11	125503112	125503112	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:125503112G>T	ENST00000534070.1	+	6	734	c.479G>T	c.(478-480)cGt>cTt	p.R160L	CHEK1_ENST00000278916.3_Missense_Mutation_p.R160L|CHEK1_ENST00000427383.2_Missense_Mutation_p.R176L|CHEK1_ENST00000532449.1_3'UTR|CHEK1_ENST00000428830.2_Missense_Mutation_p.R160L|CHEK1_ENST00000438015.1_Missense_Mutation_p.R160L|CHEK1_ENST00000524737.1_Missense_Mutation_p.R160L|CHEK1_ENST00000544373.1_Missense_Mutation_p.R160L	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	160	Interaction with CLSPN. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)	p.R160H(1)		central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		TATAATAATCGTGAGCGTTTG	0.363								Other conserved DNA damage response genes																																									1	Substitution - Missense(1)	central_nervous_system(1)											108.0	107.0	108.0					11																	125503112		2201	4299	6500	SO:0001583	missense	0			AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.479G>T	11.37:g.125503112G>T	ENSP00000435371:p.Arg160Leu		A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R160L	ENST00000534070.1	37	c.479	CCDS8459.1	11	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860500	0.71834	.	.	ENSG00000149554	ENST00000438015;ENST00000427383;ENST00000428830;ENST00000544373;ENST00000527013;ENST00000526937;ENST00000534070;ENST00000524737;ENST00000532669;ENST00000278916	T;T;T;T;T;T;T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19;-0.19	5.73	4.82	0.62117	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.064053	0.64402	D	0.000008	T	0.48978	0.1530	L	0.28014	0.82	0.58432	D	0.999994	B;B;B;B	0.31931	0.185;0.144;0.347;0.347	B;B;B;B	0.34093	0.11;0.086;0.175;0.175	T	0.50110	-0.8866	10	0.48119	T	0.1	-9.9688	10.5261	0.44950	0.1491:0.0:0.8509:0.0	.	160;176;160;160	F5H7S4;E7EPP6;B5BTY6;O14757	.;.;.;CHK1_HUMAN	L	160;176;160;160;160;160;160;160;81;160	ENSP00000388648:R160L;ENSP00000391090:R176L;ENSP00000412504:R160L;ENSP00000442317:R160L;ENSP00000431525:R160L;ENSP00000431815:R160L;ENSP00000435371:R160L;ENSP00000432890:R160L;ENSP00000434646:R81L;ENSP00000278916:R160L	ENSP00000278916:R160L	R	+	2	0	CHEK1	125008322	1.000000	0.71417	0.986000	0.45419	0.988000	0.76386	6.485000	0.73625	1.432000	0.47375	0.585000	0.79938	CGT	CHEK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000149554		0.363	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CHEK1	HGNC	protein_coding	OTTHUMT00000386714.1		0.00	55	0	G	NM_001274		125503112	+1			no_errors	ENST00000438015	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.998	T
COL4A5	1287	genome.wustl.edu	37	X	107842050	107842050	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:107842050delA	ENST00000361603.2	+	25	2142	c.1898delA	c.(1897-1899)gaafs	p.E633fs	COL4A5_ENST00000328300.6_Frame_Shift_Del_p.E633fs	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	633	Triple-helical region.		E -> K (in APSX). {ECO:0000269|PubMed:10561141}.		axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CCAGTAGGTGAAAAAGGCATA	0.507									Alport syndrome with Diffuse Leiomyomatosis																																								0													74.0	77.0	76.0					X																	107842050		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.1898delA	X.37:g.107842050delA	ENSP00000354505:p.Glu633fs		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Frame_Shift_Del	DEL	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G635fs	ENST00000361603.2	37	c.1898	CCDS14543.1	X																																																																																			COL4A5	-	pfam_Collagen	ENSG00000188153		0.507	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2		0.00	39	0	A			107842050	+1	tier1		no_errors	ENST00000328300	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	1.000	-
COL6A5	256076	genome.wustl.edu	37	3	130190616	130190616	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:130190616G>T	ENST00000265379.6	+	40	8159	c.7665G>T	c.(7663-7665)ggG>ggT	p.G2555G	COL6A5_ENST00000432398.2_Intron			A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2555	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TTGTATTAGGGAACAATCATA	0.373																																																	0																																										SO:0001819	synonymous_variant	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000265379.6:c.7665G>T	3.37:g.130190616G>T			A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G2555	ENST00000265379.6	37	c.7665		3																																																																																			COL6A5	-	NULL	ENSG00000172752		0.373	COL6A5-201	KNOWN	basic	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	42	0	G	NM_153264		130190616	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.055	T
CPNE4	131034	genome.wustl.edu	37	3	131442353	131442353	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:131442353G>T	ENST00000512055.1	-	7	2423	c.297C>A	c.(295-297)agC>agA	p.S99R	CPNE4_ENST00000429747.1_Missense_Mutation_p.S99R|CPNE4_ENST00000512332.1_Missense_Mutation_p.S117R|CPNE4_ENST00000511604.1_Missense_Mutation_p.S99R|CPNE4_ENST00000502818.1_Missense_Mutation_p.S117R			Q96A23	CPNE4_HUMAN	copine IV	99	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						TGTGGTTGCTGCTGATGTCAT	0.527																																																	0													218.0	186.0	197.0					3																	131442353		2203	4300	6503	SO:0001583	missense	0			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.297C>A	3.37:g.131442353G>T	ENSP00000421705:p.Ser99Arg		D3DNC5|Q8TEX1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom	p.S117R	ENST00000512055.1	37	c.351	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631215	0.67015	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818;ENST00000505881	T;T;T;T;T;T	0.69306	-0.39;-0.39;-0.39;-0.39;-0.39;-0.39	5.48	3.69	0.42338	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.035549	0.85682	D	0.000000	T	0.60379	0.2264	L	0.29908	0.895	0.50467	D	0.999879	B;B	0.25486	0.127;0.086	B;B	0.38225	0.268;0.128	T	0.63051	-0.6723	10	0.72032	D	0.01	-15.8349	11.652	0.51295	0.1433:0.0:0.8567:0.0	.	117;99	Q96A23-2;Q96A23	.;CPNE4_HUMAN	R	99;99;117;99;117;99	ENSP00000421705:S99R;ENSP00000411904:S99R;ENSP00000424853:S117R;ENSP00000423811:S99R;ENSP00000421646:S117R;ENSP00000425506:S99R	ENSP00000411904:S99R	S	-	3	2	CPNE4	132925043	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.482000	0.73613	1.333000	0.45449	-0.143000	0.13931	AGC	CPNE4	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	ENSG00000196353		0.527	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	-	0.00	53	0	G	NM_130808		131442353	-1	tier1	-	no_errors	ENST00000502818	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
CRISP3	10321	genome.wustl.edu	37	6	49700981	49700981	+	Missense_Mutation	SNP	C	C	T	rs377483373		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:49700981C>T	ENST00000393666.1	-	5	454	c.448G>A	c.(448-450)Gtt>Att	p.V150I	CRISP3_ENST00000371159.4_Missense_Mutation_p.V181I|CRISP3_ENST00000423399.2_Missense_Mutation_p.V60I|CRISP3_ENST00000263045.4_Missense_Mutation_p.V163I|CRISP3_ENST00000433368.2_Missense_Mutation_p.V173I			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3	150	SCP.				defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			CCACATCCAACGAGGTATGAA	0.333																																																	0								C	ILE/VAL,ILE/VAL	0,4406		0,0,2203	113.0	114.0	114.0		517,487	-0.5	0.1	6		114	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense	CRISP3	NM_001190986.1,NM_006061.2	29,29	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	173/269,163/259	49700981	1,13001	2203	4298	6501	SO:0001583	missense	0			X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823	ENST00000393666.1:c.448G>A	6.37:g.49700981C>T	ENSP00000377274:p.Val150Ile		A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	pfam_CAP_domain,pfam_Cysteine_rich_secretory,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.V173I	ENST00000393666.1	37	c.517		6	.	.	.	.	.	.	.	.	.	.	C	12.59	1.984944	0.35036	0.0	1.16E-4	ENSG00000096006	ENST00000263045;ENST00000433368;ENST00000393666;ENST00000423399;ENST00000371159;ENST00000354620	T;T;T;T;T;T	0.50277	2.82;2.82;2.82;0.75;2.82;2.82	5.16	-0.516	0.11950	CAP domain (3);	0.199817	0.32204	U	0.006435	T	0.09774	0.0240	N	0.20304	0.555	0.09310	N	1	D	0.55385	0.971	B	0.44224	0.444	T	0.31613	-0.9937	10	0.12430	T	0.62	.	3.4945	0.07650	0.1779:0.3807:0.0:0.4414	.	150	P54108	CRIS3_HUMAN	I	163;173;150;60;181;173	ENSP00000263045:V163I;ENSP00000389026:V173I;ENSP00000377274:V150I;ENSP00000410469:V60I;ENSP00000360201:V181I;ENSP00000346636:V173I	ENSP00000263045:V163I	V	-	1	0	CRISP3	49808940	0.004000	0.15560	0.058000	0.19502	0.645000	0.38454	-0.269000	0.08596	0.021000	0.15133	0.561000	0.74099	GTT	CRISP3	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	ENSG00000096006		0.333	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	CRISP3	HGNC	protein_coding		-	0.00	55	0	C	NM_006061		49700981	-1	tier1	-	no_errors	ENST00000433368	ensembl	human	known	74_37	missense	24.66	55	18	SNP	0.009	T
CROT	54677	genome.wustl.edu	37	7	87020907	87020907	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:87020907C>G	ENST00000331536.3	+	14	1489	c.1304C>G	c.(1303-1305)cCt>cGt	p.P435R	CROT_ENST00000419147.2_Missense_Mutation_p.P463R|CROT_ENST00000442291.1_Missense_Mutation_p.P435R	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	435					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TCTTGTAGCCCTGGTTGTTGC	0.383																																																	0													104.0	101.0	102.0					7																	87020907		2203	4300	6503	SO:0001583	missense	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1304C>G	7.37:g.87020907C>G	ENSP00000331981:p.Pro435Arg		A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.P435R	ENST00000331536.3	37	c.1304	CCDS5604.1	7	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125429	0.77436	.	.	ENSG00000005469	ENST00000419147;ENST00000331536;ENST00000442291	D;D;D	0.88975	-2.45;-2.45;-2.45	5.34	5.34	0.76211	.	0.048485	0.85682	D	0.000000	D	0.95720	0.8608	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94342	0.7571	10	0.25106	T	0.35	-19.5024	19.4097	0.94665	0.0:1.0:0.0:0.0	.	463;435	E7EQF2;Q9UKG9	.;OCTC_HUMAN	R	463;435;435	ENSP00000413575:P463R;ENSP00000331981:P435R;ENSP00000411983:P435R	ENSP00000331981:P435R	P	+	2	0	CROT	86858843	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.469000	0.66749	2.665000	0.90641	0.655000	0.94253	CCT	CROT	-	pfam_Carn_acyl_trans	ENSG00000005469		0.383	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROT	HGNC	protein_coding	OTTHUMT00000253485.1	-	0.00	33	0	C	NM_021151		87020907	+1	tier1	-	no_errors	ENST00000331536	ensembl	human	known	74_37	missense	29.41	35	15	SNP	1.000	G
CSNK1G2	1455	genome.wustl.edu	37	19	1969882	1969884	+	In_Frame_Del	DEL	GGG	GGG	-	rs56218768	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	GGG	GGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:1969882_1969884delGGG	ENST00000255641.8	+	2	606_608	c.111_113delGGG	c.(109-114)tcgggg>tcg	p.G38del		NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2	38					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACCAGCTCGGGGGTCCTGATG	0.685																																					Ovarian(91;880 1392 21236 36928 37598)												0																																										SO:0001651	inframe_deletion	0			AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.111_113delGGG	19.37:g.1969882_1969884delGGG	ENSP00000255641:p.Gly38del		B5BU42|O00704|Q8WUB1	In_Frame_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Casein_kinase-1_gamma_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G38in_frame_del	ENST00000255641.8	37	c.111_113	CCDS12077.1	19																																																																																			CSNK1G2	-	NULL	ENSG00000133275		0.685	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2	HGNC	protein_coding	OTTHUMT00000449287.1		0.00	120	0	GGG	NM_001319		1969884	+1			no_errors	ENST00000255641	ensembl	human	known	74_37	in_frame_del	8.24	78	7	DEL	0.105:0.997:1.000	0
CYFIP2	26999	genome.wustl.edu	37	5	156787307	156787307	+	Silent	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:156787307C>G	ENST00000521420.1	+	24	2848	c.2757C>G	c.(2755-2757)ctC>ctG	p.L919L	CYFIP2_ENST00000442283.2_3'UTR|CYFIP2_ENST00000377576.3_Silent_p.L945L|CYFIP2_ENST00000435847.2_Silent_p.L644L|CYFIP2_ENST00000522463.1_Silent_p.L749L|CYFIP2_ENST00000347377.6_Silent_p.L945L|CYFIP2_ENST00000541131.1_Silent_p.L870L|CYFIP2_ENST00000318218.6_Silent_p.L970L					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GAACCATTCTCCAGTATGTGA	0.498																																																	0													156.0	155.0	155.0					5																	156787307		2015	4211	6226	SO:0001819	synonymous_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2757C>G	5.37:g.156787307C>G				Silent	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.L970	ENST00000521420.1	37	c.2910		5																																																																																			CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.498	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	-	0.00	72	0	C	NM_001037332		156787307	+1	tier1	-	no_errors	ENST00000318218	ensembl	human	known	74_37	silent	56.67	26	34	SNP	0.995	G
DAAM1	23002	genome.wustl.edu	37	14	59787247	59787247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:59787247G>T	ENST00000395125.1	+	4	408	c.385G>T	c.(385-387)Gaa>Taa	p.E129*	DAAM1_ENST00000360909.3_Nonsense_Mutation_p.E129*|DAAM1_ENST00000351081.1_Nonsense_Mutation_p.E129*	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1	129	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		AGAAGAAGAAGAAAGAAGTAA	0.333																																																	0													89.0	99.0	96.0					14																	59787247		2203	4298	6501	SO:0001587	stop_gained	0			AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.385G>T	14.37:g.59787247G>T	ENSP00000378557:p.Glu129*		Q86U34|Q8N1Z8|Q8TB39	Nonsense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,superfamily_tRNA-bd_arm,smart_FH2_Formin	p.E129*	ENST00000395125.1	37	c.385	CCDS9737.1	14	.	.	.	.	.	.	.	.	.	.	G	37	6.105609	0.97286	.	.	ENSG00000100592	ENST00000360909;ENST00000351081;ENST00000358498;ENST00000395125	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	20.0499	0.97621	0.0:0.0:1.0:0.0	.	.	.	.	X	129	.	ENSP00000247170:E129X	E	+	1	0	DAAM1	58857000	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.278000	0.72614	2.798000	0.96311	0.655000	0.94253	GAA	DAAM1	-	pfam_GTPase-bd,superfamily_ARM-type_fold	ENSG00000100592		0.333	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2		0.00	39	0	G	NM_014992		59787247	+1			no_errors	ENST00000351081	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	1.000	T
DCAF10	79269	genome.wustl.edu	37	9	37842093	37842093	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:37842093G>T	ENST00000377724.3	+	3	1026	c.661G>T	c.(661-663)Gat>Tat	p.D221Y	DCAF10_ENST00000242323.7_Missense_Mutation_p.D221Y|RP11-613M10.9_ENST00000540557.1_Intron	NM_024345.3	NP_077321.3	Q5QP82	DCA10_HUMAN	DDB1 and CUL4 associated factor 10	221					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	12						TAGATTTCTTGATAACCGGCT	0.353																																																	0													126.0	113.0	118.0					9																	37842093		2203	4300	6503	SO:0001583	missense	0			BC003520	CCDS6613.2, CCDS75835.1	9p13.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000122741	ENSG00000122741		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	23686	protein-coding gene	gene with protein product			"""WD repeat domain 32"""	WDR32			Standard	NM_001286810		Approved	MGC10765, FLJ23201	uc004aao.3	Q5QP82	OTTHUMG00000019934	ENST00000377724.3:c.661G>T	9.37:g.37842093G>T	ENSP00000366953:p.Asp221Tyr		A4VCJ5|Q32NE2|Q8N2Q5|Q96ET5|Q9BTQ5|Q9H5P6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D221Y	ENST00000377724.3	37	c.661	CCDS6613.2	9	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442063	0.83993	.	.	ENSG00000122741	ENST00000377724;ENST00000242323	T;T	0.60797	0.16;0.16	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.79149	0.4397	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.82380	-0.0486	10	0.87932	D	0	.	16.8749	0.86050	0.0:0.0:1.0:0.0	.	221;221	Q5QP82-2;Q5QP82	.;DCA10_HUMAN	Y	221	ENSP00000366953:D221Y;ENSP00000242323:D221Y	ENSP00000242323:D221Y	D	+	1	0	DCAF10	37832093	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.447000	0.97595	2.591000	0.87537	0.655000	0.94253	GAT	DCAF10	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000122741		0.353	DCAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF10	HGNC	protein_coding	OTTHUMT00000052485.2	-	0.00	42	0	G	NM_024345		37842093	+1	tier1	-	no_errors	ENST00000377724	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
DCTN2	10540	genome.wustl.edu	37	12	57927734	57927734	+	Splice_Site	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:57927734A>T	ENST00000548249.1	-	7	937		c.e7+1		DCTN2_ENST00000551400.1_5'Flank|DCTN2_ENST00000543672.1_Splice_Site|DCTN2_ENST00000537439.1_Splice_Site|DCTN2_ENST00000434715.3_Splice_Site	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)			endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						ATCCACACTTACTTTGGCAGC	0.522																																																	0													117.0	124.0	122.0					12																	57927734		1937	4131	6068	SO:0001630	splice_region_variant	0			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.669+1T>A	12.37:g.57927734A>T			B2RBK5|Q86YN2|Q9BW17	Splice_Site	SNP	-	e9+2	ENST00000548249.1	37	c.684+2	CCDS58245.1	12	.	.	.	.	.	.	.	.	.	.	A	15.69	2.907199	0.52333	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000546758;ENST00000550954	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.088	0.64971	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCTN2	56214001	1.000000	0.71417	0.996000	0.52242	0.596000	0.36781	6.805000	0.75191	2.235000	0.73313	0.533000	0.62120	.	DCTN2	-	-	ENSG00000175203		0.522	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2	-	0.00	77	0	A	NM_006400	Intron	57927734	-1	tier1	-	no_errors	ENST00000434715	ensembl	human	known	74_37	splice_site	27.03	54	20	SNP	0.999	T
DDX19B	11269	genome.wustl.edu	37	16	70351454	70351454	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:70351454A>G	ENST00000288071.6	+	5	597	c.352A>G	c.(352-354)Ata>Gta	p.I118V	DDX19B_ENST00000393657.2_Missense_Mutation_p.I9V|RP11-529K1.2_ENST00000562077.1_RNA|DDX19B_ENST00000570055.1_3'UTR|RP11-529K1.3_ENST00000567706.1_Missense_Mutation_p.I118V|DDX19B_ENST00000451014.3_Intron|DDX19B_ENST00000355992.3_Intron|DDX19B_ENST00000568625.1_Missense_Mutation_p.I9V|DDX19B_ENST00000563392.1_Missense_Mutation_p.I9V|DDX19B_ENST00000563206.1_Missense_Mutation_p.I123V	NM_007242.5	NP_009173.1	Q9UMR2	DD19B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B	118	N-terminal lobe.				mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)	9		Ovarian(137;0.0694)				TCCATCCAAGATACAAGAGAA	0.378																																					Esophageal Squamous(26;382 757 1343 9728 15939)												0													151.0	136.0	141.0					16																	70351454		2198	4300	6498	SO:0001583	missense	0			AJ237946	CCDS10888.1, CCDS32475.1, CCDS42187.1, CCDS58478.1	16q22.3	2012-02-23	2012-02-23	2005-07-13	ENSG00000157349	ENSG00000157349		"""DEAD-boxes"""	2742	protein-coding gene	gene with protein product		605812	"""DEAD (Asp-Glu-Ala-As) box polypeptide 19"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19 (Dbp5, yeast, homolog)"""	DDX19		10428971	Standard	NM_007242		Approved	DBP5	uc002eyo.4	Q9UMR2	OTTHUMG00000137577	ENST00000288071.6:c.352A>G	16.37:g.70351454A>G	ENSP00000288071:p.Ile118Val		B3KNE9|B4DXS6|E7EMK4|Q6FIB7|Q6IAE0|Q96KE7|Q9H0U0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I118V	ENST00000288071.6	37	c.352	CCDS10888.1	16	.	.	.	.	.	.	.	.	.	.	A	22.9	4.355391	0.82243	.	.	ENSG00000157349	ENST00000393657;ENST00000288071	T;T	0.18016	2.24;2.24	5.28	5.28	0.74379	RNA helicase, DEAD-box type, Q motif (1);DEAD-like helicase (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	L	0.49350	1.555	0.80722	D	1	D	0.58268	0.982	P	0.61201	0.885	T	0.01935	-1.1244	10	0.59425	D	0.04	.	13.2183	0.59873	1.0:0.0:0.0:0.0	.	118	Q9UMR2	DD19B_HUMAN	V	9;118	ENSP00000377267:I9V;ENSP00000288071:I118V	ENSP00000288071:I118V	I	+	1	0	DDX19B	68908955	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	8.654000	0.91092	2.210000	0.71456	0.533000	0.62120	ATA	DDX19B	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_RNA_helicase_DEAD_Q_motif	ENSG00000157349		0.378	DDX19B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX19B	HGNC	protein_coding	OTTHUMT00000268965.3	-	0.00	63	0	A	NM_007242		70351454	+1	tier1	-	no_errors	ENST00000288071	ensembl	human	known	74_37	missense	52.24	32	35	SNP	1.000	G
DDX5	1655	genome.wustl.edu	37	17	62496054	62496054	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:62496054C>A	ENST00000225792.5	-	13	2233	c.1832G>T	c.(1831-1833)gGa>gTa	p.G611V	DDX5_ENST00000580026.1_5'Flank|DDX5_ENST00000578804.1_Missense_Mutation_p.G611V|MIR3064_ENST00000581130.1_RNA|POLG2_ENST00000539111.2_5'Flank|DDX5_ENST00000450599.2_Missense_Mutation_p.G532V|MIR5047_ENST00000579212.1_RNA	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	611	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TTGGGAATATCCTGTTGGCAT	0.343			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													99.0	84.0	89.0					17																	62496054		2203	4300	6503	SO:0001583	missense	0			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1832G>T	17.37:g.62496054C>A	ENSP00000225792:p.Gly611Val		B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G611V	ENST00000225792.5	37	c.1832	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	9.638	1.138259	0.21123	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.87	4.9	0.64082	.	0.574764	0.19056	N	0.123888	T	0.31009	0.0783	N	0.08118	0	0.50171	D	0.999856	B;B;B	0.16802	0.019;0.019;0.019	B;B;B	0.12156	0.007;0.007;0.007	T	0.16394	-1.0404	9	0.66056	D	0.02	-10.6043	8.2617	0.31788	0.0:0.7376:0.1299:0.1324	.	532;611;611	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	V	611;541;600	.	ENSP00000225792:G600V	G	-	2	0	DDX5	59926516	0.999000	0.42202	1.000000	0.80357	0.987000	0.75469	1.096000	0.30976	2.780000	0.95670	0.655000	0.94253	GGA	DDX5	-	NULL	ENSG00000108654		0.343	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	-	0.00	30	0	C	NM_004396		62496054	-1	tier1	-	no_errors	ENST00000225792	ensembl	human	known	74_37	missense	53.85	18	21	SNP	0.996	A
DEPDC1	55635	genome.wustl.edu	37	1	68947259	68947259	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:68947259T>C	ENST00000456315.2	-	9	1913	c.1799A>G	c.(1798-1800)gAt>gGt	p.D600G	RP4-694A7.2_ENST00000425820.1_RNA|DEPDC1_ENST00000370966.5_Missense_Mutation_p.D316G	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	600	Interaction with ZNF224.				intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		CTGTAGAGCATCGATGGCAAC	0.393																																																	0													61.0	58.0	59.0					1																	68947259		2203	4300	6503	SO:0001583	missense	0			AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1799A>G	1.37:g.68947259T>C	ENSP00000412292:p.Asp600Gly		A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Missense_Mutation	SNP	pfam_DEP_dom,superfamily_Rho_GTPase_activation_prot,smart_DEP_dom,pfscan_DEP_dom	p.D600G	ENST00000456315.2	37	c.1799	CCDS44159.1	1	.	.	.	.	.	.	.	.	.	.	T	11.85	1.760200	0.31137	.	.	ENSG00000024526	ENST00000456315;ENST00000370966	D;D	0.83914	-1.78;-1.78	5.72	2.08	0.27032	Rho GTPase-activating protein domain (1);Rho GTPase activation protein (1);	0.292158	0.41500	D	0.000863	T	0.62270	0.2414	L	0.44542	1.39	0.23232	N	0.998078	B;B	0.19706	0.038;0.01	B;B	0.26094	0.066;0.033	T	0.59658	-0.7413	10	0.87932	D	0	-0.5962	9.6446	0.39859	0.0:0.1991:0.0:0.8009	.	600;316	Q5TB30;Q5TB30-2	DEP1A_HUMAN;.	G	600;316	ENSP00000412292:D600G;ENSP00000360005:D316G	ENSP00000360005:D316G	D	-	2	0	DEPDC1	68719847	1.000000	0.71417	0.156000	0.22583	0.755000	0.42902	3.752000	0.55172	0.095000	0.17434	0.533000	0.62120	GAT	DEPDC1	-	superfamily_Rho_GTPase_activation_prot	ENSG00000024526		0.393	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DEPDC1	HGNC	protein_coding	OTTHUMT00000025514.2	-	0.00	80	0	T	NM_017779		68947259	-1	tier1	-	no_errors	ENST00000456315	ensembl	human	known	74_37	missense	17.65	84	18	SNP	0.958	C
DGKK	139189	genome.wustl.edu	37	X	50146073	50146073	+	RNA	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:50146073A>G	ENST00000376025.2	-	0	1353							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					GAATTACACCACAGGCAGCGG	0.453																																																	0													62.0	56.0	58.0					X																	50146073		1968	4151	6119			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50146073A>G			B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.453	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	-	0.00	20	0	A	NM_001013742		50146073	-1	tier1	-	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	64.29	10	18	SNP	1.000	G
DIDO1	11083	genome.wustl.edu	37	20	61537402	61537402	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:61537402delT	ENST00000266070.4	-	6	1750	c.1425delA	c.(1423-1425)aaafs	p.K475fs	DIDO1_ENST00000370366.1_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000266071.5_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000395335.2_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000370368.1_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000395343.1_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000370371.4_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000395340.1_Frame_Shift_Del_p.K475fs|DIDO1_ENST00000354665.4_Frame_Shift_Del_p.K475fs	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	475					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTGTGGTCTCTTTTTTTTCTG	0.493																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												0													99.0	106.0	104.0					20																	61537402		2203	4300	6503	SO:0001589	frameshift_variant	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1425delA	20.37:g.61537402delT	ENSP00000266070:p.Lys475fs		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Frame_Shift_Del	DEL	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.E476fs	ENST00000266070.4	37	c.1425	CCDS33506.1	20																																																																																			DIDO1	-	NULL	ENSG00000101191		0.493	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2		0.00	34	0	T	NM_080796		61537402	-1	tier1		no_errors	ENST00000266070	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.986	-
DLEU7	220107	genome.wustl.edu	37	13	51397464	51397464	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr13:51397464G>C	ENST00000504404.1	-	2	701	c.652C>G	c.(652-654)Ctc>Gtc	p.L218V	DLEU7_ENST00000400393.3_Intron|DLEU7-AS1_ENST00000413510.2_RNA			Q6UYE1	LEU7_HUMAN	deleted in lymphocytic leukemia, 7	218													Acute lymphoblastic leukemia(7;1.03e-07)|Lung NSC(96;0.000818)|Breast(56;0.00122)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.25e-08)		ATGTCTGGGAGATTCTGTAAG	0.428																																																	0																																										SO:0001583	missense	0			AK126830	CCDS53869.1	13q14.3	2005-02-22			ENSG00000186047	ENSG00000186047			17567	protein-coding gene	gene with protein product						14706829	Standard	NM_198989		Approved	FLJ44882	uc001vex.2	Q6UYE1	OTTHUMG00000016936	ENST00000504404.1:c.652C>G	13.37:g.51397464G>C	ENSP00000427177:p.Leu218Val		Q2M2E4|Q6ZT82	Missense_Mutation	SNP	NULL	p.L218V	ENST00000504404.1	37	c.652		13	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010270	0.75046	.	.	ENSG00000186047	ENST00000504404;ENST00000335465	T	0.61742	0.08	5.97	5.97	0.96955	.	0.000000	0.50627	D	0.000108	T	0.76673	0.4020	.	.	.	0.42190	D	0.991723	D	0.76494	0.999	D	0.68765	0.96	T	0.78066	-0.2349	9	0.62326	D	0.03	.	17.5797	0.87963	0.0:0.0:1.0:0.0	.	218	Q6UYE1	LEU7_HUMAN	V	218;171	ENSP00000427177:L218V	ENSP00000439677:L171V	L	-	1	0	DLEU7	50295465	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.791000	0.69045	2.834000	0.97654	0.650000	0.86243	CTC	DLEU7	-	NULL	ENSG00000186047		0.428	DLEU7-001	KNOWN	basic|appris_candidate_longest	protein_coding	DLEU7	HGNC	protein_coding	OTTHUMT00000045005.2	-	0.00	48	0	G	NM_198989		51397464	-1	tier1	-	no_errors	ENST00000504404	ensembl	human	known	74_37	missense	54.84	28	34	SNP	1.000	C
DNHD1	144132	genome.wustl.edu	37	11	6588195	6588195	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:6588195T>C	ENST00000527990.2	+	34	11456	c.11456T>C	c.(11455-11457)aTa>aCa	p.I3819T	DNHD1_ENST00000254579.6_Missense_Mutation_p.I3819T			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3819					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CTGCGGAACATAGTGAGGGCC	0.522																																																	0													69.0	71.0	70.0					11																	6588195		2011	4169	6180	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11456T>C	11.37:g.6588195T>C	ENSP00000436180:p.Ile3819Thr		Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.I3819T	ENST00000527990.2	37	c.11456	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	T	12.61	1.989193	0.35131	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	T;T	0.26223	1.75;1.75	4.51	4.51	0.55191	.	0.589267	0.15411	N	0.263760	T	0.14874	0.0359	N	0.08118	0	0.23950	N	0.996377	B;B;B	0.19817	0.039;0.023;0.016	B;B;B	0.16722	0.01;0.016;0.01	T	0.17289	-1.0374	10	0.87932	D	0	-1.3802	11.7325	0.51746	0.0:0.0:0.0:1.0	.	2907;87;3819	B0I1S4;D3DQT9;Q96M86	.;.;DNHD1_HUMAN	T	3819;3819;87;87	ENSP00000254579:I3819T;ENSP00000436180:I3819T	ENSP00000254579:I3819T	I	+	2	0	DNHD1	6544771	0.712000	0.27916	0.825000	0.32803	0.806000	0.45545	1.513000	0.35823	2.018000	0.59344	0.528000	0.53228	ATA	DNHD1	-	NULL	ENSG00000179532		0.522	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	-	0.00	31	0	T	NM_144666		6588195	+1	tier1	-	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	24.56	43	14	SNP	0.879	C
DOCK9	23348	genome.wustl.edu	37	13	99534153	99534153	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr13:99534153C>A	ENST00000376460.1	-	24	2748	c.2668G>T	c.(2668-2670)Gtg>Ttg	p.V890L	DOCK9_ENST00000442173.1_Missense_Mutation_p.V890L|DOCK9_ENST00000448493.2_Missense_Mutation_p.V902L|DOCK9_ENST00000339416.2_Missense_Mutation_p.V891L	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	891					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TACCGAGTCACGTTAACCGCG	0.532																																																	0													108.0	107.0	107.0					13																	99534153		2147	4258	6405	SO:0001583	missense	0			AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.2668G>T	13.37:g.99534153C>A	ENSP00000365643:p.Val890Leu		B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V891L	ENST00000376460.1	37	c.2671	CCDS45062.1	13	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208102	0.79240	.	.	ENSG00000088387	ENST00000376460;ENST00000357329;ENST00000376455;ENST00000400235;ENST00000428223;ENST00000339416;ENST00000448493;ENST00000442173	T;T;T;T	0.64260	-0.09;-0.09;1.94;1.95	5.64	5.64	0.86602	.	0.123114	0.56097	D	0.000031	T	0.61874	0.2382	L	0.54323	1.7	0.48452	D	0.999659	B;P;B;B;B	0.37914	0.429;0.611;0.429;0.026;0.411	B;B;B;B;B	0.40329	0.241;0.241;0.326;0.031;0.173	T	0.65615	-0.6125	10	0.66056	D	0.02	.	14.5454	0.68027	0.1463:0.8537:0.0:0.0	.	891;890;890;890;891	A6H8Z6;E9PFM9;B3KX25;Q9BZ29-5;Q9BZ29	.;.;.;.;DOCK9_HUMAN	L	890;891;891;891;890;891;902;890	ENSP00000365643:V890L;ENSP00000341086:V891L;ENSP00000401958:V902L;ENSP00000406883:V890L	ENSP00000341086:V891L	V	-	1	0	DOCK9	98332154	1.000000	0.71417	0.993000	0.49108	0.930000	0.56654	4.623000	0.61247	2.653000	0.90120	0.655000	0.94253	GTG	DOCK9	-	superfamily_ARM-type_fold	ENSG00000088387		0.532	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK9	HGNC	protein_coding	OTTHUMT00000045566.1	-	0.00	24	0	C	NM_015296		99534153	-1	tier1	-	no_errors	ENST00000339416	ensembl	human	known	74_37	missense	15.38	55	10	SNP	0.997	A
DUSP10	11221	genome.wustl.edu	37	1	221875157	221875157	+	3'UTR	DEL	A	A	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:221875157delA	ENST00000366899.3	-	0	2284				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCAGAGAAGGAAAAAAAAAAA	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*597T>-	1.37:g.221875157delA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	DEL	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.353	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	12	0	A	NM_007207		221875157	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	16.00	21	4	DEL	0.000	-
DYNC1LI1	51143	genome.wustl.edu	37	3	32569958	32569958	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:32569958G>T	ENST00000273130.4	-	12	1545	c.1442C>A	c.(1441-1443)cCa>cAa	p.P481Q	DYNC1LI1_ENST00000432458.2_Missense_Mutation_p.P365Q	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	481					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						GGTGGATGGTGGTAAACCACT	0.448																																																	0													71.0	71.0	71.0					3																	32569958		2203	4300	6503	SO:0001583	missense	0			AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.1442C>A	3.37:g.32569958G>T	ENSP00000273130:p.Pro481Gln		A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	pfam_Dynein_light_int_chain,superfamily_P-loop_NTPase	p.P481Q	ENST00000273130.4	37	c.1442	CCDS2654.1	3	.	.	.	.	.	.	.	.	.	.	G	5.613	0.297893	0.10622	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	T;T	0.15718	2.4;2.4	5.76	5.76	0.90799	.	0.201338	0.35407	N	0.003227	T	0.12390	0.0301	N	0.05467	-0.045	0.58432	D	0.999998	P;B	0.47034	0.889;0.287	P;B	0.46758	0.526;0.112	T	0.03524	-1.1028	10	0.02654	T	1	-7.1741	19.975	0.97300	0.0:0.0:1.0:0.0	.	365;481	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	Q	481;365	ENSP00000273130:P481Q;ENSP00000407279:P365Q	ENSP00000273130:P481Q	P	-	2	0	DYNC1LI1	32544962	1.000000	0.71417	0.988000	0.46212	0.390000	0.30446	7.088000	0.76901	2.724000	0.93272	0.585000	0.79938	CCA	DYNC1LI1	-	pfam_Dynein_light_int_chain	ENSG00000144635		0.448	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1LI1	HGNC	protein_coding	OTTHUMT00000253250.1	-	0.00	40	0	G	NM_016141		32569958	-1	tier1	-	no_errors	ENST00000273130	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
EFCAB13	124989	genome.wustl.edu	37	17	45422437	45422437	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:45422437G>T	ENST00000331493.2	+	8	901	c.490G>T	c.(490-492)Gga>Tga	p.G164*	EFCAB13_ENST00000517484.1_Nonsense_Mutation_p.G164*	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	164						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										AGTAACCCATGGATATTTACA	0.328																																																	0													96.0	104.0	102.0					17																	45422437		2203	4298	6501	SO:0001587	stop_gained	0			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.490G>T	17.37:g.45422437G>T	ENSP00000332111:p.Gly164*		G3V128|Q49AG9	Nonsense_Mutation	SNP	NULL	p.G164*	ENST00000331493.2	37	c.490	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	G	20.1	3.938307	0.73557	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	.	.	.	3.52	1.42	0.22433	.	0.665365	0.13170	N	0.408376	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.6508	4.686	0.12758	0.128:0.2263:0.6458:0.0	.	.	.	.	X	164	.	ENSP00000332111:G164X	G	+	1	0	C17orf57	42777436	0.030000	0.19436	0.001000	0.08648	0.036000	0.12997	0.357000	0.20199	0.269000	0.21961	0.484000	0.47621	GGA	EFCAB13	-	NULL	ENSG00000178852		0.328	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	-	0.00	50	0	G	NM_152347		45422437	+1	tier1	-	no_errors	ENST00000331493	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	0.001	T
EFR3B	22979	genome.wustl.edu	37	2	25366701	25366701	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:25366701C>A	ENST00000403714.3	+	18	2203	c.2020C>A	c.(2020-2022)Ctc>Atc	p.L674I	EFR3B_ENST00000401432.3_Missense_Mutation_p.L674I|EFR3B_ENST00000402191.1_Missense_Mutation_p.L639I|EFR3B_ENST00000405108.1_Missense_Mutation_p.L526I	NM_014971.1	NP_055786.1	Q9Y2G0	EFR3B_HUMAN	EFR3 homolog B (S. cerevisiae)	674										endometrium(1)	1						CTCGGACCGGCTCTGCCTGCC	0.572																																																	0													87.0	79.0	81.0					2																	25366701		692	1591	2283	SO:0001583	missense	0			AB023170	CCDS46231.1	2p24.1	2008-02-05	2007-11-14	2007-11-14	ENSG00000084710	ENSG00000084710			29155	protein-coding gene	gene with protein product			"""KIAA0953"""	KIAA0953		10231032	Standard	NM_014971		Approved	FLJ37871	uc010eyh.3	Q9Y2G0	OTTHUMG00000151988	ENST00000403714.3:c.2020C>A	2.37:g.25366701C>A	ENSP00000384081:p.Leu674Ile		B7WPL8|Q86XU6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L674I	ENST00000403714.3	37	c.2020	CCDS46231.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414517	0.83449	.	.	ENSG00000084710	ENST00000401432;ENST00000403714;ENST00000402191;ENST00000545169;ENST00000405108;ENST00000264719	T;T;T;T;T	0.45276	0.9;1.07;1.05;1.07;0.92	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.63331	0.2502	M	0.72353	2.195	0.80722	D	1	D;D	0.76494	0.972;0.999	P;D	0.68192	0.592;0.956	T	0.67173	-0.5737	10	0.72032	D	0.01	-27.4185	16.6623	0.85244	0.0:1.0:0.0:0.0	.	674;674	Q9Y2G0;Q9Y2G0-3	EFR3B_HUMAN;.	I	674;674;639;639;526;509	ENSP00000386082:L674I;ENSP00000384081:L674I;ENSP00000385832:L639I;ENSP00000384454:L526I;ENSP00000264719:L509I	ENSP00000264719:L509I	L	+	1	0	EFR3B	25220205	1.000000	0.71417	1.000000	0.80357	0.367000	0.29736	5.825000	0.69286	2.535000	0.85469	0.561000	0.74099	CTC	EFR3B	-	NULL	ENSG00000084710		0.572	EFR3B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFR3B	HGNC	protein_coding	OTTHUMT00000324808.1	-	0.00	54	0	C	NM_014971		25366701	+1	tier1	-	no_errors	ENST00000403714	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	A
EIF1AY	9086	genome.wustl.edu	37	Y	22751375	22751375	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrY:22751375A>G	ENST00000361365.2	+	6	490	c.343A>G	c.(343-345)Atc>Gtc	p.I115V	EIF1AY_ENST00000464196.1_3'UTR|EIF1AY_ENST00000382772.3_Missense_Mutation_p.I98V	NM_004681.3	NP_004672.2	O14602	IF1AY_HUMAN	eukaryotic translation initiation factor 1A, Y-linked	115							translation initiation factor activity (GO:0003743)										TTTAGCTAAAATCAATGAAAC	0.378																																																	0													77.0	79.0	78.0					Y																	22751375		594	1934	2528	SO:0001583	missense	0			AF000987	CCDS14795.1, CCDS65368.1	Yq11.223	2013-09-20	2003-09-12		ENSG00000198692	ENSG00000198692			3252	protein-coding gene	gene with protein product		400014	"""eukaryotic translation initiation factor 1A, Y chromosome"""			9381176	Standard	NM_001278612		Approved		uc004fuk.3	O14602	OTTHUMG00000036544	ENST00000361365.2:c.343A>G	Y.37:g.22751375A>G	ENSP00000354722:p.Ile115Val		Q9BS77	Missense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1,tigrfam_TIF_eIF-1A	p.I115V	ENST00000361365.2	37	c.343	CCDS14795.1	Y																																																																																			EIF1AY	-	superfamily_NA-bd_OB-fold	ENSG00000198692		0.378	EIF1AY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AY	HGNC	protein_coding	OTTHUMT00000088877.1	-	0.00	23	0	A	NM_004681		22751375	+1	tier1	-	no_errors	ENST00000361365	ensembl	human	known	74_37	missense	72.73	12	32	SNP	1.000	G
EIF5B	9669	genome.wustl.edu	37	2	99977012	99977012	+	Splice_Site	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:99977012G>A	ENST00000289371.6	+	3	448	c.246G>A	c.(244-246)aaG>aaA	p.K82K		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	82					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTGCAGTGAAGGTGAAAGACA	0.373																																					Colon(162;2388 2567 2705 3444)												0													78.0	75.0	76.0					2																	99977012		1867	4117	5984	SO:0001630	splice_region_variant	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.246+1G>A	2.37:g.99977012G>A			O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.K82	ENST00000289371.6	37	c.246	CCDS42721.1	2																																																																																			EIF5B	-	NULL	ENSG00000158417		0.373	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2	-	0.00	62	0	G	NM_015904	Silent	99977012	+1	tier1	-	no_errors	ENST00000289371	ensembl	human	known	74_37	silent	10.13	71	8	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	GL000212.1	65288	65289	+	IGR	DNP	CG	CG	TC			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrGL000212.1:65288_65289CG>TC								None (None upstream) : None (None downstream)																							GCCTCGCTGACGGGGACGCCGT	0.733																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65288_65289delinsTC				Missense_Mutation|Silent	SNP	NULL	p.T346M|p.T346		37	c.1037|c.1038		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.733					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	30	0	C|G			65288|65289	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	missense|silent	16.67	30	6	SNP	NULL	T|C
GSX2	170825	genome.wustl.edu	37	4	54969776	54969776	+	IGR	SNP	G	G	A	rs72250994		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:54969776G>A	ENST00000326902.2	+	0	1812				FIP1L1_ENST00000507166.1_Intron|AC110298.1_ENST00000408292.1_RNA	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2						forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			GCGCGCGCGCGCGcacacaca	0.562																																																	0																																										SO:0001628	intergenic_variant	0				CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696		4.37:g.54969776G>A				RNA	SNP	-	NULL	ENST00000326902.2	37	NULL	CCDS3494.1	4																																																																																			AC110298.1	-	-	ENSG00000221219		0.562	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221219	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000250595.1	-	0.00	42	0	G	NM_133267		54969776	-1	tier1	-	no_errors	ENST00000408292	ensembl	human	novel	74_37	rna	16.67	30	6	SNP	0.000	A
AL358813.2	0	genome.wustl.edu	37	1	149673218	149673219	+	5'Flank	INS	-	-	C	rs587739142|rs375533415|rs587733687	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:149673218_149673219insC	ENST00000369173.2	+	0	0				RNU1-68P_ENST00000517116.1_RNA|RP11-353N4.5_ENST00000608683.1_lincRNA|RP11-353N4.4_ENST00000443602.2_lincRNA																							GCCTAGAGATGCCCTTTGCGAG	0.688													cgcc|CCC|CCCC|complex_deletion	54	0.0107827	0.0	0.0173	5008	,	,		17630	0.0139		0.005	False		,,,				2504	0.0235																0																																										SO:0001631	upstream_gene_variant	0																															1.37:g.149673221_149673221dupC	Exception_encountered			RNA	INS	-	NULL	ENST00000369173.2	37	NULL		1																																																																																			RP11-353N4.4	-	-	ENSG00000223759		0.688	AL358813.2-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000223759	Clone_based_vega_gene	protein_coding			0.00	12	0	0			149673219	+1			no_errors	ENST00000443602	ensembl	human	known	74_37	rna	23.08	10	3	INS	0.007:0.006	C
LINC01597	400841	genome.wustl.edu	37	20	29521795	29521795	+	lincRNA	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:29521795C>T	ENST00000380888.3	-	0	0				RP4-610C12.3_ENST00000454331.1_lincRNA																							GCAATATTTCCTAGATATCAG	0.358																																																	0																																												0																															20.37:g.29521795C>T				RNA	SNP	-	NULL	ENST00000380888.3	37	NULL		20																																																																																			RP4-610C12.3	-	-	ENSG00000225490		0.358	RP4-610C12.4-001	KNOWN	basic	lincRNA	ENSG00000225490	Clone_based_vega_gene	lincRNA	OTTHUMT00000256907.1	-	0.00	54	0	C			29521795	-1	tier1	-	no_errors	ENST00000454331	ensembl	human	known	74_37	rna	30.65	43	19	SNP	0.985	T
CCDC85A	114800	genome.wustl.edu	37	2	56612129	56612129	+	3'UTR	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:56612129C>T	ENST00000407595.2	+	0	2803				RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGTAGCAAGACGTTGTAGAGT	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.*639C>T	2.37:g.56612129C>T				RNA	SNP	-	NULL	ENST00000407595.2	37	NULL	CCDS46290.1	2																																																																																			RP11-482H16.1	-	-	ENSG00000271894		0.328	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271894	Clone_based_vega_gene	protein_coding	OTTHUMT00000324993.1	-	0.00	60	0	C			56612129	+1	tier1	-	no_errors	ENST00000607540	ensembl	human	known	74_37	rna	20.83	76	20	SNP	0.001	T
EPHA2	1969	genome.wustl.edu	37	1	16464460	16464460	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:16464460G>A	ENST00000358432.5	-	5	1354	c.1200C>T	c.(1198-1200)agC>agT	p.S400S		NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	400	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S400S(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	GCTCCAGGTCGCTCACTGTCA	0.637																																																	1	Substitution - coding silent(1)	endometrium(1)											67.0	63.0	64.0					1																	16464460		2203	4300	6503	SO:0001819	synonymous_variant	0			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.1200C>T	1.37:g.16464460G>A			B5A968|Q8N3Z2	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.S400	ENST00000358432.5	37	c.1200	CCDS169.1	1																																																																																			EPHA2	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142627		0.637	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	HGNC	protein_coding	OTTHUMT00000026322.1		0.00	51	0	G	NM_004431		16464460	-1			no_errors	ENST00000358432	ensembl	human	known	74_37	silent	6.12	46	3	SNP	0.862	A
SLC5A9	200010	genome.wustl.edu	37	1	48694879	48694879	+	Intron	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:48694879C>A	ENST00000438567.2	+	4	391				SLC5A9_ENST00000420136.2_Intron|RP5-1024N4.4_ENST00000606809.1_RNA|SLC5A9_ENST00000533824.1_Intron|SLC5A9_ENST00000236495.5_Intron	NM_001011547.2	NP_001011547.2	Q2M3M2	SC5A9_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 9						sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|large_intestine(4)|liver(2)|lung(11)|ovary(3)|prostate(1)|urinary_tract(1)	26						gggggcctcccacagcacagc	0.597																																																	0													81.0	90.0	87.0					1																	48694879		2203	4300	6503	SO:0001627	intron_variant	0			BX648549	CCDS30709.2, CCDS44136.1	1p33	2013-07-19	2013-07-19		ENSG00000117834	ENSG00000117834		"""Solute carriers"""	22146	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 9"""				Standard	NM_001011547		Approved	SGLT4	uc001crn.2	Q2M3M2	OTTHUMG00000007959	ENST00000438567.2:c.340-88C>A	1.37:g.48694879C>A			B3KY87|B7ZL45|B7ZL47|E9PAK4|E9PJ08|Q5TET3	RNA	SNP	-	NULL	ENST00000438567.2	37	NULL	CCDS30709.2	1																																																																																			RP5-1024N4.4	-	-	ENSG00000272491		0.597	SLC5A9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272491	Clone_based_vega_gene	protein_coding	OTTHUMT00000022061.3	-	0.00	37	0	C	XM_117174		48694879	-1	tier1	-	no_errors	ENST00000606809	ensembl	human	known	74_37	rna	35.48	20	11	SNP	0.000	A
EPHA3	2042	genome.wustl.edu	37	3	89390109	89390109	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:89390109G>T	ENST00000336596.2	+	4	1083	c.858G>T	c.(856-858)aaG>aaT	p.K286N	EPHA3_ENST00000452448.2_Missense_Mutation_p.K286N|EPHA3_ENST00000494014.1_Missense_Mutation_p.K286N	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	286	Cys-rich.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTAATATGAAGTGTGCTAAGT	0.403										TSP Lung(6;0.00050)																																							0													163.0	157.0	159.0					3																	89390109		2203	4300	6503	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.858G>T	3.37:g.89390109G>T	ENSP00000337451:p.Lys286Asn		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.K286N	ENST00000336596.2	37	c.858	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	G	8.510	0.866332	0.17250	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.18338	2.22;2.22;2.22	6.17	0.957	0.19613	Tyrosine-protein kinase ephrin type A/B receptor-like (1);	0.094256	0.85682	D	0.000000	T	0.15955	0.0384	L	0.56769	1.78	0.48185	D	0.999603	P;B	0.39717	0.684;0.356	B;B	0.38378	0.272;0.185	T	0.03673	-1.1014	9	.	.	.	.	9.4785	0.38887	0.4351:0.0:0.5649:0.0	.	286;286	P29320;P29320-2	EPHA3_HUMAN;.	N	286	ENSP00000337451:K286N;ENSP00000399926:K286N;ENSP00000419190:K286N	.	K	+	3	2	EPHA3	89472799	1.000000	0.71417	0.706000	0.30403	0.888000	0.51559	1.012000	0.29924	-0.108000	0.12066	0.655000	0.94253	AAG	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Growth_fac_rcpt_N_dom	ENSG00000044524		0.403	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	-	0.00	62	0	G	NM_005233		89390109	+1	tier1	-	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	8.93	51	5	SNP	1.000	T
ETNPPL	64850	genome.wustl.edu	37	4	109674127	109674127	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:109674127T>C	ENST00000296486.3	-	6	696	c.542A>G	c.(541-543)gAc>gGc	p.D181G	ETNPPL_ENST00000510706.1_Missense_Mutation_p.D141G|ETNPPL_ENST00000411864.2_Missense_Mutation_p.D175G|ETNPPL_ENST00000512646.1_Missense_Mutation_p.D123G	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase	181						mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										GTCTGCATGGTCTTCTCTATA	0.368																																																	0													159.0	149.0	152.0					4																	109674127		2203	4300	6503	SO:0001583	missense	0			AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.542A>G	4.37:g.109674127T>C	ENSP00000296486:p.Asp181Gly		B7Z1Y0|E9PBY0|Q9H174	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	p.D181G	ENST00000296486.3	37	c.542	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	T	15.38	2.816714	0.50633	.	.	ENSG00000164089	ENST00000296486;ENST00000411864;ENST00000512646;ENST00000510706	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.46	3.04	0.35103	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.179615	0.64402	D	0.000017	T	0.39064	0.1064	M	0.67397	2.05	0.58432	D	0.999994	B;B;B	0.12630	0.003;0.002;0.006	B;B;B	0.23419	0.021;0.012;0.046	T	0.13629	-1.0502	9	.	.	.	-11.0279	8.7821	0.34798	0.0:0.1577:0.0:0.8423	.	123;175;181	E9PBY0;Q8TBG4-2;Q8TBG4	.;.;AT2L1_HUMAN	G	181;175;123;141	ENSP00000296486:D181G;ENSP00000392269:D175G;ENSP00000427065:D123G;ENSP00000423240:D141G	.	D	-	2	0	AGXT2L1	109893576	1.000000	0.71417	0.953000	0.39169	0.901000	0.52897	5.139000	0.64801	0.370000	0.24538	0.533000	0.62120	GAC	ETNPPL	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	ENSG00000164089		0.368	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETNPPL	HGNC	protein_coding	OTTHUMT00000363508.1	-	0.00	61	0	T	NM_031279		109674127	-1	tier1	-	no_errors	ENST00000296486	ensembl	human	known	74_37	missense	38.89	44	28	SNP	1.000	C
FAM107B	83641	genome.wustl.edu	37	10	14816271	14816271	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:14816271G>T	ENST00000181796.2	-	1	625	c.392C>A	c.(391-393)tCa>tAa	p.S131*		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GTCAATAATTGATGGTCTGGG	0.577																																																	0													100.0	80.0	87.0					10																	14816271		2203	4300	6503	SO:0001587	stop_gained	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.392C>A	10.37:g.14816271G>T	ENSP00000181796:p.Ser131*		A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Nonsense_Mutation	SNP	pfam_DUF1151	p.S131*	ENST00000181796.2	37	c.392	CCDS7102.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.472216	0.96274	.	.	ENSG00000065809	ENST00000181796	.	.	.	4.71	4.71	0.59529	.	0.485489	0.15295	N	0.269934	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0839	15.6098	0.76707	0.0:0.0:1.0:0.0	.	.	.	.	X	131	.	ENSP00000181796:S131X	S	-	2	0	FAM107B	14856277	1.000000	0.71417	1.000000	0.80357	0.400000	0.30750	5.965000	0.70387	2.449000	0.82847	0.561000	0.74099	TCA	FAM107B	-	NULL	ENSG00000065809		0.577	FAM107B-001	KNOWN	basic|CCDS	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000356966.1	-	0.00	29	0	G	NM_031453		14816271	-1	tier1	-	no_errors	ENST00000181796	ensembl	human	known	74_37	nonsense	7.41	50	4	SNP	1.000	T
FAM129B	64855	genome.wustl.edu	37	9	130271337	130271337	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:130271337A>G	ENST00000373312.3	-	10	1448	c.1235T>C	c.(1234-1236)cTg>cCg	p.L412P	FAM129B_ENST00000373314.3_Missense_Mutation_p.L399P|FAM129B_ENST00000468379.1_Intron	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	412					negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GTCCAGTCGCAGCGACTCCAT	0.637																																																	0													78.0	57.0	64.0					9																	130271337		2203	4300	6503	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.1235T>C	9.37:g.130271337A>G	ENSP00000362409:p.Leu412Pro		Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.L412P	ENST00000373312.3	37	c.1235	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542713	0.65198	.	.	ENSG00000136830	ENST00000373314;ENST00000538931;ENST00000373312	T;T	0.31769	1.48;1.48	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.54854	0.1884	M	0.71206	2.165	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.989;0.981	T	0.58725	-0.7586	10	0.87932	D	0	-18.0217	13.8666	0.63592	1.0:0.0:0.0:0.0	.	62;399;412	F5H3T0;Q96TA1-2;Q96TA1	.;.;NIBL1_HUMAN	P	399;62;412	ENSP00000362411:L399P;ENSP00000362409:L412P	ENSP00000362409:L412P	L	-	2	0	FAM129B	129311158	1.000000	0.71417	0.998000	0.56505	0.299000	0.27559	8.826000	0.92034	2.166000	0.68216	0.459000	0.35465	CTG	FAM129B	-	NULL	ENSG00000136830		0.637	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1		0.00	57	0	A	NM_022833		130271337	-1			no_errors	ENST00000373312	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	G
FAM160A1	729830	genome.wustl.edu	37	4	152571182	152571182	+	Silent	SNP	T	T	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:152571182T>G	ENST00000505231.1	+	9	2148	c.1989T>G	c.(1987-1989)gcT>gcG	p.A663A	FAM160A1_ENST00000435205.1_Silent_p.A663A			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	663										endometrium(2)|kidney(1)	3						AGGAGGAAGCTGCTAGGCCAC	0.552																																																	0													36.0	43.0	41.0					4																	152571182		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1989T>G	4.37:g.152571182T>G			Q6ZUS2	Silent	SNP	pfam_RetinoicA-induced_16-like	p.A663	ENST00000505231.1	37	c.1989	CCDS47146.1	4																																																																																			FAM160A1	-	NULL	ENSG00000164142		0.552	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	-	0.00	50	0	T	NM_001109977		152571182	+1	tier1	-	no_errors	ENST00000435205	ensembl	human	known	74_37	silent	30.91	38	17	SNP	0.000	G
FAM168A	23201	genome.wustl.edu	37	11	73130983	73130983	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:73130983G>T	ENST00000064778.4	-	5	524	c.240C>A	c.(238-240)acC>acA	p.T80T	FAM168A_ENST00000356467.4_Silent_p.T71T|FAM168A_ENST00000450446.2_Silent_p.T71T			Q92567	F168A_HUMAN	family with sequence similarity 168, member A	80										endometrium(3)|kidney(1)|lung(1)	5						GGAGGTGGAAGGTGCCTTCAG	0.507																																																	0													99.0	104.0	102.0					11																	73130983		1967	4135	6102	SO:0001819	synonymous_variant	0			BC014932	CCDS41689.1, CCDS66165.1, CCDS73346.1	11q13.4	2008-06-11	2008-06-11	2008-06-11		ENSG00000054965			28999	protein-coding gene	gene with protein product	"""tongue cancer chemotherapy resistance-associated protein 1"""		"""KIAA0280"""	KIAA0280			Standard	XM_005273852		Approved	TCRP1	uc001oty.1	Q92567		ENST00000064778.4:c.240C>A	11.37:g.73130983G>T			A2ICY2|A2ID81|Q86UG2	Silent	SNP	NULL	p.T80	ENST00000064778.4	37	c.240		11																																																																																			FAM168A	-	NULL	ENSG00000054965		0.507	FAM168A-003	KNOWN	basic	protein_coding	FAM168A	HGNC	protein_coding	OTTHUMT00000397424.1		0.00	61	0	G	NM_015159		73130983	-1			no_errors	ENST00000064778	ensembl	human	known	74_37	silent	5.33	71	4	SNP	1.000	T
FAM72B	653820	genome.wustl.edu	37	1	120854652	120854652	+	3'UTR	SNP	T	T	G	rs587770516		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:120854652T>G	ENST00000369390.3	+	0	1345				FAM72B_ENST00000355228.4_3'UTR|FAM72B_ENST00000471903.2_3'UTR	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B											large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		TGGATCAACTTTAAAATTGTT	0.259																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.*66T>G	1.37:g.120854652T>G			B2RPQ5|Q5QP15	RNA	SNP	-	NULL	ENST00000369390.3	37	NULL	CCDS41374.1	1																																																																																			FAM72B	-	-	ENSG00000188610		0.259	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM72B	HGNC	protein_coding	OTTHUMT00000098437.1	-	0.00	42	0	T			120854652	+1	tier1	-	no_errors	ENST00000471903	ensembl	human	known	74_37	rna	34.15	27	14	SNP	0.633	G
FAM84B	157638	genome.wustl.edu	37	8	127565642	127565642	+	3'UTR	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:127565642G>T	ENST00000304916.3	-	0	4448				FAM84B_ENST00000517458.1_5'UTR	NM_174911.4	NP_777571.1	Q96KN1	FA84B_HUMAN	family with sequence similarity 84, member B							cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	5	Ovarian(5;9.43e-05)|Esophageal squamous(12;0.0012)|Hepatocellular(40;0.128)|Myeloproliferative disorder(2;0.135)		STAD - Stomach adenocarcinoma(47;0.000556)|Colorectal(2;0.0102)|Lung(2;0.0136)|READ - Rectum adenocarcinoma(2;0.0723)			TCCAGTCGATGTCCTGCTTAT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AJ417849	CCDS6358.1	8q24.13	2006-02-09				ENSG00000168672			24166	protein-coding gene	gene with protein product	"""breast cancer membrane-associated protein 101"", ""neurological/sensory 2"""	609483				12477722	Standard	NM_174911		Approved	BCMP101, NSE2	uc003yrz.2	Q96KN1		ENST00000304916.3:c.*3060C>A	8.37:g.127565642G>T				RNA	SNP	-	NULL	ENST00000304916.3	37	NULL	CCDS6358.1	8																																																																																			FAM84B	-	-	ENSG00000168672		0.373	FAM84B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM84B	HGNC	protein_coding	OTTHUMT00000381487.1	-	0.00	62	0	G	NM_174911		127565642	-1	tier1	-	no_errors	ENST00000517458	ensembl	human	known	74_37	rna	6.49	72	5	SNP	0.000	T
FANCC	2176	genome.wustl.edu	37	9	98009794	98009794	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:98009794G>T	ENST00000289081.3	-	3	424	c.170C>A	c.(169-171)tCt>tAt	p.S57Y	FANCC_ENST00000375305.1_Missense_Mutation_p.S57Y	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	57					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				GACTGTATTAGAATCCTGTGA	0.343			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													82.0	87.0	86.0					9																	98009794		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.170C>A	9.37:g.98009794G>T	ENSP00000289081:p.Ser57Tyr		B1ALR8	Missense_Mutation	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.S57Y	ENST00000289081.3	37	c.170	CCDS35071.1	9	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.137905	0.00335	.	.	ENSG00000158169	ENST00000289081;ENST00000375305;ENST00000433829	T;T;T	0.61859	0.07;0.07;0.07	5.35	2.34	0.29019	.	0.663520	0.15470	N	0.260670	T	0.57858	0.2082	L	0.59436	1.845	0.18873	N	0.999988	P;P	0.42871	0.792;0.792	P;P	0.50490	0.642;0.642	T	0.43475	-0.9389	10	0.26408	T	0.33	-0.7254	6.2669	0.20932	0.2462:0.1391:0.6147:0.0	.	57;57	B1ALR7;Q00597	.;FANCC_HUMAN	Y	57	ENSP00000289081:S57Y;ENSP00000364454:S57Y;ENSP00000406908:S57Y	ENSP00000289081:S57Y	S	-	2	0	FANCC	97049615	0.998000	0.40836	0.825000	0.32803	0.071000	0.16799	2.923000	0.48868	0.847000	0.35167	-0.310000	0.09108	TCT	FANCC	-	pfam_Fanconi,pirsf_Fanconi	ENSG00000158169		0.343	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1		0.00	27	0	G	NM_000136		98009794	-1			no_errors	ENST00000289081	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.058	T
FHAD1	114827	genome.wustl.edu	37	1	15717703	15717703	+	Intron	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:15717703A>G	ENST00000375998.4	+	30	4122				FHAD1_ENST00000358897.4_Intron|FHAD1_ENST00000471347.1_Intron|FHAD1_ENST00000314740.8_Intron|FHAD1_ENST00000417793.1_Intron			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1											skin(1)|stomach(1)	2						TTCTGTATTGAAGAGACGAGT	0.348																																																	0																																										SO:0001627	intron_variant	0			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.4123-6090A>G	1.37:g.15717703A>G			Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	RNA	SNP	-	NULL	ENST00000375998.4	37	NULL		1																																																																																			FHAD1	-	-	ENSG00000142621		0.348	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	-	0.00	53	0	A	NM_052929		15717703	+1	tier1	-	no_errors	ENST00000472449	ensembl	human	known	74_37	rna	36.51	39	23	SNP	0.985	G
FIGN	55137	genome.wustl.edu	37	2	164468092	164468092	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:164468092C>T	ENST00000333129.3	-	3	564	c.250G>A	c.(250-252)Gac>Aac	p.D84N	FIGN_ENST00000482917.1_5'UTR|FIGN_ENST00000409634.1_Intron	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	84					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)			breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						ACGGGTCGGTCCACAGGACCT	0.478																																																	0													162.0	150.0	154.0					2																	164468092		1893	4119	6012	SO:0001583	missense	0			AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.250G>A	2.37:g.164468092C>T	ENSP00000333836:p.Asp84Asn		B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D84N	ENST00000333129.3	37	c.250	CCDS2221.2	2	.	.	.	.	.	.	.	.	.	.	C	12.57	1.978135	0.34942	.	.	ENSG00000182263	ENST00000333129	T	0.23348	1.91	6.17	6.17	0.99709	.	0.124624	0.52532	U	0.000080	T	0.27098	0.0664	L	0.40543	1.245	0.48236	D	0.999617	B	0.17667	0.023	B	0.16289	0.015	T	0.01972	-1.1237	10	0.34782	T	0.22	-32.4623	20.8794	0.99867	0.0:1.0:0.0:0.0	.	84	Q5HY92	FIGN_HUMAN	N	84	ENSP00000333836:D84N	ENSP00000333836:D84N	D	-	1	0	FIGN	164176338	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.999000	0.70665	2.941000	0.99782	0.655000	0.94253	GAC	FIGN	-	NULL	ENSG00000182263		0.478	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGN	HGNC	protein_coding	OTTHUMT00000157220.2	-	0.00	46	0	C	NM_018086		164468092	-1	tier1	-	no_errors	ENST00000333129	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
FLG	2312	genome.wustl.edu	37	1	152280506	152280506	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:152280506G>A	ENST00000368799.1	-	3	6891	c.6856C>T	c.(6856-6858)Cac>Tac	p.H2286Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2286	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCTTCGTGATGGGACCTG	0.557									Ichthyosis																																								0													252.0	258.0	256.0					1																	152280506		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6856C>T	1.37:g.152280506G>A	ENSP00000357789:p.His2286Tyr		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.H2286Y	ENST00000368799.1	37	c.6856	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	6.385	0.439054	0.12104	.	.	ENSG00000143631	ENST00000368799;ENST00000271820	T	0.01665	4.7	2.73	2.73	0.32206	.	.	.	.	.	T	0.00845	0.0028	L	0.47716	1.5	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44112	-0.9349	9	0.46703	T	0.11	.	9.1783	0.37125	0.0:0.0:1.0:0.0	.	2286	P20930	FILA_HUMAN	Y	2286;196	ENSP00000357789:H2286Y	ENSP00000271820:H196Y	H	-	1	0	FLG	150547130	0.002000	0.14202	0.006000	0.13384	0.028000	0.11728	0.455000	0.21843	1.587000	0.49959	0.420000	0.28162	CAC	FLG	-	NULL	ENSG00000143631		0.557	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	193	0	G	NM_002016		152280506	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	5.91	238	15	SNP	0.009	A
FLNC	2318	genome.wustl.edu	37	7	128486363	128486363	+	Frame_Shift_Del	DEL	C	C	-	rs34373805	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:128486363delC	ENST00000325888.8	+	23	4234	c.3973delC	c.(3973-3975)ctgfs	p.L1325fs	FLNC_ENST00000346177.6_Frame_Shift_Del_p.L1325fs	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1325					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						AGGCGTGCATCTGGTGGAGGT	0.667																																																	0													38.0	49.0	45.0					7																	128486363		2119	4223	6342	SO:0001589	frameshift_variant	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3973delC	7.37:g.128486363delC	ENSP00000327145:p.Leu1325fs		B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Frame_Shift_Del	DEL	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.L1325fs	ENST00000325888.8	37	c.3973	CCDS43644.1	7																																																																																			FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.667	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3		0.00	22	0	C			128486363	+1	tier1		no_errors	ENST00000325888	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.656	-
FLT3	2322	genome.wustl.edu	37	13	28623675	28623675	+	Splice_Site	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr13:28623675C>T	ENST00000241453.7	-	8	964		c.e8-1		FLT3_ENST00000380982.4_Splice_Site|FLT3_ENST00000537084.1_Splice_Site	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3						B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGTAGTTGCCCTAGGTTTTAA	0.353			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													90.0	87.0	88.0					13																	28623675		2203	4300	6503	SO:0001630	splice_region_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.883-1G>A	13.37:g.28623675C>T			A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Splice_Site	SNP	-	e8-1	ENST00000241453.7	37	c.883-1	CCDS31953.1	13	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106391	0.77096	.	.	ENSG00000122025	ENST00000241453;ENST00000380982;ENST00000537084	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5174	0.87778	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FLT3	27521675	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.533000	0.60615	2.885000	0.99019	0.655000	0.94253	.	FLT3	-	-	ENSG00000122025		0.353	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	-	0.00	43	0	C		Intron	28623675	-1	tier1	-	no_errors	ENST00000380982	ensembl	human	known	74_37	splice_site	68.42	12	26	SNP	1.000	T
FLVCR2	55640	genome.wustl.edu	37	14	76045398	76045398	+	Missense_Mutation	SNP	C	C	T	rs548569935	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:76045398C>T	ENST00000238667.4	+	1	439	c.83C>T	c.(82-84)tCg>tTg	p.S28L	AC007182.6_ENST00000455232.1_RNA	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	28	8 X 6 AA tandem repeats of P-S-[VS]-S- [VIAG]-[HNP].				heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		CCCAGCGTCTCGGTCCATCCC	0.642																																																	0													90.0	95.0	94.0					14																	76045398		2203	4300	6503	SO:0001583	missense	0			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.83C>T	14.37:g.76045398C>T	ENSP00000238667:p.Ser28Leu		B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Trimer_LpxA-like,pfscan_MFS_dom	p.S28L	ENST00000238667.4	37	c.83	CCDS9844.1	14	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600983	0.28534	.	.	ENSG00000119686	ENST00000238667	T	0.26810	1.71	4.08	3.19	0.36642	.	1.127850	0.06695	N	0.770281	T	0.18593	0.0446	L	0.27053	0.805	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.07121	-1.0789	10	0.22706	T	0.39	.	8.1372	0.31061	0.0:0.8905:0.0:0.1095	.	28	Q9UPI3	FLVC2_HUMAN	L	28	ENSP00000238667:S28L	ENSP00000238667:S28L	S	+	2	0	AC007182.1	75115151	0.085000	0.21516	0.318000	0.25279	0.050000	0.14768	0.493000	0.22451	1.313000	0.45069	0.650000	0.86243	TCG	FLVCR2	-	superfamily_Trimer_LpxA-like	ENSG00000119686		0.642	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR2	HGNC	protein_coding	OTTHUMT00000413672.1	-	0.00	72	0	C	NM_017791		76045398	+1	tier1	-	no_errors	ENST00000238667	ensembl	human	known	74_37	missense	28.57	70	28	SNP	0.737	T
FOXP1	27086	genome.wustl.edu	37	3	71008342	71008342	+	3'UTR	DEL	T	T	-	rs398062446		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:71008342delT	ENST00000318789.4	-	0	2615				FOXP1_ENST00000491238.1_3'UTR|FOXP1_ENST00000475937.1_3'UTR	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TTTTGACGTGTTTTTTTTTTT	0.408			T	PAX5	ALL																																			Dom	yes		3	3p14.1	27086	forkhead box P1		L	0																																										SO:0001624	3_prime_UTR_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.*56A>-	3.37:g.71008342delT			A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	RNA	DEL	-	NULL	ENST00000318789.4	37	NULL	CCDS2914.1	3																																																																																			FOXP1	-	-	ENSG00000114861		0.408	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1		0.00	29	0	T	NM_032682		71008342	-1	tier1		no_errors	ENST00000460805	ensembl	human	known	74_37	rna	11.11	24	3	DEL	0.439	-
FSIP2	401024	genome.wustl.edu	37	2	186656763	186656763	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:186656763T>C	ENST00000424728.1	+	16	4900	c.4900T>C	c.(4900-4902)Tca>Cca	p.S1634P	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.S1723P|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1634										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ACATGAAGCATCATTTCTGTC	0.333																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.4900T>C	2.37:g.186656763T>C	ENSP00000401306:p.Ser1634Pro		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.S1723P	ENST00000424728.1	37	c.5167		2	.	.	.	.	.	.	.	.	.	.	T	5.008	0.187219	0.09547	.	.	ENSG00000188738	ENST00000343098;ENST00000424728;ENST00000326147	T;T	0.47177	0.85;0.86	5.09	1.39	0.22231	.	0.986718	0.08249	N	0.974884	T	0.37293	0.0998	L	0.36672	1.1	0.09310	N	1	.	.	.	.	.	.	T	0.35151	-0.9800	8	0.41790	T	0.15	.	3.0903	0.06291	0.1873:0.5498:0.0:0.2629	.	.	.	.	P	1723;1634;1634	ENSP00000344403:S1723P;ENSP00000401306:S1634P	ENSP00000321903:S1634P	S	+	1	0	FSIP2	186365008	0.001000	0.12720	0.000000	0.03702	0.046000	0.14306	0.483000	0.22292	0.051000	0.15978	0.528000	0.53228	TCA	FSIP2	-	NULL	ENSG00000188738		0.333	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	9	0	T	NM_173651		186656763	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.000	C
GATM	2628	genome.wustl.edu	37	15	45657033	45657033	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:45657033C>T	ENST00000396659.3	-	7	1343	c.1004G>A	c.(1003-1005)tGg>tAg	p.W335*	GATM_ENST00000558336.1_Nonsense_Mutation_p.W335*	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	335					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	AATGATAGTCCATCCTGCTTT	0.338																																																	0													125.0	122.0	123.0					15																	45657033		2198	4298	6496	SO:0001587	stop_gained	0			S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.1004G>A	15.37:g.45657033C>T	ENSP00000379895:p.Trp335*		B4DH99|B4DPI3|Q53EQ4	Nonsense_Mutation	SNP	NULL	p.W335*	ENST00000396659.3	37	c.1004	CCDS10122.1	15	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838065	0.91117	.	.	ENSG00000171766	ENST00000396659	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.2212	14.6792	0.69004	0.0:1.0:0.0:0.0	.	.	.	.	X	335	.	ENSP00000379895:W335X	W	-	2	0	GATM	43444325	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.489000	0.73641	2.531000	0.85337	0.591000	0.81541	TGG	GATM	-	NULL	ENSG00000171766		0.338	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATM	HGNC	protein_coding	OTTHUMT00000254220.2	-	0.00	52	0	C	NM_001482		45657033	-1	tier1	-	no_errors	ENST00000396659	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
GNB1L	54584	genome.wustl.edu	37	22	19808147	19808147	+	Silent	SNP	C	C	T	rs368294430		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr22:19808147C>T	ENST00000329517.6	-	4	464	c.228G>A	c.(226-228)acG>acA	p.T76T	GNB1L_ENST00000460402.1_Intron|GNB1L_ENST00000405009.1_Silent_p.T76T|GNB1L_ENST00000403325.1_Silent_p.T76T	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	76					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					CCTGGGGCAGCGTCTGCAGCC	0.652																																																	0								C		1,4405		0,1,2202	29.0	34.0	32.0		228	-4.0	0.1	22		32	1,8597		0,1,4298	no	coding-synonymous	GNB1L	NM_053004.2		0,2,6500	TT,TC,CC		0.0116,0.0227,0.0154		76/328	19808147	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	0			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.228G>A	22.37:g.19808147C>T			Q9H2S2|Q9H4M4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T76	ENST00000329517.6	37	c.228	CCDS13768.1	22																																																																																			GNB1L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000185838		0.652	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1L	HGNC	protein_coding	OTTHUMT00000075202.1	-	0.00	93	0	C			19808147	-1	tier1	-	no_errors	ENST00000329517	ensembl	human	known	74_37	silent	27.72	73	28	SNP	0.311	T
GON4L	54856	genome.wustl.edu	37	1	155785777	155785777	+	Intron	DEL	A	A	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:155785777delA	ENST00000368331.1	-	8	1114				GON4L_ENST00000271883.5_Intron|GON4L_ENST00000361040.5_Intron|GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCAGGGCAGAAAAAAAAAAA	0.348																																																	0																																										SO:0001627	intron_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1066-86T>-	1.37:g.155785777delA			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	DEL	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			GON4L	-	-	ENSG00000116580		0.348	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding			0.00	14	0	A	NM_032292		155785777	-1	tier1		no_errors	ENST00000471341	ensembl	human	known	74_37	rna	18.42	31	7	DEL	0.000	-
GPR88	54112	genome.wustl.edu	37	1	101004692	101004692	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:101004692C>T	ENST00000315033.4	+	2	609	c.170C>T	c.(169-171)tCg>tTg	p.S57L		NM_022049.2	NP_071332.2	Q9GZN0	GPR88_HUMAN	G protein-coupled receptor 88	57					G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuronal action potential (GO:0019228)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|skin(1)	3		all_epithelial(167;1.19e-05)|all_lung(203;0.00159)|Lung NSC(277;0.00171)		Epithelial(280;0.0372)|all cancers(265;0.0558)|COAD - Colon adenocarcinoma(174;0.141)|Colorectal(144;0.156)|Lung(183;0.189)		TATCTCGTGTCGTCCTTCCGA	0.672																																																	0													42.0	38.0	39.0					1																	101004692		2203	4300	6503	SO:0001583	missense	0			AB042411	CCDS772.1	1p21.3	2012-08-21	2006-02-15		ENSG00000181656	ENSG00000181656		"""GPCR / Class A : Orphans"""	4539	protein-coding gene	gene with protein product		607468	"""G-protein coupled receptor 88"", ""G protein coupled receptor 88"""				Standard	NM_022049		Approved		uc001dth.3	Q9GZN0	OTTHUMG00000010981	ENST00000315033.4:c.170C>T	1.37:g.101004692C>T	ENSP00000314223:p.Ser57Leu		Q29S24|Q6VN48	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S57L	ENST00000315033.4	37	c.170	CCDS772.1	1	.	.	.	.	.	.	.	.	.	.	C	5.822	0.335902	0.11013	.	.	ENSG00000181656	ENST00000315033	T	0.34275	1.37	4.46	4.46	0.54185	GPCR, rhodopsin-like superfamily (1);	0.378994	0.18577	U	0.137170	T	0.06005	0.0156	N	0.04335	-0.225	0.32880	D	0.510475	B	0.21606	0.058	B	0.15484	0.013	T	0.17349	-1.0372	10	0.32370	T	0.25	-11.9319	4.6691	0.12680	0.0:0.6354:0.2237:0.1409	.	57	Q9GZN0	GPR88_HUMAN	L	57	ENSP00000314223:S57L	ENSP00000314223:S57L	S	+	2	0	GPR88	100777280	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.238000	0.32707	2.300000	0.77407	0.563000	0.77884	TCG	GPR88	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181656		0.672	GPR88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR88	HGNC	protein_coding	OTTHUMT00000030212.1	-	0.00	32	0	C	NM_022049		101004692	+1	tier1	-	no_errors	ENST00000315033	ensembl	human	known	74_37	missense	33.33	26	13	SNP	1.000	T
GREB1	9687	genome.wustl.edu	37	2	11761097	11761097	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:11761097G>T	ENST00000381486.2	+	23	4411	c.4111G>T	c.(4111-4113)Gaa>Taa	p.E1371*	GREB1_ENST00000234142.5_Nonsense_Mutation_p.E1371*|GREB1_ENST00000396123.1_Nonsense_Mutation_p.E369*	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1371						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		TCGGCTCACAGAAGTGGATGT	0.483																																					Ovarian(39;850 945 2785 23371 33093)												0													202.0	207.0	205.0					2																	11761097		1990	4159	6149	SO:0001587	stop_gained	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4111G>T	2.37:g.11761097G>T	ENSP00000370896:p.Glu1371*		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase	p.E1371*	ENST00000381486.2	37	c.4111	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	44	11.205679	0.99531	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-22.8647	18.1253	0.89584	0.0:0.0:1.0:0.0	.	.	.	.	X	1371;1371;369	.	ENSP00000234142:E1371X	E	+	1	0	GREB1	11678548	1.000000	0.71417	0.688000	0.30117	0.216000	0.24613	9.312000	0.96287	2.288000	0.76882	0.643000	0.83706	GAA	GREB1	-	superfamily_P-loop_NTPase	ENSG00000196208		0.483	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1		0.00	32	0	G	NM_014668		11761097	+1			no_errors	ENST00000234142	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	T
GRWD1	83743	genome.wustl.edu	37	19	48956267	48956267	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:48956267C>T	ENST00000253237.5	+	7	1559	c.1326C>T	c.(1324-1326)cgC>cgT	p.R442R	KCNJ14_ENST00000342291.2_5'Flank	NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	442						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		CCATCTTCCGCACCATCAGCG	0.612																																																	0													36.0	40.0	39.0					19																	48956267		2203	4297	6500	SO:0001819	synonymous_variant	0			AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.1326C>T	19.37:g.48956267C>T			Q8TF59	Silent	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R442	ENST00000253237.5	37	c.1326	CCDS12720.1	19																																																																																			GRWD1	-	NULL	ENSG00000105447		0.612	GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRWD1	HGNC	protein_coding	OTTHUMT00000466122.1	-	0.00	19	0	C	NM_031485		48956267	+1	tier1	-	no_errors	ENST00000253237	ensembl	human	known	74_37	silent	22.58	24	7	SNP	0.950	T
GZF1	64412	genome.wustl.edu	37	20	23350227	23350227	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:23350227G>T	ENST00000338121.5	+	5	1711	c.1634G>T	c.(1633-1635)cGt>cTt	p.R545L	GZF1_ENST00000544236.1_Missense_Mutation_p.R69L|GZF1_ENST00000377051.2_Missense_Mutation_p.R545L|GZF1_ENST00000542987.1_Missense_Mutation_p.R54L			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	545					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TCAGGGGAGCGTCCCTACTGC	0.572																																																	0													119.0	119.0	119.0					20																	23350227		2203	4300	6503	SO:0001583	missense	0			AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1634G>T	20.37:g.23350227G>T	ENSP00000338290:p.Arg545Leu		A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R545L	ENST00000338121.5	37	c.1634	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.662136	0.96734	.	.	ENSG00000125812	ENST00000544236;ENST00000338121;ENST00000542987;ENST00000377051	T;T;T;T	0.20200	2.09;2.09;2.09;2.09	5.94	5.94	0.96194	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.213738	0.31461	N	0.007601	T	0.46444	0.1393	L	0.58669	1.825	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.27262	-1.0079	10	0.87932	D	0	.	19.3398	0.94336	0.0:0.0:1.0:0.0	.	545	Q9H116	GZF1_HUMAN	L	69;545;54;545	ENSP00000445458:R69L;ENSP00000338290:R545L;ENSP00000445118:R54L;ENSP00000366250:R545L	ENSP00000338290:R545L	R	+	2	0	GZF1	23298227	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.810000	0.99221	2.818000	0.97014	0.650000	0.86243	CGT	GZF1	-	pfscan_Znf_C2H2	ENSG00000125812		0.572	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	HGNC	protein_coding	OTTHUMT00000078333.1		0.00	25	0	G	NM_022482		23350227	+1			no_errors	ENST00000338121	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	T
HDDC2	51020	genome.wustl.edu	37	6	125613988	125613988	+	Splice_Site	SNP	T	T	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:125613988T>A	ENST00000398153.2	-	4	419	c.377A>T	c.(376-378)gAa>gTa	p.E126V	HDDC2_ENST00000368377.4_Splice_Site_p.E92V|HDDC2_ENST00000608295.1_Intron	NM_016063.2	NP_057147.2	Q7Z4H3	HDDC2_HUMAN	HD domain containing 2	126	HD.					extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)				endometrium(1)|large_intestine(1)|lung(4)	6			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0186)		TATACTTACTTCCCAAAGTTC	0.358																																																	0													138.0	137.0	137.0					6																	125613988		1847	4100	5947	SO:0001630	splice_region_variant	0			AF151888	CCDS43503.1	6q13-q24.3	2008-02-05	2005-08-22	2005-08-22	ENSG00000111906	ENSG00000111906			21078	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 74"""	C6orf74		10810093	Standard	NM_016063		Approved	CGI-130, dJ167O5.2	uc003qaa.1	Q7Z4H3	OTTHUMG00000015506	ENST00000398153.2:c.378+1A>T	6.37:g.125613988T>A			Q5TDQ4|Q6NZ49|Q9BTT2|Q9BV31|Q9Y3D1	Missense_Mutation	SNP	pfam_HD_domain,smart_HD/PDEase_dom	p.E126V	ENST00000398153.2	37	c.377	CCDS43503.1	6	.	.	.	.	.	.	.	.	.	.	T	27.5	4.836396	0.91117	.	.	ENSG00000111906	ENST00000318787;ENST00000398153;ENST00000368377	T;T;T	0.47869	0.83;0.88;0.83	5.52	5.52	0.82312	Metal-dependent phosphohydrolase, HD domain (1);Metal-dependent phosphohydrolase, HD subdomain (1);HD domain (1);	0.045054	0.85682	D	0.000000	T	0.50582	0.1624	M	0.84585	2.705	0.80722	D	1	P	0.38250	0.624	B	0.44044	0.439	T	0.59139	-0.7510	10	0.54805	T	0.06	.	14.9183	0.70815	0.0:0.0:0.0:1.0	.	126	Q7Z4H3	HDDC2_HUMAN	V	92;126;92	ENSP00000316242:E92V;ENSP00000381220:E126V;ENSP00000357361:E92V	ENSP00000316242:E92V	E	-	2	0	HDDC2	125655687	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.337000	0.79256	2.218000	0.71995	0.533000	0.62120	GAA	HDDC2	-	pfam_HD_domain,smart_HD/PDEase_dom	ENSG00000111906		0.358	HDDC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HDDC2	HGNC	protein_coding	OTTHUMT00000472493.1	-	0.00	43	0	T	NM_016063	Missense_Mutation	125613988	-1	tier1	-	no_errors	ENST00000398153	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
HIPK2	28996	genome.wustl.edu	37	7	139416737	139416737	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:139416737T>C	ENST00000406875.3	-	2	191	c.97A>G	c.(97-99)Ata>Gta	p.I33V	HIPK2_ENST00000342645.6_Missense_Mutation_p.I33V|HIPK2_ENST00000428878.2_Missense_Mutation_p.I33V	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	33				I -> V (in Ref. 1; AAG41236). {ECO:0000305}.	adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CTCGGCTCTATTTTCAGTTTC	0.498																																																	0													73.0	70.0	71.0					7																	139416737		1568	3582	5150	SO:0001583	missense	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.97A>G	7.37:g.139416737T>C	ENSP00000385571:p.Ile33Val		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I33V	ENST00000406875.3	37	c.97		7	.	.	.	.	.	.	.	.	.	.	T	0.679	-0.798968	0.02841	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.37058	1.26;1.27;1.22	4.69	3.8	0.43715	.	.	.	.	.	T	0.14874	0.0359	.	.	.	0.24589	N	0.993831	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25606	-1.0127	8	0.02654	T	1	.	8.3496	0.32295	0.0:0.7601:0.1555:0.0843	.	33;33	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	V	33	ENSP00000385571:I33V;ENSP00000413724:I33V;ENSP00000343108:I33V	ENSP00000343108:I33V	I	-	1	0	HIPK2	139063223	1.000000	0.71417	0.847000	0.33407	0.990000	0.78478	4.710000	0.61873	1.295000	0.44724	-0.242000	0.12053	ATA	HIPK2	-	NULL	ENSG00000064393		0.498	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	-	0.00	36	0	T	NM_022740		139416737	-1	tier1	-	no_errors	ENST00000406875	ensembl	human	known	74_37	missense	30.19	37	16	SNP	1.000	C
HMGB1P5	10354	genome.wustl.edu	37	3	22424366	22424366	+	RNA	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:22424366G>T	ENST00000451497.1	+	0	931									high mobility group box 1 pseudogene 5																		CTGTTTTGTTGACATTCTGAA	0.333																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424366G>T				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	18	0	G	NG_000897		22424366	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	13.04	20	3	SNP	1.000	T
HNRNPM	4670	genome.wustl.edu	37	19	8536251	8536251	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:8536251C>T	ENST00000325495.4	+	10	978	c.937C>T	c.(937-939)Caa>Taa	p.Q313*	HNRNPM_ENST00000348943.3_Nonsense_Mutation_p.Q274*	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	313					alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						ACCAGGAGGGCAACCCATTGA	0.488																																																	0													113.0	87.0	96.0					19																	8536251		2203	4300	6503	SO:0001587	stop_gained	0			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.937C>T	19.37:g.8536251C>T	ENSP00000325376:p.Gln313*		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNP_M_PY-NLS,smart_RRM_dom,pfscan_RRM_dom	p.Q313*	ENST00000325495.4	37	c.937	CCDS12203.1	19	.	.	.	.	.	.	.	.	.	.	C	40	8.100933	0.98654	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.2373	0.89954	0.0:1.0:0.0:0.0	.	.	.	.	X	313;274;213	.	ENSP00000325376:Q313X	Q	+	1	0	HNRNPM	8442251	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.815000	0.86186	2.721000	0.93114	0.655000	0.94253	CAA	HNRNPM	-	NULL	ENSG00000099783		0.488	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPM	HGNC	protein_coding	OTTHUMT00000460894.1	-	0.00	74	0	C			8536251	+1	tier1	-	no_errors	ENST00000325495	ensembl	human	known	74_37	nonsense	10.53	34	4	SNP	1.000	T
HPS4	89781	genome.wustl.edu	37	22	26860750	26860750	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr22:26860750C>T	ENST00000398145.2	-	11	1462	c.846G>A	c.(844-846)caG>caA	p.Q282Q	HPS4_ENST00000402105.3_Silent_p.Q277Q|HPS4_ENST00000336873.5_Silent_p.Q282Q|HPS4_ENST00000493455.2_5'Flank|HPS4_ENST00000398141.1_Silent_p.Q295Q	NM_022081.5	NP_071364.4	Q9NQG7	HPS4_HUMAN	Hermansky-Pudlak syndrome 4	282					blood coagulation (GO:0007596)|hemostasis (GO:0007599)|lysosome organization (GO:0007040)|melanocyte differentiation (GO:0030318)|positive regulation of eye pigmentation (GO:0048075)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	BLOC-3 complex (GO:0031085)|cytoplasm (GO:0005737)|lysosome (GO:0005764)|melanosome (GO:0042470)|membrane (GO:0016020)|platelet dense granule (GO:0042827)	protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(3)|kidney(5)|large_intestine(4)|lung(12)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	32						TTGGATGGTGCTGGGCTGAAC	0.577									Hermansky-Pudlak syndrome																																								0													90.0	77.0	81.0					22																	26860750		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8		CCDS13835.1, CCDS46677.1	22q12.1	2014-09-17			ENSG00000100099	ENSG00000100099			15844	protein-coding gene	gene with protein product		606682				11836498, 12663659	Standard	NM_022081		Approved	KIAA1667, LE	uc003aci.4	Q9NQG7	OTTHUMG00000030459	ENST00000398145.2:c.846G>A	22.37:g.26860750C>T			B1AHQ4|Q5H8V6|Q96LX6|Q9BY93|Q9UH37|Q9UH38	Silent	SNP	NULL	p.Q295	ENST00000398145.2	37	c.885	CCDS13835.1	22																																																																																			HPS4	-	NULL	ENSG00000100099		0.577	HPS4-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HPS4	HGNC	protein_coding	OTTHUMT00000320778.1		0.00	13	0	C	NM_022081		26860750	-1			no_errors	ENST00000398141	ensembl	human	known	74_37	silent	12.50	21	3	SNP	0.000	T
HPS5	11234	genome.wustl.edu	37	11	18327774	18327774	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:18327774C>T	ENST00000349215.3	-	7	1009	c.732G>A	c.(730-732)agG>agA	p.R244R	HPS5_ENST00000531848.1_Silent_p.R130R|HPS5_ENST00000438420.2_Silent_p.R130R|HPS5_ENST00000396253.3_Silent_p.R130R	NM_181507.1	NP_852608.1	Q9UPZ3	HPS5_HUMAN	Hermansky-Pudlak syndrome 5	244					blood coagulation (GO:0007596)|organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CTTCCCACATCCTAGAGCCTG	0.458									Hermansky-Pudlak syndrome																																								0													107.0	103.0	104.0					11																	18327774		2199	4293	6492	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	AB023234	CCDS7836.1, CCDS7837.1	11p14	2014-06-18			ENSG00000110756	ENSG00000110756			17022	protein-coding gene	gene with protein product		607521				10231032, 10094488	Standard	NM_181507		Approved		uc001mod.1	Q9UPZ3	OTTHUMG00000166612	ENST00000349215.3:c.732G>A	11.37:g.18327774C>T			A8K6J8|A8K8S1|D3DQX9|D3DQY0|O95942|Q8N4U0	Silent	SNP	superfamily_WD40_repeat_dom,pirsf_BLOC-2_complex_Hps5_subunit	p.R244	ENST00000349215.3	37	c.732	CCDS7836.1	11																																																																																			HPS5	-	pirsf_BLOC-2_complex_Hps5_subunit	ENSG00000110756		0.458	HPS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS5	HGNC	protein_coding	OTTHUMT00000390808.1	-	0.00	74	0	C	NM_181507		18327774	-1	tier1	-	no_errors	ENST00000349215	ensembl	human	known	74_37	silent	7.77	95	8	SNP	0.997	T
IFNA4	3441	genome.wustl.edu	37	9	21187114	21187114	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:21187114G>A	ENST00000421715.1	-	1	484	c.417C>T	c.(415-417)tcC>tcT	p.S139S		NM_021068.2	NP_066546.1	P05014	IFNA4_HUMAN	interferon, alpha 4	139					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17				GBM - Glioblastoma multiforme(5;2.69e-202)|Lung(24;2.26e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CAGCCAGGATGGAGTCCTCAT	0.448																																					NSCLC(154;890 1986 23660 27800 51138)												0													53.0	55.0	54.0					9																	21187114		2191	4272	6463	SO:0001819	synonymous_variant	0				CCDS6498.1	9p22	2010-08-24			ENSG00000236637	ENSG00000236637		"""Interferons"""	5425	protein-coding gene	gene with protein product		147564				1385305	Standard	NM_021068		Approved	MGC142200, IFN-alpha4a	uc003zon.2	P05014	OTTHUMG00000019660	ENST00000421715.1:c.417C>T	9.37:g.21187114G>A			P13358|Q14CS4|Q5VV15	Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.S139	ENST00000421715.1	37	c.417	CCDS6498.1	9																																																																																			IFNA4	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000236637		0.448	IFNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA4	HGNC	protein_coding	OTTHUMT00000051889.1	-	0.00	113	0	G	NM_021068		21187114	-1	tier1	-	no_errors	ENST00000421715	ensembl	human	known	74_37	silent	48.00	39	36	SNP	0.020	A
IGF2R	3482	genome.wustl.edu	37	6	160525851	160525851	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:160525851G>A	ENST00000356956.1	+	48	7359	c.7211G>A	c.(7210-7212)gGg>gAg	p.G2404E	IGF2R_ENST00000475584.1_Intron	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	2404					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TCCCTGCATGGGGATGACCAG	0.582																																																	0													109.0	88.0	95.0					6																	160525851		2203	4300	6503	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.7211G>A	6.37:g.160525851G>A	ENSP00000349437:p.Gly2404Glu		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.G2404E	ENST00000356956.1	37	c.7211	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309854	0.60414	.	.	ENSG00000197081	ENST00000356956	T	0.08546	3.08	5.35	-0.201	0.13212	.	0.521409	0.21028	N	0.081387	T	0.04227	0.0117	M	0.75447	2.3	0.30562	N	0.764365	P	0.34462	0.454	B	0.35240	0.198	T	0.18681	-1.0329	10	0.45353	T	0.12	-19.8096	8.8881	0.35416	0.0:0.2013:0.2206:0.5781	.	2404	P11717	MPRI_HUMAN	E	2404	ENSP00000349437:G2404E	ENSP00000349437:G2404E	G	+	2	0	IGF2R	160445841	0.993000	0.37304	0.749000	0.31150	0.985000	0.73830	1.002000	0.29796	0.264000	0.21851	0.655000	0.94253	GGG	IGF2R	-	NULL	ENSG00000197081		0.582	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1		0.00	31	0	G	NM_000876		160525851	+1			no_errors	ENST00000356956	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
IMPG2	50939	genome.wustl.edu	37	3	100963611	100963611	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:100963611A>G	ENST00000193391.7	-	13	1751	c.1564T>C	c.(1564-1566)Tca>Cca	p.S522P		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	522					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	AAATCTTCTGACTCTTCAACA	0.343																																																	0													55.0	54.0	54.0					3																	100963611		2203	4300	6503	SO:0001583	missense	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1564T>C	3.37:g.100963611A>G	ENSP00000193391:p.Ser522Pro		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S522P	ENST00000193391.7	37	c.1564	CCDS2940.1	3	.	.	.	.	.	.	.	.	.	.	A	7.957	0.746077	0.15710	.	.	ENSG00000081148	ENST00000193391	T	0.27104	1.69	5.66	1.67	0.24075	.	0.826203	0.10830	N	0.629480	T	0.14356	0.0347	N	0.14661	0.345	0.20074	N	0.999935	B;B	0.15141	0.012;0.007	B;B	0.09377	0.004;0.004	T	0.28106	-1.0054	10	0.30078	T	0.28	0.1145	8.9685	0.35892	0.756:0.0:0.244:0.0	.	522;522	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	P	522	ENSP00000193391:S522P	ENSP00000193391:S522P	S	-	1	0	IMPG2	102446301	0.317000	0.24589	0.783000	0.31826	0.614000	0.37383	0.695000	0.25527	0.451000	0.26802	0.533000	0.62120	TCA	IMPG2	-	NULL	ENSG00000081148		0.343	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	-	0.00	28	0	A			100963611	-1	tier1	-	no_errors	ENST00000193391	ensembl	human	known	74_37	missense	54.76	19	23	SNP	0.405	G
INSIG2	51141	genome.wustl.edu	37	2	118860856	118860856	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:118860856C>T	ENST00000245787.4	+	3	534	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	INSIG2_ENST00000485520.1_3'UTR	NM_016133.2	NP_057217.2	Q9Y5U4	INSI2_HUMAN	insulin induced gene 2	110					cholesterol biosynthetic process (GO:0006695)|cranial suture morphogenesis (GO:0060363)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of steroid biosynthetic process (GO:0010894)|palate development (GO:0060021)|response to fatty acid (GO:0070542)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)|triglyceride metabolic process (GO:0006641)	endoplasmic reticulum membrane (GO:0005789)|SREBP-SCAP-Insig complex (GO:0032937)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						CAGTGTAATGCGGTGTGTAGC	0.393																																																	0													235.0	231.0	233.0					2																	118860856		2203	4300	6503	SO:0001583	missense	0			AF527632	CCDS2122.1	2q14.1	2008-02-05			ENSG00000125629	ENSG00000125629			20452	protein-coding gene	gene with protein product		608660				12242332	Standard	NM_016133		Approved		uc002tlk.3	Q9Y5U4	OTTHUMG00000058518	ENST00000245787.4:c.328C>T	2.37:g.118860856C>T	ENSP00000245787:p.Arg110Trp		A8K5W8|Q8TBI8	Missense_Mutation	SNP	pfam_INSIG_fam	p.R110W	ENST00000245787.4	37	c.328	CCDS2122.1	2	.	.	.	.	.	.	.	.	.	.	C	19.48	3.834841	0.71373	.	.	ENSG00000125629	ENST00000245787	.	.	.	5.4	5.4	0.78164	.	0.056406	0.64402	D	0.000001	T	0.78941	0.4363	M	0.77616	2.38	0.58432	D	0.999999	D;D	0.89917	1.0;0.997	D;P	0.87578	0.998;0.879	T	0.80781	-0.1229	9	0.87932	D	0	.	14.2365	0.65929	0.1489:0.8511:0.0:0.0	.	2;110	B4DQ23;Q9Y5U4	.;INSI2_HUMAN	W	110	.	ENSP00000245787:R110W	R	+	1	2	INSIG2	118577326	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.264000	0.43302	2.805000	0.96524	0.655000	0.94253	CGG	INSIG2	-	pfam_INSIG_fam	ENSG00000125629		0.393	INSIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSIG2	HGNC	protein_coding	OTTHUMT00000129624.1		0.00	40	0	C	NM_016133		118860856	+1			no_errors	ENST00000245787	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
ING5	84289	genome.wustl.edu	37	2	242662678	242662678	+	Silent	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:242662678A>G	ENST00000313552.6	+	7	698	c.672A>G	c.(670-672)aaA>aaG	p.K224K	ING5_ENST00000406941.1_Silent_p.K224K|AC114730.11_ENST00000435195.1_RNA	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	224					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CGAAACCCAAAGGAAAATGGT	0.537																																																	0													214.0	221.0	219.0					2																	242662678		2203	4300	6503	SO:0001819	synonymous_variant	0			AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.672A>G	2.37:g.242662678A>G			A8K1P3|Q53NU6|Q57Z54|Q9BS30	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K224	ENST00000313552.6	37	c.672	CCDS33425.1	2																																																																																			ING5	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000168395		0.537	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING5	HGNC	protein_coding	OTTHUMT00000322901.3	-	0.00	73	0	A	NM_032329		242662678	+1	tier1	-	no_errors	ENST00000313552	ensembl	human	known	74_37	silent	44.44	45	36	SNP	1.000	G
NAV1	89796	genome.wustl.edu	37	1	201791219	201791219	+	3'UTR	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:201791219G>A	ENST00000367296.4	+	0	8213				NAV1_ENST00000295624.6_3'UTR|NAV1_ENST00000367295.1_3'UTR|IPO9-AS1_ENST00000421159.1_RNA|NAV1_ENST00000367297.4_3'UTR|NAV1_ENST00000367302.1_3'UTR|NAV1_ENST00000367300.3_3'UTR|IPO9-AS1_ENST00000421449.1_RNA|IPO9-AS1_ENST00000413035.1_RNA	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1						microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TCCCATGGATGACAGGGTTCT	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.*2159G>A	1.37:g.201791219G>A			A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	RNA	SNP	-	NULL	ENST00000367296.4	37	NULL	CCDS1414.2	1																																																																																			IPO9-AS1	-	-	ENSG00000231871		0.443	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IPO9-AS1	HGNC	protein_coding	OTTHUMT00000087013.1	-	0.00	53	0	G	NM_020443		201791219	-1	tier1	-	no_errors	ENST00000421159	ensembl	human	known	74_37	rna	21.28	37	10	SNP	0.001	A
IPO9	55705	genome.wustl.edu	37	1	201837796	201837796	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:201837796G>A	ENST00000361565.4	+	16	1945	c.1876G>A	c.(1876-1878)Gct>Act	p.A626T		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	626					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						CGCCTCACTGGCTCAGGACAT	0.547																																																	0													92.0	76.0	82.0					1																	201837796		2203	4300	6503	SO:0001583	missense	0			AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.1876G>A	1.37:g.201837796G>A	ENSP00000354742:p.Ala626Thr		B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.A626T	ENST00000361565.4	37	c.1876	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.714232	0.68730	.	.	ENSG00000198700	ENST00000361565	T	0.67523	-0.27	6.17	5.26	0.73747	Armadillo-like helical (1);Armadillo-type fold (1);	0.044536	0.85682	D	0.000000	T	0.51346	0.1669	N	0.22421	0.69	0.80722	D	1	B	0.27286	0.174	B	0.22880	0.042	T	0.46498	-0.9187	10	0.20046	T	0.44	-9.54	14.7574	0.69576	0.0:0.0:0.8544:0.1456	.	626	Q96P70	IPO9_HUMAN	T	626	ENSP00000354742:A626T	ENSP00000354742:A626T	A	+	1	0	IPO9	200104419	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.491000	0.81471	1.611000	0.50210	0.655000	0.94253	GCT	IPO9	-	superfamily_ARM-type_fold	ENSG00000198700		0.547	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	HGNC	protein_coding	OTTHUMT00000087088.1	-	0.00	40	0	G	NM_018085		201837796	+1	tier1	-	no_errors	ENST00000361565	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
KCTD16	57528	genome.wustl.edu	37	5	143853578	143853578	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:143853578G>T	ENST00000507359.3	+	3	2279	c.1188G>T	c.(1186-1188)gaG>gaT	p.E396D	KCTD16_ENST00000512467.1_Missense_Mutation_p.E396D	NM_020768.3	NP_065819.1	Q68DU8	KCD16_HUMAN	potassium channel tetramerization domain containing 16	396					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)		p.E396E(1)		large_intestine(5)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	21		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			AGGAGCTGGAGAAATGTATCC	0.408																																																	1	Substitution - coding silent(1)	ovary(1)											60.0	71.0	67.0					5																	143853578		2200	4300	6500	SO:0001583	missense	0			AB037738	CCDS34260.1	5q32	2013-06-20	2013-06-20		ENSG00000183775	ENSG00000183775			29244	protein-coding gene	gene with protein product		613423	"""potassium channel tetramerisation domain containing 16"""			10718198	Standard	NM_020768		Approved	KIAA1317	uc003lnm.1	Q68DU8	OTTHUMG00000163172	ENST00000507359.3:c.1188G>T	5.37:g.143853578G>T	ENSP00000426548:p.Glu396Asp		Q9P2M9	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.E396D	ENST00000507359.3	37	c.1188	CCDS34260.1	5	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540680	0.65085	.	.	ENSG00000183775	ENST00000512467;ENST00000507359	T;T	0.46063	0.88;0.88	6.17	1.94	0.25998	.	0.000000	0.85682	D	0.000000	T	0.25121	0.0610	L	0.29908	0.895	0.38196	D	0.940049	B	0.32781	0.384	B	0.26416	0.069	T	0.11494	-1.0585	10	0.72032	D	0.01	.	6.1676	0.20398	0.3416:0.0:0.5318:0.1267	.	396	Q68DU8	KCD16_HUMAN	D	396	ENSP00000424151:E396D;ENSP00000426548:E396D	ENSP00000426548:E396D	E	+	3	2	KCTD16	143833771	0.997000	0.39634	1.000000	0.80357	0.992000	0.81027	0.405000	0.21015	0.484000	0.27630	0.655000	0.94253	GAG	KCTD16	-	NULL	ENSG00000183775		0.408	KCTD16-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD16	HGNC	protein_coding	OTTHUMT00000371898.3		0.00	30	0	G	XM_098368		143853578	+1			no_errors	ENST00000507359	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.997	T
KHDRBS2	202559	genome.wustl.edu	37	6	62757860	62757860	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:62757860A>G	ENST00000281156.4	-	3	537	c.259T>C	c.(259-261)Tcc>Ccc	p.S87P		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	87	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		CTCTTCAAGGAGTTTCCTCTT	0.363																																																	0													144.0	136.0	139.0					6																	62757860		2203	4300	6503	SO:0001583	missense	0			BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.259T>C	6.37:g.62757860A>G	ENSP00000281156:p.Ser87Pro		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.S87P	ENST00000281156.4	37	c.259	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	A	20.5	3.994556	0.74703	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.30182	1.54	5.05	5.05	0.67936	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.50240	0.1604	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58891	-0.7556	10	0.87932	D	0	-2.7781	15.0834	0.72133	1.0:0.0:0.0:0.0	.	87	Q5VWX1	KHDR2_HUMAN	P	87	ENSP00000281156:S87P	ENSP00000281156:S87P	S	-	1	0	KHDRBS2	62815819	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.087000	0.71362	2.015000	0.59207	0.377000	0.23210	TCC	KHDRBS2	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000112232		0.363	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	-	0.00	50	0	A	NM_152688		62757860	-1	tier1	-	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	33.96	35	18	SNP	1.000	G
ICE1	23379	genome.wustl.edu	37	5	5462676	5462676	+	Silent	SNP	A	A	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:5462676A>C	ENST00000296564.7	+	13	3451	c.3229A>C	c.(3229-3231)Aga>Cga	p.R1077R		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1077					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGCATTTTGCAGAAAACATGG	0.463																																																	0													113.0	112.0	112.0					5																	5462676		1919	4144	6063	SO:0001819	synonymous_variant	0																														ENST00000296564.7:c.3229A>C	5.37:g.5462676A>C			Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Silent	SNP	superfamily_Vitellinogen_superhlx	p.R1077	ENST00000296564.7	37	c.3229	CCDS47187.1	5																																																																																			KIAA0947	-	NULL	ENSG00000164151		0.463	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	-	0.00	26	0	A			5462676	+1	tier1	-	no_errors	ENST00000296564	ensembl	human	known	74_37	silent	40.00	45	30	SNP	0.000	C
KIF21A	55605	genome.wustl.edu	37	12	39703470	39703471	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:39703470_39703471insA	ENST00000361418.5	-	33	4209_4210	c.4194_4195insT	c.(4192-4197)tataccfs	p.T1399fs	KIF21A_ENST00000541463.2_Frame_Shift_Ins_p.T1346fs|KIF21A_ENST00000544797.2_Frame_Shift_Ins_p.T1362fs|KIF21A_ENST00000547745.1_5'Flank|KIF21A_ENST00000395670.3_Frame_Shift_Ins_p.T1400fs|KIF21A_ENST00000361961.3_Frame_Shift_Ins_p.T1386fs			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1399					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				ACCAAACTGGTATAATTACAGT	0.391																																																	0																																										SO:0001589	frameshift_variant	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.4195dupT	12.37:g.39703471_39703471dupA	ENSP00000354878:p.Thr1399fs		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.T1399fs	ENST00000361418.5	37	c.4198_4197	CCDS53776.1	12																																																																																			KIF21A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139116		0.391	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1		0.00	39	0	-	NM_017641		39703471	-1	tier1		no_errors	ENST00000395670	ensembl	human	known	74_37	frame_shift_ins	51.43	17	18	INS	1.000:0.997	A
KIF5B	3799	genome.wustl.edu	37	10	32324841	32324841	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:32324841delT	ENST00000302418.4	-	9	1250	c.793delA	c.(793-795)attfs	p.I265fs		NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	265	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				AAAGCAGAAATAACATTTCCA	0.388			T	"""RET, ALK"""	NSCLC																																			Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													115.0	105.0	109.0					10																	32324841		2203	4300	6503	SO:0001589	frameshift_variant	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.793delA	10.37:g.32324841delT	ENSP00000307078:p.Ile265fs		A0AVB2|Q5VZ85	Frame_Shift_Del	DEL	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I265fs	ENST00000302418.4	37	c.793	CCDS7171.1	10																																																																																			KIF5B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom	ENSG00000170759		0.388	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1		0.00	50	0	T	NM_004521		32324841	-1	tier1		no_errors	ENST00000302418	ensembl	human	known	74_37	frame_shift_del	40.00	30	20	DEL	1.000	-
KIR3DX1	90011	genome.wustl.edu	37	19	55048095	55048095	+	Missense_Mutation	SNP	A	A	C	rs554102215		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:55048095A>C	ENST00000335056.3	+	5	700	c.662A>C	c.(661-663)tAc>tCc	p.Y221S	KIR3DX1_ENST00000482404.1_3'UTR			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	221						extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		CTAGGAAAATACAAAAAGCCT	0.413											OREG0003665	type=REGULATORY REGION|Gene=BC033195|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0													45.0	46.0	46.0					19																	55048095		1834	4096	5930	SO:0001583	missense	0			BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.662A>C	19.37:g.55048095A>C	ENSP00000335388:p.Tyr221Ser	1004	B7WNL0|Q8N0S4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.Y221S	ENST00000335056.3	37	c.662		19	.	.	.	.	.	.	.	.	.	.	A	2.101	-0.405995	0.04832	.	.	ENSG00000104970	ENST00000335056	T	0.00801	5.68	1.9	-0.596	0.11657	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47249	-0.9132	6	0.87932	D	0	.	4.5583	0.12147	0.4797:0.0:0.0:0.5203	.	.	.	.	S	221	ENSP00000335388:Y221S	ENSP00000221567:Y221S	Y	+	2	0	KIR3DX1	59739907	0.000000	0.05858	0.000000	0.03702	0.116000	0.19942	0.425000	0.21346	-0.227000	0.09884	0.528000	0.53228	TAC	KIR3DX1	-	NULL	ENSG00000104970		0.413	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	HGNC	protein_coding	OTTHUMT00000140800.2	-	0.00	50	0	A	NR_026716		55048095	+1	tier1	-	no_errors	ENST00000335056	ensembl	human	known	74_37	missense	24.56	42	14	SNP	0.000	C
KMT2A	4297	genome.wustl.edu	37	11	118343155	118343155	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:118343155G>T	ENST00000389506.5	+	3	1281	c.1281G>T	c.(1279-1281)cgG>cgT	p.R427R	KMT2A_ENST00000354520.4_Silent_p.R427R|KMT2A_ENST00000534358.1_Silent_p.R427R			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	427					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)	p.R427R(1)									CCCCTCGGCGGTTTATAGAGG	0.458																																																	1	Substitution - coding silent(1)	lung(1)											99.0	109.0	106.0					11																	118343155		2200	4296	6496	SO:0001819	synonymous_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1281G>T	11.37:g.118343155G>T			E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R427	ENST00000389506.5	37	c.1281	CCDS31686.1	11																																																																																			KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.458	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2		0.00	29	0	G	NM_005933		118343155	+1			no_errors	ENST00000389506	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.974	T
KRTAP13-4	284827	genome.wustl.edu	37	21	31802694	31802694	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr21:31802694C>A	ENST00000334068.2	+	1	123	c.101C>A	c.(100-102)gCc>gAc	p.A34D		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	34						intermediate filament (GO:0005882)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						TACAGCACTGCCCTCTGCTCT	0.602																																					NSCLC(196;2401 3038 18004 35753)												0													83.0	84.0	83.0					21																	31802694		2203	4300	6503	SO:0001583	missense	0			AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.101C>A	21.37:g.31802694C>A	ENSP00000334834:p.Ala34Asp		A2RRL3	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.A34D	ENST00000334068.2	37	c.101	CCDS13592.1	21	.	.	.	.	.	.	.	.	.	.	-	0.004	-2.317414	0.00235	.	.	ENSG00000186971	ENST00000334068	T	0.03094	4.05	4.95	-4.4	0.03600	.	1.142630	0.06809	N	0.789989	T	0.00875	0.0029	N	0.00450	-1.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46091	-0.9216	10	0.02654	T	1	.	5.9408	0.19192	0.4936:0.2506:0.2559:0.0	.	34	Q3LI77	KR134_HUMAN	D	34	ENSP00000334834:A34D	ENSP00000334834:A34D	A	+	2	0	KRTAP13-4	30724565	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.313000	0.08103	-0.855000	0.04125	-1.106000	0.02097	GCC	KRTAP13-4	-	pfam_KRTAP_PMG	ENSG00000186971		0.602	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-4	HGNC	protein_coding	OTTHUMT00000128222.1	-	0.00	47	0	C			31802694	+1	tier1	-	no_errors	ENST00000334068	ensembl	human	known	74_37	missense	31.51	50	23	SNP	0.004	A
LDLRAD4	753	genome.wustl.edu	37	18	13645351	13645351	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr18:13645351A>G	ENST00000359446.5	+	6	1084	c.616A>G	c.(616-618)Agg>Ggg	p.R206G	LDLRAD4_ENST00000399848.3_Missense_Mutation_p.R188G|LDLRAD4_ENST00000585931.1_Missense_Mutation_p.R129G|RP11-701H16.4_ENST00000588397.1_RNA|LDLRAD4_ENST00000587757.1_Missense_Mutation_p.R169G|LDLRAD4_ENST00000361205.4_Missense_Mutation_p.R206G|LDLRAD4_ENST00000586765.1_Missense_Mutation_p.R151G|LDLRAD4_ENST00000592991.1_Missense_Mutation_p.R108G	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	206					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)	p.R169W(2)|p.R206W(2)									AGAGTCCGTGAGGGCCCCACC	0.587																																																	4	Substitution - Missense(4)	lung(4)											78.0	86.0	83.0					18																	13645351		2203	4300	6503	SO:0001583	missense	0			AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.616A>G	18.37:g.13645351A>G	ENSP00000352420:p.Arg206Gly		B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.R206G	ENST00000359446.5	37	c.616	CCDS32793.1	18	.	.	.	.	.	.	.	.	.	.	A	18.38	3.610988	0.66558	.	.	ENSG00000168675	ENST00000361205;ENST00000399848;ENST00000359446;ENST00000399847;ENST00000361303;ENST00000435606	T;T	0.41758	0.99;1.11	5.17	-0.768	0.11013	.	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	M	0.84326	2.69	0.53688	D	0.999971	D;D;D;D;D;D	0.89917	0.997;0.998;0.997;0.998;1.0;1.0	D;D;D;D;D;D	0.87578	0.993;0.995;0.993;0.995;0.998;0.996	T	0.70934	-0.4737	10	0.87932	D	0	-9.0324	14.7064	0.69194	0.4537:0.5463:0.0:0.0	.	130;148;151;169;188;206	O15165-4;O15165-3;E9PAY9;B3KNT9;O15165-2;O15165	.;.;.;.;.;CR001_HUMAN	G	206;188;169;151;148;130	ENSP00000354753:R206G;ENSP00000382741:R188G	ENSP00000352420:R169G	R	+	1	2	C18orf1	13635351	0.997000	0.39634	0.992000	0.48379	0.984000	0.73092	0.660000	0.25009	-0.009000	0.14296	0.533000	0.62120	AGG	LDLRAD4	-	NULL	ENSG00000168675		0.587	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LDLRAD4	HGNC	protein_coding	OTTHUMT00000458326.1		0.00	41	0	A	NM_181481		13645351	+1			no_errors	ENST00000359446	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.993	G
LDLRAP1	26119	genome.wustl.edu	37	1	25889481	25889481	+	Intron	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:25889481C>G	ENST00000374338.4	+	6	651				LDLRAP1_ENST00000488127.1_Intron	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1						amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGCCACCGCTAATCACCCC	0.557																																																	0																																										SO:0001627	intron_variant	0			BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.533-80C>G	1.37:g.25889481C>G			A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	RNA	SNP	-	NULL	ENST00000374338.4	37	NULL	CCDS30639.1	1																																																																																			LDLRAP1	-	-	ENSG00000157978		0.557	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAP1	HGNC	protein_coding	OTTHUMT00000019350.3	-	0.00	79	0	C	NM_015627		25889481	+1	tier1	-	no_errors	ENST00000484476	ensembl	human	known	74_37	rna	11.88	89	12	SNP	0.000	G
LGALS9C	654346	genome.wustl.edu	37	17	18396131	18396131	+	Silent	SNP	T	T	C	rs138238232	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:18396131T>C	ENST00000328114.6	+	10	963	c.882T>C	c.(880-882)agT>agC	p.S294S	LGALS9C_ENST00000584941.1_Intron|LGALS9C_ENST00000581545.1_Intron|LGALS9C_ENST00000412421.2_Silent_p.S206S|LGALS9C_ENST00000583322.1_Silent_p.S261S	NM_001040078.2	NP_001035167.2	Q6DKI2	LEG9C_HUMAN	lectin, galactoside-binding, soluble, 9C	294	Beta-galactoside binding 2. {ECO:0000250}.|Galectin 2. {ECO:0000255|PROSITE- ProRule:PRU00639}.						carbohydrate binding (GO:0030246)			NS(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(2)	7						AGGAGCGAAGTCTGCCCCGAA	0.592																																																	0													34.0	21.0	25.0					17																	18396131		2181	4064	6245	SO:0001819	synonymous_variant	0				CCDS32587.1	17p11.2	2011-08-04			ENSG00000171916	ENSG00000171916		"""Lectins, galactoside-binding"""	33874	protein-coding gene	gene with protein product							Standard	NM_001040078		Approved		uc002gtw.3	Q6DKI2	OTTHUMG00000059251	ENST00000328114.6:c.882T>C	17.37:g.18396131T>C			B0AZM7	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.S294	ENST00000328114.6	37	c.882	CCDS32587.1	17																																																																																			LGALS9C	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	ENSG00000171916		0.592	LGALS9C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LGALS9C	HGNC	protein_coding	OTTHUMT00000131456.2	-	0.00	63	0	T	NM_001040078		18396131	+1	tier1	rs138238232	no_errors	ENST00000328114	ensembl	human	known	74_37	silent	14.04	49	8	SNP	0.081	C
LGI2	55203	genome.wustl.edu	37	4	25013980	25013980	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:25013980A>T	ENST00000382114.4	-	7	982	c.797T>A	c.(796-798)tTc>tAc	p.F266Y		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	266						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				ATAGCTCCGGAAATTCATTTC	0.507																																																	0													164.0	135.0	144.0					4																	25013980		2203	4300	6503	SO:0001583	missense	0			AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.797T>A	4.37:g.25013980A>T	ENSP00000371548:p.Phe266Tyr		Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	pfam_EPTP,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_EAR	p.F266Y	ENST00000382114.4	37	c.797	CCDS3431.1	4	.	.	.	.	.	.	.	.	.	.	A	28.8	4.947577	0.92593	.	.	ENSG00000153012	ENST00000382114	D	0.98889	-5.21	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.98798	0.9595	M	0.68317	2.08	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	D	0.99764	1.1022	10	0.62326	D	0.03	-20.6584	14.6631	0.68888	1.0:0.0:0.0:0.0	.	266	Q8N0V4	LGI2_HUMAN	Y	266	ENSP00000371548:F266Y	ENSP00000371548:F266Y	F	-	2	0	LGI2	24623078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.125000	0.94402	1.922000	0.55676	0.454000	0.30748	TTC	LGI2	-	pfam_EPTP	ENSG00000153012		0.507	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGI2	HGNC	protein_coding	OTTHUMT00000214978.1	-	0.00	63	0	A			25013980	-1	tier1	-	no_errors	ENST00000382114	ensembl	human	known	74_37	missense	35.56	29	16	SNP	1.000	T
LIG1	3978	genome.wustl.edu	37	19	48665527	48665527	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:48665527G>T	ENST00000263274.7	-	3	518	c.99C>A	c.(97-99)ccC>ccA	p.P33P	LIG1_ENST00000536218.1_Silent_p.P33P|LIG1_ENST00000427526.2_Intron|LIG1_ENST00000599165.1_5'UTR	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	33					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	ACTTTGGAGGGGGCTCCGTCT	0.458								Nucleotide excision repair (NER)																																									0													192.0	187.0	188.0					19																	48665527		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.99C>A	19.37:g.48665527G>T			B2RAI8|Q2TB12|Q32P23	Silent	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.P33	ENST00000263274.7	37	c.99	CCDS12711.1	19																																																																																			LIG1	-	NULL	ENSG00000105486		0.458	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	-	0.00	36	0	G	NM_000234		48665527	-1	tier1	-	no_errors	ENST00000263274	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.144	T
LINC00341	79686	genome.wustl.edu	37	14	95875694	95875694	+	lincRNA	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:95875694G>T	ENST00000464767.1	-	0	733					NR_026779.1		Q9H761	CN139_HUMAN	long intergenic non-protein coding RNA 341																		TTTCTCATCAGAACAGGAAGA	0.517																																																	0																																												0			AK024929		14q32.13	2012-10-12	2011-08-10	2011-08-10	ENSG00000229645			"""Long non-coding RNAs"""	20353	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 139"", ""non-protein coding RNA 341"""	C14orf139, NCRNA00341			Standard	NR_026779		Approved		uc001yeh.4	Q9H761	OTTHUMG00000028884		14.37:g.95875694G>T			Q6IA18	RNA	SNP	-	NULL	ENST00000464767.1	37	NULL		14																																																																																			LINC00341	-	-	ENSG00000229645		0.517	LINC00341-001	KNOWN	basic	lincRNA	LINC00341	HGNC	lincRNA	OTTHUMT00000072103.2		0.00	29	0	G	NR_026779		95875694	-1			no_errors	ENST00000464767	ensembl	human	known	74_37	rna	10.26	35	4	SNP	0.005	T
LINC00623	728855	genome.wustl.edu	37	1	149581283	149581283	+	RNA	SNP	C	C	T	rs369844172		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:149581283C>T	ENST00000598569.1	+	0	760																											TTAGAAAAGACATGAGACTAA	0.254																																																	0																																												0																															1.37:g.149581283C>T				RNA	SNP	-	NULL	ENST00000598569.1	37	NULL		1																																																																																			RP11-353N4.6	-	-	ENSG00000269501		0.254	RP11-353N4.6-002	KNOWN	basic	processed_transcript	LINC00623	Clone_based_vega_gene	pseudogene	OTTHUMT00000462966.1	-	0.00	14	0	C			149581283	+1	tier1	-	no_errors	ENST00000598569	ensembl	human	known	74_37	rna	38.10	13	8	SNP	0.001	T
LMTK2	22853	genome.wustl.edu	37	7	97820971	97820971	+	Silent	SNP	C	C	A	rs149882695		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:97820971C>A	ENST00000297293.5	+	11	1487	c.1194C>A	c.(1192-1194)ccC>ccA	p.P398P		NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	398	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					AAAAGAGACCCGCGGCTGAAG	0.507																																																	0													58.0	56.0	56.0					7																	97820971		2203	4300	6503	SO:0001819	synonymous_variant	0			AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.1194C>A	7.37:g.97820971C>A			A4D272|Q75MG7|Q9UPS3	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P398	ENST00000297293.5	37	c.1194	CCDS5654.1	7																																																																																			LMTK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000164715		0.507	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMTK2	HGNC	protein_coding	OTTHUMT00000334560.1		0.00	38	0	C	NM_014916		97820971	+1			no_errors	ENST00000297293	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.107	A
SMURF1	57154	genome.wustl.edu	37	7	98630574	98630575	+	Intron	INS	-	-	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:98630574_98630575insA	ENST00000361125.1	-	18	2494				AC004893.11_ENST00000468960.2_RNA|AC004893.11_ENST00000360902.1_RNA|SMURF1_ENST00000361368.2_Intron	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1						BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			GACTCCATCTCAAAAAAAAACA	0.46																																																	0																																										SO:0001627	intron_variant	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.2174+84->T	7.37:g.98630583_98630583dupA			A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	RNA	INS	-	NULL	ENST00000361125.1	37	NULL	CCDS34690.1	7																																																																																			AC004893.11	-	-	ENSG00000242687		0.460	SMURF1-001	KNOWN	basic|CCDS	protein_coding	LOC101927550	Clone_based_vega_gene	protein_coding	OTTHUMT00000335001.2		0.00	28	0	-	NM_020429		98630575	+1	tier1		no_errors	ENST00000360902	ensembl	human	known	74_37	rna	7.14	26	2	INS	0.001:0.000	A
LOC729218	729218	genome.wustl.edu	37	4	119552902	119552902	+	lincRNA	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:119552902C>G	ENST00000567913.2	+	0	2413																											AGTGGACCCTCCAGACCCAGA	0.557																																																	0																																												0																															4.37:g.119552902C>G				RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-	ENSG00000260404		0.557	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC101929676	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2		0.00	21	0	C			119552902	+1			no_errors	ENST00000567913	ensembl	human	known	74_37	rna	16.67	25	5	SNP	0.461	G
LOC441666	441666	genome.wustl.edu	37	10	42831134	42831134	+	RNA	SNP	C	C	T	rs78055338		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:42831134C>T	ENST00000609841.1	-	0	2769					NR_024380.1																						GCCAAACTTCCTTAGGTTCAT	0.348																																																	0																																												0																															10.37:g.42831134C>T				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.348	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	24	0	C			42831134	-1	tier1	rs78055338	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	43.75	18	14	SNP	0.071	T
MAP3K10	4294	genome.wustl.edu	37	19	40718833	40718833	+	Silent	SNP	G	G	T	rs375485459		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:40718833G>T	ENST00000253055.3	+	7	1962	c.1674G>T	c.(1672-1674)acG>acT	p.T558T		NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	558					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						AGGGACGAACGTGGGGGCCCA	0.657																																																	0													34.0	37.0	36.0					19																	40718833		2202	4299	6501	SO:0001819	synonymous_variant	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.1674G>T	19.37:g.40718833G>T			Q12761|Q14871	Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.T558	ENST00000253055.3	37	c.1674	CCDS12549.1	19																																																																																			MAP3K10	-	pirsf_MAPKKK9/10/11	ENSG00000130758		0.657	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1		0.00	49	0	G	NM_002446		40718833	+1			no_errors	ENST00000253055	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.765	T
MARCH4	57574	genome.wustl.edu	37	2	217234657	217234657	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:217234657delG	ENST00000273067.4	-	1	2093	c.327delC	c.(325-327)cccfs	p.P109fs		NM_020814.2	NP_065865.1	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4, E3 ubiquitin protein ligase	109	Pro-rich.					Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(1)	20		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		AAGGTGGCAAGGGGGGTGGAG	0.667																																																	0													13.0	14.0	14.0					2																	217234657		2200	4298	6498	SO:0001589	frameshift_variant	0			AB037820	CCDS33376.1	2q35	2013-01-09	2012-02-23		ENSG00000144583	ENSG00000144583		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	29269	protein-coding gene	gene with protein product		608208	"""membrane-associated ring finger (C3HC4) 4"""			10718198, 14722266	Standard	NM_020814		Approved	KIAA1399, MARCH-IV, RNF174	uc002vgb.3	Q9P2E8	OTTHUMG00000154824	ENST00000273067.4:c.327delC	2.37:g.217234657delG	ENSP00000273067:p.Pro109fs		Q4KMN7|Q86WR8	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.L110fs	ENST00000273067.4	37	c.327	CCDS33376.1	2																																																																																			MARCH4	-	NULL	ENSG00000144583		0.667	MARCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH4	HGNC	protein_coding	OTTHUMT00000337272.2		0.00	25	0	G	NM_020814		217234657	-1	tier1		no_errors	ENST00000273067	ensembl	human	known	74_37	frame_shift_del	7.14	26	2	DEL	0.997	-
MBLAC2	153364	genome.wustl.edu	37	5	89770101	89770101	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:89770101C>T	ENST00000316610.6	-	1	484	c.9G>A	c.(7-9)gcG>gcA	p.A3A	MBLAC2_ENST00000514906.1_Silent_p.A3A|POLR3G_ENST00000399107.1_5'Flank|POLR3G_ENST00000514483.1_5'Flank|POLR3G_ENST00000504930.1_5'Flank	NM_203406.1	NP_981951	Q68D91	MBLC2_HUMAN	metallo-beta-lactamase domain containing 2	3						extracellular vesicular exosome (GO:0070062)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(1)|liver(1)|lung(3)	5						ACCACTCGAGCGCCGACATGC	0.627																																																	0													28.0	25.0	26.0					5																	89770101		2203	4300	6503	SO:0001819	synonymous_variant	0			BC038230	CCDS4067.1	5q14.3	2009-04-08	2009-04-08		ENSG00000176055	ENSG00000176055			33711	protein-coding gene	gene with protein product							Standard	NM_203406		Approved	DKFZp686P15118, MGC46734	uc003kjp.3	Q68D91	OTTHUMG00000131327	ENST00000316610.6:c.9G>A	5.37:g.89770101C>T			D6RJI1|Q8IY16|Q8N8D8	Silent	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.A3	ENST00000316610.6	37	c.9	CCDS4067.1	5																																																																																			MBLAC2	-	NULL	ENSG00000176055		0.627	MBLAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBLAC2	HGNC	protein_coding	OTTHUMT00000254098.2	-	0.00	31	0	C	NM_203406		89770101	-1	tier1	-	no_errors	ENST00000316610	ensembl	human	known	74_37	silent	36.84	24	14	SNP	1.000	T
MCHR2	84539	genome.wustl.edu	37	6	100395640	100395640	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:100395640G>T	ENST00000281806.2	-	3	704	c.390C>A	c.(388-390)gaC>gaA	p.D130E	MCHR2_ENST00000369212.2_Missense_Mutation_p.D130E	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.D130D(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		TCACTTACCTGTCCACACTCA	0.443																																																	1	Substitution - coding silent(1)	lung(1)											131.0	142.0	138.0					6																	100395640		2203	4300	6503	SO:0001583	missense	0			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.390C>A	6.37:g.100395640G>T	ENSP00000281806:p.Asp130Glu		B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH2_receptor,prints_GPCR_Rhodpsn,prints_MCH_rcpt	p.D130E	ENST00000281806.2	37	c.390	CCDS5044.1	6	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979214	0.74360	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	D;D;D	0.83755	-1.76;-1.76;-1.76	4.57	3.65	0.41850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000003	D	0.84656	0.5520	M	0.64170	1.965	0.42349	D	0.992368	D	0.89917	1.0	D	0.97110	1.0	D	0.85739	0.1336	10	0.87932	D	0	.	9.1243	0.36805	0.1176:0.0:0.8824:0.0	.	130	Q969V1	MCHR2_HUMAN	E	130	ENSP00000403490:D130E;ENSP00000281806:D130E;ENSP00000358214:D130E	ENSP00000281806:D130E	D	-	3	2	MCHR2	100502361	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.316000	0.59178	0.830000	0.34757	0.650000	0.86243	GAC	MCHR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000152034		0.443	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR2	HGNC	protein_coding	OTTHUMT00000041620.2		0.00	44	0	G	NM_032503		100395640	-1			no_errors	ENST00000281806	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
MCMDC2	157777	genome.wustl.edu	37	8	67793086	67793086	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:67793086G>T	ENST00000422365.2	+	8	883	c.712G>T	c.(712-714)Gaa>Taa	p.E238*	MCMDC2_ENST00000492775.1_Nonsense_Mutation_p.E238*|MCMDC2_ENST00000313616.5_Nonsense_Mutation_p.E238*|MCMDC2_ENST00000541540.1_Nonsense_Mutation_p.E175*|MCMDC2_ENST00000396592.3_Nonsense_Mutation_p.E238*	NM_173518.4	NP_775789.3	Q4G0Z9	MCMD2_HUMAN	minichromosome maintenance domain containing 2	238					DNA replication (GO:0006260)		ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(2)|kidney(2)|lung(5)	9						AATTTTAGATGAATCAGTGAA	0.279																																																	0													18.0	20.0	19.0					8																	67793086		2148	4193	6341	SO:0001587	stop_gained	0			BC034576	CCDS6197.2, CCDS47868.1, CCDS47869.1	8q13.1	2012-04-13	2012-04-13	2012-04-13	ENSG00000178460	ENSG00000178460			26368	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 45"""	C8orf45			Standard	NM_173518		Approved	FLJ25692	uc003xwz.4	Q4G0Z9	OTTHUMG00000157068	ENST00000422365.2:c.712G>T	8.37:g.67793086G>T	ENSP00000413632:p.Glu238*		B4DYZ3|B4DZM4|B4E293|Q6P533|Q7Z3P4	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase	p.E238*	ENST00000422365.2	37	c.712	CCDS6197.2	8	.	.	.	.	.	.	.	.	.	.	G	28.8	4.951869	0.92660	.	.	ENSG00000178460	ENST00000379356;ENST00000396592;ENST00000422365;ENST00000492775;ENST00000313616;ENST00000541540	.	.	.	5.86	5.86	0.93980	.	0.047637	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-13.2882	20.259	0.98436	0.0:0.0:1.0:0.0	.	.	.	.	X	110;238;238;238;238;175	.	ENSP00000317234:E238X	E	+	1	0	C8orf45	67955640	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.193000	0.77780	2.793000	0.96121	0.644000	0.83932	GAA	MCMDC2	-	superfamily_NA-bd_OB-fold,smart_MCM_DNA-dep_ATPase	ENSG00000178460		0.279	MCMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCMDC2	HGNC	protein_coding	OTTHUMT00000347350.1	-	0.00	39	0	G	NM_173518		67793086	+1	tier1	-	no_errors	ENST00000422365	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	T
MECOM	2122	genome.wustl.edu	37	3	168810878	168810878	+	Frame_Shift_Del	DEL	G	G	-	rs540158912		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:168810878delG	ENST00000464456.1	-	12	3641	c.2441delC	c.(2440-2442)tcgfs	p.S815fs	MECOM_ENST00000433243.2_Frame_Shift_Del_p.S825fs|MECOM_ENST00000392736.3_Frame_Shift_Del_p.S824fs|MECOM_ENST00000460814.1_Frame_Shift_Del_p.S815fs|MECOM_ENST00000494292.1_Frame_Shift_Del_p.S1003fs|MECOM_ENST00000472280.1_Frame_Shift_Del_p.S825fs|MECOM_ENST00000468789.1_Frame_Shift_Del_p.S824fs|MECOM_ENST00000264674.3_Frame_Shift_Del_p.S889fs	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						ATGAGGCGACGATGTTGCTGT	0.388																																																	0													105.0	94.0	98.0					3																	168810878		2203	4300	6503	SO:0001589	frameshift_variant	0			S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2441delC	3.37:g.168810878delG	ENSP00000419770:p.Ser815fs		Q13466|Q6FH90	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.S1002fs	ENST00000464456.1	37	c.3005	CCDS54669.1	3																																																																																			MECOM	-	NULL	ENSG00000085276		0.388	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	MECOM	HGNC	protein_coding	OTTHUMT00000351519.1		0.00	64	0	G	NM_005241, NM_004991		168810878	-1	tier1		no_errors	ENST00000494292	ensembl	human	known	74_37	frame_shift_del	29.36	77	32	DEL	1.000	-
MED14	9282	genome.wustl.edu	37	X	40541948	40541948	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:40541948C>A	ENST00000324817.1	-	18	2390	c.2272G>T	c.(2272-2274)Ggt>Tgt	p.G758C	MED14_ENST00000496531.2_5'UTR	NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	758	Interaction with SREBF1.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTTCTACCACCAACAGGCTCA	0.388																																																	0													83.0	61.0	69.0					X																	40541948		2203	4300	6503	SO:0001583	missense	0			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.2272G>T	X.37:g.40541948C>A	ENSP00000323720:p.Gly758Cys		Q4KMR7|Q9UNB3	Missense_Mutation	SNP	pfam_Mediator_Med14	p.G758C	ENST00000324817.1	37	c.2272	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454439	0.84209	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.75686	0.3883	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.77156	-0.2691	9	0.72032	D	0.01	.	18.9488	0.92632	0.0:1.0:0.0:0.0	.	758	O60244	MED14_HUMAN	C	758	.	ENSP00000323720:G758C	G	-	1	0	MED14	40426892	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.484000	0.81180	2.423000	0.82170	0.600000	0.82982	GGT	MED14	-	NULL	ENSG00000180182		0.388	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1	-	0.00	28	0	C	NM_004229		40541948	-1	tier1	-	no_errors	ENST00000324817	ensembl	human	known	74_37	missense	18.75	39	9	SNP	1.000	A
MGA	23269	genome.wustl.edu	37	15	42041627	42041627	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:42041627C>G	ENST00000570161.1	+	16	5822	c.5822C>G	c.(5821-5823)tCt>tGt	p.S1941C	MGA_ENST00000389936.4_Missense_Mutation_p.S1902C|MGA_ENST00000219905.7_Missense_Mutation_p.S1941C|MGA_ENST00000545763.1_Missense_Mutation_p.S1732C|MGA_ENST00000566586.1_Missense_Mutation_p.S1732C			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTCTCCAGTCTGGTAGTTTT	0.448																																																	0													43.0	41.0	42.0					15																	42041627		1894	4117	6011	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5822C>G	15.37:g.42041627C>G	ENSP00000457035:p.Ser1941Cys		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.S1941C	ENST00000570161.1	37	c.5822	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	17.42	3.386201	0.61956	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.26957	1.7;1.7;1.7	5.72	5.72	0.89469	.	0.000000	0.51477	D	0.000087	T	0.41050	0.1142	N	0.24115	0.695	0.31751	N	0.634622	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.998;0.999;0.993;0.993	T	0.43750	-0.9372	10	0.87932	D	0	.	19.8788	0.96888	0.0:1.0:0.0:0.0	.	557;1732;1941;1902	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	C	1941;1902;1732	ENSP00000219905:S1941C;ENSP00000374586:S1902C;ENSP00000442467:S1732C	ENSP00000219905:S1941C	S	+	2	0	MGA	39828919	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.996000	0.57009	2.704000	0.92352	0.563000	0.77884	TCT	MGA	-	NULL	ENSG00000174197		0.448	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	32	0	C	NM_001164273.1		42041627	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
NGB	58157	genome.wustl.edu	37	14	77732623	77732623	+	3'UTR	DEL	A	A	-	rs397720987|rs28909969	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:77732623delA	ENST00000298352.4	-	0	1086				MIR1260A_ENST00000408827.1_RNA	NM_021257.3	NP_067080.1	Q9NPG2	NGB_HUMAN	neuroglobin						apoptotic process (GO:0006915)|oxygen transport (GO:0015671)	mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0273)		AGGGAGTGCCAAAAAAGGTAA	0.552													AAAAA|AAAAAA|AAAAA|insertion	167	0.0333466	0.031	0.0548	5008	,	,		20535	0.0129		0.0338	False		,,,				2504	0.0419																0										153,3405		12,129,1638	108.0	114.0	113.0			-0.6	0.0	14	dbSNP_125	115	193,7195		6,181,3507	no	utr-3	NGB	NM_021257.3		18,310,5145	A1A1,A1R,RR		2.6123,4.3002,3.161			77732623	346,10600	1568	3582	5150	SO:0001624	3_prime_UTR_variant	0			AJ245946	CCDS9856.1	14q24.3	2014-06-13			ENSG00000165553	ENSG00000165553			14077	protein-coding gene	gene with protein product		605304				11029004, 17210637	Standard	NM_021257		Approved		uc001xtg.1	Q9NPG2	OTTHUMG00000171558	ENST00000298352.4:c.*256T>-	14.37:g.77732623delA				RNA	DEL	-	NULL	ENST00000298352.4	37	NULL	CCDS9856.1	14																																																																																			MIR1260A	-	-	ENSG00000221754		0.552	NGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR1260A	HGNC	protein_coding	OTTHUMT00000414194.1		0.00	35	0	A	NM_021257		77732623	+1	tier1		no_errors	ENST00000408827	ensembl	human	known	74_37	rna	10.00	36	4	DEL	0.000	-
MIR3687-2	103504728	genome.wustl.edu	37	21	9825882	9825882	+	RNA	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr21:9825882G>A	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						gccgagggccggtcggccgcc	0.841																																																	0																																												0																															21.37:g.9825882G>A				RNA	SNP	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			MIR3648	-	-	ENSG00000264462		0.841	MIR3687-201	KNOWN	basic	miRNA	MIR3648	HGNC	miRNA		-	0.00	63	0	G			9825882	+1	tier1	-	no_errors	ENST00000581792	ensembl	human	known	74_37	rna	10.64	42	5	SNP	0.028	A
MLNR	2862	genome.wustl.edu	37	13	49794627	49794627	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr13:49794627G>T	ENST00000218721.1	+	1	154	c.154G>T	c.(154-156)Ggg>Tgg	p.G52W	MLNR_ENST00000398307.1_Missense_Mutation_p.G52W	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	52					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		GTTCGTCGTCGGGGTGAGCGG	0.697																																																	0													80.0	52.0	61.0					13																	49794627		2202	4297	6499	SO:0001583	missense	0			AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.154G>T	13.37:g.49794627G>T	ENSP00000218721:p.Gly52Trp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GHS-R	p.G52W	ENST00000218721.1	37	c.154	CCDS9414.1	13	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907355	0.72868	.	.	ENSG00000102539	ENST00000218721;ENST00000398307	T;T	0.53857	0.6;0.6	4.67	2.87	0.33458	.	0.000000	0.85682	U	0.000000	T	0.56093	0.1962	L	0.27053	0.805	0.34425	D	0.697851	D	0.89917	1.0	D	0.97110	1.0	T	0.65331	-0.6194	10	0.87932	D	0	-7.2662	8.7793	0.34781	0.0848:0.1518:0.7633:0.0	.	52	O43193	MTLR_HUMAN	W	52	ENSP00000218721:G52W;ENSP00000381352:G52W	ENSP00000218721:G52W	G	+	1	0	MLNR	48692628	1.000000	0.71417	0.674000	0.29902	0.808000	0.45660	6.333000	0.72939	0.362000	0.24319	0.563000	0.77884	GGG	MLNR	-	prints_GPCR_Rhodpsn	ENSG00000102539		0.697	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLNR	HGNC	protein_coding	OTTHUMT00000044897.1		0.00	16	0	G	NM_001507		49794627	+1			no_errors	ENST00000218721	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
MMP16	4325	genome.wustl.edu	37	8	89179938	89179938	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:89179938G>T	ENST00000286614.6	-	4	950	c.669C>A	c.(667-669)gaC>gaA	p.D223E	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	223					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GCTCATCTGAGTCAAAATGGG	0.413																																																	0													95.0	82.0	86.0					8																	89179938		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.669C>A	8.37:g.89179938G>T	ENSP00000286614:p.Asp223Glu		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D223E	ENST00000286614.6	37	c.669	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	G	20.4	3.982427	0.74474	.	.	ENSG00000156103	ENST00000286614	T	0.38240	1.15	5.54	-0.257	0.12979	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.086436	0.85682	D	0.000000	T	0.67720	0.2923	H	0.97131	3.945	0.58432	D	0.999999	D;D	0.63046	0.976;0.992	P;D	0.70935	0.833;0.971	T	0.75513	-0.3291	10	0.87932	D	0	.	11.848	0.52395	0.398:0.0:0.602:0.0	.	223;223	P51512-2;P51512	.;MMP16_HUMAN	E	223	ENSP00000286614:D223E	ENSP00000286614:D223E	D	-	3	2	MMP16	89249054	1.000000	0.71417	0.940000	0.37924	0.996000	0.88848	2.376000	0.44292	-0.008000	0.14320	0.650000	0.86243	GAC	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo	ENSG00000156103		0.413	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2		0.00	56	0	G	NM_005941		89179938	-1			no_errors	ENST00000286614	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
MMP27	64066	genome.wustl.edu	37	11	102562551	102562551	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:102562551G>A	ENST00000260229.4	-	10	1579	c.1488C>T	c.(1486-1488)agC>agT	p.S496S		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	496	Required for retention in the endoplasmic reticulum. {ECO:0000269|PubMed:24548619}.				collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.S496S(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	AAATAAACAAGCTTAAACTCT	0.284																																																	1	Substitution - coding silent(1)	lung(1)											109.0	108.0	108.0					11																	102562551		2202	4295	6497	SO:0001819	synonymous_variant	0			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1488C>T	11.37:g.102562551G>A			Q6UWK6	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.S496	ENST00000260229.4	37	c.1488	CCDS8319.1	11																																																																																			MMP27	-	NULL	ENSG00000137675		0.284	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	-	0.00	59	0	G	NM_022122		102562551	-1	tier1	-	no_errors	ENST00000260229	ensembl	human	known	74_37	silent	32.84	45	22	SNP	0.127	A
MNDA	4332	genome.wustl.edu	37	1	158815481	158815481	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:158815481C>T	ENST00000368141.4	+	5	936	c.675C>T	c.(673-675)taC>taT	p.Y225Y		NM_002432.1	NP_002423.1	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen	225	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				B cell receptor signaling pathway (GO:0050853)|cellular defense response (GO:0006968)|cellular response to DNA damage stimulus (GO:0006974)|negative regulation of B cell proliferation (GO:0030889)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Y225Y(1)		NS(2)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(26)|ovary(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	all_hematologic(112;0.0378)					CATTTAAATACGAGTCCCCAG	0.458																																																	1	Substitution - coding silent(1)	endometrium(1)											87.0	83.0	84.0					1																	158815481		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032319	CCDS1177.1	1q22	2008-02-05			ENSG00000163563	ENSG00000163563			7183	protein-coding gene	gene with protein product		159553				1644857, 7512843	Standard	NM_002432		Approved	PYHIN3	uc001fsz.1	P41218	OTTHUMG00000022776	ENST00000368141.4:c.675C>T	1.37:g.158815481C>T				Silent	SNP	pfam_HIN200/IF120x,pfam_DAPIN,pfscan_DAPIN,pfscan_HIN200/IF120x	p.Y225	ENST00000368141.4	37	c.675	CCDS1177.1	1																																																																																			MNDA	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163563		0.458	MNDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MNDA	HGNC	protein_coding	OTTHUMT00000059069.1		0.00	44	0	C	NM_002432		158815481	+1			no_errors	ENST00000368141	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.017	T
MRPL32	64983	genome.wustl.edu	37	7	42976978	42976978	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:42976978G>T	ENST00000223324.2	+	3	557	c.370G>T	c.(370-372)Gcc>Tcc	p.A124S	MRPL32_ENST00000496564.1_Intron	NM_031903.2	NP_114109.1	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32	124					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)	10						TGTCCTTTGTGCCTACTGCTA	0.418																																																	0													130.0	119.0	123.0					7																	42976978		2203	4300	6503	SO:0001583	missense	0			AB051343	CCDS5468.1	7p14	2012-09-13			ENSG00000106591	ENSG00000106591		"""Mitochondrial ribosomal proteins / large subunits"""	14035	protein-coding gene	gene with protein product		611839				11543634	Standard	NM_031903		Approved	HSPC283, L32mt, MRP-L32, bMRP-59b	uc003tia.3	Q9BYC8	OTTHUMG00000155180	ENST00000223324.2:c.370G>T	7.37:g.42976978G>T	ENSP00000223324:p.Ala124Ser		Q96Q68|Q9P098	Missense_Mutation	SNP	pfam_Ribosomal_L32p,superfamily_Ribosomal_zn-bd	p.A124S	ENST00000223324.2	37	c.370	CCDS5468.1	7	.	.	.	.	.	.	.	.	.	.	G	17.21	3.331155	0.60853	.	.	ENSG00000106591	ENST00000223324	.	.	.	5.9	5.9	0.94986	.	0.133148	0.64402	D	0.000001	T	0.27454	0.0674	N	0.02916	-0.46	0.30509	N	0.769624	B	0.10296	0.003	B	0.06405	0.002	T	0.05178	-1.0901	9	0.16420	T	0.52	-4.3367	20.2789	0.98501	0.0:0.0:1.0:0.0	.	124	Q9BYC8	RM32_HUMAN	S	124	.	ENSP00000223324:A124S	A	+	1	0	MRPL32	42943503	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	9.071000	0.93980	2.788000	0.95919	0.650000	0.86243	GCC	MRPL32	-	pfam_Ribosomal_L32p,superfamily_Ribosomal_zn-bd	ENSG00000106591		0.418	MRPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL32	HGNC	protein_coding	OTTHUMT00000338669.1	-	0.00	46	0	G	NM_031903		42976978	+1	tier1	-	no_errors	ENST00000223324	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
MUC15	143662	genome.wustl.edu	37	11	26587287	26587287	+	Missense_Mutation	SNP	T	T	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:26587287T>G	ENST00000455601.2	-	2	237	c.119A>C	c.(118-120)aAa>aCa	p.K40T	ANO3_ENST00000525139.1_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.K67T|MUC15_ENST00000436318.2_Missense_Mutation_p.K67T|ANO3_ENST00000256737.3_Intron|ANO3_ENST00000531568.1_Intron|MUC15_ENST00000527569.1_Missense_Mutation_p.K67T|MUC15_ENST00000281268.8_Missense_Mutation_p.K67T|ANO3_ENST00000537978.1_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	40					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						TTCCATTGTTTTAAAAACTTC	0.338																																																	0													80.0	77.0	78.0					11																	26587287		2203	4300	6503	SO:0001583	missense	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.119A>C	11.37:g.26587287T>G	ENSP00000397339:p.Lys40Thr		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	NULL	p.K67T	ENST00000455601.2	37	c.200	CCDS7859.1	11	.	.	.	.	.	.	.	.	.	.	T	15.11	2.736422	0.49045	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.37752	1.37;1.33;1.18;1.33;1.18	4.61	2.02	0.26589	.	0.355546	0.24527	N	0.037742	T	0.42988	0.1227	L	0.46157	1.445	0.09310	N	1	D;D;D	0.67145	0.996;0.989;0.996	P;P;P	0.62813	0.907;0.728;0.866	T	0.17837	-1.0356	10	0.25106	T	0.35	-9.5721	8.4161	0.32672	0.0:0.0:0.3907:0.6093	.	67;40;67	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	T	40;67;67;67;67	ENSP00000397339:K40T;ENSP00000416753:K67T;ENSP00000281268:K67T;ENSP00000431983:K67T;ENSP00000431945:K67T	ENSP00000281268:K67T	K	-	2	0	MUC15	26543863	0.003000	0.15002	0.007000	0.13788	0.032000	0.12392	0.778000	0.26732	0.843000	0.35070	0.454000	0.30748	AAA	MUC15	-	NULL	ENSG00000169550		0.338	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	-	0.00	53	0	T	NM_145650		26587287	-1	tier1	-	no_errors	ENST00000436318	ensembl	human	known	74_37	missense	34.85	43	23	SNP	0.002	G
MUC16	94025	genome.wustl.edu	37	19	9066912	9066912	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:9066912G>A	ENST00000397910.4	-	3	20737	c.20534C>T	c.(20533-20535)aCa>aTa	p.T6845I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6847	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTGCCCAATGTGTCTGTGGT	0.473																																																	0													163.0	155.0	158.0					19																	9066912		2058	4207	6265	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.20534C>T	19.37:g.9066912G>A	ENSP00000381008:p.Thr6845Ile		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T6845I	ENST00000397910.4	37	c.20534	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.011	-1.707248	0.00719	.	.	ENSG00000181143	ENST00000397910	T	0.19250	2.16	1.76	-3.52	0.04682	.	.	.	.	.	T	0.06096	0.0158	N	0.01874	-0.695	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.29852	-0.9998	8	0.87932	D	0	.	0.4115	0.00441	0.2107:0.1615:0.2735:0.3543	.	6845	B5ME49	.	I	6845	ENSP00000381008:T6845I	ENSP00000381008:T6845I	T	-	2	0	MUC16	8927912	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.903000	0.00703	-3.430000	0.00165	-2.440000	0.00212	ACA	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	54	0	G	NM_024690		9066912	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	49.09	28	27	SNP	0.000	A
MUC6	4588	genome.wustl.edu	37	11	1025310	1025310	+	Missense_Mutation	SNP	C	C	T	rs527440972		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:1025310C>T	ENST00000421673.2	-	23	2907	c.2857G>A	c.(2857-2859)Gtg>Atg	p.V953M		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	953	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCGAGCTGCACGTGGGGCTCC	0.647													c|||	1	0.000199681	0.0	0.0014	5008	,	,		17847	0.0		0.0	False		,,,				2504	0.0																0													61.0	71.0	68.0					11																	1025310		2105	4221	6326	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.2857G>A	11.37:g.1025310C>T	ENSP00000406861:p.Val953Met		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.V953M	ENST00000421673.2	37	c.2857	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	C	7.452	0.642983	0.14451	.	.	ENSG00000184956	ENST00000421673	T	0.66995	-0.24	4.34	3.4	0.38934	von Willebrand factor, type D domain (3);	0.000000	0.28409	U	0.015452	T	0.78997	0.4372	M	0.86097	2.795	0.09310	N	1	D	0.89917	1.0	D	0.70935	0.971	T	0.67662	-0.5613	10	0.44086	T	0.13	.	6.4614	0.21958	0.0:0.6863:0.1648:0.1489	.	953	Q6W4X9	MUC6_HUMAN	M	953	ENSP00000406861:V953M	ENSP00000406861:V953M	V	-	1	0	MUC6	1015310	0.000000	0.05858	0.004000	0.12327	0.006000	0.05464	0.425000	0.21346	0.939000	0.37446	0.556000	0.70494	GTG	MUC6	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000184956		0.647	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2		0.00	33	0	C	XM_290540		1025310	-1			no_errors	ENST00000421673	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.001	T
MUC5AC	4586	genome.wustl.edu	37	11	1220217	1220217	+	3'UTR	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:1220217C>T	ENST00000358378.6	+	0	2902							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CACACACTGCCCTGTGGTGAG	0.667																																																	0													20.0	21.0	21.0					11																	1220217		868	1982	2850	SO:0001624	3_prime_UTR_variant	0			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*2899C>T	11.37:g.1220217C>T			O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	SNP	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			MUC5AC	-	-	ENSG00000215182		0.667	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2	-	0.00	50	0	C	XM_001130382		1220217	+1	tier1	-	no_errors	ENST00000358378	ensembl	human	putative	74_37	rna	26.67	66	24	SNP	0.955	T
MUM1L1	139221	genome.wustl.edu	37	X	105451396	105451396	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:105451396C>T	ENST00000357175.2	+	4	2620	c.1971C>T	c.(1969-1971)taC>taT	p.Y657Y	MUM1L1_ENST00000337685.2_Silent_p.Y657Y|MUM1L1_ENST00000372552.1_Silent_p.Y657Y	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	657						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GGTTAGATTACGAGGCAGCTG	0.343													c|||	1	0.000264901	0.0008	0.0	3775	,	,		14202	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001819	synonymous_variant	0			AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1971C>T	X.37:g.105451396C>T			D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Silent	SNP	superfamily_PyrdxlP-dep_Trfase	p.Y657	ENST00000357175.2	37	c.1971	CCDS55469.1	X																																																																																			MUM1L1	-	NULL	ENSG00000157502		0.343	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	-	0.00	39	0	C	NM_152423		105451396	+1	tier1	-	no_errors	ENST00000337685	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.278	T
MVD	4597	genome.wustl.edu	37	16	88721685	88721685	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:88721685G>T	ENST00000301012.3	-	7	848	c.819C>A	c.(817-819)ccC>ccA	p.P273P	MVD_ENST00000568709.1_5'Flank	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase	273					cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		GGTAAGAGATGGGCGGGAAGG	0.652																																																	0													256.0	192.0	214.0					16																	88721685		2187	4294	6481	SO:0001819	synonymous_variant	0			U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.819C>A	16.37:g.88721685G>T			Q53Y65	Silent	SNP	pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Mev_diP_decarb,tigrfam_Mev_diP_decarb	p.P273	ENST00000301012.3	37	c.819	CCDS10968.1	16	.	.	.	.	.	.	.	.	.	.	G	5.844	0.339993	0.11069	.	.	ENSG00000167508	ENST00000378400	.	.	.	4.53	-2.07	0.07276	.	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53892	-0.8374	6	0.87932	D	0	-4.5926	3.9348	0.09301	0.1393:0.3501:0.3909:0.1197	.	.	.	.	Q	101	.	ENSP00000367653:P101Q	P	-	2	0	MVD	87249186	0.996000	0.38824	0.958000	0.39756	0.469000	0.32828	0.272000	0.18644	-0.149000	0.11215	0.491000	0.48974	CCA	MVD	-	pirsf_Mev_diP_decarb,tigrfam_Mev_diP_decarb	ENSG00000167508		0.652	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVD	HGNC	protein_coding	OTTHUMT00000269547.2		0.00	50	0	G	NM_002461		88721685	-1			no_errors	ENST00000301012	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.993	T
MYO5A	4644	genome.wustl.edu	37	15	52720618	52720618	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:52720618G>T	ENST00000399231.3	-	3	530	c.287C>A	c.(286-288)tCc>tAc	p.S96Y	MYO5A_ENST00000553916.1_Missense_Mutation_p.S96Y|MYO5A_ENST00000399233.2_Missense_Mutation_p.S96Y|MYO5A_ENST00000356338.6_Missense_Mutation_p.S96Y|MYO5A_ENST00000358212.6_Missense_Mutation_p.S96Y	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	96	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		AATAAGTTTGGAATCAATAAA	0.408																																																	0													130.0	120.0	123.0					15																	52720618		1913	4127	6040	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.287C>A	15.37:g.52720618G>T	ENSP00000382177:p.Ser96Tyr		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S96Y	ENST00000399231.3	37	c.287	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	G	26.0	4.690164	0.88735	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000553916	D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35	5.76	5.76	0.90799	Myosin head, motor domain (2);	0.048525	0.85682	D	0.000000	D	0.92945	0.7755	M	0.69463	2.115	0.80722	D	1	P;D	0.63046	0.562;0.992	B;P	0.59703	0.411;0.862	D	0.91058	0.4883	10	0.33141	T	0.24	.	19.9571	0.97224	0.0:0.0:1.0:0.0	.	96;96	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	Y	96	ENSP00000382177:S96Y;ENSP00000382179:S96Y;ENSP00000348693:S96Y;ENSP00000350945:S96Y;ENSP00000451109:S96Y	ENSP00000348693:S96Y	S	-	2	0	MYO5A	50507910	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	TCC	MYO5A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197535		0.408	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1		0.00	52	0	G	NM_000259		52720618	-1			no_errors	ENST00000358212	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
NDST4	64579	genome.wustl.edu	37	4	115997378	115997378	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:115997378C>T	ENST00000264363.2	-	2	1493	c.815G>A	c.(814-816)gGc>gAc	p.G272D		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	272	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)	p.G272D(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		CAAGTTGTTGCCAAAAAGTAC	0.448																																																	1	Substitution - Missense(1)	skin(1)											186.0	171.0	176.0					4																	115997378		2203	4300	6503	SO:0001583	missense	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.815G>A	4.37:g.115997378C>T	ENSP00000264363:p.Gly272Asp		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.G272D	ENST00000264363.2	37	c.815	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530501	0.85706	.	.	ENSG00000138653	ENST00000264363	T	0.56275	0.47	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.79730	0.4496	M	0.92026	3.265	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	D	0.84050	0.0369	10	0.87932	D	0	.	19.5505	0.95315	0.0:1.0:0.0:0.0	.	272	Q9H3R1	NDST4_HUMAN	D	272	ENSP00000264363:G272D	ENSP00000264363:G272D	G	-	2	0	NDST4	116216827	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.770000	0.85390	2.610000	0.88304	0.591000	0.81541	GGC	NDST4	-	pfam_Heparan_SO4_deacetylase	ENSG00000138653		0.448	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1		0.00	33	0	C	NM_022569		115997378	-1			no_errors	ENST00000264363	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152468716	152468716	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:152468716G>A	ENST00000172853.10	-	74	11207	c.11060C>T	c.(11059-11061)gCc>gTc	p.A3687V	NEB_ENST00000397345.3_Missense_Mutation_p.A3930V|NEB_ENST00000427231.2_Missense_Mutation_p.A3930V|NEB_ENST00000603639.1_Missense_Mutation_p.A3930V|NEB_ENST00000604864.1_Missense_Mutation_p.A3930V|NEB_ENST00000409198.1_Missense_Mutation_p.A3687V			P20929	NEBU_HUMAN	nebulin	3687					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATTGTCAGGGCATTATTCTT	0.463																																																	0													125.0	121.0	123.0					2																	152468716		1953	4164	6117	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11060C>T	2.37:g.152468716G>A	ENSP00000172853:p.Ala3687Val		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.A3930V	ENST00000172853.10	37	c.11789		2	.	.	.	.	.	.	.	.	.	.	G	35	5.565855	0.96540	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.54	5.54	0.83059	.	0.059421	0.64402	D	0.000003	T	0.67411	0.2890	M	0.86573	2.825	0.80722	D	1	P	0.44690	0.841	P	0.51657	0.676	T	0.66352	-0.5945	10	0.30854	T	0.27	.	19.8413	0.96690	0.0:0.0:1.0:0.0	.	3687	P20929	NEBU_HUMAN	V	3687;3930;3930;3687	ENSP00000386259:A3687V;ENSP00000380505:A3930V;ENSP00000416578:A3930V;ENSP00000172853:A3687V	ENSP00000172853:A3687V	A	-	2	0	NEB	152176962	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.903000	0.87398	2.779000	0.95612	0.655000	0.94253	GCC	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.463	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding			0.00	79	0	G	NM_004543		152468716	-1			no_errors	ENST00000397345	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	A
NETO2	81831	genome.wustl.edu	37	16	47162452	47162452	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:47162452C>A	ENST00000562435.1	-	4	649	c.265G>T	c.(265-267)Gat>Tat	p.D89Y	NETO2_ENST00000303155.5_Missense_Mutation_p.D89Y	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	89	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				TAATGTTCATCAAAGGTCAAC	0.358										HNSCC(25;0.065)																																							0													153.0	160.0	157.0					16																	47162452		2202	4300	6502	SO:0001583	missense	0			AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.265G>T	16.37:g.47162452C>A	ENSP00000455169:p.Asp89Tyr		J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.D89Y	ENST00000562435.1	37	c.265	CCDS10727.1	16	.	.	.	.	.	.	.	.	.	.	C	27.2	4.808461	0.90707	.	.	ENSG00000171208	ENST00000303155	T	0.18810	2.19	5.92	5.92	0.95590	CUB (5);	0.000000	0.85682	D	0.000000	T	0.54886	0.1886	M	0.85041	2.73	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.58434	-0.7637	10	0.87932	D	0	.	20.3206	0.98668	0.0:1.0:0.0:0.0	.	89;89	Q32NC3;Q8NC67	.;NETO2_HUMAN	Y	89	ENSP00000306726:D89Y	ENSP00000306726:D89Y	D	-	1	0	NETO2	45719953	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	3.879000	0.56138	2.809000	0.96659	0.655000	0.94253	GAT	NETO2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000171208		0.358	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NETO2	HGNC	protein_coding	OTTHUMT00000256766.2		0.00	15	0	C	NM_018092		47162452	-1			no_errors	ENST00000562435	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	A
NFE2L1	4779	genome.wustl.edu	37	17	46133885	46133885	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:46133885G>T	ENST00000362042.3	+	3	1264	c.648G>T	c.(646-648)tgG>tgT	p.W216C	NFE2L1_ENST00000357480.5_Missense_Mutation_p.W216C|NFE2L1_ENST00000361665.3_Missense_Mutation_p.W205C|NFE2L1_ENST00000585291.1_Missense_Mutation_p.W216C|NFE2L1_ENST00000582155.1_Missense_Mutation_p.W58C|NFE2L1_ENST00000583378.1_Missense_Mutation_p.W47C|NFE2L1_ENST00000536222.1_Missense_Mutation_p.W90C	NM_003204.2	NP_003195.1	Q14494	NF2L1_HUMAN	nuclear factor, erythroid 2-like 1	216	Asp/Glu-rich (acidic).				anatomical structure morphogenesis (GO:0009653)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|inflammatory response (GO:0006954)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			cervix(1)|endometrium(3)|kidney(9)|large_intestine(7)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGGACACCTGGGCAGGCGAGG	0.622																																																	0													143.0	145.0	144.0					17																	46133885		2203	4300	6503	SO:0001583	missense	0			AK090459	CCDS11524.1	17q21.3	2013-08-23	2013-08-23			ENSG00000082641		"""basic leucine zipper proteins"""	7781	protein-coding gene	gene with protein product		163260	"""nuclear factor (erythroid-derived 2)-like 1"""	TCF11		8248256, 9501099	Standard	NM_003204		Approved	NRF1, LCR-F1, FLJ00380	uc002imz.4	Q14494		ENST00000362042.3:c.648G>T	17.37:g.46133885G>T	ENSP00000354855:p.Trp216Cys		D3DTU3|D3DTU5|Q12877|Q96FN6	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.W216C	ENST00000362042.3	37	c.648	CCDS11524.1	17	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401373	0.83120	.	.	ENSG00000082641	ENST00000362042;ENST00000361665;ENST00000357480;ENST00000536222	T;T	0.19669	2.38;2.13	5.41	5.41	0.78517	.	0.081152	0.53938	D	0.000043	T	0.43765	0.1262	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.999;0.997;0.935;0.992	T	0.10109	-1.0644	10	0.33940	T	0.23	-9.398	16.0974	0.81135	0.0:0.0:1.0:0.0	.	90;58;216;216	F5H1B7;B4DYE1;Q14494-2;Q14494	.;.;.;NF2L1_HUMAN	C	235;216;216;90	ENSP00000350072:W216C;ENSP00000445811:W90C	ENSP00000350072:W216C	W	+	3	0	NFE2L1	43488884	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	4.890000	0.63178	2.544000	0.85801	0.591000	0.81541	TGG	NFE2L1	-	NULL	ENSG00000082641		0.622	NFE2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L1	HGNC	protein_coding	OTTHUMT00000443019.1	-	0.00	34	0	G	NM_003204		46133885	+1	tier1	-	no_errors	ENST00000362042	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
NPVF	64111	genome.wustl.edu	37	7	25266259	25266259	+	Missense_Mutation	SNP	A	A	T	rs113088992		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:25266259A>T	ENST00000222674.2	-	2	571	c.525T>A	c.(523-525)gaT>gaA	p.D175E		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	175					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						ACTGTTTTTGATCGGGATTCT	0.408																																																	0													211.0	193.0	199.0					7																	25266259		2203	4300	6503	SO:0001583	missense	0			AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.525T>A	7.37:g.25266259A>T	ENSP00000222674:p.Asp175Glu		A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	NULL	p.D175E	ENST00000222674.2	37	c.525	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	A	4.057	0.008348	0.07912	.	.	ENSG00000105954	ENST00000222674	T	0.24908	1.83	5.67	-9.84	0.00479	.	0.891317	0.09753	N	0.760325	T	0.13243	0.0321	L	0.45581	1.43	0.09310	N	1	B	0.20671	0.047	B	0.20955	0.032	T	0.21008	-1.0258	10	0.17832	T	0.49	-22.4511	3.3052	0.06997	0.2646:0.1046:0.4255:0.2052	.	175	Q9HCQ7	RFRP_HUMAN	E	175	ENSP00000222674:D175E	ENSP00000222674:D175E	D	-	3	2	NPVF	25232784	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.588000	0.05774	-1.540000	0.01730	-1.151000	0.01829	GAT	NPVF	-	NULL	ENSG00000105954		0.408	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	HGNC	protein_coding	OTTHUMT00000250315.1	-	0.00	53	0	A	NM_022150		25266259	-1	tier1	-	no_errors	ENST00000222674	ensembl	human	known	74_37	missense	44.54	66	53	SNP	0.000	T
NUTM1	256646	genome.wustl.edu	37	15	34646055	34646055	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:34646055G>T	ENST00000333756.4	+	4	1128	c.973G>T	c.(973-975)Gag>Tag	p.E325*	NUTM1_ENST00000438749.3_Nonsense_Mutation_p.E343*|NUTM1_ENST00000537011.1_Nonsense_Mutation_p.E353*	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	325						cytoplasm (GO:0005737)|nucleus (GO:0005634)											CCTGGCCTCTGAGGTTTGCCA	0.537																																																	0													84.0	82.0	83.0					15																	34646055		2201	4298	6499	SO:0001587	stop_gained	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.973G>T	15.37:g.34646055G>T	ENSP00000329448:p.Glu325*		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Nonsense_Mutation	SNP	NULL	p.E325*	ENST00000333756.4	37	c.973	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	41	8.875845	0.98986	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	.	.	.	5.49	5.49	0.81192	.	0.249580	0.28414	N	0.015430	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	14.8705	0.70453	0.0:0.0:1.0:0.0	.	.	.	.	X	353;343;325	.	ENSP00000329448:E325X	E	+	1	0	C15orf55	32433347	1.000000	0.71417	0.998000	0.56505	0.877000	0.50540	4.888000	0.63164	2.571000	0.86741	0.557000	0.71058	GAG	NUTM1	-	NULL	ENSG00000184507		0.537	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1		0.00	43	0	G	NM_175741		34646055	+1			no_errors	ENST00000333756	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
NUTM1	256646	genome.wustl.edu	37	15	34649094	34649094	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:34649094G>A	ENST00000333756.4	+	7	2956	c.2801G>A	c.(2800-2802)gGc>gAc	p.G934D	NUTM1_ENST00000438749.3_Missense_Mutation_p.G952D|NUTM1_ENST00000537011.1_Missense_Mutation_p.G962D	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	934						cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAAGGAGAAGGCAGGGTGGAT	0.483																																																	0													74.0	66.0	69.0					15																	34649094		2201	4298	6499	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2801G>A	15.37:g.34649094G>A	ENSP00000329448:p.Gly934Asp		B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.G934D	ENST00000333756.4	37	c.2801	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	15.30	2.791922	0.50102	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.14144	2.54;2.75;2.53	5.09	2.21	0.28008	.	0.519863	0.19332	N	0.116871	T	0.22975	0.0555	M	0.71036	2.16	0.09310	N	1	B;B;B	0.32693	0.262;0.38;0.044	B;P;B	0.47015	0.333;0.534;0.029	T	0.23476	-1.0187	10	0.62326	D	0.03	.	4.4899	0.11808	0.1829:0.0:0.6409:0.1762	.	952;962;934	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	D	962;952;934	ENSP00000444896:G962D;ENSP00000407031:G952D;ENSP00000329448:G934D	ENSP00000329448:G934D	G	+	2	0	C15orf55	32436386	0.912000	0.30974	0.011000	0.14972	0.008000	0.06430	0.794000	0.26958	0.325000	0.23359	0.655000	0.94253	GGC	NUTM1	-	NULL	ENSG00000184507		0.483	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	HGNC	protein_coding	OTTHUMT00000418026.1	-	0.00	20	0	G	NM_175741		34649094	+1	tier1	-	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.026	A
OR14A2	388761	genome.wustl.edu	37	1	247886507	247886507	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:247886507G>C	ENST00000366485.1	-	1	838	c.839C>G	c.(838-840)cCt>cGt	p.P280R	RP11-634B7.5_ENST00000426444.1_RNA|RP11-634B7.4_ENST00000449298.1_RNA			Q96R54	O14A2_HUMAN	olfactory receptor, family 14, subfamily A, member 2	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AAATACTGGAGGCATCACAGT	0.403																																																	0																																										SO:0001583	missense	0			AB065620		1q44	2013-01-16	2008-04-02	2008-04-02	ENSG00000241128	ENSG00000241128		"""GPCR / Class A : Olfactory receptors"""	15024	other	unknown			"""olfactory receptor, family 5, subfamily AX, member 1 pseudogene"", ""olfactory receptor, family 5, subfamily AX, member 1"""	OR5AX1P, OR5AX1			Standard	NG_002409		Approved			Q96R54	OTTHUMG00000040207	ENST00000366485.1:c.839C>G	1.37:g.247886507G>C	ENSP00000355441:p.Pro280Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P280R	ENST00000366485.1	37	c.839		1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.183515	0.38609	.	.	ENSG00000241128	ENST00000366485	T	0.37915	1.17	3.0	3.0	0.34707	.	0.153676	0.30028	U	0.010590	T	0.37265	0.0997	.	.	.	0.24556	N	0.993997	.	.	.	.	.	.	T	0.23691	-1.0181	7	0.72032	D	0.01	.	7.3452	0.26660	0.1285:0.0:0.8715:0.0	.	.	.	.	R	280	ENSP00000355441:P280R	ENSP00000355441:P280R	P	-	2	0	OR14A2	245953130	0.000000	0.05858	0.013000	0.15412	0.076000	0.17211	0.261000	0.18442	1.666000	0.50821	0.650000	0.86243	CCT	OR14A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000241128		0.403	OR14A2-001	KNOWN	basic|appris_principal	protein_coding	OR14A2	HGNC	protein_coding	OTTHUMT00000096864.1	-	0.00	43	0	G	NG_002409		247886507	-1	tier1	-	no_errors	ENST00000366485	ensembl	human	known	74_37	missense	18.87	43	10	SNP	0.839	C
OR8B3	390271	genome.wustl.edu	37	11	124266927	124266927	+	Silent	SNP	A	A	G	rs142812088		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:124266927A>G	ENST00000354597.3	-	1	337	c.321T>C	c.(319-321)ttT>ttC	p.F107F		NM_001005467.1	NP_001005467.1	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B, member 3	107						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CAGAGATGACAAAAAAGAGAA	0.388																																																	0													78.0	76.0	77.0					11																	124266927		2201	4299	6500	SO:0001819	synonymous_variant	0			AB065827	CCDS31709.1	11q24.1	2012-08-09			ENSG00000196661	ENSG00000196661		"""GPCR / Class A : Olfactory receptors"""	8472	protein-coding gene	gene with protein product							Standard	NM_001005467		Approved		uc010saj.2	Q8NGG8	OTTHUMG00000165983	ENST00000354597.3:c.321T>C	11.37:g.124266927A>G			Q6IFQ8|Q8NGH1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F107	ENST00000354597.3	37	c.321	CCDS31709.1	11																																																																																			OR8B3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196661		0.388	OR8B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B3	HGNC	protein_coding	OTTHUMT00000387291.1		0.00	26	0	A	NM_001005467		124266927	-1			no_errors	ENST00000354597	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.691	G
ORAI1	84876	genome.wustl.edu	37	12	122079313	122079313	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:122079313G>T	ENST00000330079.7	+	2	869	c.676G>T	c.(676-678)Gtc>Ttc	p.V226F		NM_032790.3	NP_116179	Q96D31	CRCM1_HUMAN	ORAI calcium release-activated calcium modulator 1	224					blood coagulation (GO:0007596)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|regulation of calcium ion transport (GO:0051924)|store-operated calcium entry (GO:0002115)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|store-operated calcium channel activity (GO:0015279)	p.V226I(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	11	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000415)|Epithelial(86;0.00148)		AGCAGCCAACGTCAGCACCAG	0.652																																																	1	Substitution - Missense(1)	large_intestine(1)											41.0	54.0	50.0					12																	122079313		2193	4291	6484	SO:0001583	missense	0			AK027372		12q24.31	2014-09-17	2007-08-14	2007-08-14	ENSG00000182500	ENSG00000276045		"""ORAI calcium release-activated calcium modulators"""	25896	protein-coding gene	gene with protein product	"""calcium release-activated calcium modulator 1"""	610277	"""transmembrane protein 142A"""	TMEM142A		16582901	Standard	NM_032790		Approved	FLJ14466, CRACM1	uc021rff.1	Q96D31		ENST00000330079.7:c.676G>T	12.37:g.122079313G>T	ENSP00000328216:p.Val226Phe		Q3MHV3|Q6DHX2|Q96BP7|Q96K71	Missense_Mutation	SNP	pfam_CRAC_channel	p.V226F	ENST00000330079.7	37	c.676	CCDS41851.1	12	.	.	.	.	.	.	.	.	.	.	G	0.581	-0.837115	0.02692	.	.	ENSG00000182500	ENST00000330079;ENST00000537188	T;T	0.44083	1.52;0.93	5.19	3.02	0.34903	.	1.325880	0.05029	N	0.474295	T	0.28764	0.0713	N	0.14661	0.345	0.09310	N	1	B	0.22146	0.065	B	0.32465	0.146	T	0.34750	-0.9816	10	0.38643	T	0.18	0.1102	2.3406	0.04259	0.2031:0.0:0.501:0.2958	.	224	Q96D31	CRCM1_HUMAN	F	226;121	ENSP00000328216:V226F;ENSP00000441198:V121F	ENSP00000328216:V226F	V	+	1	0	ORAI1	120563696	0.000000	0.05858	0.001000	0.08648	0.018000	0.09664	0.086000	0.14935	1.134000	0.42165	0.591000	0.81541	GTC	ORAI1	-	pfam_CRAC_channel	ENSG00000182500		0.652	ORAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORAI1	HGNC	protein_coding	OTTHUMT00000402151.1	-	0.00	59	0	G	NM_032790		122079313	+1	tier1	-	no_errors	ENST00000330079	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.001	T
OTOF	9381	genome.wustl.edu	37	2	26695388	26695388	+	Splice_Site	SNP	G	G	T	rs200476647	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:26695388G>T	ENST00000272371.2	-	30	3989	c.3863C>A	c.(3862-3864)gCg>gAg	p.A1288E	OTOF_ENST00000338581.6_Splice_Site_p.A521E|OTOF_ENST00000339598.3_Splice_Site_p.A521E|OTOF_ENST00000402415.3_Splice_Site_p.A598E|OTOF_ENST00000403946.3_Splice_Site_p.A1288E	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1288					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGCCTTACCGCGTCCAGCTT	0.577																																					GBM(102;732 1451 20652 24062 31372)												0													104.0	84.0	90.0					2																	26695388		2203	4300	6503	SO:0001630	splice_region_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3864+1C>A	2.37:g.26695388G>T			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.A1288E	ENST00000272371.2	37	c.3863	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.794759	0.90453	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	T;T;T;T;T	0.80653	-1.07;-1.07;-1.14;-1.4;-1.4	4.93	4.93	0.64822	.	0.103097	0.64402	D	0.000003	T	0.75895	0.3912	M	0.62723	1.935	0.80722	D	1	B;B;B;B	0.32203	0.36;0.102;0.007;0.003	B;B;B;B	0.30179	0.112;0.056;0.007;0.006	T	0.73046	-0.4106	10	0.08837	T	0.75	-34.6374	16.7288	0.85430	0.0:0.0:1.0:0.0	.	1288;521;598;521	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	E	521;521;598;1288;1288	ENSP00000345137:A521E;ENSP00000344521:A521E;ENSP00000383906:A598E;ENSP00000272371:A1288E;ENSP00000385255:A1288E	ENSP00000272371:A1288E	A	-	2	0	OTOF	26548892	1.000000	0.71417	0.998000	0.56505	0.901000	0.52897	8.748000	0.91615	2.295000	0.77249	0.561000	0.74099	GCG	OTOF	-	NULL	ENSG00000115155		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	-	0.00	38	0	G		Missense_Mutation	26695388	-1	tier1	-	no_errors	ENST00000272371	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	T
OXER1	165140	genome.wustl.edu	37	2	42991002	42991002	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:42991002G>A	ENST00000378661.2	-	1	399	c.318C>T	c.(316-318)ggC>ggT	p.G106G		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	106					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						TCCCCACCAGGCCCAGGACAA	0.647																																																	0													42.0	46.0	45.0					2																	42991002		2203	4300	6503	SO:0001819	synonymous_variant	0			AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.318C>T	2.37:g.42991002G>A			Q86WP7|Q8NGW4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G106	ENST00000378661.2	37	c.318	CCDS1810.1	2																																																																																			OXER1	-	prints_GPCR_Rhodpsn	ENSG00000162881		0.647	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXER1	HGNC	protein_coding	OTTHUMT00000250514.1	-	0.00	32	0	G	NM_148962		42991002	-1	tier1	-	no_errors	ENST00000378661	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.885	A
P2RY14	9934	genome.wustl.edu	37	3	150931563	150931563	+	Missense_Mutation	SNP	C	C	T	rs368040389		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:150931563C>T	ENST00000309170.3	-	3	854	c.542G>A	c.(541-543)cGg>cAg	p.R181Q	MED12L_ENST00000273432.4_Intron|P2RY14_ENST00000424796.2_Missense_Mutation_p.R181Q|MED12L_ENST00000474524.1_Intron	NM_001081455.1|NM_014879.3	NP_001074924.1|NP_055694.3	Q15391	P2Y14_HUMAN	purinergic receptor P2Y, G-protein coupled, 14	181					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|UDP-activated nucleotide receptor activity (GO:0045029)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)	20			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTGCCACTTCCGTCCCAGTTC	0.383																																																	0								C	GLN/ARG,GLN/ARG,	0,4406		0,0,2203	178.0	163.0	168.0		542,542,	-2.1	0.0	3		168	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,intron	P2RY14,MED12L	NM_001081455.1,NM_014879.3,NM_053002.4	43,43,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,	181/339,181/339,	150931563	1,13005	2203	4300	6503	SO:0001583	missense	0			D13626	CCDS3156.1	3q21-q25	2012-08-08	2004-07-12	2004-07-14	ENSG00000174944	ENSG00000174944		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	16442	protein-coding gene	gene with protein product		610116	"""G protein-coupled receptor 105"""	GPR105			Standard	NM_014879		Approved	KIAA0001	uc003eys.1	Q15391	OTTHUMG00000159859	ENST00000309170.3:c.542G>A	3.37:g.150931563C>T	ENSP00000308361:p.Arg181Gln		Q8IYT7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_P2Y14_rcpt,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.R181Q	ENST00000309170.3	37	c.542	CCDS3156.1	3	.	.	.	.	.	.	.	.	.	.	C	8.175	0.792528	0.16258	0.0	1.16E-4	ENSG00000174944	ENST00000309170;ENST00000424796	T;T	0.37411	1.2;1.2	5.9	-2.09	0.07232	GPCR, rhodopsin-like superfamily (1);	1.478160	0.04719	N	0.418988	T	0.18299	0.0439	N	0.12182	0.205	0.09310	N	1	B	0.15930	0.015	B	0.15052	0.012	T	0.19484	-1.0304	10	0.13470	T	0.59	-2.3534	6.2968	0.21091	0.3502:0.297:0.0:0.3528	.	181	Q15391	P2Y14_HUMAN	Q	181	ENSP00000308361:R181Q;ENSP00000408733:R181Q	ENSP00000308361:R181Q	R	-	2	0	P2RY14	152414253	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.088000	0.01359	-0.306000	0.08818	-0.145000	0.13849	CGG	P2RY14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000174944		0.383	P2RY14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY14	HGNC	protein_coding	OTTHUMT00000357789.1	-	0.00	27	0	C	NM_014879		150931563	-1	tier1	-	no_errors	ENST00000309170	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.000	T
PABPC5	140886	genome.wustl.edu	37	X	90691327	90691327	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:90691327G>A	ENST00000312600.3	+	2	965	c.751G>A	c.(751-753)Gct>Act	p.A251T	PABPC5-AS1_ENST00000456187.1_RNA|PABPC5_ENST00000373105.1_Missense_Mutation_p.A87T	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	251	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						GACACACGAGGCTGCCCAAAA	0.448																																																	0													75.0	74.0	75.0					X																	90691327		2203	4300	6503	SO:0001583	missense	0			AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.751G>A	X.37:g.90691327G>A	ENSP00000308012:p.Ala251Thr		A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.A251T	ENST00000312600.3	37	c.751	CCDS14460.1	X	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873191	0.51695	.	.	ENSG00000174740	ENST00000373105;ENST00000312600;ENST00000402906	T;T	0.16897	2.31;2.31	4.39	4.39	0.52855	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.052999	0.64402	D	0.000001	T	0.36054	0.0953	L	0.55990	1.75	0.46279	D	0.998967	D	0.89917	1.0	D	0.91635	0.999	T	0.05402	-1.0887	10	0.59425	D	0.04	.	13.8602	0.63554	0.0:0.0:1.0:0.0	.	251	Q96DU9	PABP5_HUMAN	T	87;251;219	ENSP00000362197:A87T;ENSP00000308012:A251T	ENSP00000308012:A251T	A	+	1	0	PABPC5	90577983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.240000	0.95396	2.442000	0.82660	0.529000	0.55759	GCT	PABPC5	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000174740		0.448	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC5	HGNC	protein_coding	OTTHUMT00000057429.1	-	0.00	31	0	G	NM_080832		90691327	+1	tier1	-	no_errors	ENST00000312600	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	A
PADI6	353238	genome.wustl.edu	37	1	17707573	17707573	+	RNA	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:17707573G>A	ENST00000434762.2	+	0	517							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGCGGTTGGGGTGCCATCCTG	0.493																																																	0													68.0	71.0	70.0					1																	17707573		1931	4130	6061			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17707573G>A			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.493	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	-	0.00	57	0	G	NM_207421		17707573	+1	tier1	-	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	32.14	38	18	SNP	0.988	A
PAXIP1	22976	genome.wustl.edu	37	7	154782739	154782740	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:154782739_154782740insA	ENST00000404141.1	-	4	454_455	c.300_301insT	c.(298-303)tttggafs	p.G101fs	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Frame_Shift_Ins_p.G101fs			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	101	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with PAGR1. {ECO:0000250}.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCAGTGATTCCAAAAAAAATCT	0.332																																																	0																																										SO:0001589	frameshift_variant	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.301dupT	7.37:g.154782747_154782747dupA	ENSP00000384048:p.Gly101fs		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Frame_Shift_Ins	INS	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.G100fs	ENST00000404141.1	37	c.301_300	CCDS47753.1	7																																																																																			PAXIP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000157212		0.332	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	37	0	-	NM_007349		154782740	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	frame_shift_ins	6.98	40	3	INS	1.000:1.000	A
PBRM1	55193	genome.wustl.edu	37	3	52668638	52668638	+	Silent	SNP	G	G	T	rs17052357	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:52668638G>T	ENST00000296302.7	-	11	1282	c.1281C>A	c.(1279-1281)ccC>ccA	p.P427P	PBRM1_ENST00000409767.1_Silent_p.P427P|PBRM1_ENST00000410007.1_Silent_p.P427P|PBRM1_ENST00000356770.4_Silent_p.P395P|PBRM1_ENST00000394830.3_Silent_p.P427P|PBRM1_ENST00000409114.3_Silent_p.P427P|PBRM1_ENST00000337303.4_Silent_p.P427P|PBRM1_ENST00000409057.1_Silent_p.P427P			Q86U86	PB1_HUMAN	polybromo 1	427	Bromo 3. {ECO:0000255|PROSITE- ProRule:PRU00035}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		GTAGTGATATGGGCATTTTAA	0.353			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																			Rec	yes		3	3p21	55193	polybromo 1		E	0													162.0	182.0	175.0					3																	52668638		2203	4300	6503	SO:0001819	synonymous_variant	0			BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.1281C>A	3.37:g.52668638G>T			A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Silent	SNP	pfam_Bromodomain,pfam_BAH_dom,pfam_HMG_box_dom,superfamily_Bromodomain,superfamily_HMG_box_dom,smart_Bromodomain,smart_BAH_dom,smart_HMG_box_dom,pfscan_BAH_dom,pfscan_HMG_box_dom,pfscan_Bromodomain,prints_Bromodomain	p.P427	ENST00000296302.7	37	c.1281		3																																																																																			PBRM1	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000163939		0.353	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	PBRM1	HGNC	protein_coding	OTTHUMT00000327232.1		0.00	38	0	G	NM_018165		52668638	-1			no_errors	ENST00000296302	ensembl	human	known	74_37	silent	6.67	42	3	SNP	1.000	T
PCDHA4	56144	genome.wustl.edu	37	5	140188667	140188667	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:140188667G>A	ENST00000530339.1	+	1	1895	c.1895G>A	c.(1894-1896)aGc>aAc	p.S632N	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.S632N|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.S632N	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	632	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCGAGATCAGCACAACGCGT	0.687																																																	0													101.0	99.0	99.0					5																	140188667		2203	4300	6503	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1895G>A	5.37:g.140188667G>A	ENSP00000435300:p.Ser632Asn		O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S632N	ENST00000530339.1	37	c.1895	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	15.00	2.702139	0.48307	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.55234	0.53;0.53;0.53	4.08	4.08	0.47627	Cadherin (4);Cadherin-like (1);	0.134573	0.33534	U	0.004816	T	0.79673	0.4486	H	0.95470	3.675	0.24107	N	0.995857	D;P;D	0.55800	0.973;0.949;0.971	P;P;D	0.66979	0.839;0.827;0.948	T	0.75728	-0.3216	10	0.52906	T	0.07	.	16.6588	0.85236	0.0:0.0:1.0:0.0	.	632;632;632	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	N	632	ENSP00000423470:S632N;ENSP00000349344:S632N;ENSP00000435300:S632N	ENSP00000349344:S632N	S	+	2	0	PCDHA4	140168851	0.997000	0.39634	1.000000	0.80357	0.048000	0.14542	5.130000	0.64745	2.006000	0.58801	0.484000	0.47621	AGC	PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.687	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	-	0.00	87	0	G	NM_018907		140188667	+1	tier1	-	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	36.70	69	40	SNP	1.000	A
PCDHB2	56133	genome.wustl.edu	37	5	140475366	140475366	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:140475366G>T	ENST00000194155.4	+	1	1140	c.992G>T	c.(991-993)gGa>gTa	p.G331V		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	331	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCTATCTGGAACTTGTGTG	0.433																																																	0													98.0	98.0	98.0					5																	140475366		2203	4300	6503	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.992G>T	5.37:g.140475366G>T	ENSP00000194155:p.Gly331Val		Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G331V	ENST00000194155.4	37	c.992	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	G	14.26	2.482448	0.44147	.	.	ENSG00000112852	ENST00000194155	T	0.55413	0.52	5.38	3.42	0.39159	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.69744	0.3145	M	0.69823	2.125	0.44694	D	0.997687	D	0.69078	0.997	D	0.68483	0.958	T	0.74899	-0.3507	9	0.59425	D	0.04	.	15.7582	0.78054	0.0:0.4286:0.5714:0.0	.	331	Q9Y5E7	PCDB2_HUMAN	V	331	ENSP00000194155:G331V	ENSP00000194155:G331V	G	+	2	0	PCDHB2	140455550	0.000000	0.05858	1.000000	0.80357	0.984000	0.73092	0.821000	0.27338	1.364000	0.46038	0.650000	0.86243	GGA	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000112852		0.433	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2		0.00	38	0	G	NM_018936		140475366	+1			no_errors	ENST00000194155	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.447	T
PCLO	27445	genome.wustl.edu	37	7	82583743	82583743	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:82583743C>T	ENST00000333891.9	-	5	6863	c.6526G>A	c.(6526-6528)Gtc>Atc	p.V2176I	PCLO_ENST00000423517.2_Missense_Mutation_p.V2176I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAGGGTGGGACAGATGTAGCA	0.438																																																	0													127.0	127.0	127.0					7																	82583743		1983	4163	6146	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6526G>A	7.37:g.82583743C>T	ENSP00000334319:p.Val2176Ile			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.V2176I	ENST00000333891.9	37	c.6526	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	9.329	1.060024	0.19987	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16743	2.32;2.33	5.66	4.76	0.60689	.	.	.	.	.	T	0.10508	0.0257	N	0.16478	0.41	0.80722	D	1	B;B	0.15473	0.013;0.013	B;B	0.12156	0.007;0.007	T	0.08638	-1.0712	9	0.87932	D	0	.	6.6069	0.22729	0.1339:0.6666:0.1294:0.0701	.	2176;2176	Q9Y6V0-5;Q9Y6V0-6	.;.	I	2107;2176;2176	ENSP00000334319:V2176I;ENSP00000388393:V2176I	ENSP00000334319:V2176I	V	-	1	0	PCLO	82421679	0.998000	0.40836	0.995000	0.50966	0.994000	0.84299	1.410000	0.34691	1.353000	0.45828	0.650000	0.86243	GTC	PCLO	-	NULL	ENSG00000186472		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	34	0	C	NM_014510		82583743	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	31.91	30	15	SNP	0.972	T
PCMTD1	115294	genome.wustl.edu	37	8	52733245	52733245	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:52733245G>T	ENST00000360540.5	-	7	1146	c.740C>A	c.(739-741)gCt>gAt	p.A247D	PCMTD1_ENST00000522514.1_Missense_Mutation_p.A247D|PCMTD1_ENST00000544451.1_Missense_Mutation_p.A171D|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	247						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				GTAAATACGAGCCAAGTCCTG	0.363																																																	0													50.0	51.0	50.0					8																	52733245		2201	4298	6499	SO:0001583	missense	0				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.740C>A	8.37:g.52733245G>T	ENSP00000353739:p.Ala247Asp		Q96FK9	Missense_Mutation	SNP	pfam_PCMT	p.A247D	ENST00000360540.5	37	c.740	CCDS6148.1	8	.	.	.	.	.	.	.	.	.	.	G	28.0	4.878246	0.91664	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.47177	0.85;0.85;0.85	5.77	5.77	0.91146	.	0.055607	0.64402	D	0.000001	T	0.64238	0.2580	L	0.52573	1.65	0.80722	D	1	D;D;P	0.71674	0.961;0.998;0.849	P;D;B	0.64237	0.541;0.923;0.382	T	0.64499	-0.6393	10	0.72032	D	0.01	-15.9573	19.9832	0.97338	0.0:0.0:1.0:0.0	.	117;171;247	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	D	247;171;247	ENSP00000353739:A247D;ENSP00000444026:A171D;ENSP00000428099:A247D	ENSP00000353739:A247D	A	-	2	0	PCMTD1	52895798	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.903000	0.92573	2.722000	0.93159	0.655000	0.94253	GCT	PCMTD1	-	NULL	ENSG00000168300		0.363	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	HGNC	protein_coding	OTTHUMT00000377909.2		0.00	53	0	G	NM_052937		52733245	-1			no_errors	ENST00000360540	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
PCP4L1	654790	genome.wustl.edu	37	1	161254251	161254251	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:161254251delA	ENST00000504449.1	+	3	435	c.187delA	c.(187-189)aaafs	p.K64fs		NM_001102566.1	NP_001096036.1	A6NKN8	PC4L1_HUMAN	Purkinje cell protein 4 like 1	64	IQ.									endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4	all_cancers(52;4.16e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			TCAGAAAAGGAAAAAGGATCC	0.527																																																	0													58.0	60.0	59.0					1																	161254251		1933	4139	6072	SO:0001589	frameshift_variant	0			BC028905	CCDS53412.1	1q23.3	2006-02-27	2006-02-27		ENSG00000248485	ENSG00000248485			20448	protein-coding gene	gene with protein product			"""purkinje cell protein 4 like 1"""				Standard	NM_001102566		Approved	IQM1	uc001gad.3	A6NKN8	OTTHUMG00000034340	ENST00000504449.1:c.187delA	1.37:g.161254251delA	ENSP00000426296:p.Lys64fs		B2RV24|B9EJG4	Frame_Shift_Del	DEL	NULL	p.K64fs	ENST00000504449.1	37	c.187	CCDS53412.1	1																																																																																			PCP4L1	-	NULL	ENSG00000248485		0.527	PCP4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCP4L1	HGNC	protein_coding	OTTHUMT00000082986.2		0.00	22	0	A			161254251	+1	tier1		no_errors	ENST00000504449	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	1.000	-
PDE3A	5139	genome.wustl.edu	37	12	20801778	20801778	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:20801778A>G	ENST00000359062.3	+	13	2762	c.2722A>G	c.(2722-2724)Act>Gct	p.T908A	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	908	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	AATTTTGGCCACTGACCTGAA	0.353																																																	0													107.0	101.0	103.0					12																	20801778		2203	4300	6503	SO:0001583	missense	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2722A>G	12.37:g.20801778A>G	ENSP00000351957:p.Thr908Ala		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.T908A	ENST00000359062.3	37	c.2722	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	A	24.3	4.514568	0.85389	.	.	ENSG00000172572	ENST00000359062	D	0.93076	-3.16	5.33	5.33	0.75918	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.098581	0.64402	D	0.000001	D	0.98280	0.9430	H	0.99074	4.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.99785	1.1029	10	0.87932	D	0	.	15.5913	0.76530	1.0:0.0:0.0:0.0	.	908	Q14432	PDE3A_HUMAN	A	908	ENSP00000351957:T908A	ENSP00000351957:T908A	T	+	1	0	PDE3A	20693045	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.779000	0.91792	2.144000	0.66660	0.455000	0.32223	ACT	PDE3A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000172572		0.353	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	68	0	A			20801778	+1	tier1	-	no_errors	ENST00000359062	ensembl	human	known	74_37	missense	30.23	60	26	SNP	1.000	G
PDXDC2P	283970	genome.wustl.edu	37	16	70072984	70072984	+	RNA	DEL	T	T	-	rs569222625|rs185032058		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:70072984delT	ENST00000531894.1	-	0	333					NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										TTGCTTCAAGTTTTTTTTTTT	0.378																																																	0																																												0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70072984delT			A8K9Z5	RNA	DEL	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-	ENSG00000196696		0.378	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1		0.00	18	0	T			70072984	-1	tier1		no_errors	ENST00000530079	ensembl	human	known	74_37	rna	10.53	17	2	DEL	0.000	-
PDZD8	118987	genome.wustl.edu	37	10	119100615	119100615	+	Splice_Site	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:119100615T>C	ENST00000334464.5	-	2	1112		c.e2-2			NM_173791.3	NP_776152.1	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8						cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|regulation of cell morphogenesis (GO:0022604)|viral process (GO:0016032)	membrane (GO:0016020)	metal ion binding (GO:0046872)			kidney(3)|large_intestine(8)|lung(24)|upper_aerodigestive_tract(3)	38		Colorectal(252;0.19)		all cancers(201;0.0121)		GGCTTAAACCTGACAAAAGTA	0.358																																																	0													106.0	97.0	100.0					10																	119100615		2203	4300	6503	SO:0001630	splice_region_variant	0			AL122051	CCDS7600.1	10q26.12	2006-01-24		2006-01-24	ENSG00000165650	ENSG00000165650			26974	protein-coding gene	gene with protein product		614235		PDZK8		12477932	Standard	NM_173791		Approved	bA129M16.2, FLJ34427	uc001lde.1	Q8NEN9	OTTHUMG00000019122	ENST00000334464.5:c.873-2A>G	10.37:g.119100615T>C			Q86WE0|Q86WE5|Q9UFF1	Splice_Site	SNP	-	e2-2	ENST00000334464.5	37	c.873-2	CCDS7600.1	10	.	.	.	.	.	.	.	.	.	.	T	16.78	3.218658	0.58560	.	.	ENSG00000165650	ENST00000334464	.	.	.	5.68	5.68	0.88126	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.593	0.56453	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDZD8	119090605	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.196000	0.58407	2.288000	0.76882	0.482000	0.46254	.	PDZD8	-	-	ENSG00000165650		0.358	PDZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD8	HGNC	protein_coding	OTTHUMT00000050565.1	-	0.00	74	0	T	NM_173791	Intron	119100615	-1	tier1	-	no_errors	ENST00000334464	ensembl	human	known	74_37	splice_site	6.06	62	4	SNP	1.000	C
PHKA1	5255	genome.wustl.edu	37	X	71800902	71800902	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:71800902C>T	ENST00000373542.4	-	32	3781	c.3622G>A	c.(3622-3624)Gcc>Acc	p.A1208T	PHKA1_ENST00000339490.3_Missense_Mutation_p.A1195T|PHKA1_ENST00000541944.1_Missense_Mutation_p.A1136T|PHKA1_ENST00000373539.3_Missense_Mutation_p.A1225T|PHKA1_ENST00000373545.3_Missense_Mutation_p.A1166T	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1208					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					ACGTAGGTGGCGGCTGCCTTG	0.572																																																	0													81.0	61.0	68.0					X																	71800902		2203	4300	6503	SO:0001583	missense	0				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3622G>A	X.37:g.71800902C>T	ENSP00000362643:p.Ala1208Thr		B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.A1225T	ENST00000373542.4	37	c.3673	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579302	0.65878	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.42	4.96	4.07	0.47477	.	0.053497	0.85682	D	0.000000	D	0.95878	0.8658	M	0.73962	2.25	0.48341	D	0.999636	D;P;D;D	0.76494	0.999;0.93;0.962;0.998	P;B;P;P	0.61132	0.884;0.305;0.554;0.852	D	0.94377	0.7601	10	0.38643	T	0.18	-7.8055	11.4157	0.49951	0.1821:0.8179:0.0:0.0	.	1136;1166;1195;1208	B7ZL07;A6NIT2;P46020-2;P46020	.;.;.;KPB1_HUMAN	T	1166;1208;1136;1195;1225	ENSP00000362646:A1166T;ENSP00000362643:A1208T;ENSP00000441251:A1136T;ENSP00000342469:A1195T;ENSP00000362640:A1225T	ENSP00000342469:A1195T	A	-	1	0	PHKA1	71717627	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.688000	0.68227	0.845000	0.35118	0.538000	0.68166	GCC	PHKA1	-	NULL	ENSG00000067177		0.572	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	-	0.00	45	0	C			71800902	-1	tier1	-	no_errors	ENST00000373539	ensembl	human	known	74_37	missense	57.38	26	35	SNP	1.000	T
PGK1	5230	genome.wustl.edu	37	X	77381578	77381578	+	3'UTR	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chrX:77381578A>T	ENST00000373316.4	+	0	1672				PGK1_ENST00000537456.1_3'UTR|PGK1_ENST00000476531.1_3'UTR|PGK1_ENST00000442431.1_3'UTR	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	TAGAGTGCATATATTTATATT	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.*251A>T	X.37:g.77381578A>T			A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	RNA	SNP	-	NULL	ENST00000373316.4	37	NULL	CCDS14438.1	X																																																																																			PGK1	-	-	ENSG00000102144		0.348	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK1	HGNC	protein_coding	OTTHUMT00000057310.1	-	0.00	13	0	A			77381578	+1	tier1	-	no_errors	ENST00000476531	ensembl	human	known	74_37	rna	66.67	5	10	SNP	0.892	T
PI4KB	5298	genome.wustl.edu	37	1	151265383	151265383	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:151265383G>T	ENST00000368873.1	-	12	2564	c.2396C>A	c.(2395-2397)tCt>tAt	p.S799Y	PI4KB_ENST00000368872.1_Missense_Mutation_p.S784Y|PI4KB_ENST00000529142.1_Missense_Mutation_p.S467Y|PI4KB_ENST00000271657.5_Missense_Mutation_p.S811Y|PI4KB_ENST00000368874.4_Missense_Mutation_p.S784Y|PI4KB_ENST00000368875.2_Missense_Mutation_p.S811Y			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	799					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGTGGTGATAGACCGCATACT	0.577																																					Colon(154;765 1838 9854 28443 37492)												0													144.0	137.0	140.0					1																	151265383		2203	4300	6503	SO:0001583	missense	0			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.2396C>A	1.37:g.151265383G>T	ENSP00000357867:p.Ser799Tyr		B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S811Y	ENST00000368873.1	37	c.2432		1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917329	0.92249	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000529142;ENST00000368872;ENST00000455060	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.54	5.54	0.83059	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.53948	0.1828	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	0.994;1.0;1.0	D;D;D	0.87578	0.971;0.998;0.998	T	0.61613	-0.7027	10	0.87932	D	0	-15.2122	17.0271	0.86450	0.0:0.0:1.0:0.0	.	799;784;467	Q9UBF8;Q9UBF8-2;Q9UBF8-3	PI4KB_HUMAN;.;.	Y	784;811;811;799;467;784;210	ENSP00000357868:S784Y;ENSP00000357869:S811Y;ENSP00000271657:S811Y;ENSP00000357867:S799Y;ENSP00000433149:S467Y;ENSP00000357866:S784Y;ENSP00000410974:S210Y	ENSP00000271657:S811Y	S	-	2	0	PI4KB	149532007	1.000000	0.71417	0.978000	0.43139	0.990000	0.78478	6.944000	0.75940	2.884000	0.98904	0.655000	0.94253	TCT	PI4KB	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000143393		0.577	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	HGNC	protein_coding	OTTHUMT00000034400.3		0.00	43	0	G	NM_002651		151265383	-1			no_errors	ENST00000271657	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
PICK1	9463	genome.wustl.edu	37	22	38471034	38471036	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr22:38471034_38471036delGGA	ENST00000404072.3	+	13	1490_1492	c.1143_1145delGGA	c.(1141-1146)ggggag>ggg	p.E388del	PICK1_ENST00000356976.3_In_Frame_Del_p.E388del|RP5-1039K5.13_ENST00000445483.1_RNA	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1	388	Poly-Glu.				ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					TCACAGATGGggaggaggaggag	0.635																																																	0																																										SO:0001651	inframe_deletion	0			AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.1143_1145delGGA	22.37:g.38471043_38471045delGGA	ENSP00000385205:p.Glu388del		B3KS52|O95906	In_Frame_Del	DEL	pfam_AH_dom,pfam_PDZ,pfam_BAR_dom,superfamily_PDZ,smart_PDZ,pfscan_AH_dom,pfscan_PDZ	p.E385in_frame_del	ENST00000404072.3	37	c.1143_1145	CCDS13965.1	22																																																																																			PICK1	-	NULL	ENSG00000100151		0.635	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PICK1	HGNC	protein_coding	OTTHUMT00000321569.2		0.00	19	0	GGA	NM_012407		38471036	+1	tier1		no_errors	ENST00000356976	ensembl	human	known	74_37	in_frame_del	14.29	24	4	DEL	0.071:1.000:1.000	-
PIGN	23556	genome.wustl.edu	37	18	59813201	59813201	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr18:59813201G>T	ENST00000357637.5	-	10	1278	c.863C>A	c.(862-864)gCt>gAt	p.A288D	PIGN_ENST00000400334.3_Missense_Mutation_p.A288D	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	288					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CTTGATTCCAGCTCCCCAAGT	0.358																																																	0													49.0	48.0	48.0					18																	59813201		1830	4083	5913	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.863C>A	18.37:g.59813201G>T	ENSP00000350263:p.Ala288Asp		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.A288D	ENST00000357637.5	37	c.863	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979828	0.92982	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.28454	1.61;1.61	5.87	5.87	0.94306	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.64316	0.2587	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65738	-0.6095	9	.	.	.	-19.2387	20.5827	0.99408	0.0:0.0:1.0:0.0	.	288;288	B2RCI8;O95427	.;PIGN_HUMAN	D	288	ENSP00000350263:A288D;ENSP00000383188:A288D	.	A	-	2	0	PIGN	57964181	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.590000	0.90821	2.941000	0.99782	0.655000	0.94253	GCT	PIGN	-	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000197563		0.358	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	-	0.00	66	0	G	NM_176787		59813201	-1	tier1	-	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
PLCL1	5334	genome.wustl.edu	37	2	198953678	198953678	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:198953678G>T	ENST00000428675.1	+	3	3210	c.2812G>T	c.(2812-2814)Gac>Tac	p.D938Y	PLCL1_ENST00000437704.2_Missense_Mutation_p.D840Y	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	938					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CATCACCAGTGACAATACTCC	0.463																																																	0													287.0	275.0	279.0					2																	198953678		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.2812G>T	2.37:g.198953678G>T	ENSP00000402861:p.Asp938Tyr		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.D938Y	ENST00000428675.1	37	c.2812	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759526	0.89932	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.18960	2.18;2.21	5.13	5.13	0.70059	.	0.094092	0.46442	D	0.000286	T	0.40272	0.1110	M	0.75447	2.3	0.80722	D	1	D;P	0.55605	0.972;0.897	P;P	0.52710	0.707;0.492	T	0.19582	-1.0301	9	.	.	.	.	18.7752	0.91908	0.0:0.0:1.0:0.0	.	938;864	Q15111;B4DYZ4	PLCL1_HUMAN;.	Y	938;840	ENSP00000402861:D938Y;ENSP00000414138:D840Y	.	D	+	1	0	PLCL1	198661923	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.643000	0.98464	2.661000	0.90470	0.650000	0.86243	GAC	PLCL1	-	NULL	ENSG00000115896		0.463	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	38	0	G	NM_006226		198953678	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	36.21	37	21	SNP	1.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68038523	68038523	+	Missense_Mutation	SNP	G	G	A	rs201561620		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:68038523G>A	ENST00000329153.5	+	10	1621	c.1489G>A	c.(1489-1491)Gat>Aat	p.D497N		NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	497						cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		TGGGTCTGACGATGACTGCAG	0.587											OREG0022748	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													82.0	83.0	83.0					14																	68038523		2046	4203	6249	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.1489G>A	14.37:g.68038523G>A	ENSP00000330278:p.Asp497Asn	1104	A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.D497N	ENST00000329153.5	37	c.1489	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872041	0.72180	.	.	ENSG00000054690	ENST00000329153	T	0.12147	2.71	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.34513	0.0900	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;0.988	D;P	0.83275	0.996;0.639	T	0.01630	-1.1308	10	0.38643	T	0.18	.	16.2597	0.82535	0.0:0.0:1.0:0.0	.	12;497	Q9ULM0-2;Q9ULM0	.;PKHH1_HUMAN	N	497	ENSP00000330278:D497N	ENSP00000330278:D497N	D	+	1	0	PLEKHH1	67108276	1.000000	0.71417	0.827000	0.32855	0.202000	0.24057	8.855000	0.92236	2.486000	0.83907	0.561000	0.74099	GAT	PLEKHH1	-	NULL	ENSG00000054690		0.587	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	-	0.00	44	0	G	XM_031054		68038523	+1	tier1	rs201561620	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	A
PNISR	25957	genome.wustl.edu	37	6	99848035	99848036	+	3'UTR	INS	-	-	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:99848035_99848036insA	ENST00000369239.5	-	0	3002_3003				PNISR_ENST00000438806.1_3'UTR	NM_032870.2	NP_116259.2	Q8TF01	PNISR_HUMAN	PNN-interacting serine/arginine-rich protein							cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24						ATTTACAGATTAAAAAAAAAAA	0.307																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027759	CCDS5043.1	6q16.3	2011-06-06	2011-06-06	2011-06-06	ENSG00000132424	ENSG00000132424			21222	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 111"", ""splicing factor, arginine/serine-rich 18"""	C6orf111, SFRS18		14578391	Standard	NM_032870		Approved	FLJ14752, bA98I9.2, DKFZp564B0769, SRrp130	uc021zdd.1	Q8TF01	OTTHUMG00000015262	ENST00000369239.5:c.*381->T	6.37:g.99848046_99848046dupA			A8K540|E1P5D2|Q5T064|Q5T065|Q6P2B4|Q6P2N4|Q6PJ93|Q6PK36|Q7Z640|Q8N2L1|Q8TF00|Q96K10|Q96SI3|Q96SM5|Q9P076|Q9P0C0|Q9Y4N3	RNA	INS	-	NULL	ENST00000369239.5	37	NULL	CCDS5043.1	6																																																																																			PNISR	-	-	ENSG00000132424		0.307	PNISR-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PNISR	HGNC	protein_coding	OTTHUMT00000041598.1		0.00	23	0	-	NM_032870		99848036	-1	tier1		no_errors	ENST00000481229	ensembl	human	known	74_37	rna	9.09	20	2	INS	0.988:0.986	A
PRB3	5544	genome.wustl.edu	37	12	11421033	11421033	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:11421033G>A	ENST00000279573.7	-	3	285	c.150C>T	c.(148-150)acC>acT	p.T50T	PRB3_ENST00000440870.3_5'UTR|PRB3_ENST00000538488.1_Silent_p.T50T|PRB3_ENST00000381842.3_Silent_p.T50T			Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	50	Pro-rich.			PQRTPPP -> SQGPPPR (in Ref. 1; CAA30728). {ECO:0000305}.	defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			GAGGAGGTGGGGTACGTTGGG	0.587																																																	0													154.0	158.0	156.0					12																	11421033		2196	4297	6493	SO:0001819	synonymous_variant	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000279573.7:c.150C>T	12.37:g.11421033G>A			Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Silent	SNP	NULL	p.T50	ENST00000279573.7	37	c.150		12																																																																																			PRB3	-	NULL	ENSG00000197870		0.587	PRB3-001	KNOWN	basic|appris_candidate	protein_coding	PRB3	HGNC	protein_coding	OTTHUMT00000402119.5	-	0.00	77	0	G	NM_006249		11421033	-1	tier1	-	no_errors	ENST00000381842	ensembl	human	known	74_37	silent	33.90	78	40	SNP	0.005	A
PRKCB	5579	genome.wustl.edu	37	16	23847536	23847536	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:23847536G>A	ENST00000321728.7	+	1	215	c.40G>A	c.(40-42)Gag>Aag	p.E14K	PRKCB_ENST00000498058.1_Missense_Mutation_p.E14K|PRKCB_ENST00000303531.7_Missense_Mutation_p.E14K	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	14					apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	GAGCGAGGGCGAGGAGAGCAC	0.726																																																	0													40.0	35.0	37.0					16																	23847536		2197	4300	6497	SO:0001583	missense	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.40G>A	16.37:g.23847536G>A	ENSP00000318315:p.Glu14Lys		C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd,prints_C2_dom	p.E14K	ENST00000321728.7	37	c.40	CCDS10618.1	16	.	.	.	.	.	.	.	.	.	.	g	11.30	1.599015	0.28534	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.71817	-0.59;-0.6	3.56	-0.065	0.13770	.	0.831089	0.09952	N	0.734469	T	0.43590	0.1254	N	0.12182	0.205	0.42123	D	0.991438	B;B	0.10296	0.0;0.003	B;B	0.08055	0.0;0.003	T	0.33929	-0.9849	10	0.14252	T	0.57	.	2.4415	0.04496	0.1129:0.3486:0.3609:0.1775	.	14;14	P05771-2;P05771	.;KPCB_HUMAN	K	14	ENSP00000318315:E14K;ENSP00000305355:E14K	ENSP00000305355:E14K	E	+	1	0	PRKCB	23755037	0.999000	0.42202	0.997000	0.53966	0.097000	0.18754	1.157000	0.31724	0.129000	0.18514	-0.260000	0.10688	GAG	PRKCB	-	pirsf_Protein_kinase_C_a/b/g	ENSG00000166501		0.726	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	-	0.00	17	0	G	NM_212535		23847536	+1	tier1	-	no_errors	ENST00000303531	ensembl	human	known	74_37	missense	40.00	12	8	SNP	1.000	A
PRPF39	55015	genome.wustl.edu	37	14	45579751	45579751	+	Splice_Site	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:45579751G>T	ENST00000355765.6	+	10	1473		c.e10-1		SNORD127_ENST00000458892.1_RNA	NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ACTGTTTCTAGGTAATATTAA	0.353																																																	0													25.0	23.0	24.0					14																	45579751		2198	4283	6481	SO:0001630	splice_region_variant	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.1304-1G>T	14.37:g.45579751G>T			Q08AL1|Q08AL2|Q9NUU5	Splice_Site	SNP	-	e9-1	ENST00000355765.6	37	c.1304-1	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349340	0.61183	.	.	ENSG00000185246	ENST00000355765	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4833	0.90819	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRPF39	44649501	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.837000	0.99465	2.457000	0.83068	0.563000	0.77884	.	PRPF39	-	-	ENSG00000185246		0.353	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2	-	0.00	52	0	G		Intron	45579751	+1	tier1	-	no_errors	ENST00000355765	ensembl	human	known	74_37	splice_site	9.30	39	4	SNP	1.000	T
PTBP1	5725	genome.wustl.edu	37	19	806468	806468	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:806468C>T	ENST00000349038.4	+	9	1026	c.953C>T	c.(952-954)gCg>gTg	p.A318V	PTBP1_ENST00000356948.6_Missense_Mutation_p.A344V|PTBP1_ENST00000394601.4_Missense_Mutation_p.A337V|PTBP1_ENST00000350092.4_Intron|MIR4745_ENST00000577608.1_RNA	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	318	Poly-Ala.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGCGGCGGCGGCAGCTGCG	0.692																																																	0													15.0	16.0	16.0					19																	806468		2183	4263	6446	SO:0001583	missense	0			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.953C>T	19.37:g.806468C>T	ENSP00000014112:p.Ala318Val		Q9BUQ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.A344V	ENST00000349038.4	37	c.1031	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540193	0.27563	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.49432	0.78;0.78;1.06	4.29	3.24	0.37175	.	0.191888	0.44688	D	0.000421	T	0.34571	0.0902	L	0.48986	1.54	0.80722	D	1	B;P;P	0.45768	0.086;0.866;0.789	B;B;B	0.33042	0.005;0.157;0.154	T	0.12218	-1.0556	10	0.33141	T	0.24	-8.5882	10.9523	0.47336	0.0:0.9075:0.0:0.0925	.	318;337;344	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	V	344;337;318	ENSP00000349428:A344V;ENSP00000408096:A337V;ENSP00000014112:A318V	ENSP00000014112:A318V	A	+	2	0	PTBP1	757468	1.000000	0.71417	0.011000	0.14972	0.017000	0.09413	7.247000	0.78257	0.790000	0.33803	0.563000	0.77884	GCG	PTBP1	-	tigrfam_HnRNP-L_PTB	ENSG00000011304		0.692	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	HGNC	protein_coding	OTTHUMT00000457605.1		0.00	75	0	C			806468	+1			no_errors	ENST00000356948	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.973	T
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000539239.1_Intron|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs|RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000395872.1_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																																	0													16.0	16.0	16.0					12																	28114898		875	1991	2866	SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT			Q15251|Q6FH74	Frame_Shift_Del	DEL	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1		0.00	15	0	T	NM_198965		28114898	-1	tier1		no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_del	15.38	22	4	DEL	0.135	-
PTPN22	26191	genome.wustl.edu	37	1	114414233	114414233	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:114414233C>G	ENST00000359785.5	-	1	148	c.13G>C	c.(13-15)Gaa>Caa	p.E5Q	PTPN22_ENST00000528414.1_Missense_Mutation_p.E5Q|PTPN22_ENST00000420377.2_Missense_Mutation_p.E5Q|PTPN22_ENST00000460620.1_Missense_Mutation_p.E5Q|PTPN22_ENST00000525799.1_Missense_Mutation_p.E5Q|AP4B1-AS1_ENST00000419536.1_RNA|PTPN22_ENST00000534519.1_5'UTR|PTPN22_ENST00000538253.1_5'UTR	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	5					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGCAGAATTTCTCTTTGGTCC	0.453																																																	0													100.0	104.0	103.0					1																	114414233		2203	4300	6503	SO:0001583	missense	0			AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.13G>C	1.37:g.114414233C>G	ENSP00000352833:p.Glu5Gln		A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Non-rcpt_Tyr_Pase_8/22,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.E5Q	ENST00000359785.5	37	c.13	CCDS863.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280402	0.80692	.	.	ENSG00000134242	ENST00000460620;ENST00000359785;ENST00000528414;ENST00000420377;ENST00000525799;ENST00000354605	T;T;T;T;T	0.14766	2.48;3.63;3.36;3.52;3.05	5.28	5.28	0.74379	.	0.386762	0.27193	N	0.020490	T	0.25382	0.0617	M	0.64997	1.995	0.80722	D	1	P;D;D;D;B;D	0.63880	0.951;0.976;0.966;0.993;0.39;0.976	B;P;P;D;B;P	0.63488	0.323;0.746;0.557;0.915;0.139;0.818	T	0.00307	-1.1830	10	0.59425	D	0.04	.	16.8618	0.86020	0.0:1.0:0.0:0.0	.	5;5;5;5;5;5	E9PPI1;E9PMT0;E9PLD8;G5E984;Q9Y2R2-5;Q9Y2R2	.;.;.;.;.;PTN22_HUMAN	Q	5	ENSP00000433141:E5Q;ENSP00000352833:E5Q;ENSP00000435176:E5Q;ENSP00000388229:E5Q;ENSP00000432674:E5Q	ENSP00000346621:E5Q	E	-	1	0	PTPN22	114215756	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	2.126000	0.42026	2.744000	0.94065	0.655000	0.94253	GAA	PTPN22	-	pirsf_Non-rcpt_Tyr_Pase_8/22	ENSG00000134242		0.453	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN22	HGNC	protein_coding	OTTHUMT00000033015.1	-	0.00	43	0	C	NM_015967		114414233	-1	tier1	-	no_errors	ENST00000359785	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	G
PTPRR	5801	genome.wustl.edu	37	12	71148007	71148007	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:71148007delA	ENST00000283228.2	-	5	1154	c.702delT	c.(700-702)tttfs	p.F234fs	PTPRR_ENST00000549308.1_5'UTR|PTPRR_ENST00000440835.2_5'UTR|PTPRR_ENST00000378778.1_Frame_Shift_Del_p.F28fs|PTPRR_ENST00000342084.4_Frame_Shift_Del_p.F122fs	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	234					ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		AGATGCTGAGAAAAATGACAA	0.358																																																	0													127.0	122.0	124.0					12																	71148007		2203	4299	6502	SO:0001589	frameshift_variant	0			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.702delT	12.37:g.71148007delA	ENSP00000283228:p.Phe234fs		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Frame_Shift_Del	DEL	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L235fs	ENST00000283228.2	37	c.702	CCDS8998.1	12																																																																																			PTPRR	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5	ENSG00000153233		0.358	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	HGNC	protein_coding	OTTHUMT00000404485.1		0.00	26	0	A	NM_002849		71148007	-1	tier1		no_errors	ENST00000283228	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	0.995	-
PVRL2	5819	genome.wustl.edu	37	19	45381584	45381585	+	Intron	INS	-	-	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:45381584_45381585insT	ENST00000252483.5	+	5	1042				PVRL2_ENST00000252485.4_Frame_Shift_Ins_p.I383fs	NM_001042724.1	NP_001036189.1	Q92692	PVRL2_HUMAN	poliovirus receptor-related 2 (herpesvirus entry mediator B)						acrosome assembly (GO:0001675)|adherens junction organization (GO:0034332)|adhesion of symbiont to host (GO:0044406)|cell junction assembly (GO:0034329)|cell part morphogenesis (GO:0032990)|cell-cell junction organization (GO:0045216)|cilium organization (GO:0044782)|coreceptor-mediated virion attachment to host cell (GO:0046814)|cytoskeleton organization (GO:0007010)|establishment of mitochondrion localization (GO:0051654)|fertilization (GO:0009566)|fusion of virus membrane with host plasma membrane (GO:0019064)|homophilic cell adhesion (GO:0007156)|positive regulation of immunoglobulin mediated immune response (GO:0002891)|positive regulation of mast cell activation (GO:0033005)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|sperm mitochondrion organization (GO:0030382)|spermatid development (GO:0007286)|spermatid nucleus differentiation (GO:0007289)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	cell adhesion molecule binding (GO:0050839)|coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|large_intestine(6)|lung(5)	13	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		CTTGGCCTTCATCCTGCTgagg	0.678																																																	0																																										SO:0001627	intron_variant	0			X80038	CCDS12645.1, CCDS42576.1	19q13.32	2013-01-29			ENSG00000130202	ENSG00000130202		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9707	protein-coding gene	gene with protein product		600798		HVEB		7622062, 10196354	Standard	NM_001042724		Approved	PVRR2, PRR2, CD112	uc002ozw.1	Q92692	OTTHUMG00000180839	ENST00000252483.5:c.1042+3849->T	19.37:g.45381585_45381585dupT			A8K5L5|O75455|Q6IBI6|Q96J29	Frame_Shift_Ins	INS	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.L384fs	ENST00000252483.5	37	c.1147_1148	CCDS42576.1	19																																																																																			PVRL2	-	NULL	ENSG00000130202		0.678	PVRL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVRL2	HGNC	protein_coding	OTTHUMT00000453231.1		0.00	38	0	-	NM_002856		45381585	+1	tier1		no_errors	ENST00000252485	ensembl	human	known	74_37	frame_shift_ins	27.78	39	15	INS	0.997:1.000	T
PXDN	7837	genome.wustl.edu	37	2	1653244	1653244	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:1653244C>T	ENST00000252804.4	-	17	2358	c.2308G>A	c.(2308-2310)Gtg>Atg	p.V770M		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	770					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)	p.V770M(1)		breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TTCTCGTACACGGATTTCAGC	0.637																																																	1	Substitution - Missense(1)	large_intestine(1)											99.0	112.0	108.0					2																	1653244		2028	4194	6222	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2308G>A	2.37:g.1653244C>T	ENSP00000252804:p.Val770Met		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.V770M	ENST00000252804.4	37	c.2308	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114294	0.77210	.	.	ENSG00000130508	ENST00000252804	T	0.69306	-0.39	5.63	5.63	0.86233	.	0.065909	0.64402	D	0.000011	T	0.80105	0.4562	M	0.65677	2.01	0.58432	D	0.999999	D	0.69078	0.997	D	0.63033	0.91	T	0.79743	-0.1675	10	0.51188	T	0.08	-47.2202	19.7328	0.96190	0.0:1.0:0.0:0.0	.	770	Q92626	PXDN_HUMAN	M	770	ENSP00000252804:V770M	ENSP00000252804:V770M	V	-	1	0	PXDN	1632251	1.000000	0.71417	0.994000	0.49952	0.668000	0.39293	7.698000	0.84413	2.661000	0.90470	0.558000	0.71614	GTG	PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.637	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1		0.00	25	0	C	XM_056455		1653244	-1			no_errors	ENST00000252804	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
QDPR	5860	genome.wustl.edu	37	4	17506070	17506070	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:17506070C>A	ENST00000281243.5	-	3	406	c.227G>T	c.(226-228)gGt>gTt	p.G76V	QDPR_ENST00000513615.1_Missense_Mutation_p.G76V|QDPR_ENST00000508623.1_Missense_Mutation_p.G76V|QDPR_ENST00000428702.2_Missense_Mutation_p.G45V	NM_000320.2	NP_000311.2	P09417	DHPR_HUMAN	quinoid dihydropteridine reductase	76					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|dihydrobiopterin metabolic process (GO:0051066)|L-phenylalanine catabolic process (GO:0006559)|liver development (GO:0001889)|response to aluminum ion (GO:0010044)|response to glucagon (GO:0033762)|response to lead ion (GO:0010288)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	6,7-dihydropteridine reductase activity (GO:0004155)|electron carrier activity (GO:0009055)|NADH binding (GO:0070404)|NADPH binding (GO:0070402)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	13						CTTCTCTTCACCCAAGAGCTT	0.458																																																	0													136.0	127.0	130.0					4																	17506070		2203	4300	6503	SO:0001583	missense	0			AB053170	CCDS3421.1	4p15.31	2014-04-01			ENSG00000151552	ENSG00000151552	1.5.1.34	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	9752	protein-coding gene	gene with protein product	"""6,7-dihydropteridine reductase"", ""short chain dehydrogenase/reductase family 33C, member 1"""	612676				19027726	Standard	NM_000320		Approved	DHPR, PKU2, SDR33C1	uc003gpd.3	P09417	OTTHUMG00000128537	ENST00000281243.5:c.227G>T	4.37:g.17506070C>A	ENSP00000281243:p.Gly76Val		A8K158|B3KW71|Q53F52|Q9H3M5	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR	p.G76V	ENST00000281243.5	37	c.227	CCDS3421.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.0|23.0	4.366302|4.366302	0.82463|0.82463	.|.	.|.	ENSG00000151552|ENSG00000151552	ENST00000513615;ENST00000281243;ENST00000428702;ENST00000508623|ENST00000505710	D;D;D;D|.	0.94758|.	-3.51;-2.3;-3.51;-3.51|.	5.5|5.5	5.5|5.5	0.81552|0.81552	NAD(P)-binding domain (1);|.	0.047484|.	0.85682|.	D|.	0.000000|.	D|D	0.82737|0.82737	0.5102|0.5102	M|M	0.86028|0.86028	2.79|2.79	0.80722|0.80722	D|D	1|1	P;D|.	0.65815|.	0.948;0.995|.	P;P|.	0.62184|.	0.578;0.899|.	D|D	0.84394|0.84394	0.0556|0.0556	10|5	0.62326|.	D|.	0.03|.	-16.9569|-16.9569	18.1678|18.1678	0.89734|0.89734	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	45;76|.	B3KW71;P09417|.	.;DHPR_HUMAN|.	V|L	76;76;45;76|52	ENSP00000422759:G76V;ENSP00000281243:G76V;ENSP00000390944:G45V;ENSP00000426377:G76V|.	ENSP00000281243:G76V|.	G|V	-|-	2|1	0|0	QDPR|QDPR	17115168|17115168	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.734000|0.734000	0.41952|0.41952	6.678000|6.678000	0.74508|0.74508	2.575000|2.575000	0.86900|0.86900	0.563000|0.563000	0.77884|0.77884	GGT|GTG	QDPR	-	pfam_DH_sc/Rdtase_SDR	ENSG00000151552		0.458	QDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QDPR	HGNC	protein_coding	OTTHUMT00000250372.1	-	0.00	60	0	C	NM_000320		17506070	-1	tier1	-	no_errors	ENST00000281243	ensembl	human	known	74_37	missense	17.65	42	9	SNP	1.000	A
RAB3GAP2	25782	genome.wustl.edu	37	1	220440891	220440891	+	Intron	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:220440891G>T	ENST00000358951.2	-	1	232				RAB3GAP2_ENST00000462353.1_5'UTR	NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)						establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GCCTCTTTTTGATTCTTCATT	0.438																																																	0																																										SO:0001627	intron_variant	0			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.115+4673C>A	1.37:g.220440891G>T			A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	RNA	SNP	-	NULL	ENST00000358951.2	37	NULL	CCDS31028.1	1																																																																																			RAB3GAP2	-	-	ENSG00000118873		0.438	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2		0.00	49	0	G	NM_012414		220440891	-1			no_errors	ENST00000462353	ensembl	human	known	74_37	rna	11.48	54	7	SNP	0.978	T
RASSF7	8045	genome.wustl.edu	37	11	562263	562263	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:562263G>A	ENST00000397583.3	+	3	742	c.309G>A	c.(307-309)ccG>ccA	p.P103P	RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000454668.2_Silent_p.P103P|RASSF7_ENST00000431809.1_Silent_p.P103P|RASSF7_ENST00000344375.4_Silent_p.P103P|RASSF7_ENST00000397582.3_Silent_p.P103P|C11orf35_ENST00000329451.3_5'Flank|RASSF7_ENST00000524468.1_3'UTR|RP11-496I9.1_ENST00000527620.1_RNA	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	103					apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTCCACCCCCGGAACGCTGCC	0.662																																					Pancreas(184;1170 3913 7268)												0													43.0	43.0	43.0					11																	562263		2202	4300	6502	SO:0001819	synonymous_variant	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.309G>A	11.37:g.562263G>A			G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	NULL	p.G102R	ENST00000397583.3	37	c.304	CCDS7702.1	11																																																																																			RASSF7	-	NULL	ENSG00000099849		0.662	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	-	0.00	31	0	G	NM_003475		562263	+1	tier1	-	no_errors	ENST00000414138	ensembl	human	known	74_37	missense	51.35	18	19	SNP	0.000	A
RBBP6	5930	genome.wustl.edu	37	16	24582688	24582688	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:24582688T>A	ENST00000319715.4	+	18	4733	c.4301T>A	c.(4300-4302)cTg>cAg	p.L1434Q	RBBP6_ENST00000348022.2_Missense_Mutation_p.L1400Q|RBBP6_ENST00000381039.3_Missense_Mutation_p.L594Q	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	1434	Interaction with p53. {ECO:0000250}.				embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		TTGGACCGTCTGAATGAACAA	0.403																																																	0													76.0	73.0	74.0					16																	24582688		2197	4300	6497	SO:0001583	missense	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.4301T>A	16.37:g.24582688T>A	ENSP00000317872:p.Leu1434Gln		Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.L1434Q	ENST00000319715.4	37	c.4301	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	T	11.89	1.772946	0.31411	.	.	ENSG00000122257	ENST00000381039;ENST00000319715;ENST00000348022	T;T;T	0.17854	2.25;2.54;2.54	5.52	4.43	0.53597	.	0.784839	0.10814	N	0.631270	T	0.09598	0.0236	N	0.14661	0.345	0.09310	N	1	B;B;B	0.31351	0.32;0.32;0.214	B;B;B	0.34931	0.192;0.192;0.094	T	0.39333	-0.9619	10	0.12766	T	0.61	0.437	4.7291	0.12955	0.0:0.1718:0.1627:0.6655	.	594;1400;1434	Q7Z6E9-4;Q7Z6E9-2;Q7Z6E9	.;.;RBBP6_HUMAN	Q	594;1434;1400	ENSP00000370427:L594Q;ENSP00000317872:L1434Q;ENSP00000316291:L1400Q	ENSP00000317872:L1434Q	L	+	2	0	RBBP6	24490189	0.003000	0.15002	0.353000	0.25747	0.981000	0.71138	1.246000	0.32803	1.027000	0.39758	0.460000	0.39030	CTG	RBBP6	-	NULL	ENSG00000122257		0.403	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	-	0.00	35	0	T	NM_006910		24582688	+1	tier1	-	no_errors	ENST00000319715	ensembl	human	known	74_37	missense	26.47	25	9	SNP	0.006	A
RBM15	64783	genome.wustl.edu	37	1	110883931	110883931	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:110883931G>A	ENST00000369784.3	+	1	2804	c.1904G>A	c.(1903-1905)aGc>aAc	p.S635N	RBM15_ENST00000487146.2_Missense_Mutation_p.S635N|RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000602849.1_Missense_Mutation_p.S635N	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	635	Arg-rich.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGCCCAGCAGCAGAGACCAG	0.592			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													52.0	47.0	48.0					1																	110883931		2203	4300	6503	SO:0001583	missense	0			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1904G>A	1.37:g.110883931G>A	ENSP00000358799:p.Ser635Asn		A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.S635N	ENST00000369784.3	37	c.1904	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	G	10.94	1.492000	0.26774	.	.	ENSG00000162775	ENST00000369784	T	0.18338	2.22	4.77	4.77	0.60923	.	0.000000	0.56097	D	0.000029	T	0.04048	0.0113	N	0.15975	0.35	0.39332	D	0.965431	B;B	0.23891	0.093;0.056	B;B	0.17433	0.018;0.008	T	0.32188	-0.9916	10	0.25106	T	0.35	-11.8098	11.4484	0.50138	0.0828:0.0:0.9172:0.0	.	635;635	Q96T37-3;Q96T37	.;RBM15_HUMAN	N	635	ENSP00000358799:S635N	ENSP00000358799:S635N	S	+	2	0	RBM15	110685454	0.946000	0.32159	1.000000	0.80357	0.996000	0.88848	1.725000	0.38074	2.480000	0.83734	0.655000	0.94253	AGC	RBM15	-	NULL	ENSG00000162775		0.592	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2	-	0.00	25	0	G	NM_022768		110883931	+1	tier1	-	no_errors	ENST00000369784	ensembl	human	known	74_37	missense	35.00	13	7	SNP	1.000	A
RBP3	5949	genome.wustl.edu	37	10	48381934	48381934	+	Missense_Mutation	SNP	G	G	A	rs111792211		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:48381934G>A	ENST00000224600.4	-	4	3828	c.3715C>T	c.(3715-3717)Cgg>Tgg	p.R1239W		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1239					lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CCTGGGCTCCGCTTCACCCTC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		15606	0.0		0.0	False		,,,				2504	0.001																0													36.0	33.0	34.0					10																	48381934		2203	4300	6503	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3715C>T	10.37:g.48381934G>A	ENSP00000224600:p.Arg1239Trp		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.R1239W	ENST00000224600.4	37	c.3715	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344147	0.41498	.	.	ENSG00000107618	ENST00000224600	T	0.65549	-0.16	5.49	0.978	0.19740	.	0.616801	0.13471	N	0.385452	T	0.43634	0.1256	N	0.24115	0.695	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37549	-0.9701	10	0.87932	D	0	-12.0112	6.0907	0.19993	0.2525:0.0:0.6108:0.1367	.	1239	P10745	RET3_HUMAN	W	1239	ENSP00000224600:R1239W	ENSP00000224600:R1239W	R	-	1	2	RBP3	48001940	0.000000	0.05858	0.002000	0.10522	0.111000	0.19643	0.213000	0.17521	0.287000	0.22375	0.655000	0.94253	CGG	RBP3	-	NULL	ENSG00000107618		0.647	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1		0.00	27	0	G	NM_002900		48381934	-1			no_errors	ENST00000224600	ensembl	human	known	74_37	missense	6.38	44	3	SNP	0.000	A
RCC2	55920	genome.wustl.edu	37	1	17743020	17743020	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:17743020G>T	ENST00000375436.4	-	8	1169	c.982C>A	c.(982-984)Cca>Aca	p.P328T	RCC2_ENST00000375433.3_Missense_Mutation_p.P328T|AC004824.1_ENST00000583469.1_RNA	NM_018715.3	NP_061185.1	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	328					chromosome passenger complex localization to kinetochore (GO:0072356)|endosome organization (GO:0007032)|focal adhesion assembly (GO:0048041)|integrin-mediated signaling pathway (GO:0007229)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of GTPase activity (GO:0034260)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of attachment of spindle microtubules to kinetochore (GO:0051987)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|regulation of cell migration (GO:0030334)	chromosome, centromeric core domain (GO:0034506)|cytosol (GO:0005829)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|Rac GTPase binding (GO:0048365)			breast(2)|endometrium(1)|kidney(3)|large_intestine(7)|lung(4)	17		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)		ACCACGTTTGGTACAGGCAGA	0.557																																																	0													119.0	93.0	102.0					1																	17743020		2203	4300	6503	SO:0001583	missense	0				CCDS181.1	1p36.13	2010-05-05			ENSG00000179051	ENSG00000179051			30297	protein-coding gene	gene with protein product		609587				10819331, 12919680	Standard	NM_018715		Approved	TD-60	uc001bal.3	Q9P258	OTTHUMG00000002513	ENST00000375436.4:c.982C>A	1.37:g.17743020G>T	ENSP00000364585:p.Pro328Thr		Q8IVL9|Q9BSN6|Q9NPV8	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,prints_Reg_chr_condens,pfscan_Reg_chr_condens	p.P328T	ENST00000375436.4	37	c.982	CCDS181.1	1	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313020	0.40895	.	.	ENSG00000179051	ENST00000375436;ENST00000375433	T;T	0.80393	-1.37;-1.37	5.56	5.56	0.83823	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.82273	0.5001	N	0.16478	0.41	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80130	-0.1511	10	0.26408	T	0.33	-9.7585	18.4435	0.90676	0.0:0.0:1.0:0.0	.	328	Q9P258	RCC2_HUMAN	T	328	ENSP00000364585:P328T;ENSP00000364582:P328T	ENSP00000364582:P328T	P	-	1	0	RCC2	17615607	1.000000	0.71417	0.956000	0.39512	0.697000	0.40408	7.803000	0.85983	2.778000	0.95560	0.655000	0.94253	CCA	RCC2	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens	ENSG00000179051		0.557	RCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCC2	HGNC	protein_coding	OTTHUMT00000007144.1	-	0.00	42	0	G	NM_018715		17743020	-1	tier1	-	no_errors	ENST00000375433	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
RFX5	5993	genome.wustl.edu	37	1	151314865	151314865	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:151314865G>A	ENST00000290524.4	-	11	1826	c.1648C>T	c.(1648-1650)Cat>Tat	p.H550Y	RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452513.2_Missense_Mutation_p.H510Y|RFX5_ENST00000368870.2_Missense_Mutation_p.H550Y|RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452671.2_Missense_Mutation_p.H550Y	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	550					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCTTTGGTATGCTGGGAACCG	0.542																																																	0													123.0	125.0	124.0					1																	151314865		2203	4300	6503	SO:0001583	missense	0				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.1648C>T	1.37:g.151314865G>A	ENSP00000290524:p.His550Tyr		B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.H550Y	ENST00000290524.4	37	c.1648	CCDS994.1	1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.471623	0.26423	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000452671;ENST00000452513;ENST00000392746	T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3	5.25	3.35	0.38373	.	0.461581	0.21345	N	0.076071	T	0.17195	0.0413	M	0.62723	1.935	0.22401	N	0.999138	B;B	0.31100	0.308;0.001	B;B	0.31751	0.135;0.001	T	0.15150	-1.0447	10	0.72032	D	0.01	-0.7348	6.9934	0.24767	0.0938:0.1822:0.724:0.0	.	510;550	B7Z848;P48382	.;RFX5_HUMAN	Y	550;550;550;510;550	ENSP00000290524:H550Y;ENSP00000357864:H550Y;ENSP00000389130:H550Y;ENSP00000398388:H510Y;ENSP00000376502:H550Y	ENSP00000290524:H550Y	H	-	1	0	RFX5	149581489	0.985000	0.35326	0.605000	0.28930	0.912000	0.54170	1.444000	0.35068	0.761000	0.33130	0.591000	0.81541	CAT	RFX5	-	NULL	ENSG00000143390		0.542	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	HGNC	protein_coding	OTTHUMT00000034892.6		0.00	28	0	G	NM_000449		151314865	-1			no_errors	ENST00000290524	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.711	A
RFWD2	64326	genome.wustl.edu	37	1	175957539	175957539	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:175957539G>T	ENST00000367669.3	-	17	2371	c.1857C>A	c.(1855-1857)gaC>gaA	p.D619E	RFWD2_ENST00000308769.8_Missense_Mutation_p.D595E	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	619					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TTAGCTGACTGTCTGTTGAGC	0.403																																					Ovarian(134;1413 1765 5706 35534 51541)												0													120.0	104.0	109.0					1																	175957539		2203	4300	6503	SO:0001583	missense	0			AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.1857C>A	1.37:g.175957539G>T	ENSP00000356641:p.Asp619Glu		E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D619E	ENST00000367669.3	37	c.1857	CCDS30944.1	1	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439443	0.63067	.	.	ENSG00000143207	ENST00000367665;ENST00000367669;ENST00000367666;ENST00000308769	D;D;D	0.89196	-2.48;-2.48;-2.48	4.98	0.768	0.18487	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.048504	0.85682	D	0.000000	D	0.95118	0.8418	H	0.95470	3.675	0.58432	D	0.999995	D;P;D;D;P	0.89917	1.0;0.568;1.0;0.961;0.568	D;B;D;P;B	0.97110	1.0;0.222;0.999;0.702;0.222	D	0.93841	0.7136	10	0.87932	D	0	-15.2719	9.603	0.39617	0.3274:0.0:0.6726:0.0	.	394;379;595;619;619	Q8NHY2-3;B1AMD2;Q8NHY2-2;Q8NHY2;Q504W6	.;.;.;RFWD2_HUMAN;.	E	394;619;454;595	ENSP00000356641:D619E;ENSP00000356638:D454E;ENSP00000310943:D595E	ENSP00000310943:D595E	D	-	3	2	RFWD2	174224162	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	1.466000	0.35310	0.183000	0.20059	-0.218000	0.12543	GAC	RFWD2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143207		0.403	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD2	HGNC	protein_coding	OTTHUMT00000084672.2	-	0.00	30	0	G	NM_022457		175957539	-1	tier1	-	no_errors	ENST00000367669	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
RFX7	64864	genome.wustl.edu	37	15	56395777	56395777	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:56395777G>T	ENST00000559447.2	-	5	473	c.202C>A	c.(202-204)Cgt>Agt	p.R68S	RFX7_ENST00000423270.1_Missense_Mutation_p.R165S|RFX7_ENST00000317318.6_Missense_Mutation_p.R165S|RFX7_ENST00000422057.1_Missense_Mutation_p.R68S			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	68					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GTGCCCAAACGACGTGCCTTC	0.378																																																	0													85.0	81.0	82.0					15																	56395777		1874	4100	5974	SO:0001583	missense	0					15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.202C>A	15.37:g.56395777G>T	ENSP00000453281:p.Arg68Ser		Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.R165S	ENST00000559447.2	37	c.493		15	.	.	.	.	.	.	.	.	.	.	G	34	5.300499	0.95601	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	D;D;D	0.92199	-2.99;-2.99;-2.99	5.54	5.54	0.83059	Winged helix-turn-helix transcription repressor DNA-binding (1);DNA-binding RFX (1);	0.000000	0.64402	D	0.000001	D	0.97040	0.9033	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97512	1.0067	10	0.87932	D	0	-12.161	18.8257	0.92117	0.0:0.0:1.0:0.0	.	68	Q2KHR2	RFX7_HUMAN	S	68;165;165	ENSP00000387504:R68S;ENSP00000313299:R165S;ENSP00000397644:R165S	ENSP00000313299:R165S	R	-	1	0	RFX7	54183069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.763000	0.94921	0.557000	0.71058	CGT	RFX7	-	pfam_DNA-bd_RFX	ENSG00000181827		0.378	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	RFX7	HGNC	protein_coding	OTTHUMT00000418841.3		0.00	48	0	G	NM_022841		56395777	-1			no_errors	ENST00000423270	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
RGS7	6000	genome.wustl.edu	37	1	241031952	241031952	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:241031952C>A	ENST00000407727.1	-	8	543	c.544G>T	c.(544-546)Gac>Tac	p.D182Y	RGS7_ENST00000446183.2_Missense_Mutation_p.D98Y|RGS7_ENST00000348120.2_Missense_Mutation_p.D129Y|RGS7_ENST00000401882.1_Missense_Mutation_p.D129Y|RGS7_ENST00000366563.1_Missense_Mutation_p.D182Y|RGS7_ENST00000366564.1_Missense_Mutation_p.D182Y|RGS7_ENST00000366562.4_Missense_Mutation_p.D182Y|RGS7_ENST00000331110.7_Missense_Mutation_p.D156Y|RGS7_ENST00000366565.1_Missense_Mutation_p.D182Y			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	182					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCAATCTTGTCTCTCTTCTTG	0.448																																																	0													155.0	120.0	132.0					1																	241031952		2203	4300	6503	SO:0001583	missense	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.544G>T	1.37:g.241031952C>A	ENSP00000384428:p.Asp182Tyr		Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Missense_Mutation	SNP	pfam_RGS_dom,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal_superfam,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.D182Y	ENST00000407727.1	37	c.544		1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541842	0.85917	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	T;T;T;T;T;T;T;T;T;T	0.38887	1.36;1.33;1.34;1.33;1.11;1.34;1.36;1.34;1.33;1.34	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.68531	0.3011	M	0.80183	2.485	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D	0.85130	0.98;0.982;0.992;0.997;0.987;0.967;0.982	T	0.72114	-0.4388	10	0.87932	D	0	-8.7199	18.6358	0.91378	0.0:1.0:0.0:0.0	.	98;156;129;182;182;182;182	B7Z223;B7Z257;P49802-4;P49802-2;P49802-5;P49802-3;P49802	.;.;.;.;.;.;RGS7_HUMAN	Y	156;182;182;182;13;129;98;182;182;129	ENSP00000331485:D156Y;ENSP00000355523:D182Y;ENSP00000355522:D182Y;ENSP00000355521:D182Y;ENSP00000404399:D13Y;ENSP00000341242:D129Y;ENSP00000390138:D98Y;ENSP00000355520:D182Y;ENSP00000384428:D182Y;ENSP00000385508:D129Y	ENSP00000331485:D156Y	D	-	1	0	RGS7	239098575	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.734000	0.84928	2.653000	0.90120	0.655000	0.94253	GAC	RGS7	-	NULL	ENSG00000182901		0.448	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		-	0.00	37	0	C	NM_002924		241031952	-1	tier1	-	no_errors	ENST00000407727	ensembl	human	known	74_37	missense	36.07	39	22	SNP	1.000	A
RNASEH2B	79621	genome.wustl.edu	37	13	51519601	51519601	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr13:51519601G>T	ENST00000336617.3	+	7	948	c.549G>T	c.(547-549)gtG>gtT	p.V183V	RNASEH2B_ENST00000422660.1_Silent_p.V183V|RNASEH2B_ENST00000495244.2_3'UTR	NM_024570.3	NP_078846.2	Q5TBB1	RNH2B_HUMAN	ribonuclease H2, subunit B	183			V -> M (in AGS2). {ECO:0000269|PubMed:17846997}.		in utero embryonic development (GO:0001701)|negative regulation of gene expression (GO:0010629)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of DNA damage checkpoint (GO:2000001)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|ribonucleotide metabolic process (GO:0009259)|RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)	RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(2)|liver(1)|lung(1)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(7;1.03e-07)|Breast(56;0.00122)|Lung NSC(96;0.00143)|Prostate(109;0.0047)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;9e-08)		CCAATAATGTGAATGTCAGTT	0.378																																																	0													116.0	116.0	116.0					13																	51519601		2203	4300	6503	SO:0001819	synonymous_variant	0			AK021774	CCDS9425.1, CCDS45047.1	13q14.3	2014-09-17	2006-08-17	2006-08-17	ENSG00000136104	ENSG00000136104			25671	protein-coding gene	gene with protein product		610326	"""deleted in lymphocytic leukemia 8"", ""Aicardi-Goutieres syndrome 2"""	DLEU8, AGS2		16845400	Standard	NM_001142279		Approved	FLJ11712	uc001vfa.4	Q5TBB1	OTTHUMG00000016937	ENST00000336617.3:c.549G>T	13.37:g.51519601G>T			G3XAJ1|Q05DR2|Q6PK48|Q9HAF7	Silent	SNP	pfam_RNase_H2_suB	p.V183	ENST00000336617.3	37	c.549	CCDS9425.1	13																																																																																			RNASEH2B	-	pfam_RNase_H2_suB	ENSG00000136104		0.378	RNASEH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH2B	HGNC	protein_coding	OTTHUMT00000045006.3		0.00	37	0	G	NM_024570		51519601	+1			no_errors	ENST00000336617	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.021	T
RNPC3	55599	genome.wustl.edu	37	1	104068788	104068788	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:104068788G>T	ENST00000533099.1	+	2	332	c.96G>T	c.(94-96)agG>agT	p.R32S	RN7SKP285_ENST00000410137.1_RNA|RP11-153F1.1_ENST00000444810.1_RNA|RP11-153F1.1_ENST00000447322.2_RNA|RNPC3_ENST00000524631.1_Missense_Mutation_p.R32S|RNPC3_ENST00000423855.2_Missense_Mutation_p.R32S			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	32	Necessary for interaction with PDCD7.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TTCTGGTCAGGCACCTGCCGG	0.607																																																	0													39.0	38.0	39.0					1																	104068788		692	1591	2283	SO:0001583	missense	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.96G>T	1.37:g.104068788G>T	ENSP00000432886:p.Arg32Ser		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R32S	ENST00000533099.1	37	c.96	CCDS781.1	1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488540	0.84854	.	.	ENSG00000185946	ENST00000524631;ENST00000531883;ENST00000533099;ENST00000423855	T;T;T;T	0.15834	2.39;2.39;2.39;2.39	5.09	4.18	0.49190	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.26666	0.0652	M	0.64676	1.99	0.49687	D	0.999815	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	T	0.03514	-1.1029	10	0.87932	D	0	-7.9776	11.4223	0.49989	0.0839:0.0:0.9161:0.0	.	32;32	A8K1C9;Q96LT9	.;RBM40_HUMAN	S	32	ENSP00000437278:R32S;ENSP00000431344:R32S;ENSP00000432886:R32S;ENSP00000391432:R32S	ENSP00000391432:R32S	R	+	3	2	RNPC3	103841376	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	1.807000	0.38902	1.368000	0.46115	0.563000	0.77884	AGG	RNPC3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000185946		0.607	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1	-	0.00	62	0	G	NM_017619		104068788	+1	tier1	-	no_errors	ENST00000423855	ensembl	human	known	74_37	missense	28.21	56	22	SNP	1.000	T
RUNX1T1	862	genome.wustl.edu	37	8	92983023	92983023	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:92983023C>T	ENST00000523629.1	-	11	1856	c.1402G>A	c.(1402-1404)Gtg>Atg	p.V468M	RUNX1T1_ENST00000422361.2_Missense_Mutation_p.V431M|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.V468M|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.V479M|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.V431M|RUNX1T1_ENST00000396218.1_Missense_Mutation_p.V441M|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.V431M|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.V441M	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	468					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V431M(1)|p.V468M(1)|p.V479M(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GCCTCAGACACGGCCTTCTGC	0.617																																																	3	Substitution - Missense(3)	endometrium(3)											80.0	63.0	69.0					8																	92983023		2203	4300	6503	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1402G>A	8.37:g.92983023C>T	ENSP00000428543:p.Val468Met		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.V479M	ENST00000523629.1	37	c.1435	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.370244	0.95900	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.71065	0.3296	M	0.85197	2.74	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;P;D	0.97110	1.0;0.999;0.838;0.998	T	0.74272	-0.3719	10	0.87932	D	0	-13.8439	20.2182	0.98305	0.0:1.0:0.0:0.0	.	479;431;468;441	E7EPN4;Q7Z4J5;Q06455;Q06455-2	.;.;MTG8_HUMAN;.	M	468;441;468;431;431;431;479;441	ENSP00000428543:V468M;ENSP00000379520:V441M;ENSP00000265814:V468M;ENSP00000353504:V431M;ENSP00000390137:V431M;ENSP00000428742:V431M;ENSP00000402257:V479M;ENSP00000430728:V441M	ENSP00000265814:V468M	V	-	1	0	RUNX1T1	93052199	1.000000	0.71417	0.976000	0.42696	0.917000	0.54804	7.818000	0.86416	2.785000	0.95823	0.655000	0.94253	GTG	RUNX1T1	-	prints_ETO	ENSG00000079102		0.617	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	-	0.00	27	0	C	NM_004349, NM_175635		92983023	-1	tier1	-	no_errors	ENST00000436581	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34115234	34115234	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:34115234G>T	ENST00000389232.4	+	81	11103	c.11033G>T	c.(11032-11034)gGa>gTa	p.G3678V	RYR3_ENST00000415757.3_Missense_Mutation_p.G3673V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3678					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAGGATGCTGGATTCTTTCAA	0.433																																																	0													114.0	109.0	111.0					15																	34115234		1844	4107	5951	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11033G>T	15.37:g.34115234G>T	ENSP00000373884:p.Gly3678Val		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.G3678V	ENST00000389232.4	37	c.11033	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710735	0.68730	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.89875	-2.58	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.94138	0.8120	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76575	0.973;0.988	D	0.94025	0.7296	10	0.62326	D	0.03	.	19.2535	0.93935	0.0:0.0:1.0:0.0	.	3673;3678	Q15413-2;Q15413	.;RYR3_HUMAN	V	3678;3677;3673	ENSP00000373884:G3678V	ENSP00000354735:G3673V	G	+	2	0	RYR3	31902526	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.601000	0.98297	2.780000	0.95670	0.655000	0.94253	GGA	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.433	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	58	0	G			34115234	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
SAFB2	9667	genome.wustl.edu	37	19	5621406	5621406	+	Splice_Site	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:5621406G>A	ENST00000252542.4	-	2	452	c.188C>T	c.(187-189)gCg>gTg	p.A63V	SAFB_ENST00000433404.1_5'Flank|SAFB_ENST00000538656.1_5'Flank|SAFB_ENST00000454510.1_5'Flank|SAFB_ENST00000292123.5_5'Flank|SAFB_ENST00000592224.1_5'Flank|SAFB_ENST00000588852.1_5'Flank	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	63	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TTCTTTAACCGCCTATTAGGG	0.438																																					Ovarian(127;888 1728 23957 44128 52668)												0													209.0	194.0	199.0					19																	5621406		2203	4300	6503	SO:0001630	splice_region_variant	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.187-1C>T	19.37:g.5621406G>A			B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.A63V	ENST00000252542.4	37	c.188	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995038	0.74703	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542;ENST00000536849	T	0.14640	2.49	4.35	4.35	0.52113	DNA-binding SAP (4);	0.000000	0.45867	D	0.000336	T	0.34250	0.0891	M	0.85542	2.76	0.80722	D	1	D;P	0.56521	0.976;0.916	P;B	0.53224	0.721;0.239	T	0.43750	-0.9372	10	0.56958	D	0.05	-22.4484	16.8731	0.86044	0.0:0.0:1.0:0.0	.	63;63	A0PJ47;Q14151	.;SAFB2_HUMAN	V	63;63;63;63;42	ENSP00000252542:A63V	ENSP00000252542:A63V	A	-	2	0	SAFB2	5572406	1.000000	0.71417	0.798000	0.32154	0.331000	0.28603	7.831000	0.86748	1.962000	0.57031	0.462000	0.41574	GCG	SAFB2	-	pfam_SAP_dom,smart_SAP_dom,pfscan_SAP_dom	ENSG00000130254		0.438	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	-	0.00	36	0	G	NM_014649	Missense_Mutation	5621406	-1	tier1	-	no_errors	ENST00000252542	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.997	A
SAMD9L	219285	genome.wustl.edu	37	7	92761406	92761406	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr7:92761406G>T	ENST00000318238.4	-	5	5095	c.3879C>A	c.(3877-3879)agC>agA	p.S1293R	SAMD9L_ENST00000411955.1_Missense_Mutation_p.S1293R|SAMD9L_ENST00000437805.1_Missense_Mutation_p.S1293R	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1293					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TGACTTTCTTGCTTAACATGA	0.338																																																	0													79.0	83.0	81.0					7																	92761406		2200	4300	6500	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.3879C>A	7.37:g.92761406G>T	ENSP00000326247:p.Ser1293Arg		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.S1293R	ENST00000318238.4	37	c.3879	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.593377	0.00864	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.21031	2.03;2.03;2.03	5.22	-0.417	0.12347	.	0.883664	0.10088	N	0.717558	T	0.10508	0.0257	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33317	-0.9873	10	0.06236	T	0.91	-0.3114	13.4868	0.61371	0.0724:0.494:0.4335:0.0	.	1293	Q8IVG5	SAM9L_HUMAN	R	1293	ENSP00000326247:S1293R;ENSP00000405760:S1293R;ENSP00000408796:S1293R	ENSP00000326247:S1293R	S	-	3	2	SAMD9L	92599342	0.000000	0.05858	0.413000	0.26509	0.709000	0.40893	-2.228000	0.01209	0.029000	0.15352	0.467000	0.42956	AGC	SAMD9L	-	NULL	ENSG00000177409		0.338	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1		0.00	27	0	G	NM_152703		92761406	-1			no_errors	ENST00000318238	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
SAMSN1	64092	genome.wustl.edu	37	21	15882700	15882700	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr21:15882700G>A	ENST00000400566.1	-	5	573	c.492C>T	c.(490-492)ttC>ttT	p.F164F	SAMSN1_ENST00000285670.2_Silent_p.F232F|SAMSN1_ENST00000400564.1_Intron	NM_022136.4	NP_071419.3	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	164					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)	p.F164F(1)		breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CACGGCCACAGAATGGTCCTG	0.493																																																	1	Substitution - coding silent(1)	prostate(1)											132.0	130.0	131.0					21																	15882700		2157	4276	6433	SO:0001819	synonymous_variant	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000400566.1:c.492C>T	21.37:g.15882700G>A			B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Silent	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.F164	ENST00000400566.1	37	c.492	CCDS42906.1	21																																																																																			SAMSN1	-	pfam_rSAM/SH3_domain-containing,superfamily_SH3_domain	ENSG00000155307		0.493	SAMSN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157914.1	-	0.00	35	0	G			15882700	-1	tier1	-	no_errors	ENST00000400566	ensembl	human	known	74_37	silent	44.07	33	26	SNP	1.000	A
SCRIB	23513	genome.wustl.edu	37	8	144893398	144893398	+	Missense_Mutation	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:144893398A>T	ENST00000320476.3	-	10	1030	c.1024T>A	c.(1024-1026)Ttg>Atg	p.L342M	SCRIB_ENST00000377533.3_Missense_Mutation_p.L261M|MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000356994.2_Missense_Mutation_p.L342M	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	342	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TTGTCCCTCAAGGAGAGGACG	0.667																																					Pancreas(51;966 1133 10533 14576 29674)												0													30.0	25.0	26.0					8																	144893398		2199	4297	6496	SO:0001583	missense	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.1024T>A	8.37:g.144893398A>T	ENSP00000322938:p.Leu342Met		Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	pfam_PDZ,pfam_Leu-rich_rpt,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.L342M	ENST00000320476.3	37	c.1024	CCDS6411.1	8	.	.	.	.	.	.	.	.	.	.	A	12.27	1.888516	0.33348	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.70164	1.64;-0.46;1.1	3.28	-0.443	0.12249	.	.	.	.	.	T	0.72961	0.3526	M	0.66560	2.04	0.48511	D	0.999669	D;D	0.76494	0.999;0.961	D;P	0.73708	0.981;0.848	T	0.70051	-0.4978	9	0.87932	D	0	.	3.54	0.07807	0.3086:0.2487:0.4427:0.0	.	342;342	Q14160;Q14160-3	SCRIB_HUMAN;.	M	342;342;261	ENSP00000349486:L342M;ENSP00000322938:L342M;ENSP00000366756:L261M	ENSP00000322938:L342M	L	-	1	2	SCRIB	144965386	0.005000	0.15991	0.242000	0.24170	0.002000	0.02628	0.020000	0.13466	0.050000	0.15949	-0.460000	0.05396	TTG	SCRIB	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000180900		0.667	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCRIB	HGNC	protein_coding	OTTHUMT00000382215.1		0.00	29	0	A	NM_015356		144893398	-1			no_errors	ENST00000320476	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.831	T
SEC14L2	23541	genome.wustl.edu	37	22	30811775	30811775	+	Missense_Mutation	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr22:30811775A>G	ENST00000312932.9	+	9	952	c.692A>G	c.(691-693)cAt>cGt	p.H231R	SEC14L2_ENST00000405717.3_Missense_Mutation_p.H231R|SEC14L2_ENST00000403484.1_Missense_Mutation_p.H157R|SEC14L2_ENST00000402592.3_Missense_Mutation_p.H148R|RP4-539M6.19_ENST00000439838.1_Missense_Mutation_p.H65R	NM_012429.3	NP_036561.1	O76054	S14L2_HUMAN	SEC14-like 2 (S. cerevisiae)	231	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cholesterol biosynthetic process (GO:0045540)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	10					Vitamin E(DB00163)	TTACTGAAACATATCAGCCCT	0.502																																																	0													58.0	54.0	55.0					22																	30811775		2203	4300	6503	SO:0001583	missense	0			AL096881	CCDS13876.1, CCDS46685.1, CCDS56228.1	22q12.2	2010-08-19	2001-11-28		ENSG00000100003	ENSG00000100003			10699	protein-coding gene	gene with protein product	"""supernatant protein factor"""	607558	"""SEC14 (S. cerevisiae)-like 2"""	C22orf6		10591208	Standard	NM_033382		Approved	TAP, SPF, KIAA1186, KIAA1658	uc003ahr.3	O76054	OTTHUMG00000151024	ENST00000312932.9:c.692A>G	22.37:g.30811775A>G	ENSP00000316203:p.His231Arg		B7Z8Q1|F5H3U4|Q53EQ2|Q6PD61|Q9ULN4	Missense_Mutation	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.H231R	ENST00000312932.9	37	c.692	CCDS13876.1	22	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349603	0.41599	.	.	ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000100003;ENSG00000249590	ENST00000312932;ENST00000428195;ENST00000403484;ENST00000405717;ENST00000402592;ENST00000439838	T;T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69;1.69	5.31	4.27	0.50696	Cellular retinaldehyde-binding/triple function, C-terminal (5);	0.307847	0.36932	N	0.002322	T	0.16769	0.0403	L	0.37697	1.125	0.80722	D	1	P;B;B;B;B;B	0.37466	0.596;0.057;0.029;0.269;0.003;0.176	B;B;B;B;B;B	0.24974	0.056;0.026;0.026;0.057;0.006;0.056	T	0.03423	-1.1038	10	0.38643	T	0.18	-0.0979	11.4972	0.50415	0.8656:0.0:0.0:0.1344	.	148;177;231;157;231;231	F5H3U4;B7Z3Z8;B2RAW8;B3KRD8;O76054;O76054-4	.;.;.;.;S14L2_HUMAN;.	R	231;177;157;231;148;65	ENSP00000316203:H231R;ENSP00000387781:H177R;ENSP00000383993:H157R;ENSP00000385186:H231R;ENSP00000383882:H148R;ENSP00000415178:H65R	ENSP00000415178:H65R	H	+	2	0	RP4-539M6.19;SEC14L2	29141775	0.901000	0.30685	0.429000	0.26710	0.989000	0.77384	6.822000	0.75277	1.019000	0.39547	0.528000	0.53228	CAT	SEC14L2	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000100003		0.502	SEC14L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L2	HGNC	protein_coding	OTTHUMT00000321018.4	-	0.00	21	0	A	NM_012429		30811775	+1	tier1	-	no_errors	ENST00000312932	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.872	G
SEPT8	23176	genome.wustl.edu	37	5	132096666	132096666	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:132096666G>T	ENST00000378719.2	-	9	1351	c.1114C>A	c.(1114-1116)Cac>Aac	p.H372N	SEPT8_ENST00000378706.1_Missense_Mutation_p.H372N|SEPT8_ENST00000378701.1_Missense_Mutation_p.H370N|SEPT8_ENST00000378721.4_Missense_Mutation_p.H370N|SEPT8_ENST00000481030.1_5'Flank|SEPT8_ENST00000296873.7_Missense_Mutation_p.H372N|SEPT8_ENST00000458488.2_Missense_Mutation_p.H372N|SEPT8_ENST00000378699.2_Missense_Mutation_p.H312N|SEPT8_ENST00000448933.1_Missense_Mutation_p.H312N	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	372					cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)	p.H372N(1)	SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CGCTTCAGGTGCTCAAACTTC	0.622																																																	1	Substitution - Missense(1)	ovary(1)											81.0	85.0	84.0					5																	132096666		1985	4146	6131	SO:0001583	missense	0			AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.1114C>A	5.37:g.132096666G>T	ENSP00000367991:p.His372Asn		A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.H372N	ENST00000378719.2	37	c.1114	CCDS43358.1	5	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717061	0.48622	.	.	ENSG00000164402	ENST00000378719;ENST00000378721;ENST00000296873;ENST00000448933;ENST00000378706;ENST00000378699;ENST00000378701;ENST00000458488	D;D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.34	3.47	0.39725	.	0.113488	0.64402	D	0.000008	T	0.73659	0.3615	L	0.29908	0.895	0.39396	D	0.966504	B;B;B;B	0.29571	0.016;0.033;0.249;0.058	B;B;B;B	0.25614	0.009;0.013;0.062;0.03	T	0.73936	-0.3825	10	0.49607	T	0.09	.	14.3863	0.66947	0.0:0.0:0.7314:0.2686	.	370;370;372;372	B7ZVZ1;A6NFQ9;F6W7K9;Q92599	.;.;.;SEPT8_HUMAN	N	372;370;372;312;372;312;370;372	ENSP00000367991:H372N;ENSP00000367993:H370N;ENSP00000296873:H372N;ENSP00000399840:H312N;ENSP00000367978:H372N;ENSP00000367971:H312N;ENSP00000367973:H370N;ENSP00000394766:H372N	ENSP00000296873:H372N	H	-	1	0	SEPT8	132124565	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.807000	0.86032	1.233000	0.43693	0.655000	0.94253	CAC	SEPT8	-	pirsf_Septin	ENSG00000164402		0.622	SEPT8-002	KNOWN	basic|CCDS	protein_coding	SEPT8	HGNC	protein_coding	OTTHUMT00000132827.2		0.00	24	0	G	XM_034872		132096666	-1			no_errors	ENST00000378719	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SH3RF2	153769	genome.wustl.edu	37	5	145439666	145439666	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:145439666G>T	ENST00000511217.1	+	8	1845	c.1793G>T	c.(1792-1794)aGc>aTc	p.S598I	SH3RF2_ENST00000359120.4_Missense_Mutation_p.S598I|SH3RF2_ENST00000511705.1_3'UTR			Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	598					negative regulation of phosphatase activity (GO:0010923)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)	22			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGCGGCCAGCTCCCTCATT	0.617																																																	0													56.0	62.0	60.0					5																	145439666		2203	4300	6503	SO:0001583	missense	0			AL833297	CCDS4280.1	5q32	2013-01-09	2011-11-04	2011-11-04	ENSG00000156463	ENSG00000156463		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	26299	protein-coding gene	gene with protein product	"""heart protein phosphatase 1-binding protein"", ""POSH-eliminating RING protein"""	613377	"""protein phosphatase 1, regulatory subunit 39"""	PPP1R39		22128169	Standard	NM_152550		Approved	FLJ23654, RNF158, Hepp1, POSHER	uc003lnt.3	Q8TEC5	OTTHUMG00000129685	ENST00000511217.1:c.1793G>T	5.37:g.145439666G>T	ENSP00000424497:p.Ser598Ile		A8K961|Q08AM9|Q6GMR9|Q8N5S8|Q96LP8	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_SH3_domain	p.S598I	ENST00000511217.1	37	c.1793	CCDS4280.1	5	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644536	0.47258	.	.	ENSG00000156463	ENST00000359120;ENST00000511217	T;T	0.22743	1.94;1.94	5.73	1.89	0.25635	.	0.304848	0.36134	N	0.002770	T	0.27832	0.0685	L	0.46157	1.445	0.25165	N	0.990329	P;P	0.52061	0.95;0.938	P;P	0.55455	0.776;0.603	T	0.03278	-1.1053	10	0.51188	T	0.08	-12.178	8.5542	0.33471	0.3137:0.0:0.6863:0.0	.	89;598	Q8TEC5-2;Q8TEC5	.;SH3R2_HUMAN	I	598	ENSP00000352028:S598I;ENSP00000424497:S598I	ENSP00000352028:S598I	S	+	2	0	SH3RF2	145419859	0.997000	0.39634	0.764000	0.31436	0.204000	0.24138	2.430000	0.44766	0.748000	0.32831	0.536000	0.68110	AGC	SH3RF2	-	NULL	ENSG00000156463		0.617	SH3RF2-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SH3RF2	HGNC	protein_coding	OTTHUMT00000372804.1		0.00	104	0	G	NM_152550		145439666	+1			no_errors	ENST00000359120	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.899	T
SIK1	150094	genome.wustl.edu	37	21	44838214	44838214	+	Frame_Shift_Del	DEL	C	C	-	rs372101645		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr21:44838214delC	ENST00000270162.6	-	12	1802	c.1670delG	c.(1669-1671)ggcfs	p.G557fs		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	557					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	TCCTCCCAAGCCCCCCTGAGC	0.697																																																	0													30.0	32.0	32.0					21																	44838214		2201	4300	6501	SO:0001589	frameshift_variant	0			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1670delG	21.37:g.44838214delC	ENSP00000270162:p.Gly557fs		A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G557fs	ENST00000270162.6	37	c.1670	CCDS33575.1	21																																																																																			SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000142178		0.697	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1		0.00	12	0	C	NM_173354		44838214	-1	tier1		no_errors	ENST00000270162	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.991	-
SIRPG	55423	genome.wustl.edu	37	20	1615955	1615955	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:1615955C>A	ENST00000303415.3	-	4	1103	c.1039G>T	c.(1039-1041)Gtc>Ttc	p.V347F	SIRPG_ENST00000216927.4_Intron|SIRPG_ENST00000344103.4_Intron|RP11-77C3.3_ENST00000437384.1_RNA|SIRPG_ENST00000381583.2_Intron|RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Missense_Mutation_p.V314F	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma	347					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						TGGACTGTGACCTCTAGGGCA	0.468																																																	0													87.0	76.0	80.0					20																	1615955		2203	4300	6503	SO:0001583	missense	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.1039G>T	20.37:g.1615955C>A	ENSP00000305529:p.Val347Phe		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V347F	ENST00000303415.3	37	c.1039	CCDS13020.2	20	.	.	.	.	.	.	.	.	.	.	.	4.175	0.031131	0.08101	.	.	ENSG00000089012	ENST00000381580;ENST00000303415	T;T	0.13538	3.0;2.58	1.6	-0.91	0.10511	.	1.968200	0.02332	N	0.074046	T	0.13372	0.0324	L	0.44542	1.39	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.32666	-0.9898	10	0.46703	T	0.11	.	5.7139	0.17950	0.5599:0.4401:0.0:0.0	.	347	Q9P1W8	SIRPG_HUMAN	F	314;347	ENSP00000370992:V314F;ENSP00000305529:V347F	ENSP00000305529:V347F	V	-	1	0	SIRPG	1563955	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.070000	0.11523	-0.215000	0.10063	0.195000	0.17529	GTC	SIRPG	-	smart_Ig_sub	ENSG00000089012		0.468	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPG	HGNC	protein_coding	OTTHUMT00000077566.2	-	0.00	61	0	C	NM_018556		1615955	-1	tier1	-	no_errors	ENST00000303415	ensembl	human	known	74_37	missense	36.63	64	37	SNP	0.001	A
SLC41A3	54946	genome.wustl.edu	37	3	125741672	125741672	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:125741672C>T	ENST00000315891.6	-	6	940	c.702G>A	c.(700-702)ctG>ctA	p.L234L	SLC41A3_ENST00000383598.2_Silent_p.L208L|SLC41A3_ENST00000346785.5_Silent_p.L198L|SLC41A3_ENST00000360370.4_Silent_p.L234L|SLC41A3_ENST00000508835.1_Silent_p.L117L|SLC41A3_ENST00000514023.1_5'Flank	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		CCAGAATGGACAGTGTGATGA	0.532																																																	0													187.0	181.0	183.0					3																	125741672		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.702G>A	3.37:g.125741672C>T			A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Silent	SNP	pfam_SLC41_membr_dom,superfamily_Acyl_Trfase/lysoPLipase	p.L234	ENST00000315891.6	37	c.702	CCDS33843.1	3																																																																																			SLC41A3	-	pfam_SLC41_membr_dom	ENSG00000114544		0.532	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	HGNC	protein_coding	OTTHUMT00000370886.1		0.00	58	0	C	NM_017836		125741672	-1			no_errors	ENST00000315891	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.989	T
SKIL	6498	genome.wustl.edu	37	3	170110118	170110118	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:170110118G>T	ENST00000458537.3	+	6	2677	c.1968G>T	c.(1966-1968)caG>caT	p.Q656H	SKIL_ENST00000259119.4_Missense_Mutation_p.Q656H|SKIL_ENST00000413427.2_Missense_Mutation_p.Q610H|SKIL_ENST00000426052.2_Missense_Mutation_p.Q636H	NM_001145097.2|NM_001248008.1|NM_005414.4	NP_001138569.1|NP_001234937.1|NP_005405.2	P12757	SKIL_HUMAN	SKI-like proto-oncogene	656					blastocyst formation (GO:0001825)|cell cycle arrest (GO:0007050)|gene expression (GO:0010467)|lens fiber cell differentiation (GO:0070306)|lymphocyte homeostasis (GO:0002260)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of axonogenesis (GO:0050772)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|protein heterotrimerization (GO:0070208)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|response to antibiotic (GO:0046677)|response to cytokine (GO:0034097)|response to growth factor (GO:0070848)|skeletal muscle tissue development (GO:0007519)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|protein complex binding (GO:0032403)|protein domain specific binding (GO:0019904)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	25	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AACTCAGACAGGAACGGGAAG	0.403																																																	0													117.0	125.0	122.0					3																	170110118		2203	4300	6503	SO:0001583	missense	0			X15217	CCDS33890.1, CCDS46953.1, CCDS46954.1	3q26	2014-06-25	2014-06-25		ENSG00000136603	ENSG00000136603		"""SKI transcriptional corepressors"""	10897	protein-coding gene	gene with protein product		165340	"""SKI-like oncogene"""			2762147	Standard	NM_005414		Approved	SNO, SnoN, SnoA	uc003fgw.3	P12757	OTTHUMG00000158831	ENST00000458537.3:c.1968G>T	3.37:g.170110118G>T	ENSP00000415243:p.Gln656His		A6NGT1|B4DT50|O00464|P12756|Q07501	Missense_Mutation	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.Q656H	ENST00000458537.3	37	c.1968	CCDS33890.1	3	.	.	.	.	.	.	.	.	.	.	G	16.19	3.054407	0.55218	.	.	ENSG00000136603	ENST00000259119;ENST00000426052;ENST00000413427;ENST00000458537	D;D;D;D	0.91577	-2.86;-2.86;-2.87;-2.86	6.08	6.08	0.98989	.	0.119810	0.52532	D	0.000073	D	0.84352	0.5453	L	0.42245	1.32	0.38019	D	0.934787	P;B	0.38827	0.649;0.369	B;B	0.32149	0.132;0.141	D	0.84033	0.0360	10	0.33940	T	0.23	-13.1135	10.5332	0.44988	0.0679:0.0:0.7993:0.1329	.	610;656	P12757-3;P12757	.;SKIL_HUMAN	H	656;636;610;656	ENSP00000259119:Q656H;ENSP00000406520:Q636H;ENSP00000400193:Q610H;ENSP00000415243:Q656H	ENSP00000259119:Q656H	Q	+	3	2	SKIL	171592812	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	1.383000	0.34385	2.894000	0.99253	0.655000	0.94253	CAG	SKIL	-	NULL	ENSG00000136603		0.403	SKIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIL	HGNC	protein_coding	OTTHUMT00000352351.4	-	0.00	28	0	G	NM_005414		170110118	+1	tier1	-	no_errors	ENST00000259119	ensembl	human	known	74_37	missense	21.74	36	10	SNP	1.000	T
SLCO3A1	28232	genome.wustl.edu	37	15	92715088	92715088	+	Missense_Mutation	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:92715088G>A	ENST00000424469.2	+	11	2128	c.2075G>A	c.(2074-2076)aGc>aAc	p.S692N	RP11-152L20.3_ENST00000561674.1_RNA|RP11-24J19.1_ENST00000557683.1_RNA	NM_001145044.1	NP_001138516.1	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	0					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	TTTGTGAGAAGCTGAGGGCCT	0.572																																																	0													85.0	85.0	85.0					15																	92715088		687	1589	2276	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000424469.2:c.2075G>A	15.37:g.92715088G>A	ENSP00000387846:p.Ser692Asn		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.S692N	ENST00000424469.2	37	c.2075	CCDS45354.1	15	.	.	.	.	.	.	.	.	.	.	G	21.4	4.139456	0.77775	.	.	ENSG00000176463	ENST00000424469	T	0.38560	1.13	5.38	5.38	0.77491	.	.	.	.	.	T	0.34513	0.0900	.	.	.	0.21445	N	0.999686	B	0.33238	0.403	B	0.26969	0.075	T	0.32745	-0.9895	8	0.66056	D	0.02	.	14.5121	0.67794	0.0:0.0:1.0:0.0	.	692	Q9UIG8-2	.	N	692	ENSP00000387846:S692N	ENSP00000387846:S692N	S	+	2	0	SLCO3A1	90516092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.982000	0.56909	2.793000	0.96121	0.655000	0.94253	AGC	SLCO3A1	-	NULL	ENSG00000176463		0.572	SLCO3A1-002	PUTATIVE	basic|exp_conf|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000414816.1	-	0.00	47	0	G	NM_013272		92715088	+1	tier1	-	no_errors	ENST00000424469	ensembl	human	putative	74_37	missense	37.78	28	17	SNP	1.000	A
SMG5	23381	genome.wustl.edu	37	1	156219653	156219653	+	3'UTR	SNP	C	C	T	rs139293673	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:156219653C>T	ENST00000361813.5	-	0	3920				PAQR6_ENST00000540423.1_5'Flank|PAQR6_ENST00000292291.5_5'Flank|PAQR6_ENST00000356983.2_5'Flank|PAQR6_ENST00000492619.1_5'Flank|PAQR6_ENST00000368270.1_5'Flank|SMG5_ENST00000368267.5_Missense_Mutation_p.S334N|PAQR6_ENST00000335852.1_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					ACAGGCCAGACTGCCTGCAGC	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.*725G>A	1.37:g.156219653C>T			D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1	p.S334N	ENST00000361813.5	37	c.1001	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	C	0.242	-1.013142	0.02095	.	.	ENSG00000198952	ENST00000368267	.	.	.	3.23	1.28	0.21552	.	.	.	.	.	T	0.19805	0.0476	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21314	-1.0249	5	0.41790	T	0.15	.	8.115	0.30937	0.0:0.765:0.0:0.235	.	.	.	.	N	334	.	ENSP00000357250:S334N	S	-	2	0	SMG5	154486277	0.000000	0.05858	0.009000	0.14445	0.002000	0.02628	0.059000	0.14322	-0.051000	0.13334	-1.134000	0.01955	AGT	SMG5	-	NULL	ENSG00000198952		0.627	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	-	0.00	41	0	C	NM_015327		156219653	-1	tier1	-	no_errors	ENST00000368267	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.011	T
SNCG	6623	genome.wustl.edu	37	10	88719881	88719881	+	Missense_Mutation	SNP	G	G	A	rs371074090		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:88719881G>A	ENST00000372017.3	+	3	329	c.287G>A	c.(286-288)cGc>cAc	p.R96H	SNCG_ENST00000483064.1_3'UTR|SNCG_ENST00000348795.4_Silent_p.A113A|MMRN2_ENST00000372027.5_5'Flank	NM_003087.2	NP_003078.2	O76070	SYUG_HUMAN	synuclein, gamma (breast cancer-specific protein 1)	96					adult locomotory behavior (GO:0008344)|aggressive behavior (GO:0002118)|cellular response to hydrostatic pressure (GO:0071464)|protein secretion (GO:0009306)|regulation of dopamine secretion (GO:0014059)|regulation of neurotransmitter secretion (GO:0046928)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				endometrium(1)|skin(1)	2						GGGGTGGTGCGCAAGGTGAGC	0.672																																																	0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	69.0	62.0	65.0		287	2.8	1.0	10		65	0,8600		0,0,4300	no	missense	SNCG	NM_003087.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	96/128	88719881	1,13005	2203	4300	6503	SO:0001583	missense	0			AF044311	CCDS7380.1	10q23.2-q23.3	2006-06-28			ENSG00000173267	ENSG00000173267			11141	protein-coding gene	gene with protein product	"""synoretin"""	602998				9044857, 9700196	Standard	NM_003087		Approved	BCSG1, SR, persyn	uc001keb.2	O76070	OTTHUMG00000018656	ENST00000372017.3:c.287G>A	10.37:g.88719881G>A	ENSP00000361087:p.Arg96His		O15104|Q96P61	Missense_Mutation	SNP	pfam_Synuclein,prints_Synuclein,prints_Synuclein_gamma	p.R96H	ENST00000372017.3	37	c.287	CCDS7380.1	10	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630795	0.46944	2.27E-4	0.0	ENSG00000173267	ENST00000372017	D	0.84146	-1.81	4.69	2.8	0.32819	.	0.229092	0.39834	N	0.001257	T	0.75583	0.3869	L	0.36672	1.1	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.65643	-0.6118	10	0.59425	D	0.04	-19.0272	6.2121	0.20636	0.3986:0.0:0.6014:0.0	.	96	O76070	SYUG_HUMAN	H	96	ENSP00000361087:R96H	ENSP00000361087:R96H	R	+	2	0	SNCG	88709861	0.008000	0.16893	0.995000	0.50966	0.932000	0.56968	0.753000	0.26376	0.561000	0.29186	0.561000	0.74099	CGC	SNCG	-	pfam_Synuclein,prints_Synuclein,prints_Synuclein_gamma	ENSG00000173267		0.672	SNCG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCG	HGNC	protein_coding	OTTHUMT00000049167.1	-	0.00	29	0	G			88719881	+1	tier1	-	no_errors	ENST00000372017	ensembl	human	known	74_37	missense	31.58	26	12	SNP	0.052	A
SNHG14	104472715	genome.wustl.edu	37	15	25339239	25339239	+	RNA	SNP	A	A	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:25339239A>T	ENST00000546682.1	+	0	1110				SNHG14_ENST00000549804.2_RNA|SNHG14_ENST00000553108.1_RNA|SNORD116-23_ENST00000384645.1_RNA|SNORD116-24_ENST00000384549.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		AAAATGAGTGAAAACTCTATA	0.408																																																	0													233.0	206.0	214.0					15																	25339239		876	1991	2867			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25339239A>T				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNORD116-24	-	-	ENSG00000207279		0.408	SNHG14-022	KNOWN	basic	antisense	SNORD116-24	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	104	0	A			25339239	+1	tier1	-	no_errors	ENST00000384549	ensembl	human	known	74_37	rna	44.66	57	46	SNP	0.919	T
SPATA31E1	286234	genome.wustl.edu	37	9	90503680	90503680	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:90503680G>T	ENST00000325643.5	+	4	4344	c.4278G>T	c.(4276-4278)tcG>tcT	p.S1426S		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1426					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAAGCACCTCGGGCGGCCCCC	0.622																																																	0													24.0	28.0	26.0					9																	90503680		2202	4296	6498	SO:0001819	synonymous_variant	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.4278G>T	9.37:g.90503680G>T			B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	NULL	p.S1426	ENST00000325643.5	37	c.4278	CCDS6676.1	9																																																																																			SPATA31E1	-	NULL	ENSG00000177992		0.622	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	-	0.00	38	0	G	NM_178828		90503680	+1	tier1	-	no_errors	ENST00000325643	ensembl	human	known	74_37	silent	21.88	25	7	SNP	0.000	T
SPATA33	124045	genome.wustl.edu	37	16	89724680	89724680	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:89724680C>T	ENST00000301031.4	+	2	59	c.59C>T	c.(58-60)aCc>aTc	p.T20I	CHMP1A_ENST00000535997.2_5'Flank|CHMP1A_ENST00000253475.5_5'Flank|SPATA33_ENST00000568929.1_5'UTR|SPATA33_ENST00000579310.1_Missense_Mutation_p.T21I|CHMP1A_ENST00000397901.3_5'Flank|CHMP1A_ENST00000550102.1_5'Flank|CHMP1A_ENST00000547614.1_5'Flank	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	20						cytoplasm (GO:0005737)|nucleus (GO:0005634)											AAGGGATCCACCTATTCAGTT	0.532																																																	0													83.0	87.0	86.0					16																	89724680		2198	4300	6498	SO:0001583	missense	0			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.59C>T	16.37:g.89724680C>T	ENSP00000301031:p.Thr20Ile		A8WFL2|B4DZN8	Missense_Mutation	SNP	NULL	p.T21I	ENST00000301031.4	37	c.62	CCDS10983.1	16	.	.	.	.	.	.	.	.	.	.	C	5.844	0.339902	0.11069	.	.	ENSG00000167523	ENST00000301031;ENST00000457689	T	0.43294	0.95	3.03	-0.176	0.13311	.	.	.	.	.	T	0.20333	0.0489	N	0.12182	0.205	0.09310	N	1	B;B;B	0.10296	0.001;0.001;0.003	B;B;B	0.09377	0.002;0.003;0.004	T	0.21280	-1.0250	9	0.24483	T	0.36	.	5.3138	0.15845	0.0:0.6037:0.1715:0.2248	.	21;34;20	B4DZN8;Q86XC3;Q96N06	.;.;CP055_HUMAN	I	20;21	ENSP00000301031:T20I	ENSP00000301031:T20I	T	+	2	0	C16orf55	88252181	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.010000	0.12743	-0.207000	0.10187	-0.962000	0.02626	ACC	SPATA33	-	NULL	ENSG00000167523		0.532	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA33	HGNC	protein_coding	OTTHUMT00000269924.2	-	0.00	77	0	C	NM_153025		89724680	+1	tier1	-	no_errors	ENST00000579310	ensembl	human	known	74_37	missense	22.32	87	25	SNP	0.000	T
SPATA33	124045	genome.wustl.edu	37	16	89724682	89724682	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:89724682T>C	ENST00000301031.4	+	2	61	c.61T>C	c.(61-63)Tat>Cat	p.Y21H	CHMP1A_ENST00000535997.2_5'Flank|CHMP1A_ENST00000253475.5_5'Flank|SPATA33_ENST00000568929.1_5'UTR|SPATA33_ENST00000579310.1_Missense_Mutation_p.Y22H|CHMP1A_ENST00000397901.3_5'Flank|CHMP1A_ENST00000550102.1_5'Flank|CHMP1A_ENST00000547614.1_5'Flank	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	21						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGGATCCACCTATTCAGTTCC	0.532																																																	0													82.0	86.0	85.0					16																	89724682		2198	4300	6498	SO:0001583	missense	0			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.61T>C	16.37:g.89724682T>C	ENSP00000301031:p.Tyr21His		A8WFL2|B4DZN8	Missense_Mutation	SNP	NULL	p.Y22H	ENST00000301031.4	37	c.64	CCDS10983.1	16	.	.	.	.	.	.	.	.	.	.	T	9.897	1.205793	0.22205	.	.	ENSG00000167523	ENST00000301031;ENST00000457689	T	0.44881	0.91	3.03	-6.06	0.02165	.	.	.	.	.	T	0.19685	0.0473	N	0.14661	0.345	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.15954	-1.0419	9	0.46703	T	0.11	.	4.595	0.12325	0.3261:0.4218:0.0:0.2521	.	22;35;21	B4DZN8;Q86XC3;Q96N06	.;.;CP055_HUMAN	H	21;22	ENSP00000301031:Y21H	ENSP00000301031:Y21H	Y	+	1	0	C16orf55	88252183	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.826000	0.01705	-1.693000	0.01427	-2.525000	0.00183	TAT	SPATA33	-	NULL	ENSG00000167523		0.532	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA33	HGNC	protein_coding	OTTHUMT00000269924.2	-	0.00	79	0	T	NM_153025		89724682	+1	tier1	-	no_errors	ENST00000579310	ensembl	human	known	74_37	missense	22.32	87	25	SNP	0.000	C
SPRED3	399473	genome.wustl.edu	37	19	38882864	38882866	+	In_Frame_Del	DEL	CCT	CCT	-	rs151129136		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:38882864_38882866delCCT	ENST00000338502.4	+	3	462_464	c.359_361delCCT	c.(358-363)ccctcc>ccc	p.S128del	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000587013.1_In_Frame_Del_p.S172del|SPRED3_ENST00000586301.1_In_Frame_Del_p.S128del	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	128	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCACTCAccccctcctcctcctc	0.645																																																	0									,	401,4,3395		26,0,349,0,4,1521					,	3.3	0.9		dbSNP_134	44	1035,11,6892		107,0,821,1,9,3031	no	codingComplex,codingComplex	SPRED3	NM_001042522.1,NM_001039616.1	,	133,0,1170,1,13,4552	A1A1,A1A2,A1R,A2A2,A2R,RR		13.1771,10.6579,12.3616	,	,		1436,15,10287				SO:0001651	inframe_deletion	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.359_361delCCT	19.37:g.38882873_38882875delCCT	ENSP00000345405:p.Ser128del		Q2MJR1	In_Frame_Del	DEL	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.S124in_frame_del	ENST00000338502.4	37	c.359_361	CCDS42560.1	19																																																																																			SPRED3	-	NULL	ENSG00000188766		0.645	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1		0.00	24	0	CCT	XM_351191		38882866	+1	tier1		no_errors	ENST00000338502	ensembl	human	known	74_37	in_frame_del	20.00	24	6	DEL	1.000:0.995:0.997	-
SUPV3L1	6832	genome.wustl.edu	37	10	70968805	70968805	+	3'UTR	DEL	T	T	-	rs372365210	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:70968805delT	ENST00000359655.4	+	0	2435					NM_003171.3	NP_003162.2	Q8IYB8	SUV3_HUMAN	suppressor of var1, 3-like 1 (S. cerevisiae)						ATP catabolic process (GO:0006200)|chromatin maintenance (GO:0070827)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|mitochondrial mRNA catabolic process (GO:0000958)|mitochondrial mRNA surveillance (GO:0035946)|mitochondrial ncRNA surveillance (GO:0035945)|mitochondrial RNA 3'-end processing (GO:0000965)|mitochondrial RNA surveillance (GO:2000827)|mitochondrion morphogenesis (GO:0070584)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial RNA catabolic process (GO:0000962)|RNA catabolic process (GO:0006401)	mitochondrial degradosome (GO:0045025)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3'-5' RNA helicase activity (GO:0034458)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TCTGTTCCTGttttttttttt	0.338																																																	0													24.0	24.0	24.0					10																	70968805		2196	4283	6479	SO:0001624	3_prime_UTR_variant	0			AF042169	CCDS7287.1	10q22.1	2008-08-01	2001-11-28		ENSG00000156502	ENSG00000156502			11471	protein-coding gene	gene with protein product		605122	"""suppressor of var1 (S.cerevisiae) 3-like 1"""			9925937, 16176273	Standard	XM_005270068		Approved	SUV3	uc001jpe.1	Q8IYB8	OTTHUMG00000018375	ENST00000359655.4:c.*14T>-	10.37:g.70968805delT			A8K301|O43630	RNA	DEL	-	NULL	ENST00000359655.4	37	NULL	CCDS7287.1	10																																																																																			SUPV3L1	-	-	ENSG00000156502		0.338	SUPV3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPV3L1	HGNC	protein_coding	OTTHUMT00000048396.2		0.00	25	0	T	NM_003171		70968805	+1	tier1		no_errors	ENST00000497254	ensembl	human	known	74_37	rna	10.53	34	4	DEL	0.002	-
GOLGA2	2801	genome.wustl.edu	37	9	131037732	131037732	+	Intron	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr9:131037732C>A	ENST00000421699.2	-	1	97				SWI5_ENST00000608796.1_5'Flank|SWI5_ENST00000418976.1_5'Flank|SWI5_ENST00000419867.2_5'Flank|SWI5_ENST00000495313.1_Silent_p.R16R|SWI5_ENST00000320188.5_5'Flank|GOLGA2_ENST00000609374.1_Intron|GOLGA2_ENST00000490628.1_Intron	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2						mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						CTTGGAGACCCGAGACCAAAG	0.687																																																	0																																										SO:0001627	intron_variant	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.84+439G>T	9.37:g.131037732C>A			Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	pfam_DNA-repair_Swi5	p.R16	ENST00000421699.2	37	c.46	CCDS6896.2	9																																																																																			SWI5	-	NULL	ENSG00000175854		0.687	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SWI5	HGNC	protein_coding	OTTHUMT00000054358.2	-	0.00	83	0	C	NM_004486		131037732	+1	tier1	-	no_errors	ENST00000495313	ensembl	human	putative	74_37	silent	28.36	96	38	SNP	0.005	A
SYNE2	23224	genome.wustl.edu	37	14	64634074	64634074	+	Missense_Mutation	SNP	C	C	T	rs139218000		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:64634074C>T	ENST00000344113.4	+	91	16941	c.16729C>T	c.(16729-16731)Cgg>Tgg	p.R5577W	SYNE2_ENST00000555002.1_Missense_Mutation_p.R2211W|SYNE2_ENST00000358025.3_Missense_Mutation_p.R5577W|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.R1962W|SYNE2_ENST00000394768.2_Missense_Mutation_p.R1962W|SYNE2_ENST00000554584.1_Missense_Mutation_p.R5452W	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5577					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCAATGGATTCGGGCCACGGC	0.478																																																	0								C	TRP/ARG,TRP/ARG	2,4404	4.2+/-10.8	0,2,2201	62.0	60.0	61.0		16729,16729	4.9	1.0	14	dbSNP_134	61	0,8600		0,0,4300	no	missense,missense	SYNE2	NM_015180.4,NM_182914.2	101,101	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	5577/6886,5577/6908	64634074	2,13004	2203	4300	6503	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.16729C>T	14.37:g.64634074C>T	ENSP00000341781:p.Arg5577Trp		Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R5577W	ENST00000344113.4	37	c.16729	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	21.0	4.090098	0.76756	4.54E-4	0.0	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.50813	0.73;4.05;0.74;1.26;4.1;4.05	5.78	4.87	0.63330	.	0.398534	0.21261	N	0.077475	T	0.61540	0.2355	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.76494	0.998;0.998;0.997;0.999	P;P;P;P	0.59221	0.827;0.809;0.676;0.854	T	0.65010	-0.6272	10	0.66056	D	0.02	.	13.9441	0.64073	0.2763:0.7237:0.0:0.0	.	1962;5452;5577;5577	Q8WXH0-7;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;SYNE2_HUMAN;.	W	5577;1962;5577;5452;5458;2211;1962	ENSP00000350719:R5577W;ENSP00000349969:R1962W;ENSP00000341781:R5577W;ENSP00000452570:R5452W;ENSP00000450831:R2211W;ENSP00000378249:R1962W	ENSP00000261678:R5458W	R	+	1	2	SYNE2	63703827	0.989000	0.36119	0.968000	0.41197	0.882000	0.50991	2.798000	0.47884	1.517000	0.48917	0.655000	0.94253	CGG	SYNE2	-	NULL	ENSG00000054654		0.478	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2		0.00	57	0	C	NM_182914		64634074	+1			no_errors	ENST00000358025	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.966	T
SYNJ2	8871	genome.wustl.edu	37	6	158487571	158487571	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:158487571G>T	ENST00000355585.4	+	12	1696	c.1621G>T	c.(1621-1623)Gga>Tga	p.G541*	SYNJ2_ENST00000367122.2_Nonsense_Mutation_p.G541*|SYNJ2_ENST00000367121.3_Nonsense_Mutation_p.G541*|SYNJ2_ENST00000449859.2_Nonsense_Mutation_p.G469*	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	541					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		GAACGTGAACGGAGGAAAGCA	0.582																																																	0													102.0	93.0	96.0					6																	158487571		2203	4300	6503	SO:0001587	stop_gained	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1621G>T	6.37:g.158487571G>T	ENSP00000347792:p.Gly541*		Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Nonsense_Mutation	SNP	pfam_Syja_N,pfam_DUF1866,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.G541*	ENST00000355585.4	37	c.1621	CCDS5254.1	6	.	.	.	.	.	.	.	.	.	.	G	38	6.815988	0.97861	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000449859	.	.	.	5.27	5.27	0.74061	.	0.000000	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9514	0.92642	0.0:0.0:1.0:0.0	.	.	.	.	X	541;541;541;469	.	ENSP00000347792:G541X	G	+	1	0	SYNJ2	158407559	1.000000	0.71417	0.607000	0.28956	0.567000	0.35839	9.746000	0.98859	2.492000	0.84095	0.456000	0.33151	GGA	SYNJ2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc	ENSG00000078269		0.582	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2		0.00	74	0	G			158487571	+1			no_errors	ENST00000355585	ensembl	human	known	74_37	nonsense	6.17	76	5	SNP	1.000	T
TACR3	6870	genome.wustl.edu	37	4	104579403	104579403	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:104579403G>T	ENST00000304883.2	-	2	846	c.706C>A	c.(706-708)Caa>Aaa	p.Q236K		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	236					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TCTGGCCATTGCACAAAGCAG	0.388																																																	0													130.0	121.0	124.0					4																	104579403		2203	4300	6503	SO:0001583	missense	0			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.706C>A	4.37:g.104579403G>T	ENSP00000303325:p.Gln236Lys		Q0P510	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NK3_rcpt,prints_Neurokn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK1_rcpt	p.Q236K	ENST00000304883.2	37	c.706	CCDS3664.1	4	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160901	0.38119	.	.	ENSG00000169836	ENST00000304883	T	0.36878	1.23	6.07	6.07	0.98685	GPCR, rhodopsin-like superfamily (1);	0.165021	0.50627	D	0.000104	T	0.21674	0.0522	N	0.11698	0.16	0.37341	D	0.910406	B	0.17465	0.022	B	0.22152	0.038	T	0.16482	-1.0401	10	0.10377	T	0.69	.	14.4042	0.67071	0.0:0.242:0.758:0.0	.	236	P29371	NK3R_HUMAN	K	236	ENSP00000303325:Q236K	ENSP00000303325:Q236K	Q	-	1	0	TACR3	104798852	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.826000	0.55738	2.885000	0.99019	0.655000	0.94253	CAA	TACR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NK3_rcpt,prints_NK1_rcpt	ENSG00000169836		0.388	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR3	HGNC	protein_coding	OTTHUMT00000253804.1	-	0.00	70	0	G	NM_001059		104579403	-1	tier1	-	no_errors	ENST00000304883	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	T
TAGAP	117289	genome.wustl.edu	37	6	159457254	159457254	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr6:159457254G>T	ENST00000367066.3	-	10	2132	c.1801C>A	c.(1801-1803)Cag>Aag	p.Q601K	RP1-111C20.4_ENST00000607391.1_RNA|RP1-111C20.4_ENST00000607796.1_RNA|TAGAP_ENST00000326965.6_Missense_Mutation_p.Q423K|RP1-111C20.4_ENST00000606466.1_RNA|RP1-111C20.4_ENST00000606470.1_RNA	NM_001278733.1|NM_054114.3	NP_001265662.1|NP_473455.2	Q8N103	TAGAP_HUMAN	T-cell activation RhoGTPase activating protein	601					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|autonomic_ganglia(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(2)|skin(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-16)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GCCGGGCCCTGCATGGCCTCT	0.657																																																	0													35.0	40.0	38.0					6																	159457254		2203	4300	6503	SO:0001583	missense	0			AF385429	CCDS5261.1, CCDS5262.1, CCDS5263.1	6q25.3	2011-09-07	2008-03-25		ENSG00000164691	ENSG00000164691		"""Rho GTPase activating proteins"""	15669	protein-coding gene	gene with protein product		609667	"""T-cell activation GTPase activating protein"""			16375659, 18311140, 18356936	Standard	NM_152133		Approved	FLJ32631, IDDM21, ARHGAP47	uc003qrz.3	Q8N103	OTTHUMG00000015923	ENST00000367066.3:c.1801C>A	6.37:g.159457254G>T	ENSP00000356033:p.Gln601Lys		Q2NKM8|Q8NI40|Q96KZ2|Q96QA2	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q601K	ENST00000367066.3	37	c.1801	CCDS5261.1	6	.	.	.	.	.	.	.	.	.	.	G	1.499	-0.552603	0.03996	.	.	ENSG00000164691	ENST00000367066;ENST00000326965;ENST00000539071	T;T	0.17213	2.29;2.51	5.54	2.72	0.32119	.	1.308200	0.05194	N	0.503670	T	0.03477	0.0100	L	0.34521	1.04	0.09310	N	0.999995	B	0.15473	0.013	B	0.13407	0.009	T	0.40739	-0.9547	10	0.08179	T	0.78	-0.0479	7.3613	0.26748	0.0805:0.0:0.4168:0.5027	.	601	Q8N103	TAGAP_HUMAN	K	601;423;266	ENSP00000356033:Q601K;ENSP00000322650:Q423K	ENSP00000322650:Q423K	Q	-	1	0	TAGAP	159377242	0.999000	0.42202	0.000000	0.03702	0.082000	0.17680	2.758000	0.47565	0.260000	0.21731	0.655000	0.94253	CAG	TAGAP	-	NULL	ENSG00000164691		0.657	TAGAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAGAP	HGNC	protein_coding	OTTHUMT00000042890.1		0.00	17	0	G	NM_054114		159457254	-1			no_errors	ENST00000367066	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.000	T
TAS2R8	50836	genome.wustl.edu	37	12	10959369	10959369	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:10959369G>T	ENST00000240615.2	-	1	523	c.211C>A	c.(211-213)Ctg>Atg	p.L71M		NM_023918.1	NP_076407.1	Q9NYW2	TA2R8_HUMAN	taste receptor, type 2, member 8	71					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						TCTGGGTTCAGTACTATTACA	0.333																																																	0													111.0	107.0	109.0					12																	10959369		2203	4300	6503	SO:0001583	missense	0			AF227134	CCDS8632.1	12p13	2012-08-22			ENSG00000121314	ENSG00000121314		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14915	protein-coding gene	gene with protein product		604794				10761934, 10766242	Standard	NM_023918		Approved	T2R8, TRB5	uc010shh.2	Q9NYW2	OTTHUMG00000168506	ENST00000240615.2:c.211C>A	12.37:g.10959369G>T	ENSP00000240615:p.Leu71Met		Q4KN29|Q645Y2	Missense_Mutation	SNP	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.L71M	ENST00000240615.2	37	c.211	CCDS8632.1	12	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232046	0.39399	.	.	ENSG00000121314	ENST00000240615	T	0.44881	0.91	4.79	-8.05	0.01106	GPCR, rhodopsin-like superfamily (1);	0.513188	0.14712	U	0.302909	T	0.53867	0.1823	M	0.80422	2.495	0.09310	N	1	P	0.37955	0.612	P	0.57846	0.828	T	0.59359	-0.7469	10	0.66056	D	0.02	.	7.4351	0.27150	0.5757:0.219:0.2053:0.0	.	71	Q9NYW2	TA2R8_HUMAN	M	71	ENSP00000240615:L71M	ENSP00000240615:L71M	L	-	1	2	TAS2R8	10850636	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.708000	0.05035	-1.570000	0.01665	-0.971000	0.02607	CTG	TAS2R8	-	pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000121314		0.333	TAS2R8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R8	HGNC	protein_coding	OTTHUMT00000399932.1		0.00	28	0	G			10959369	-1			no_errors	ENST00000240615	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.000	T
TBC1D23	55773	genome.wustl.edu	37	3	100029351	100029351	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr3:100029351C>T	ENST00000394144.4	+	14	1525	c.1518C>T	c.(1516-1518)atC>atT	p.I506I	TBC1D23_ENST00000344949.5_Silent_p.I506I|TBC1D23_ENST00000475134.1_Silent_p.I369I|TBC1D23_ENST00000486274.1_3'UTR	NM_001199198.2	NP_001186127.1	Q9NUY8	TBC23_HUMAN	TBC1 domain family, member 23	506					positive regulation of interleukin-6 production (GO:0032755)|regulation of inflammatory response (GO:0050727)|regulation of tumor necrosis factor production (GO:0032680)		Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(10)|ovary(1)|prostate(2)|skin(2)	25						AAAAAGTTATCAGTTTTATAG	0.328																																																	0													108.0	110.0	109.0					3																	100029351		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001908	CCDS2936.1, CCDS56265.1	3q12.2	2013-07-10			ENSG00000036054	ENSG00000036054			25622	protein-coding gene	gene with protein product						22312129	Standard	NM_001199198		Approved	FLJ11046	uc003dtt.4	Q9NUY8	OTTHUMG00000159067	ENST00000394144.4:c.1518C>T	3.37:g.100029351C>T			B9A6M5|Q8TCN8|Q8WUB7|Q96D90|Q9NV75	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Rhodanese-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Rhodanese-like_dom	p.I506	ENST00000394144.4	37	c.1518	CCDS56265.1	3																																																																																			TBC1D23	-	NULL	ENSG00000036054		0.328	TBC1D23-002	KNOWN	basic|CCDS	protein_coding	TBC1D23	HGNC	protein_coding	OTTHUMT00000353150.1	-	0.00	45	0	C	NM_018309		100029351	+1	tier1	-	no_errors	ENST00000394144	ensembl	human	known	74_37	silent	20.51	62	16	SNP	1.000	T
TCF7L2	6934	genome.wustl.edu	37	10	114911604	114911604	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:114911604G>A	ENST00000355995.4	+	10	1629	c.1122G>A	c.(1120-1122)ttG>ttA	p.L374L	TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000536810.1_Silent_p.L374L|TCF7L2_ENST00000534894.1_Silent_p.L374L|TCF7L2_ENST00000538897.1_Silent_p.L374L|TCF7L2_ENST00000369386.1_Silent_p.L17L|TCF7L2_ENST00000545257.1_Silent_p.L374L|TCF7L2_ENST00000352065.5_Silent_p.L351L|TCF7L2_ENST00000369389.1_Silent_p.L85L|TCF7L2_ENST00000355717.4_Silent_p.L398L|TCF7L2_ENST00000542695.1_Silent_p.L90L|TCF7L2_ENST00000369397.4_Silent_p.L351L|TCF7L2_ENST00000543371.1_Silent_p.L374L			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	374	Mediates interaction with MAD2L2.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		AGTGCACGTTGAAAGAAAGCG	0.522			T	VTI1A	colorectal																																			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0													71.0	69.0	70.0					10																	114911604		2203	4300	6503	SO:0001819	synonymous_variant	0			X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1122G>A	10.37:g.114911604G>A			B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Silent	SNP	pfam_CTNNB1-bd_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.L374	ENST00000355995.4	37	c.1122		10																																																																																			TCF7L2	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000148737		0.522	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	HGNC	protein_coding			0.00	53	0	G	NM_030756		114911604	+1			no_errors	ENST00000355995	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
TGM7	116179	genome.wustl.edu	37	15	43568766	43568766	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:43568766G>T	ENST00000452443.2	-	13	2024	c.2020C>A	c.(2020-2022)Ctc>Atc	p.L674I		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	674					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	GTCGGGTAGAGGTCCAGTTGA	0.577																																																	0													156.0	134.0	141.0					15																	43568766		2202	4299	6501	SO:0001583	missense	0			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.2020C>A	15.37:g.43568766G>T	ENSP00000389466:p.Leu674Ile			Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.L674I	ENST00000452443.2	37	c.2020	CCDS32213.1	15	.	.	.	.	.	.	.	.	.	.	G	0.979	-0.697826	0.03279	.	.	ENSG00000159495	ENST00000452443	T	0.66995	-0.24	4.61	2.57	0.30868	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.147023	0.45361	D	0.000368	T	0.61299	0.2336	L	0.32530	0.975	0.28102	N	0.931383	D	0.67145	0.996	D	0.65573	0.936	T	0.54984	-0.8211	10	0.08381	T	0.77	-15.5703	3.7723	0.08646	0.2031:0.0:0.6035:0.1934	.	674	Q96PF1	TGM7_HUMAN	I	674	ENSP00000389466:L674I	ENSP00000389466:L674I	L	-	1	0	TGM7	41356058	0.992000	0.36948	0.995000	0.50966	0.072000	0.16883	1.096000	0.30976	1.067000	0.40740	0.585000	0.79938	CTC	TGM7	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000159495		0.577	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	HGNC	protein_coding	OTTHUMT00000432489.1		0.00	45	0	G	NM_052955		43568766	-1			no_errors	ENST00000452443	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.886	T
TEX9	374618	genome.wustl.edu	37	15	56720604	56720604	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr15:56720604G>T	ENST00000352903.2	+	12	1162	c.1138G>T	c.(1138-1140)Gag>Tag	p.E380*	TEX9_ENST00000560582.1_Nonsense_Mutation_p.E91*|TEX9_ENST00000537232.1_Nonsense_Mutation_p.E305*|MNS1_ENST00000566386.1_Intron	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	380								p.E380K(1)		cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TTTCACTGAGGAGGAATTTAT	0.343																																																	1	Substitution - Missense(1)	skin(1)											111.0	112.0	112.0					15																	56720604		2192	4290	6482	SO:0001587	stop_gained	0			BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.1138G>T	15.37:g.56720604G>T	ENSP00000342169:p.Glu380*		B4DH73	Nonsense_Mutation	SNP	NULL	p.E380*	ENST00000352903.2	37	c.1138	CCDS10157.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.332471	0.98217	.	.	ENSG00000151575	ENST00000352903;ENST00000537232	.	.	.	5.86	3.95	0.45737	.	0.140823	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-19.9454	15.7495	0.77972	0.0:0.2581:0.7419:0.0	.	.	.	.	X	380;305	.	ENSP00000342169:E380X	E	+	1	0	TEX9	54507896	1.000000	0.71417	0.998000	0.56505	0.751000	0.42716	8.955000	0.93058	0.788000	0.33755	-0.172000	0.13284	GAG	TEX9	-	NULL	ENSG00000151575		0.343	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX9	HGNC	protein_coding	OTTHUMT00000255048.2		0.00	20	0	G	NM_198524		56720604	+1			no_errors	ENST00000352903	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	T
TMBIM4	51643	genome.wustl.edu	37	12	66531936	66531937	+	Frame_Shift_Ins	INS	-	-	A	rs199863727	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:66531936_66531937insA	ENST00000358230.3	-	7	640_641	c.520_521insT	c.(520-522)tatfs	p.Y174fs	TMBIM4_ENST00000544599.1_5'UTR|TMBIM4_ENST00000539652.1_Intron|TMBIM4_ENST00000286424.7_Frame_Shift_Ins_p.Y221fs|TMBIM4_ENST00000542724.1_Frame_Shift_Ins_p.Y143fs|TMBIM4_ENST00000398033.4_Frame_Shift_Ins_p.I159fs|TMBIM4_ENST00000556010.1_Intron	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	174					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		TATCTCACTATAAAAAAAAAAC	0.351																																																	0																																										SO:0001589	frameshift_variant	0			AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.521dupT	12.37:g.66531946_66531946dupA	ENSP00000350965:p.Tyr174fs		Q542Z6|Q9UHY5|Q9Y3C2	Frame_Shift_Ins	INS	pfam_Bax_inhibitor_1-related	p.Y174fs	ENST00000358230.3	37	c.521_520	CCDS41805.1	12																																																																																			TMBIM4	-	pfam_Bax_inhibitor_1-related	ENSG00000155957		0.351	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMBIM4	HGNC	protein_coding	OTTHUMT00000401832.2		0.00	53	0	-	NM_016056		66531937	-1	tier1		no_errors	ENST00000358230	ensembl	human	known	74_37	frame_shift_ins	8.33	44	4	INS	0.856:0.028	A
TNFRSF10D	8793	genome.wustl.edu	37	8	23006036	23006036	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:23006036G>A	ENST00000312584.3	-	3	379	c.285C>T	c.(283-285)gcC>gcT	p.A95A		NM_003840.4	NP_003831.2	Q9UBN6	TR10D_HUMAN	tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain	95					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		ACGGGTTACAGGCTCCAGTAT	0.448																																																	0													149.0	137.0	141.0					8																	23006036		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029761	CCDS6038.1	8p21	2006-02-22			ENSG00000173530	ENSG00000173530		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11907	protein-coding gene	gene with protein product		603614				9382840, 9537512	Standard	NM_003840		Approved	DcR2, TRUNDD, TRAILR4, CD264	uc003xcz.2	Q9UBN6	OTTHUMG00000097845	ENST00000312584.3:c.285C>T	8.37:g.23006036G>A			B2R8W0|Q9Y6Q4	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_10	p.A95	ENST00000312584.3	37	c.285	CCDS6038.1	8																																																																																			TNFRSF10D	-	prints_TNFR_10	ENSG00000173530		0.448	TNFRSF10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10D	HGNC	protein_coding	OTTHUMT00000215135.1	-	0.00	69	0	G			23006036	-1	tier1	-	no_errors	ENST00000312584	ensembl	human	known	74_37	silent	37.10	38	23	SNP	0.000	A
TMEM67	91147	genome.wustl.edu	37	8	94777867	94777867	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:94777867G>T	ENST00000453321.3	+	6	702	c.644G>T	c.(643-645)gGa>gTa	p.G215V	TMEM67_ENST00000409623.3_Missense_Mutation_p.G134V	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	215					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			GCACGTTATGGAGAAGTTGTG	0.343																																																	0													151.0	154.0	153.0					8																	94777867		2203	4300	6503	SO:0001583	missense	0			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.644G>T	8.37:g.94777867G>T	ENSP00000389998:p.Gly215Val		B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	pfam_Meckelin,superfamily_Growth_fac_rcpt_N_dom	p.G215V	ENST00000453321.3	37	c.644	CCDS6258.2	8	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628330	0.46944	.	.	ENSG00000164953	ENST00000452276;ENST00000453321;ENST00000409623	D;D;D	0.97209	-4.29;-4.29;-4.29	5.73	4.85	0.62838	.	0.378221	0.29932	N	0.010823	D	0.95611	0.8573	L	0.54323	1.7	0.58432	D	0.999998	B;B	0.28584	0.007;0.216	B;B	0.32928	0.008;0.155	D	0.94264	0.7505	10	0.56958	D	0.05	-7.5061	14.3513	0.66705	0.0:0.1617:0.8383:0.0	.	215;134	Q5HYA8;G5E9H2	MKS3_HUMAN;.	V	112;215;134	ENSP00000388671:G112V;ENSP00000389998:G215V;ENSP00000386966:G134V	ENSP00000314488:G205V	G	+	2	0	TMEM67	94847043	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	2.881000	0.48538	1.387000	0.46486	0.591000	0.81541	GGA	TMEM67	-	pfam_Meckelin	ENSG00000164953		0.343	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	HGNC	protein_coding	OTTHUMT00000329641.2		0.00	67	0	G	NM_153704		94777867	+1			no_errors	ENST00000453321	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578291	7578291	+	Splice_Site	SNP	T	T	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:7578291T>A	ENST00000269305.4	-	6	749		c.e6-2		TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(16)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGCCAGACCTAAGAGCAATC	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Unknown(16)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(7)|bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|liver(3)|central_nervous_system(2)|breast(2)|thyroid(1)|stomach(1)|kidney(1)|urinary_tract(1)|oesophagus(1)|ovary(1)	GRCh37	CS941545	TP53	S							80.0	72.0	75.0					17																	7578291		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-2A>T	17.37:g.7578291T>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5-2	ENST00000269305.4	37	c.560-2	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	9.074	0.997681	0.19043	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	3.68	3.68	0.42216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9475	0.47310	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519016	0.998000	0.40836	0.996000	0.52242	0.034000	0.12701	2.807000	0.47955	1.912000	0.55364	0.460000	0.39030	.	TP53	-	-	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	54	0	T	NM_000546	Intron	7578291	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	44.00	28	22	SNP	1.000	A
TOP3A	7156	genome.wustl.edu	37	17	18202892	18202892	+	Missense_Mutation	SNP	G	G	A	rs34256024		TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:18202892G>A	ENST00000321105.5	-	9	1185	c.971C>T	c.(970-972)cCt>cTt	p.P324L	TOP3A_ENST00000542570.1_Missense_Mutation_p.P229L|TOP3A_ENST00000540524.1_5'UTR	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	324					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						CAAGGCTTGAGGCCGCCACTT	0.512																																																	0													317.0	279.0	292.0					17																	18202892		2203	4300	6503	SO:0001583	missense	0			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.971C>T	17.37:g.18202892G>A	ENSP00000321636:p.Pro324Leu		A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Znf_GRF,pfam_Toprim_domain,pfam_Topo_IA_Znf,superfamily_Topo_IA_core_domain,superfamily_Znf_CCHC,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.P324L	ENST00000321105.5	37	c.971	CCDS11194.1	17	.	.	.	.	.	.	.	.	.	.	G	16.51	3.144554	0.57044	.	.	ENSG00000177302	ENST00000321105;ENST00000542570	T;T	0.32753	1.44;1.44	5.5	5.5	0.81552	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);	0.045256	0.85682	D	0.000000	T	0.74566	0.3733	H	0.98818	4.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85269	0.1055	10	0.87932	D	0	-8.5716	19.8217	0.96599	0.0:0.0:1.0:0.0	.	229;324	B4DK80;Q13472	.;TOP3A_HUMAN	L	324;229	ENSP00000321636:P324L;ENSP00000442336:P229L	ENSP00000321636:P324L	P	-	2	0	TOP3A	18143617	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.594000	0.98254	2.758000	0.94735	0.644000	0.83932	CCT	TOP3A	-	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain,smart_Topo_IA_DNA-bd	ENSG00000177302		0.512	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	HGNC	protein_coding	OTTHUMT00000132052.2	-	0.00	69	0	G			18202892	-1	tier1	-	no_errors	ENST00000321105	ensembl	human	known	74_37	missense	51.11	22	23	SNP	1.000	A
TRIOBP	11078	genome.wustl.edu	37	22	38130534	38130534	+	Silent	SNP	G	G	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr22:38130534G>A	ENST00000406386.3	+	9	4446	c.4191G>A	c.(4189-4191)agG>agA	p.R1397R		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	1397					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TGCCCCCCAGGACATCAGCCA	0.657																																																	0													14.0	16.0	16.0					22																	38130534		1848	4077	5925	SO:0001819	synonymous_variant	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.4191G>A	22.37:g.38130534G>A			B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R1397	ENST00000406386.3	37	c.4191	CCDS43015.1	22																																																																																			TRIOBP	-	NULL	ENSG00000100106		0.657	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	-	0.00	66	0	G			38130534	+1	tier1	-	no_errors	ENST00000406386	ensembl	human	known	74_37	silent	22.55	79	23	SNP	0.597	A
TRMT1L	81627	genome.wustl.edu	37	1	185108677	185108677	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:185108677G>T	ENST00000367506.5	-	9	1412	c.1144C>A	c.(1144-1146)Cta>Ata	p.L382I	TRMT1L_ENST00000367504.3_Missense_Mutation_p.L226I	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	382	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						GCAGAATCTAGATAATTCACT	0.343																																																	0													40.0	43.0	42.0					1																	185108677		2203	4300	6503	SO:0001583	missense	0			AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.1144C>A	1.37:g.185108677G>T	ENSP00000356476:p.Leu382Ile		Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	pfam_TRM1,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L382I	ENST00000367506.5	37	c.1144	CCDS1366.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349439	0.82132	.	.	ENSG00000121486	ENST00000367504;ENST00000367506;ENST00000458395	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.75339	0.3836	L	0.48986	1.54	0.80722	D	1	D	0.71674	0.998	D	0.67231	0.95	T	0.70417	-0.4877	9	0.37606	T	0.19	-9.4588	20.6593	0.99626	0.0:0.0:1.0:0.0	.	382	Q7Z2T5	TRM1L_HUMAN	I	226;382;6	.	ENSP00000356474:L226I	L	-	1	2	TRMT1L	183375300	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	5.465000	0.66725	2.885000	0.99019	0.655000	0.94253	CTA	TRMT1L	-	pfam_TRM1	ENSG00000121486		0.343	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1L	HGNC	protein_coding	OTTHUMT00000085787.1	-	0.00	41	0	G	NM_030934		185108677	-1	tier1	-	no_errors	ENST00000367506	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179464488	179464488	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:179464488G>T	ENST00000591111.1	-	239	51441	c.51217C>A	c.(51217-51219)Ccg>Acg	p.P17073T	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P9774T|TTN_ENST00000589042.1_Missense_Mutation_p.P18714T|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P16146T|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.P9841T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P9649T|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17073	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTAGTGTCGGGAATGGCACA	0.403																																																	0													120.0	111.0	114.0					2																	179464488		1866	4105	5971	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51217C>A	2.37:g.179464488G>T	ENSP00000465570:p.Pro17073Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P16146T	ENST00000591111.1	37	c.48436		2	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509345	0.44660	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.6	5.6	0.85130	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.90817	0.7116	H	0.98048	4.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.93846	0.7141	9	0.87932	D	0	.	19.6238	0.95670	0.0:0.0:1.0:0.0	.	9649;9774;9841;17073	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	16146;9649;9841;9774;9647	ENSP00000343764:P16146T;ENSP00000434586:P9649T;ENSP00000340554:P9841T;ENSP00000352154:P9774T	ENSP00000340554:P9841T	P	-	1	0	TTN	179172733	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.793000	0.99091	2.642000	0.89623	0.557000	0.71058	CCG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	30	0	G	NM_133378		179464488	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179474466	179474466	+	Silent	SNP	C	C	A	rs2288566	byFrequency	TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr2:179474466C>A	ENST00000591111.1	-	222	46985	c.46761G>T	c.(46759-46761)gcG>gcT	p.A15587A	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000359218.5_Silent_p.A8288A|TTN_ENST00000589042.1_Silent_p.A17228A|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000342992.6_Silent_p.A14660A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Silent_p.A8355A|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000460472.2_Silent_p.A8163A|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15587	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTAATACCCGCGGCGTTCT	0.463																																																	0													216.0	207.0	210.0					2																	179474466		1864	4099	5963	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46761G>T	2.37:g.179474466C>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A14660	ENST00000591111.1	37	c.43980		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	33	0	C	NM_133378		179474466	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.107	A
TUBG2	27175	genome.wustl.edu	37	17	40818726	40818726	+	Missense_Mutation	SNP	G	G	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr17:40818726G>C	ENST00000251412.7	+	11	1463	c.1264G>C	c.(1264-1266)Gac>Cac	p.D422H	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	422					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		TGATGAGATGGACAGGTCTAG	0.537																																																	0													125.0	109.0	114.0					17																	40818726		2203	4300	6503	SO:0001583	missense	0			AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.1264G>C	17.37:g.40818726G>C	ENSP00000251412:p.Asp422His		A6NDI4|Q32NB2	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Gamma_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin,prints_Alpha_tubulin	p.D422H	ENST00000251412.7	37	c.1264	CCDS32658.1	17	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996141	0.54147	.	.	ENSG00000037042	ENST00000251412	D	0.84660	-1.88	5.07	4.09	0.47781	Tubulin, C-terminal (1);Tubulin/FtsZ, C-terminal (1);	0.051444	0.85682	N	0.000000	D	0.91646	0.7360	M	0.88450	2.955	0.80722	D	1	D	0.67145	0.996	P	0.56216	0.794	D	0.93416	0.6773	10	0.72032	D	0.01	-42.1492	15.8822	0.79211	0.0:0.1353:0.8647:0.0	.	422	Q9NRH3	TBG2_HUMAN	H	422	ENSP00000251412:D422H	ENSP00000251412:D422H	D	+	1	0	TUBG2	38072252	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.414000	0.66405	1.342000	0.45619	0.561000	0.74099	GAC	TUBG2	-	superfamily_Tub_FtsZ_C,prints_Gamma_tubulin	ENSG00000037042		0.537	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBG2	HGNC	protein_coding	OTTHUMT00000452326.1	-	0.00	78	0	G	NM_016437		40818726	+1	tier1	-	no_errors	ENST00000251412	ensembl	human	known	74_37	missense	34.72	47	25	SNP	1.000	C
TXNRD1	7296	genome.wustl.edu	37	12	104715025	104715025	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:104715025G>T	ENST00000529546.1	+	7	807	c.582G>T	c.(580-582)atG>atT	p.M194I	TXNRD1_ENST00000354940.6_Missense_Mutation_p.M232I|TXNRD1_ENST00000378070.4_Missense_Mutation_p.M331I|TXNRD1_ENST00000388854.3_Missense_Mutation_p.M284I|TXNRD1_ENST00000542918.1_Missense_Mutation_p.M282I|TXNRD1_ENST00000540716.1_Missense_Mutation_p.M194I|TXNRD1_ENST00000503506.2_Missense_Mutation_p.M232I|TXNRD1_ENST00000429002.2_Missense_Mutation_p.M382I|TXNRD1_ENST00000526691.1_Missense_Mutation_p.M284I|TXNRD1_ENST00000397736.2_Missense_Mutation_p.M276I|TXNRD1_ENST00000526390.1_Missense_Mutation_p.M276I|TXNRD1_ENST00000427956.1_Missense_Mutation_p.M347I|TXNRD1_ENST00000525566.1_Missense_Mutation_p.M382I|TXNRD1_ENST00000526950.1_Missense_Mutation_p.M301I|TXNRD1_ENST00000524698.1_Missense_Mutation_p.M232I			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	382				V -> G (in Ref. 6; AAF15900). {ECO:0000305}.	cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	ACCAGGACATGGCCAACAAAA	0.418																																					Ovarian(139;555 1836 9186 9946 10884)												0													222.0	204.0	210.0					12																	104715025		1933	4145	6078	SO:0001583	missense	0				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.582G>T	12.37:g.104715025G>T	ENSP00000434919:p.Met194Ile		B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.M382I	ENST00000529546.1	37	c.1146	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012858	0.75161	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000397736;ENST00000427956;ENST00000526950	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.76	5.76	0.90799	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	N	0.20766	0.605	0.80722	D	1	B;B;B;B;B;B;B	0.33964	0.029;0.011;0.434;0.002;0.001;0.068;0.011	B;B;B;B;B;B;B	0.37780	0.105;0.053;0.258;0.031;0.009;0.089;0.028	T	0.40961	-0.9535	10	0.66056	D	0.02	-36.2329	20.0386	0.97572	0.0:0.0:1.0:0.0	.	282;276;382;284;232;382;347	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	I	382;382;232;284;284;232;276;194;194;232;282;331;276;347;301	ENSP00000434516:M382I;ENSP00000412045:M382I;ENSP00000421934:M232I;ENSP00000435929:M284I;ENSP00000373506:M284I;ENSP00000347020:M232I;ENSP00000435123:M276I;ENSP00000434919:M194I;ENSP00000442709:M194I;ENSP00000433425:M232I;ENSP00000440978:M282I;ENSP00000367310:M331I;ENSP00000380844:M276I;ENSP00000393328:M347I;ENSP00000432812:M301I	ENSP00000347020:M232I	M	+	3	0	TXNRD1	103239155	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.739000	0.74827	2.738000	0.93877	0.638000	0.83543	ATG	TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000198431		0.418	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	-	0.00	67	0	G	NM_003330		104715025	+1	tier1	-	no_errors	ENST00000429002	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
UBQLN4	56893	genome.wustl.edu	37	1	156020165	156020165	+	Missense_Mutation	SNP	T	T	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:156020165T>A	ENST00000368309.3	-	4	750	c.658A>T	c.(658-660)Atg>Ttg	p.M220L	UBQLN4_ENST00000472638.1_Intron	NM_020131.3	NP_064516.2	Q9NRR5	UBQL4_HUMAN	ubiquilin 4	220					regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|polyubiquitin binding (GO:0031593)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)	16	Hepatocellular(266;0.133)|all_neural(408;0.195)					GGGTTGGCCATAATCATGTGA	0.527																																																	0													177.0	153.0	161.0					1																	156020165		2203	4300	6503	SO:0001583	missense	0			BC018403	CCDS1127.1	1q21	2013-02-12	2004-11-05	2004-11-06	ENSG00000160803	ENSG00000160803		"""Ubiquilin family"""	1237	protein-coding gene	gene with protein product	"""ataxin-1 ubiquitin-like interacting protein"""	605440	"""chromosome 1 open reading frame 6"""	C1orf6		10575211, 11001934	Standard	NM_020131		Approved	A1U, UBIN	uc001fna.3	Q9NRR5	OTTHUMG00000017461	ENST00000368309.3:c.658A>T	1.37:g.156020165T>A	ENSP00000357292:p.Met220Leu		A6ND44|B2RAY7|Q5VYA0|Q5VYA1|Q9BR98|Q9UHX4	Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_UBA/Ts_N,pfam_Rad60/SUMO_like,superfamily_UBA-like,superfamily_ARM-type_fold,superfamily_XPC-bd,smart_Ubiquitin_dom,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.M220L	ENST00000368309.3	37	c.658	CCDS1127.1	1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.784045	0.31593	.	.	ENSG00000160803	ENST00000368309	T	0.22743	1.94	4.49	4.49	0.54785	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.05410	0.0143	N	0.16567	0.415	0.80722	D	1	B;B	0.19331	0.035;0.012	B;B	0.12837	0.008;0.008	T	0.20605	-1.0270	10	0.21540	T	0.41	-43.4845	12.8026	0.57594	0.0:0.0:0.0:1.0	.	200;220	B4DZF6;Q9NRR5	.;UBQL4_HUMAN	L	220	ENSP00000357292:M220L	ENSP00000357292:M220L	M	-	1	0	UBQLN4	154286789	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.985000	0.63845	1.900000	0.55004	0.459000	0.35465	ATG	UBQLN4	-	superfamily_ARM-type_fold,smart_STI1_HS-bd	ENSG00000160803		0.527	UBQLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN4	HGNC	protein_coding	OTTHUMT00000046193.1	-	0.00	52	0	T	NM_020131		156020165	-1	tier1	-	no_errors	ENST00000368309	ensembl	human	known	74_37	missense	35.90	25	14	SNP	1.000	A
UGT3A1	133688	genome.wustl.edu	37	5	35965642	35965642	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr5:35965642delG	ENST00000274278.3	-	4	1046	c.689delC	c.(688-690)ccafs	p.P230fs	UGT3A1_ENST00000503189.1_Frame_Shift_Del_p.P230fs|UGT3A1_ENST00000507113.1_Frame_Shift_Del_p.P196fs|UGT3A1_ENST00000333811.4_Frame_Shift_Del_p.P176fs|UGT3A1_ENST00000513233.1_Intron	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	230						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGAGCCTTCTGGGAAATGCTC	0.463																																																	0													121.0	123.0	123.0					5																	35965642		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.689delC	5.37:g.35965642delG	ENSP00000274278:p.Pro230fs		G5E961|Q8IYS9|Q8NAW4|Q96DM6	Frame_Shift_Del	DEL	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.P230fs	ENST00000274278.3	37	c.689	CCDS3913.1	5																																																																																			UGT3A1	-	pfam_UDP_glucos_trans	ENSG00000145626		0.463	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	HGNC	protein_coding	OTTHUMT00000253770.2		0.00	88	0	G	NM_152404		35965642	-1			no_errors	ENST00000274278	ensembl	human	known	74_37	frame_shift_del	8.89	123	12	DEL	0.584	0
UNC13A	23025	genome.wustl.edu	37	19	17766135	17766136	+	Missense_Mutation	DNP	GC	GC	TA			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:17766135_17766136GC>TA	ENST00000519716.2	-	11	1338_1339	c.1339_1340GC>TA	c.(1339-1341)GCc>TAc	p.A447Y	UNC13A_ENST00000428389.2_Missense_Mutation_p.A535Y|UNC13A_ENST00000552293.1_Missense_Mutation_p.A447Y|UNC13A_ENST00000550896.1_Missense_Mutation_p.A447Y|UNC13A_ENST00000551649.1_Missense_Mutation_p.A447Y|UNC13A_ENST00000252773.7_Missense_Mutation_p.A447Y	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	447					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GTTGGCCTTGGCCCTGGACATG	0.639																																																	0																																										SO:0001583	missense	0			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1339_1340delinsTA	19.37:g.17766135_17766136delinsTA	ENSP00000429562:p.Ala447Tyr		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.A535D|p.A535S	ENST00000519716.2	37	c.1604|c.1603	CCDS46013.2	19																																																																																			UNC13A	-	NULL	ENSG00000130477		0.639	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	-	0.00	39	0	G|C	XM_038604		17766135|17766136	-1	tier1	-	no_errors	ENST00000428389	ensembl	human	known	74_37	missense	29.17|30.43	34|32	14	SNP	1.000	T|A
USH1C	10083	genome.wustl.edu	37	11	17531023	17531023	+	Intron	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr11:17531023G>T	ENST00000318024.4	-	16	1393				USH1C_ENST00000005226.7_Missense_Mutation_p.S631R|USH1C_ENST00000529563.1_Intron|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000527020.1_Intron	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						AGGGATGGTTGCTCAGTGCTT	0.632																																																	0													75.0	69.0	71.0					11																	17531023		2200	4293	6493	SO:0001627	intron_variant	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1285-7496C>A	11.37:g.17531023G>T			A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S631R	ENST00000318024.4	37	c.1893	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	G	11.53	1.664820	0.29604	.	.	ENSG00000006611	ENST00000005226	T	0.42513	0.97	5.9	3.66	0.41972	.	0.353756	0.27397	N	0.019547	T	0.28863	0.0716	.	.	.	0.09310	N	0.999999	B	0.10296	0.003	B	0.04013	0.001	T	0.14587	-1.0467	9	0.37606	T	0.19	.	9.3089	0.37891	0.0862:0.0:0.7651:0.1488	.	631	Q7RTU8	.	R	631	ENSP00000005226:S631R	ENSP00000005226:S631R	S	-	3	2	USH1C	17487599	0.996000	0.38824	1.000000	0.80357	0.400000	0.30750	1.168000	0.31859	1.462000	0.47948	0.585000	0.79938	AGC	USH1C	-	NULL	ENSG00000006611		0.632	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	-	0.00	42	0	G	NM_005709		17531023	-1	tier1	-	no_errors	ENST00000005226	ensembl	human	known	74_37	missense	7.46	62	5	SNP	0.998	T
VPS13D	55187	genome.wustl.edu	37	1	12416003	12416003	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:12416003delC	ENST00000358136.3	+	48	9857	c.9727delC	c.(9727-9729)cctfs	p.P3243fs	VPS13D_ENST00000356315.4_Frame_Shift_Del_p.P3218fs	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GCTCATTCCACCTGGAACCCA	0.433																																																	0													104.0	96.0	99.0					1																	12416003		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.9727delC	1.37:g.12416003delC	ENSP00000350854:p.Pro3243fs			Frame_Shift_Del	DEL	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.P3243fs	ENST00000358136.3	37	c.9727	CCDS30588.1	1																																																																																			VPS13D	-	NULL	ENSG00000048707		0.433	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2		0.00	41	0	C	NM_015378		12416003	+1	tier1		no_errors	ENST00000358136	ensembl	human	known	74_37	frame_shift_del	25.00	48	16	DEL	1.000	-
VWA3A	146177	genome.wustl.edu	37	16	22128497	22128497	+	Splice_Site	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:22128497G>T	ENST00000389398.5	+	11	1086	c.990G>T	c.(988-990)gaG>gaT	p.E330D	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	330						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CAAAGATGGAGGTAAGCCCTT	0.542																																																	0													153.0	145.0	148.0					16																	22128497		1973	4154	6127	SO:0001630	splice_region_variant	0			AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.990+1G>T	16.37:g.22128497G>T			A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E330D	ENST00000389398.5	37	c.990	CCDS45441.1	16	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857825	0.51376	.	.	ENSG00000175267	ENST00000310694;ENST00000389398	T	0.16597	2.33	5.49	4.54	0.55810	.	0.814673	0.10587	N	0.657181	T	0.38639	0.1048	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	P	0.61397	0.888	T	0.08911	-1.0699	10	0.72032	D	0.01	.	10.7009	0.45926	0.0883:0.0:0.9117:0.0	.	330	A6NCI4	VWA3A_HUMAN	D	230;330	ENSP00000374049:E330D	ENSP00000308827:E230D	E	+	3	2	VWA3A	22035998	1.000000	0.71417	1.000000	0.80357	0.203000	0.24098	2.838000	0.48199	2.578000	0.87016	0.655000	0.94253	GAG	VWA3A	-	NULL	ENSG00000175267		0.542	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3A	HGNC	protein_coding	OTTHUMT00000430052.1	-	0.00	42	0	G		Missense_Mutation	22128497	+1	tier1	-	no_errors	ENST00000389398	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	50174670	50174670	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr10:50174670T>C	ENST00000325239.5	+	54	8563	c.8536T>C	c.(8536-8538)Ttt>Ctt	p.F2846L	WDFY4_ENST00000413659.2_3'UTR|WDFY4_ENST00000465910.1_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2846						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCCACAGCCCTTTTTCTACAG	0.602																																																	0													56.0	60.0	59.0					10																	50174670		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.8536T>C	10.37:g.50174670T>C	ENSP00000320563:p.Phe2846Leu		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F2846L	ENST00000325239.5	37	c.8536	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.80|12.80	2.047570|2.047570	0.36085|0.36085	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239;ENST00000544136|ENST00000312002	T|.	0.30714|.	1.52|.	5.64|5.64	3.3|3.3	0.37823|0.37823	.|.	0.125689|.	0.53938|.	N|.	0.000045|.	T|T	0.66528|0.66528	0.2798|0.2798	M|M	0.80183|0.80183	2.485|2.485	0.80722|0.80722	D|D	1|1	B;B|.	0.20887|.	0.008;0.049|.	B;B|.	0.22601|.	0.006;0.04|.	T|T	0.63207|0.63207	-0.6689|-0.6689	9|5	.|.	.|.	.|.	.|.	7.3299|7.3299	0.26575|0.26575	0.0:0.1822:0.0:0.8178|0.0:0.1822:0.0:0.8178	.|.	309;2846|.	B4DWY9;Q6ZS81|.	.;WDFY4_HUMAN|.	L|P	2846;2846;309|1936	ENSP00000320563:F2846L|.	.|.	F|L	+|+	1|2	0|0	WDFY4|WDFY4	49844676|49844676	0.998000|0.998000	0.40836|0.40836	0.100000|0.100000	0.21137|0.21137	0.151000|0.151000	0.21798|0.21798	2.118000|2.118000	0.41949|0.41949	0.412000|0.412000	0.25729|0.25729	0.528000|0.528000	0.53228|0.53228	TTT|CTT	WDFY4	-	NULL	ENSG00000128815		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	54	0	T	XM_033379		50174670	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.965	C
WDR18	57418	genome.wustl.edu	37	19	991108	991108	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:991108C>A	ENST00000251289.5	+	6	792	c.769C>A	c.(769-771)Cca>Aca	p.P257T	WDR18_ENST00000587001.2_Missense_Mutation_p.P257T	NM_024100.3	NP_077005.2	Q9BV38	WDR18_HUMAN	WD repeat domain 18	257					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|lung(2)|skin(2)	7		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGCTTCCACCCAGAGCAGGA	0.701																																																	0													43.0	36.0	38.0					19																	991108		2185	4289	6474	SO:0001583	missense	0				CCDS12051.1	19p13.3	2013-01-09				ENSG00000065268		"""WD repeat domain containing"""	17956	protein-coding gene	gene with protein product	"""Involved in Processing ITS2 3 homolog (S. cerevisiae)"""					22190735	Standard	NM_024100		Approved	Ipi3	uc002lqm.1	Q9BV38		ENST00000251289.5:c.769C>A	19.37:g.991108C>A	ENSP00000251289:p.Pro257Thr		O60390|Q9BWR2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P257T	ENST00000251289.5	37	c.769	CCDS12051.1	19	.	.	.	.	.	.	.	.	.	.	C	1.339	-0.594758	0.03771	.	.	ENSG00000065268	ENST00000251289	T	0.72051	-0.62	3.62	1.29	0.21616	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.433499	0.25329	N	0.031442	T	0.40570	0.1122	N	0.04880	-0.145	0.36160	D	0.848069	B	0.15473	0.013	B	0.11329	0.006	T	0.21999	-1.0229	10	0.11182	T	0.66	.	6.0613	0.19839	0.2423:0.6413:0.0:0.1164	.	257	Q9BV38	WDR18_HUMAN	T	257	ENSP00000251289:P257T	ENSP00000251289:P257T	P	+	1	0	WDR18	942108	0.924000	0.31332	0.952000	0.39060	0.335000	0.28730	0.266000	0.18534	0.740000	0.32651	0.591000	0.81541	CCA	WDR18	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000065268		0.701	WDR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR18	HGNC	protein_coding	OTTHUMT00000458225.2	-	0.00	57	0	C			991108	+1	tier1	-	no_errors	ENST00000251289	ensembl	human	known	74_37	missense	45.59	37	31	SNP	0.821	A
WNK1	65125	genome.wustl.edu	37	12	994860	994860	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:994860G>T	ENST00000315939.6	+	19	5533	c.4890G>T	c.(4888-4890)caG>caT	p.Q1630H	WNK1_ENST00000340908.4_Missense_Mutation_p.Q1223H|WNK1_ENST00000537687.1_Missense_Mutation_p.Q1890H|WNK1_ENST00000535572.1_Missense_Mutation_p.Q1383H|WNK1_ENST00000530271.2_Missense_Mutation_p.Q2128H	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1630					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTCCCAACCAGCCCCATACTC	0.468																																					Colon(19;451 567 6672 12618 28860)												0													99.0	97.0	98.0					12																	994860		2203	4300	6503	SO:0001583	missense	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4890G>T	12.37:g.994860G>T	ENSP00000313059:p.Gln1630His		A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q2128H	ENST00000315939.6	37	c.6384	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	G	13.88	2.367867	0.42003	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.78126	-1.12;-1.13;-1.05;-1.15;0.34	5.67	4.78	0.61160	.	0.000000	0.64402	D	0.000006	D	0.84808	0.5554	M	0.63843	1.955	0.43242	D	0.995159	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74348	0.983;0.983;0.962	D	0.85767	0.1353	10	0.66056	D	0.02	-7.4676	11.3696	0.49692	0.1902:0.0:0.8098:0.0	.	1383;1383;1630	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	H	1383;1630;1890;803;2128;1223	ENSP00000441972:Q1383H;ENSP00000313059:Q1630H;ENSP00000444465:Q1890H;ENSP00000433548:Q2128H;ENSP00000341292:Q1223H	ENSP00000252477:Q803H	Q	+	3	2	WNK1	865121	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.064000	0.30579	1.537000	0.49254	0.655000	0.94253	CAG	WNK1	-	NULL	ENSG00000060237		0.468	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1		0.00	43	0	G	NM_018979		994860	+1			no_errors	ENST00000530271	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
XPO6	23214	genome.wustl.edu	37	16	28128767	28128767	+	Missense_Mutation	SNP	C	C	A			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr16:28128767C>A	ENST00000304658.5	-	15	2376	c.1876G>T	c.(1876-1878)Gct>Tct	p.A626S	XPO6_ENST00000565698.1_Missense_Mutation_p.A612S	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	626					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TGCAGCGCAGCCAGGGACTGA	0.443																																																	0													116.0	107.0	110.0					16																	28128767		1949	4145	6094	SO:0001583	missense	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.1876G>T	16.37:g.28128767C>A	ENSP00000302790:p.Ala626Ser		A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.A626S	ENST00000304658.5	37	c.1876	CCDS42135.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.543282	0.96474	.	.	ENSG00000169180	ENST00000304658	T	0.66099	-0.19	5.76	5.76	0.90799	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69780	0.3149	M	0.64997	1.995	0.80722	D	1	P;D	0.62365	0.911;0.991	P;P	0.51016	0.505;0.656	T	0.71104	-0.4689	10	0.51188	T	0.08	-11.8762	17.4695	0.87642	0.0:1.0:0.0:0.0	.	626;626	B7ZM10;Q96QU8	.;XPO6_HUMAN	S	626	ENSP00000302790:A626S	ENSP00000302790:A626S	A	-	1	0	XPO6	28036268	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.584000	0.82572	2.727000	0.93392	0.655000	0.94253	GCT	XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.443	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	-	0.00	26	0	C	XM_055195		28128767	-1	tier1	-	no_errors	ENST00000304658	ensembl	human	known	74_37	missense	29.63	19	8	SNP	1.000	A
XRCC1	7515	genome.wustl.edu	37	19	44055806	44055806	+	Silent	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:44055806C>T	ENST00000262887.5	-	10	1663	c.1116G>A	c.(1114-1116)caG>caA	p.Q372Q	L34079.3_ENST00000597119.1_RNA|XRCC1_ENST00000543982.1_Silent_p.Q341Q			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	372	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				GGCCTAGGACCTGGCTGTACT	0.632								Other BER factors																																									0													90.0	85.0	87.0					19																	44055806		2203	4300	6503	SO:0001819	synonymous_variant	0			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1116G>A	19.37:g.44055806C>T			Q6IBS4|Q9HCB1	Silent	SNP	pfam_Xrcc1_N,pfam_BRCT_dom,superfamily_Galactose-bd-like,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q372	ENST00000262887.5	37	c.1116	CCDS12624.1	19																																																																																			XRCC1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	ENSG00000073050		0.632	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	HGNC	protein_coding	OTTHUMT00000463194.1	-	0.00	53	0	C	NM_006297		44055806	-1	tier1	-	no_errors	ENST00000262887	ensembl	human	known	74_37	silent	30.14	51	22	SNP	1.000	T
ZBTB40	9923	genome.wustl.edu	37	1	22816927	22816927	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr1:22816927G>T	ENST00000375647.4	+	2	693	c.486G>T	c.(484-486)gaG>gaT	p.E162D	ZBTB40_ENST00000404138.1_Missense_Mutation_p.E162D|ZBTB40_ENST00000374651.4_Missense_Mutation_p.E162D	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	162					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		CTTCCCCAGAGCTTGCTGCCA	0.522																																																	0													131.0	147.0	141.0					1																	22816927		2203	4300	6503	SO:0001583	missense	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.486G>T	1.37:g.22816927G>T	ENSP00000364798:p.Glu162Asp		O75066|Q5TFU5|Q8N1R1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E162D	ENST00000375647.4	37	c.486	CCDS224.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.64|14.64	2.594451|2.594451	0.46214|0.46214	.|.	.|.	ENSG00000184677|ENSG00000184677	ENST00000374649|ENST00000404138;ENST00000375647;ENST00000400239;ENST00000374651	.|T;T;T;T	.|0.08546	.|3.08;3.08;3.16;3.08	4.94|4.94	-0.504|-0.504	0.11997|0.11997	.|.	.|0.000000	.|0.53938	.|D	.|0.000054	.|T	.|0.06005	.|0.0156	L|L	0.48362|0.48362	1.52|1.52	0.09310|0.09310	N|N	1|1	.|B;B	.|0.06786	.|0.001;0.001	.|B;B	.|0.08055	.|0.003;0.001	.|T	.|0.32322	.|-0.9911	.|10	.|0.87932	.|D	.|0	.|-14.4987	0.8074|0.8074	0.01086|0.01086	0.3173:0.1166:0.3288:0.2373|0.3173:0.1166:0.3288:0.2373	.|.	.|162;162	.|F8WAI8;Q9NUA8	.|.;ZBT40_HUMAN	.|D	-1|162	.|ENSP00000384527:E162D;ENSP00000364798:E162D;ENSP00000383098:E162D;ENSP00000363782:E162D	.|ENSP00000363782:E162D	.|E	+|+	.|3	.|2	ZBTB40|ZBTB40	22689514|22689514	0.001000|0.001000	0.12720|0.12720	0.012000|0.012000	0.15200|0.15200	0.428000|0.428000	0.31595|0.31595	-0.077000|-0.077000	0.11394|0.11394	-0.037000|-0.037000	0.13646|0.13646	0.591000|0.591000	0.81541|0.81541	.|GAG	ZBTB40	-	NULL	ENSG00000184677		0.522	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1		0.00	30	0	G	NM_014870		22816927	+1			no_errors	ENST00000375647	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.000	T
ZC3H10	84872	genome.wustl.edu	37	12	56515545	56515545	+	Missense_Mutation	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:56515545C>T	ENST00000257940.2	+	3	1475	c.1199C>T	c.(1198-1200)tCg>tTg	p.S400L	RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.5_ENST00000550947.1_RNA|RP11-603J24.5_ENST00000549438.1_RNA	NM_032786.1	NP_116175.1	Q96K80	ZC3HA_HUMAN	zinc finger CCCH-type containing 10	400							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	11			OV - Ovarian serous cystadenocarcinoma(18;0.12)			GTGGCTGTATCGATGGCCCAA	0.592																																																	0													129.0	98.0	109.0					12																	56515545		2203	4300	6503	SO:0001583	missense	0			BC018708	CCDS8903.1	12q13.2	2012-07-05	2005-06-02	2005-06-02		ENSG00000135482		"""Zinc fingers, CCCH-type domain containing"""	25893	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 10"""	ZC3HDC10		12477932	Standard	NM_032786		Approved	FLJ14451	uc001sjp.1	Q96K80		ENST00000257940.2:c.1199C>T	12.37:g.56515545C>T	ENSP00000257940:p.Ser400Leu			Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S400L	ENST00000257940.2	37	c.1199	CCDS8903.1	12	.	.	.	.	.	.	.	.	.	.	C	21.8	4.200353	0.79015	.	.	ENSG00000135482	ENST00000257940	.	.	.	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	T	0.64338	0.2589	N	0.19112	0.55	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	T	0.67360	-0.5690	9	0.66056	D	0.02	-5.1176	19.059	0.93080	0.0:1.0:0.0:0.0	.	400	Q96K80	ZC3HA_HUMAN	L	400	.	ENSP00000257940:S400L	S	+	2	0	ZC3H10	54801812	1.000000	0.71417	0.942000	0.38095	0.903000	0.53119	7.391000	0.79828	2.882000	0.98803	0.655000	0.94253	TCG	ZC3H10	-	NULL	ENSG00000135482		0.592	ZC3H10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H10	HGNC	protein_coding	OTTHUMT00000407826.1	-	0.00	18	0	C	NM_032786		56515545	+1	tier1	-	no_errors	ENST00000257940	ensembl	human	known	74_37	missense	68.42	6	13	SNP	1.000	T
ZDHHC17	23390	genome.wustl.edu	37	12	77239524	77239524	+	Silent	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr12:77239524G>T	ENST00000426126.2	+	13	2014	c.1365G>T	c.(1363-1365)gtG>gtT	p.V455V	ZDHHC17_ENST00000334822.5_Silent_p.V455V|ZDHHC17_ENST00000550789.1_3'UTR	NM_015336.2	NP_056151.2	Q8IUH5	ZDH17_HUMAN	zinc finger, DHHC-type containing 17	455					lipoprotein transport (GO:0042953)|magnesium ion transport (GO:0015693)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein palmitoylation (GO:0018345)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(3)|liver(2)|lung(14)	23						ATTGTGGTGTGTGCAACCGCT	0.363																																																	0													194.0	193.0	193.0					12																	77239524		1876	4100	5976	SO:0001819	synonymous_variant	0			AB023163	CCDS44946.1	12q21.2	2013-01-10				ENSG00000186908		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18412	protein-coding gene	gene with protein product		607799				9700202, 18794299	Standard	NM_015336		Approved	HIP14, HYPH, KIAA0946	uc001syk.1	Q8IUH5	OTTHUMG00000169917	ENST00000426126.2:c.1365G>T	12.37:g.77239524G>T			B4DR39|O75407|Q7Z2I0|Q86W89|Q86YK0|Q9P088|Q9UPZ8	Silent	SNP	pfam_Ankyrin_rpt,pfam_Znf_DHHC_palmitoyltrfase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_DHHC_palmitoyltrfase,prints_Ankyrin_rpt	p.V455	ENST00000426126.2	37	c.1365	CCDS44946.1	12																																																																																			ZDHHC17	-	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	ENSG00000186908		0.363	ZDHHC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC17	HGNC	protein_coding	OTTHUMT00000406555.1	-	0.00	66	0	G	NM_015336		77239524	+1	tier1	-	no_errors	ENST00000334822	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.965	T
ZFHX2	85446	genome.wustl.edu	37	14	23992792	23992792	+	Missense_Mutation	SNP	T	T	C			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr14:23992792T>C	ENST00000419474.3	-	9	6714	c.6359A>G	c.(6358-6360)gAa>gGa	p.E2120G	RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000553985.1_RNA|ZFHX2_ENST00000606808.1_5'Flank	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	2120					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GGCCTTCTTTTCCTTGGCACG	0.602																																																	0																																										SO:0001583	missense	0			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.6359A>G	14.37:g.23992792T>C	ENSP00000413418:p.Glu2120Gly		Q9UPU6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E2120G	ENST00000419474.3	37	c.6359	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	T	17.96	3.516919	0.64634	.	.	ENSG00000136367	ENST00000419474	D	0.96651	-4.08	4.46	4.46	0.54185	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.48767	D	0.000167	D	0.98061	0.9361	M	0.87971	2.92	0.47778	D	0.999514	D	0.89917	1.0	D	0.91635	0.999	D	0.98860	1.0762	10	0.87932	D	0	.	12.8591	0.57903	0.0:0.0:0.0:1.0	.	2120	Q9C0A1	ZFHX2_HUMAN	G	2120	ENSP00000413418:E2120G	ENSP00000413418:E2120G	E	-	2	0	ZFHX2	23062632	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.819000	0.86621	1.875000	0.54330	0.379000	0.24179	GAA	ZFHX2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000136367		0.602	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	-	0.00	15	0	T	NM_014894		23992792	-1	tier1	-	no_errors	ENST00000419474	ensembl	human	known	74_37	missense	60.00	10	15	SNP	1.000	C
ZFP64	55734	genome.wustl.edu	37	20	50701424	50701424	+	Missense_Mutation	SNP	C	C	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr20:50701424C>G	ENST00000361387.2	-	9	1670	c.1610G>C	c.(1609-1611)aGc>aCc	p.S537T	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Missense_Mutation_p.S318T	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						CTTGGCCAGGCTGCTGGGCCG	0.657																																																	0													54.0	49.0	51.0					20																	50701424		2203	4300	6503	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1610G>C	20.37:g.50701424C>G	ENSP00000355179:p.Ser537Thr		Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S537T	ENST00000361387.2	37	c.1610	CCDS13439.1	20	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169370	0.57584	.	.	ENSG00000020256	ENST00000371523;ENST00000361387	T;T	0.07114	3.22;3.22	4.4	3.46	0.39613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13586	0.0329	L	0.51422	1.61	0.80722	D	1	D;D	0.56287	0.969;0.975	D;P	0.63381	0.914;0.778	T	0.23833	-1.0177	9	0.11794	T	0.64	.	4.037	0.09733	0.0:0.6778:0.0:0.3222	.	537;318	Q9NTW7;Q9NTW7-2	ZF64B_HUMAN;.	T	318;537	ENSP00000360578:S318T;ENSP00000355179:S537T	ENSP00000355179:S537T	S	-	2	0	ZFP64	50134831	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.725000	0.61979	2.440000	0.82611	0.655000	0.94253	AGC	ZFP64	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000020256		0.657	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	-	0.00	25	0	C	NM_018197		50701424	-1	tier1	-	no_errors	ENST00000361387	ensembl	human	known	74_37	missense	36.11	23	13	SNP	1.000	G
ZNF480	147657	genome.wustl.edu	37	19	52825798	52825798	+	Missense_Mutation	SNP	G	G	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr19:52825798G>T	ENST00000595962.1	+	5	1361	c.1295G>T	c.(1294-1296)tGt>tTt	p.C432F	ZNF480_ENST00000334564.7_Missense_Mutation_p.C389F|CTD-2525I3.6_ENST00000594379.1_RNA|ZNF480_ENST00000335090.6_Missense_Mutation_p.C355F|ZNF480_ENST00000490272.1_3'UTR	NM_144684.2	NP_653285.2	Q8WV37	ZN480_HUMAN	zinc finger protein 480	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(134;0.00212)|OV - Ovarian serous cystadenocarcinoma(262;0.00369)		TGTAATGAATGTGGTAAAGCA	0.373																																																	0													118.0	120.0	119.0					19																	52825798		2203	4300	6503	SO:0001583	missense	0			AY512662	CCDS12850.2, CCDS74437.1	19q13.41	2013-01-08			ENSG00000198464	ENSG00000198464		"""Zinc fingers, C2H2-type"", ""-"""	23305	protein-coding gene	gene with protein product		613910				15219843	Standard	XM_005258525		Approved	MGC32104	uc010ydl.2	Q8WV37	OTTHUMG00000157507	ENST00000595962.1:c.1295G>T	19.37:g.52825798G>T	ENSP00000471754:p.Cys432Phe		Q5JPG9|Q6P0Q4|Q8N1M5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C432F	ENST00000595962.1	37	c.1295	CCDS12850.2	19	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841223	0.51057	.	.	ENSG00000198464	ENST00000468240;ENST00000334564;ENST00000335090	D;D;D	0.85861	-2.04;-2.04;-2.04	2.21	2.21	0.28008	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94398	0.8198	H	0.97758	4.07	0.38033	D	0.935223	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95603	0.8665	9	0.87932	D	0	.	11.5389	0.50655	0.0:0.0:1.0:0.0	.	389;432	F8WEZ9;Q8WV37	.;ZN480_HUMAN	F	432;389;355	ENSP00000417424:C432F;ENSP00000334164:C389F;ENSP00000335670:C355F	ENSP00000334164:C389F	C	+	2	0	ZNF480	57517610	1.000000	0.71417	0.020000	0.16555	0.039000	0.13416	2.894000	0.48640	1.225000	0.43566	0.461000	0.40582	TGT	ZNF480	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198464		0.373	ZNF480-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF480	HGNC	protein_coding	OTTHUMT00000349001.3	-	0.00	52	0	G	NM_144684		52825798	+1	tier1	-	no_errors	ENST00000468240	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
ZNF595	152687	genome.wustl.edu	37	4	53273	53273	+	5'UTR	SNP	C	C	T			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr4:53273C>T	ENST00000509152.2	+	0	76				ZNF595_ENST00000339368.6_3'UTR|ZNF595_ENST00000526473.2_5'UTR			Q8IYB9	ZN595_HUMAN	zinc finger protein 595						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)	20		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		GCGTTCTCGGCTCCGGGAGGC	0.607																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BX537887	CCDS75075.1, CCDS75076.1, CCDS75077.1	4p16.3	2013-01-08				ENSG00000272602		"""Zinc fingers, C2H2-type"", ""-"""	27196	protein-coding gene	gene with protein product						12477932	Standard	NM_182524		Approved	FLJ31740		Q8IYB9		ENST00000509152.2:c.-110C>T	4.37:g.53273C>T				RNA	SNP	-	NULL	ENST00000509152.2	37	NULL		4																																																																																			ZNF595	-	-	ENSG00000197701		0.607	ZNF595-004	PUTATIVE	basic|appris_candidate|exp_conf	protein_coding	ZNF595	HGNC	protein_coding	OTTHUMT00000357817.2	-	0.00	220	0	C	NM_182524		53273	+1	tier1	-	no_errors	ENST00000339368	ensembl	human	known	74_37	rna	7.69	251	21	SNP	0.003	T
ZNF623	9831	genome.wustl.edu	37	8	144733440	144733440	+	Silent	SNP	A	A	G			TCGA-IG-A97H-01A-11D-A387-09	TCGA-IG-A97H-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ae6c7f9a-afa5-4b92-948e-5a82ae1b45ba	8f6eec0f-94ae-4e36-8f6f-b912a0c0d428	g.chr8:144733440A>G	ENST00000501748.2	+	1	1487	c.1398A>G	c.(1396-1398)aaA>aaG	p.K466K	ZNF623_ENST00000458270.2_Silent_p.K426K|ZNF623_ENST00000526926.1_Silent_p.K426K	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	466					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ATTGTGGGAAAGGCTTTATTC	0.418																																																	0													98.0	94.0	95.0					8																	144733440		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.1398A>G	8.37:g.144733440A>G			A4FU80|B4DGP3|E7ENV5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K466	ENST00000501748.2	37	c.1398	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	a	5.172	0.217366	0.09810	.	.	ENSG00000183309	ENST00000328466	.	.	.	4.65	-0.535	0.11879	.	.	.	.	.	T	0.61825	0.2378	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61118	-0.7127	5	0.72032	D	0.01	-22.9793	8.1943	0.31387	0.6487:0.0:0.3513:0.0	.	.	.	.	R	426	.	ENSP00000330358:K426R	K	+	2	0	ZNF623	144804583	0.000000	0.05858	0.994000	0.49952	0.598000	0.36846	-0.846000	0.04336	-0.263000	0.09378	-0.490000	0.04691	AAG	ZNF623	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183309		0.418	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	-	0.00	39	0	A	NM_014789		144733440	+1	tier1	-	no_errors	ENST00000501748	ensembl	human	known	74_37	silent	33.33	18	9	SNP	0.983	G
