#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAAS	8086	genome.wustl.edu	37	12	53709127	53709127	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:53709127G>T	ENST00000209873.4	-	4	556	c.391C>A	c.(391-393)Cat>Aat	p.H131N	AAAS_ENST00000549983.1_5'UTR|AAAS_ENST00000394384.3_Missense_Mutation_p.H131N|AAAS_ENST00000550286.1_Intron	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	131					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						ACAGACAGATGGGGGAACAGG	0.582																																																	0													52.0	51.0	51.0					12																	53709127		2203	4300	6503	SO:0001583	missense	0			AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.391C>A	12.37:g.53709127G>T	ENSP00000209873:p.His131Asn		Q5JB47|Q9NWI6|Q9UG19	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H131N	ENST00000209873.4	37	c.391	CCDS8856.1	12	.	.	.	.	.	.	.	.	.	.	G	24.9	4.580573	0.86645	.	.	ENSG00000094914	ENST00000209873;ENST00000394384;ENST00000547757;ENST00000552161	D;D;T	0.85702	-1.81;-2.02;-1.22	4.5	4.5	0.54988	.	0.105010	0.64402	D	0.000006	D	0.88396	0.6425	L	0.47716	1.5	0.80722	D	1	B;D	0.57899	0.2;0.981	B;D	0.67900	0.089;0.954	D	0.85804	0.1375	10	0.27082	T	0.32	-9.7607	15.0919	0.72201	0.0:0.0:1.0:0.0	.	131;131	Q5JB47;Q9NRG9	.;AAAS_HUMAN	N	131	ENSP00000209873:H131N;ENSP00000377908:H131N;ENSP00000448020:H131N	ENSP00000209873:H131N	H	-	1	0	AAAS	51995394	1.000000	0.71417	0.999000	0.59377	0.911000	0.54048	8.317000	0.89987	2.530000	0.85305	0.643000	0.83706	CAT	AAAS	-	NULL	ENSG00000094914		0.582	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAAS	HGNC	protein_coding	OTTHUMT00000405632.1		0.00	36	0	G			53709127	-1			no_errors	ENST00000209873	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
ABCA2	20	genome.wustl.edu	37	9	139905491	139905491	+	Missense_Mutation	SNP	G	G	A	rs573640596	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:139905491G>A	ENST00000371605.3	-	38	6134	c.5987C>T	c.(5986-5988)gCg>gTg	p.A1996V	ABCA2_ENST00000265662.5_Missense_Mutation_p.A1997V|ABCA2_ENST00000341511.6_Missense_Mutation_p.A1997V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1996					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)	p.A1997V(1)		central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCCCTCAACCGCCATGGCCAC	0.672													g|||	2	0.000399361	0.0	0.0	5008	,	,		7513	0.001		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)											23.0	29.0	27.0					9																	139905491		1986	4144	6130	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.5987C>T	9.37:g.139905491G>A	ENSP00000360666:p.Ala1996Val		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A1997V	ENST00000371605.3	37	c.5990		9	.	.	.	.	.	.	.	.	.	.	g	11.42	1.633488	0.29068	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.87412	-2.25;-2.25;-2.25	3.42	3.42	0.39159	.	0.399450	0.26069	U	0.026523	T	0.79661	0.4484	L	0.34521	1.04	0.23506	N	0.997535	B;B	0.12013	0.001;0.005	B;B	0.14023	0.006;0.01	T	0.61491	-0.7052	10	0.15066	T	0.55	.	15.0671	0.72005	0.0:0.0:1.0:0.0	.	1996;2027	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	V	1997;1996;2027;1997	ENSP00000265662:A1997V;ENSP00000360666:A1996V;ENSP00000344155:A1997V	ENSP00000265662:A1997V	A	-	2	0	ABCA2	139025312	1.000000	0.71417	0.833000	0.33012	0.209000	0.24338	7.369000	0.79578	1.760000	0.52011	0.282000	0.19409	GCG	ABCA2	-	NULL	ENSG00000107331		0.672	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	98	0	G	NM_001606		139905491	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	missense	46.73	57	50	SNP	1.000	A
ABCB6	10058	genome.wustl.edu	37	2	220083263	220083263	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:220083263C>T	ENST00000265316.3	-	1	449	c.133G>A	c.(133-135)Gtg>Atg	p.V45M	ABCB6_ENST00000439002.2_Missense_Mutation_p.V45M	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	45					brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGAGCCAGCACCAAGGCCAGA	0.682																																																	0													16.0	20.0	18.0					2																	220083263		2196	4290	6486	SO:0001583	missense	0			AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.133G>A	2.37:g.220083263C>T	ENSP00000265316:p.Val45Met		O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.V45M	ENST00000265316.3	37	c.133	CCDS2436.1	2	.	.	.	.	.	.	.	.	.	.	C	16.93	3.256838	0.59321	.	.	ENSG00000115657	ENST00000265316;ENST00000439002;ENST00000427013	T;T	0.79141	-1.24;-1.24	5.21	4.33	0.51752	.	0.484707	0.21833	N	0.068446	T	0.69735	0.3144	N	0.24115	0.695	0.80722	D	1	D;P	0.57899	0.981;0.943	P;P	0.53062	0.717;0.525	T	0.70299	-0.4910	10	0.56958	D	0.05	-12.6437	3.5706	0.07916	0.2535:0.4624:0.2043:0.0798	.	45;45	Q9NP58-4;Q9NP58	.;ABCB6_HUMAN	M	45	ENSP00000265316:V45M;ENSP00000394333:V45M	ENSP00000265316:V45M	V	-	1	0	ABCB6	219791507	0.970000	0.33590	1.000000	0.80357	0.631000	0.37964	0.143000	0.16115	1.436000	0.47453	-0.218000	0.12543	GTG	ABCB6	-	NULL	ENSG00000115657		0.682	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB6	HGNC	protein_coding	OTTHUMT00000256820.2	-	0.00	119	0	C	NM_005689		220083263	-1	tier1	-	no_errors	ENST00000265316	ensembl	human	known	74_37	missense	17.78	74	16	SNP	1.000	T
ADAM12	8038	genome.wustl.edu	37	10	127753405	127753405	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:127753405C>T	ENST00000368679.4	-	14	1897	c.1588G>A	c.(1588-1590)Gag>Aag	p.E530K	ADAM12_ENST00000467145.1_5'UTR|ADAM12_ENST00000368676.4_Missense_Mutation_p.E530K	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	530	Cys-rich.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CACTGCTGCTCGTGAGTCTGG	0.632																																																	0													110.0	76.0	87.0					10																	127753405		2203	4300	6503	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1588G>A	10.37:g.127753405C>T	ENSP00000357668:p.Glu530Lys		O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.E530K	ENST00000368679.4	37	c.1588	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.710055	0.96821	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	T;T	0.21734	1.99;1.99	5.11	5.11	0.69529	ADAM, cysteine-rich (2);	0.000000	0.85682	D	0.000000	T	0.40767	0.1130	L	0.45285	1.41	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;0.999;0.999	D;D;D;D;D	0.74348	0.945;0.909;0.909;0.909;0.983	T	0.16364	-1.0405	10	0.66056	D	0.02	.	18.7396	0.91768	0.0:1.0:0.0:0.0	.	527;527;530;527;530	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	K	530	ENSP00000357668:E530K;ENSP00000357665:E530K	ENSP00000357665:E530K	E	-	1	0	ADAM12	127743395	1.000000	0.71417	0.968000	0.41197	0.985000	0.73830	4.693000	0.61753	2.654000	0.90174	0.650000	0.86243	GAG	ADAM12	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000148848		0.632	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	-	0.00	39	0	C			127753405	-1	tier1	-	no_errors	ENST00000368679	ensembl	human	known	74_37	missense	24.14	22	7	SNP	1.000	T
ADAM28	10863	genome.wustl.edu	37	8	24178785	24178785	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:24178785G>A	ENST00000265769.4	+	8	813	c.703G>A	c.(703-705)Gct>Act	p.A235T	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000437154.2_Missense_Mutation_p.A235T|ADAM28_ENST00000540823.1_Missense_Mutation_p.A2T|ADAM28_ENST00000397649.3_Intron	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	235	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A235S(1)		central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ATTTGAGATGGCTAATTATGT	0.323																																					NSCLC(193;488 2149 22258 34798 40734)												1	Substitution - Missense(1)	endometrium(1)											131.0	135.0	134.0					8																	24178785		2203	4300	6503	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.703G>A	8.37:g.24178785G>A	ENSP00000265769:p.Ala235Thr		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.A235T	ENST00000265769.4	37	c.703	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721164	0.68959	.	.	ENSG00000042980	ENST00000265769;ENST00000540823;ENST00000437154	T;T;T	0.63580	-0.05;-0.05;-0.05	5.27	4.25	0.50352	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.60958	0.2309	L	0.53617	1.68	0.80722	D	1	P;P;B	0.47484	0.741;0.896;0.082	B;P;B	0.48368	0.403;0.575;0.096	T	0.60571	-0.7237	9	0.48119	T	0.1	.	8.1027	0.30868	0.142:0.0:0.858:0.0	.	2;235;235	B4DDY3;Q9UKQ2;Q9UKQ2-2	.;ADA28_HUMAN;.	T	235;2;235	ENSP00000265769:A235T;ENSP00000443743:A2T;ENSP00000393699:A235T	ENSP00000265769:A235T	A	+	1	0	ADAM28	24234730	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.811000	0.38942	1.104000	0.41587	0.650000	0.86243	GCT	ADAM28	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000042980		0.323	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2		0.00	59	0	G	NM_021778		24178785	+1			no_errors	ENST00000265769	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
ADAMTS8	11095	genome.wustl.edu	37	11	130289037	130289037	+	Missense_Mutation	SNP	G	G	A	rs369424623		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:130289037G>A	ENST00000257359.6	-	2	1577	c.871C>T	c.(871-873)Cgt>Tgt	p.R291C		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	291	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		CAGAAGTTACGCAGTGTAAGC	0.562																																																	0								G	CYS/ARG	0,4034		0,0,2017	151.0	161.0	158.0		871	3.6	1.0	11		158	2,8362		0,2,4180	no	missense	ADAMTS8	NM_007037.4	180	0,2,6197	AA,AG,GG		0.0239,0.0,0.0161	probably-damaging	291/890	130289037	2,12396	2017	4182	6199	SO:0001583	missense	0			AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.871C>T	11.37:g.130289037G>A	ENSP00000257359:p.Arg291Cys		Q9NZS0	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS8,prints_Peptidase_M12B_ADAM-TS	p.R291C	ENST00000257359.6	37	c.871	CCDS41732.1	11	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847054	0.71603	0.0	2.39E-4	ENSG00000134917	ENST00000257359;ENST00000414575	D	0.87179	-2.22	5.62	3.58	0.41010	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.93644	0.7970	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.94644	0.7833	10	0.87932	D	0	.	14.1239	0.65208	0.0:0.0:0.7269:0.2731	.	291	Q9UP79	ATS8_HUMAN	C	291;320	ENSP00000257359:R291C	ENSP00000257359:R291C	R	-	1	0	ADAMTS8	129794247	0.996000	0.38824	1.000000	0.80357	0.897000	0.52465	1.887000	0.39698	1.305000	0.44909	0.655000	0.94253	CGT	ADAMTS8	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000134917		0.562	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS8	HGNC	protein_coding	OTTHUMT00000385636.1	-	0.00	83	0	G	NM_007037		130289037	-1	tier1	-	no_errors	ENST00000257359	ensembl	human	known	74_37	missense	53.57	26	30	SNP	0.999	A
ADAP1	11033	genome.wustl.edu	37	7	938841	938841	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:938841G>A	ENST00000265846.5	-	10	1144	c.925C>T	c.(925-927)Ctg>Ttg	p.L309L	ADAP1_ENST00000539900.1_Silent_p.L320L|ADAP1_ENST00000449296.2_Silent_p.L237L	NM_001284308.1|NM_001284309.1|NM_001284311.1|NM_006869.2	NP_001271237.1|NP_001271238.1|NP_001271240.1|NP_006860	O75689	ADAP1_HUMAN	ArfGAP with dual PH domains 1	309	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF GTPase activity (GO:0032312)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	6						AACCCATGCAGCACCGTGTAG	0.652																																																	0													49.0	48.0	48.0					7																	938841		2200	4288	6488	SO:0001819	synonymous_variant	0			AJ006422	CCDS5318.1, CCDS64576.1, CCDS64577.1, CCDS75558.1	7p22.3	2013-01-10	2008-09-22	2008-09-22	ENSG00000105963	ENSG00000105963		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16486	protein-coding gene	gene with protein product		608114	"""centaurin, alpha 1"""	CENTA1		10333475	Standard	NM_006869		Approved	GCS1L	uc003sjo.4	O75689	OTTHUMG00000023380	ENST00000265846.5:c.925C>T	7.37:g.938841G>A			A4D2Q2|B3KRZ4|B4DVA6|F6XZ68|H7C2Q4	Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,smart_ArfGAP,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.L320	ENST00000265846.5	37	c.958	CCDS5318.1	7																																																																																			ADAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105963		0.652	ADAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAP1	HGNC	protein_coding	OTTHUMT00000059701.2		0.00	101	0	G	NM_006869		938841	-1			no_errors	ENST00000539900	ensembl	human	known	74_37	silent	5.68	83	5	SNP	1.000	A
AHSG	197	genome.wustl.edu	37	3	186333473	186333473	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:186333473G>T	ENST00000273784.5	+	2	289		c.e2-1		AHSG_ENST00000411641.2_Splice_Site	NM_001622.2	NP_001613.2	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein						acute-phase response (GO:0006953)|negative regulation of bone mineralization (GO:0030502)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|ossification (GO:0001503)|pinocytosis (GO:0006907)|positive regulation of phagocytosis (GO:0050766)|regulation of bone mineralization (GO:0030500)|regulation of inflammatory response (GO:0050727)|skeletal system development (GO:0001501)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|kinase inhibitor activity (GO:0019210)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(2)|stomach(1)	22	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		TGTCTCCACAGCAGCCCTCCG	0.582											OREG0015967	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													51.0	52.0	52.0					3																	186333473		2203	4300	6503	SO:0001630	splice_region_variant	0			D67013, M16961	CCDS3278.1	3q27.3	2006-02-22			ENSG00000145192	ENSG00000145192			349	protein-coding gene	gene with protein product		138680				9322749, 7736783	Standard	NM_001622		Approved	FETUA, A2HS, HSGA	uc003fqk.4	P02765	OTTHUMG00000156605	ENST00000273784.5:c.214-1G>T	3.37:g.186333473G>T		2006	A8K9N6|B2R7G1|O14961|O14962|Q9P152	Splice_Site	SNP	-	e2-1	ENST00000273784.5	37	c.214-1		3	.	.	.	.	.	.	.	.	.	.	G	9.014	0.983111	0.18889	.	.	ENSG00000145192	ENST00000411641;ENST00000541510;ENST00000273784	.	.	.	5.58	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.7865	0.46409	0.0871:0.0:0.9129:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AHSG	187816167	1.000000	0.71417	0.970000	0.41538	0.045000	0.14185	4.026000	0.57232	1.510000	0.48803	0.655000	0.94253	.	AHSG	-	-	ENSG00000145192		0.582	AHSG-002	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	AHSG	HGNC	protein_coding	OTTHUMT00000344762.1		0.00	54	0	G	NM_001622	Intron	186333473	+1			no_errors	ENST00000411641	ensembl	human	known	74_37	splice_site	8.82	31	3	SNP	0.989	T
AIRE	326	genome.wustl.edu	37	21	45706439	45706439	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr21:45706439G>T	ENST00000291582.5	+	2	259		c.e2-1			NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator						humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		CCCCACTGCAGGAGACGCTTC	0.647									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																																								0													41.0	39.0	40.0					21																	45706439		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	APECED	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.133-1G>T	21.37:g.45706439G>T			B2RP50|O43922|O43932|O75745	Splice_Site	SNP	-	e2-1	ENST00000291582.5	37	c.133-1	CCDS13706.1	21	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851019	0.32699	.	.	ENSG00000160224	ENST00000291582	.	.	.	4.25	4.25	0.50352	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.853	0.57869	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AIRE	44530867	1.000000	0.71417	0.998000	0.56505	0.233000	0.25261	4.822000	0.62686	2.288000	0.76882	0.591000	0.81541	.	AIRE	-	-	ENSG00000160224		0.647	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIRE	HGNC	protein_coding	OTTHUMT00000195842.2		0.00	45	0	G		Intron	45706439	+1			no_errors	ENST00000291582	ensembl	human	known	74_37	splice_site	19.23	21	5	SNP	1.000	T
AKNAD1	254268	genome.wustl.edu	37	1	109363176	109363176	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:109363176G>T	ENST00000370001.3	-	14	2508	c.2240C>A	c.(2239-2241)aCa>aAa	p.T747K	AKNAD1_ENST00000477908.1_5'UTR	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	747						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						CTTTCCTGGTGTGGGCTCATG	0.348																																																	0													130.0	128.0	129.0					1																	109363176		2203	4299	6502	SO:0001583	missense	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.2240C>A	1.37:g.109363176G>T	ENSP00000359018:p.Thr747Lys		B9EK62|Q5T1N0|Q8N990|Q8NCN9	Missense_Mutation	SNP	pfam_TF_AT-hook	p.T747K	ENST00000370001.3	37	c.2240	CCDS791.2	1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427970	0.25726	.	.	ENSG00000162641	ENST00000370001	T	0.19105	2.17	5.31	0.742	0.18341	.	0.912970	0.09057	N	0.854874	T	0.04861	0.0131	N	0.24115	0.695	0.09310	N	1	P	0.40476	0.718	B	0.36030	0.216	T	0.31364	-0.9946	10	0.62326	D	0.03	0.0806	7.8366	0.29374	0.3737:0.0:0.6263:0.0	.	747	Q5T1N1	AKND1_HUMAN	K	747	ENSP00000359018:T747K	ENSP00000359018:T747K	T	-	2	0	AKNAD1	109164699	0.000000	0.05858	0.000000	0.03702	0.865000	0.49528	0.187000	0.16998	0.183000	0.20059	0.563000	0.77884	ACA	AKNAD1	-	NULL	ENSG00000162641		0.348	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	HGNC	protein_coding	OTTHUMT00000030923.2	-	0.00	89	0	G	NM_152763		109363176	-1	tier1	-	no_errors	ENST00000370001	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
ALS2CL	259173	genome.wustl.edu	37	3	46723579	46723579	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:46723579G>T	ENST00000318962.4	-	11	1198	c.1115C>A	c.(1114-1116)aCc>aAc	p.T372N	ALS2CL_ENST00000415953.1_Missense_Mutation_p.T372N	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	372					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		CCATTTCAGGGTTCCCCTGGA	0.622																																																	0													55.0	50.0	52.0					3																	46723579		2203	4300	6503	SO:0001583	missense	0			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.1115C>A	3.37:g.46723579G>T	ENSP00000313670:p.Thr372Asn		Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.T372N	ENST00000318962.4	37	c.1115	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	G	15.65	2.897288	0.52121	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	T;T	0.58060	0.36;0.36	4.74	4.74	0.60224	.	0.176811	0.38058	N	0.001831	T	0.67767	0.2928	M	0.64567	1.98	0.80722	D	1	D	0.69078	0.997	D	0.70016	0.967	T	0.65907	-0.6054	10	0.35671	T	0.21	.	15.257	0.73593	0.0:0.0:1.0:0.0	.	372	Q60I27	AL2CL_HUMAN	N	372	ENSP00000313670:T372N;ENSP00000413223:T372N	ENSP00000313670:T372N	T	-	2	0	ALS2CL	46698583	0.998000	0.40836	0.998000	0.56505	0.518000	0.34316	2.956000	0.49129	2.456000	0.83038	0.557000	0.71058	ACC	ALS2CL	-	pfam_MORN,smart_MORN	ENSG00000178038		0.622	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	-	0.00	85	0	G	NM_147129		46723579	-1	tier1	-	no_errors	ENST00000318962	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.997	T
ANK3	288	genome.wustl.edu	37	10	61830581	61830581	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:61830581T>C	ENST00000280772.2	-	37	10249	c.10058A>G	c.(10057-10059)aAg>aGg	p.K3353R	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000373827.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3353					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTTGGAAGCCTTTTCAGCAGA	0.388																																																	0													160.0	158.0	159.0					10																	61830581		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10058A>G	10.37:g.61830581T>C	ENSP00000280772:p.Lys3353Arg		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.K3353R	ENST00000280772.2	37	c.10058	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	T	12.74	2.029270	0.35797	.	.	ENSG00000151150	ENST00000280772	T	0.66099	-0.19	5.42	5.42	0.78866	.	0.000000	0.44097	D	0.000483	T	0.69540	0.3122	L	0.38175	1.15	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.66432	-0.5925	10	0.27082	T	0.32	.	15.4522	0.75282	0.0:0.0:0.0:1.0	.	3353	Q12955	ANK3_HUMAN	R	3353	ENSP00000280772:K3353R	ENSP00000280772:K3353R	K	-	2	0	ANK3	61500587	0.995000	0.38212	0.993000	0.49108	0.985000	0.73830	1.866000	0.39489	2.060000	0.61445	0.459000	0.35465	AAG	ANK3	-	NULL	ENSG00000151150		0.388	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	73	0	T	NM_020987		61830581	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	C
ANKRD60	140731	genome.wustl.edu	37	20	56803315	56803315	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr20:56803315G>A	ENST00000457363.1	-	1	394	c.395C>T	c.(394-396)cCc>cTc	p.P132L				Q9BZ19	ANR60_HUMAN	ankyrin repeat domain 60	132	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.									kidney(1)	1						GAGGTTGAAGGGGATGCCGAC	0.632																																																	0													25.0	31.0	29.0					20																	56803315		692	1591	2283	SO:0001583	missense	0			AL354776		20q13.32	2013-01-10	2008-03-25	2008-03-25	ENSG00000124227	ENSG00000124227		"""Ankyrin repeat domain containing"""	16217	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 86"""	C20orf86			Standard	XM_006710087		Approved	bA196N14.3		Q9BZ19	OTTHUMG00000032837	ENST00000457363.1:c.395C>T	20.37:g.56803315G>A	ENSP00000396747:p.Pro132Leu		Q4VXE6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin_supergroup	p.P132L	ENST00000457363.1	37	c.395		20	.	.	.	.	.	.	.	.	.	.	G	17.95	3.514010	0.64522	.	.	ENSG00000124227	ENST00000457363	T	0.80994	-1.44	3.74	1.74	0.24563	.	0.000000	0.49305	D	0.000159	T	0.82098	0.4963	.	.	.	0.40793	D	0.983273	.	.	.	.	.	.	T	0.80398	-0.1399	7	0.87932	D	0	-33.1458	7.1802	0.25768	0.0971:0.1715:0.7314:0.0	.	.	.	.	L	132	ENSP00000396747:P132L	ENSP00000396747:P132L	P	-	2	0	ANKRD60	56236721	1.000000	0.71417	0.898000	0.35279	0.973000	0.67179	4.151000	0.58105	0.355000	0.24131	-0.440000	0.05779	CCC	ANKRD60	-	pfscan_Ubiquitin_supergroup	ENSG00000124227		0.632	ANKRD60-201	KNOWN	basic|appris_principal	protein_coding	ANKRD60	HGNC	protein_coding		-	0.00	86	0	G	XM_001134442		56803315	-1	tier1	-	no_errors	ENST00000457363	ensembl	human	known	74_37	missense	50.00	42	42	SNP	0.899	A
APC	324	genome.wustl.edu	37	5	112179573	112179573	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:112179573C>A	ENST00000457016.1	+	16	8662	c.8282C>A	c.(8281-8283)cCa>cAa	p.P2761Q	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.P2761Q|APC_ENST00000508376.2_Missense_Mutation_p.P2761Q			P25054	APC_HUMAN	adenomatous polyposis coli	2761	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.P2761L(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAACGTACCCCATTCAGTTCT	0.453		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	2	Substitution - Missense(1)|Unknown(1)	large_intestine(1)|skin(1)											73.0	74.0	73.0					5																	112179573		2202	4299	6501	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.8282C>A	5.37:g.112179573C>A	ENSP00000413133:p.Pro2761Gln		D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P2761Q	ENST00000457016.1	37	c.8282	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	C	16.08	3.020178	0.54576	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	T;T;T	0.78126	-1.15;-1.15;-1.15	5.92	5.92	0.95590	EB-1 binding (1);	0.000000	0.85682	D	0.000000	T	0.71854	0.3389	L	0.29908	0.895	0.80722	D	1	P;P	0.41643	0.758;0.758	B;B	0.41374	0.355;0.355	T	0.68667	-0.5348	9	.	.	.	-16.8033	20.3248	0.98698	0.0:1.0:0.0:0.0	.	2763;2761	Q4LE70;P25054	.;APC_HUMAN	Q	2761	ENSP00000413133:P2761Q;ENSP00000257430:P2761Q;ENSP00000427089:P2761Q	.	P	+	2	0	APC	112207472	1.000000	0.71417	0.973000	0.42090	0.946000	0.59487	6.453000	0.73488	2.818000	0.97014	0.655000	0.94253	CCA	APC	-	pfam_EB1-bd	ENSG00000134982		0.453	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2		0.00	56	0	C	NM_000038		112179573	+1			no_errors	ENST00000257430	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
APOBR	55911	genome.wustl.edu	37	16	28507082	28507082	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:28507082G>T	ENST00000431282.1	+	2	730	c.720G>T	c.(718-720)ggG>ggT	p.G240G	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Silent_p.G240G|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Silent_p.G240G			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	240	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						AGGAGCCTGGGGCCGAAGGGG	0.657																																																	0													15.0	18.0	17.0					16																	28507082		2061	4203	6264	SO:0001819	synonymous_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.720G>T	16.37:g.28507082G>T			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	NULL	p.G240	ENST00000431282.1	37	c.720		16																																																																																			APOBR	-	NULL	ENSG00000184730		0.657	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding			0.00	37	0	G	NM_182804		28507082	+1			no_errors	ENST00000564831	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.003	T
APOM	55937	genome.wustl.edu	37	6	31625026	31625026	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:31625026G>T	ENST00000375916.3	+	3	790	c.294G>T	c.(292-294)cgG>cgT	p.R98R	APOM_ENST00000375920.4_Silent_p.R26R|C6orf47-AS1_ENST00000422049.1_RNA|APOM_ENST00000375918.2_Silent_p.R26R	NM_019101.2	NP_061974.2	O95445	APOM_HUMAN	apolipoprotein M	98					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein metabolic process (GO:0042157)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|response to glucose (GO:0009749)|reverse cholesterol transport (GO:0043691)	discoidal high-density lipoprotein particle (GO:0034365)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|lipid transporter activity (GO:0005319)|phospholipid binding (GO:0005543)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(1)	7						GTGTGCCCCGGAAATGGATCT	0.512																																					Colon(39;129 858 13764 41453 42617)												0													119.0	107.0	111.0					6																	31625026		1509	2707	4216	SO:0001819	synonymous_variant	0			AJ245434	CCDS4710.1, CCDS59004.1	6p21	2014-01-22			ENSG00000204444	ENSG00000204444		"""Apolipoproteins"", ""Lipocalins"""	13916	protein-coding gene	gene with protein product		606907				10531326, 11418126	Standard	NM_019101		Approved	ApoM, G3a, NG20	uc003nvl.3	O95445	OTTHUMG00000031250	ENST00000375916.3:c.294G>T	6.37:g.31625026G>T			B0UX98|Q5SRP4|Q9P046|Q9UMP6	Silent	SNP	pfam_ApoM,superfamily_Calycin-like	p.R98	ENST00000375916.3	37	c.294	CCDS4710.1	6																																																																																			APOM	-	pfam_ApoM,superfamily_Calycin-like	ENSG00000204444		0.512	APOM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOM	HGNC	protein_coding	OTTHUMT00000076527.3	-	0.00	84	0	G	NM_019101		31625026	+1	tier1	-	no_errors	ENST00000375916	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.973	T
ARHGAP9	64333	genome.wustl.edu	37	12	57872895	57872895	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:57872895C>T	ENST00000356411.2	-	2	433	c.295G>A	c.(295-297)Ggc>Agc	p.G99S	ARHGAP9_ENST00000550454.1_5'Flank|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.G99S|ARHGAP9_ENST00000550288.1_Missense_Mutation_p.G178S|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.G170S|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.G99S|ARHGAP9_ENST00000430041.2_5'Flank			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	99					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			AGCAATTGGCCGGGGATGACG	0.557																																																	0													151.0	135.0	140.0					12																	57872895		2203	4300	6503	SO:0001583	missense	0			AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.295G>A	12.37:g.57872895C>T	ENSP00000348782:p.Gly99Ser		B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.G99S	ENST00000356411.2	37	c.295		12	.	.	.	.	.	.	.	.	.	.	C	2.018	-0.425539	0.04701	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000552249	T;T;T;T;T	0.39229	3.26;3.26;1.91;3.27;1.09	5.12	2.75	0.32379	Src homology-3 domain (1);	1.144530	0.06282	N	0.697545	T	0.13114	0.0318	N	0.00538	-1.39	0.09310	N	1	B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.26467	-1.0102	10	0.11485	T	0.65	.	6.1804	0.20468	0.0:0.2006:0.0:0.7994	.	99;178;99;99;99	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9	.;.;RHG09_HUMAN;.;.	S	99;99;99;170;148;17	ENSP00000377380:G99S;ENSP00000348782:G99S;ENSP00000394307:G99S;ENSP00000377386:G170S;ENSP00000448358:G17S	ENSP00000344852:G148S	G	-	1	0	ARHGAP9	56159162	0.000000	0.05858	0.029000	0.17559	0.041000	0.13682	0.296000	0.19083	0.905000	0.36596	-0.238000	0.12139	GGC	ARHGAP9	-	superfamily_SH3_domain	ENSG00000123329		0.557	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	ARHGAP9	HGNC	protein_coding		-	0.00	39	0	C	NM_032496		57872895	-1	tier1	-	no_errors	ENST00000356411	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.032	T
ARID1B	57492	genome.wustl.edu	37	6	157525018	157525018	+	Missense_Mutation	SNP	G	G	A	rs544895806		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:157525018G>A	ENST00000350026.5	+	18	4875	c.4874G>A	c.(4873-4875)cGt>cAt	p.R1625H	ARID1B_ENST00000275248.4_Missense_Mutation_p.R1620H|ARID1B_ENST00000367148.1_Missense_Mutation_p.R1678H|ARID1B_ENST00000346085.5_Missense_Mutation_p.R1638H	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1625					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GAGGCGTGGCGTGTGATGATG	0.408													G|||	1	0.000199681	0.0008	0.0	5008	,	,		24788	0.0		0.0	False		,,,				2504	0.0																0													551.0	553.0	552.0					6																	157525018		2203	4296	6499	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4874G>A	6.37:g.157525018G>A	ENSP00000055163:p.Arg1625His		Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R1678H	ENST00000350026.5	37	c.5033	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344288	0.82022	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.07216	3.61;3.65;3.58;3.63;3.21	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.27241	0.0668	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.998	T	0.02138	-1.1207	10	0.52906	T	0.07	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	1625;1638;1620	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	H	1638;1625;1678;1620;1147	ENSP00000344546:R1638H;ENSP00000055163:R1625H;ENSP00000356116:R1678H;ENSP00000275248:R1620H;ENSP00000412835:R1147H	ENSP00000275248:R1620H	R	+	2	0	ARID1B	157566710	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.652000	0.90054	0.655000	0.94253	CGT	ARID1B	-	NULL	ENSG00000049618		0.408	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	-	0.00	97	0	G	NM_020732		157525018	+1	tier1	-	no_errors	ENST00000367148	ensembl	human	known	74_37	missense	43.56	57	44	SNP	1.000	A
ARMC4	55130	genome.wustl.edu	37	10	28149697	28149697	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:28149697C>A	ENST00000305242.5	-	19	2970	c.2878G>T	c.(2878-2880)Ggt>Tgt	p.G960C	ARMC4_ENST00000537576.1_Missense_Mutation_p.G652C|ARMC4_ENST00000545014.1_Missense_Mutation_p.G485C	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	960					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						TTGTGCTCACCGAAGGCCACT	0.463																																																	0													180.0	146.0	157.0					10																	28149697		2203	4300	6503	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2878G>T	10.37:g.28149697C>A	ENSP00000306410:p.Gly960Cys		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.G960C	ENST00000305242.5	37	c.2878	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403041	0.83230	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	D;D;T	0.93859	-3.3;-3.3;-0.13	5.45	5.45	0.79879	Armadillo-like helical (1);Armadillo-type fold (1);	0.048899	0.85682	D	0.000000	D	0.97387	0.9145	M	0.89534	3.04	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.989;0.997	D	0.96966	0.9705	10	0.45353	T	0.12	-27.4022	19.6409	0.95757	0.0:1.0:0.0:0.0	.	485;960	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	C	652;960;485	ENSP00000443208:G652C;ENSP00000306410:G960C;ENSP00000441076:G485C	ENSP00000306410:G960C	G	-	1	0	ARMC4	28189703	1.000000	0.71417	0.658000	0.29665	0.755000	0.42902	7.490000	0.81461	2.711000	0.92665	0.655000	0.94253	GGT	ARMC4	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000169126		0.463	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1		0.00	54	0	C	NM_018076		28149697	-1			no_errors	ENST00000305242	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
ATP8B1	5205	genome.wustl.edu	37	18	55365039	55365040	+	Frame_Shift_Ins	INS	-	-	T	rs372472702		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:55365039_55365040insT	ENST00000283684.4	-	6	613_614	c.614_615insA	c.(613-615)aatfs	p.N205fs	ATP8B1_ENST00000589147.1_5'UTR|ATP8B1_ENST00000536015.1_Frame_Shift_Ins_p.N205fs|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	205					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				GAACAAAATCATTTTTTTTCAG	0.386																																																	0			GRCh37	CI043911	ATP8B1	I																																				SO:0001589	frameshift_variant	0			AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.615dupA	18.37:g.55365047_55365047dupT	ENSP00000283684:p.Asn205fs		Q9BTP8	Frame_Shift_Ins	INS	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.N205fs	ENST00000283684.4	37	c.615_614	CCDS11965.1	18																																																																																			ATP8B1	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000081923		0.386	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B1	HGNC	protein_coding	OTTHUMT00000256097.1		0.00	70	0	-	NM_005603		55365040	-1	tier1		no_errors	ENST00000283684	ensembl	human	known	74_37	frame_shift_ins	28.74	62	25	INS	1.000:1.000	T
BAI1	575	genome.wustl.edu	37	8	143623484	143623484	+	Missense_Mutation	SNP	G	G	T	rs200543937		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:143623484G>T	ENST00000517894.1	+	28	4783	c.3889G>T	c.(3889-3891)Ggg>Tgg	p.G1297W	BAI1_ENST00000323289.5_Missense_Mutation_p.G1297W			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1297					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CTATCCCGGCGGGCCCCTGCC	0.647																																																	0																																										SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3889G>T	8.37:g.143623484G>T	ENSP00000430945:p.Gly1297Trp			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.G1297W	ENST00000517894.1	37	c.3889		8	.	.	.	.	.	.	.	.	.	.	g	21.1	4.092737	0.76756	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.28069	1.63;1.63	4.26	4.26	0.50523	.	0.141093	0.31673	U	0.007242	T	0.46678	0.1405	L	0.40543	1.245	0.35235	D	0.777282	D	0.76494	0.999	D	0.77557	0.99	T	0.60737	-0.7204	10	0.66056	D	0.02	.	15.6704	0.77270	0.0:0.0:1.0:0.0	.	1297	E9PBK0	.	W	1297	ENSP00000430945:G1297W;ENSP00000313046:G1297W	ENSP00000313046:G1297W	G	+	1	0	BAI1	143620486	0.986000	0.35501	0.983000	0.44433	0.905000	0.53344	2.140000	0.42159	1.910000	0.55303	0.586000	0.80456	GGG	BAI1	-	NULL	ENSG00000181790		0.647	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3		0.00	79	0	G	NM_001702		143623484	+1			no_errors	ENST00000323289	ensembl	human	known	74_37	missense	5.48	68	4	SNP	0.997	T
BCL11B	64919	genome.wustl.edu	37	14	99723818	99723818	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:99723818C>T	ENST00000357195.3	-	2	426	c.417G>A	c.(415-417)gaG>gaA	p.E139E	BCL11B_ENST00000443726.2_Intron|BCL11B_ENST00000345514.2_Silent_p.E139E	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	139					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CTGCAATGTTCTCCTGCTTGG	0.607			T	TLX3	T-ALL																																			Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0													143.0	138.0	140.0					14																	99723818		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.417G>A	14.37:g.99723818C>T			Q9H162	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E139	ENST00000357195.3	37	c.417	CCDS9950.1	14																																																																																			BCL11B	-	NULL	ENSG00000127152		0.607	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	-	0.00	55	0	C	NM_138576		99723818	-1	tier1	-	no_errors	ENST00000357195	ensembl	human	known	74_37	silent	56.52	30	39	SNP	1.000	T
BMS1P8	653557	genome.wustl.edu	37	16	33497547	33497547	+	RNA	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:33497547T>C	ENST00000565156.1	-	0	287									BMS1 pseudogene 8																		AAGGCTGGGATGGAAACAGGA	0.418																																																	0																																												0					16p11.2	2013-09-20			ENSG00000260518	ENSG00000260518			49152	pseudogene	pseudogene							Standard	NG_011420		Approved				OTTHUMG00000176352		16.37:g.33497547T>C				RNA	SNP	-	NULL	ENST00000565156.1	37	NULL		16																																																																																			BMS1P8	-	-	ENSG00000260518		0.418	BMS1P8-003	KNOWN	basic	processed_transcript	BMS1P8	HGNC	pseudogene	OTTHUMT00000431810.1	-	0.00	380	0	T			33497547	-1	tier1	-	no_errors	ENST00000565156	ensembl	human	known	74_37	rna	10.75	332	40	SNP	1.000	C
BRWD1	54014	genome.wustl.edu	37	21	40569302	40569302	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr21:40569302G>A	ENST00000333229.2	-	41	6020	c.5693C>T	c.(5692-5694)tCc>tTc	p.S1898F	BRWD1_ENST00000342449.3_Missense_Mutation_p.S1898F|BRWD1_ENST00000380800.3_Missense_Mutation_p.S1898F	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1898					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CCTTTTCCTGGAAATTTTTCT	0.363																																					Melanoma(170;988 1986 4794 16843 39731)												0													85.0	89.0	88.0					21																	40569302		2203	4299	6502	SO:0001583	missense	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5693C>T	21.37:g.40569302G>A	ENSP00000330753:p.Ser1898Phe		C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.S1898F	ENST00000333229.2	37	c.5693	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645118	0.67358	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.49720	0.77;0.77;0.77	5.02	5.02	0.67125	.	0.804886	0.11415	N	0.566383	T	0.54615	0.1869	L	0.55481	1.735	0.80722	D	1	P;B	0.46220	0.874;0.119	P;B	0.51355	0.667;0.077	T	0.53542	-0.8424	10	0.66056	D	0.02	-3.8534	9.7031	0.40198	0.129:0.0:0.871:0.0	.	1898;1898	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	F	1898	ENSP00000330753:S1898F;ENSP00000344333:S1898F;ENSP00000370178:S1898F	ENSP00000330753:S1898F	S	-	2	0	BRWD1	39491172	0.998000	0.40836	0.978000	0.43139	0.815000	0.46073	3.084000	0.50143	2.327000	0.79052	0.655000	0.94253	TCC	BRWD1	-	NULL	ENSG00000185658		0.363	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	-	0.00	51	0	G	NM_033656		40569302	-1	tier1	-	no_errors	ENST00000333229	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.953	A
BUB1B	701	genome.wustl.edu	37	15	40501908	40501908	+	Missense_Mutation	SNP	C	C	T	rs202132335		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:40501908C>T	ENST00000287598.6	+	17	2411	c.2216C>T	c.(2215-2217)gCc>gTc	p.A739V	BUB1B_ENST00000412359.3_Missense_Mutation_p.A753V	NM_001211.5	NP_001202	O60566	BUB1B_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase B	739					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|protein localization to chromosome, centromeric region (GO:0071459)|protein localization to kinetochore (GO:0034501)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|condensed chromosome kinetochore (GO:0000777)|condensed chromosome outer kinetochore (GO:0000940)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|perinuclear region of cytoplasm (GO:0048471)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(1)|stomach(2)|urinary_tract(2)	36		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)		GAGTTAAGTGCCTCTGCAGAG	0.443			"""Mis, N, F, S"""			rhabdomyosarcoma			Mosaic Variegated Aneuploidy Syndrome																														yes	Rec		Mosaic variegated aneuploidy	15	15q15	701	BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast)		M	0													130.0	128.0	129.0					15																	40501908		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	AF107297	CCDS10053.1	15q15	2014-09-17	2013-01-17		ENSG00000156970	ENSG00000156970			1149	protein-coding gene	gene with protein product		602860	"""budding uninhibited by benzimidazoles 1 (yeast homolog), beta"", ""budding uninhibited by benzimidazoles 1 homolog beta (yeast)"""			9889005	Standard	NM_001211		Approved	BUBR1, MAD3L, Bub1A, SSK1	uc001zkx.4	O60566	OTTHUMG00000129877	ENST00000287598.6:c.2216C>T	15.37:g.40501908C>T	ENSP00000287598:p.Ala739Val		B2R6U0|B4DL09|B4DLG3|O60501|O60627|O60758|O75389|Q59HH6|Q8WV50|Q96KM4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I	p.A753V	ENST00000287598.6	37	c.2258	CCDS10053.1	15	.	.	.	.	.	.	.	.	.	.	C	2.962	-0.214306	0.06101	.	.	ENSG00000156970	ENST00000287598;ENST00000412359;ENST00000442874	T;T	0.15256	2.44;2.44	4.91	0.718	0.18202	.	0.582138	0.16878	N	0.195814	T	0.09335	0.0230	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26849	-1.0091	10	0.33940	T	0.23	5.7486	5.4245	0.16417	0.3912:0.4603:0.0:0.1484	.	739	O60566	BUB1B_HUMAN	V	739;753;622	ENSP00000287598:A739V;ENSP00000398470:A753V	ENSP00000287598:A739V	A	+	2	0	BUB1B	38289200	0.000000	0.05858	0.017000	0.16124	0.036000	0.12997	0.513000	0.22770	0.280000	0.22209	-0.164000	0.13417	GCC	BUB1B	-	NULL	ENSG00000156970		0.443	BUB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1B	HGNC	protein_coding	OTTHUMT00000252122.4	-	0.00	64	0	C			40501908	+1	tier1	-	no_errors	ENST00000412359	ensembl	human	known	74_37	missense	22.55	79	23	SNP	0.001	T
PRKCZ	5590	genome.wustl.edu	37	1	2116604	2116604	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:2116604G>T	ENST00000400921.2	+	0	2069				C1orf86_ENST00000400919.3_3'UTR|RP11-181G12.2_ENST00000536678.1_RNA|PRKCZ_ENST00000400920.1_3'UTR|RP11-181G12.2_ENST00000333854.2_RNA|PRKCZ_ENST00000479263.1_3'UTR|RP11-181G12.2_ENST00000444529.1_RNA	NM_001033581.1	NP_001028753.1	Q05513	KPCZ_HUMAN	protein kinase C, zeta						actin cytoskeleton reorganization (GO:0031532)|activation of phospholipase D activity (GO:0031584)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|inflammatory response (GO:0006954)|insulin receptor signaling pathway (GO:0008286)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|membrane hyperpolarization (GO:0060081)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hydrolase activity (GO:0051346)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of protein complex assembly (GO:0031333)|neuron projection extension (GO:1990138)|peptidyl-serine phosphorylation (GO:0018105)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of interleukin-10 secretion (GO:2001181)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|protein heterooligomerization (GO:0051291)|protein kinase C signaling (GO:0070528)|protein localization to plasma membrane (GO:0072659)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle transport along microtubule (GO:0047496)	apical cortex (GO:0045179)|apical plasma membrane (GO:0016324)|axon hillock (GO:0043203)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|myelin sheath abaxonal region (GO:0035748)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	ATP binding (GO:0005524)|insulin receptor substrate binding (GO:0043560)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(4)|endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	18	all_cancers(77;0.000177)|all_epithelial(69;6.41e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;1.14e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.96e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.3e-23)|GBM - Glioblastoma multiforme(42;2.85e-08)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00294)|BRCA - Breast invasive adenocarcinoma(365;0.00493)|STAD - Stomach adenocarcinoma(132;0.00669)|KIRC - Kidney renal clear cell carcinoma(229;0.0411)|Lung(427;0.213)	Tamoxifen(DB00675)	GGGCGCTGCTGGGAGCAGAAC	0.701																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC014270	CCDS37.1, CCDS41229.1, CCDS55563.1	1p36.33-p36.2	2009-07-10			ENSG00000067606	ENSG00000067606	2.7.11.1		9412	protein-coding gene	gene with protein product		176982					Standard	NM_001242874		Approved	PKC2	uc001aiq.3	Q05513	OTTHUMG00000001238	ENST00000400921.2:c.*156G>T	1.37:g.2116604G>T			A8K4N0|A8MU64|B7Z2J7|E9PCW2|Q15207|Q5SYT5|Q969S4	RNA	SNP	-	NULL	ENST00000400921.2	37	NULL	CCDS41229.1	1																																																																																			C1orf86	-	-	ENSG00000162585		0.701	PRKCZ-009	KNOWN	basic|CCDS	protein_coding	C1orf86	HGNC	protein_coding	OTTHUMT00000098533.3	-	0.00	71	0	G	NM_002744		2116604	-1	tier1	-	no_errors	ENST00000469733	ensembl	human	known	74_37	rna	56.41	17	22	SNP	0.000	T
CA10	56934	genome.wustl.edu	37	17	50235352	50235352	+	5'UTR	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:50235352C>T	ENST00000285273.4	-	0	906				CA10_ENST00000451037.2_5'UTR|CA10_ENST00000442502.2_5'UTR|CA10_ENST00000570565.1_Intron|CA10_ENST00000340813.6_5'UTR	NM_001082533.1	NP_001076002.1	Q9NS85	CAH10_HUMAN	carbonic anhydrase X						brain development (GO:0007420)					cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|skin(3)|stomach(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(22;4.74e-06)		Zonisamide(DB00909)	TCGGGCTCGACGGATGTGCGC	0.617																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF288385	CCDS32684.1	17q21	2012-08-21			ENSG00000154975	ENSG00000154975		"""Carbonic anhydrases"""	1369	protein-coding gene	gene with protein product		604642				8673298, 9921901	Standard	NM_020178		Approved	CARPX, CA-RPX, HUCEP-15	uc002itx.4	Q9NS85	OTTHUMG00000177544	ENST00000285273.4:c.-206G>A	17.37:g.50235352C>T			B2R7J0|B4DGL6	RNA	SNP	-	NULL	ENST00000285273.4	37	NULL	CCDS32684.1	17																																																																																			CA10	-	-	ENSG00000154975		0.617	CA10-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CA10	HGNC	protein_coding	OTTHUMT00000437480.1	-	0.00	53	0	C	NM_020178		50235352	-1	tier1	-	no_errors	ENST00000573294	ensembl	human	known	74_37	rna	26.87	49	18	SNP	1.000	T
CACNA1A	773	genome.wustl.edu	37	19	13441080	13441080	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:13441080C>T	ENST00000360228.5	-	10	1322	c.1323G>A	c.(1321-1323)caG>caA	p.Q441Q	CACNA1A_ENST00000573710.2_Silent_p.Q442Q	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	442					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TATCAGCCAGCTGATCCTCAG	0.522																																																	0													76.0	78.0	77.0					19																	13441080		1935	4147	6082	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1323G>A	19.37:g.13441080C>T			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.Q441	ENST00000360228.5	37	c.1323	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.522	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	-	0.00	64	0	C	NM_000068		13441080	-1	tier1	-	no_errors	ENST00000360228	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
CACNA1C	775	genome.wustl.edu	37	12	2778185	2778185	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:2778185G>T	ENST00000347598.4	+	40	4854	c.4854G>T	c.(4852-4854)ctG>ctT	p.L1618L	CACNA1C_ENST00000335762.5_Silent_p.L1595L|CACNA1C_ENST00000399629.1_Silent_p.L1587L|CACNA1C_ENST00000399638.1_Silent_p.L1598L|CACNA1C_ENST00000399649.1_Silent_p.L1557L|CACNA1C_ENST00000327702.7_Silent_p.L1570L|CACNA1C_ENST00000399601.1_Silent_p.L1570L|CACNA1C_ENST00000399595.1_Silent_p.L1559L|CACNA1C_ENST00000399621.1_Silent_p.L1570L|CACNA1C_ENST00000399617.1_Silent_p.L1570L|CACNA1C_ENST00000399644.1_Silent_p.L1570L|CACNA1C_ENST00000399634.1_Silent_p.L1570L|CACNA1C_ENST00000399591.1_Silent_p.L1559L|CACNA1C_ENST00000406454.3_Silent_p.L1570L|CACNA1C_ENST00000399641.1_Silent_p.L1570L|CACNA1C_ENST00000402845.3_Silent_p.L1570L|CACNA1C_ENST00000399597.1_Silent_p.L1570L|CACNA1C_ENST00000344100.3_Silent_p.L1592L|CACNA1C_ENST00000399655.1_Silent_p.L1570L|CACNA1C_ENST00000399637.1_Silent_p.L1570L|CACNA1C-AS2_ENST00000545526.1_RNA|CACNA1C_ENST00000399603.1_Silent_p.L1570L|CACNA1C_ENST00000399606.1_Silent_p.L1590L	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1618					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GGACGGCCCTGAGGATCAAAA	0.577																																																	0													109.0	113.0	111.0					12																	2778185		2174	4294	6468	SO:0001819	synonymous_variant	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.4854G>T	12.37:g.2778185G>T			B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.L1570	ENST00000347598.4	37	c.4710	CCDS44788.1	12																																																																																			CACNA1C	-	NULL	ENSG00000151067		0.577	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	62	0	G	NM_000719		2778185	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	silent	9.09	40	4	SNP	1.000	T
CAPN15	6650	genome.wustl.edu	37	16	597573	597573	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:597573G>A	ENST00000219611.2	+	4	1098	c.735G>A	c.(733-735)ccG>ccA	p.P245P	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	245					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										ACCCCGTGCCGCGCAGCCGAC	0.746																																																	0													11.0	17.0	15.0					16																	597573		1954	3985	5939	SO:0001819	synonymous_variant	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.735G>A	16.37:g.597573G>A			B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.P245	ENST00000219611.2	37	c.735	CCDS10410.1	16																																																																																			CAPN15	-	NULL	ENSG00000103326		0.746	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN15	HGNC	protein_coding	OTTHUMT00000239271.1	-	0.00	29	0	G	NM_005632		597573	+1	tier1	-	no_errors	ENST00000219611	ensembl	human	known	74_37	silent	14.71	29	5	SNP	0.925	A
CARHSP1	23589	genome.wustl.edu	37	16	8953101	8953101	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:8953101G>T	ENST00000396593.2	-	2	444	c.85C>A	c.(85-87)Cgc>Agc	p.R29S	CARHSP1_ENST00000567626.1_5'Flank|RP11-77H9.2_ENST00000565934.1_RNA|CARHSP1_ENST00000567554.1_Missense_Mutation_p.R29S|CARHSP1_ENST00000561530.1_Missense_Mutation_p.R29S|CARHSP1_ENST00000311052.5_Missense_Mutation_p.R29S|CARHSP1_ENST00000562843.1_Missense_Mutation_p.R29S	NM_001042476.1|NM_001278260.1|NM_001278261.1|NM_001278262.1|NM_001278263.1|NM_001278264.1|NM_001278265.1|NM_001278266.1|NM_014316.3	NP_001035941.1|NP_001265189.1|NP_001265190.1|NP_001265191.1|NP_001265192.1|NP_001265193.1|NP_001265194.1|NP_001265195.1|NP_055131.2	Q9Y2V2	CHSP1_HUMAN	calcium regulated heat stable protein 1, 24kDa	29					intracellular signal transduction (GO:0035556)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|P granule (GO:0043186)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|phosphatase binding (GO:0019902)			endometrium(2)|lung(1)	3						GATGGTGAGCGCTCACGGCTC	0.672																																																	0													27.0	26.0	27.0					16																	8953101		2197	4300	6497	SO:0001583	missense	0			AF115345	CCDS10537.1	16p13.2	2008-02-05	2002-08-29		ENSG00000153048	ENSG00000153048			17150	protein-coding gene	gene with protein product			"""calcium regulated heat stable protein 1 (24kD)"""			9712905	Standard	NM_014316		Approved	CRHSP-24, CSDC1	uc031quz.1	Q9Y2V2	OTTHUMG00000129695	ENST00000396593.2:c.85C>A	16.37:g.8953101G>T	ENSP00000379838:p.Arg29Ser		B2R4C3|D3DUF5|Q2YDX5|Q9BQ53	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold,smart_Cold_shock_prot	p.R29S	ENST00000396593.2	37	c.85	CCDS10537.1	16	.	.	.	.	.	.	.	.	.	.	G	7.522	0.656892	0.14580	.	.	ENSG00000153048	ENST00000396593;ENST00000311052	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.58119	0.2100	M	0.76838	2.35	0.80722	D	1	B	0.31040	0.305	B	0.19666	0.026	T	0.60601	-0.7231	9	0.05833	T	0.94	-4.4229	17.0305	0.86459	0.0:0.0:1.0:0.0	.	29	Q9Y2V2	CHSP1_HUMAN	S	29	.	ENSP00000311847:R29S	R	-	1	0	CARHSP1	8860602	1.000000	0.71417	0.779000	0.31741	0.064000	0.16182	8.534000	0.90620	2.351000	0.79841	0.467000	0.42956	CGC	CARHSP1	-	NULL	ENSG00000153048		0.672	CARHSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARHSP1	HGNC	protein_coding	OTTHUMT00000251902.1	-	0.00	32	0	G	NM_014316		8953101	-1	tier1	-	no_errors	ENST00000311052	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.998	T
CARKD	55739	genome.wustl.edu	37	13	111287078	111287078	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr13:111287078G>A	ENST00000309957.2	+	7	620	c.606G>A	c.(604-606)gtG>gtA	p.V202V	CARKD_ENST00000470164.2_3'UTR|CARKD_ENST00000397191.4_3'UTR|CARKD_ENST00000424185.2_Silent_p.V92V|CARKD_ENST00000458711.2_Silent_p.V71V	NM_001242881.1|NM_018210.3	NP_001229810.1|NP_060680.2			carbohydrate kinase domain containing											NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	15						GGAAGGCTGTGCTCACTCCCA	0.612																																																	0													73.0	61.0	65.0					13																	111287078		2203	4300	6503	SO:0001819	synonymous_variant	0			AF151071	CCDS9513.1, CCDS55903.1	13q34	2008-12-19			ENSG00000213995	ENSG00000213995			25576	protein-coding gene	gene with protein product		615910					Standard	NM_018210		Approved	LP3298, FLJ10769	uc001vrc.3	Q8IW45	OTTHUMG00000017345	ENST00000309957.2:c.606G>A	13.37:g.111287078G>A				Silent	SNP	pfam_YjeF_C_carb_kinase-rel,tigrfam_YjeF_C_carb_kinase-rel	p.V202	ENST00000309957.2	37	c.606	CCDS9513.1	13																																																																																			CARKD	-	pfam_YjeF_C_carb_kinase-rel,tigrfam_YjeF_C_carb_kinase-rel	ENSG00000213995		0.612	CARKD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARKD	HGNC	protein_coding	OTTHUMT00000045764.1	-	0.00	32	0	G	NM_018210		111287078	+1	tier1	-	no_errors	ENST00000309957	ensembl	human	known	74_37	silent	11.43	30	4	SNP	0.404	A
CARTPT	9607	genome.wustl.edu	37	5	71016607	71016607	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:71016607G>T	ENST00000296777.4	+	0	647				CARTPT_ENST00000513096.1_3'UTR	NM_004291.3	NP_004282.1	Q16568	CART_HUMAN	CART prepropeptide						activation of MAPKK activity (GO:0000186)|adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|circadian regulation of gene expression (GO:0032922)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of appetite (GO:0032099)|negative regulation of bone resorption (GO:0045779)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of osteoclast differentiation (GO:0045671)|neuropeptide signaling pathway (GO:0007218)|positive regulation of blood pressure (GO:0045777)|positive regulation of epinephrine secretion (GO:0032812)|positive regulation of transmission of nerve impulse (GO:0051971)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|somatostatin secretion (GO:0070253)|synaptic transmission (GO:0007268)	extracellular space (GO:0005615)|secretory granule (GO:0030141)				large_intestine(1)|lung(2)|ovary(1)	4		Lung NSC(167;0.00153)|Ovarian(174;0.0175)|Prostate(74;0.11)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;8.4e-56)	Amphetamine(DB00182)	CACATTAGATGTTACTGTGTG	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U16826	CCDS4011.1	5q13.2	2008-02-05			ENSG00000164326	ENSG00000164326			24323	protein-coding gene	gene with protein product	"""cocaine and amphetamine regulated transcript"""	602606				9590691, 8647455	Standard	NM_004291		Approved	CART	uc003kbv.2	Q16568	OTTHUMG00000131261	ENST00000296777.4:c.*165G>T	5.37:g.71016607G>T			Q6FG92	RNA	SNP	-	NULL	ENST00000296777.4	37	NULL	CCDS4011.1	5																																																																																			CARTPT	-	-	ENSG00000164326		0.348	CARTPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARTPT	HGNC	protein_coding	OTTHUMT00000254029.2	-	0.00	106	0	G	NM_004291		71016607	+1	tier1	-	no_errors	ENST00000513096	ensembl	human	putative	74_37	rna	5.26	72	4	SNP	0.178	T
CASKIN1	57524	genome.wustl.edu	37	16	2240120	2240120	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:2240120G>A	ENST00000343516.6	-	3	290	c.198C>T	c.(196-198)agC>agT	p.S66S		NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	66					signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						CCAGCAGCAGGCTGATCAATT	0.672																																																	0													39.0	41.0	40.0					16																	2240120		2036	4210	6246	SO:0001819	synonymous_variant	0			AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.198C>T	16.37:g.2240120G>A			Q9P2P0	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_SH3_domain,prints_Ankyrin_rpt	p.S66	ENST00000343516.6	37	c.198	CCDS42103.1	16																																																																																			CASKIN1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000167971		0.672	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASKIN1	HGNC	protein_coding	OTTHUMT00000435055.1	-	0.00	68	0	G	NM_020764		2240120	-1	tier1	-	no_errors	ENST00000343516	ensembl	human	known	74_37	silent	11.11	48	6	SNP	0.597	A
CBR1	873	genome.wustl.edu	37	21	37444605	37444605	+	Intron	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr21:37444605C>T	ENST00000290349.6	+	3	572				CBR1_ENST00000399191.3_Silent_p.C177C|AP000688.14_ENST00000535199.1_RNA|CBR1_ENST00000530908.1_3'UTR|SETD4_ENST00000399201.1_Intron	NM_001757.2	NP_001748.1	P16152	CBR1_HUMAN	carbonyl reductase 1						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|drug metabolic process (GO:0017144)|epithelial cell differentiation (GO:0030855)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|vitamin K metabolic process (GO:0042373)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	15-hydroxyprostaglandin dehydrogenase (NADP+) activity (GO:0047021)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|prostaglandin-E2 9-reductase activity (GO:0050221)			endometrium(2)|kidney(3)	5					Doxorubicin(DB00997)|Haloperidol(DB00502)|Lubiprostone(DB01046)|Tetrabenazine(DB04844)	ACTTTCTATGCGTATTCCTCT	0.428																																																	0																																										SO:0001627	intron_variant	0				CCDS13641.1, CCDS68202.1	21q22.1	2011-09-14			ENSG00000159228	ENSG00000159228	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	1548	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 21C, member 1"""	114830		CBR		8432528, 19027726	Standard	NM_001757		Approved	SDR21C1	uc002yvb.1	P16152	OTTHUMG00000086618	ENST00000290349.6:c.398-139C>T	21.37:g.37444605C>T			B2RBZ7|B4DFK7|Q3LHW8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.C177	ENST00000290349.6	37	c.531	CCDS13641.1	21																																																																																			CBR1	-	NULL	ENSG00000159228		0.428	CBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBR1	HGNC	protein_coding	OTTHUMT00000194633.2	-	0.00	77	0	C			37444605	+1	tier1	-	no_errors	ENST00000399191	ensembl	human	putative	74_37	silent	6.45	58	4	SNP	0.000	T
CC2D2A	57545	genome.wustl.edu	37	4	15529096	15529096	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:15529096G>A	ENST00000503292.1	+	13	1356	c.1176G>A	c.(1174-1176)caG>caA	p.Q392Q	CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000413206.1_Silent_p.Q392Q|CC2D2A_ENST00000424120.1_Silent_p.Q392Q|CC2D2A_ENST00000389652.5_Silent_p.Q343Q	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	392					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						ACAGTAGTCAGCATGTGATCA	0.418																																																	0													88.0	85.0	86.0					4																	15529096		1894	4116	6010	SO:0001819	synonymous_variant	0			AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1176G>A	4.37:g.15529096G>A			A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Silent	SNP	superfamily_C2_dom,smart_C2_dom	p.Q392	ENST00000503292.1	37	c.1176	CCDS47026.1	4																																																																																			CC2D2A	-	NULL	ENSG00000048342		0.418	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CC2D2A	HGNC	protein_coding	OTTHUMT00000359906.2	-	0.00	99	0	G	NM_001080522		15529096	+1	tier1	-	no_errors	ENST00000413206	ensembl	human	known	74_37	silent	28.40	58	23	SNP	1.000	A
CCDC64	92558	genome.wustl.edu	37	12	120427970	120427970	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:120427970C>A	ENST00000397558.2	+	1	298	c.298C>A	c.(298-300)Ctg>Atg	p.L100M		NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	100					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CCCCGAGCTGCTGTCGGTGAT	0.706																																																	0													4.0	5.0	5.0					12																	120427970		1735	3897	5632	SO:0001583	missense	0			U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.298C>A	12.37:g.120427970C>A	ENSP00000380690:p.Leu100Met		A8MUC8|B4DWL0|B5MDJ0|O95000	Missense_Mutation	SNP	NULL	p.L100M	ENST00000397558.2	37	c.298	CCDS41845.1	12	.	.	.	.	.	.	.	.	.	.	C	18.87	3.715340	0.68844	.	.	ENSG00000135127	ENST00000357093;ENST00000397558	T	0.19394	2.15	3.99	3.99	0.46301	.	0.000000	0.52532	D	0.000064	T	0.39655	0.1086	L	0.51422	1.61	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.17501	-1.0367	10	0.39692	T	0.17	-6.3722	16.1446	0.81555	0.0:1.0:0.0:0.0	.	100	Q6ZP65	BICR1_HUMAN	M	81;100	ENSP00000380690:L100M	ENSP00000349605:L81M	L	+	1	2	CCDC64	118912353	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.738000	0.47401	1.806000	0.52798	0.558000	0.71614	CTG	CCDC64	-	NULL	ENSG00000135127		0.706	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC64	HGNC	protein_coding	OTTHUMT00000403390.2		0.00	101	0	C	NM_207311		120427970	+1			no_errors	ENST00000397558	ensembl	human	novel	74_37	missense	5.26	72	4	SNP	1.000	A
CCDC96	257236	genome.wustl.edu	37	4	7043369	7043369	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:7043369G>T	ENST00000310085.4	-	1	1359	c.1297C>A	c.(1297-1299)Cgc>Agc	p.R433S	TADA2B_ENST00000310074.7_5'Flank|TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	433										endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						ACCTTGCTGCGAAGTTTTAAA	0.443																																																	0													311.0	306.0	308.0					4																	7043369		2203	4300	6503	SO:0001583	missense	0			AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.1297C>A	4.37:g.7043369G>T	ENSP00000309285:p.Arg433Ser		Q8N2I7	Missense_Mutation	SNP	NULL	p.R433S	ENST00000310085.4	37	c.1297	CCDS3395.1	4	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223240	0.39300	.	.	ENSG00000173013	ENST00000310085	T	0.59772	0.24	3.55	3.55	0.40652	.	0.621077	0.14365	N	0.324189	T	0.73885	0.3644	M	0.83223	2.63	0.09310	N	1	D	0.63046	0.992	D	0.65987	0.94	T	0.62534	-0.6834	10	0.54805	T	0.06	-5.0508	9.9228	0.41474	0.0:0.0:0.6689:0.3311	.	433	Q2M329	CCD96_HUMAN	S	433	ENSP00000309285:R433S	ENSP00000309285:R433S	R	-	1	0	CCDC96	7094270	0.055000	0.20627	0.104000	0.21259	0.954000	0.61252	1.641000	0.37197	1.817000	0.53016	0.462000	0.41574	CGC	CCDC96	-	NULL	ENSG00000173013		0.443	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC96	HGNC	protein_coding	OTTHUMT00000246838.1	-	0.00	41	0	G	NM_153376		7043369	-1	tier1	-	no_errors	ENST00000310085	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.081	T
CCNA2	890	genome.wustl.edu	37	4	122744749	122744749	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:122744749C>T	ENST00000274026.5	-	1	338	c.35G>A	c.(34-36)cGc>cAc	p.R12H		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	12					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						GCCCGCCTCGCGGGTCGCAGG	0.687																																																	0													7.0	11.0	9.0					4																	122744749		2066	4207	6273	SO:0001583	missense	0				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.35G>A	4.37:g.122744749C>T	ENSP00000274026:p.Arg12His		A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.R12H	ENST00000274026.5	37	c.35	CCDS3723.1	4	.	.	.	.	.	.	.	.	.	.	C	16.84	3.235084	0.58886	.	.	ENSG00000145386	ENST00000274026	T	0.18502	2.21	4.52	2.49	0.30216	.	1.304800	0.05020	N	0.472584	T	0.16769	0.0403	L	0.47716	1.5	0.30705	N	0.749857	B	0.10296	0.003	B	0.04013	0.001	T	0.27054	-1.0085	10	0.34782	T	0.22	.	5.7589	0.18188	0.1803:0.6928:0.0:0.1268	.	12	P20248	CCNA2_HUMAN	H	12	ENSP00000274026:R12H	ENSP00000274026:R12H	R	-	2	0	CCNA2	122964199	1.000000	0.71417	0.998000	0.56505	0.144000	0.21451	1.115000	0.31209	0.457000	0.26962	-0.182000	0.12963	CGC	CCNA2	-	pirsf_Cyclin_A/B/D/E	ENSG00000145386		0.687	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNA2	HGNC	protein_coding	OTTHUMT00000256712.2	-	0.00	29	0	C	NM_001237		122744749	-1	tier1	-	no_errors	ENST00000274026	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
CD5	921	genome.wustl.edu	37	11	60886405	60886405	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:60886405C>A	ENST00000347785.3	+	4	585	c.419C>A	c.(418-420)cCt>cAt	p.P140H		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	140					apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		AAGACAACACCTCCAACGACA	0.597																																																	0													126.0	109.0	115.0					11																	60886405		2203	4299	6502	SO:0001583	missense	0			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.419C>A	11.37:g.60886405C>A	ENSP00000342681:p.Pro140His		A0N0P4|A8K9I3	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Tcell_CD5,prints_SRCR	p.P140H	ENST00000347785.3	37	c.419	CCDS8000.1	11	.	.	.	.	.	.	.	.	.	.	C	15.58	2.874455	0.51695	.	.	ENSG00000110448	ENST00000347785;ENST00000544014	T;T	0.03831	4.6;3.79	4.43	4.43	0.53597	Speract/scavenger receptor-related (1);	0.295993	0.24117	N	0.041388	T	0.17916	0.0430	M	0.75447	2.3	0.09310	N	0.999995	D	0.76494	0.999	D	0.64042	0.921	T	0.01208	-1.1418	10	0.66056	D	0.02	-5.8814	12.7393	0.57241	0.0:1.0:0.0:0.0	.	140	P06127	CD5_HUMAN	H	140	ENSP00000342681:P140H;ENSP00000440899:P140H	ENSP00000342681:P140H	P	+	2	0	CD5	60642981	0.016000	0.18221	0.046000	0.18839	0.022000	0.10575	2.104000	0.41815	2.459000	0.83118	0.609000	0.83330	CCT	CD5	-	superfamily_Srcr_rcpt-rel,prints_Tcell_CD5	ENSG00000110448		0.597	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5	HGNC	protein_coding	OTTHUMT00000396465.2	-	0.00	42	0	C	NM_014207		60886405	+1	tier1	-	no_errors	ENST00000347785	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.116	A
CD84	8832	genome.wustl.edu	37	1	160535365	160535365	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:160535365C>T	ENST00000311224.4	-	2	283	c.217G>A	c.(217-219)Gta>Ata	p.V73I	RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000368054.3_Missense_Mutation_p.V73I|CD84_ENST00000534968.1_Intron|CD84_ENST00000368047.3_5'UTR|CD84_ENST00000368051.3_Missense_Mutation_p.V73I|CD84_ENST00000368048.3_Missense_Mutation_p.V73I	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	73	Ig-like V-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ACAGTAACTACGGGTGCTGTT	0.433																																																	0													210.0	193.0	199.0					1																	160535365		2203	4300	6503	SO:0001583	missense	0			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.217G>A	1.37:g.160535365C>T	ENSP00000312367:p.Val73Ile		B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.V73I	ENST00000311224.4	37	c.217	CCDS53396.1	1	.	.	.	.	.	.	.	.	.	.	c	4.682	0.126832	0.08931	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.62788	0.4;0.39;0.39;0.13;0.14;-0.0	5.11	-1.6	0.08426	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.836780	0.02323	N	0.073139	T	0.09905	0.0243	N	0.01109	-1.01	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0;0.0	T	0.03818	-1.1001	10	0.18276	T	0.48	2.6225	4.817	0.13372	0.0:0.2703:0.3412:0.3884	.	73;73;73;73;73;73	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	I	73	ENSP00000357033:V73I;ENSP00000357027:V73I;ENSP00000312367:V73I;ENSP00000357030:V73I;ENSP00000353163:V73I;ENSP00000357026:V73I	ENSP00000312367:V73I	V	-	1	0	CD84	158801989	0.004000	0.15560	0.000000	0.03702	0.006000	0.05464	-0.148000	0.10219	-0.363000	0.08101	-1.280000	0.01385	GTA	CD84	-	smart_Ig_sub	ENSG00000066294		0.433	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	-	0.00	72	0	C	NM_003874		160535365	-1	tier1	-	no_errors	ENST00000311224	ensembl	human	novel	74_37	missense	7.59	73	6	SNP	0.000	T
CDCA7L	55536	genome.wustl.edu	37	7	21948030	21948030	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:21948030G>A	ENST00000406877.3	-	4	678	c.399C>T	c.(397-399)agC>agT	p.S133S	CDCA7L_ENST00000356195.5_Silent_p.S99S|CDCA7L_ENST00000465490.1_5'UTR|CDCA7L_ENST00000373934.4_Silent_p.S87S	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like	133					positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.S133S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						TTCTAGACCTGCTTCTTCTAG	0.453																																																	1	Substitution - coding silent(1)	lung(1)											124.0	109.0	114.0					7																	21948030		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.399C>T	7.37:g.21948030G>A			A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Silent	SNP	pfam_Znf-4CXXC_R1	p.S133	ENST00000406877.3	37	c.399	CCDS5374.1	7																																																																																			CDCA7L	-	NULL	ENSG00000164649		0.453	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	HGNC	protein_coding	OTTHUMT00000250218.4		0.00	39	0	G	NM_018719		21948030	-1			no_errors	ENST00000406877	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.001	A
CEP112	201134	genome.wustl.edu	37	17	64024488	64024488	+	Silent	SNP	G	G	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:64024488G>C	ENST00000392769.2	-	15	1757	c.1539C>G	c.(1537-1539)gtC>gtG	p.V513V	CEP112_ENST00000541355.1_Silent_p.V148V|CEP112_ENST00000535342.2_Silent_p.V513V|CEP112_ENST00000537949.1_Silent_p.V471V	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	513					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						TTAATTGACAGACATTCTGCT	0.323																																																	0													193.0	172.0	179.0					17																	64024488		2202	4298	6500	SO:0001819	synonymous_variant	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1539C>G	17.37:g.64024488G>C			Q6PIB5|Q8NCR4|Q8NFR4	Silent	SNP	superfamily_t-SNARE	p.V513	ENST00000392769.2	37	c.1539	CCDS32710.1	17																																																																																			CEP112	-	NULL	ENSG00000154240		0.323	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	-	0.00	53	0	G	NM_145036		64024488	-1	tier1	-	no_errors	ENST00000392769	ensembl	human	known	74_37	silent	13.43	58	9	SNP	0.983	C
CEP95	90799	genome.wustl.edu	37	17	62521951	62521951	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:62521951C>G	ENST00000556440.2	+	9	1483	c.973C>G	c.(973-975)Cca>Gca	p.P325A	CEP95_ENST00000553412.1_Missense_Mutation_p.P161A	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	325						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						GGAAGTATATCCAGCTCAGGT	0.383																																																	0													68.0	67.0	68.0					17																	62521951		1852	4101	5953	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.973C>G	17.37:g.62521951C>G	ENSP00000450461:p.Pro325Ala		B4DMD2|Q96M81	Missense_Mutation	SNP	superfamily_CH-domain	p.P325A	ENST00000556440.2	37	c.973	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	C	6.487	0.457964	0.12342	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.28255	1.62;1.62	5.1	-4.3	0.03710	.	0.589006	0.16531	N	0.210367	T	0.13372	0.0324	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.42103	-0.9471	10	0.02654	T	1	0.4526	0.5384	0.00641	0.387:0.2263:0.1268:0.2599	.	325	Q96GE4	CEP95_HUMAN	A	260;325;161	ENSP00000450461:P325A;ENSP00000450906:P161A	ENSP00000438458:P260A	P	+	1	0	CEP95	59952413	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.344000	0.19962	-0.796000	0.04456	-0.188000	0.12872	CCA	CEP95	-	NULL	ENSG00000258890		0.383	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	-	0.00	78	0	C	NM_138363		62521951	+1	tier1	-	no_errors	ENST00000556440	ensembl	human	known	74_37	missense	18.80	107	25	SNP	0.000	G
CEP112	201134	genome.wustl.edu	37	17	64025255	64025255	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:64025255G>C	ENST00000392769.2	-	14	1707	c.1489C>G	c.(1489-1491)Ctt>Gtt	p.L497V	CEP112_ENST00000541355.1_Missense_Mutation_p.L132V|CEP112_ENST00000535342.2_Missense_Mutation_p.L497V|CEP112_ENST00000537949.1_Missense_Mutation_p.L455V	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	497					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						GAAGCTGAAAGAGCATGTTCT	0.313																																																	0													168.0	164.0	165.0					17																	64025255		2202	4294	6496	SO:0001583	missense	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1489C>G	17.37:g.64025255G>C	ENSP00000376522:p.Leu497Val		Q6PIB5|Q8NCR4|Q8NFR4	Missense_Mutation	SNP	superfamily_t-SNARE	p.L497V	ENST00000392769.2	37	c.1489	CCDS32710.1	17	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282401	0.23392	.	.	ENSG00000154240	ENST00000535342;ENST00000392769;ENST00000541355;ENST00000537949	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	5.55	3.4	0.38934	.	0.069772	0.56097	N	0.000023	T	0.11367	0.0277	N	0.25380	0.74	0.30621	N	0.758449	B;B;B	0.24043	0.096;0.096;0.096	B;B;B	0.22152	0.038;0.026;0.038	T	0.09015	-1.0694	10	0.29301	T	0.29	-3.899	10.1343	0.42697	0.07:0.2588:0.6712:0.0	.	455;455;497	F5GYE8;A2RRR7;Q8N8E3	.;.;CE112_HUMAN	V	497;497;132;455	ENSP00000442784:L497V;ENSP00000376522:L497V;ENSP00000443711:L132V;ENSP00000440775:L455V	ENSP00000376522:L497V	L	-	1	0	CEP112	61455717	0.990000	0.36364	0.989000	0.46669	0.956000	0.61745	1.176000	0.31957	1.437000	0.47472	0.655000	0.94253	CTT	CEP112	-	NULL	ENSG00000154240		0.313	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	-	0.00	79	0	G	NM_145036		64025255	-1	tier1	-	no_errors	ENST00000392769	ensembl	human	known	74_37	missense	10.98	73	9	SNP	0.917	C
CEPT1	10390	genome.wustl.edu	37	1	111690319	111690320	+	5'UTR	INS	-	-	A	rs577424942|rs560770564|rs529661950	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:111690319_111690320insA	ENST00000545121.1	+	0	191_192				CEPT1_ENST00000357172.4_5'UTR	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	CTTTAAATATTAAAAAAAAACA	0.361																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.-17->A	1.37:g.111690328_111690328dupA			Q69YJ9|Q9P0Y8	RNA	INS	-	NULL	ENST00000545121.1	37	NULL	CCDS830.1	1																																																																																			CEPT1	-	-	ENSG00000134255		0.361	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEPT1	HGNC	protein_coding	OTTHUMT00000034462.2		0.00	35	0	-	NM_006090		111690320	+1	tier1		no_errors	ENST00000460443	ensembl	human	known	74_37	rna	6.90	27	2	INS	0.002:0.005	A
CERS5	91012	genome.wustl.edu	37	12	50528336	50528336	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:50528336C>A	ENST00000317551.6	-	9	1146	c.1022G>T	c.(1021-1023)aGg>aTg	p.R341M	CERS5_ENST00000422340.2_Missense_Mutation_p.R283M	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	341					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										CACCTTTCCCCTGATCAAGGC	0.493																																																	0													168.0	160.0	163.0					12																	50528336		2203	4300	6503	SO:0001583	missense	0				CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.1022G>T	12.37:g.50528336C>A	ENSP00000325485:p.Arg341Met		B4DV54	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.R341M	ENST00000317551.6	37	c.1022	CCDS8801.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.70|19.70	3.875783|3.875783	0.72180|0.72180	.|.	.|.	ENSG00000139624|ENSG00000139624	ENST00000553122|ENST00000551005;ENST00000317551;ENST00000422340	.|T;T;T	.|0.24538	.|1.85;2.86;2.67	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|0.055509	.|0.64402	.|D	.|0.000002	T|T	0.51312|0.51312	0.1667|0.1667	M|M	0.78344|0.78344	2.41|2.41	0.58432|0.58432	D|D	0.999995|0.999995	.|D;B;D	.|0.76494	.|0.999;0.088;0.994	.|P;B;D	.|0.63597	.|0.827;0.07;0.916	T|T	0.47433|0.47433	-0.9118|-0.9118	5|10	.|0.39692	.|T	.|0.17	-5.2415|-5.2415	18.9053|18.9053	0.92458|0.92458	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|283;341;260	.|B4DV54;Q8N5B7;F8W0U5	.|.;CERS5_HUMAN;.	W|M	71|260;341;283	.|ENSP00000447556:R260M;ENSP00000325485:R341M;ENSP00000389050:R283M	.|ENSP00000325485:R341M	G|R	-|-	1|2	0|0	CERS5|CERS5	48814603|48814603	0.597000|0.597000	0.26874|0.26874	0.998000|0.998000	0.56505|0.56505	0.898000|0.898000	0.52572|0.52572	1.937000|1.937000	0.40193|0.40193	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	GGG|AGG	CERS5	-	pirsf_Longevity_assurance_LAG1_LAC1	ENSG00000139624		0.493	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERS5	HGNC	protein_coding	OTTHUMT00000406069.3	-	0.00	79	0	C	NM_147190		50528336	-1	tier1	-	no_errors	ENST00000317551	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.983	A
CHD7	55636	genome.wustl.edu	37	8	61707598	61707598	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:61707598G>T	ENST00000423902.2	+	4	2629	c.2150G>T	c.(2149-2151)gGa>gTa	p.G717V	CHD7_ENST00000525508.1_Missense_Mutation_p.G717V|CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	717	Lys-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.556_871dup(1)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GTCAACAAGGGAAAAACAGAA	0.393																																																	1	Insertion - In frame(1)	lung(1)											86.0	88.0	87.0					8																	61707598		1830	4070	5900	SO:0001583	missense	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.2150G>T	8.37:g.61707598G>T	ENSP00000392028:p.Gly717Val		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G717V	ENST00000423902.2	37	c.2150	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277488	0.40294	.	.	ENSG00000171316	ENST00000307121;ENST00000423902;ENST00000525508	D;T	0.81499	-1.5;-1.08	5.46	5.46	0.80206	.	0.000000	0.40144	N	0.001163	T	0.59280	0.2182	N	0.02011	-0.69	0.58432	D	0.999999	B	0.10296	0.003	B	0.08055	0.003	T	0.58020	-0.7710	10	0.40728	T	0.16	-19.1935	14.5129	0.67800	0.0:0.0:0.8534:0.1466	.	717	Q9P2D1	CHD7_HUMAN	V	717	ENSP00000392028:G717V;ENSP00000436027:G717V	ENSP00000307304:G717V	G	+	2	0	CHD7	61870152	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.994000	0.70623	2.713000	0.92767	0.655000	0.94253	GGA	CHD7	-	NULL	ENSG00000171316		0.393	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2		0.00	89	0	G	XM_098762		61707598	+1			no_errors	ENST00000423902	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
CHRM3	1131	genome.wustl.edu	37	1	240072323	240072323	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:240072323C>A	ENST00000255380.4	+	5	2351	c.1572C>A	c.(1570-1572)acC>acA	p.T524T		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	524	Agonist binding. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TACCCAAAACCTTTTGGAATC	0.483																																																	0													131.0	110.0	117.0					1																	240072323		2203	4300	6503	SO:0001819	synonymous_variant	0			U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1572C>A	1.37:g.240072323C>A			Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_M3_rcpt,prints_Musac_Ach_rcpt,prints_GPCR_Rhodpsn	p.T524	ENST00000255380.4	37	c.1572	CCDS1616.1	1																																																																																			CHRM3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Musac_Ach_rcpt	ENSG00000133019		0.483	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM3	HGNC	protein_coding	OTTHUMT00000095644.2	-	0.00	57	0	C	NM_000740		240072323	+1	tier1	-	no_errors	ENST00000255380	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.995	A
CHST5	23563	genome.wustl.edu	37	16	75563653	75563653	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:75563653G>T	ENST00000336257.3	-	3	2024	c.630C>A	c.(628-630)ctC>ctA	p.L210L	RP11-77K12.7_ENST00000460606.1_3'UTR|CHST5_ENST00000541075.1_Silent_p.L216L	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	210					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)	p.L210L(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						CGGGGTCGCTGAGCAGCGGGT	0.711																																																	1	Substitution - coding silent(1)	ovary(1)											63.0	67.0	66.0					16																	75563653		2198	4298	6496	SO:0001819	synonymous_variant	0			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.630C>A	16.37:g.75563653G>T			B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.L216	ENST00000336257.3	37	c.648	CCDS10919.1	16																																																																																			CHST5	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000135702		0.711	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST5	HGNC	protein_coding	OTTHUMT00000269025.2		0.00	32	0	G	NM_012126		75563653	-1			no_errors	ENST00000541075	ensembl	human	known	74_37	silent	11.54	23	3	SNP	0.909	T
CLPTM1	1209	genome.wustl.edu	37	19	45489736	45489736	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:45489736G>A	ENST00000337392.5	+	7	846	c.696G>A	c.(694-696)gtG>gtA	p.V232V	CLPTM1_ENST00000589158.1_3'UTR|CLPTM1_ENST00000541297.2_Silent_p.V218V|CLPTM1_ENST00000546079.1_Silent_p.V130V	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	232					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)		p.V232V(2)|p.E233*(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		ATGGGCCTGTGGAGGTGATCT	0.592																																																	4	Substitution - Nonsense(2)|Substitution - coding silent(2)	lung(4)											145.0	111.0	123.0					19																	45489736		2203	4300	6503	SO:0001819	synonymous_variant	0			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.696G>A	19.37:g.45489736G>A			B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	pfam_CLPTM1	p.V232	ENST00000337392.5	37	c.696	CCDS12651.1	19																																																																																			CLPTM1	-	pfam_CLPTM1	ENSG00000104853		0.592	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	HGNC	protein_coding	OTTHUMT00000453267.1		0.00	81	0	G	NM_001294		45489736	+1			no_errors	ENST00000337392	ensembl	human	known	74_37	silent	5.66	50	3	SNP	1.000	A
CLRN2	645104	genome.wustl.edu	37	4	17524614	17524614	+	Silent	SNP	G	G	A	rs374029760		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:17524614G>A	ENST00000511148.2	+	2	483	c.381G>A	c.(379-381)ccG>ccA	p.P127P		NM_001079827.2	NP_001073296.1	A0PK11	CLRN2_HUMAN	clarin 2	127						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|upper_aerodigestive_tract(1)	15						TCCAGGTCCCGTACCGGGCAG	0.552																																																	0								G		0,4294		0,0,2147	60.0	65.0	63.0		381	-10.1	0.0	4		63	1,8537		0,1,4268	no	coding-synonymous	CLRN2	NM_001079827.2		0,1,6415	AA,AG,GG		0.0117,0.0,0.0078		127/233	17524614	1,12831	2147	4269	6416	SO:0001819	synonymous_variant	0				CCDS47032.1	4p15.32	2008-01-17			ENSG00000249581	ENSG00000249581			33939	protein-coding gene	gene with protein product						12080385	Standard	NM_001079827		Approved		uc003gpg.1	A0PK11	OTTHUMG00000160273	ENST00000511148.2:c.381G>A	4.37:g.17524614G>A				Silent	SNP	pfam_PMP22/EMP/MP20/Claudin	p.P127	ENST00000511148.2	37	c.381	CCDS47032.1	4																																																																																			CLRN2	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000249581		0.552	CLRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLRN2	HGNC	protein_coding	OTTHUMT00000359990.2	-	0.00	76	0	G	NM_001079827		17524614	+1	tier1	-	no_errors	ENST00000511148	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.013	A
CNRIP1	25927	genome.wustl.edu	37	2	68544289	68544289	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:68544289C>A	ENST00000263655.3	-	2	935	c.330G>T	c.(328-330)ccG>ccT	p.P110P	CNRIP1_ENST00000409559.3_Splice_Site_p.P110P|CNRIP1_ENST00000409862.1_Silent_p.P110P|CNRIP1_ENST00000481714.1_5'UTR	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	110										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						CAAGCCTTACCGGCATGGTGA	0.478																																																	0													173.0	153.0	160.0					2																	68544289		2203	4300	6503	SO:0001630	splice_region_variant	0			AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.330+1G>T	2.37:g.68544289C>A			B2R4D0|Q49AN4|Q9UFZ0	Silent	SNP	NULL	p.P110	ENST00000263655.3	37	c.330	CCDS1886.1	2																																																																																			CNRIP1	-	NULL	ENSG00000119865		0.478	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNRIP1	HGNC	protein_coding	OTTHUMT00000251758.1		0.00	67	0	C	NM_015463	Silent	68544289	-1			no_errors	ENST00000263655	ensembl	human	known	74_37	silent	5.26	72	4	SNP	1.000	A
CNTN4	152330	genome.wustl.edu	37	3	3080635	3080635	+	Missense_Mutation	SNP	C	C	T	rs548465694	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:3080635C>T	ENST00000397461.1	+	18	2495	c.2111C>T	c.(2110-2112)gCg>gTg	p.A704V	CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000397459.2_Missense_Mutation_p.A376V|CNTN4_ENST00000358480.3_Missense_Mutation_p.A485V|CNTN4_ENST00000418658.1_Missense_Mutation_p.A704V|CNTN4_ENST00000448906.2_Missense_Mutation_p.A376V|CNTN4_ENST00000427331.1_Missense_Mutation_p.A704V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	704	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTCACACCAGCGAATGTCAGT	0.498													C|||	2	0.000399361	0.0	0.0	5008	,	,		20205	0.0		0.0	False		,,,				2504	0.002																0													103.0	97.0	99.0					3																	3080635		2203	4300	6503	SO:0001583	missense	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.2111C>T	3.37:g.3080635C>T	ENSP00000380602:p.Ala704Val		B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A704V	ENST00000397461.1	37	c.2111	CCDS43041.1	3	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177368	0.57692	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62	5.49	5.49	0.81192	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.39200	0.1069	L	0.38953	1.18	0.80722	D	1	B;B	0.27656	0.076;0.184	B;B	0.18263	0.021;0.014	T	0.13656	-1.0501	10	0.27785	T	0.31	.	17.5773	0.87953	0.0:1.0:0.0:0.0	.	703;704	Q8IWV2-3;Q8IWV2	.;CNTN4_HUMAN	V	704;704;704;485;376;376	ENSP00000396010:A704V;ENSP00000380602:A704V;ENSP00000413642:A704V;ENSP00000351267:A485V;ENSP00000380600:A376V;ENSP00000392077:A376V	ENSP00000351267:A485V	A	+	2	0	CNTN4	3055635	1.000000	0.71417	0.998000	0.56505	0.733000	0.41908	7.311000	0.78958	2.565000	0.86533	0.655000	0.94253	GCG	CNTN4	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144619		0.498	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	98	0	C			3080635	+1	tier1	-	no_errors	ENST00000397461	ensembl	human	known	74_37	missense	5.75	82	5	SNP	1.000	T
COL11A1	1301	genome.wustl.edu	37	1	103352363	103352363	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:103352363C>A	ENST00000370096.3	-	63	5170	c.4858G>T	c.(4858-4860)Ggt>Tgt	p.G1620C	COL11A1_ENST00000512756.1_Splice_Site_p.G1504C|COL11A1_ENST00000353414.4_Splice_Site_p.G1581C|COL11A1_ENST00000358392.2_Splice_Site_p.G1632C	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1620	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.G1620C(1)|p.G1632C(1)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATTTACATACCATCTGGGAAG	0.418																																																	2	Substitution - Missense(2)	lung(2)											152.0	151.0	151.0					1																	103352363		2203	4300	6503	SO:0001630	splice_region_variant	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.4858+1G>T	1.37:g.103352363C>A			B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G1632C	ENST00000370096.3	37	c.4894	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	19.77	3.889902	0.72524	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	5.53	5.53	0.82687	Fibrillar collagen, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.72162	0.3426	H	0.97682	4.055	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.82864	-0.0246	9	.	.	.	.	19.4555	0.94886	0.0:1.0:0.0:0.0	.	1504;1581;1632;1620;840	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	C	1620;1632;1581;840;1504	ENSP00000359114:G1620C;ENSP00000351163:G1632C;ENSP00000302551:G1581C;ENSP00000426533:G1504C	.	G	-	1	0	COL11A1	103124951	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.818000	0.86416	2.608000	0.88229	0.313000	0.20887	GGT	COL11A1	-	pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fib_collagen_C	ENSG00000060718		0.418	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	53	0	C	NM_080630	Missense_Mutation	103352363	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	A
COL19A1	1310	genome.wustl.edu	37	6	70856587	70856587	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:70856587G>A	ENST00000322773.4	+	26	1909	c.1807G>A	c.(1807-1809)Ggg>Agg	p.G603R	COL19A1_ENST00000393344.1_Missense_Mutation_p.G225R	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	603	Collagen-like 5.|Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TGGTCCACGTGGGCCAAAGGT	0.313																																																	0													38.0	41.0	40.0					6																	70856587		2203	4300	6503	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1807G>A	6.37:g.70856587G>A	ENSP00000316030:p.Gly603Arg		Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.G603R	ENST00000322773.4	37	c.1807	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858755	0.32884	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99353	-5.77;-5.77	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	H	0.99182	4.46	0.51233	D	0.999915	D	0.89917	1.0	D	0.97110	1.0	D	0.97060	0.9770	10	0.87932	D	0	.	18.3144	0.90215	0.0:0.0:1.0:0.0	.	603	Q14993	COJA1_HUMAN	R	603;225	ENSP00000316030:G603R;ENSP00000377013:G225R	ENSP00000316030:G603R	G	+	1	0	COL19A1	70913308	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	6.313000	0.72844	2.770000	0.95276	0.655000	0.94253	GGG	COL19A1	-	pfam_Collagen	ENSG00000082293		0.313	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	-	0.00	100	0	G			70856587	+1	tier1	-	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	21.21	78	21	SNP	1.000	A
CPEB1	64506	genome.wustl.edu	37	15	83218339	83218340	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:83218339_83218340insG	ENST00000562019.1	-	9	1600_1601	c.1284_1285insC	c.(1282-1287)cccagcfs	p.S429fs	CPEB1_ENST00000564522.1_Frame_Shift_Ins_p.S349fs|CPEB1_ENST00000568128.1_Frame_Shift_Ins_p.S424fs|RP11-152F13.10_ENST00000562833.1_Frame_Shift_Ins_p.P158fs|CPEB1_ENST00000563800.1_Frame_Shift_Ins_p.S451fs|CPEB1_ENST00000423133.2_Frame_Shift_Ins_p.S349fs|CPEB1_ENST00000450751.2_Frame_Shift_Ins_p.S349fs|CPEB1_ENST00000398592.2_Frame_Shift_Ins_p.S198fs|RP11-379H8.1_ENST00000568285.1_Intron|CPEB1_ENST00000568757.1_Frame_Shift_Ins_p.S349fs|CPEB1_ENST00000261723.6_Frame_Shift_Ins_p.S427fs|CPEB1_ENST00000398591.2_Frame_Shift_Ins_p.S354fs			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1	429	Necessary for stress granule assembly and correct localization in dcp1 bodies.				cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			ACCGTCCTGCTGGGGTCAAGCC	0.554																																																	0																																										SO:0001589	frameshift_variant	0			AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.1285dupC	15.37:g.83218343_83218343dupG	ENSP00000457836:p.Ser429fs		B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Frame_Shift_Ins	INS	pfscan_RRM_dom	p.S428fs	ENST00000562019.1	37	c.1285_1284		15																																																																																			CPEB1	-	NULL	ENSG00000214575		0.554	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	CPEB1	HGNC	protein_coding	OTTHUMT00000421102.1		0.00	55	0	-	NM_030594		83218340	-1	tier1		no_errors	ENST00000562019	ensembl	human	known	74_37	frame_shift_ins	36.59	26	15	INS	1.000:1.000	G
CPNE5	57699	genome.wustl.edu	37	6	36710042	36710042	+	3'UTR	DEL	G	G	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:36710042delG	ENST00000244751.2	-	0	2409				CPNE5_ENST00000459703.1_5'UTR|CPNE5_ENST00000393189.2_3'UTR	NM_020939.1	NP_065990.1	Q9HCH3	CPNE5_HUMAN	copine V							extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(4)|liver(1)|lung(9)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GCTGAGACCAGGTTCAGATGT	0.711																																																	0													16.0	21.0	19.0					6																	36710042		2194	4292	6486	SO:0001624	3_prime_UTR_variant	0			H09181	CCDS4825.1	6p21.2	2010-05-28			ENSG00000124772	ENSG00000124772			2318	protein-coding gene	gene with protein product		604209				9430674	Standard	NM_020939		Approved	CPN5, COPN5, KIAA1599	uc003omr.1	Q9HCH3	OTTHUMG00000014602	ENST00000244751.2:c.*3C>-	6.37:g.36710042delG			Q7Z6C8	RNA	DEL	-	NULL	ENST00000244751.2	37	NULL	CCDS4825.1	6																																																																																			CPNE5	-	-	ENSG00000124772		0.711	CPNE5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE5	HGNC	protein_coding	OTTHUMT00000040351.1		0.00	41	0	G	NM_020939		36710042	-1	tier1		no_errors	ENST00000459703	ensembl	human	known	74_37	rna	10.53	17	2	DEL	0.000	-
CPS1	1373	genome.wustl.edu	37	2	211515163	211515163	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:211515163G>T	ENST00000233072.5	+	28	3676		c.e28+1		CPS1_ENST00000451903.2_Splice_Site|CPS1_ENST00000430249.2_Splice_Site	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial						anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AGTTTCTCAGGTAGTGTCCAA	0.358																																																	0													116.0	116.0	116.0					2																	211515163		2203	4300	6503	SO:0001630	splice_region_variant	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3480+1G>T	2.37:g.211515163G>T			B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Splice_Site	SNP	-	e29+1	ENST00000233072.5	37	c.3498+1	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230023	0.79688	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0281	0.97530	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPS1	211223408	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	8.794000	0.91867	2.818000	0.97014	0.655000	0.94253	.	CPS1	-	-	ENSG00000021826		0.358	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	94	0	G		Intron	211515163	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	splice_site	22.34	73	21	SNP	1.000	T
CPT1C	126129	genome.wustl.edu	37	19	50208316	50208316	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:50208316C>T	ENST00000392518.4	+	9	1196	c.824C>T	c.(823-825)gCc>gTc	p.A275V	CPT1C_ENST00000598293.1_Missense_Mutation_p.A275V|CPT1C_ENST00000405931.2_Missense_Mutation_p.A264V|CPT1C_ENST00000323446.5_Missense_Mutation_p.A275V|CPT1C_ENST00000354199.5_Missense_Mutation_p.A275V	NM_001199752.1	NP_001186681.1	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C	275					carnitine metabolic process (GO:0009437)|fatty acid beta-oxidation (GO:0006635)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endoplasmic reticulum membrane (GO:0005789)|mitochondrial outer membrane (GO:0005741)|synapse (GO:0045202)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		GCTGGGAATGCCGTCCATGCC	0.647																																																	0													66.0	70.0	68.0					19																	50208316		2203	4300	6503	SO:0001583	missense	0			AF357970	CCDS12779.1, CCDS46147.1	19q13.33	2014-03-14				ENSG00000169169			18540	protein-coding gene	gene with protein product		608846				12376098, 11001805	Standard	NM_001136052		Approved	FLJ23809, CPTIC, CPT1P	uc010eng.3	Q8TCG5		ENST00000392518.4:c.824C>T	19.37:g.50208316C>T	ENSP00000376303:p.Ala275Val		A8K0Z8|Q5K6N5|Q8N6Q9|Q8NDS6|Q8TE84	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.A275V	ENST00000392518.4	37	c.824	CCDS12779.1	19	.	.	.	.	.	.	.	.	.	.	C	1.850	-0.465353	0.04476	.	.	ENSG00000169169	ENST00000392518;ENST00000354199;ENST00000405931;ENST00000323446;ENST00000295404	D;D;D;D	0.87887	-2.31;-2.31;-2.31;-2.31	4.34	4.34	0.51931	.	0.000000	0.47455	D	0.000239	T	0.69106	0.3074	N	0.10945	0.07	0.28222	N	0.926469	B;B;B;B	0.29432	0.049;0.244;0.004;0.005	B;B;B;B	0.25506	0.055;0.061;0.007;0.019	T	0.58775	-0.7577	10	0.05436	T	0.98	-18.5716	10.1157	0.42589	0.0:0.9019:0.0:0.0981	.	113;275;264;275	C9IY45;Q8TCG5-3;Q8TCG5-2;Q8TCG5	.;.;.;CPT1C_HUMAN	V	275;275;264;275;113	ENSP00000376303:A275V;ENSP00000346138:A275V;ENSP00000384465:A264V;ENSP00000319343:A275V	ENSP00000295404:A113V	A	+	2	0	CPT1C	54900128	0.000000	0.05858	0.438000	0.26821	0.589000	0.36550	0.724000	0.25954	2.260000	0.74910	0.561000	0.74099	GCC	CPT1C	-	pfam_Carn_acyl_trans	ENSG00000169169		0.647	CPT1C-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPT1C	HGNC	protein_coding	OTTHUMT00000465873.1		0.00	27	0	C	NM_152359		50208316	+1			no_errors	ENST00000323446	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.656	T
CRTAC1	55118	genome.wustl.edu	37	10	99655678	99655678	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:99655678G>T	ENST00000370597.3	-	10	1636	c.1281C>A	c.(1279-1281)tcC>tcA	p.S427S	CRTAC1_ENST00000298819.4_Silent_p.S427S|CRTAC1_ENST00000370591.2_Silent_p.S427S	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	427						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GCTGAGCCATGGACTCTCCAT	0.582																																																	0													129.0	108.0	115.0					10																	99655678		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1281C>A	10.37:g.99655678G>T			B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Silent	SNP	pfam_FG-GAP,pfam_UnbV_ASPIC,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom	p.S427	ENST00000370597.3	37	c.1281	CCDS31266.1	10																																																																																			CRTAC1	-	NULL	ENSG00000095713		0.582	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	CRTAC1	HGNC	protein_coding	OTTHUMT00000049754.1		0.00	42	0	G	NM_018058		99655678	-1			no_errors	ENST00000370597	ensembl	human	known	74_37	silent	10.81	32	4	SNP	1.000	T
CSF2RA	1438	genome.wustl.edu	37	X	1428408	1428408	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:1428408G>A	ENST00000381524.3	+	0	1425				CSF2RA_ENST00000355432.3_Missense_Mutation_p.A354T|CSF2RA_ENST00000501036.2_3'UTR|CSF2RA_ENST00000494969.2_Intron|CSF2RA_ENST00000381500.1_3'UTR|CSF2RA_ENST00000498153.1_3'UTR|CSF2RA_ENST00000432318.2_3'UTR|CSF2RA_ENST00000417535.2_3'UTR|CSF2RA_ENST00000361536.3_3'UTR|CSF2RA_ENST00000381529.3_3'UTR|CSF2RA_ENST00000355805.2_3'UTR			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.A354T(1)		central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	GGACATCTCCGCCTCCGCGAC	0.483													g|||	1	0.000199681	0.0008	0.0	5008	,	,		20650	0.0		0.0	False		,,,				2504	0.0				Esophageal Squamous(131;723 1707 25334 40494 41806)												1	Substitution - Missense(1)	large_intestine(1)						G	,,,,,THR/ALA,,	1,4405		0,1,2202	256.0	238.0	244.0		,,,,,1060,,	-1.4	0.0	X	dbSNP_134	244	0,8592		0,0,4296	no	utr-3,utr-3,utr-3,utr-3,utr-3,missense,utr-3,utr-3	CSF2RA	NM_001161529.1,NM_001161530.1,NM_001161532.1,NM_006140.4,NM_172245.2,NM_172246.2,NM_172247.2,NM_172249.2	,,,,,58,,	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,	,,,,,354/378,,	1428408	1,12997	2203	4296	6499	SO:0001624	3_prime_UTR_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.*36G>A	X.37:g.1428408G>A			A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.A354T	ENST00000381524.3	37	c.1060	CCDS35191.1	X	.	.	.	.	.	.	.	.	.	.	.	10.53	1.375564	0.24857	2.27E-4	0.0	ENSG00000198223	ENST00000355432	T	0.43688	0.94	0.69	-1.38	0.09027	.	.	.	.	.	T	0.24314	0.0589	.	.	.	0.09310	N	1	B	0.27117	0.168	B	0.08055	0.003	T	0.13335	-1.0513	7	0.87932	D	0	.	.	.	.	.	355	P15509-5	.	T	354	ENSP00000347606:A354T	ENSP00000347606:A354T	A	+	1	0	CSF2RA	1388408	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-1.397000	0.02511	-1.238000	0.02535	0.110000	0.15639	GCC	CSF2RA	-	NULL	ENSG00000198223		0.483	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CSF2RA	HGNC	protein_coding	OTTHUMT00000035013.2	-	0.00	336	0	G			1428408	+1	tier1	-	no_errors	ENST00000355432	ensembl	human	known	74_37	missense	34.48	152	80	SNP	0.000	A
CSNK1D	1453	genome.wustl.edu	37	17	80202572	80202572	+	3'UTR	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:80202572C>A	ENST00000314028.6	-	0	1682				CSNK1D_ENST00000398519.5_Intron|CSNK1D_ENST00000392334.2_3'UTR	NM_001893.4	NP_001884.2	P48730	KC1D_HUMAN	casein kinase 1, delta						circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle (GO:0005819)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			breast(2)|large_intestine(2)|lung(7)	11	Breast(20;0.00136)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.227)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0155)			GATCCTAGACCGGGGGACGTG	0.532											OREG0024822	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001624	3_prime_UTR_variant	0				CCDS11805.1, CCDS11806.1	17q25	2013-01-17				ENSG00000141551			2452	protein-coding gene	gene with protein product		600864				7797465	Standard	NM_001893		Approved	HCKID, CKID, CKIdelta	uc002kej.3	P48730		ENST00000314028.6:c.*85G>T	17.37:g.80202572C>A		1196	A2I2P2|Q96KZ6|Q9BTN5	RNA	SNP	-	NULL	ENST00000314028.6	37	NULL	CCDS11805.1	17																																																																																			CSNK1D	-	-	ENSG00000141551		0.532	CSNK1D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSNK1D	HGNC	protein_coding	OTTHUMT00000442632.1	-	0.00	109	0	C	NM_139062		80202572	-1	tier1	-	no_errors	ENST00000577578	ensembl	human	putative	74_37	rna	24.73	70	23	SNP	1.000	A
CTNNA3	29119	genome.wustl.edu	37	10	68535271	68535271	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:68535271delT	ENST00000433211.2	-	8	1233	c.1059delA	c.(1057-1059)aaafs	p.K353fs	CTNNA3_ENST00000373744.4_Frame_Shift_Del_p.K353fs	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TACTCCTTTCTTTTTTTCCAG	0.358																																																	0													152.0	148.0	150.0					10																	68535271		2203	4300	6503	SO:0001589	frameshift_variant	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.1059delA	10.37:g.68535271delT	ENSP00000389714:p.Lys353fs			Frame_Shift_Del	DEL	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.E354fs	ENST00000433211.2	37	c.1059	CCDS7269.1	10																																																																																			CTNNA3	-	pfam_Vinculin/catenin	ENSG00000183230		0.358	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2		0.00	74	0	T	NM_013266		68535271	-1	tier1		no_errors	ENST00000373744	ensembl	human	known	74_37	frame_shift_del	18.18	54	12	DEL	0.960	-
CTSF	8722	genome.wustl.edu	37	11	66335492	66335492	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:66335492G>T	ENST00000310325.5	-	2	384	c.275C>A	c.(274-276)cCc>cAc	p.P92H	CTSF_ENST00000533168.1_5'Flank	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F	92					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GCACACCATGGGGTCGTTGCA	0.652																																																	0													48.0	55.0	53.0					11																	66335492		2200	4295	6495	SO:0001583	missense	0			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090	ENST00000310325.5:c.275C>A	11.37:g.66335492G>T	ENSP00000310832:p.Pro92His		B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.P92H	ENST00000310325.5	37	c.275	CCDS8144.1	11	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640402	0.67244	.	.	ENSG00000174080	ENST00000310325	T	0.80738	-1.41	4.45	2.56	0.30785	.	0.247775	0.33732	N	0.004610	T	0.73102	0.3544	L	0.29908	0.895	0.30658	N	0.754707	D	0.63880	0.993	P	0.49999	0.628	T	0.71689	-0.4517	10	0.51188	T	0.08	.	7.0641	0.25141	0.2086:0.0:0.7914:0.0	.	92	Q9UBX1	CATF_HUMAN	H	92	ENSP00000310832:P92H	ENSP00000310832:P92H	P	-	2	0	CTSF	66092068	0.972000	0.33761	1.000000	0.80357	0.851000	0.48451	1.314000	0.33597	0.609000	0.30018	0.462000	0.41574	CCC	CTSF	-	NULL	ENSG00000174080		0.652	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSF	HGNC	protein_coding	OTTHUMT00000393047.1		0.00	76	0	G	NM_003793		66335492	-1			no_errors	ENST00000310325	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
CTSL	1514	genome.wustl.edu	37	9	90345320	90345320	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:90345320G>T	ENST00000343150.5	+	7	1699	c.809G>T	c.(808-810)aGc>aTc	p.S270I	CTSL_ENST00000340342.6_Missense_Mutation_p.S270I|CTSL_ENST00000495822.1_3'UTR			P07711	CATL1_HUMAN	cathepsin L	270					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular response to thyroid hormone stimulus (GO:0097067)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|macrophage apoptotic process (GO:0071888)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|nucleus (GO:0005634)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|histone binding (GO:0042393)|proteoglycan binding (GO:0043394)										CCAGACTGTAGCAGTGAAGAC	0.463																																																	0													119.0	109.0	113.0					9																	90345320		2203	4300	6503	SO:0001583	missense	0			X12451	CCDS6675.1	9q21.33	2013-06-27	2013-06-27	2013-06-27	ENSG00000135047	ENSG00000135047	3.4.22.15	"""Cathepsins"""	2537	protein-coding gene	gene with protein product		116880	"""cathepsin L1"""	CTSL1		8419312, 2835398	Standard	NM_145918		Approved	FLJ31037	uc004apk.4	P07711	OTTHUMG00000020149	ENST00000343150.5:c.809G>T	9.37:g.90345320G>T	ENSP00000345344:p.Ser270Ile		Q6IAV1|Q96QJ0	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.S270I	ENST00000343150.5	37	c.809	CCDS6675.1	9	.	.	.	.	.	.	.	.	.	.	G	19.36	3.813268	0.70912	.	.	ENSG00000135047	ENST00000343150;ENST00000340342	T;T	0.25912	1.77;1.77	4.42	3.51	0.40186	Peptidase C1A, papain C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.55862	0.1947	M	0.90198	3.095	0.80722	D	1	D	0.67145	0.996	D	0.72338	0.977	T	0.65429	-0.6170	10	0.72032	D	0.01	.	12.7841	0.57493	0.0812:0.0:0.9188:0.0	.	270	P07711	CATL1_HUMAN	I	270	ENSP00000345344:S270I;ENSP00000365061:S270I	ENSP00000365061:S270I	S	+	2	0	CTSL1	89535140	1.000000	0.71417	0.028000	0.17463	0.063000	0.16089	3.285000	0.51716	1.033000	0.39918	0.591000	0.81541	AGC	CTSL	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000135047		0.463	CTSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSL	HGNC	protein_coding	OTTHUMT00000052936.1	-	0.00	69	0	G	NM_001912		90345320	+1	tier1	-	no_errors	ENST00000340342	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
CX3CL1	6376	genome.wustl.edu	37	16	57413557	57413557	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:57413557G>T	ENST00000006053.6	+	2	193	c.82G>T	c.(82-84)Ggt>Tgt	p.G28C	CX3CL1_ENST00000564948.1_Intron|CX3CL1_ENST00000563383.1_Missense_Mutation_p.G34C|CX3CL1_ENST00000565912.1_5'UTR	NM_002996.3	NP_002987.1	P78423	X3CL1_HUMAN	chemokine (C-X3-C motif) ligand 1	28	Chemokine.				angiogenesis involved in wound healing (GO:0060055)|cell adhesion (GO:0007155)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|immune response (GO:0006955)|leukocyte adhesive activation (GO:0050902)|leukocyte chemotaxis (GO:0030595)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neutrophil chemotaxis (GO:0030593)|positive regulation of angiogenesis (GO:0045766)|positive regulation of calcium-independent cell-cell adhesion (GO:0051041)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transforming growth factor beta1 production (GO:0032914)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chemokine activity (GO:0008009)|receptor binding (GO:0005102)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5						ACAGCACCACGGTGTGACGAA	0.542																																																	0													153.0	108.0	123.0					16																	57413557		2198	4300	6498	SO:0001583	missense	0			U84487	CCDS10779.1	16q13	2013-02-25	2002-08-22	2002-08-23	ENSG00000006210	ENSG00000006210		"""Endogenous ligands"""	10647	protein-coding gene	gene with protein product		601880	"""small inducible cytokine subfamily D (Cys-X3-Cys), member 1 (fractalkine, neurotactin)"""	SCYD1		9177350, 9024663	Standard	NM_002996		Approved	NTN, C3Xkine, ABCD-3, CXC3C, CXC3, fractalkine, neurotactin	uc002eli.3	P78423	OTTHUMG00000133469	ENST00000006053.6:c.82G>T	16.37:g.57413557G>T	ENSP00000006053:p.Gly28Cys		O00672	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CX3CL1	p.G28C	ENST00000006053.6	37	c.82	CCDS10779.1	16	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207364	0.39003	.	.	ENSG00000006210	ENST00000006053	T	0.14022	2.54	3.26	2.3	0.28687	Chemokine interleukin-8-like domain (1);	0.836600	0.10073	U	0.719511	T	0.31638	0.0803	M	0.68317	2.08	0.25484	N	0.987708	D	0.89917	1.0	D	0.80764	0.994	T	0.07404	-1.0774	10	0.87932	D	0	-18.9178	6.5199	0.22269	0.1326:0.0:0.8674:0.0	.	28	P78423	X3CL1_HUMAN	C	28	ENSP00000006053:G28C	ENSP00000006053:G28C	G	+	1	0	CX3CL1	55971058	0.407000	0.25352	0.021000	0.16686	0.120000	0.20174	1.523000	0.35932	0.969000	0.38237	0.456000	0.33151	GGT	CX3CL1	-	superfamily_Chemokine_IL8-like_dom,prints_Chemokine_CX3CL1	ENSG00000006210		0.542	CX3CL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CL1	HGNC	protein_coding	OTTHUMT00000257345.3	-	0.00	110	0	G	NM_002996		57413557	+1	tier1	-	no_errors	ENST00000006053	ensembl	human	known	74_37	missense	5.00	75	4	SNP	0.020	T
CYP4F3	4051	genome.wustl.edu	37	19	15769357	15769357	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:15769357G>A	ENST00000221307.8	+	11	1353	c.1306G>A	c.(1306-1308)Gac>Aac	p.D436N	CYP4F3_ENST00000591058.1_Missense_Mutation_p.D436N|CYP4F3_ENST00000586182.2_Missense_Mutation_p.D436N|CYP4F3_ENST00000585846.1_Missense_Mutation_p.D436N	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	436					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						CGTGTGGCCGGACCCTGAGGT	0.577																																																	0													117.0	130.0	125.0					19																	15769357		2203	4300	6503	SO:0001583	missense	0			AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.1306G>A	19.37:g.15769357G>A	ENSP00000221307:p.Asp436Asn		B7Z8Z3|O60634|Q5U740	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.D436N	ENST00000221307.8	37	c.1306	CCDS12332.1	19	.	.	.	.	.	.	.	.	.	.	.	3.942	-0.014106	0.07681	.	.	ENSG00000186529	ENST00000538865;ENST00000221307	D	0.81499	-1.5	4.63	2.41	0.29592	.	0.254805	0.30781	U	0.008893	T	0.66567	0.2802	L	0.28776	0.89	0.41841	D	0.990124	B;B;B	0.16802	0.019;0.009;0.009	B;B;B	0.26969	0.075;0.074;0.052	T	0.55749	-0.8092	10	0.27082	T	0.32	.	5.802	0.18420	0.3509:0.0:0.6491:0.0	.	146;436;436	B7Z8I6;B7Z8Z3;Q08477	.;.;CP4F3_HUMAN	N	363;436	ENSP00000221307:D436N	ENSP00000221307:D436N	D	+	1	0	CYP4F3	15630357	0.909000	0.30893	0.996000	0.52242	0.220000	0.24768	1.467000	0.35321	0.786000	0.33708	0.305000	0.20034	GAC	CYP4F3	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000186529		0.577	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CYP4F3	HGNC	protein_coding	OTTHUMT00000460819.3	-	0.00	95	0	G	NM_000896		15769357	+1	tier1	-	no_errors	ENST00000221307	ensembl	human	known	74_37	missense	55.93	26	33	SNP	0.860	A
DAB1	1600	genome.wustl.edu	37	1	57480792	57480792	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:57480792G>T	ENST00000371231.1	-	13	1341	c.1307C>A	c.(1306-1308)aCc>aAc	p.T436N	DAB1_ENST00000420954.2_Missense_Mutation_p.T401N|DAB1_ENST00000371234.4_Missense_Mutation_p.T403N|DAB1_ENST00000414851.2_Missense_Mutation_p.T385N|DAB1_ENST00000371236.2_Missense_Mutation_p.T403N|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000439789.2_Missense_Mutation_p.T317N			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	436					adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						GGGCTTGTCGGTCTGTGGACT	0.602																																																	0													77.0	72.0	74.0					1																	57480792		2203	4300	6503	SO:0001583	missense	0			BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.1307C>A	1.37:g.57480792G>T	ENSP00000360275:p.Thr436Asn		A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Missense_Mutation	SNP	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.T436N	ENST00000371231.1	37	c.1307		1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.878362	0.33162	.	.	ENSG00000173406	ENST00000371236;ENST00000371233;ENST00000371234;ENST00000420954;ENST00000414851;ENST00000439789;ENST00000371231	T;T;T;T;T;T	0.46451	0.9;0.9;0.87;0.9;1.88;0.88	5.54	4.59	0.56863	.	0.462648	0.26457	N	0.024263	T	0.25344	0.0616	N	0.08118	0	0.34017	D	0.652212	B;B;B;B;B	0.25105	0.061;0.04;0.118;0.009;0.118	B;B;B;B;B	0.26969	0.046;0.027;0.075;0.01;0.075	T	0.29274	-1.0017	10	0.31617	T	0.26	-25.5943	14.2757	0.66179	0.0:0.1994:0.8006:0.0	.	385;436;403;317;401	O75553-4;O75553;O75553-6;O75553-3;O75553-5	.;DAB1_HUMAN;.;.;.	N	403;403;403;401;385;317;436	ENSP00000360280:T403N;ENSP00000360278:T403N;ENSP00000395296:T401N;ENSP00000387581:T385N;ENSP00000409328:T317N;ENSP00000360275:T436N	ENSP00000360275:T436N	T	-	2	0	DAB1	57253380	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.297000	0.43593	1.444000	0.47605	0.650000	0.86243	ACC	DAB1	-	NULL	ENSG00000173406		0.602	DAB1-010	KNOWN	basic	protein_coding	DAB1	HGNC	protein_coding	OTTHUMT00000027962.1	-	0.00	80	0	G	NM_021080		57480792	-1	tier1	-	no_errors	ENST00000371231	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
DCC	1630	genome.wustl.edu	37	18	51025708	51025708	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:51025708G>T	ENST00000442544.2	+	27	4555	c.3939G>T	c.(3937-3939)ctG>ctT	p.L1313L	DCC_ENST00000581580.1_Silent_p.L946L|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1313					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CACCTATGCTGCCCCCATCTC	0.507																																																	0													178.0	146.0	157.0					18																	51025708		2203	4300	6503	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3939G>T	18.37:g.51025708G>T				Silent	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L1313	ENST00000442544.2	37	c.3939	CCDS11952.1	18																																																																																			DCC	-	pfam_Neogenin_C	ENSG00000187323		0.507	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	100	0	G	NM_005215		51025708	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	silent	28.07	82	32	SNP	1.000	T
DCDC1	341019	genome.wustl.edu	37	11	30914471	30914471	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:30914471T>C	ENST00000597505.1	-	34	4966	c.4967A>G	c.(4966-4968)aAg>aGg	p.K1656R	DCDC1_ENST00000406071.2_Missense_Mutation_p.K394R			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					GTTGCTCGGCTTGACTGCTAT	0.423																																																	0													204.0	195.0	198.0					11																	30914471		1891	4134	6025	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.4967A>G	11.37:g.30914471T>C	ENSP00000472625:p.Lys1656Arg		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	NULL	p.K394R	ENST00000597505.1	37	c.1181		11	.	.	.	.	.	.	.	.	.	.	T	6.791	0.514899	0.12944	.	.	ENSG00000170959	ENST00000406071	.	.	.	5.8	1.53	0.23141	.	.	.	.	.	T	0.21674	0.0522	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.29912	-0.9996	6	0.10111	T	0.7	.	3.9666	0.09434	0.1506:0.3097:0.0:0.5398	.	.	.	.	R	394	.	ENSP00000385936:K394R	K	-	2	0	DCDC5	30871047	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.210000	0.17455	-0.004000	0.14419	0.454000	0.30748	AAG	DCDC1	-	NULL	ENSG00000170959		0.423	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	73	0	T	NM_181807		30914471	-1	tier1	-	no_errors	ENST00000406071	ensembl	human	known	74_37	missense	54.39	26	31	SNP	0.000	C
DCLRE1C	64421	genome.wustl.edu	37	10	14970128	14970128	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:14970128G>T	ENST00000378278.2	-	10	841	c.804C>A	c.(802-804)agC>agA	p.S268R	DCLRE1C_ENST00000378246.2_Missense_Mutation_p.S153R|DCLRE1C_ENST00000378255.1_Missense_Mutation_p.S148R|DCLRE1C_ENST00000396817.2_Missense_Mutation_p.S148R|DCLRE1C_ENST00000492201.1_5'Flank|DCLRE1C_ENST00000378258.1_Missense_Mutation_p.S148R|DCLRE1C_ENST00000357717.2_Missense_Mutation_p.S153R|DCLRE1C_ENST00000378249.1_Missense_Mutation_p.S153R|DCLRE1C_ENST00000453695.2_Missense_Mutation_p.S148R|DCLRE1C_ENST00000378289.4_Missense_Mutation_p.S268R|DCLRE1C_ENST00000378254.1_Missense_Mutation_p.S148R			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	268					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						AGGGTAATTTGCTCCACTGAA	0.358								Non-homologous end-joining																																									0													94.0	88.0	90.0					10																	14970128		2203	4300	6503	SO:0001583	missense	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.804C>A	10.37:g.14970128G>T	ENSP00000367527:p.Ser268Arg		D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Missense_Mutation	SNP	pfam_DRMBL	p.S268R	ENST00000378278.2	37	c.804	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	G	14.86	2.662694	0.47572	.	.	ENSG00000152457	ENST00000378289;ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258	T;T;T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	5.6	0.444	0.16592	DNA repair metallo-beta-lactamase (1);	0.209202	0.64402	D	0.000019	T	0.36963	0.0986	L	0.38838	1.175	0.23186	N	0.998159	P;B;B	0.48089	0.905;0.007;0.029	P;B;B	0.49226	0.603;0.009;0.078	T	0.25847	-1.0120	10	0.56958	D	0.05	.	8.8369	0.35117	0.5173:0.0:0.4827:0.0	.	268;153;268	Q96SD1-4;Q96SD1-3;Q96SD1	.;.;DCR1C_HUMAN	R	268;148;153;153;153;148;148;148;268;148	ENSP00000367538:S268R;ENSP00000400529:S148R;ENSP00000367492:S153R;ENSP00000350349:S153R;ENSP00000367496:S153R;ENSP00000380030:S148R;ENSP00000367503:S148R;ENSP00000367502:S148R;ENSP00000367527:S268R;ENSP00000367506:S148R	ENSP00000350349:S153R	S	-	3	2	DCLRE1C	15010134	1.000000	0.71417	0.858000	0.33744	0.716000	0.41182	0.660000	0.25009	-0.130000	0.11599	0.563000	0.77884	AGC	DCLRE1C	-	pfam_DRMBL	ENSG00000152457		0.358	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	-	0.00	42	0	G	NM_022487		14970128	-1	tier1	-	no_errors	ENST00000378278	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
DCT	1638	genome.wustl.edu	37	13	95121153	95121153	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr13:95121153C>T	ENST00000377028.5	-	2	855	c.442G>A	c.(442-444)Gcg>Acg	p.A148T	DCT_ENST00000446125.1_Missense_Mutation_p.A148T|DCT_ENST00000490854.1_5'Flank	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	148					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CTCTTCTTCGCGAGATCTAAG	0.562																																																	0													226.0	223.0	224.0					13																	95121153		2203	4300	6503	SO:0001583	missense	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.442G>A	13.37:g.95121153C>T	ENSP00000366227:p.Ala148Thr		Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.A148T	ENST00000377028.5	37	c.442	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	C	16.37	3.105291	0.56291	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.98901	-5.22;-5.22	5.79	4.93	0.64822	Uncharacterised domain, di-copper centre (2);	0.203730	0.51477	D	0.000088	D	0.99190	0.9719	M	0.92122	3.275	0.54753	D	0.999987	D;D	0.89917	0.996;1.0	P;P	0.60236	0.766;0.871	D	0.98818	1.0746	9	.	.	.	-11.3911	16.0071	0.80370	0.1356:0.8644:0.0:0.0	.	148;148	Q09GT4;P40126	.;TYRP2_HUMAN	T	148	ENSP00000366227:A148T;ENSP00000392762:A148T	.	A	-	1	0	DCT	93919154	0.991000	0.36638	0.049000	0.19019	0.007000	0.05969	2.931000	0.48932	1.405000	0.46838	0.655000	0.94253	GCG	DCT	-	superfamily_Unchr_di-copper_centre	ENSG00000080166		0.562	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	-	0.00	63	0	C			95121153	-1	tier1	-	no_errors	ENST00000446125	ensembl	human	known	74_37	missense	11.32	47	6	SNP	0.948	T
DCX	1641	genome.wustl.edu	37	X	110644499	110644499	+	Missense_Mutation	SNP	C	C	A	rs146279155		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:110644499C>A	ENST00000338081.3	-	3	838	c.667G>T	c.(667-669)Gtc>Ttc	p.V223F	DCX_ENST00000371993.2_Missense_Mutation_p.V142F|DCX_ENST00000356220.3_Missense_Mutation_p.V142F|DCX_ENST00000496551.1_5'UTR|DCX_ENST00000488120.1_Missense_Mutation_p.V142F|DCX_ENST00000356915.2_Missense_Mutation_p.V142F	NM_000555.3	NP_000546.2	O43602	DCX_HUMAN	doublecortin	223					axon extension (GO:0048675)|axon guidance (GO:0007411)|brain development (GO:0007420)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neuron migration (GO:0001764)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuron projection (GO:0043005)	microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|skin(6)|upper_aerodigestive_tract(1)	41						TTGGGATTGACATTCTTGGTG	0.443																																																	0													126.0	115.0	119.0					X																	110644499		2203	4300	6503	SO:0001583	missense	0			AF040254	CCDS14556.1, CCDS14557.1, CCDS14558.1	Xq22.3-q23	2008-08-01	2008-08-01		ENSG00000077279	ENSG00000077279			2714	protein-coding gene	gene with protein product	"""doublecortex"""	300121	"""doublecortex; lissencephaly, X-linked (doublecortin)"""			9489699, 9489700	Standard	NM_178151		Approved	SCLH, DC, LISX, DBCN, XLIS	uc004epd.3	O43602	OTTHUMG00000022204	ENST00000338081.3:c.667G>T	X.37:g.110644499C>A	ENSP00000337697:p.Val223Phe		A6NFY6|A9Z1V8|D3DUY8|D3DUY9|D3DUZ0|O43911|Q5JYZ5	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pirsf_Doublecortin_chordata,pfscan_Doublecortin_dom	p.V223F	ENST00000338081.3	37	c.667	CCDS14556.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.94|13.94	2.385764|2.385764	0.42308|0.42308	.|.	.|.	ENSG00000077279|ENSG00000077279	ENST00000358070|ENST00000356915;ENST00000371993;ENST00000338081;ENST00000356220;ENST00000488120	.|D;D;D;D;D	.|0.86366	.|-2.11;-2.11;-2.11;-2.11;-2.11	4.74|4.74	4.74|4.74	0.60224|0.60224	.|Doublecortin domain (2);	.|0.138741	.|0.47852	.|D	.|0.000219	D|D	0.88175|0.88175	0.6366|0.6366	M|M	0.77313|0.77313	2.365|2.365	0.80722|0.80722	D|D	1|1	.|B;B	.|0.15141	.|0.012;0.012	.|B;B	.|0.21708	.|0.036;0.036	D|D	0.86229|0.86229	0.1636|0.1636	5|10	.|0.52906	.|T	.|0.07	.|.	17.6068|17.6068	0.88040|0.88040	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|211;223	.|B4DM53;O43602	.|.;DCX_HUMAN	I|F	214|142;142;223;142;142	.|ENSP00000349385:V142F;ENSP00000361061:V142F;ENSP00000337697:V223F;ENSP00000348553:V142F;ENSP00000419861:V142F	.|ENSP00000337697:V223F	M|V	-|-	3|1	0|0	DCX|DCX	110531155|110531155	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.980000|5.980000	0.70516|0.70516	2.283000|2.283000	0.76528|0.76528	0.600000|0.600000	0.82982|0.82982	ATG|GTC	DCX	-	pirsf_Doublecortin_chordata	ENSG00000077279		0.443	DCX-006	KNOWN	basic|CCDS	protein_coding	DCX	HGNC	protein_coding	OTTHUMT00000357058.1	-	0.00	24	0	C	NM_178153		110644499	-1	tier1	-	no_errors	ENST00000338081	ensembl	human	known	74_37	missense	87.50	3	21	SNP	1.000	A
DDX51	317781	genome.wustl.edu	37	12	132626438	132626438	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:132626438G>T	ENST00000397333.3	-	6	990	c.952C>A	c.(952-954)Cag>Aag	p.Q318K	NOC4L_ENST00000330579.1_5'Flank	NM_175066.3	NP_778236.2	Q8N8A6	DDX51_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 51	318	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(1)|lung(5)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.59e-08)|Epithelial(86;3.62e-07)|all cancers(50;2.13e-05)		AGAGACTTCTGTCCCGTAACC	0.567																																																	0													62.0	64.0	63.0					12																	132626438		1959	4147	6106	SO:0001583	missense	0			BC040185	CCDS41865.1	12q24.33	2005-10-12				ENSG00000185163		"""DEAD-boxes"""	20082	protein-coding gene	gene with protein product							Standard	NM_175066		Approved		uc001ujy.4	Q8N8A6		ENST00000397333.3:c.952C>A	12.37:g.132626438G>T	ENSP00000380495:p.Gln318Lys		A8MPT9|Q5CZ71|Q8IXK5|Q96ED1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q318K	ENST00000397333.3	37	c.952	CCDS41865.1	12	.	.	.	.	.	.	.	.	.	.	G	15.75	2.924753	0.52653	.	.	ENSG00000185163	ENST00000397333	T	0.14640	2.49	4.95	4.95	0.65309	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.060499	0.64402	D	0.000002	T	0.12987	0.0315	N	0.12502	0.225	0.80722	D	1	P	0.37548	0.599	P	0.45167	0.472	T	0.21075	-1.0256	10	0.42905	T	0.14	-24.8905	15.6902	0.77446	0.0:0.0:1.0:0.0	.	318	Q8N8A6	DDX51_HUMAN	K	318	ENSP00000380495:Q318K	ENSP00000380495:Q318K	Q	-	1	0	DDX51	131192391	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	8.526000	0.90588	2.279000	0.76181	0.491000	0.48974	CAG	DDX51	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000185163		0.567	DDX51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX51	HGNC	protein_coding	OTTHUMT00000398978.1	-	0.00	88	0	G	NM_175066		132626438	-1	tier1	-	no_errors	ENST00000397333	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
DIRAS3	9077	genome.wustl.edu	37	1	68512485	68512485	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:68512485C>A	ENST00000370981.1	-	4	1132	c.496G>T	c.(496-498)Ggt>Tgt	p.G166C	DIRAS3_ENST00000395201.1_Missense_Mutation_p.G166C|GNG12-AS1_ENST00000413628.1_RNA|GNG12-AS1_ENST00000420587.1_RNA			O95661	DIRA3_HUMAN	DIRAS family, GTP-binding RAS-like 3	166					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of gene expression by genetic imprinting (GO:0006349)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CAGGTGGCACCATCATTCAGG	0.512																																																	0													116.0	113.0	114.0					1																	68512485		2203	4300	6503	SO:0001583	missense	0			U96750	CCDS641.1	1p31	2014-05-09		2005-01-27	ENSG00000162595	ENSG00000162595			687	protein-coding gene	gene with protein product		605193	"""ras homolog gene family, member I"""	ARHI		9874798	Standard	XM_006711027		Approved	NOEY2	uc001ded.3	O95661	OTTHUMG00000009544	ENST00000370981.1:c.496G>T	1.37:g.68512485C>A	ENSP00000360020:p.Gly166Cys		B3KMP3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.G166C	ENST00000370981.1	37	c.496	CCDS641.1	1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.060956	0.76074	.	.	ENSG00000162595	ENST00000370981;ENST00000395201	T;T	0.80994	-1.44;-1.44	4.66	3.74	0.42951	Small GTP-binding protein domain (1);	.	.	.	.	D	0.91290	0.7254	H	0.95982	3.75	0.50467	D	0.99987	D	0.89917	1.0	D	0.91635	0.999	D	0.93962	0.7241	9	0.87932	D	0	.	14.6962	0.69124	0.0:0.8535:0.1464:0.0	.	166	O95661	DIRA3_HUMAN	C	166	ENSP00000360020:G166C;ENSP00000378627:G166C	ENSP00000360020:G166C	G	-	1	0	DIRAS3	68285073	1.000000	0.71417	0.005000	0.12908	0.015000	0.08874	3.433000	0.52834	1.073000	0.40885	0.650000	0.86243	GGT	DIRAS3	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000162595		0.512	DIRAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIRAS3	HGNC	protein_coding	OTTHUMT00000026354.2		0.00	60	0	C	NM_004675		68512485	-1			no_errors	ENST00000370981	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	A
DNM1P47	100216544	genome.wustl.edu	37	15	102294919	102294919	+	RNA	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:102294919G>T	ENST00000561463.1	+	0	2965									DNM1 pseudogene 47																		GACTCGCATGGGAAGAAGAAG	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294919G>T				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	35	0	G	NG_009149		102294919	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.254	T
DNM1P47	100216544	genome.wustl.edu	37	15	102296231	102296231	+	RNA	SNP	C	C	T	rs373597641		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:102296231C>T	ENST00000561463.1	+	0	4277									DNM1 pseudogene 47																		GTCCAACCTGCACTCGCGTGG	0.607																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102296231C>T				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.607	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	15	0	C	NG_009149		102296231	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	31.25	11	5	SNP	1.000	T
DOCK4	9732	genome.wustl.edu	37	7	111428768	111428768	+	Silent	SNP	C	C	T	rs548719991	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:111428768C>T	ENST00000437633.1	-	32	3607	c.3351G>A	c.(3349-3351)ctG>ctA	p.L1117L	DOCK4_ENST00000428084.1_Silent_p.L1117L	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1117					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CTTCTGACATCAGGCTATCCA	0.418													C|||	3	0.000599042	0.0023	0.0	5008	,	,		21462	0.0		0.0	False		,,,				2504	0.0																0													121.0	118.0	119.0					7																	111428768		1919	4114	6033	SO:0001819	synonymous_variant	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.3351G>A	7.37:g.111428768C>T			O14584|O94824|Q8NB45	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH3_domain,pfscan_SH3_domain	p.L1117	ENST00000437633.1	37	c.3351	CCDS47688.1	7																																																																																			DOCK4	-	NULL	ENSG00000128512		0.418	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	-	0.00	67	0	C	NM_014705		111428768	-1	tier1	-	no_errors	ENST00000428084	ensembl	human	known	74_37	silent	51.79	27	29	SNP	1.000	T
DUSP10	11221	genome.wustl.edu	37	1	221875156	221875157	+	3'UTR	INS	-	-	A	rs571834010		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:221875156_221875157insA	ENST00000366899.3	-	0	2284_2285				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000323825.3_3'UTR|DUSP10_ENST00000544095.1_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCCAGAGAAGGAAAAAAAAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*598->T	1.37:g.221875167_221875167dupA			D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-	ENSG00000143507		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1		0.00	20	0	-	NM_007207		221875157	-1	tier1		no_errors	ENST00000468085	ensembl	human	known	74_37	rna	11.36	39	5	INS	0.002:0.000	A
DVL3	1857	genome.wustl.edu	37	3	183888379	183888379	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:183888379G>A	ENST00000313143.3	+	15	2235	c.1987G>A	c.(1987-1989)Ggc>Agc	p.G663S	DVL3_ENST00000431765.1_Missense_Mutation_p.G646S|EIF2B5_ENST00000444495.1_Intron	NM_004423.3	NP_004414.3	Q92997	DVL3_HUMAN	dishevelled segment polarity protein 3	663					canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|intracellular signal transduction (GO:0035556)|non-canonical Wnt signaling pathway (GO:0035567)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|outflow tract septum morphogenesis (GO:0003148)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cell cortex (GO:0005938)	beta-catenin binding (GO:0008013)|frizzled binding (GO:0005109)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(6)|liver(1)|lung(13)|ovary(1)|prostate(1)	35	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			CCCTCTCTACGGCCCCCCCAT	0.736																																																	0													25.0	32.0	30.0					3																	183888379		2198	4294	6492	SO:0001583	missense	0			D86963	CCDS3253.1	3q27	2013-05-22	2013-05-22		ENSG00000161202	ENSG00000161202		"""Dishevelled homologs"""	3087	protein-coding gene	gene with protein product		601368	"""dishevelled 3 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 3 (Drosophila)"""			8817329	Standard	NM_004423		Approved	KIAA0208	uc003fms.3	Q92997	OTTHUMG00000156841	ENST00000313143.3:c.1987G>A	3.37:g.183888379G>A	ENSP00000316054:p.Gly663Ser		B4E3E5|D3DNT0|O14642|Q13531|Q8N5E9|Q92607	Missense_Mutation	SNP	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_fam,prints_Dishevelled_3	p.G663S	ENST00000313143.3	37	c.1987	CCDS3253.1	3	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864261	0.32977	.	.	ENSG00000161202	ENST00000313143;ENST00000415612;ENST00000431765	T;T	0.03580	3.89;3.88	3.91	3.03	0.35002	Dishevelled C-terminal (1);	0.095467	0.45867	D	0.000335	T	0.01940	0.0061	N	0.11927	0.2	0.43203	D	0.995052	B;B;B;B	0.23185	0.081;0.012;0.023;0.081	B;B;B;B	0.22152	0.038;0.038;0.004;0.038	T	0.45041	-0.9288	10	0.07030	T	0.85	-2.165	7.5701	0.27902	0.269:0.0:0.731:0.0	.	646;495;663;663	B4E3E5;Q9UG07;F5GWR8;Q92997	.;.;.;DVL3_HUMAN	S	663;663;646	ENSP00000316054:G663S;ENSP00000405885:G646S	ENSP00000316054:G663S	G	+	1	0	DVL3	185371073	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	3.651000	0.54431	0.755000	0.32990	0.561000	0.74099	GGC	DVL3	-	pfam_Dishevelled_C-dom	ENSG00000161202		0.736	DVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DVL3	HGNC	protein_coding	OTTHUMT00000346184.1	-	0.00	45	0	G	NM_004423		183888379	+1	tier1	-	no_errors	ENST00000313143	ensembl	human	known	74_37	missense	18.42	30	7	SNP	1.000	A
EBF2	64641	genome.wustl.edu	37	8	25715990	25715990	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:25715990G>T	ENST00000520164.1	-	14	1910	c.1373C>A	c.(1372-1374)cCg>cAg	p.P458Q	EBF2_ENST00000535548.1_Missense_Mutation_p.P189Q|EBF2_ENST00000408929.3_Missense_Mutation_p.P310Q	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	458	Pro/Ser/Thr-rich.				adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P458L(2)		endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GTATCCCCGCGGAGAGATGCT	0.522																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)												2	Substitution - Missense(2)	endometrium(2)											142.0	142.0	142.0					8																	25715990		2043	4197	6240	SO:0001583	missense	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1373C>A	8.37:g.25715990G>T	ENSP00000430241:p.Pro458Gln		A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.P458Q	ENST00000520164.1	37	c.1373	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807998	0.90707	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.48201	0.82;0.82;0.82	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.72028	0.3410	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.76661	-0.2877	10	0.87932	D	0	.	18.0598	0.89373	0.0:0.0:1.0:0.0	.	458	Q9HAK2	COE2_HUMAN	Q	458;310;189	ENSP00000430241:P458Q;ENSP00000386178:P310Q;ENSP00000437909:P189Q	ENSP00000386178:P310Q	P	-	2	0	EBF2	25771907	1.000000	0.71417	0.950000	0.38849	0.969000	0.65631	9.869000	0.99810	2.506000	0.84524	0.655000	0.94253	CCG	EBF2	-	NULL	ENSG00000221818		0.522	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2		0.00	81	0	G	NM_022659		25715990	-1			no_errors	ENST00000520164	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
EDC4	23644	genome.wustl.edu	37	16	67910814	67910814	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:67910814G>T	ENST00000358933.5	+	4	629	c.390G>T	c.(388-390)caG>caT	p.Q130H	AC040162.1_ENST00000408599.1_RNA|EDC4_ENST00000574770.1_3'UTR	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4	130					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Q130H(1)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		ACTGGGAACAGAAGTACTACT	0.507																																																	1	Substitution - Missense(1)	cervix(1)											160.0	155.0	157.0					16																	67910814		2198	4300	6498	SO:0001583	missense	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.390G>T	16.37:g.67910814G>T	ENSP00000351811:p.Gln130His		A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q130H	ENST00000358933.5	37	c.390	CCDS10849.1	16	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774694	0.31411	.	.	ENSG00000038358	ENST00000358933;ENST00000536072	T	0.42900	0.96	5.83	5.83	0.93111	WD40 repeat-like-containing domain (1);	0.058263	0.64402	D	0.000001	T	0.27419	0.0673	N	0.11023	0.085	0.50313	D	0.999862	B;B	0.10296	0.003;0.003	B;B	0.10450	0.003;0.005	T	0.11991	-1.0565	10	0.12766	T	0.61	-18.4954	19.7135	0.96105	0.0:0.0:1.0:0.0	.	62;130	B7Z7V8;Q6P2E9	.;EDC4_HUMAN	H	130;62	ENSP00000351811:Q130H	ENSP00000351811:Q130H	Q	+	3	2	EDC4	66468315	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.028000	0.49705	2.769000	0.95229	0.655000	0.94253	CAG	EDC4	-	superfamily_WD40_repeat_dom	ENSG00000038358		0.507	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC4	HGNC	protein_coding	OTTHUMT00000268874.2		0.00	39	0	G	NM_014329		67910814	+1			no_errors	ENST00000358933	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
EDEM1	9695	genome.wustl.edu	37	3	5244835	5244835	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:5244835G>T	ENST00000256497.4	+	5	1175		c.e5+1		EDEM1_ENST00000445686.1_Splice_Site	NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GGATTACTAGGTGTGGCACCT	0.522																																																	0													95.0	98.0	97.0					3																	5244835		2203	4300	6503	SO:0001630	splice_region_variant	0			D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1042+1G>T	3.37:g.5244835G>T			A8K9C8|B4DXP3	Splice_Site	SNP	-	e5+1	ENST00000256497.4	37	c.1042+1	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265591	0.59431	.	.	ENSG00000134109	ENST00000419550;ENST00000256497;ENST00000445686	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9535	0.92649	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EDEM1	5219835	1.000000	0.71417	0.969000	0.41365	0.423000	0.31445	9.205000	0.95048	2.532000	0.85374	0.650000	0.86243	.	EDEM1	-	-	ENSG00000134109		0.522	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	-	0.00	68	0	G	NM_014674	Intron	5244835	+1	tier1	-	no_errors	ENST00000256497	ensembl	human	known	74_37	splice_site	9.52	38	4	SNP	1.000	T
EGLN3	112399	genome.wustl.edu	37	14	34400348	34400348	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:34400348C>T	ENST00000250457.3	-	2	759	c.431G>A	c.(430-432)cGc>cAc	p.R144H	EGLN3_ENST00000553215.1_Missense_Mutation_p.R50H	NM_022073.3	NP_071356.1	Q9H6Z9	EGLN3_HUMAN	egl-9 family hypoxia-inducible factor 3	144	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|protein hydroxylation (GO:0018126)|regulation of cell proliferation (GO:0042127)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 4-dioxygenase activity (GO:0031545)	p.R144H(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|upper_aerodigestive_tract(1)	15	Breast(36;0.0303)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.000246)|Lung(238;0.000959)|Epithelial(34;0.155)	GBM - Glioblastoma multiforme(112;0.0118)	Vitamin C(DB00126)	GGTGATGCAGCGACCATCACC	0.468																																					Esophageal Squamous(161;245 1904 13895 22565 30076)												1	Substitution - Missense(1)	lung(1)											147.0	133.0	138.0					14																	34400348		2203	4300	6503	SO:0001583	missense	0			AJ310545	CCDS9646.1	14q12	2013-08-21	2013-08-21		ENSG00000129521	ENSG00000129521			14661	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 3"""	606426	"""EGL nine (C.elegans) homolog 3"", ""egl nine homolog 3 (C. elegans)"""				Standard	NM_022073		Approved	PHD3, HIFPH3	uc001wsa.4	Q9H6Z9	OTTHUMG00000029498	ENST00000250457.3:c.431G>A	14.37:g.34400348C>T	ENSP00000250457:p.Arg144His		Q2TA79|Q3B8N4|Q6P1R2	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.R144H	ENST00000250457.3	37	c.431	CCDS9646.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.686560	0.96784	.	.	ENSG00000129521	ENST00000250457;ENST00000539567;ENST00000553215;ENST00000487915	T;T;T	0.64618	-0.11;-0.11;-0.11	5.71	5.71	0.89125	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	D	0.89354	0.6691	H	0.99475	4.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93631	0.6956	10	0.87932	D	0	-9.6189	19.8677	0.96824	0.0:1.0:0.0:0.0	.	144;50	Q9H6Z9;F8W1G2	EGLN3_HUMAN;.	H	144;144;50;26	ENSP00000250457:R144H;ENSP00000447470:R50H;ENSP00000451316:R26H	ENSP00000250457:R144H	R	-	2	0	EGLN3	33470099	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.794000	0.85869	2.709000	0.92574	0.655000	0.94253	CGC	EGLN3	-	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	ENSG00000129521		0.468	EGLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EGLN3	HGNC	protein_coding	OTTHUMT00000276647.1		0.00	44	0	C			34400348	-1			no_errors	ENST00000250457	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	T
EHMT1	79813	genome.wustl.edu	37	9	140710434	140710434	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:140710434G>T	ENST00000460843.1	+	23	3321	c.3294G>T	c.(3292-3294)gaG>gaT	p.E1098D		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1098	Pre-SET. {ECO:0000255|PROSITE- ProRule:PRU00157}.				chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ACATGGCGGAGCCTCCCTTGA	0.557																																																	0													53.0	46.0	49.0					9																	140710434		2203	4300	6503	SO:0001583	missense	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3294G>T	9.37:g.140710434G>T	ENSP00000417980:p.Glu1098Asp		B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.E1098D	ENST00000460843.1	37	c.3294	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743292	0.69418	.	.	ENSG00000181090	ENST00000371400;ENST00000460843	T	0.76578	-1.03	5.3	3.07	0.35406	Pre-SET zinc-binding sub-group (1);Pre-SET domain (2);	0.044560	0.85682	D	0.000000	T	0.62938	0.2469	N	0.20328	0.56	0.80722	D	1	B	0.15930	0.015	B	0.25506	0.061	T	0.55114	-0.8191	10	0.20519	T	0.43	.	12.0331	0.53410	0.1696:0.0:0.8304:0.0	.	1098	Q9H9B1	EHMT1_HUMAN	D	1067;1098	ENSP00000417980:E1098D	ENSP00000360453:E1067D	E	+	3	2	EHMT1	139830255	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	3.763000	0.55257	1.188000	0.43014	0.591000	0.81541	GAG	EHMT1	-	pfam_Pre-SET_dom,smart_Pre-SET_Zn-bd_sub,pfscan_Pre-SET_dom	ENSG00000181090		0.557	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	-	0.00	66	0	G	NM_024757		140710434	+1	tier1	-	no_errors	ENST00000460843	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
EIF3B	8662	genome.wustl.edu	37	7	2412354	2412354	+	Silent	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:2412354T>C	ENST00000360876.4	+	12	1790	c.1734T>C	c.(1732-1734)gcT>gcC	p.A578A	EIF3B_ENST00000397011.2_Silent_p.A578A	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		GTAAGTTTGCTGTGCTGCACG	0.458																																																	0													130.0	113.0	118.0					7																	2412354		2203	4300	6503	SO:0001819	synonymous_variant	0			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1734T>C	7.37:g.2412354T>C				Silent	SNP	pfam_TIF_beta_prop-like,pfam_RRM_dom,smart_RRM_dom,pirsf_EIF3B,pfscan_RRM_dom	p.A578	ENST00000360876.4	37	c.1734	CCDS5332.1	7																																																																																			EIF3B	-	pfam_TIF_beta_prop-like,pirsf_EIF3B	ENSG00000106263		0.458	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	EIF3B	HGNC	protein_coding	OTTHUMT00000207006.1	-	0.00	146	0	T			2412354	+1	tier1	-	no_errors	ENST00000360876	ensembl	human	known	74_37	silent	21.19	92	25	SNP	0.023	C
DPP9	91039	genome.wustl.edu	37	19	4682879	4682880	+	Intron	DEL	AG	AG	-	rs148398571		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:4682879_4682880delAG	ENST00000598800.1	-	21	2750				DPP9_ENST00000262960.9_Intron|DPP9_ENST00000594671.1_Intron|AC005594.3_ENST00000381796.1_RNA|DPP9_ENST00000601173.1_5'Flank			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		AGATGGGGGCAGAGAGAGAGAG	0.663																																																	0																																										SO:0001627	intron_variant	0			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.2245-29CT>-	19.37:g.4682889_4682890delAG			O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	RNA	DEL	-	NULL	ENST00000598800.1	37	NULL		19																																																																																			AC005594.3	-	-	ENSG00000205790		0.663	DPP9-026	NOVEL	basic	protein_coding	ENSG00000205790	Clone_based_vega_gene	protein_coding	OTTHUMT00000459343.2		0.00	33	0	AG			4682880	+1	tier1		no_errors	ENST00000381796	ensembl	human	known	74_37	rna	8.57	32	3	DEL	0.000:0.006	-
C2orf48	348738	genome.wustl.edu	37	2	10295249	10295249	+	Intron	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:10295249G>A	ENST00000381786.3	+	3	482				SNORA2_ENST00000383920.1_RNA	NM_182626.2	NP_872432.1	Q96LS8	CB048_HUMAN	chromosome 2 open reading frame 48											endometrium(1)|lung(7)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		ACTGAGCAGTGAACAGACCAC	0.408																																																	0																																										SO:0001627	intron_variant	0			AK057831	CCDS1670.1	2p25.1	2006-09-01			ENSG00000163009	ENSG00000163009			26322	protein-coding gene	gene with protein product						12477932	Standard	NM_182626		Approved	FLJ25102	uc021vds.1	Q96LS8	OTTHUMG00000119017	ENST00000381786.3:c.193+12747G>A	2.37:g.10295249G>A				RNA	SNP	-	NULL	ENST00000381786.3	37	NULL	CCDS1670.1	2																																																																																			SNORA2	-	-	ENSG00000206647		0.408	C2orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206647	RFAM	protein_coding	OTTHUMT00000239217.1	-	0.00	24	0	G	NM_182626		10295249	-1	tier1	-	no_errors	ENST00000383920	ensembl	human	novel	74_37	rna	33.33	8	4	SNP	0.016	A
AL445258.1	0	genome.wustl.edu	37	X	145072391	145072391	+	RNA	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:145072391C>A	ENST00000401213.1	-	0	64				hsa-mir-892c_ENST00000516410.1_RNA																							TGTACTTACTCTACCCAGAAA	0.478																																																	0																																												0																															X.37:g.145072391C>A				RNA	SNP	-	NULL	ENST00000401213.1	37	NULL		X																																																																																			AL445258.1	-	-	ENSG00000216032		0.478	AL445258.1-201	NOVEL	basic	miRNA	ENSG00000216032	Clone_based_ensembl_gene	miRNA		-	0.00	34	0	C			145072391	-1	tier1	-	no_errors	ENST00000401213	ensembl	human	novel	74_37	rna	15.38	22	4	SNP	0.000	A
RAPGEF2	9693	genome.wustl.edu	37	4	160216910	160216910	+	Intron	SNP	C	C	T	rs66478721|rs113715111|rs374442933|rs60091174		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:160216910C>T	ENST00000264431.4	+	2	479				RAPGEF2_ENST00000504604.1_Intron|AC105316.1_ENST00000401270.1_RNA	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		tgtgtgtgcgcgcgcgcgcgc	0.428																																																	0																																										SO:0001627	intron_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8584C>T	4.37:g.160216910C>T			D3DP27	RNA	SNP	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			AC105316.1	-	-	ENSG00000216089		0.428	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000364980.2	-	0.00	41	0	C	NM_014247		160216910	+1	tier1	-	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	12.12	29	4	SNP	0.000	T
ASRGL1	80150	genome.wustl.edu	37	11	62105447	62105447	+	5'UTR	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:62105447G>T	ENST00000415229.2	+	0	213				ASRGL1_ENST00000301776.5_5'UTR|RP11-703H8.7_ENST00000400902.4_RNA|ASRGL1_ENST00000535727.1_5'UTR	NM_001083926.1	NP_001077395.1	Q7L266	ASGL1_HUMAN	asparaginase like 1						asparagine catabolic process via L-aspartate (GO:0033345)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	asparaginase activity (GO:0004067)|beta-aspartyl-peptidase activity (GO:0008798)			endometrium(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	7					L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)	AGGATCCGCCGACATGAATCC	0.647																																																	0													17.0	13.0	15.0					11																	62105447		2200	4296	6496	SO:0001623	5_prime_UTR_variant	0				CCDS8019.1	11q12.3	2008-07-18			ENSG00000162174	ENSG00000162174			16448	protein-coding gene	gene with protein product	"""asparaginase-like 1 protein"""	609212					Standard	NM_025080		Approved	FLJ22316, ALP1, ALP	uc001ntf.4	Q7L266	OTTHUMG00000167513	ENST00000415229.2:c.-3G>T	11.37:g.62105447G>T			B2R7Q0|Q567Q4|Q6P1P0|Q8NI34|Q9H6F7	RNA	SNP	-	NULL	ENST00000415229.2	37	NULL	CCDS8019.1	11																																																																																			RP11-703H8.7	-	-	ENSG00000255118		0.647	ASRGL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000255118	Clone_based_vega_gene	protein_coding	OTTHUMT00000394865.1	-	0.00	74	0	G	NM_001083926		62105447	-1	tier1	-	no_errors	ENST00000400902	ensembl	human	known	74_37	rna	7.14	52	4	SNP	0.000	T
RP11-313I2.11	0	genome.wustl.edu	37	11	89487185	89487185	+	lincRNA	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:89487185C>A	ENST00000527332.1	-	0	450																											GACACCAGAGCAAGAACACAG	0.383																																																	0													3.0	4.0	3.0					11																	89487185		623	1835	2458			0																															11.37:g.89487185C>A				RNA	SNP	-	NULL	ENST00000527332.1	37	NULL		11																																																																																			RP11-313I2.11	-	-	ENSG00000254971		0.383	RP11-313I2.11-001	KNOWN	basic	lincRNA	ENSG00000254971	Clone_based_vega_gene	lincRNA	OTTHUMT00000395428.1	-	0.00	128	0	C			89487185	-1	tier1	-	no_errors	ENST00000527332	ensembl	human	known	74_37	rna	13.07	133	20	SNP	0.000	A
PLEKHM2	23207	genome.wustl.edu	37	1	16011005	16011006	+	5'UTR	INS	-	-	GGC	rs373057584		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:16011005_16011006insGGC	ENST00000375799.3	+	0	179_180				PLEKHM2_ENST00000375793.2_5'UTR|RP4-680D5.9_ENST00000606262.1_lincRNA|AL121992.1_ENST00000584345.1_RNA	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2						Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		Agcggcggcggggcggcggcgg	0.822																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.-48->GGC	1.37:g.16011012_16011014dupGGC			O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	RNA	INS	-	NULL	ENST00000375799.3	37	NULL	CCDS44063.1	1																																																																																			AL121992.1	-	-	ENSG00000264048		0.822	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000264048	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000008463.1		0.00	8	0	-	NM_015164		16011006	+1	tier1		no_errors	ENST00000584345	ensembl	human	novel	74_37	rna	40.00	6	4	INS	1.000:0.998	GGC
EPG5	57724	genome.wustl.edu	37	18	43495476	43495476	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:43495476C>A	ENST00000282041.5	-	20	3727	c.3693G>T	c.(3691-3693)caG>caT	p.Q1231H	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1231					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						AGTTTCCTACCTGAGTGGGCG	0.423																																																	0													84.0	87.0	86.0					18																	43495476		2076	4212	6288	SO:0001630	splice_region_variant	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3693+1G>T	18.37:g.43495476C>A			A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.Q1231H	ENST00000282041.5	37	c.3693	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	C	12.47	1.949098	0.34377	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.10668	2.85	5.51	5.51	0.81932	.	0.563205	0.16343	N	0.218587	T	0.30070	0.0753	L	0.53249	1.67	0.53688	D	0.999973	D;D	0.76494	0.999;0.999	D;D	0.67548	0.952;0.952	T	0.00289	-1.1844	9	.	.	.	-14.1202	19.4214	0.94723	0.0:1.0:0.0:0.0	.	1231;1231	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	H	1231;106	ENSP00000282041:Q1231H	.	Q	-	3	2	EPG5	41749474	1.000000	0.71417	1.000000	0.80357	0.235000	0.25334	6.470000	0.73558	2.598000	0.87819	0.650000	0.86243	CAG	EPG5	-	NULL	ENSG00000152223		0.423	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	-	0.00	52	0	C	NM_020964	Missense_Mutation	43495476	-1	tier1	-	no_errors	ENST00000282041	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
ERRFI1	54206	genome.wustl.edu	37	1	8074194	8074194	+	Silent	SNP	C	C	T	rs141231690		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:8074194C>T	ENST00000377482.5	-	4	688	c.465G>A	c.(463-465)ccG>ccA	p.P155P	ERRFI1_ENST00000467067.1_3'UTR|ERRFI1_ENST00000474874.1_Intron|ERRFI1_ENST00000469499.1_3'UTR	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	155					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		AGATTGGCAACGGTGGAAGAG	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18140	0.0		0.0	False		,,,				2504	0.0																0								C		3,4403	6.2+/-15.9	0,3,2200	85.0	92.0	89.0		465	-10.9	0.0	1	dbSNP_134	89	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ERRFI1	NM_018948.3		0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308		155/463	8074194	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	0			BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.465G>A	1.37:g.8074194C>T			B2RDX9|Q9NTG9|Q9UD05	Silent	SNP	pfam_Cdc42_binding_dom_like,pfam_Inhibitor_Mig-6	p.P155	ENST00000377482.5	37	c.465	CCDS94.1	1																																																																																			ERRFI1	-	NULL	ENSG00000116285		0.502	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERRFI1	HGNC	protein_coding	OTTHUMT00000003617.1	-	0.00	39	0	C	NM_018948		8074194	-1	tier1	rs141231690	no_errors	ENST00000377482	ensembl	human	known	74_37	silent	14.29	24	4	SNP	0.005	T
EXOC6	54536	genome.wustl.edu	37	10	94773986	94773986	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:94773986G>T	ENST00000260762.6	+	20	2145	c.2131G>T	c.(2131-2133)Ggg>Tgg	p.G711W	EXOC6_ENST00000443748.2_Missense_Mutation_p.G608W|EXOC6_ENST00000371552.4_Missense_Mutation_p.G706W|EXOC6_ENST00000371547.4_Missense_Mutation_p.G727W	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	711					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				AGGATTCCAGGGGGATACCCT	0.388																																																	0													93.0	95.0	94.0					10																	94773986		2203	4300	6503	SO:0001583	missense	0			BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.2131G>T	10.37:g.94773986G>T	ENSP00000260762:p.Gly711Trp		E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	pfam_Sec15,pirsf_Sec15	p.G727W	ENST00000260762.6	37	c.2179	CCDS7424.2	10	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796950	0.90453	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762;ENST00000458552	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.62	5.62	0.85841	.	0.116074	0.64402	D	0.000016	T	0.50565	0.1623	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D;D	0.76494	0.983;0.999;0.985;0.974;0.992;0.992	P;D;D;D;D;D	0.74023	0.825;0.982;0.949;0.966;0.949;0.949	T	0.48328	-0.9045	10	0.72032	D	0.01	-10.0413	19.653	0.95825	0.0:0.0:1.0:0.0	.	727;608;703;664;711;706	F2Z2Q3;E7EW84;B4DEZ1;B2RDH5;Q8TAG9;E9PHI3	.;.;.;.;EXOC6_HUMAN;.	W	727;706;608;711;60	ENSP00000360602:G727W;ENSP00000360607:G706W;ENSP00000396206:G608W;ENSP00000260762:G711W;ENSP00000398982:G60W	ENSP00000260762:G711W	G	+	1	0	EXOC6	94763966	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.114000	0.94329	2.648000	0.89879	0.557000	0.71058	GGG	EXOC6	-	pfam_Sec15,pirsf_Sec15	ENSG00000138190		0.388	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC6	HGNC	protein_coding	OTTHUMT00000049410.2		0.00	65	0	G	NM_019053		94773986	+1			no_errors	ENST00000371547	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
F2R	2149	genome.wustl.edu	37	5	76029016	76029016	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:76029016C>A	ENST00000319211.4	+	2	1231	c.966C>A	c.(964-966)ttC>ttA	p.F322L		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	322					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCTGCATCTTCATCATTTGCT	0.498																																																	0													157.0	127.0	137.0					5																	76029016		2203	4300	6503	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.966C>A	5.37:g.76029016C>A	ENSP00000321326:p.Phe322Leu		Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thrmbn_rcpt,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.F322L	ENST00000319211.4	37	c.966	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721942	0.68959	.	.	ENSG00000181104	ENST00000319211	T	0.56611	0.45	4.7	1.83	0.25207	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70649	0.3248	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.69709	-0.5072	10	0.72032	D	0.01	-47.9381	5.635	0.17532	0.0:0.4454:0.0:0.5546	.	322	P25116	PAR1_HUMAN	L	322	ENSP00000321326:F322L	ENSP00000321326:F322L	F	+	3	2	F2R	76064772	0.978000	0.34361	0.632000	0.29296	0.879000	0.50718	0.656000	0.24948	0.645000	0.30675	0.561000	0.74099	TTC	F2R	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	ENSG00000181104		0.498	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	-	0.00	51	0	C			76029016	+1	tier1	-	no_errors	ENST00000319211	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.983	A
FAM129B	64855	genome.wustl.edu	37	9	130289517	130289517	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:130289517G>A	ENST00000373312.3	-	3	484	c.271C>T	c.(271-273)Ctc>Ttc	p.L91F	FAM129B_ENST00000373314.3_Missense_Mutation_p.L78F|FAM129B_ENST00000468379.1_5'UTR	NM_022833.2	NP_073744.2	Q96TA1	NIBL1_HUMAN	family with sequence similarity 129, member B	91	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of apoptotic process (GO:0043066)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						TGGGGCACGAGGCTGAAGCGG	0.637																																																	0													82.0	75.0	77.0					9																	130289517		2203	4300	6503	SO:0001583	missense	0			AF151783	CCDS35144.1, CCDS35145.1	9q34.13	2010-02-01	2006-11-23	2006-11-23	ENSG00000136830	ENSG00000136830			25282	protein-coding gene	gene with protein product		614045	"""chromosome 9 open reading frame 88"""	C9orf88		14702039, 19362540	Standard	XM_005252135		Approved	DKFZP434H0820, FLJ13518, FLJ22151, FLJ22298, bA356B19.6, MINERVA	uc004brh.3	Q96TA1	OTTHUMG00000020705	ENST00000373312.3:c.271C>T	9.37:g.130289517G>A	ENSP00000362409:p.Leu91Phe		Q4LE55|Q5VVW6|Q5VVW7|Q9BUS2|Q9NT35	Missense_Mutation	SNP	pfscan_Pleckstrin_homology	p.L91F	ENST00000373312.3	37	c.271	CCDS35145.1	9	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569113	0.45798	.	.	ENSG00000136830	ENST00000373314;ENST00000373312	T;T	0.17054	2.3;2.3	5.53	3.58	0.41010	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.204024	0.43110	D	0.000617	T	0.12178	0.0296	L	0.31664	0.95	0.40320	D	0.978817	B;B	0.15930	0.015;0.015	B;B	0.18561	0.022;0.022	T	0.07986	-1.0744	10	0.41790	T	0.15	-32.4446	8.6782	0.34191	0.0847:0.1535:0.7618:0.0	.	78;91	Q96TA1-2;Q96TA1	.;NIBL1_HUMAN	F	78;91	ENSP00000362411:L78F;ENSP00000362409:L91F	ENSP00000362409:L91F	L	-	1	0	FAM129B	129329338	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	3.623000	0.54224	1.334000	0.45468	0.561000	0.74099	CTC	FAM129B	-	pfscan_Pleckstrin_homology	ENSG00000136830		0.637	FAM129B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129B	HGNC	protein_coding	OTTHUMT00000054196.1	-	0.00	88	0	G	NM_022833		130289517	-1	tier1	-	no_errors	ENST00000373312	ensembl	human	known	74_37	missense	27.20	91	34	SNP	0.984	A
FAM135A	57579	genome.wustl.edu	37	6	71235512	71235512	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:71235512G>T	ENST00000418814.2	+	15	3339	c.2725G>T	c.(2725-2727)Gca>Tca	p.A909S	FAM135A_ENST00000505868.1_Missense_Mutation_p.A909S|FAM135A_ENST00000505769.1_Intron|FAM135A_ENST00000361499.3_Missense_Mutation_p.A713S|FAM135A_ENST00000457062.2_Missense_Mutation_p.A696S|FAM135A_ENST00000370479.3_Missense_Mutation_p.A696S	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	909										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						TGAAACTGTAGCAATACATTC	0.358																																																	0													66.0	69.0	68.0					6																	71235512		2203	4297	6500	SO:0001583	missense	0			AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.2725G>T	6.37:g.71235512G>T	ENSP00000410768:p.Ala909Ser		A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like,pfam_LACT/PDAT_acylTrfase	p.A909S	ENST00000418814.2	37	c.2725	CCDS55028.1	6	.	.	.	.	.	.	.	.	.	.	G	5.036	0.192336	0.09599	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000457062;ENST00000361499;ENST00000505868	T;T;T;T;T	0.17528	2.28;2.28;2.28;2.28;2.27	5.96	1.97	0.26223	.	0.326963	0.29459	N	0.012088	T	0.02807	0.0084	L	0.33485	1.01	0.25364	N	0.988759	B;B;B;B	0.19200	0.015;0.007;0.034;0.032	B;B;B;B	0.17979	0.009;0.009;0.016;0.02	T	0.43718	-0.9374	10	0.11182	T	0.66	.	4.8926	0.13735	0.2379:0.0:0.4976:0.2645	.	909;909;713;696	Q9P2D6-4;Q9P2D6;Q9P2D6-2;Q9P2D6-3	.;F135A_HUMAN;.;.	S	909;696;696;713;909	ENSP00000410768:A909S;ENSP00000359510:A696S;ENSP00000409201:A696S;ENSP00000354913:A713S;ENSP00000423307:A909S	ENSP00000354913:A713S	A	+	1	0	FAM135A	71292233	0.964000	0.33143	1.000000	0.80357	0.988000	0.76386	1.552000	0.36244	0.866000	0.35629	0.655000	0.94253	GCA	FAM135A	-	NULL	ENSG00000082269		0.358	FAM135A-001	KNOWN	basic|CCDS	protein_coding	FAM135A	HGNC	protein_coding	OTTHUMT00000041137.2		0.00	51	0	G	NM_020819		71235512	+1			no_errors	ENST00000418814	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.997	T
FAM86B1	85002	genome.wustl.edu	37	8	12051142	12051142	+	Intron	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:12051142T>C	ENST00000448228.2	-	1	146				FAM85A_ENST00000528514.1_RNA|FAM86B1_ENST00000533513.1_Intron|FAM86B1_ENST00000533852.2_Intron|FAM86B1_ENST00000534520.1_Intron|FAM86B1_ENST00000321602.8_Intron	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1											kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		GGGCGCTGACTTTTTAGAATG	0.567																																																	0																																										SO:0001627	intron_variant	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.96+341A>G	8.37:g.12051142T>C				Missense_Mutation	SNP	NULL	p.S50G	ENST00000448228.2	37	c.148	CCDS59512.1	8																																																																																			FAM86B1	-	NULL	ENSG00000186523		0.567	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	-	0.00	112	0	T	NM_032916		12051142	-1	tier1	-	no_errors	ENST00000526708	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.016	C
FAT2	2196	genome.wustl.edu	37	5	150946027	150946027	+	Silent	SNP	G	G	T	rs141641920		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:150946027G>T	ENST00000261800.5	-	1	2478	c.2466C>A	c.(2464-2466)ccC>ccA	p.P822P		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	822	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P822P(1)		NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTACCCACCGGGAGGAAATC	0.507																																																	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)											108.0	103.0	105.0					5																	150946027		2203	4300	6503	SO:0001819	synonymous_variant	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2466C>A	5.37:g.150946027G>T			O75091|Q9NSR7	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.P822	ENST00000261800.5	37	c.2466	CCDS4317.1	5																																																																																			FAT2	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000086570		0.507	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1		0.00	67	0	G	NM_001447		150946027	-1			no_errors	ENST00000261800	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.962	T
FLVCR2	55640	genome.wustl.edu	37	14	76107334	76107334	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:76107334G>T	ENST00000238667.4	+	7	1628	c.1272G>T	c.(1270-1272)gaG>gaT	p.E424D	FLVCR2_ENST00000539311.1_Missense_Mutation_p.E219D|FLVCR2_ENST00000556856.1_Intron|FLVCR2_ENST00000553587.1_Intron|FLVCR2_ENST00000556241.1_Intron|FLVCR2_ENST00000555027.1_Missense_Mutation_p.E139D	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	424					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		TGGGATTTGAGTTTGCTGTGG	0.502																																																	0													124.0	113.0	117.0					14																	76107334		2203	4300	6503	SO:0001583	missense	0			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.1272G>T	14.37:g.76107334G>T	ENSP00000238667:p.Glu424Asp		B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Trimer_LpxA-like,pfscan_MFS_dom	p.E424D	ENST00000238667.4	37	c.1272	CCDS9844.1	14	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632978	0.87660	.	.	ENSG00000119686	ENST00000238667;ENST00000539311;ENST00000553341;ENST00000554580;ENST00000555027	T;T;T;T;T	0.58652	0.39;0.39;0.32;0.32;0.32	5.26	4.37	0.52481	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.047589	0.85682	D	0.000000	T	0.74152	0.3679	M	0.90198	3.095	0.80722	D	1	P;P	0.45986	0.87;0.783	P;P	0.55508	0.777;0.702	T	0.77335	-0.2626	10	0.59425	D	0.04	-23.3256	9.9069	0.41381	0.1661:0.0:0.8339:0.0	.	219;424	B7Z485;Q9UPI3	.;FLVC2_HUMAN	D	424;219;125;124;139	ENSP00000238667:E424D;ENSP00000443439:E219D;ENSP00000452584:E125D;ENSP00000451781:E124D;ENSP00000452453:E139D	ENSP00000238667:E424D	E	+	3	2	AC007182.1	75177087	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.823000	0.55715	1.221000	0.43506	0.655000	0.94253	GAG	FLVCR2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000119686		0.502	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR2	HGNC	protein_coding	OTTHUMT00000413672.1		0.00	68	0	G	NM_017791		76107334	+1			no_errors	ENST00000238667	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
FNTA	2339	genome.wustl.edu	37	8	42919258	42919258	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:42919258G>A	ENST00000302279.3	+	3	495	c.301G>A	c.(301-303)Gat>Aat	p.D101N	FNTA_ENST00000524546.1_3'UTR|RP11-598P20.5_ENST00000534420.1_Missense_Mutation_p.D58N|FNTA_ENST00000342116.4_Intron|FNTA_ENST00000529687.1_5'UTR	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	101					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			AGATGTTTATGATTACTTCCG	0.368																																																	0													178.0	169.0	172.0					8																	42919258		2203	4300	6503	SO:0001583	missense	0			L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.301G>A	8.37:g.42919258G>A	ENSP00000303423:p.Asp101Asn		A6NJW0|Q53XJ9|Q9UDC1	Missense_Mutation	SNP	pfam_Prenyl_trans_a,pfscan_Prenyl_trans_a	p.D101N	ENST00000302279.3	37	c.301	CCDS6140.1	8	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788165	0.70337	.	.	ENSG00000254673;ENSG00000168522;ENSG00000168522;ENSG00000168522	ENST00000534420;ENST00000302279;ENST00000531266;ENST00000533336	.	.	.	5.05	5.05	0.67936	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.49626	0.1568	L	0.41710	1.295	0.80722	D	1	P;P	0.40534	0.473;0.72	B;B	0.37387	0.093;0.248	T	0.53208	-0.8471	9	0.44086	T	0.13	-27.0863	15.8992	0.79359	0.0:0.0:1.0:0.0	.	10;101	A8MVX8;P49354	.;FNTA_HUMAN	N	58;101;83;39	.	ENSP00000303423:D101N	D	+	1	0	FNTA;RP11-598P20.5	43038415	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.536000	0.98067	2.335000	0.79485	0.555000	0.69702	GAT	FNTA	-	NULL	ENSG00000168522		0.368	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNTA	HGNC	protein_coding	OTTHUMT00000383178.1	-	0.00	103	0	G	NM_002027		42919258	+1	tier1	-	no_errors	ENST00000302279	ensembl	human	known	74_37	missense	27.71	60	23	SNP	1.000	A
FNTA	2339	genome.wustl.edu	37	8	42919288	42919288	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:42919288G>A	ENST00000302279.3	+	3	525	c.331G>A	c.(331-333)Gaa>Aaa	p.E111K	FNTA_ENST00000524546.1_3'UTR|RP11-598P20.5_ENST00000534420.1_Missense_Mutation_p.E68K|FNTA_ENST00000342116.4_Intron|FNTA_ENST00000529687.1_5'UTR	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	111					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GCAGCGTGATGAAAGAAGTGA	0.388																																																	0													198.0	186.0	190.0					8																	42919288		2203	4300	6503	SO:0001583	missense	0			L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.331G>A	8.37:g.42919288G>A	ENSP00000303423:p.Glu111Lys		A6NJW0|Q53XJ9|Q9UDC1	Missense_Mutation	SNP	pfam_Prenyl_trans_a,pfscan_Prenyl_trans_a	p.E111K	ENST00000302279.3	37	c.331	CCDS6140.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.438057	0.96168	.	.	ENSG00000254673;ENSG00000168522;ENSG00000168522;ENSG00000168522	ENST00000534420;ENST00000302279;ENST00000531266;ENST00000533336	.	.	.	5.05	5.05	0.67936	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.83589	0.5287	M	0.87971	2.92	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.73380	0.98;0.972	D	0.86877	0.2039	9	0.87932	D	0	-22.7993	15.8992	0.79359	0.0:0.0:1.0:0.0	.	20;111	A8MVX8;P49354	.;FNTA_HUMAN	K	68;111;93;49	.	ENSP00000303423:E111K	E	+	1	0	FNTA;RP11-598P20.5	43038445	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.536000	0.98067	2.335000	0.79485	0.555000	0.69702	GAA	FNTA	-	NULL	ENSG00000168522		0.388	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNTA	HGNC	protein_coding	OTTHUMT00000383178.1	-	0.00	104	0	G	NM_002027		42919288	+1	tier1	-	no_errors	ENST00000302279	ensembl	human	known	74_37	missense	29.35	65	27	SNP	1.000	A
FOSL1	8061	genome.wustl.edu	37	11	65660497	65660497	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:65660497G>T	ENST00000312562.2	-	4	862	c.676C>A	c.(676-678)Cta>Ata	p.L226I	FOSL1_ENST00000448083.2_Missense_Mutation_p.L124I|FOSL1_ENST00000532401.1_3'UTR|FOSL1_ENST00000531493.1_Missense_Mutation_p.L190I	NM_005438.3	NP_005429.1	P15407	FOSL1_HUMAN	FOS-like antigen 1	226					cellular defense response (GO:0006968)|cellular response to extracellular stimulus (GO:0031668)|chemotaxis (GO:0006935)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to virus (GO:0009615)|transcription from RNA polymerase II promoter (GO:0006366)|vitellogenesis (GO:0007296)	cytosol (GO:0005829)|neuron projection (GO:0043005)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	10				READ - Rectum adenocarcinoma(159;0.168)		AAAGGAGTTAGGGAGGGTGTG	0.612																																																	0													48.0	47.0	48.0					11																	65660497		2201	4296	6497	SO:0001583	missense	0			BC016648	CCDS8121.1, CCDS73324.1	11q13	2013-01-10			ENSG00000175592	ENSG00000175592		"""basic leucine zipper proteins"""	13718	protein-coding gene	gene with protein product		136515				2107490	Standard	XM_005274311		Approved	fra-1	uc001ogg.1	P15407	OTTHUMG00000166715	ENST00000312562.2:c.676C>A	11.37:g.65660497G>T	ENSP00000310170:p.Leu226Ile		B4DR11|Q6FG51	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.L226I	ENST00000312562.2	37	c.676	CCDS8121.1	11	.	.	.	.	.	.	.	.	.	.	G	9.961	1.222736	0.22457	.	.	ENSG00000175592	ENST00000448083;ENST00000312562;ENST00000531493;ENST00000534222	T	0.77750	-1.12	4.96	4.96	0.65561	.	0.073862	0.56097	D	0.000033	T	0.55545	0.1927	N	0.08118	0	0.80722	D	1	P;P	0.46142	0.873;0.799	B;B	0.40101	0.319;0.17	T	0.56709	-0.7934	10	0.14252	T	0.57	-14.6529	10.9061	0.47081	0.0:0.0:0.8124:0.1876	.	124;226	B4DR11;P15407	.;FOSL1_HUMAN	I	124;226;190;6	ENSP00000310170:L226I	ENSP00000310170:L226I	L	-	1	2	FOSL1	65417073	0.999000	0.42202	1.000000	0.80357	0.927000	0.56198	2.157000	0.42320	2.282000	0.76494	0.555000	0.69702	CTA	FOSL1	-	NULL	ENSG00000175592		0.612	FOSL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL1	HGNC	protein_coding	OTTHUMT00000391168.2		0.00	49	0	G	NM_005438		65660497	-1			no_errors	ENST00000312562	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
FOXK2	3607	genome.wustl.edu	37	17	80561028	80561031	+	3'UTR	DEL	CAGC	CAGC	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	CAGC	CAGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:80561028_80561031delCAGC	ENST00000335255.5	+	0	3810_3813				RP13-638C3.4_ENST00000576912.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			GATTATCACTCAGCCGTTTAAGAA	0.544																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.*1656CAGC>-	17.37:g.80561028_80561031delCAGC			A6NEP5|Q13622|Q13623|Q13624	RNA	DEL	-	NULL	ENST00000335255.5	37	NULL	CCDS11813.1	17																																																																																			RP13-638C3.4	-	-	ENSG00000261845		0.544	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK2	Clone_based_vega_gene	protein_coding	OTTHUMT00000277099.2		0.00	18	0	CAGC	NM_181430		80561031	-1	tier1		no_errors	ENST00000576912	ensembl	human	known	74_37	rna	14.29	18	3	DEL	1.000:1.000:1.000:0.998	-
FRMD4A	55691	genome.wustl.edu	37	10	13702382	13702382	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:13702382C>T	ENST00000357447.2	-	20	2200	c.1832G>A	c.(1831-1833)tGg>tAg	p.W611*	FRMD4A_ENST00000358621.4_Nonsense_Mutation_p.W596*|FRMD4A_ENST00000378503.1_Nonsense_Mutation_p.W611*	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	611					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)				breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						GGACTCACTCCACATTTTGGG	0.542											OREG0020030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													137.0	121.0	126.0					10																	13702382		2203	4300	6503	SO:0001587	stop_gained	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.1832G>A	10.37:g.13702382C>T	ENSP00000350032:p.Trp611*	689	A7E2Y3|Q5T377	Nonsense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.W611*	ENST00000357447.2	37	c.1832	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.607453	0.97701	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-6.8293	20.2946	0.98546	0.0:1.0:0.0:0.0	.	.	.	.	X	596;611;611	.	ENSP00000350032:W611X	W	-	2	0	FRMD4A	13742388	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	7.770000	0.85390	2.804000	0.96469	0.462000	0.41574	TGG	FRMD4A	-	NULL	ENSG00000151474		0.542	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	-	0.00	106	0	C	NM_018027		13702382	-1	tier1	-	no_errors	ENST00000357447	ensembl	human	known	74_37	nonsense	26.60	69	25	SNP	1.000	T
FRMPD1	22844	genome.wustl.edu	37	9	37745111	37745111	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:37745111G>T	ENST00000539465.1	+	16	3675	c.3082G>T	c.(3082-3084)Gcc>Tcc	p.A1028S	FRMPD1_ENST00000377765.3_Missense_Mutation_p.A1028S|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1028						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGCCTGCCTGGCCAGCAACCC	0.522																																																	0													82.0	87.0	86.0					9																	37745111		2203	4300	6503	SO:0001583	missense	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3082G>T	9.37:g.37745111G>T	ENSP00000444411:p.Ala1028Ser		B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.A1028S	ENST00000539465.1	37	c.3082	CCDS6612.1	9	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447627	0.26074	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.06768	3.26;3.26	3.47	-6.94	0.01633	.	2.057610	0.02363	N	0.077027	T	0.04092	0.0114	N	0.14661	0.345	0.09310	N	1	B	0.20261	0.043	B	0.17433	0.018	T	0.38112	-0.9676	10	0.08837	T	0.75	0.6661	7.1799	0.25765	0.1485:0.0:0.7198:0.1317	.	1028	Q5SYB0	FRPD1_HUMAN	S	1028	ENSP00000366995:A1028S;ENSP00000444411:A1028S	ENSP00000366995:A1028S	A	+	1	0	FRMPD1	37735111	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.628000	0.05515	-1.197000	0.02673	-0.391000	0.06502	GCC	FRMPD1	-	NULL	ENSG00000070601		0.522	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	-	0.00	62	0	G	NM_014907		37745111	+1	tier1	-	no_errors	ENST00000377765	ensembl	human	known	74_37	missense	67.31	17	35	SNP	0.000	T
DDX42	11325	genome.wustl.edu	37	17	61899463	61899463	+	IGR	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:61899463C>A	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.R452S	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						AGATATCATCCCTTGGCAGAT	0.458																																																	0													121.0	105.0	110.0					17																	61899463		2203	4300	6503	SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61899463C>A			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.R452S	ENST00000578681.1	37	c.1356	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	1.867	-0.461107	0.04508	.	.	ENSG00000108592	ENST00000427159	T	0.28666	1.6	5.07	-0.934	0.10428	.	0.454507	0.21938	N	0.066934	T	0.14743	0.0356	L	0.29908	0.895	0.27339	N	0.956558	B	0.26672	0.156	B	0.16722	0.016	T	0.21759	-1.0236	10	0.17369	T	0.5	-8.4326	4.9555	0.14036	0.1411:0.406:0.0:0.4529	.	452	Q8IY81	RRMJ3_HUMAN	S	452	ENSP00000396673:R452S	ENSP00000396673:R452S	R	-	3	2	FTSJ3	59253195	0.001000	0.12720	0.559000	0.28332	0.249000	0.25844	-1.282000	0.02799	-0.310000	0.08766	-0.355000	0.07637	AGG	FTSJ3	-	NULL	ENSG00000108592		0.458	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1	-	0.00	56	0	C	NM_007372		61899463	-1	tier1	-	no_errors	ENST00000427159	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.416	A
GAL3ST2	64090	genome.wustl.edu	37	2	242743043	242743043	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:242743043G>A	ENST00000192314.6	+	4	790	c.659G>A	c.(658-660)cGc>cAc	p.R220H	AC114730.5_ENST00000437438.1_RNA	NM_022134.2	NP_071417.2	Q9H3Q3	G3ST2_HUMAN	galactose-3-O-sulfotransferase 2	220	Arg-rich.				biosynthetic process (GO:0009058)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylceramide sulfotransferase activity (GO:0001733)|sulfotransferase activity (GO:0008146)			endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|skin(1)	14		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		GTGGAGCGGCGCTTCCGGCTG	0.692																																																	0													20.0	16.0	17.0					2																	242743043		2154	4204	6358	SO:0001583	missense	0			AB040610	CCDS33427.1	2q37.2	2014-05-19			ENSG00000154252	ENSG00000154252		"""Sulfotransferases, membrane-bound"""	24869	protein-coding gene	gene with protein product		608237				11029462	Standard	NM_022134		Approved	GP3ST	uc002wcj.1	Q9H3Q3	OTTHUMG00000151473	ENST00000192314.6:c.659G>A	2.37:g.242743043G>A	ENSP00000192314:p.Arg220His		Q17RK0|Q57Z52	Missense_Mutation	SNP	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	p.R220H	ENST00000192314.6	37	c.659	CCDS33427.1	2	.	.	.	.	.	.	.	.	.	.	G	15.03	2.710769	0.48517	.	.	ENSG00000154252	ENST00000192314	T	0.16897	2.31	4.12	1.21	0.21127	.	0.395299	0.22086	N	0.064827	T	0.15912	0.0383	M	0.74389	2.26	0.26730	N	0.970614	B	0.33841	0.428	B	0.29598	0.104	T	0.14755	-1.0461	10	0.59425	D	0.04	-28.334	4.4939	0.11828	0.4119:0.1673:0.4208:0.0	.	220	Q9H3Q3	G3ST2_HUMAN	H	220	ENSP00000192314:R220H	ENSP00000192314:R220H	R	+	2	0	GAL3ST2	242391716	0.000000	0.05858	0.978000	0.43139	0.812000	0.45895	-0.409000	0.07160	0.322000	0.23283	0.462000	0.41574	CGC	GAL3ST2	-	pfam_Gal-3-0_sulfotransfrase,superfamily_P-loop_NTPase	ENSG00000154252		0.692	GAL3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL3ST2	HGNC	protein_coding	OTTHUMT00000322792.1	-	0.00	41	0	G	NM_022134		242743043	+1	tier1	-	no_errors	ENST00000192314	ensembl	human	known	74_37	missense	30.30	23	10	SNP	0.924	A
GAL3ST4	79690	genome.wustl.edu	37	7	99764827	99764827	+	5'UTR	DEL	G	G	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:99764827delG	ENST00000360039.4	-	0	284				GAL3ST4_ENST00000413800.1_5'UTR|GAL3ST4_ENST00000423751.1_5'UTR|GAL3ST4_ENST00000411994.1_5'UTR|GAL3ST4_ENST00000426974.2_Frame_Shift_Del_p.R4fs|GAL3ST4_ENST00000482469.1_5'UTR|GPC2_ENST00000471050.1_5'Flank	NM_024637.4	NP_078913.3	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4						cell-cell signaling (GO:0007267)|glycoprotein metabolic process (GO:0009100)|oligosaccharide metabolic process (GO:0009311)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|galactose 3-O-sulfotransferase activity (GO:0050694)|galactosylceramide sulfotransferase activity (GO:0001733)|proteoglycan sulfotransferase activity (GO:0050698)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(5)|prostate(1)|upper_aerodigestive_tract(1)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTTGGAGATCGGGGGGTCATT	0.602																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF316113	CCDS5688.1	7q22.1	2007-04-02			ENSG00000197093	ENSG00000197093		"""Sulfotransferases, membrane-bound"""	24145	protein-coding gene	gene with protein product		608235				11333265	Standard	NM_024637		Approved	FLJ12116	uc003utu.3	Q96RP7	OTTHUMG00000154885	ENST00000360039.4:c.-109C>-	7.37:g.99764827delG			A4D2A8|B4DWL8|D6W5U5|Q8N3P7|Q8WZ17|Q96E33|Q9HA78	Frame_Shift_Del	DEL	pfam_Gal-3-0_sulfotransfrase	p.R4fs	ENST00000360039.4	37	c.10	CCDS5688.1	7																																																																																			GAL3ST4	-	NULL	ENSG00000197093		0.602	GAL3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAL3ST4	HGNC	protein_coding	OTTHUMT00000337495.2		0.00	22	0	G	NM_024637		99764827	-1	tier1		no_errors	ENST00000426974	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.993	-
GANAB	23193	genome.wustl.edu	37	11	62406908	62406908	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:62406908G>T	ENST00000356638.3	-	3	191	c.175C>A	c.(175-177)Cca>Aca	p.P59T	GANAB_ENST00000346178.4_Missense_Mutation_p.P59T|GANAB_ENST00000540933.1_Intron|GANAB_ENST00000534779.1_Intron|GANAB_ENST00000534422.1_5'UTR	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	59					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GCTCGGTATGGAGAGAGGCCT	0.542																																					Melanoma(23;1005 1074 15747 18937)												0													98.0	90.0	93.0					11																	62406908		2202	4299	6501	SO:0001583	missense	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.175C>A	11.37:g.62406908G>T	ENSP00000349053:p.Pro59Thr		A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom	p.P59T	ENST00000356638.3	37	c.175	CCDS8026.1	11	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621409	0.28889	.	.	ENSG00000089597	ENST00000346178;ENST00000356638	D;D	0.89196	-2.48;-2.34	4.79	4.79	0.61399	Glycoside hydrolase-type carbohydrate-binding (1);	0.057671	0.64402	D	0.000001	D	0.83732	0.5318	L	0.46819	1.47	0.80722	D	1	B;B	0.22211	0.01;0.066	B;B	0.21151	0.005;0.033	T	0.78718	-0.2095	10	0.30078	T	0.28	-10.0114	10.4705	0.44633	0.0:0.0:0.8062:0.1938	.	59;59	Q14697;Q14697-2	GANAB_HUMAN;.	T	59	ENSP00000340466:P59T;ENSP00000349053:P59T	ENSP00000340466:P59T	P	-	1	0	GANAB	62163484	1.000000	0.71417	0.992000	0.48379	0.950000	0.60333	2.826000	0.48104	2.496000	0.84212	0.556000	0.70494	CCA	GANAB	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000089597		0.542	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1		0.00	67	0	G	NM_198334		62406908	-1			no_errors	ENST00000346178	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
GAPVD1	26130	genome.wustl.edu	37	9	128124957	128124957	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:128124957G>T	ENST00000495955.1	+	28	4659	c.4369G>T	c.(4369-4371)Gag>Tag	p.E1457*	GAPVD1_ENST00000312123.9_Nonsense_Mutation_p.E1418*|GAPVD1_ENST00000394083.2_Nonsense_Mutation_p.E1391*|GAPVD1_ENST00000470056.1_Nonsense_Mutation_p.E1412*|GAPVD1_ENST00000297933.6_Nonsense_Mutation_p.E1439*|GAPVD1_ENST00000394104.2_Nonsense_Mutation_p.E1457*|GAPVD1_ENST00000394105.2_Nonsense_Mutation_p.E1466*|GAPVD1_ENST00000265956.4_Nonsense_Mutation_p.E1431*			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1457	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GTCTGGAGAGGAGTCCTATTG	0.448																																																	0													139.0	129.0	132.0					9																	128124957		2203	4300	6503	SO:0001587	stop_gained	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.4369G>T	9.37:g.128124957G>T	ENSP00000419063:p.Glu1457*		A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Nonsense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.E1466*	ENST00000495955.1	37	c.4396		9	.	.	.	.	.	.	.	.	.	.	G	44	10.676071	0.99448	.	.	ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000297933;ENST00000312123;ENST00000438537	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.68	0.91544	0.0:0.0:1.0:0.0	.	.	.	.	X	1412;1466;1457;1431;1391;1457;1439;1418;150	.	ENSP00000265956:E1431X	E	+	1	0	GAPVD1	127164778	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.571000	0.98176	2.704000	0.92352	0.655000	0.94253	GAG	GAPVD1	-	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9	ENSG00000165219		0.448	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1	-	0.00	33	0	G			128124957	+1	tier1	-	no_errors	ENST00000394105	ensembl	human	known	74_37	nonsense	11.43	31	4	SNP	1.000	T
GBP1	2633	genome.wustl.edu	37	1	89525079	89525079	+	Missense_Mutation	SNP	C	C	T	rs147085563		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:89525079C>T	ENST00000370473.4	-	4	568	c.349G>A	c.(349-351)Gcc>Acc	p.A117T		NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	117	GB1/RHD3-type G.|GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		ACGGCCAGGGCGAAGATCCAG	0.498																																																	0													191.0	168.0	176.0					1																	89525079		2203	4300	6503	SO:0001583	missense	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.349G>A	1.37:g.89525079C>T	ENSP00000359504:p.Ala117Thr		D3DT26|Q5T8M1	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.A117T	ENST00000370473.4	37	c.349	CCDS718.1	1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904007	0.52333	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.80824	-1.42	4.6	4.6	0.57074	Guanylate-binding protein, N-terminal (1);	0.293264	0.30762	N	0.008921	T	0.69851	0.3157	M	0.67953	2.075	0.27177	N	0.960771	P	0.46142	0.873	B	0.43445	0.42	T	0.67094	-0.5757	10	0.54805	T	0.06	.	10.2678	0.43466	0.1978:0.8022:0.0:0.0	.	117	P32455	GBP1_HUMAN	T	117;80	ENSP00000359504:A117T	ENSP00000359504:A117T	A	-	1	0	GBP1	89297667	0.922000	0.31269	0.997000	0.53966	0.703000	0.40648	0.768000	0.26590	2.119000	0.64992	0.306000	0.20318	GCC	GBP1	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase	ENSG00000117228		0.498	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	-	0.00	149	0	C	NM_002053		89525079	-1	tier1	rs147085563	no_errors	ENST00000370473	ensembl	human	known	74_37	missense	63.44	33	59	SNP	1.000	T
GDF5	8200	genome.wustl.edu	37	20	34022109	34022109	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr20:34022109G>T	ENST00000374372.1	-	4	1607	c.1104C>A	c.(1102-1104)acC>acA	p.T368T	GDF5OS_ENST00000374375.1_Silent_p.T51T|GDF5_ENST00000374369.3_Silent_p.T368T			P43026	GDF5_HUMAN	growth differentiation factor 5	368					cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix organization (GO:0030198)|forelimb morphogenesis (GO:0035136)|growth (GO:0040007)|hindlimb morphogenesis (GO:0035137)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuron differentiation (GO:0045666)|regulation of multicellular organism growth (GO:0040014)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(9)|skin(3)	26	Lung NSC(9;0.00642)|all_lung(11;0.0094)		BRCA - Breast invasive adenocarcinoma(18;0.00663)			ACTCATACACGGTCTTATCGT	0.592																																																	0													94.0	95.0	94.0					20																	34022109		2203	4300	6503	SO:0001819	synonymous_variant	0			X80915	CCDS13254.1	20q11.2	2008-05-22	2007-04-12		ENSG00000125965	ENSG00000125965			4220	protein-coding gene	gene with protein product	"""cartilage-derived morphogenetic protein-1"""	601146				9288091, 9288098	Standard	NM_000557		Approved	CDMP1, BMP14	uc002xck.1	P43026	OTTHUMG00000032341	ENST00000374372.1:c.1104C>A	20.37:g.34022109G>T			E1P5Q2|Q96SB1	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.T368	ENST00000374372.1	37	c.1104	CCDS13254.1	20																																																																																			GDF5	-	NULL	ENSG00000125965		0.592	GDF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF5	HGNC	protein_coding	OTTHUMT00000078875.2		0.00	54	0	G			34022109	-1			no_errors	ENST00000374369	ensembl	human	known	74_37	silent	5.26	54	3	SNP	0.129	T
GLB1	2720	genome.wustl.edu	37	3	33118629	33118629	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:33118629G>T	ENST00000445488.2	-	2	236	c.176C>A	c.(175-177)gCa>gAa	p.A59E	GLB1_ENST00000307363.5_Intron|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000399402.3_Intron			P16278	BGAL_HUMAN	galactosidase, beta 1	0			R -> C (in GM1G1; protein enzymatically inactive; severe mutation). {ECO:0000269|PubMed:15714521, ECO:0000269|PubMed:16941474, ECO:0000269|PubMed:17309651}.|R -> H (in GM1G1; with cardiac involvement in some patients; protein enzymatically inactive; severe mutation). {ECO:0000269|PubMed:10338095, ECO:0000269|PubMed:10737981, ECO:0000269|PubMed:15714521, ECO:0000269|PubMed:16941474, ECO:0000269|PubMed:17309651, ECO:0000269|PubMed:19472408, ECO:0000269|Ref.25}.		carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GTTGCTGCTTGCGTGCTCATT	0.502																																																	0																																										SO:0001583	missense	0			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000445488.2:c.176C>A	3.37:g.33118629G>T	ENSP00000393377:p.Ala59Glu		B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.A59E	ENST00000445488.2	37	c.176		3	.	.	.	.	.	.	.	.	.	.	G	5.499	0.277106	0.10403	.	.	ENSG00000170266	ENST00000445488;ENST00000436768	D;D	0.97352	-4.35;-4.28	1.16	-2.32	0.06745	.	.	.	.	.	D	0.94621	0.8266	.	.	.	0.09310	N	1	.	.	.	.	.	.	D	0.88735	0.3239	6	0.87932	D	0	.	4.1604	0.10280	0.2145:0.2349:0.5506:0.0	.	.	.	.	E	59	ENSP00000393377:A59E;ENSP00000387989:A59E	ENSP00000387989:A59E	A	-	2	0	GLB1	33093633	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-0.694000	0.05115	-1.215000	0.02610	-1.401000	0.01141	GCA	GLB1	-	NULL	ENSG00000170266		0.502	GLB1-201	KNOWN	basic	protein_coding	GLB1	HGNC	protein_coding		-	0.00	74	0	G	NM_000404		33118629	-1	tier1	-	no_errors	ENST00000445488	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.002	T
GOLGA7B	401647	genome.wustl.edu	37	10	99619339	99619339	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:99619339G>T	ENST00000370602.1	+	2	202	c.137G>T	c.(136-138)cGg>cTg	p.R46L		NM_001010917.2	NP_001010917.1	Q2TAP0	GOG7B_HUMAN	golgin A7 family, member B	46						Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)|large_intestine(3)|prostate(1)	5						CTGGACAGCCGGGTAAGGATG	0.493																																																	0													71.0	71.0	71.0					10																	99619339		2203	4300	6503	SO:0001630	splice_region_variant	0			BC008047	CCDS31265.1	10q24.2	2011-10-25	2010-02-12	2008-10-03	ENSG00000155265	ENSG00000155265			31668	protein-coding gene	gene with protein product		614189	"""chromosome 10 open reading frame 133"", ""chromosome 10 open reading frame 132"", ""golgi autoantigen, golgin subfamily a, 7B"""	C10orf133, C10orf132			Standard	NM_001010917		Approved	bA459F3.4, bA451M19.3	uc001kos.3	Q2TAP0	OTTHUMG00000018869	ENST00000370602.1:c.138+1G>T	10.37:g.99619339G>T			Q5T4F5	Missense_Mutation	SNP	pfam_Golgin_A_7/ERF4	p.R46L	ENST00000370602.1	37	c.137	CCDS31265.1	10	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807975	0.90707	.	.	ENSG00000155265	ENST00000370602	.	.	.	4.89	4.89	0.63831	Golgin subfamily A member 7/ERF4 (1);	0.000000	0.85682	D	0.000000	T	0.75027	0.3794	L	0.56769	1.78	0.80722	D	1	D	0.64830	0.994	D	0.74023	0.982	T	0.70691	-0.4802	9	0.25751	T	0.34	-33.5516	17.8428	0.88720	0.0:0.0:1.0:0.0	.	46	Q2TAP0	GOG7B_HUMAN	L	46	.	ENSP00000359634:R46L	R	+	2	0	GOLGA7B	99609329	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.137000	0.94496	2.566000	0.86566	0.555000	0.69702	CGG	GOLGA7B	-	pfam_Golgin_A_7/ERF4	ENSG00000155265		0.493	GOLGA7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA7B	HGNC	protein_coding	OTTHUMT00000049752.1	-	0.00	80	0	G	NM_001010917	Missense_Mutation	99619339	+1	tier1	-	no_errors	ENST00000370602	ensembl	human	known	74_37	missense	5.13	73	4	SNP	1.000	T
GPATCH8	23131	genome.wustl.edu	37	17	42541870	42541870	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:42541870G>T	ENST00000591680.1	-	3	193	c.163C>A	c.(163-165)Ctg>Atg	p.L55M	GPATCH8_ENST00000434000.1_De_novo_Start_InFrame	NM_001002909.2	NP_001002909.1	Q9UKJ3	GPTC8_HUMAN	G patch domain containing 8	55	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(7)|kidney(6)|large_intestine(4)|liver(2)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.206)		CCCTGGCCCAGCTTCCACCCA	0.398																																																	0													183.0	190.0	188.0					17																	42541870		2203	4300	6503	SO:0001583	missense	0			AB011125	CCDS32666.1	17q21.31	2013-01-28	2006-08-22	2006-12-13	ENSG00000186566	ENSG00000186566		"""G patch domain containing"""	29066	protein-coding gene	gene with protein product		614396	"""KIAA0553"""	KIAA0553, GPATC8		9628581	Standard	NM_001002909		Approved		uc002igw.2	Q9UKJ3	OTTHUMG00000181818	ENST00000591680.1:c.163C>A	17.37:g.42541870G>T	ENSP00000467556:p.Leu55Met		B9EGP9|O60300|Q8TB99	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_Znf_C2H2_jaz,smart_G_patch_dom,pfscan_Znf_C2H2,pfscan_G_patch_dom	p.L55M	ENST00000591680.1	37	c.163	CCDS32666.1	17	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382316	0.42207	.	.	ENSG00000186566	ENST00000335500	.	.	.	5.47	5.47	0.80525	D111/G-patch (3);	0.000000	0.46145	D	0.000318	T	0.66336	0.2779	N	0.20986	0.625	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.70185	-0.4941	9	0.66056	D	0.02	-6.1313	19.3249	0.94258	0.0:0.0:1.0:0.0	.	55	Q9UKJ3	GPTC8_HUMAN	M	55	.	ENSP00000335486:L55M	L	-	1	2	GPATCH8	39897396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.370000	0.66144	2.556000	0.86216	0.467000	0.42956	CTG	GPATCH8	-	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	ENSG00000186566		0.398	GPATCH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH8	HGNC	protein_coding	OTTHUMT00000457797.1	-	0.00	99	0	G	NM_001002909		42541870	-1	tier1	-	no_errors	ENST00000591680	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
GRAMD4	23151	genome.wustl.edu	37	22	47068794	47068794	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:47068794C>A	ENST00000406902.1	+	14	1352	c.1139C>A	c.(1138-1140)cCg>cAg	p.P380Q	GRAMD4_ENST00000408031.1_5'Flank|GRAMD4_ENST00000361034.3_Missense_Mutation_p.P380Q			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4	380					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		AAACGCTGCCCGAGGCTGCGC	0.582																																																	0													65.0	62.0	63.0					22																	47068794		2202	4300	6502	SO:0001583	missense	0				CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1139C>A	22.37:g.47068794C>A	ENSP00000385689:p.Pro380Gln		A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.P380Q	ENST00000406902.1	37	c.1139	CCDS33672.1	22	.	.	.	.	.	.	.	.	.	.	c	23.8	4.454069	0.84209	.	.	ENSG00000075240	ENST00000406902;ENST00000361034	T;T	0.43294	0.95;0.95	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000004	T	0.41442	0.1159	L	0.54323	1.7	0.80722	D	1	P	0.48589	0.912	B	0.41510	0.359	T	0.48833	-0.9000	10	0.62326	D	0.03	-33.0747	15.3517	0.74393	0.0:1.0:0.0:0.0	.	380	Q6IC98	GRAM4_HUMAN	Q	380	ENSP00000385689:P380Q;ENSP00000354313:P380Q	ENSP00000354313:P380Q	P	+	2	0	GRAMD4	45447458	1.000000	0.71417	0.944000	0.38274	0.806000	0.45545	7.046000	0.76592	2.294000	0.77228	0.563000	0.77884	CCG	GRAMD4	-	NULL	ENSG00000075240		0.582	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAMD4	HGNC	protein_coding	OTTHUMT00000317969.1	-	0.00	52	0	C	NM_015124		47068794	+1	tier1	-	no_errors	ENST00000361034	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
GRHPR	9380	genome.wustl.edu	37	9	37430521	37430521	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:37430521G>T	ENST00000318158.6	+	7	697	c.612G>T	c.(610-612)gaG>gaT	p.E204D	GRHPR_ENST00000607784.1_Missense_Mutation_p.E204D	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	204					cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		CTACCCCTGAGCTGGCTGCCC	0.582																																																	0													110.0	101.0	104.0					9																	37430521		2203	4300	6503	SO:0001583	missense	0			AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.612G>T	9.37:g.37430521G>T	ENSP00000313432:p.Glu204Asp		Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd	p.E204D	ENST00000318158.6	37	c.612	CCDS6609.1	9	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645520	0.47258	.	.	ENSG00000137106	ENST00000377824;ENST00000318158;ENST00000438860	T;T	0.78924	-1.22;-1.22	5.52	4.63	0.57726	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.407996	0.30329	N	0.009864	T	0.65069	0.2656	L	0.34521	1.04	0.27566	N	0.950036	B;B;B;B	0.10296	0.002;0.0;0.003;0.0	B;B;B;B	0.15484	0.01;0.002;0.013;0.002	T	0.52064	-0.8625	10	0.20519	T	0.43	-22.3961	9.9776	0.41793	0.1541:0.0:0.8459:0.0	.	204;217;61;204	Q5T946;Q5M7Z5;Q9H636;Q9UBQ7	.;.;.;GRHPR_HUMAN	D	204;204;61	ENSP00000367055:E204D;ENSP00000313432:E204D	ENSP00000313432:E204D	E	+	3	2	GRHPR	37420521	1.000000	0.71417	0.992000	0.48379	0.943000	0.58893	2.504000	0.45416	1.480000	0.48289	0.655000	0.94253	GAG	GRHPR	-	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd	ENSG00000137106		0.582	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHPR	HGNC	protein_coding	OTTHUMT00000052442.1	-	0.00	35	0	G	NM_012203		37430521	+1	tier1	-	no_errors	ENST00000318158	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
GRID2	2895	genome.wustl.edu	37	4	94693643	94693643	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:94693643C>A	ENST00000282020.4	+	16	3276	c.3018C>A	c.(3016-3018)tcC>tcA	p.S1006S	GRID2_ENST00000510992.1_Silent_p.S911S	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	1006					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)	p.S1006*(1)|p.S1006S(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GAGGCACCTCCATATGAGCAT	0.413																																																	2	Substitution - Nonsense(1)|Substitution - coding silent(1)	lung(2)											54.0	52.0	53.0					4																	94693643		2203	4300	6503	SO:0001819	synonymous_variant	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.3018C>A	4.37:g.94693643C>A			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S1006	ENST00000282020.4	37	c.3018	CCDS3637.1	4																																																																																			GRID2	-	NULL	ENSG00000152208		0.413	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2		0.00	40	0	C			94693643	+1			no_errors	ENST00000282020	ensembl	human	known	74_37	silent	8.33	33	3	SNP	1.000	A
GRIK4	2900	genome.wustl.edu	37	11	120744855	120744855	+	Silent	SNP	C	C	T	rs111523175		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:120744855C>T	ENST00000527524.2	+	10	1274	c.987C>T	c.(985-987)ggC>ggT	p.G329G	RP11-640N11.2_ENST00000505153.2_RNA|GRIK4_ENST00000438375.2_Silent_p.G329G	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	329					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		AAGAGATCGGCGTGAAGCCCT	0.647													c|||	1	0.000199681	0.0	0.0	5008	,	,		18044	0.0		0.001	False		,,,				2504	0.0																0													60.0	53.0	55.0					11																	120744855		2203	4299	6502	SO:0001819	synonymous_variant	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.987C>T	11.37:g.120744855C>T			A8K9L1	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G329	ENST00000527524.2	37	c.987	CCDS8433.1	11																																																																																			GRIK4	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000149403		0.647	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	46	0	C	NM_014619		120744855	+1	tier1	rs111523175	no_errors	ENST00000527524	ensembl	human	known	74_37	silent	73.91	6	17	SNP	0.942	T
GRM4	2914	genome.wustl.edu	37	6	34101143	34101143	+	Missense_Mutation	SNP	C	C	T	rs143062959		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:34101143C>T	ENST00000538487.2	-	2	574	c.131G>A	c.(130-132)cGc>cAc	p.R44H	GRM4_ENST00000374177.3_Intron|GRM4_ENST00000374181.4_Missense_Mutation_p.R44H	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	44					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCCATCTATGCGGATGGAATT	0.612													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19576	0.0		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	3,4403	4.2+/-10.8	0,3,2200	44.0	39.0	41.0		131	4.2	1.0	6	dbSNP_134	41	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GRM4	NM_000841.1	29	0,4,6499	TT,TC,CC		0.0116,0.0681,0.0308	probably-damaging	44/913	34101143	4,13002	2203	4300	6503	SO:0001583	missense	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.131G>A	6.37:g.34101143C>T	ENSP00000440556:p.Arg44His		B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_GABA_rcpt_B	p.R44H	ENST00000538487.2	37	c.131	CCDS4787.1	6	.	.	.	.	.	.	.	.	.	.	C	15.85	2.955541	0.53293	6.81E-4	1.16E-4	ENSG00000124493	ENST00000374181;ENST00000538487	T;T	0.72725	-0.68;-0.68	4.19	4.19	0.49359	.	0.072106	0.53938	D	0.000049	T	0.57066	0.2028	L	0.43646	1.37	0.80722	D	1	P;D	0.65815	0.796;0.995	B;P	0.53146	0.087;0.719	T	0.54384	-0.8302	10	0.15066	T	0.55	.	10.3635	0.44010	0.0:0.9071:0.0:0.0929	.	44;44	B7ZLU9;Q14833	.;GRM4_HUMAN	H	44	ENSP00000363296:R44H;ENSP00000440556:R44H	ENSP00000363296:R44H	R	-	2	0	GRM4	34209121	0.998000	0.40836	1.000000	0.80357	0.989000	0.77384	2.681000	0.46926	2.335000	0.79485	0.467000	0.42956	CGC	GRM4	-	superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_4	ENSG00000124493		0.612	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2	-	0.00	76	0	C			34101143	-1	tier1	rs143062959	no_errors	ENST00000374181	ensembl	human	known	74_37	missense	41.03	23	16	SNP	1.000	T
GSDMC	56169	genome.wustl.edu	37	8	130762331	130762331	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:130762331G>T	ENST00000276708.4	-	12	1999	c.1118C>A	c.(1117-1119)cCt>cAt	p.P373H		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	373						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GGCACCACCAGGGCCATCCAA	0.383																																																	0													33.0	33.0	33.0					8																	130762331		2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1118C>A	8.37:g.130762331G>T	ENSP00000276708:p.Pro373His		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.P373H	ENST00000276708.4	37	c.1118	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	G	13.77	2.334919	0.41297	.	.	ENSG00000147697	ENST00000276708	T	0.28895	1.59	4.89	-0.496	0.12027	.	0.419987	0.22687	N	0.056876	T	0.29458	0.0734	M	0.64567	1.98	0.09310	N	1	P	0.45634	0.863	P	0.45881	0.496	T	0.14062	-1.0486	10	0.52906	T	0.07	.	4.5525	0.12120	0.2584:0.0:0.5985:0.1431	.	373	Q9BYG8	GSDMC_HUMAN	H	373	ENSP00000276708:P373H	ENSP00000276708:P373H	P	-	2	0	GSDMC	130831513	0.098000	0.21812	0.001000	0.08648	0.086000	0.17979	0.426000	0.21363	-0.194000	0.10399	0.591000	0.81541	CCT	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.383	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	87	0	G			130762331	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	32.73	74	36	SNP	0.015	T
GTPBP10	85865	genome.wustl.edu	37	7	89976069	89976069	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:89976069G>A	ENST00000222511.6	+	1	80	c.14G>A	c.(13-15)aGt>aAt	p.S5N	GTPBP10_ENST00000257659.8_Missense_Mutation_p.S5N	NM_033107.3	NP_149098.2	A4D1E9	GTPBA_HUMAN	GTP-binding protein 10 (putative)	5					ribosome biogenesis (GO:0042254)	chromosome (GO:0005694)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)	p.S5N(1)		endometrium(1)|kidney(2)|large_intestine(3)|lung(4)	10						GTGCATTGCAGTTGCGTGTTG	0.597											OREG0018158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	large_intestine(1)											209.0	194.0	199.0					7																	89976069		2203	4300	6503	SO:0001583	missense	0				CCDS5617.1, CCDS43614.1	7q21.13	2006-08-15			ENSG00000105793	ENSG00000105793			25106	protein-coding gene	gene with protein product		610920				12477932	Standard	NM_001042717		Approved	DKFZP686A10121, FLJ38242	uc003ukm.2	A4D1E9	OTTHUMG00000023655	ENST00000222511.6:c.14G>A	7.37:g.89976069G>A	ENSP00000222511:p.Ser5Asn	1271	B4DFY6|Q3B7A6|Q5H9V2|Q8IXG8|Q8N982|Q8WU16|Q9BSP1|Q9Y6T6	Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_GTP1_OBG_dom,pfam_Fe2_transport_prot_B_N,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,prints_GTP_binding_domain	p.S5N	ENST00000222511.6	37	c.14	CCDS5617.1	7	.	.	.	.	.	.	.	.	.	.	G	11.93	1.784352	0.31593	.	.	ENSG00000105793	ENST00000257659;ENST00000222511;ENST00000417207	T;T;T	0.32023	1.85;2.71;1.47	4.81	4.81	0.61882	.	0.831180	0.11247	N	0.584081	T	0.29256	0.0728	L	0.38531	1.155	0.09310	N	1	P;B	0.41848	0.763;0.361	B;B	0.39027	0.288;0.051	T	0.17592	-1.0364	9	.	.	.	-5.6976	17.4111	0.87486	0.0:0.0:1.0:0.0	.	5;5	A4D1E9-2;A4D1E9	.;GTPBA_HUMAN	N	5	ENSP00000257659:S5N;ENSP00000222511:S5N;ENSP00000416596:S5N	.	S	+	2	0	GTPBP10	89814005	0.502000	0.26107	0.010000	0.14722	0.083000	0.17756	4.988000	0.63863	2.657000	0.90304	0.655000	0.94253	AGT	GTPBP10	-	NULL	ENSG00000105793		0.597	GTPBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP10	HGNC	protein_coding	OTTHUMT00000059976.3	-	0.00	61	0	G	NM_033107		89976069	+1	tier1	-	no_errors	ENST00000222511	ensembl	human	known	74_37	missense	62.16	28	46	SNP	0.062	A
H19	283120	genome.wustl.edu	37	11	2018119	2018119	+	RNA	SNP	C	C	T	rs563865428		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:2018119C>T	ENST00000390168.4	-	0	0					NR_030533.1				H19, imprinted maternally expressed transcript (non-protein coding)																		CTCCTTGCTGCGCAATGTCCC	0.721									Beckwith-Wiedemann syndrome		OREG0003762|OREG0003763	type=REGULATORY REGION|Gene=AF118081|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=H19|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	c|||	1	0.000199681	0.0	0.0	5008	,	,		12542	0.0		0.0	False		,,,				2504	0.001																0													3.0	6.0	5.0					11																	2018119		618	1465	2083			0	Familial Cancer Database	BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AF087017		11p15.5	2012-10-19	2008-06-04		ENSG00000130600	ENSG00000130600		"""Long non-coding RNAs"", ""-"""	4713	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 8"", ""long intergenic non-protein coding RNA 8"""	103280	"""H19, imprinted maternally expressed untranslated mRNA"""			2595451, 1688465	Standard	NR_002196		Approved	D11S813E, ASM, ASM1, NCRNA00008, LINC00008	uc021qby.1		OTTHUMG00000012477		11.37:g.2018119C>T		600		RNA	SNP	-	NULL	ENST00000390168.4	37	NULL		11																																																																																			H19	-	-	ENSG00000130600		0.721	H19-201	KNOWN	basic	miRNA	H19	HGNC	processed_transcript		-	0.00	41	0	C	NR_002196		2018119	-1	tier1	-	no_errors	ENST00000411754	ensembl	human	known	74_37	rna	27.59	21	8	SNP	0.624	T
HCN3	57657	genome.wustl.edu	37	1	155257602	155257602	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:155257602G>T	ENST00000368358.3	+	8	1681	c.1673G>T	c.(1672-1674)cGc>cTc	p.R558L	HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	558					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAGCGGAAGCGCTCCGAGCCA	0.552																																																	0													53.0	58.0	56.0					1																	155257602		2203	4300	6503	SO:0001583	missense	0			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.1673G>T	1.37:g.155257602G>T	ENSP00000357342:p.Arg558Leu		D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.R558L	ENST00000368358.3	37	c.1673	CCDS1108.1	1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239629	0.39598	.	.	ENSG00000143630	ENST00000368358	T	0.39592	1.07	4.91	2.98	0.34508	.	0.122998	0.37530	N	0.002051	T	0.10165	0.0249	N	0.14661	0.345	0.39003	D	0.959387	B;B	0.09022	0.0;0.002	B;B	0.15870	0.003;0.014	T	0.07328	-1.0778	10	0.27082	T	0.32	.	8.235	0.31620	0.0884:0.1596:0.752:0.0	.	253;558	B7Z5R8;Q9P1Z3	.;HCN3_HUMAN	L	558	ENSP00000357342:R558L	ENSP00000357342:R558L	R	+	2	0	HCN3	153524226	0.638000	0.27225	1.000000	0.80357	0.929000	0.56500	1.153000	0.31676	0.740000	0.32651	0.557000	0.71058	CGC	HCN3	-	NULL	ENSG00000143630		0.552	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN3	HGNC	protein_coding	OTTHUMT00000087388.1		0.00	85	0	G	NM_020897		155257602	+1			no_errors	ENST00000368358	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
HAPLN2	60484	genome.wustl.edu	37	1	156594237	156594237	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:156594237C>A	ENST00000255039.1	+	5	941	c.534C>A	c.(532-534)gcC>gcA	p.A178A	HAPLN2_ENST00000494218.1_3'UTR	NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	178	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GACGCCTGGCCACCTACTCCC	0.667																																																	0													24.0	24.0	24.0					1																	156594237		2201	4298	6499	SO:0001819	synonymous_variant	0			AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.534C>A	1.37:g.156594237C>A			Q5T3J0	Silent	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.A178	ENST00000255039.1	37	c.534	CCDS1148.1	1																																																																																			HAPLN2	-	pfam_Link,superfamily_C-type_lectin_fold,smart_Link,pfscan_Link	ENSG00000132702		0.667	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN2	HGNC	protein_coding	OTTHUMT00000081039.1	-	0.00	73	0	C	NM_021817		156594237	+1	tier1	-	no_errors	ENST00000255039	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	A
HERC2	8924	genome.wustl.edu	37	15	28408276	28408276	+	Silent	SNP	G	G	A	rs374505560		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:28408276G>A	ENST00000261609.7	-	69	10818	c.10710C>T	c.(10708-10710)tcC>tcT	p.S3570S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AAAGCACCGCGGAGAGCACAT	0.647																																																	0								G		3,4403	6.2+/-15.9	0,3,2200	88.0	83.0	85.0		10710	-10.3	0.0	15		85	0,8600		0,0,4300	no	coding-synonymous	HERC2	NM_004667.4		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		3570/4835	28408276	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10710C>T	15.37:g.28408276G>A				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.S3570	ENST00000261609.7	37	c.10710	CCDS10021.1	15																																																																																			HERC2	-	NULL	ENSG00000128731		0.647	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	49	0	G	NM_004667		28408276	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	silent	54.39	26	31	SNP	0.001	A
HERC2	8924	genome.wustl.edu	37	15	28463812	28463812	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:28463812C>T	ENST00000261609.7	-	38	5959	c.5851G>A	c.(5851-5853)Gaa>Aaa	p.E1951K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2									p.E1951K(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCAGTTTGTTCGGCTTCTAAA	0.343																																																	1	Substitution - Missense(1)	large_intestine(1)											38.0	48.0	44.0					15																	28463812		1351	2275	3626	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.5851G>A	15.37:g.28463812C>T	ENSP00000261609:p.Glu1951Lys			Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.E1951K	ENST00000261609.7	37	c.5851	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672233	0.67928	.	.	ENSG00000128731	ENST00000261609	T	0.39592	1.07	4.4	3.47	0.39725	.	0.128657	0.51477	D	0.000093	T	0.28928	0.0718	L	0.47716	1.5	0.80722	D	1	P	0.44006	0.824	B	0.27500	0.08	T	0.11470	-1.0586	10	0.26408	T	0.33	.	14.0559	0.64769	0.1521:0.8479:0.0:0.0	.	1951	O95714	HERC2_HUMAN	K	1951	ENSP00000261609:E1951K	ENSP00000261609:E1951K	E	-	1	0	HERC2	26137407	1.000000	0.71417	0.973000	0.42090	0.571000	0.35966	7.320000	0.79064	1.191000	0.43056	0.650000	0.86243	GAA	HERC2	-	NULL	ENSG00000128731		0.343	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	251	0	C	NM_004667		28463812	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	45.70	120	101	SNP	1.000	T
HIVEP1	3096	genome.wustl.edu	37	6	12161695	12161695	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:12161695G>A	ENST00000379388.2	+	8	6843	c.6511G>A	c.(6511-6513)Gag>Aag	p.E2171K	HIVEP1_ENST00000541134.1_Missense_Mutation_p.E36K	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	2171					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E2171Q(1)		NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ATTCAGTTATGAGCGATCTGG	0.383																																																	1	Substitution - Missense(1)	lung(1)											86.0	93.0	91.0					6																	12161695		1943	4144	6087	SO:0001583	missense	0			J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.6511G>A	6.37:g.12161695G>A	ENSP00000368698:p.Glu2171Lys		B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E2171K	ENST00000379388.2	37	c.6511	CCDS43426.1	6	.	.	.	.	.	.	.	.	.	.	G	30	5.052354	0.93793	.	.	ENSG00000095951	ENST00000379388;ENST00000442081;ENST00000541134;ENST00000542327	T;T	0.30981	2.89;1.51	5.77	5.77	0.91146	.	0.000000	0.35013	N	0.003517	T	0.42921	0.1224	M	0.84433	2.695	0.53688	D	0.999971	D	0.54964	0.969	P	0.50490	0.642	T	0.40040	-0.9584	10	0.36615	T	0.2	-26.7108	19.9827	0.97334	0.0:0.0:1.0:0.0	.	2171	P15822	ZEP1_HUMAN	K	2171;98;36;153	ENSP00000368698:E2171K;ENSP00000445617:E36K	ENSP00000368698:E2171K	E	+	1	0	HIVEP1	12269681	1.000000	0.71417	0.956000	0.39512	0.574000	0.36063	4.764000	0.62264	2.728000	0.93425	0.655000	0.94253	GAG	HIVEP1	-	NULL	ENSG00000095951		0.383	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP1	HGNC	protein_coding	OTTHUMT00000039870.2		0.00	38	0	G	NM_002114		12161695	+1			no_errors	ENST00000379388	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
HKDC1	80201	genome.wustl.edu	37	10	71021109	71021109	+	Intron	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:71021109G>A	ENST00000354624.5	+	16	2505				HKDC1_ENST00000395086.2_Intron	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1						carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CACCACGCTGGGGTTGGGCCA	0.507																																																	0																																										SO:0001627	intron_variant	0				CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2372+59G>A	10.37:g.71021109G>A			B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	RNA	SNP	-	NULL	ENST00000354624.5	37	NULL	CCDS7288.1	10																																																																																			HKDC1	-	-	ENSG00000156510		0.507	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HKDC1	HGNC	protein_coding	OTTHUMT00000048389.1	-	0.00	60	0	G	NM_025130		71021109	+1	tier1	-	no_errors	ENST00000470920	ensembl	human	known	74_37	rna	6.35	59	4	SNP	0.001	A
HOXB3	3213	genome.wustl.edu	37	17	46629737	46629737	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:46629737delG	ENST00000470495.1	-	1	1547	c.100delC	c.(100-102)caafs	p.Q34fs	HOXB-AS1_ENST00000508688.1_RNA|HOXB3_ENST00000485909.2_Intron|HOXB-AS1_ENST00000435312.1_RNA|HOXB3_ENST00000490677.1_Intron|HOXB-AS1_ENST00000502764.2_RNA|HOXB3_ENST00000476342.1_Frame_Shift_Del_p.Q34fs|HOXB3_ENST00000472863.1_Intron|HOXB3_ENST00000460160.1_Intron|HOXB3_ENST00000311626.4_Frame_Shift_Del_p.Q34fs|HOXB3_ENST00000498678.1_Frame_Shift_Del_p.Q34fs|HOXB3_ENST00000489475.1_Intron|HOXB-AS3_ENST00000465846.2_RNA			P14651	HXB3_HUMAN	homeobox B3	34					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|cartilage development (GO:0051216)|definitive hemopoiesis (GO:0060216)|embryonic skeletal system morphogenesis (GO:0048704)|face development (GO:0060324)|glossopharyngeal nerve morphogenesis (GO:0021615)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of neurogenesis (GO:0050767)|rhombomere development (GO:0021546)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(16)|prostate(4)|upper_aerodigestive_tract(1)	30						AATGGGGGTTGGGGGGGGACA	0.632																																																	0										30,117,4113		0,0,30,41,35,2024	30.0	36.0	34.0			2.8	1.0	17		33	35,182,8035		0,0,35,71,40,3980	no	codingComplex	HOXB3	NM_002146.4		0,0,65,112,75,6004	A1A1,A1A2,A1R,A2A2,A2R,RR		2.6297,3.4507,2.9092			46629737	65,299,12148	2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS11528.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120093	ENSG00000120093		"""Homeoboxes / ANTP class : HOXL subclass"""	5114	protein-coding gene	gene with protein product		142966	"""homeo box B3"""	HOX2, HOX2G		1973146, 1358459	Standard	XM_006721854		Approved		uc002ino.3	P14651	OTTHUMG00000159922	ENST00000470495.1:c.100delC	17.37:g.46629737delG	ENSP00000417207:p.Gln34fs		A8K567|B7Z5N8|B7Z5P8|B7ZAD0|D3DTV3|O95615|P17484	Frame_Shift_Del	DEL	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.Q34fs	ENST00000470495.1	37	c.100	CCDS11528.1	17																																																																																			HOXB3	-	NULL	ENSG00000120093		0.632	HOXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB3	HGNC	protein_coding	OTTHUMT00000358261.1		0.00	49	0	G			46629737	-1	tier1		no_errors	ENST00000311626	ensembl	human	known	74_37	frame_shift_del	9.38	29	3	DEL	1.000	-
HOXC13	3229	genome.wustl.edu	37	12	54338823	54338823	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:54338823G>A	ENST00000243056.3	+	2	932	c.776G>A	c.(775-777)cGc>cAc	p.R259H		NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	259					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						AGCTACCGGCGCGGGCGCAAG	0.607			T	NUP98	AML																																			Dom	yes		12	12q13.3	3229	homeo box C13		L	0													74.0	82.0	80.0					12																	54338823		2203	4300	6503	SO:0001583	missense	0				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.776G>A	12.37:g.54338823G>A	ENSP00000243056:p.Arg259His		Q5BL02|Q96J32|Q9NR24|Q9NYD5	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R259H	ENST00000243056.3	37	c.776	CCDS8865.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.447328	0.96205	.	.	ENSG00000123364	ENST00000243056	D	0.95949	-3.86	4.95	4.95	0.65309	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97936	0.9321	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98545	1.0634	10	0.87932	D	0	.	17.4956	0.87716	0.0:0.0:1.0:0.0	.	259	P31276	HXC13_HUMAN	H	259	ENSP00000243056:R259H	ENSP00000243056:R259H	R	+	2	0	HOXC13	52625090	1.000000	0.71417	0.974000	0.42286	0.918000	0.54935	9.486000	0.97944	2.755000	0.94549	0.655000	0.94253	CGC	HOXC13	-	superfamily_Homeodomain-like,pfscan_Homeobox_dom	ENSG00000123364		0.607	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	HGNC	protein_coding	OTTHUMT00000358865.2		0.00	25	0	G			54338823	+1			no_errors	ENST00000243056	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.999	A
HS3ST3B1	9953	genome.wustl.edu	37	17	14248498	14248498	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:14248498G>A	ENST00000360954.2	+	2	1144	c.708G>A	c.(706-708)tcG>tcA	p.S236S		NM_006041.1	NP_006032.1	Q9Y662	HS3SB_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1	236					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)			large_intestine(3)|lung(3)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		GGGCCATCTCGGACTACACGC	0.637																																																	0													27.0	16.0	20.0					17																	14248498		2191	4226	6417	SO:0001819	synonymous_variant	0			AF105377	CCDS11167.1	17p12	2007-04-02			ENSG00000125430	ENSG00000125430	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5198	protein-coding gene	gene with protein product		604058				9988767	Standard	NM_006041		Approved	3OST3B1, 30ST3B1	uc002goh.1	Q9Y662	OTTHUMG00000058810	ENST00000360954.2:c.708G>A	17.37:g.14248498G>A			B3KN58|D3DTS6	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S236	ENST00000360954.2	37	c.708	CCDS11167.1	17																																																																																			HS3ST3B1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000125430		0.637	HS3ST3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3B1	HGNC	protein_coding	OTTHUMT00000129998.1	-	0.00	37	0	G	NM_006041		14248498	+1	tier1	-	no_errors	ENST00000360954	ensembl	human	known	74_37	silent	60.00	14	21	SNP	0.994	A
HSPG2	3339	genome.wustl.edu	37	1	22222693	22222694	+	Frame_Shift_Ins	INS	-	-	TCCT			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:22222693_22222694insTCCT	ENST00000374695.3	-	2	252_253	c.173_174insAGGA	c.(172-174)gacfs	p.D58fs		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	58				D -> Y (in Ref. 1; AAA52700). {ECO:0000305}.	angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CAGCCAGCATGTCCTCATCATC	0.579																																																	0																																										SO:0001589	frameshift_variant	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.170_173dupAGGA	1.37:g.22222694_22222697dupTCCT	ENSP00000363827:p.Asp58fs		Q16287|Q5SZI3|Q9H3V5	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.D58fs	ENST00000374695.3	37	c.174_173	CCDS30625.1	1																																																																																			HSPG2	-	NULL	ENSG00000142798		0.579	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1		0.00	43	0	-	NM_005529		22222694	-1	tier1		no_errors	ENST00000374695	ensembl	human	known	74_37	frame_shift_ins	46.43	15	13	INS	0.988:1.000	TCCT
IGFN1	91156	genome.wustl.edu	37	1	201177487	201177487	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:201177487C>A	ENST00000335211.4	+	12	3596	c.3466C>A	c.(3466-3468)Ctg>Atg	p.L1156M	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0	Ig-like 5.					nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						ACCAGGGTCTCTGAGGGCAGG	0.597																																																	0													8.0	7.0	8.0					1																	201177487		691	1588	2279	SO:0001583	missense	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.3466C>A	1.37:g.201177487C>A	ENSP00000334714:p.Leu1156Met		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L1156M	ENST00000335211.4	37	c.3466	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297457	0.60086	.	.	ENSG00000163395	ENST00000335211	D	0.89343	-2.5	3.97	3.04	0.35103	.	.	.	.	.	T	0.76622	0.4013	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.70215	-0.4933	6	.	.	.	.	6.581	0.22594	0.0:0.8702:0.0:0.1298	.	.	.	.	M	1156	ENSP00000334714:L1156M	.	L	+	1	2	IGFN1	199444110	0.001000	0.12720	0.965000	0.40720	0.174000	0.22865	0.066000	0.14489	2.133000	0.65898	0.561000	0.74099	CTG	IGFN1	-	NULL	ENSG00000163395		0.597	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		-	0.00	46	0	C	NM_178275		201177487	+1	tier1	-	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.998	A
IL7R	3575	genome.wustl.edu	37	5	35873732	35873732	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:35873732G>T	ENST00000303115.3	+	5	817	c.688G>T	c.(688-690)Gag>Tag	p.E230*	IL7R_ENST00000343305.4_Nonsense_Mutation_p.E230*|IL7R_ENST00000506850.1_Nonsense_Mutation_p.E230*	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	230	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			CAGAACTCCAGAGATCAATAA	0.423			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																																	Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													103.0	98.0	99.0					5																	35873732		2203	4300	6503	SO:0001587	stop_gained	0			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.688G>T	5.37:g.35873732G>T	ENSP00000306157:p.Glu230*		B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.E230*	ENST00000303115.3	37	c.688	CCDS3911.1	5	.	.	.	.	.	.	.	.	.	.	G	18.25	3.581711	0.65992	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850;ENST00000505093	.	.	.	6.03	4.23	0.50019	.	1.364320	0.04385	N	0.361508	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-14.0912	7.6617	0.28407	0.0847:0.1661:0.7492:0.0	.	.	.	.	X	230;230;230;33	.	ENSP00000306157:E230X	E	+	1	0	IL7R	35909489	0.862000	0.29867	0.497000	0.27552	0.008000	0.06430	2.620000	0.46410	1.533000	0.49186	-0.176000	0.13171	GAG	IL7R	-	superfamily_Fibronectin_type3	ENSG00000168685		0.423	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2		0.00	48	0	G			35873732	+1			no_errors	ENST00000303115	ensembl	human	known	74_37	nonsense	8.33	33	3	SNP	0.808	T
INF2	64423	genome.wustl.edu	37	14	105173814	105173814	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:105173814A>G	ENST00000392634.4	+	8	1322	c.1210A>G	c.(1210-1212)Agc>Ggc	p.S404G	INF2_ENST00000330634.7_Missense_Mutation_p.S404G	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	404					actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		CCAGAGTGAGAGCATCCTGAA	0.687																																																	0													10.0	13.0	12.0					14																	105173814		1905	3992	5897	SO:0001583	missense	0			AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.1210A>G	14.37:g.105173814A>G	ENSP00000376410:p.Ser404Gly		Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.S404G	ENST00000392634.4	37	c.1210	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	A	0.036	-1.307310	0.01342	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	T;T	0.79940	-1.32;-1.32	1.85	0.663	0.17885	.	.	.	.	.	T	0.65770	0.2723	L	0.40543	1.245	0.20307	N	0.999916	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45629	-0.9248	9	0.17369	T	0.5	.	2.7296	0.05223	0.625:0.0:0.1505:0.2245	.	404;404	Q27J81-2;Q27J81	.;INF2_HUMAN	G	404	ENSP00000376406:S404G;ENSP00000376410:S404G	ENSP00000376406:S404G	S	+	1	0	INF2	104244859	0.000000	0.05858	0.006000	0.13384	0.007000	0.05969	0.092000	0.15066	0.187000	0.20147	0.529000	0.55759	AGC	INF2	-	NULL	ENSG00000203485		0.687	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	HGNC	protein_coding	OTTHUMT00000074371.4		0.00	82	0	A	NM_022489		105173814	+1			no_errors	ENST00000392634	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.012	G
IP6K2	51447	genome.wustl.edu	37	3	48732632	48732632	+	Silent	SNP	G	G	A	rs369490009		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:48732632G>A	ENST00000328631.5	-	2	316	c.93C>T	c.(91-93)tgC>tgT	p.C31C	IP6K2_ENST00000449610.1_Silent_p.C31C|IP6K2_ENST00000413298.1_Silent_p.C31C|IP6K2_ENST00000450045.1_Silent_p.C85C|IP6K2_ENST00000443964.1_Silent_p.C90C|IP6K2_ENST00000453202.1_Silent_p.C31C|IP6K2_ENST00000431721.2_Silent_p.C86C|IP6K2_ENST00000417896.1_Silent_p.C31C|IP6K2_ENST00000432678.2_Silent_p.C31C|IP6K2_ENST00000436134.1_5'UTR|IP6K2_ENST00000446860.1_Silent_p.C89C|IP6K2_ENST00000340879.4_Silent_p.C31C	NM_001005909.2|NM_016291.3	NP_001005909.1|NP_057375.2	Q9UHH9	IP6K2_HUMAN	inositol hexakisphosphate kinase 2	31					cytokine-mediated signaling pathway (GO:0019221)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell growth (GO:0030308)|phosphate ion transport (GO:0006817)|phosphatidylinositol phosphorylation (GO:0046854)|positive regulation of apoptotic process (GO:0043065)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			biliary_tract(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	15						AGCGGAGCACGCATGAGTGCC	0.622																																																	0								G	,,,,,,,	1,4405	2.1+/-5.4	0,1,2202	88.0	86.0	87.0		93,93,93,93,93,258,267,93	-8.9	0.1	3		87	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	IP6K2	NM_001005909.2,NM_001005910.2,NM_001005911.2,NM_001146178.2,NM_001146179.2,NM_001190316.1,NM_001190317.1,NM_016291.3	,,,,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,	31/427,31/98,31/98,31/88,31/88,86/186,89/189,31/427	48732632	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF177145	CCDS2777.1, CCDS33752.1, CCDS54579.1, CCDS54580.1, CCDS54581.1	3p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000068745	ENSG00000068745			17313	protein-coding gene	gene with protein product		606992	"""inositol hexaphosphate kinase 2"""	IHPK2		10574768	Standard	NM_016291		Approved		uc003cup.3	Q9UHH9	OTTHUMG00000133543	ENST00000328631.5:c.93C>T	3.37:g.48732632G>A			A8K3B1|B4E3G6|G8JLL6|Q6P0N8|Q9BSZ6|Q9BUW3|Q9H4P7|Q9NT63|Q9UFU6	Silent	SNP	pfam_IPK	p.C31	ENST00000328631.5	37	c.93	CCDS2777.1	3																																																																																			IP6K2	-	NULL	ENSG00000068745		0.622	IP6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IP6K2	HGNC	protein_coding	OTTHUMT00000257521.2		0.00	76	0	G	NM_016291		48732632	-1			no_errors	ENST00000328631	ensembl	human	known	74_37	silent	5.77	49	3	SNP	0.631	A
ITIH5	80760	genome.wustl.edu	37	10	7605279	7605279	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:7605279G>T	ENST00000256861.6	-	14	2674	c.2596C>A	c.(2596-2598)Cct>Act	p.P866T	ITIH5_ENST00000397146.2_Intron|ITIH5_ENST00000446830.2_Missense_Mutation_p.P648T|ITIH5_ENST00000298441.6_Missense_Mutation_p.P652T	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	866					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						AGGAGCAGAGGGTGAGTGAGG	0.572																																																	0													71.0	66.0	68.0					10																	7605279		2203	4300	6503	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.2596C>A	10.37:g.7605279G>T	ENSP00000256861:p.Pro866Thr		Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.P866T	ENST00000256861.6	37	c.2596		10	.	.	.	.	.	.	.	.	.	.	G	9.476	1.096858	0.20552	.	.	ENSG00000123243	ENST00000256861;ENST00000298441;ENST00000446830	T;T;T	0.02032	4.7;4.49;4.51	5.43	1.53	0.23141	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	1.706600	0.02321	N	0.073020	T	0.02083	0.0065	.	.	.	0.09310	N	1	B;B	0.28470	0.213;0.017	B;B	0.28385	0.089;0.005	T	0.49153	-0.8969	9	0.17832	T	0.49	-0.0139	9.1022	0.36676	0.2964:0.0:0.7036:0.0	.	866;652	Q86UX2;Q86UX2-3	ITIH5_HUMAN;.	T	866;652;648	ENSP00000256861:P866T;ENSP00000298441:P652T;ENSP00000387969:P648T	ENSP00000256861:P866T	P	-	1	0	ITIH5	7645285	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.615000	0.24329	0.029000	0.15352	-0.131000	0.14894	CCT	ITIH5	-	pfam_ITI_HC_C	ENSG00000123243		0.572	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1		0.00	40	0	G	NM_030569		7605279	-1			no_errors	ENST00000256861	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.000	T
PLA2G4B	100137049	genome.wustl.edu	37	15	42138474	42138474	+	Silent	SNP	C	C	A	rs375427577		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:42138474C>A	ENST00000452633.1	+	18	2026	c.1674C>A	c.(1672-1674)acC>acA	p.T558T	PLA2G4B_ENST00000458483.1_Silent_p.T558T|JMJD7-PLA2G4B_ENST00000342159.4_Silent_p.T789T|PLA2G4B_ENST00000542534.2_Silent_p.T789T|JMJD7-PLA2G4B_ENST00000382448.4_Silent_p.T789T			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	558	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		AGTTTTTCACCGATCTTCTGA	0.532																																																	0													105.0	108.0	107.0					15																	42138474		2203	4300	6503	SO:0001819	synonymous_variant	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.1674C>A	15.37:g.42138474C>A			B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Silent	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.T789	ENST00000452633.1	37	c.2367	CCDS45241.1	15																																																																																			JMJD7-PLA2G4B	-	superfamily_Acyl_Trfase/lysoPLipase,smart_LysoPLipase_cat_dom,pfscan_LysoPLipase_cat_dom	ENSG00000168970		0.532	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	-	0.00	44	0	C	NM_001114633		42138474	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.437	A
KAT6B	23522	genome.wustl.edu	37	10	76781836	76781836	+	Silent	SNP	G	G	A	rs569172957	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:76781836G>A	ENST00000287239.4	+	16	3708	c.3219G>A	c.(3217-3219)gaG>gaA	p.E1073E	KAT6B_ENST00000490365.1_3'UTR|KAT6B_ENST00000372714.1_Silent_p.E781E|RP11-77G23.5_ENST00000436608.1_RNA|KAT6B_ENST00000372724.1_Silent_p.E781E|KAT6B_ENST00000372711.1_Silent_p.E890E|RP11-77G23.2_ENST00000413431.1_RNA|KAT6B_ENST00000372725.1_Silent_p.E781E	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1073	Poly-Glu.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E1073E(1)									aagaagaagaggaggaggagg	0.488											OREG0020273	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	endometrium(1)											22.0	23.0	23.0					10																	76781836		2203	4300	6503	SO:0001819	synonymous_variant	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.3219G>A	10.37:g.76781836G>A		1170	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5_H15,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E1073	ENST00000287239.4	37	c.3219	CCDS7345.1	10																																																																																			KAT6B	-	NULL	ENSG00000156650		0.488	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1		0.00	24	0	G	NM_012330		76781836	+1			no_errors	ENST00000287239	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.928	A
KATNB1	10300	genome.wustl.edu	37	16	57789109	57789109	+	Missense_Mutation	SNP	C	C	T	rs144075503		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:57789109C>T	ENST00000379661.3	+	15	1767	c.1375C>T	c.(1375-1377)Cgg>Tgg	p.R459W		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				CCCTGCCACCCGGAACGAGCC	0.647																																																	0								C	TRP/ARG	1,4395	2.1+/-5.4	0,1,2197	26.0	29.0	28.0		1375	1.9	0.2	16	dbSNP_134	28	0,8600		0,0,4300	no	missense	KATNB1	NM_005886.2	101	0,1,6497	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	459/656	57789109	1,12995	2198	4300	6498	SO:0001583	missense	0			AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.1375C>T	16.37:g.57789109C>T	ENSP00000368982:p.Arg459Trp			Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R459W	ENST00000379661.3	37	c.1375	CCDS10788.1	16	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427468	0.43122	2.27E-4	0.0	ENSG00000140854	ENST00000379661	T	0.57595	0.39	5.33	1.92	0.25849	.	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	L	0.32530	0.975	0.48185	D	0.999609	D	0.89917	1.0	D	0.87578	0.998	T	0.62001	-0.6946	10	0.87932	D	0	-0.0045	12.5277	0.56096	0.6882:0.3118:0.0:0.0	.	459	Q9BVA0	KTNB1_HUMAN	W	459	ENSP00000368982:R459W	ENSP00000368982:R459W	R	+	1	2	KATNB1	56346610	0.958000	0.32768	0.205000	0.23548	0.074000	0.17049	1.226000	0.32563	0.592000	0.29728	0.650000	0.86243	CGG	KATNB1	-	NULL	ENSG00000140854		0.647	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KATNB1	HGNC	protein_coding	OTTHUMT00000257343.3		0.00	45	0	C			57789109	+1			no_errors	ENST00000379661	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.411	T
KCNG4	93107	genome.wustl.edu	37	16	84256561	84256561	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:84256561G>A	ENST00000308251.4	-	3	890	c.822C>T	c.(820-822)tcC>tcT	p.S274S		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	274					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						AGAACTCCAGGGAGAACCAGG	0.567																																																	0													61.0	64.0	63.0					16																	84256561		2200	4300	6500	SO:0001819	synonymous_variant	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.822C>T	16.37:g.84256561G>A			Q96H24	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.S274	ENST00000308251.4	37	c.822	CCDS10945.1	16																																																																																			KCNG4	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000168418		0.567	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	-	0.00	61	0	G	NM_172347		84256561	-1	tier1	-	no_errors	ENST00000308251	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.989	A
KCNK5	8645	genome.wustl.edu	37	6	39196767	39196767	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:39196767G>T	ENST00000359534.3	-	1	459	c.121C>A	c.(121-123)Cag>Aag	p.Q41K		NM_003740.3	NP_003731.1	O95279	KCNK5_HUMAN	potassium channel, subfamily K, member 5	41					excretion (GO:0007588)|potassium ion transport (GO:0006813)	integral component of plasma membrane (GO:0005887)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(4)|skin(3)	19						TGCAGCTTCTGTGTGTAGTAG	0.572																																																	0													146.0	149.0	148.0					6																	39196767		2203	4300	6503	SO:0001583	missense	0			AF084830	CCDS4841.1	6p21	2012-03-07			ENSG00000164626	ENSG00000164626		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6280	protein-coding gene	gene with protein product		603493				9812978, 16382106	Standard	XM_005249456		Approved	K2p5.1, TASK-2	uc003oon.3	O95279	OTTHUMG00000014642	ENST00000359534.3:c.121C>A	6.37:g.39196767G>T	ENSP00000352527:p.Gln41Lys		B2RAQ6|B5TJL2|Q5VV76	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.Q41K	ENST00000359534.3	37	c.121	CCDS4841.1	6	.	.	.	.	.	.	.	.	.	.	G	11.14	1.550457	0.27739	.	.	ENSG00000164626	ENST00000359534	T	0.19938	2.11	4.9	2.03	0.26663	.	0.323690	0.34291	N	0.004084	T	0.03178	0.0093	N	0.21194	0.64	0.29175	N	0.87689	B	0.02656	0.0	B	0.04013	0.001	T	0.45659	-0.9246	10	0.07644	T	0.81	.	9.5141	0.39095	0.0:0.3739:0.3753:0.2508	.	41	O95279	KCNK5_HUMAN	K	41	ENSP00000352527:Q41K	ENSP00000352527:Q41K	Q	-	1	0	KCNK5	39304745	0.969000	0.33509	0.052000	0.19188	0.975000	0.68041	1.610000	0.36869	0.232000	0.21100	0.511000	0.50034	CAG	KCNK5	-	NULL	ENSG00000164626		0.572	KCNK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK5	HGNC	protein_coding	OTTHUMT00000040449.1		0.00	52	0	G	NM_003740		39196767	-1			no_errors	ENST00000359534	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.218	T
KCTD5	54442	genome.wustl.edu	37	16	2752446	2752446	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:2752446C>T	ENST00000301738.4	+	5	716	c.642C>T	c.(640-642)taC>taT	p.Y214Y	KCTD5_ENST00000564195.1_Missense_Mutation_p.R184W	NM_018992.3	NP_061865.1	Q9NXV2	KCTD5_HUMAN	potassium channel tetramerization domain containing 5	214					protein homooligomerization (GO:0051260)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2						ACACCCCGTACGGTACGGCCA	0.622																																					Ovarian(56;981 1456 4301 50892)												0													79.0	69.0	73.0					16																	2752446		2197	4300	6497	SO:0001819	synonymous_variant	0			AK000047	CCDS10475.1	16p13.3	2013-06-20	2013-06-20		ENSG00000167977	ENSG00000167977			21423	protein-coding gene	gene with protein product		611285	"""potassium channel tetramerisation domain containing 5"""			12477932	Standard	NM_018992		Approved	FLJ20040	uc002crd.3	Q9NXV2	OTTHUMG00000128930	ENST00000301738.4:c.642C>T	16.37:g.2752446C>T			D3DU96	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R184W	ENST00000301738.4	37	c.550	CCDS10475.1	16																																																																																			KCTD5	-	NULL	ENSG00000167977		0.622	KCTD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD5	HGNC	protein_coding	OTTHUMT00000250909.2	-	0.00	61	0	C	NM_018992		2752446	+1	tier1	-	no_errors	ENST00000564195	ensembl	human	putative	74_37	missense	9.52	38	4	SNP	0.996	T
KDM1B	221656	genome.wustl.edu	37	6	18218058	18218058	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:18218058G>T	ENST00000297792.5	+	17	1808	c.1631G>T	c.(1630-1632)gGg>gTg	p.G544V	KDM1B_ENST00000388870.2_Missense_Mutation_p.G777V|KDM1B_ENST00000397244.1_Missense_Mutation_p.G545V|KDM1B_ENST00000546309.2_Missense_Mutation_p.G67V			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	776					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						GGTGGAAGTGGGGAGGCCTAC	0.448																																																	0													229.0	190.0	203.0					6																	18218058		2203	4300	6503	SO:0001583	missense	0			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.1631G>T	6.37:g.18218058G>T	ENSP00000297792:p.Gly544Val		A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_Znf_CW,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_SWIRM,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pfscan_SWIRM,pfscan_Znf_CW	p.G777V	ENST00000297792.5	37	c.2330	CCDS34343.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.1|27.1	4.801019|4.801019	0.90538|0.90538	.|.	.|.	ENSG00000165097|ENSG00000165097	ENST00000546309;ENST00000388870;ENST00000397244;ENST00000297792;ENST00000388869|ENST00000449850	T;D;D;D|D	0.93133|0.93488	2.92;-3.17;-3.17;-3.17|-3.23	5.85|5.85	5.85|5.85	0.93711|0.93711	Amine oxidase (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.96815|0.96815	0.8960|0.8960	M|M	0.86268|0.86268	2.805|2.805	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.998;1.0;1.0|.	D;D;D|.	0.97110|.	0.985;0.993;1.0|.	D|D	0.96627|0.96627	0.9464|0.9464	10|8	0.72032|0.72032	D|D	0.01|0.01	-16.6217|-16.6217	20.1577|20.1577	0.98120|0.98120	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	593;776;544|.	A2A2C4;Q8NB78;A2A2C6|.	.;KDM1B_HUMAN;.|.	V|W	67;777;545;544;774|594	ENSP00000442670:G67V;ENSP00000373522:G777V;ENSP00000380419:G545V;ENSP00000297792:G544V|ENSP00000405669:G594W	ENSP00000297792:G544V|ENSP00000405669:G594W	G|G	+|+	2|1	0|0	KDM1B|KDM1B	18326037|18326037	1.000000|1.000000	0.71417|0.71417	0.968000|0.968000	0.41197|0.41197	0.823000|0.823000	0.46562|0.46562	8.004000|8.004000	0.88535|0.88535	2.767000|2.767000	0.95098|0.95098	0.655000|0.655000	0.94253|0.94253	GGG|GGG	KDM1B	-	pfam_Amino_oxidase	ENSG00000165097		0.448	KDM1B-002	KNOWN	basic|CCDS	protein_coding	KDM1B	HGNC	protein_coding	OTTHUMT00000277080.1	-	0.00	97	0	G	NM_153042		18218058	+1	tier1	-	no_errors	ENST00000388870	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
KIAA0247	9766	genome.wustl.edu	37	14	70170227	70170227	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:70170227G>T	ENST00000342745.4	+	3	550	c.237G>T	c.(235-237)atG>atT	p.M79I		NM_014734.3	NP_055549.1	Q92537	K0247_HUMAN	KIAA0247	79	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)	10				all cancers(60;0.00155)|BRCA - Breast invasive adenocarcinoma(234;0.0164)|OV - Ovarian serous cystadenocarcinoma(108;0.0196)		AAGGCTACATGTTGAAGGGCG	0.552																																																	0													117.0	112.0	114.0					14																	70170227		2203	4300	6503	SO:0001583	missense	0			D87434	CCDS9796.1	14q24.1	2012-11-29			ENSG00000100647	ENSG00000100647			19956	protein-coding gene	gene with protein product						9039502	Standard	NM_014734		Approved		uc001xlk.3	Q92537	OTTHUMG00000171234	ENST00000342745.4:c.237G>T	14.37:g.70170227G>T	ENSP00000344424:p.Met79Ile			Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.M79I	ENST00000342745.4	37	c.237	CCDS9796.1	14	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651379	0.29336	.	.	ENSG00000100647	ENST00000342745	T	0.64438	-0.1	5.9	5.01	0.66863	Complement control module (2);Sushi/SCR/CCP (3);	0.185234	0.64402	D	0.000014	T	0.45094	0.1325	N	0.17674	0.51	0.41365	D	0.987455	B	0.06786	0.001	B	0.04013	0.001	T	0.36672	-0.9738	10	0.09338	T	0.73	-16.6887	15.0275	0.71680	0.068:0.0:0.932:0.0	.	79	Q92537	K0247_HUMAN	I	79	ENSP00000344424:M79I	ENSP00000344424:M79I	M	+	3	0	KIAA0247	69239980	1.000000	0.71417	0.999000	0.59377	0.942000	0.58702	2.760000	0.47581	1.504000	0.48704	-0.136000	0.14681	ATG	KIAA0247	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000100647		0.552	KIAA0247-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0247	HGNC	protein_coding	OTTHUMT00000412453.1	-	0.00	100	0	G	NM_014734		70170227	+1	tier1	-	no_errors	ENST00000342745	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
KIAA0355	9710	genome.wustl.edu	37	19	34818996	34818996	+	Silent	SNP	G	G	A	rs529061184		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:34818996G>A	ENST00000299505.6	+	6	1917	c.1044G>A	c.(1042-1044)tcG>tcA	p.S348S		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	348										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGATAGGATCGCACTTCCTGA	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		16437	0.001		0.0	False		,,,				2504	0.0																0													68.0	68.0	68.0					19																	34818996		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.1044G>A	19.37:g.34818996G>A			Q2M3W4	Silent	SNP	NULL	p.S348	ENST00000299505.6	37	c.1044	CCDS12436.1	19																																																																																			KIAA0355	-	NULL	ENSG00000166398		0.597	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4		0.00	57	0	G	NM_014686		34818996	+1			no_errors	ENST00000299505	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.043	A
KIAA1109	84162	genome.wustl.edu	37	4	123270345	123270345	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:123270345G>A	ENST00000264501.4	+	78	13686	c.13313G>A	c.(13312-13314)cGt>cAt	p.R4438H	KIAA1109_ENST00000388738.3_Missense_Mutation_p.R4438H			Q2LD37	K1109_HUMAN	KIAA1109	4438					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R4438H(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AGCCAGGGCCGTCTGTCAGTA	0.383																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											121.0	123.0	123.0					4																	123270345		1853	4077	5930	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.13313G>A	4.37:g.123270345G>A	ENSP00000264501:p.Arg4438His		Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.R4438H	ENST00000264501.4	37	c.13313	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.2|26.2	4.718733|4.718733	0.89205|0.89205	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755|ENST00000306802	T;T;T|.	0.51817|.	0.69;0.69;0.69|.	5.75|5.75	5.75|5.75	0.90469|0.90469	Fragile site-associated protein, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73289|0.73289	0.3568|0.3568	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	0.999;1.0|.	D;D|.	0.87578|.	0.994;0.998|.	T|T	0.69030|0.69030	-0.5253|-0.5253	10|5	0.49607|.	T|.	0.09|.	.|.	19.9522|19.9522	0.97203|0.97203	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	4437;4438|.	Q2LD37-4;Q2LD37|.	.;K1109_HUMAN|.	H|I	4438;4438;1107;39|814	ENSP00000264501:R4438H;ENSP00000373390:R4438H;ENSP00000410874:R1107H|.	ENSP00000264501:R4438H|.	R|V	+|+	2|1	0|0	KIAA1109|KIAA1109	123489795|123489795	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.995000|0.995000	0.86356|0.86356	8.013000|8.013000	0.88655|0.88655	2.725000|2.725000	0.93324|0.93324	0.655000|0.655000	0.94253|0.94253	CGT|GTC	KIAA1109	-	pfam_Fragile_site-assoc_C	ENSG00000138688		0.383	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1		0.00	60	0	G	NM_020797		123270345	+1			no_errors	ENST00000264501	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	A
KIAA1551	55196	genome.wustl.edu	37	12	32136925	32136925	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:32136925G>A	ENST00000312561.4	+	4	3450	c.3036G>A	c.(3034-3036)tcG>tcA	p.S1012S	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1012																	ATACGTGCTCGTCAGCTGCTA	0.403																																																	0													58.0	56.0	56.0					12																	32136925		2203	4299	6502	SO:0001819	synonymous_variant	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3036G>A	12.37:g.32136925G>A			B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	NULL	p.S1012	ENST00000312561.4	37	c.3036	CCDS8725.2	12																																																																																			KIAA1551	-	NULL	ENSG00000174718		0.403	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	48	0	G	NM_018169		32136925	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.000	A
KIF13A	63971	genome.wustl.edu	37	6	17783895	17783895	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:17783895G>T	ENST00000259711.6	-	29	3631	c.3526C>A	c.(3526-3528)Ctc>Atc	p.L1176I	KIF13A_ENST00000378814.5_Missense_Mutation_p.L1163I|KIF13A_ENST00000378826.2_Missense_Mutation_p.L1176I|KIF13A_ENST00000378843.2_Missense_Mutation_p.L1163I|KIF13A_ENST00000378816.5_Missense_Mutation_p.L1176I	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1176					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCGAGGAAGAGAACTGGTATG	0.318																																																	0													73.0	71.0	72.0					6																	17783895		1819	4070	5889	SO:0001583	missense	0			AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.3526C>A	6.37:g.17783895G>T	ENSP00000259711:p.Leu1176Ile		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1176I	ENST00000259711.6	37	c.3526	CCDS47381.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.31|16.31	3.085874|3.085874	0.55861|0.55861	.|.	.|.	ENSG00000137177|ENSG00000137177	ENST00000358380|ENST00000378814;ENST00000502297;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816;ENST00000506044	.|T;T;T;T;T;T	.|0.73681	.|-0.65;1.59;-0.77;-0.65;-0.65;-0.65	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64472|0.64472	0.2601|0.2601	L|L	0.37630|0.37630	1.12|1.12	0.80722|0.80722	D|D	1|1	.|B;D;B;P	.|0.57571	.|0.234;0.98;0.276;0.907	.|B;P;P;P	.|0.49047	.|0.421;0.599;0.557;0.514	T|T	0.60845|0.60845	-0.7182|-0.7182	5|10	.|0.20046	.|T	.|0.44	.|.	19.3733|19.3733	0.94498|0.94498	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1163;1176;1176;1163	.|Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.|.;.;KI13A_HUMAN;.	L|I	569|1163;180;1176;1176;1163;1176;174	.|ENSP00000368091:L1163I;ENSP00000425616:L180I;ENSP00000259711:L1176I;ENSP00000368103:L1176I;ENSP00000368120:L1163I;ENSP00000368093:L1176I	.|ENSP00000259711:L1176I	F|L	-|-	3|1	2|0	KIF13A|KIF13A	17891874|17891874	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.971000|0.971000	0.66376|0.66376	5.547000|5.547000	0.67249|0.67249	2.667000|2.667000	0.90743|0.90743	0.561000|0.561000	0.74099|0.74099	TTC|CTC	KIF13A	-	pfam_Kinesin-like	ENSG00000137177		0.318	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	-	0.00	60	0	G			17783895	-1	tier1	-	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
KIF2B	84643	genome.wustl.edu	37	17	51901324	51901324	+	Silent	SNP	G	G	A	rs139246128		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:51901324G>A	ENST00000268919.4	+	1	1086	c.930G>A	c.(928-930)acG>acA	p.T310T		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	310	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T310T(1)		NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTGGGAAGACGTACACCATGG	0.547																																																	1	Substitution - coding silent(1)	urinary_tract(1)						G		1,4405	2.1+/-5.4	0,1,2202	100.0	93.0	95.0		930	-10.6	0.6	17	dbSNP_134	95	0,8600		0,0,4300	no	coding-synonymous	KIF2B	NM_032559.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		310/674	51901324	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.930G>A	17.37:g.51901324G>A			Q96MA2|Q9BXG6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T310	ENST00000268919.4	37	c.930	CCDS32685.1	17																																																																																			KIF2B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000141200		0.547	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1		0.00	38	0	G	NM_032559		51901324	+1			no_errors	ENST00000268919	ensembl	human	known	74_37	silent	7.14	39	3	SNP	0.357	A
KIRREL3	84623	genome.wustl.edu	37	11	126310353	126310353	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:126310353C>A	ENST00000525144.2	-	11	1593	c.1344G>T	c.(1342-1344)ccG>ccT	p.P448P	KIRREL3_ENST00000525704.2_Silent_p.P448P|KIRREL3_ENST00000529097.2_Silent_p.P448P|KIRREL3_ENST00000416561.2_5'UTR	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	448	Ig-like C2-type 5.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CGATGCGGTCCGGCGGCGGCG	0.677																																																	0													14.0	17.0	16.0					11																	126310353		1884	4090	5974	SO:0001819	synonymous_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.1344G>T	11.37:g.126310353C>A			Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P448	ENST00000525144.2	37	c.1344	CCDS53723.1	11																																																																																			KIRREL3	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000149571		0.677	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2		0.00	51	0	C	NM_032531		126310353	-1			no_errors	ENST00000525144	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.044	A
LAMA1	284217	genome.wustl.edu	37	18	6948417	6948417	+	Missense_Mutation	SNP	C	C	T	rs369240094		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:6948417C>T	ENST00000389658.3	-	60	8788	c.8695G>A	c.(8695-8697)Gga>Aga	p.G2899R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2899	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCTGCATATCCGCTTCCGTCA	0.517																																																	0								C	ARG/GLY	1,4405	2.1+/-5.4	0,1,2202	168.0	112.0	131.0		8695	5.7	1.0	18		131	0,8600		0,0,4300	no	missense	LAMA1	NM_005559.3	125	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2899/3076	6948417	1,13005	2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8695G>A	18.37:g.6948417C>T	ENSP00000374309:p.Gly2899Arg			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G2899R	ENST00000389658.3	37	c.8695	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403632	0.62288	2.27E-4	0.0	ENSG00000101680	ENST00000389658	T	0.50813	0.73	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.066420	0.64402	D	0.000017	T	0.76463	0.3991	M	0.90019	3.08	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.80867	-0.1190	10	0.87932	D	0	.	19.8388	0.96673	0.0:1.0:0.0:0.0	.	2899;229	P25391;B3KSD8	LAMA1_HUMAN;.	R	2899	ENSP00000374309:G2899R	ENSP00000374309:G2899R	G	-	1	0	LAMA1	6938417	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	6.688000	0.74557	2.695000	0.91970	0.561000	0.74099	GGA	LAMA1	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000101680		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	60	0	C	NM_005559		6948417	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	34.38	42	22	SNP	1.000	T
LAMC3	10319	genome.wustl.edu	37	9	133967312	133967313	+	3'UTR	INS	-	-	CC	rs386416363		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:133967312_133967313insCC	ENST00000361069.4	+	0	4999_5000				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		GTGGATAGTCACTCCCTGCCGA	0.594																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*139->CC	9.37:g.133967312_133967313insCC			B1APX9|B1APY0|Q59H72	RNA	INS	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9																																																																																			LAMC3	-	-	ENSG00000050555		0.594	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3		0.00	22	0	-	NM_006059		133967313	+1	tier1		no_errors	ENST00000462567	ensembl	human	known	74_37	rna	13.79	25	4	INS	0.001:0.000	CC
LCE4A	199834	genome.wustl.edu	37	1	152681755	152681755	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:152681755C>A	ENST00000368777.1	+	2	460	c.204C>A	c.(202-204)tcC>tcA	p.S68S	LCE4A_ENST00000335535.3_Silent_p.S68S			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	68	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			ACCATAGGTCCCACTGCCACA	0.622																																																	0													50.0	57.0	55.0					1																	152681755		2203	4300	6503	SO:0001819	synonymous_variant	0			BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	ENST00000368777.1:c.204C>A	1.37:g.152681755C>A			Q14D97	Silent	SNP	NULL	p.S68	ENST00000368777.1	37	c.204	CCDS1022.1	1																																																																																			LCE4A	-	NULL	ENSG00000187170		0.622	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE4A	HGNC	protein_coding	OTTHUMT00000040048.1	-	0.00	51	0	C	NM_178356		152681755	+1	tier1	-	no_errors	ENST00000335535	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.000	A
LCT	3938	genome.wustl.edu	37	2	136570244	136570244	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:136570244G>T	ENST00000264162.2	-	7	2000	c.1990C>A	c.(1990-1992)Ccc>Acc	p.P664T	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	664	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GTGAACTCGGGGAGTTGAGCC	0.557																																																	0													121.0	109.0	113.0					2																	136570244		2203	4300	6503	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1990C>A	2.37:g.136570244G>T	ENSP00000264162:p.Pro664Thr		Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.P664T	ENST00000264162.2	37	c.1990	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239053	0.58995	.	.	ENSG00000115850	ENST00000264162;ENST00000455227	T	0.74632	-0.86	5.49	5.49	0.81192	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.312597	0.35585	N	0.003120	D	0.90594	0.7051	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92862	0.6306	10	0.87932	D	0	-17.8491	19.3929	0.94592	0.0:0.0:1.0:0.0	.	664	P09848	LPH_HUMAN	T	664;96	ENSP00000264162:P664T	ENSP00000264162:P664T	P	-	1	0	LCT	136286714	1.000000	0.71417	1.000000	0.80357	0.064000	0.16182	9.869000	0.99810	2.583000	0.87209	0.655000	0.94253	CCC	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.557	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1		0.00	68	0	G	NM_002299		136570244	-1			no_errors	ENST00000264162	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
LIMA1	51474	genome.wustl.edu	37	12	50616100	50616100	+	Missense_Mutation	SNP	C	C	T	rs146061384		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:50616100C>T	ENST00000341247.4	-	4	483	c.334G>A	c.(334-336)Gct>Act	p.A112T	LIMA1_ENST00000552783.1_5'UTR|LIMA1_ENST00000394943.3_Missense_Mutation_p.A112T|RP3-405J10.4_ENST00000551284.1_RNA|LIMA1_ENST00000552909.1_5'UTR|LIMA1_ENST00000552823.1_5'UTR|LIMA1_ENST00000552008.1_5'Flank	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	112					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.A112T(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CCAGAAGCAGCGTGGCTTGTC	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)						C	THR/ALA,,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	211.0	156.0	175.0		334,,334	-10.5	0.0	12	dbSNP_134	175	0,8600		0,0,4300	no	missense,utr-5,missense	LIMA1	NM_001113546.1,NM_001113547.1,NM_016357.4	58,,58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,,benign	112/761,,112/760	50616100	1,13005	2203	4300	6503	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.334G>A	12.37:g.50616100C>T	ENSP00000340184:p.Ala112Thr		B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A112T	ENST00000341247.4	37	c.334	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	C	0.101	-1.152724	0.01700	2.27E-4	0.0	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000551691	D;T	0.84516	-1.86;-1.12	5.65	-10.5	0.00291	.	1.190080	0.05873	N	0.624944	T	0.51822	0.1697	N	0.02539	-0.55	0.24168	N	0.995635	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.50558	-0.8814	10	0.07990	T	0.79	.	1.589	0.02650	0.2015:0.3405:0.2276:0.2303	.	121;112	Q59FE8;Q9UHB6	.;LIMA1_HUMAN	T	112	ENSP00000378400:A112T;ENSP00000340184:A112T	ENSP00000340184:A112T	A	-	1	0	LIMA1	48902367	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.574000	0.05868	-1.498000	0.01824	-1.202000	0.01658	GCT	LIMA1	-	NULL	ENSG00000050405		0.552	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2		0.00	62	0	C	NM_016357		50616100	-1			no_errors	ENST00000394943	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.000	T
LINC00242	401288	genome.wustl.edu	37	6	170190616	170190616	+	lincRNA	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:170190616G>T	ENST00000437615.1	-	0	687				LINC00574_ENST00000420557.2_lincRNA	NR_026781.1		Q5T6M2	CF122_HUMAN	long intergenic non-protein coding RNA 242																		TGACCAGTGGGGTCTCCATCC	0.592											OREG0017803	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													97.0	90.0	92.0					6																	170190616		692	1591	2283			0			AK056013		6q28	2012-10-12	2011-08-11	2011-08-11	ENSG00000229214	ENSG00000229214		"""Long non-coding RNAs"""	21249	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 122"", ""non-protein coding RNA 242"""	C6orf122, NCRNA00242			Standard	NR_026781		Approved	FLJ31451, dJ266L20.5	uc003qxj.1	Q5T6M2	OTTHUMG00000016064		6.37:g.170190616G>T		1883	Q0VD89|Q96N37	RNA	SNP	-	NULL	ENST00000437615.1	37	NULL		6																																																																																			LINC00242	-	-	ENSG00000229214		0.592	LINC00242-001	KNOWN	basic	lincRNA	LINC00242	HGNC	lincRNA	OTTHUMT00000043231.2	-	0.00	49	0	G	NR_026781		170190616	-1	tier1	-	no_errors	ENST00000437615	ensembl	human	known	74_37	rna	6.56	57	4	SNP	0.001	T
MAML3	55534	genome.wustl.edu	37	4	141055513	141055513	+	Intron	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:141055513C>A	ENST00000509479.2	-	1	1325				RP11-392B6.1_ENST00000509184.1_RNA	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					AAAACAGAACCCCAATCATTT	0.443																																																	0																																										SO:0001627	intron_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.468+18500G>T	4.37:g.141055513C>A				RNA	SNP	-	NULL	ENST00000509479.2	37	NULL	CCDS54805.1	4																																																																																			RP11-392B6.1	-	-	ENSG00000250698		0.443	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927516	Clone_based_vega_gene	protein_coding	OTTHUMT00000364934.2	-	0.00	56	0	C			141055513	+1	tier1	-	no_errors	ENST00000509184	ensembl	human	known	74_37	rna	10.00	45	5	SNP	0.000	A
MTMR3	8897	genome.wustl.edu	37	22	30405136	30405136	+	Intron	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:30405136G>T	ENST00000401950.2	+	12	1463				MTMR3_ENST00000406629.1_Intron|MTMR3_ENST00000333027.3_Intron|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000351488.3_Intron|MTMR3_ENST00000323630.5_Intron	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3						peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CTTGGCCTTGGCTTTCATTTT	0.403																																																	0													98.0	94.0	95.0					22																	30405136		2203	4300	6503	SO:0001627	intron_variant	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1121+18G>T	22.37:g.30405136G>T			A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	RNA	SNP	-	NULL	ENST00000401950.2	37	NULL	CCDS13870.1	22																																																																																			CTA-85E5.10	-	-	ENSG00000227117		0.403	MTMR3-001	KNOWN	basic|CCDS	protein_coding	LOC101929664	Clone_based_vega_gene	protein_coding	OTTHUMT00000322066.1	-	0.00	55	0	G	NM_021090		30405136	-1	tier1	-	no_errors	ENST00000429350	ensembl	human	known	74_37	rna	6.67	56	4	SNP	0.000	T
POTEG	404785	genome.wustl.edu	37	14	19563232	19563232	+	Intron	SNP	T	T	C	rs572050981	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:19563232T>C	ENST00000409832.3	+	5	969				CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CCCTTCCTTTTAACCTTGGTG	0.368													C|||	234	0.0467252	0.0371	0.0375	5008	,	,		9293	0.0575		0.0646	False		,,,				2504	0.0368																0																																										SO:0001627	intron_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.918-172T>C	14.37:g.19563232T>C			A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			CTD-2311B13.5	-	-	ENSG00000258252		0.368	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	-	0.00	35	0	T	NM_001005356		19563232	-1	tier1	-	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.050	C
LRRC74B	400891	genome.wustl.edu	37	22	21409444	21409444	+	Frame_Shift_Del	DEL	C	C	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:21409444delC	ENST00000342608.4	+	7	933	c.906delC	c.(904-906)aacfs	p.N302fs	AC002472.13_ENST00000543388.1_3'UTR|AC002472.13_ENST00000497328.1_3'UTR																lung(2)	2						TCCGGGTCAACCAGACGCTGA	0.567																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000342608.4:c.906delC	22.37:g.21409444delC	ENSP00000341179:p.Asn302fs			Frame_Shift_Del	DEL	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.Q303fs	ENST00000342608.4	37	c.906		22																																																																																			AC002472.13	-	NULL	ENSG00000187905		0.567	AC002472.13-201	KNOWN	basic|appris_principal	protein_coding	LOC400891	Clone_based_vega_gene	protein_coding			0.00	23	0	C			21409444	+1	tier1		no_errors	ENST00000342608	ensembl	human	known	74_37	frame_shift_del	28.57	5	2	DEL	1.000	-
LPCAT3	10162	genome.wustl.edu	37	12	7088683	7088683	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:7088683G>T	ENST00000261407.4	-	7	821	c.736C>A	c.(736-738)Ctg>Atg	p.L246M	LPCAT3_ENST00000535021.1_5'UTR|U47924.30_ENST00000606112.1_lincRNA	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	246					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						GGGCTGAGCAGTGTGTAGCCC	0.512																																																	0													128.0	104.0	112.0					12																	7088683		2203	4300	6503	SO:0001583	missense	0			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.736C>A	12.37:g.7088683G>T	ENSP00000261407:p.Leu246Met		B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	pfam_MBOAT_fam	p.L246M	ENST00000261407.4	37	c.736	CCDS8572.1	12	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294202	0.40594	.	.	ENSG00000111684	ENST00000261407	T	0.73363	-0.74	5.49	4.58	0.56647	.	0.309234	0.31624	N	0.007325	T	0.69223	0.3087	M	0.72118	2.19	0.36778	D	0.884198	B	0.31125	0.309	B	0.24701	0.055	T	0.72956	-0.4134	10	0.52906	T	0.07	-13.8226	8.7571	0.34652	0.0825:0.4375:0.48:0.0	.	246	Q6P1A2	MBOA5_HUMAN	M	246	ENSP00000261407:L246M	ENSP00000261407:L246M	L	-	1	2	LPCAT3	6958944	0.336000	0.24757	0.979000	0.43373	0.985000	0.73830	0.614000	0.24314	1.267000	0.44247	0.655000	0.94253	CTG	LPCAT3	-	pfam_MBOAT_fam	ENSG00000111684		0.512	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	HGNC	protein_coding	OTTHUMT00000401812.1	-	0.00	40	0	G	NM_005768		7088683	-1	tier1	-	no_errors	ENST00000261407	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.598	T
LRP2	4036	genome.wustl.edu	37	2	170053495	170053495	+	Missense_Mutation	SNP	C	C	T	rs369195059	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:170053495C>T	ENST00000263816.3	-	46	8909	c.8624G>A	c.(8623-8625)cGc>cAc	p.R2875H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2875	LDL-receptor class A 20. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AGGAATACAGCGCCCAGATGC	0.458													C|||	2	0.000399361	0.0	0.0	5008	,	,		21657	0.002		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	101.0	88.0	92.0		8624	2.4	0.1	2		92	0,8600		0,0,4300	no	missense	LRP2	NM_004525.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2875/4656	170053495	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8624G>A	2.37:g.170053495C>T	ENSP00000263816:p.Arg2875His		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R2875H	ENST00000263816.3	37	c.8624	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400954	0.62177	2.27E-4	0.0	ENSG00000081479	ENST00000263816	D	0.96041	-3.89	6.17	2.42	0.29668	.	0.143639	0.64402	N	0.000004	D	0.96281	0.8787	L	0.61218	1.895	0.09310	N	0.999999	D	0.89917	1.0	D	0.70716	0.97	D	0.90887	0.4758	10	0.72032	D	0.01	.	9.2708	0.37670	0.0:0.6407:0.2359:0.1234	.	2875	P98164	LRP2_HUMAN	H	2875	ENSP00000263816:R2875H	ENSP00000263816:R2875H	R	-	2	0	LRP2	169761741	0.786000	0.28738	0.057000	0.19452	0.721000	0.41392	0.828000	0.27435	0.176000	0.19873	0.655000	0.94253	CGC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2		0.00	80	0	C	NM_004525		170053495	-1			no_errors	ENST00000263816	ensembl	human	known	74_37	missense	6.35	58	4	SNP	0.007	T
LRRC3C	100505591	genome.wustl.edu	37	17	38100505	38100505	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:38100505G>A	ENST00000377924.4	+	2	396	c.346G>A	c.(346-348)Gcc>Acc	p.A116T		NM_001195545.1	NP_001182474.1	A6NJW4	LRR3C_HUMAN	leucine rich repeat containing 3C	116						integral component of membrane (GO:0016021)				breast(1)	1						TAATGCCCTTGCCCACCTCTC	0.632																																																	0																																										SO:0001583	missense	0				CCDS54121.1	17q12-21.1	2011-05-05			ENSG00000204913	ENSG00000204913			40034	protein-coding gene	gene with protein product							Standard	NM_001195545		Approved		uc021twv.1	A6NJW4		ENST00000377924.4:c.346G>A	17.37:g.38100505G>A	ENSP00000367157:p.Ala116Thr			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A116T	ENST00000377924.4	37	c.346	CCDS54121.1	17	.	.	.	.	.	.	.	.	.	.	G	10.44	1.351551	0.24512	.	.	ENSG00000204913	ENST00000377924	T	0.54279	0.58	4.65	3.66	0.41972	.	0.640222	0.15887	N	0.239750	T	0.25717	0.0626	N	0.02842	-0.48	0.09310	N	1	.	.	.	.	.	.	T	0.11665	-1.0578	8	0.14656	T	0.56	-6.3248	10.5155	0.44887	0.1564:0.0:0.8436:0.0	.	.	.	.	T	116	ENSP00000367157:A116T	ENSP00000367157:A116T	A	+	1	0	LRRC3C	35354031	0.000000	0.05858	0.996000	0.52242	0.977000	0.68977	0.811000	0.27198	2.398000	0.81561	0.561000	0.74099	GCC	LRRC3C	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000204913		0.632	LRRC3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC3C	HGNC	protein_coding	OTTHUMT00000446846.1	-	0.00	49	0	G			38100505	+1	tier1	-	no_errors	ENST00000377924	ensembl	human	known	74_37	missense	11.33	179	23	SNP	0.014	A
LTF	4057	genome.wustl.edu	37	3	46497888	46497888	+	Splice_Site	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:46497888C>T	ENST00000231751.4	-	3	503	c.208G>A	c.(208-210)Gaa>Aaa	p.E70K	LTF_ENST00000417439.1_Splice_Site_p.E70K|LTF_ENST00000426532.2_Splice_Site_p.E26K	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	70	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)	p.E70K(1)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		GCCCTGTTTTCCTGAAAGTAA	0.552																																																	1	Substitution - Missense(1)	skin(1)											51.0	51.0	51.0					3																	46497888		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.208-1G>A	3.37:g.46497888C>T			A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.E70K	ENST00000231751.4	37	c.208	CCDS33747.1	3	.	.	.	.	.	.	.	.	.	.	C	4.860	0.159899	0.09287	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496;ENST00000443743;ENST00000431944;ENST00000415180	T;T;T;T;T;T	0.34472	2.62;2.62;2.62;2.62;1.36;1.36	4.49	-3.43	0.04810	.	1.659760	0.03029	N	0.151847	T	0.18509	0.0444	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.19583	0.002;0.037;0.002	B;B;B	0.25987	0.013;0.065;0.013	T	0.16748	-1.0392	10	0.15499	T	0.54	-16.1431	6.7423	0.23443	0.1247:0.3087:0.0:0.5666	.	70;57;70	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	K	70;26;70;57;70;81;26	ENSP00000231751:E70K;ENSP00000405719:E26K;ENSP00000405546:E70K;ENSP00000397427:E57K;ENSP00000395234:E81K;ENSP00000400254:E26K	ENSP00000231751:E70K	E	-	1	0	LTF	46472892	0.000000	0.05858	0.002000	0.10522	0.026000	0.11368	-0.733000	0.04898	-0.943000	0.03691	-0.137000	0.14449	GAA	LTF	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	ENSG00000012223		0.552	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2		0.00	76	0	C	NM_002343	Missense_Mutation	46497888	-1			no_errors	ENST00000231751	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.007	T
LZTR1	8216	genome.wustl.edu	37	22	21350282	21350282	+	Missense_Mutation	SNP	G	G	T	rs373975296		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:21350282G>T	ENST00000215739.8	+	18	2459	c.2100G>T	c.(2098-2100)atG>atT	p.M700I	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Missense_Mutation_p.M681I	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	700	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			GGTCCTTCATGCCCGAAGATG	0.597																																																	0								G	ILE/MET	0,4406		0,0,2203	99.0	86.0	90.0		2100	5.7	1.0	22		90	1,8599	1.2+/-3.3	0,1,4299	no	missense	LZTR1	NM_006767.3	10	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	probably-damaging	700/841	21350282	1,13005	2203	4300	6503	SO:0001583	missense	0			D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.2100G>T	22.37:g.21350282G>T	ENSP00000215739:p.Met700Ile		Q14776|Q20WK0	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_Kelch_1,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.M700I	ENST00000215739.8	37	c.2100	CCDS33606.1	22	.	.	.	.	.	.	.	.	.	.	G	35	5.443165	0.96187	0.0	1.16E-4	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.71341	-0.56;-0.56	5.71	5.71	0.89125	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.86201	0.5876	M	0.87269	2.87	0.80722	D	1	D;D;D;P	0.69078	0.993;0.985;0.997;0.908	P;D;D;D	0.72338	0.877;0.977;0.967;0.922	D	0.87961	0.2730	10	0.72032	D	0.01	-43.0044	17.337	0.87285	0.0:0.0:1.0:0.0	.	681;412;700;659	B7Z3T9;B2R8T5;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	I	659;700;681	ENSP00000215739:M700I;ENSP00000374006:M681I	ENSP00000215739:M700I	M	+	3	0	LZTR1	19680282	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.798000	0.99111	2.700000	0.92200	0.462000	0.41574	ATG	LZTR1	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000099949		0.597	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTR1	HGNC	protein_coding	OTTHUMT00000320387.1		0.00	44	0	G	NM_006767		21350282	+1			no_errors	ENST00000215739	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
MAGEE1	57692	genome.wustl.edu	37	X	75648431	75648431	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:75648431C>T	ENST00000361470.2	+	1	386	c.108C>T	c.(106-108)ctC>ctT	p.L36L		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	36						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCCCCGGTCTCCCCGCTGATG	0.672																																																	0													21.0	19.0	20.0					X																	75648431		2146	4210	6356	SO:0001819	synonymous_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.108C>T	X.37:g.75648431C>T			Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L36	ENST00000361470.2	37	c.108	CCDS14433.1	X																																																																																			MAGEE1	-	NULL	ENSG00000198934		0.672	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	95	0	C	NM_020932		75648431	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	silent	72.86	19	51	SNP	0.001	T
MAPK15	225689	genome.wustl.edu	37	8	144801009	144801009	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:144801009C>T	ENST00000338033.4	+	5	470	c.351C>T	c.(349-351)atC>atT	p.I117I	MAPK15_ENST00000395107.4_Silent_p.I134I|RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Silent_p.I117I	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	117	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TGCGCTCCATCTTCTACCAGC	0.687																																																	0													23.0	25.0	24.0					8																	144801009		2203	4300	6503	SO:0001819	synonymous_variant	0			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.351C>T	8.37:g.144801009C>T			Q2TCF9|Q8N362	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.I117	ENST00000338033.4	37	c.351	CCDS6409.2	8																																																																																			MAPK15	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000181085		0.687	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1		0.00	10	0	C	NM_139021		144801009	+1			no_errors	ENST00000338033	ensembl	human	known	74_37	silent	17.86	23	5	SNP	0.998	T
MAPK15	225689	genome.wustl.edu	37	8	144801012	144801012	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:144801012C>T	ENST00000338033.4	+	5	473	c.354C>T	c.(352-354)ttC>ttT	p.F118F	MAPK15_ENST00000395107.4_Silent_p.F135F|RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Silent_p.F118F	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	118	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GCTCCATCTTCTACCAGCTCC	0.687																																																	0													23.0	25.0	24.0					8																	144801012		2203	4300	6503	SO:0001819	synonymous_variant	0			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.354C>T	8.37:g.144801012C>T			Q2TCF9|Q8N362	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F118	ENST00000338033.4	37	c.354	CCDS6409.2	8																																																																																			MAPK15	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000181085		0.687	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1		0.00	10	0	C	NM_139021		144801012	+1			no_errors	ENST00000338033	ensembl	human	known	74_37	silent	22.22	20	6	SNP	0.980	T
MAPK15	225689	genome.wustl.edu	37	8	144802413	144802413	+	Silent	SNP	C	C	T	rs147473272		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:144802413C>T	ENST00000338033.4	+	8	854	c.735C>T	c.(733-735)ctC>ctT	p.L245L	MAPK15_ENST00000395107.4_Silent_p.L262L|RP11-429J17.5_ENST00000527908.1_RNA|MAPK15_ENST00000395108.2_Intron	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	245	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TCCTGGCTCTCGGCTCAGGCT	0.682																																																	0								C		1,4393		0,1,2196	25.0	23.0	24.0		735	-6.0	0.0	8	dbSNP_134	24	0,8582		0,0,4291	no	coding-synonymous	MAPK15	NM_139021.2		0,1,6487	TT,TC,CC		0.0,0.0228,0.0077		245/545	144802413	1,12975	2197	4291	6488	SO:0001819	synonymous_variant	0			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.735C>T	8.37:g.144802413C>T			Q2TCF9|Q8N362	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L245	ENST00000338033.4	37	c.735	CCDS6409.2	8																																																																																			MAPK15	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000181085		0.682	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1	-	0.00	37	0	C	NM_139021		144802413	+1	tier1	rs147473272	no_errors	ENST00000338033	ensembl	human	known	74_37	silent	30.95	58	26	SNP	0.054	T
MAPK8IP3	23162	genome.wustl.edu	37	16	1817269	1817269	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:1817269G>C	ENST00000250894.4	+	26	3362	c.3205G>C	c.(3205-3207)Gtc>Ctc	p.V1069L	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.V1063L	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1069					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CAAGGTGCACGTCATCCAGCC	0.622																																																	0													74.0	83.0	80.0					16																	1817269		2132	4240	6372	SO:0001583	missense	0			AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3205G>C	16.37:g.1817269G>C	ENSP00000250894:p.Val1069Leu		A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.V1069L	ENST00000250894.4	37	c.3205	CCDS10442.2	16	.	.	.	.	.	.	.	.	.	.	G	25.2	4.615650	0.87359	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.73469	-0.75;-0.75	4.03	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.068055	0.64402	D	0.000016	D	0.86322	0.5905	M	0.83312	2.635	0.80722	D	1	P;P;D	0.63046	0.878;0.912;0.992	P;P;D	0.68765	0.715;0.733;0.96	D	0.89242	0.3584	10	0.87932	D	0	-39.373	16.1662	0.81757	0.0:0.0:1.0:0.0	.	1070;1063;1069	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	L	1069;1063	ENSP00000250894:V1069L;ENSP00000348290:V1063L	ENSP00000250894:V1069L	V	+	1	0	MAPK8IP3	1757270	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	7.780000	0.85658	1.976000	0.57569	0.591000	0.81541	GTC	MAPK8IP3	-	superfamily_WD40_repeat_dom	ENSG00000138834		0.622	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP3	HGNC	protein_coding	OTTHUMT00000250508.2	-	0.00	152	0	G	NM_001040439		1817269	+1	tier1	-	no_errors	ENST00000250894	ensembl	human	known	74_37	missense	30.00	90	39	SNP	1.000	C
MDFIC	29969	genome.wustl.edu	37	7	114619652	114619652	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:114619652G>T	ENST00000393486.1	+	4	899	c.309G>T	c.(307-309)ctG>ctT	p.L103L	MDFIC_ENST00000257724.3_Silent_p.L212L	NM_001166345.1|NM_199072.4	NP_001159817.1|NP_951038.1			MyoD family inhibitor domain containing											breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	8						ACACAGGTCTGAGCAATGGAA	0.468																																																	0													90.0	87.0	88.0					7																	114619652		2203	4300	6503	SO:0001819	synonymous_variant	0			AF054589	CCDS34737.1, CCDS55155.1	7q31.1-q31.2	2006-01-11			ENSG00000135272	ENSG00000135272			28870	protein-coding gene	gene with protein product		614511				10671520	Standard	NM_199072		Approved	HIC	uc003vhf.3	Q9P1T7	OTTHUMG00000023647	ENST00000393486.1:c.309G>T	7.37:g.114619652G>T				Silent	SNP	NULL	p.L103	ENST00000393486.1	37	c.309	CCDS55155.1	7																																																																																			MDFIC	-	NULL	ENSG00000135272		0.468	MDFIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDFIC	HGNC	protein_coding	OTTHUMT00000059968.4		0.00	83	0	G	NM_199072		114619652	+1			no_errors	ENST00000393486	ensembl	human	known	74_37	silent	5.75	82	5	SNP	1.000	T
MED4	29079	genome.wustl.edu	37	13	48654029	48654029	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr13:48654029G>T	ENST00000258648.2	-	6	616	c.591C>A	c.(589-591)ggC>ggA	p.G197G	MED4_ENST00000378586.1_Silent_p.G151G|MED4_ENST00000495013.1_5'UTR|MED4-AS1_ENST00000422483.1_RNA	NM_014166.3	NP_054885.1	Q9NPJ6	MED4_HUMAN	mediator complex subunit 4	197					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)	8		all_cancers(8;2.93e-25)|all_epithelial(8;4.38e-13)|all_lung(13;7.37e-06)|all_hematologic(8;8.61e-05)|Breast(56;0.000141)|Lung NSC(96;0.000518)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.00559)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;5.18e-07)		GGCCATTCACGCCATTAGTGG	0.463																																					Pancreas(38;399 1016 9170 13426 20145)												0													138.0	121.0	127.0					13																	48654029		2203	4300	6503	SO:0001819	synonymous_variant	0			AF161475	CCDS9408.1, CCDS59241.1	13q14.12	2008-02-05	2007-07-30	2004-11-09	ENSG00000136146	ENSG00000136146			17903	protein-coding gene	gene with protein product		605718	"""vitamin D receptor interacting protein"", ""mediator of RNA polymerase II transcription, subunit 4 homolog (S. cerevisiae)"""	VDRIP		10235266, 11042152	Standard	NM_014166		Approved	HSPC126, DRIP36, TRAP36	uc001vby.2	Q9NPJ6	OTTHUMG00000016891	ENST00000258648.2:c.591C>A	13.37:g.48654029G>T			B4DX67|Q53GB4|Q53H68|Q5T912|Q6FHC4|Q6IA79|Q9BS95|Q9NYR5	Silent	SNP	pfam_Mediator_Med4	p.G197	ENST00000258648.2	37	c.591	CCDS9408.1	13																																																																																			MED4	-	pfam_Mediator_Med4	ENSG00000136146		0.463	MED4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED4	HGNC	protein_coding	OTTHUMT00000044863.1		0.00	92	0	G	NM_014166		48654029	-1			no_errors	ENST00000258648	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.833	T
MEX3C	51320	genome.wustl.edu	37	18	48703496	48703496	+	5'UTR	SNP	T	T	C	rs533957172		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:48703496T>C	ENST00000591040.1	-	0	493							Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		ATTCTCTTCATTGAGCTCTAT	0.468													T|||	1	0.000199681	0.0	0.0	5008	,	,		21983	0.0		0.001	False		,,,				2504	0.0																0													118.0	110.0	113.0					18																	48703496		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.-306A>G	18.37:g.48703496T>C			A1L022|Q9NZE3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.N402S	ENST00000591040.1	37	c.1205		18	.	.	.	.	.	.	.	.	.	.	T	9.339	1.062624	0.19987	.	.	ENSG00000176624	ENST00000406189	T	0.42131	0.98	5.97	5.97	0.96955	.	0.094112	0.64402	D	0.000001	T	0.23688	0.0573	N	0.19112	0.55	0.34681	D	0.724726	P	0.43788	0.817	B	0.33454	0.164	T	0.29701	-1.0003	10	0.09084	T	0.74	-11.2377	15.4434	0.75208	0.0:0.0:0.0:1.0	.	402	Q5U5Q3	MEX3C_HUMAN	S	402	ENSP00000385610:N402S	ENSP00000385610:N402S	N	-	2	0	MEX3C	46957494	0.957000	0.32711	1.000000	0.80357	0.977000	0.68977	1.636000	0.37144	2.288000	0.76882	0.533000	0.62120	AAT	MEX3C	-	NULL	ENSG00000176624		0.468	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	HGNC	protein_coding	OTTHUMT00000449559.1	-	0.00	43	0	T	NM_016626		48703496	-1	tier1	-	no_errors	ENST00000406189	ensembl	human	known	74_37	missense	32.79	41	20	SNP	0.997	C
MLF2	8079	genome.wustl.edu	37	12	6859859	6859859	+	Intron	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:6859859G>T	ENST00000203630.5	-	5	915				MLF2_ENST00000539187.1_Intron|MLF2_ENST00000542154.1_Intron|MLF2_ENST00000564181.1_5'UTR|MLF2_ENST00000435120.1_Intron			Q15773	MLF2_HUMAN	myeloid leukemia factor 2						defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						GGCCGGGGAAGGGTATGGGGC	0.473																																																	0													144.0	114.0	124.0					12																	6859859		2203	4300	6503	SO:0001627	intron_variant	0			U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.270+19C>A	12.37:g.6859859G>T				RNA	SNP	-	NULL	ENST00000203630.5	37	NULL	CCDS8559.1	12																																																																																			MLF2	-	-	ENSG00000089693		0.473	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLF2	HGNC	protein_coding	OTTHUMT00000400733.2	-	0.00	39	0	G			6859859	-1	tier1	-	no_errors	ENST00000564181	ensembl	human	known	74_37	rna	6.78	55	4	SNP	0.000	T
MMEL1	79258	genome.wustl.edu	37	1	2542738	2542738	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:2542738G>A	ENST00000378412.3	-	4	435	c.274C>T	c.(274-276)Cct>Tct	p.P92S	MMEL1_ENST00000502556.1_Missense_Mutation_p.P92S|MMEL1_ENST00000288709.6_Missense_Mutation_p.P83S			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	92						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		ACGCAGCCAGGGGTGGTGCAG	0.701																																																	0													20.0	18.0	18.0					1																	2542738		2194	4294	6488	SO:0001583	missense	0			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.274C>T	1.37:g.2542738G>A	ENSP00000367668:p.Pro92Ser		B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.P92S	ENST00000378412.3	37	c.274	CCDS30569.2	1	.	.	.	.	.	.	.	.	.	.	g	8.869	0.948927	0.18356	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.83163	-1.69;-1.69;-1.69	4.07	4.07	0.47477	.	0.389700	0.26792	N	0.022477	T	0.73473	0.3591	L	0.46885	1.475	0.43508	D	0.995766	B	0.29590	0.25	B	0.26202	0.067	T	0.66988	-0.5784	10	0.10111	T	0.7	-7.4798	11.1319	0.48351	0.0:0.0:0.8154:0.1846	.	92	Q495T6	MMEL1_HUMAN	S	92;83;92;92	ENSP00000288709:P83S;ENSP00000367668:P92S;ENSP00000422492:P92S	ENSP00000288709:P83S	P	-	1	0	MMEL1	2532598	1.000000	0.71417	0.975000	0.42487	0.065000	0.16274	2.213000	0.42844	2.267000	0.75376	0.442000	0.29010	CCT	MMEL1	-	NULL	ENSG00000142606		0.701	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	-	0.00	21	0	G	NM_033467		2542738	-1	tier1	-	no_errors	ENST00000378412	ensembl	human	known	74_37	missense	50.00	10	11	SNP	0.989	A
MON2	23041	genome.wustl.edu	37	12	62960230	62960230	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:62960230G>T	ENST00000393632.2	+	29	4714	c.4323G>T	c.(4321-4323)aaG>aaT	p.K1441N	MON2_ENST00000546600.1_Splice_Site_p.K1441N|MON2_ENST00000393629.2_Splice_Site_p.K1435N|MON2_ENST00000552738.1_Splice_Site_p.K1412N|MON2_ENST00000280379.6_Splice_Site_p.K1442N|MON2_ENST00000393630.3_Splice_Site_p.K1442N	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1441					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		ATATTATTAAGGTATCTTTTT	0.308																																																	0													79.0	88.0	85.0					12																	62960230		2201	4300	6501	SO:0001630	splice_region_variant	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4323+1G>T	12.37:g.62960230G>T			A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold	p.K1442N	ENST00000393632.2	37	c.4326	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	13.09	2.132747	0.37630	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.59224	0.28;0.28;0.28;0.28;0.28;0.28	5.05	5.05	0.67936	.	0.164583	0.50627	D	0.000117	T	0.52980	0.1768	L	0.47190	1.495	0.80722	D	1	B;B;B;B;B	0.21071	0.03;0.051;0.051;0.017;0.043	B;B;B;B;B	0.26693	0.033;0.072;0.072;0.024;0.072	T	0.47420	-0.9119	9	.	.	.	-13.8961	16.9447	0.86227	0.0:0.0:1.0:0.0	.	1435;1412;1441;310;1441	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	N	1441;1442;1442;1441;1412;1435	ENSP00000377252:K1441N;ENSP00000377250:K1442N;ENSP00000280379:K1442N;ENSP00000447407:K1441N;ENSP00000449215:K1412N;ENSP00000377249:K1435N	.	K	+	3	2	MON2	61246497	1.000000	0.71417	1.000000	0.80357	0.409000	0.31022	7.518000	0.81795	2.485000	0.83878	0.655000	0.94253	AAG	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.308	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	-	0.00	81	0	G	NM_015026	Missense_Mutation	62960230	+1	tier1	-	no_errors	ENST00000393630	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
MROH2B	133558	genome.wustl.edu	37	5	41058239	41058239	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:41058239C>T	ENST00000399564.4	-	7	1132	c.682G>A	c.(682-684)Gga>Aga	p.G228R	MROH2B_ENST00000506092.2_5'UTR	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	228								p.G228*(1)									AGGGCGTATCCACGGAAGTCT	0.517																																																	1	Substitution - Nonsense(1)	endometrium(1)											76.0	74.0	75.0					5																	41058239		1921	4124	6045	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.682G>A	5.37:g.41058239C>T	ENSP00000382476:p.Gly228Arg		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G228R	ENST00000399564.4	37	c.682	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	11.65	1.702985	0.30232	.	.	ENSG00000171495	ENST00000399564	T	0.08807	3.05	5.27	5.27	0.74061	Armadillo-type fold (1);	0.237344	0.29668	N	0.011514	T	0.05823	0.0152	N	0.08118	0	0.18873	N	0.999981	B	0.18968	0.032	B	0.21917	0.037	T	0.34650	-0.9820	10	0.56958	D	0.05	.	14.2725	0.66159	0.0:1.0:0.0:0.0	.	228	Q7Z745	HTRB2_HUMAN	R	228	ENSP00000382476:G228R	ENSP00000382476:G228R	G	-	1	0	HEATR7B2	41093996	0.459000	0.25768	0.535000	0.28026	0.029000	0.11900	2.256000	0.43231	2.732000	0.93576	0.650000	0.86243	GGA	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.517	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2		0.00	70	0	C	NM_173489		41058239	-1			no_errors	ENST00000399564	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.364	T
MRPS18B	28973	genome.wustl.edu	37	6	30593315	30593315	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:30593315G>T	ENST00000259873.4	+	7	675	c.518G>T	c.(517-519)cGg>cTg	p.R173L	ATAT1_ENST00000318999.7_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|ATAT1_ENST00000330083.5_5'Flank|ATAT1_ENST00000376485.4_5'Flank|ATAT1_ENST00000329992.8_5'Flank|ATAT1_ENST00000319027.5_5'Flank|ATAT1_ENST00000376478.2_5'Flank|ATAT1_ENST00000376483.4_5'Flank|MRPS18B_ENST00000506373.2_3'UTR	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	173					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)	p.R173L(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						GTTGAACCACGGGACCTTGAC	0.502																																																	1	Substitution - Missense(1)	lung(1)											191.0	223.0	211.0					6																	30593315		1510	2709	4219	SO:0001583	missense	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.518G>T	6.37:g.30593315G>T	ENSP00000259873:p.Arg173Leu		A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.R173L	ENST00000259873.4	37	c.518	CCDS4682.1	6	.	.	.	.	.	.	.	.	.	.	G	22.0	4.228527	0.79576	.	.	ENSG00000204568	ENST00000259873;ENST00000376508	T	0.50548	0.74	5.02	5.02	0.67125	.	0.225469	0.36374	N	0.002628	T	0.52901	0.1763	M	0.63428	1.95	0.80722	D	1	D;D	0.69078	0.997;0.992	D;P	0.67231	0.95;0.758	T	0.57323	-0.7831	10	0.66056	D	0.02	.	9.3014	0.37847	0.0946:0.0:0.9054:0.0	.	130;173	Q5STN0;Q9Y676	.;RT18B_HUMAN	L	173;130	ENSP00000259873:R173L	ENSP00000259873:R173L	R	+	2	0	MRPS18B	30701294	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.539000	0.45718	2.618000	0.88619	0.655000	0.94253	CGG	MRPS18B	-	NULL	ENSG00000204568		0.502	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2		0.00	96	0	G			30593315	+1			no_errors	ENST00000259873	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9059174	9059174	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:9059174C>T	ENST00000397910.4	-	3	28475	c.28272G>A	c.(28270-28272)ccG>ccA	p.P9424P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9426	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCACAGACAGCGGGCTTGGCC	0.512																																																	0													114.0	113.0	113.0					19																	9059174		2008	4179	6187	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28272G>A	19.37:g.9059174C>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P9424	ENST00000397910.4	37	c.28272	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	91	0	C	NM_024690		9059174	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9059772	9059772	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:9059772A>G	ENST00000397910.4	-	3	27877	c.27674T>C	c.(27673-27675)aTg>aCg	p.M9225T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9227	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CACATTGGTCATCTCCAGTTT	0.463																																																	0													115.0	113.0	114.0					19																	9059772		2017	4173	6190	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27674T>C	19.37:g.9059772A>G	ENSP00000381008:p.Met9225Thr		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.M9225T	ENST00000397910.4	37	c.27674	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	1.638	-0.517271	0.04171	.	.	ENSG00000181143	ENST00000397910	T	0.21031	2.03	1.75	-3.49	0.04724	.	.	.	.	.	T	0.08626	0.0214	N	0.08118	0	.	.	.	B	0.02656	0.0	B	0.01281	0.0	T	0.25537	-1.0129	8	0.87932	D	0	.	3.6103	0.08058	0.3187:0.0:0.4722:0.2091	.	9225	B5ME49	.	T	9225	ENSP00000381008:M9225T	ENSP00000381008:M9225T	M	-	2	0	MUC16	8920772	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-4.670000	0.00200	-1.398000	0.02066	0.249000	0.18162	ATG	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	64	0	A	NM_024690		9059772	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.000	G
MYH15	22989	genome.wustl.edu	37	3	108107869	108107869	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:108107869G>T	ENST00000273353.3	-	39	5599	c.5543C>A	c.(5542-5544)gCc>gAc	p.A1848D		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1848						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TCCCCTCTGGGCCTCTGCACT	0.572																																																	0													117.0	122.0	120.0					3																	108107869		2034	4199	6233	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.5543C>A	3.37:g.108107869G>T	ENSP00000273353:p.Ala1848Asp			Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.A1848D	ENST00000273353.3	37	c.5543	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	G	20.5	3.993232	0.74703	.	.	ENSG00000144821	ENST00000273353	D	0.83335	-1.71	5.98	2.56	0.30785	Myosin tail (1);	.	.	.	.	D	0.85630	0.5741	M	0.72479	2.2	0.09310	N	1	P	0.49447	0.924	P	0.55161	0.77	T	0.75153	-0.3418	9	0.87932	D	0	.	5.1242	0.14876	0.0941:0.1356:0.6302:0.1401	.	1848	Q9Y2K3	MYH15_HUMAN	D	1848	ENSP00000273353:A1848D	ENSP00000273353:A1848D	A	-	2	0	MYH15	109590559	0.000000	0.05858	0.114000	0.21550	0.278000	0.26855	0.781000	0.26774	0.612000	0.30071	0.655000	0.94253	GCC	MYH15	-	pfam_Myosin_tail	ENSG00000144821		0.572	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	-	0.00	86	0	G	XM_036988		108107869	-1	tier1	-	no_errors	ENST00000273353	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.005	T
MYH6	4624	genome.wustl.edu	37	14	23874914	23874914	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:23874914G>A	ENST00000356287.3	-	3	296	c.267C>T	c.(265-267)gaC>gaT	p.D89D	MYH6_ENST00000405093.3_Silent_p.D89D			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	89	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GCATGGCCATGTCCTCAATCT	0.582																																																	0													265.0	183.0	211.0					14																	23874914		2203	4300	6503	SO:0001819	synonymous_variant	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.267C>T	14.37:g.23874914G>A			A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D89	ENST00000356287.3	37	c.267	CCDS9600.1	14																																																																																			MYH6	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197616		0.582	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	-	0.00	91	0	G			23874914	-1	tier1	-	no_errors	ENST00000356287	ensembl	human	known	74_37	silent	36.36	42	24	SNP	1.000	A
MYRFL	196446	genome.wustl.edu	37	12	70345895	70345895	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:70345895G>T	ENST00000552032.2	+	20	2441	c.2227G>T	c.(2227-2229)Gac>Tac	p.D743Y	MYRFL_ENST00000547771.2_Splice_Site|RP11-611E13.2_ENST00000549419.1_RNA|MYRFL_ENST00000299350.4_Missense_Mutation_p.D108Y|MYRFL_ENST00000535034.1_Missense_Mutation_p.D108Y			Q96LU7	MRFL_HUMAN	myelin regulatory factor-like	743						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CTTTTCAGAAGACAAAAGCAA	0.438																																																	0																																										SO:0001583	missense	0			AK057785		12q15	2012-12-19	2012-12-19	2012-12-19	ENSG00000166268	ENSG00000166268			26316	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 15"", ""chromosome 12 open reading frame 28"""	C12orf15, C12orf28			Standard	XM_006709961		Approved	FLJ25056, bcm1377		Q96LU7	OTTHUMG00000169438	ENST00000552032.2:c.2227G>T	12.37:g.70345895G>T	ENSP00000448753:p.Asp743Tyr			Splice_Site	SNP	-	e20-1	ENST00000552032.2	37	c.2192-1		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.75|10.75	1.439202|1.439202	0.25900|0.25900	.|.	.|.	ENSG00000166268|ENSG00000166268	ENST00000552032;ENST00000299350;ENST00000535034|ENST00000548892	T;T|.	0.24723|.	1.85;1.84|.	4.31|4.31	-0.0562|-0.0562	0.13806|0.13806	.|.	1.215590|.	0.05593|.	N|.	0.575028|.	T|T	0.33702|0.33702	0.0872|0.0872	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	D;P|.	0.59767|.	0.986;0.904|.	P;P|.	0.54100|.	0.742;0.563|.	T|T	0.32508|0.32508	-0.9904|-0.9904	10|5	0.44086|.	T|.	0.13|.	-0.2182|-0.2182	0.8022|0.8022	0.01077|0.01077	0.1897:0.1568:0.34:0.3134|0.1897:0.1568:0.34:0.3134	.|.	108;447|.	F5GYH9;F8VY44|.	.;.|.	Y|N	447;108;108|207	ENSP00000299350:D108Y;ENSP00000440626:D108Y|.	ENSP00000299350:D108Y|.	D|K	+|+	1|3	0|2	C12orf28|C12orf28	68632162|68632162	0.998000|0.998000	0.40836|0.40836	0.053000|0.053000	0.19242|0.19242	0.047000|0.047000	0.14425|0.14425	1.924000|1.924000	0.40065|0.40065	0.183000|0.183000	0.20059|0.20059	-0.474000|-0.474000	0.04947|0.04947	GAC|AAG	MYRFL	-	-	ENSG00000166268		0.438	MYRFL-004	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	MYRFL	HGNC	protein_coding	OTTHUMT00000404016.2	-	0.00	61	0	G	NM_182530		70345895	+1	tier1	-	no_errors	ENST00000547771	ensembl	human	putative	74_37	splice_site	9.09	50	5	SNP	0.177	T
NCOA4	8031	genome.wustl.edu	37	10	51586330	51586330	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:51586330C>T	ENST00000443446.1	+	9	1987	c.1758C>T	c.(1756-1758)ggC>ggT	p.G586G	NCOA4_ENST00000344348.6_Silent_p.G586G|NCOA4_ENST00000374087.4_Silent_p.G586G|NCOA4_ENST00000438493.1_Silent_p.G602G|NCOA4_ENST00000430396.2_Silent_p.G486G|NCOA4_ENST00000452682.1_Silent_p.G602G|NCOA4_ENST00000414907.2_Silent_p.G420G|NCOA4_ENST00000374082.1_Missense_Mutation_p.A541V	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	586					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						ACCATTATGGCCTCCCTGCAG	0.428			T	RET	papillary thyroid																																			Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	0													154.0	149.0	151.0					10																	51586330		2203	4300	6503	SO:0001819	synonymous_variant	0			L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1758C>T	10.37:g.51586330C>T			A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	pfam_ARA70	p.A541V	ENST00000443446.1	37	c.1622	CCDS7237.1	10	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821187	0.50633	.	.	ENSG00000138293	ENST00000374082	T	0.19250	2.16	5.98	4.13	0.48395	.	.	.	.	.	T	0.30448	0.0765	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.06303	-1.0834	6	0.87932	D	0	-13.3169	6.2071	0.20608	0.0:0.6528:0.1389:0.2082	.	.	.	.	V	541	ENSP00000363195:A541V	ENSP00000363195:A541V	A	+	2	0	NCOA4	51256336	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	1.198000	0.32223	1.538000	0.49270	0.655000	0.94253	GCC	NCOA4	-	NULL	ENSG00000138293		0.428	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA4	HGNC	protein_coding	OTTHUMT00000048052.1	-	0.00	88	0	C	NM_005437		51586330	+1	tier1	-	no_errors	ENST00000374082	ensembl	human	novel	74_37	missense	6.94	67	5	SNP	1.000	T
NCOR2	9612	genome.wustl.edu	37	12	124819756	124819756	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:124819756C>T	ENST00000405201.1	-	40	6336	c.6336G>A	c.(6334-6336)tcG>tcA	p.S2112S	NCOR2_ENST00000404621.1_Silent_p.S2102S|NCOR2_ENST00000397355.1_Silent_p.S2103S|NCOR2_ENST00000404121.2_Silent_p.S1673S|NCOR2_ENST00000356219.3_Silent_p.S2119S|NCOR2_ENST00000429285.2_Silent_p.S2102S			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	2123					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCGGGCTGGACGAGGGCTGGC	0.692																																																	0													22.0	28.0	26.0					12																	124819756		2048	4168	6216	SO:0001819	synonymous_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.6336G>A	12.37:g.124819756C>T			O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S2119	ENST00000405201.1	37	c.6357	CCDS41858.2	12																																																																																			NCOR2	-	NULL	ENSG00000196498		0.692	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	-	0.00	47	0	C	NM_006312		124819756	-1	tier1	-	no_errors	ENST00000356219	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.482	T
NKAPL	222698	genome.wustl.edu	37	6	28227844	28227844	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:28227844A>G	ENST00000343684.3	+	1	747	c.695A>G	c.(694-696)aAg>aGg	p.K232R	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	232	Lys-rich.									breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						aagaagaaaaagaaacacaaa	0.348																																																	0													21.0	25.0	24.0					6																	28227844		2200	4299	6499	SO:0001583	missense	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.695A>G	6.37:g.28227844A>G	ENSP00000345716:p.Lys232Arg		Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	pfam_DUF926	p.K232R	ENST00000343684.3	37	c.695	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	A	8.013	0.757872	0.15846	.	.	ENSG00000189134	ENST00000343684	T	0.14266	2.52	4.21	3.06	0.35304	.	0.422095	0.25613	N	0.029471	T	0.02688	0.0081	L	0.41824	1.3	0.41124	D	0.985838	B	0.29627	0.252	B	0.26614	0.071	T	0.29971	-0.9994	10	0.10902	T	0.67	-11.8334	3.5517	0.07848	0.7018:0.0:0.1033:0.1948	.	232	Q5M9Q1	NKAPL_HUMAN	R	232	ENSP00000345716:K232R	ENSP00000345716:K232R	K	+	2	0	NKAPL	28335823	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.815000	0.27253	0.966000	0.38159	0.533000	0.62120	AAG	NKAPL	-	NULL	ENSG00000189134		0.348	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	-	0.00	59	0	A			28227844	+1	tier1	-	no_errors	ENST00000343684	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	G
NLGN2	57555	genome.wustl.edu	37	17	7311939	7311939	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:7311939G>T	ENST00000302926.2	+	1	438	c.365G>T	c.(364-366)tGg>tTg	p.W122L	NLGN2_ENST00000575301.1_Missense_Mutation_p.W122L	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	122					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				CTGCCTGTGTGGTTCACCGAC	0.701																																																	0													20.0	18.0	19.0					17																	7311939		2156	4191	6347	SO:0001583	missense	0			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.365G>T	17.37:g.7311939G>T	ENSP00000305288:p.Trp122Leu		Q9P2I1	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.W122L	ENST00000302926.2	37	c.365	CCDS11103.1	17	.	.	.	.	.	.	.	.	.	.	g	24.1	4.494773	0.85069	.	.	ENSG00000169992	ENST00000302926	T	0.66638	-0.22	3.42	3.42	0.39159	Carboxylesterase, type B (1);	0.000000	0.64402	D	0.000002	T	0.56572	0.1994	L	0.33245	0.995	0.58432	D	0.999997	B	0.27997	0.197	B	0.33254	0.16	T	0.57648	-0.7775	10	0.37606	T	0.19	.	13.2034	0.59782	0.0:0.0:1.0:0.0	.	122	Q8NFZ4	NLGN2_HUMAN	L	122	ENSP00000305288:W122L	ENSP00000305288:W122L	W	+	2	0	NLGN2	7252663	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.560000	0.98139	2.242000	0.73789	0.436000	0.28706	TGG	NLGN2	-	pfam_CarbesteraseB	ENSG00000169992		0.701	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	-	0.00	79	0	G	NM_020795		7311939	+1	tier1	-	no_errors	ENST00000302926	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
NMT1	4836	genome.wustl.edu	37	17	43180436	43180436	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:43180436G>T	ENST00000592782.1	+	10	1242	c.1111G>T	c.(1111-1113)Gtg>Ttg	p.V371L	NMT1_ENST00000258960.2_Missense_Mutation_p.V371L			P30419	NMT1_HUMAN	N-myristoyltransferase 1	371					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				CCAGGAGGAGGTGGAGCACTG	0.537																																																	0													158.0	145.0	150.0					17																	43180436		2203	4300	6503	SO:0001583	missense	0				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.1111G>T	17.37:g.43180436G>T	ENSP00000468424:p.Val371Leu		A8K7C1|Q9UE09	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.V371L	ENST00000592782.1	37	c.1111	CCDS11494.1	17	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688159	0.88639	.	.	ENSG00000136448	ENST00000258960	T	0.49432	0.78	5.17	5.17	0.71159	Acyl-CoA N-acyltransferase (2);Myristoyl-CoA:protein N-myristoyltransferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.63651	0.2529	M	0.75264	2.295	0.80722	D	1	P;P	0.44734	0.842;0.749	P;B	0.52454	0.699;0.346	T	0.63786	-0.6558	10	0.45353	T	0.12	-15.3481	18.8699	0.92309	0.0:0.0:1.0:0.0	.	38;371	A4FU65;P30419	.;NMT1_HUMAN	L	371	ENSP00000258960:V371L	ENSP00000258960:V371L	V	+	1	0	NMT1	40535962	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.648000	0.98483	2.687000	0.91594	0.655000	0.94253	GTG	NMT1	-	pfam_MyristoylCoA_TrFase_C,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	ENSG00000136448		0.537	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	-	0.00	93	0	G	NM_021079		43180436	+1	tier1	-	no_errors	ENST00000258960	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
NPIPA1	9284	genome.wustl.edu	37	16	15045675	15045675	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:15045675G>A	ENST00000328085.6	+	8	846	c.846G>A	c.(844-846)gcG>gcA	p.A282A	NPIPA1_ENST00000472413.1_3'UTR	NM_006985.2	NP_008916.2	Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1	282	Pro-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											TACCCTCAGCGGATGATAATC	0.527																																																	0													39.0	32.0	35.0					16																	15045675		1324	2283	3607	SO:0001819	synonymous_variant	0			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000328085.6:c.846G>A	16.37:g.15045675G>A			O15102	Silent	SNP	NULL	p.A282	ENST00000328085.6	37	c.846	CCDS10557.1	16																																																																																			NPIPA1	-	NULL	ENSG00000183426		0.527	NPIPA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NPIPA1	HGNC	protein_coding	OTTHUMT00000207326.2		0.00	80	0	G	NM_006985		15045675	+1			no_errors	ENST00000328085	ensembl	human	novel	74_37	silent	7.55	49	4	SNP	0.080	A
NPR3	4883	genome.wustl.edu	37	5	32711915	32711915	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:32711915G>T	ENST00000265074.8	+	1	376	c.33G>T	c.(31-33)ccG>ccT	p.P11P	NPR3_ENST00000415167.2_Silent_p.P11P|NPR3_ENST00000415685.2_Intron|NPR3_ENST00000434067.2_Intron	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	11					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	CTTTCTCCCCGTGCGTACTAC	0.726																																																	0													3.0	4.0	3.0					5																	32711915		1464	2897	4361	SO:0001819	synonymous_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.33G>T	5.37:g.32711915G>T			A2RRD1|B4DT84|E7EPG9	Silent	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_Ntpep_rcpt	p.P11	ENST00000265074.8	37	c.33	CCDS56357.1	5																																																																																			NPR3	-	NULL	ENSG00000113389		0.726	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3	-	0.00	61	0	G	NM_000908		32711915	+1	tier1	-	no_errors	ENST00000265074	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.951	T
OBFC1	79991	genome.wustl.edu	37	10	105659926	105659927	+	Frame_Shift_Ins	INS	-	-	TGTA			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:105659926_105659927insTGTA	ENST00000224950.3	-	5	517_518	c.350_351insTACA	c.(349-351)caafs	p.Q117fs	OBFC1_ENST00000369764.1_Frame_Shift_Ins_p.Q117fs|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	117					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CAATGGTCTCTTGTAGCTTCTT	0.46																																																	0																																										SO:0001589	frameshift_variant	0			BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.347_350dupTACA	10.37:g.105659927_105659930dupTGTA	ENSP00000224950:p.Gln117fs		D3DR99|Q5TCZ0	Frame_Shift_Ins	INS	pfam_CST_STN1_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_CST_STN1	p.Q117fs	ENST00000224950.3	37	c.351_350	CCDS7552.1	10																																																																																			OBFC1	-	pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_CST_STN1	ENSG00000107960		0.460	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBFC1	HGNC	protein_coding	OTTHUMT00000050174.1		0.00	48	0	-	NM_024928		105659927	-1	tier1		no_errors	ENST00000224950	ensembl	human	known	74_37	frame_shift_ins	20.31	51	13	INS	1.000:1.000	TGTA
OR4C15	81309	genome.wustl.edu	37	11	55322152	55322152	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:55322152G>T	ENST00000314644.2	+	1	370	c.370G>T	c.(370-372)Gcg>Tcg	p.A124S		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CTTCCTGGATGCGTGCTTCTC	0.473										HNSCC(20;0.049)																																							0													190.0	154.0	166.0					11																	55322152		2201	4296	6497	SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.370G>T	11.37:g.55322152G>T	ENSP00000324958:p.Ala124Ser		Q6IFE2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A124S	ENST00000314644.2	37	c.370	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	G	12.64	2.000059	0.35320	.	.	ENSG00000181939	ENST00000314644	T	0.01347	4.99	5.12	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01905	0.0060	L	0.45352	1.415	0.23528	N	0.997484	B	0.32338	0.365	B	0.29077	0.098	T	0.42899	-0.9424	9	0.54805	T	0.06	.	11.7269	0.51714	0.0881:0.0:0.9119:0.0	.	70	Q8NGM1	OR4CF_HUMAN	S	124	ENSP00000324958:A124S	ENSP00000324958:A124S	A	+	1	0	OR4C15	55078728	0.000000	0.05858	0.994000	0.49952	0.588000	0.36517	-1.889000	0.01614	2.665000	0.90641	0.385000	0.25706	GCG	OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181939		0.473	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1		0.00	46	0	G	NM_001001920		55322152	+1			no_errors	ENST00000314644	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.955	T
OR4D2	124538	genome.wustl.edu	37	17	56247817	56247817	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:56247817G>T	ENST00000545221.1	+	1	801	c.801G>T	c.(799-801)atG>atT	p.M267I		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						CATTCCCTATGGACAAGCTTG	0.537																																																	0													153.0	127.0	136.0					17																	56247817		2203	4300	6503	SO:0001583	missense	0				CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.801G>T	17.37:g.56247817G>T	ENSP00000441354:p.Met267Ile		Q6IFN8|Q96R75	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M267I	ENST00000545221.1	37	c.801	CCDS32688.1	17	.	.	.	.	.	.	.	.	.	.	G	9.167	1.020279	0.19433	.	.	ENSG00000255713	ENST00000545221	T	0.00051	8.81	5.71	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.086501	0.49305	D	0.000145	T	0.00109	0.0003	N	0.25485	0.75	0.28407	N	0.918351	B	0.11235	0.004	B	0.17979	0.02	T	0.11792	-1.0573	10	0.02654	T	1	-33.8508	7.8601	0.29506	0.0806:0.0:0.7571:0.1622	.	267	P58180	OR4D2_HUMAN	I	267	ENSP00000441354:M267I	ENSP00000441354:M267I	M	+	3	0	OR4D2	53602816	0.504000	0.26123	1.000000	0.80357	0.846000	0.48090	0.345000	0.19979	1.552000	0.49463	0.609000	0.83330	ATG	OR4D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000255713		0.537	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D2	HGNC	protein_coding	OTTHUMT00000443366.1	-	0.00	74	0	G			56247817	+1	tier1	-	no_errors	ENST00000545221	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
OR4N4	283694	genome.wustl.edu	37	15	22382670	22382670	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:22382670G>T	ENST00000328795.4	+	1	289	c.198G>T	c.(196-198)ttG>ttT	p.L66F	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	66						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGGGCAACTTGGCCTTCCTGG	0.473																																																	0													149.0	149.0	149.0					15																	22382670		2203	4296	6499	SO:0001583	missense	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.198G>T	15.37:g.22382670G>T	ENSP00000332500:p.Leu66Phe		Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L66F	ENST00000328795.4	37	c.198	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	12.14	1.848021	0.32699	.	.	ENSG00000183706	ENST00000328795	T	0.00512	6.89	3.24	2.3	0.28687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38381	N	0.001706	T	0.01387	0.0045	M	0.84156	2.68	0.30257	N	0.793545	D	0.89917	1.0	D	0.97110	1.0	T	0.24621	-1.0155	10	0.87932	D	0	-9.7559	3.8874	0.09103	0.1324:0.0:0.6314:0.2362	.	66	Q8N0Y3	OR4N4_HUMAN	F	66	ENSP00000332500:L66F	ENSP00000332500:L66F	L	+	3	2	OR4N4	19884034	0.997000	0.39634	0.997000	0.53966	0.398000	0.30690	0.739000	0.26173	0.681000	0.31386	0.195000	0.17529	TTG	OR4N4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000183706		0.473	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	-	0.00	115	0	G			22382670	+1	tier1	-	no_errors	ENST00000328795	ensembl	human	known	74_37	missense	21.30	84	23	SNP	1.000	T
OR6Y1	391112	genome.wustl.edu	37	1	158517559	158517559	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:158517559C>G	ENST00000302617.3	-	1	336	c.337G>C	c.(337-339)Gtc>Ctc	p.V113L		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					TCAGTGCAGACAAAGGTCACA	0.453																																																	0													139.0	125.0	130.0					1																	158517559		2202	4300	6502	SO:0001583	missense	0			BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.337G>C	1.37:g.158517559C>G	ENSP00000304807:p.Val113Leu		Q6IFS0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V113L	ENST00000302617.3	37	c.337	CCDS30899.1	1	.	.	.	.	.	.	.	.	.	.	C	10.62	1.400389	0.25291	.	.	ENSG00000197532	ENST00000302617	T	0.01335	5.0	4.91	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38005	N	0.001848	T	0.00412	0.0013	L	0.38175	1.15	0.09310	N	1	P	0.41546	0.754	B	0.33750	0.169	T	0.45071	-0.9286	10	0.02654	T	1	.	11.4892	0.50371	0.0:0.9128:0.0:0.0872	.	113	Q8NGX8	OR6Y1_HUMAN	L	113	ENSP00000304807:V113L	ENSP00000304807:V113L	V	-	1	0	OR6Y1	156784183	0.000000	0.05858	0.975000	0.42487	0.903000	0.53119	0.479000	0.22228	2.695000	0.91970	0.563000	0.77884	GTC	OR6Y1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197532		0.453	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Y1	HGNC	protein_coding	OTTHUMT00000051844.1	-	0.00	40	0	C	NM_001005189		158517559	-1	tier1	-	no_errors	ENST00000302617	ensembl	human	known	74_37	missense	65.85	14	27	SNP	0.010	G
OR9A2	135924	genome.wustl.edu	37	7	142723727	142723727	+	Missense_Mutation	SNP	G	G	A	rs143573729	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:142723727G>A	ENST00000350513.2	-	1	555	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C		NM_001001658.1	NP_001001658.1	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A, member 2	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R165S(1)		central_nervous_system(3)|endometrium(4)|large_intestine(1)|lung(14)|skin(3)	25	Melanoma(164;0.059)					TTTGATTTGCGGAAGGTAAAC	0.398													G|||	6	0.00119808	0.0008	0.0043	5008	,	,		21830	0.0		0.001	False		,,,				2504	0.001																1	Substitution - Missense(1)	lung(1)						G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	81.0	78.0	79.0		493	3.4	1.0	7	dbSNP_134	79	20,8580	14.6+/-50.1	0,20,4280	yes	missense	OR9A2	NM_001001658.1	180	0,21,6482	AA,AG,GG		0.2326,0.0227,0.1615	benign	165/311	142723727	21,12985	2203	4300	6503	SO:0001583	missense	0				CCDS34767.1	7q34	2014-07-10			ENSG00000179468	ENSG00000179468		"""GPCR / Class A : Olfactory receptors"""	15093	protein-coding gene	gene with protein product							Standard	NM_001001658		Approved		uc003wcc.1	Q8NGT5	OTTHUMG00000158386	ENST00000350513.2:c.493C>T	7.37:g.142723727G>A	ENSP00000316518:p.Arg165Cys		B9EH51|Q6IF71|Q8NGD9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R165C	ENST00000350513.2	37	c.493	CCDS34767.1	7	3	0.0013736263736263737	1	0.0020325203252032522	1	0.0027624309392265192	0	0.0	1	0.0013192612137203166	G	0.004	-2.317376	0.00235	2.27E-4	0.002326	ENSG00000179468	ENST00000350513	T	0.00021	9.03	4.53	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	N	0.000513	T	0.00039	0.0001	N	0.00016	-2.855	0.29391	N	0.86264	B	0.02656	0.0	B	0.04013	0.001	T	0.27536	-1.0071	10	0.02654	T	1	-15.2416	8.3405	0.32241	0.9037:0.0:0.0963:0.0	.	165	Q8NGT5	OR9A2_HUMAN	C	165	ENSP00000316518:R165C	ENSP00000316518:R165C	R	-	1	0	OR9A2	142433849	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	4.471000	0.60182	0.870000	0.35726	-0.340000	0.08031	CGC	OR9A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000179468		0.398	OR9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9A2	HGNC	protein_coding	OTTHUMT00000350862.1		0.00	67	0	G			142723727	-1			no_errors	ENST00000350513	ensembl	human	known	74_37	missense	6.56	56	4	SNP	0.996	A
PAXIP1	22976	genome.wustl.edu	37	7	154760609	154760611	+	In_Frame_Del	DEL	CTG	CTG	-	rs151102688		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:154760609_154760611delCTG	ENST00000404141.1	-	7	1454_1456	c.1300_1302delCAG	c.(1300-1302)cagdel	p.Q434del	PAXIP1_ENST00000397192.1_In_Frame_Del_p.Q434del|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	434	Gln-rich.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GCTGAGAGATctgctgctgctgc	0.591																																																	0										67,3215		7,53,1581						-1.6	0.0		dbSNP_134	18	123,6147		12,99,3024	no	coding	PAXIP1	NM_007349.3		19,152,4605	A1A1,A1R,RR		1.9617,2.0414,1.9891				190,9362				SO:0001651	inframe_deletion	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1300_1302delCAG	7.37:g.154760618_154760620delCTG	ENSP00000384048:p.Gln434del		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	In_Frame_Del	DEL	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q434in_frame_del	ENST00000404141.1	37	c.1302_1300	CCDS47753.1	7																																																																																			PAXIP1	-	NULL	ENSG00000157212		0.591	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	27	0	CTG	NM_007349		154760611	-1	tier1		no_errors	ENST00000397192	ensembl	human	known	74_37	in_frame_del	10.34	26	3	DEL	0.998:0.998:0.999	-
PCDHB2	56133	genome.wustl.edu	37	5	140475148	140475148	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:140475148C>T	ENST00000194155.4	+	1	922	c.774C>T	c.(772-774)ccC>ccT	p.P258P		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	258	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGACAGCCCCGTTGGATCCC	0.507																																																	0													63.0	64.0	63.0					5																	140475148		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.774C>T	5.37:g.140475148C>T			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P258	ENST00000194155.4	37	c.774	CCDS4244.1	5																																																																																			PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000112852		0.507	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	-	0.00	58	0	C	NM_018936		140475148	+1	tier1	-	no_errors	ENST00000194155	ensembl	human	known	74_37	silent	19.44	29	7	SNP	0.000	T
PCSK5	5125	genome.wustl.edu	37	9	78842492	78842492	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:78842492G>T	ENST00000545128.1	+	21	3238	c.2700G>T	c.(2698-2700)caG>caT	p.Q900H		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	900	CRM (Cys-rich motif).|PLAC.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GACCAACCCAGGAAGACTGCA	0.537																																																	0													37.0	32.0	33.0					9																	78842492		876	1991	2867	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.2700G>T	9.37:g.78842492G>T	ENSP00000446280:p.Gln900His		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.Q900H	ENST00000545128.1	37	c.2700	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191517	0.58017	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.31247	1.5;1.5	5.48	3.3	0.37823	.	0.729658	0.13358	N	0.393859	T	0.33990	0.0882	L	0.60455	1.87	0.30616	N	0.758984	.	.	.	.	.	.	T	0.37407	-0.9707	8	0.46703	T	0.11	-8.4359	4.4999	0.11858	0.4863:0.0:0.5137:0.0	.	.	.	.	H	900;603;573	ENSP00000446280:Q900H;ENSP00000411654:Q573H	ENSP00000365945:Q603H	Q	+	3	2	PCSK5	78032312	0.126000	0.22350	1.000000	0.80357	0.970000	0.65996	0.269000	0.18589	1.219000	0.43474	0.655000	0.94253	CAG	PCSK5	-	superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000099139		0.537	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	58	0	G			78842492	+1	tier1	-	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.838	T
PDE9A	5152	genome.wustl.edu	37	21	44189167	44189167	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr21:44189167G>T	ENST00000291539.6	+	17	1552	c.1492G>T	c.(1492-1494)Gtg>Ttg	p.V498L	PDE9A_ENST00000335440.6_Missense_Mutation_p.V396L|PDE9A_ENST00000539837.1_Missense_Mutation_p.V370L|PDE9A_ENST00000335512.4_Missense_Mutation_p.V438L|PDE9A_ENST00000398232.3_Missense_Mutation_p.V431L|PDE9A_ENST00000380328.2_Missense_Mutation_p.V445L|PDE9A_ENST00000398227.3_Missense_Mutation_p.V338L|PDE9A_ENST00000349112.3_Missense_Mutation_p.V370L|PDE9A_ENST00000398234.3_Missense_Mutation_p.V397L|PDE9A_ENST00000398224.3_Missense_Mutation_p.V371L|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000398229.3_Missense_Mutation_p.V364L|PDE9A_ENST00000398236.3_Missense_Mutation_p.V412L|PDE9A_ENST00000398225.3_Missense_Mutation_p.V457L|PDE9A_ENST00000328862.6_Missense_Mutation_p.V472L	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	498	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	AGGCCTTCCTGTGGCACCGTT	0.512																																																	0													175.0	148.0	157.0					21																	44189167		2203	4300	6503	SO:0001583	missense	0			AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1492G>T	21.37:g.44189167G>T	ENSP00000291539:p.Val498Leu		B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.V498L	ENST00000291539.6	37	c.1492	CCDS13690.1	21	.	.	.	.	.	.	.	.	.	.	G	19.50	3.840214	0.71488	.	.	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	4.75	4.75	0.60458	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.88119	0.6351	M	0.77313	2.365	0.58432	D	0.999999	P;P;D;P;D;D;P;P;P;D;P;D;P;P;P	0.65815	0.663;0.818;0.957;0.818;0.995;0.995;0.818;0.818;0.818;0.957;0.818;0.995;0.818;0.818;0.711	B;P;P;P;D;D;P;B;P;P;P;D;P;P;P	0.73380	0.372;0.492;0.624;0.492;0.98;0.98;0.492;0.364;0.492;0.624;0.492;0.98;0.492;0.492;0.506	D	0.89873	0.4024	10	0.72032	D	0.01	.	17.7454	0.88419	0.0:0.0:1.0:0.0	.	431;412;397;472;457;390;438;281;338;364;370;396;445;371;498	O76083-13;O76083-8;O76083-6;O76083-15;O76083-14;O76083-16;O76083-2;O76083-10;O76083-9;O76083-11;O76083-4;O76083-12;O76083-5;O76083-3;O76083	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PDE9A_HUMAN	L	438;370;498;445;431;397;412;472;396;457;364;338;370;371	ENSP00000335242:V438L;ENSP00000441899:V370L;ENSP00000291539:V498L;ENSP00000369685:V445L;ENSP00000381287:V431L;ENSP00000381289:V397L;ENSP00000381291:V412L;ENSP00000328699:V472L;ENSP00000335365:V396L;ENSP00000381281:V457L;ENSP00000381285:V364L;ENSP00000381283:V338L;ENSP00000344730:V370L;ENSP00000381280:V371L	ENSP00000291539:V498L	V	+	1	0	PDE9A	43062236	1.000000	0.71417	0.913000	0.36048	0.234000	0.25298	7.323000	0.79105	2.190000	0.69967	0.313000	0.20887	GTG	PDE9A	-	pfam_PDEase_catalytic_dom	ENSG00000160191		0.512	PDE9A-016	KNOWN	basic|CCDS	protein_coding	PDE9A	HGNC	protein_coding	OTTHUMT00000195466.1	-	0.00	68	0	G			44189167	+1	tier1	-	no_errors	ENST00000291539	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
PDP1	54704	genome.wustl.edu	37	8	94935236	94935236	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:94935236C>T	ENST00000297598.4	+	2	1218	c.949C>T	c.(949-951)Caa>Taa	p.Q317*	PDP1_ENST00000396200.3_Nonsense_Mutation_p.Q342*|PDP1_ENST00000520728.1_Nonsense_Mutation_p.Q317*|PDP1_ENST00000517764.1_Nonsense_Mutation_p.Q317*	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	317					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						CCACAATGCTCAAAATGAAAG	0.507																																																	0													78.0	71.0	74.0					8																	94935236		2203	4300	6503	SO:0001587	stop_gained	0			AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.949C>T	8.37:g.94935236C>T	ENSP00000297598:p.Gln317*		B3KX71|J3KPU0|Q5U5K1	Nonsense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.Q342*	ENST00000297598.4	37	c.1024	CCDS6259.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.779625	0.96929	.	.	ENSG00000164951	ENST00000297598;ENST00000520728;ENST00000396200;ENST00000517764	.	.	.	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-13.5395	20.2789	0.98501	0.0:1.0:0.0:0.0	.	.	.	.	X	317;317;342;317	.	ENSP00000297598:Q317X	Q	+	1	0	PDP1	95004412	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.974000	0.70465	2.788000	0.95919	0.650000	0.86243	CAA	PDP1	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000164951		0.507	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDP1	HGNC	protein_coding	OTTHUMT00000378415.2	-	0.00	33	0	C	NM_018444		94935236	+1	tier1	-	no_errors	ENST00000396200	ensembl	human	known	74_37	nonsense	18.52	22	5	SNP	1.000	T
PFKFB2	5208	genome.wustl.edu	37	1	207252357	207252357	+	IGR	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:207252357C>A	ENST00000367080.3	+	0	7094				PFKFB2_ENST00000411990.2_Missense_Mutation_p.P372H|PFKFB2_ENST00000541914.1_Missense_Mutation_p.P263H|PFKFB2_ENST00000473310.1_3'UTR|PFKFB2_ENST00000367079.2_Missense_Mutation_p.P470H	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CTCATGTTGCCTTGCTAATGA	0.532																																																	0													161.0	149.0	153.0					1																	207252357		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033		1.37:g.207252357C>A			O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,superfamily_P-loop_NTPase,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.P470H	ENST00000367080.3	37	c.1409	CCDS31004.1	1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.779230	0.49891	.	.	ENSG00000123836	ENST00000411990;ENST00000367079;ENST00000541914	.	.	.	5.0	-10.0	0.00425	.	.	.	.	.	T	0.31765	0.0807	L	0.47716	1.5	0.09310	N	1	P;P;D	0.60160	0.712;0.768;0.987	B;P;P	0.54759	0.376;0.514;0.76	T	0.38993	-0.9635	8	0.87932	D	0	.	1.4402	0.02353	0.4382:0.2223:0.0892:0.2503	.	263;372;470	B4DI16;B4DY91;Q5VVQ3	.;.;.	H	372;470;263	.	ENSP00000356046:P470H	P	+	2	0	PFKFB2	205318980	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.143000	0.01297	-1.727000	0.01368	-0.302000	0.09304	CCT	PFKFB2	-	NULL	ENSG00000123836		0.532	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB2	HGNC	protein_coding	OTTHUMT00000087838.1	-	0.00	44	0	C			207252357	+1	tier1	-	no_errors	ENST00000367079	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.000	A
PGLS	25796	genome.wustl.edu	37	19	17628644	17628644	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:17628644G>T	ENST00000252603.2	+	4	668	c.624G>T	c.(622-624)aaG>aaT	p.K208N	CTD-3131K8.3_ENST00000596192.1_RNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	208					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						GAGAAGGCAAGGCAGCTGTTC	0.552																																																	0													101.0	83.0	89.0					19																	17628644		2203	4300	6503	SO:0001583	missense	0			AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.624G>T	19.37:g.17628644G>T	ENSP00000252603:p.Lys208Asn			Missense_Mutation	SNP	tigrfam_6-phosphogluconolactonase_DevB	p.K208N	ENST00000252603.2	37	c.624	CCDS12361.1	19	.	.	.	.	.	.	.	.	.	.	G	14.37	2.515563	0.44763	.	.	ENSG00000130313	ENST00000252603	T	0.72394	-0.65	5.95	3.71	0.42584	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.000000	0.85682	D	0.000000	D	0.87485	0.6189	H	0.97983	4.12	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.87250	0.2272	10	0.87932	D	0	-47.7954	5.3525	0.16043	0.3289:0.0:0.6711:0.0	.	208	O95336	6PGL_HUMAN	N	208	ENSP00000252603:K208N	ENSP00000252603:K208N	K	+	3	2	PGLS	17489644	1.000000	0.71417	1.000000	0.80357	0.157000	0.22087	3.040000	0.49799	1.526000	0.49068	-0.140000	0.14226	AAG	PGLS	-	tigrfam_6-phosphogluconolactonase_DevB	ENSG00000130313		0.552	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLS	HGNC	protein_coding	OTTHUMT00000464154.1		0.00	88	0	G			17628644	+1			no_errors	ENST00000252603	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
PHLPP1	23239	genome.wustl.edu	37	18	60646275	60646275	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:60646275G>T	ENST00000262719.5	+	17	4999	c.4765G>T	c.(4765-4767)Gag>Tag	p.E1589*	PHLPP1_ENST00000400316.4_Nonsense_Mutation_p.E1077*			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1589					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						GGTGCCAGCAGAGGCCAGTGA	0.627																																																	0													33.0	39.0	37.0					18																	60646275		2105	4219	6324	SO:0001587	stop_gained	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.4765G>T	18.37:g.60646275G>T	ENSP00000262719:p.Glu1589*		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Nonsense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.E1589*	ENST00000262719.5	37	c.4765	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	G	53	20.232960	0.99928	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	.	.	.	4.18	4.18	0.49190	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-18.6084	16.6946	0.85332	0.0:0.0:1.0:0.0	.	.	.	.	X	1077;1589	.	ENSP00000262719:E1589X	E	+	1	0	PHLPP1	58797255	1.000000	0.71417	0.984000	0.44739	0.951000	0.60555	7.281000	0.78621	2.173000	0.68751	0.561000	0.74099	GAG	PHLPP1	-	NULL	ENSG00000081913		0.627	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2		0.00	34	0	G	NM_194449		60646275	+1			no_errors	ENST00000262719	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	1.000	T
PI4KA	5297	genome.wustl.edu	37	22	21097024	21097024	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:21097024G>T	ENST00000572273.1	-	31	3541	c.3311C>A	c.(3310-3312)aCc>aAc	p.T1104N	PI4KA_ENST00000255882.6_Missense_Mutation_p.T1162N			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1104					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CTGGCCTGTGGTGCCTGAGAA	0.478																																					GBM(136;1332 1831 3115 23601 50806)												0													243.0	188.0	207.0					22																	21097024		2203	4300	6503	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3311C>A	22.37:g.21097024G>T	ENSP00000458238:p.Thr1104Asn		Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.T1162N	ENST00000572273.1	37	c.3485		22	.	.	.	.	.	.	.	.	.	.	G	13.28	2.188909	0.38707	.	.	ENSG00000241973	ENST00000255882	T	0.55760	0.5	5.87	4.82	0.62117	.	0.153798	0.64402	D	0.000020	T	0.34890	0.0913	N	0.12182	0.205	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.11397	-1.0589	10	0.17369	T	0.5	-15.4252	17.0749	0.86583	0.0:0.1264:0.8736:0.0	.	1104	P42356	PI4KA_HUMAN	N	1104	ENSP00000255882:T1104N	ENSP00000255882:T1104N	T	-	2	0	PI4KA	19427024	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	3.899000	0.56288	2.778000	0.95560	0.650000	0.86243	ACC	PI4KA	-	NULL	ENSG00000241973		0.478	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding			0.00	77	0	G	NM_058004		21097024	-1			no_errors	ENST00000255882	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
PIR	8544	genome.wustl.edu	37	X	15474054	15474054	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:15474054C>A	ENST00000380421.3	-	5	857	c.397G>T	c.(397-399)Gaa>Taa	p.E133*	PIR_ENST00000476381.1_5'UTR|PIR_ENST00000380420.5_Nonsense_Mutation_p.E133*	NM_001018109.2|NM_003662.3	NP_001018119.1|NP_003653.1	O00625	PIR_HUMAN	pirin (iron-binding nuclear protein)	133					monocyte differentiation (GO:0030224)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|quercetin 2,3-dioxygenase activity (GO:0008127)|transcription cofactor activity (GO:0003712)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9	Hepatocellular(33;0.183)					CTTTTCAGTTCCTGGTACTGA	0.498																																					Ovarian(180;1587 2015 10555 34192 51653)												0													227.0	217.0	220.0					X																	15474054		2203	4300	6503	SO:0001587	stop_gained	0			Y07868	CCDS14167.1	Xp22.31	2008-02-05			ENSG00000087842	ENSG00000087842			30048	protein-coding gene	gene with protein product		300931				9079676	Standard	NM_003662		Approved		uc004cwv.3	O00625	OTTHUMG00000021176	ENST00000380421.3:c.397G>T	X.37:g.15474054C>A	ENSP00000369786:p.Glu133*		Q5U0G0|Q6FHD2	Nonsense_Mutation	SNP	pfam_Pirin_C_dom,pfam_Pirin_N_dom,superfamily_RmlC_Cupin,pirsf_Pirin	p.E133*	ENST00000380421.3	37	c.397	CCDS14167.1	X	.	.	.	.	.	.	.	.	.	.	C	40	8.246610	0.98724	.	.	ENSG00000087842	ENST00000380420;ENST00000380421	.	.	.	6.04	5.17	0.71159	.	0.146087	0.64402	D	0.000014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-21.9321	12.3643	0.55221	0.0:0.915:0.0:0.085	.	.	.	.	X	133	.	ENSP00000369785:E133X	E	-	1	0	PIR	15383975	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	5.416000	0.66417	2.559000	0.86315	0.597000	0.82753	GAA	PIR	-	superfamily_RmlC_Cupin,pirsf_Pirin	ENSG00000087842		0.498	PIR-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIR	HGNC	protein_coding	OTTHUMT00000055863.1	-	0.00	39	0	C	NM_003662		15474054	-1	tier1	-	no_errors	ENST00000380420	ensembl	human	known	74_37	nonsense	12.50	21	3	SNP	1.000	A
PLD1	5337	genome.wustl.edu	37	3	171453400	171453400	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:171453400C>A	ENST00000351298.4	-	4	442	c.316G>T	c.(316-318)Gaa>Taa	p.E106*	PLD1_ENST00000340989.4_Nonsense_Mutation_p.E106*|PLD1_ENST00000342215.6_Nonsense_Mutation_p.E106*|PLD1_ENST00000356327.5_Nonsense_Mutation_p.E106*	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	106	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TGTGTTAATTCAATAGTGTAA	0.308																																					NSCLC(149;2174 3517 34058)												0													82.0	78.0	79.0					3																	171453400		2203	4300	6503	SO:0001587	stop_gained	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.316G>T	3.37:g.171453400C>A	ENSP00000342793:p.Glu106*			Nonsense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.E106*	ENST00000351298.4	37	c.316	CCDS3216.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.127480	0.94473	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989;ENST00000418087	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-26.7375	18.3134	0.90208	0.0:1.0:0.0:0.0	.	.	.	.	X	106	.	ENSP00000340326:E106X	E	-	1	0	PLD1	172936094	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.454000	0.73493	2.397000	0.81536	0.563000	0.77884	GAA	PLD1	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_PLipase_D_euk,pfscan_Phox	ENSG00000075651		0.308	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	-	0.00	78	0	C	NM_002662		171453400	-1	tier1	-	no_errors	ENST00000351298	ensembl	human	known	74_37	nonsense	5.21	91	5	SNP	1.000	A
PLD5	200150	genome.wustl.edu	37	1	242271092	242271092	+	Nonsense_Mutation	SNP	G	G	A	rs367992813		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:242271092G>A	ENST00000536534.2	-	8	1361	c.1120C>T	c.(1120-1122)Cga>Tga	p.R374*	PLD5_ENST00000442594.2_Nonsense_Mutation_p.R282*|PLD5_ENST00000427495.1_Nonsense_Mutation_p.R312*			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	374						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CTAACGCTTCGTAAAACTAAT	0.358													G|||	1	0.000199681	0.0	0.0	5008	,	,		20083	0.0		0.001	False		,,,				2504	0.0																0								G	stop/ARG,stop/ARG,stop/ARG	0,4406		0,0,2203	88.0	90.0	89.0		934,496,1120	4.5	1.0	1		89	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained,stop-gained,stop-gained	PLD5	NM_001195811.1,NM_001195812.1,NM_152666.2	,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,	312/475,166/329,374/537	242271092	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1120C>T	1.37:g.242271092G>A	ENSP00000440896:p.Arg374*		A1KXV0|B7Z324|Q494U9|Q8NB22	Nonsense_Mutation	SNP	smart_PLipase_D/transphosphatidylase	p.R374*	ENST00000536534.2	37	c.1120	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	G	39	7.484326	0.98312	0.0	1.16E-4	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	.	.	.	5.38	4.46	0.54185	.	0.065247	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.3979	13.4569	0.61204	0.0:0.0:0.8428:0.1572	.	.	.	.	X	312;282;374	.	ENSP00000401285:R312X	R	-	1	2	PLD5	240337715	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.110000	0.50352	1.234000	0.43709	0.643000	0.83706	CGA	PLD5	-	NULL	ENSG00000180287		0.358	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	HGNC	protein_coding	OTTHUMT00000397213.2	-	0.00	109	0	G	NM_152666		242271092	-1	tier1	-	no_errors	ENST00000536534	ensembl	human	known	74_37	nonsense	78.38	24	87	SNP	1.000	A
PLVAP	83483	genome.wustl.edu	37	19	17487876	17487876	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:17487876G>T	ENST00000252590.4	-	1	283	c.222C>A	c.(220-222)ctC>ctA	p.L74L		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	74					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TGAGCCCTAGGAGCTGACTGT	0.617																																																	0													107.0	91.0	96.0					19																	17487876		2203	4300	6503	SO:0001819	synonymous_variant	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.222C>A	19.37:g.17487876G>T			Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Silent	SNP	pfam_PV-1	p.L74	ENST00000252590.4	37	c.222	CCDS32952.1	19																																																																																			PLVAP	-	pfam_PV-1	ENSG00000130300		0.617	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	-	0.00	66	0	G	NM_031310		17487876	-1	tier1	-	no_errors	ENST00000252590	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.000	T
PLXNA4	91584	genome.wustl.edu	37	7	131870107	131870107	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:131870107C>T	ENST00000359827.3	-	16	4071	c.3109G>A	c.(3109-3111)Gtg>Atg	p.V1037M	PLXNA4_ENST00000321063.4_Missense_Mutation_p.V1037M			Q9HCM2	PLXA4_HUMAN	plexin A4	1037	IPT/TIG 2.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GGGTCTTCCACATACTGAAAG	0.542																																																	0													120.0	127.0	125.0					7																	131870107		2063	4191	6254	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.3109G>A	7.37:g.131870107C>T	ENSP00000352882:p.Val1037Met		A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.V1037M	ENST00000359827.3	37	c.3109	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	14.59	2.581170	0.46006	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.59906	0.23;0.23	5.6	2.83	0.33086	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.112691	0.64402	N	0.000012	T	0.57286	0.2043	L	0.58302	1.8	0.54753	D	0.999983	P	0.48016	0.904	P	0.47044	0.535	T	0.54207	-0.8328	10	0.41790	T	0.15	.	11.0701	0.47997	0.0:0.7982:0.0:0.2018	.	1037	Q9HCM2	PLXA4_HUMAN	M	1037	ENSP00000323194:V1037M;ENSP00000352882:V1037M	ENSP00000323194:V1037M	V	-	1	0	PLXNA4	131520647	0.203000	0.23435	0.879000	0.34478	0.603000	0.37013	0.803000	0.27083	0.330000	0.23485	0.561000	0.74099	GTG	PLXNA4	-	superfamily_Ig_E-set,smart_IPT	ENSG00000221866		0.542	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	-	0.00	74	0	C	NM_181775		131870107	-1	tier1	-	no_errors	ENST00000321063	ensembl	human	known	74_37	missense	60.26	31	47	SNP	0.988	T
PLXND1	23129	genome.wustl.edu	37	3	129286546	129286546	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:129286546C>T	ENST00000324093.4	-	21	4146	c.3968G>A	c.(3967-3969)cGc>cAc	p.R1323H	PLXND1_ENST00000393239.1_Missense_Mutation_p.R1323H	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1323					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)	p.R1323H(1)	PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						ACTACCTTTGCGGATTTCCTC	0.612																																					Ovarian(97;366 1484 3738 22084 39045)												1	Substitution - Missense(1)	large_intestine(1)											71.0	65.0	67.0					3																	129286546		2203	4300	6503	SO:0001583	missense	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3968G>A	3.37:g.129286546C>T	ENSP00000317128:p.Arg1323His		A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.R1323H	ENST00000324093.4	37	c.3968	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512850	0.85389	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.39406	1.14;1.08	5.3	4.42	0.53409	.	0.144561	0.46758	D	0.000274	T	0.60573	0.2279	M	0.66939	2.045	0.54753	D	0.999983	D	0.89917	1.0	D	0.85130	0.997	T	0.63559	-0.6610	10	0.87932	D	0	.	11.2454	0.48993	0.0:0.8012:0.128:0.0708	.	1323	Q9Y4D7	PLXD1_HUMAN	H	1323	ENSP00000317128:R1323H;ENSP00000376931:R1323H	ENSP00000317128:R1323H	R	-	2	0	PLXND1	130769236	1.000000	0.71417	0.885000	0.34714	0.894000	0.52154	5.332000	0.65911	1.228000	0.43614	0.655000	0.94253	CGC	PLXND1	-	NULL	ENSG00000004399		0.612	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	61	0	C	NM_015103		129286546	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.998	T
PMAIP1	5366	genome.wustl.edu	37	18	57569920	57569920	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:57569920G>T	ENST00000316660.6	+	2	330	c.100G>T	c.(100-102)Gac>Tac	p.D34Y	PMAIP1_ENST00000269518.9_Missense_Mutation_p.R84I	NM_021127.2	NP_066950.1	Q13794	APR_HUMAN	phorbol-12-myristate-13-acetate-induced protein 1	34					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of mitochondrial membrane potential (GO:0010917)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|proteasomal protein catabolic process (GO:0010498)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane permeability (GO:0046902)|release of cytochrome c from mitochondria (GO:0001836)|response to dsRNA (GO:0043331)|response to UV (GO:0009411)|response to X-ray (GO:0010165)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(1)	1		Colorectal(73;0.0946)				GAGATTTGGAGACAAACTGAA	0.438																																																	0													104.0	105.0	104.0					18																	57569920		2203	4300	6503	SO:0001583	missense	0			D90070	CCDS11975.1	18q21.32	2014-03-07			ENSG00000141682	ENSG00000141682			9108	protein-coding gene	gene with protein product		604959				2398525, 12879012	Standard	NM_021127		Approved	APR, NOXA	uc002lic.2	Q13794	OTTHUMG00000132765	ENST00000316660.6:c.100G>T	18.37:g.57569920G>T	ENSP00000326119:p.Asp34Tyr		B2R4T7|Q8N589	Missense_Mutation	SNP	NULL	p.D34Y	ENST00000316660.6	37	c.100	CCDS11975.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.31|19.31	3.802505|3.802505	0.70682|0.70682	.|.	.|.	ENSG00000141682|ENSG00000141682	ENST00000316660|ENST00000269518	.|.	.|.	.|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	.|0.000000	.|0.37906	.|N	.|0.001893	T|T	0.79106|0.79106	0.4390|0.4390	.|.	.|.	.|.	0.43408|0.43408	D|D	0.995541|0.995541	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.91635	1.0|0.999	T|T	0.81109|0.81109	-0.1082|-0.1082	7|8	0.87932|0.87932	D|D	0|0	.|.	14.9298|14.9298	0.70906|0.70906	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	34|84	Q13794|Q8N589	APR_HUMAN|.	Y|I	34|84	.|.	ENSP00000326119:D34Y|ENSP00000269518:R84I	D|R	+|+	1|2	0|0	PMAIP1|PMAIP1	55720900|55720900	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.663000|0.663000	0.39108|0.39108	2.988000|2.988000	0.49386|0.49386	2.793000|2.793000	0.96121|0.96121	0.655000|0.655000	0.94253|0.94253	GAC|AGA	PMAIP1	-	NULL	ENSG00000141682		0.438	PMAIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMAIP1	HGNC	protein_coding	OTTHUMT00000256137.1		0.00	45	0	G	NM_021127		57569920	+1			no_errors	ENST00000316660	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
PODXL2	50512	genome.wustl.edu	37	3	127379570	127379570	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:127379570G>T	ENST00000342480.6	+	3	738	c.699G>T	c.(697-699)gtG>gtT	p.V233V		NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	233					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						CATCAGGTGTGGAGGTGGAGA	0.627																																																	0													62.0	70.0	68.0					3																	127379570		2203	4300	6503	SO:0001819	synonymous_variant	0			AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.699G>T	3.37:g.127379570G>T			Q6UVY4|Q8WUV6	Silent	SNP	pfam_CD34/Podocalyxin	p.V233	ENST00000342480.6	37	c.699	CCDS3044.1	3																																																																																			PODXL2	-	NULL	ENSG00000114631		0.627	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PODXL2	HGNC	protein_coding	OTTHUMT00000356638.1	-	0.00	67	0	G	NM_015720		127379570	+1	tier1	-	no_errors	ENST00000342480	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.741	T
POGK	57645	genome.wustl.edu	37	1	166810311	166810311	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:166810311T>C	ENST00000367875.1	+	2	478	c.118T>C	c.(118-120)Tct>Cct	p.S40P	POGK_ENST00000537173.1_5'UTR|POGK_ENST00000536514.1_5'UTR|POGK_ENST00000367876.4_Missense_Mutation_p.S40P			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	40					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						ACGAATCTGCTCTGAGGGCGG	0.542																																					GBM(76;192 1530 30153 48742)												0													80.0	74.0	76.0					1																	166810311		2203	4300	6503	SO:0001583	missense	0			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.118T>C	1.37:g.166810311T>C	ENSP00000356849:p.Ser40Pro		Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S40P	ENST00000367875.1	37	c.118	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.996194	0.54147	.	.	ENSG00000143157	ENST00000449930;ENST00000367876;ENST00000367875	T;T;T	0.01767	4.75;4.65;4.65	5.34	-0.188	0.13264	Krueppel-associated box (1);	0.172384	0.28219	N	0.016141	T	0.00496	0.0016	N	0.19112	0.55	0.31068	N	0.713303	B	0.26445	0.149	B	0.23150	0.044	T	0.49799	-0.8901	9	0.72032	D	0.01	-11.4389	7.0976	0.25319	0.1492:0.0:0.4629:0.3879	.	40	Q9P215	POGK_HUMAN	P	40	ENSP00000404402:S40P;ENSP00000356850:S40P;ENSP00000356849:S40P	ENSP00000356849:S40P	S	+	1	0	POGK	165076935	0.995000	0.38212	0.991000	0.47740	0.953000	0.61014	1.087000	0.30865	0.142000	0.18901	0.528000	0.53228	TCT	POGK	-	superfamily_Krueppel-associated_box	ENSG00000143157		0.542	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	-	0.00	56	0	T	NM_017542		166810311	+1	tier1	-	no_errors	ENST00000367875	ensembl	human	known	74_37	missense	84.00	4	21	SNP	0.974	C
PPP1R18	170954	genome.wustl.edu	37	6	30653319	30653319	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:30653319G>T	ENST00000274853.3	-	1	2353	c.477C>A	c.(475-477)gcC>gcA	p.A159A	PPP1R18_ENST00000399199.3_Silent_p.A159A|NRM_ENST00000470733.1_5'Flank|PPP1R18_ENST00000488324.1_Intron	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	159						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TCAACTCTTGGGCTCCCCCTA	0.607																																																	0													146.0	162.0	157.0					6																	30653319		1210	2511	3721	SO:0001819	synonymous_variant	0			AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.477C>A	6.37:g.30653319G>T			A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Silent	SNP	NULL	p.A159	ENST00000274853.3	37	c.477	CCDS43444.1	6																																																																																			PPP1R18	-	NULL	ENSG00000146112		0.607	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R18	HGNC	protein_coding	OTTHUMT00000076498.2		0.00	40	0	G	NM_133471		30653319	-1			no_errors	ENST00000274853	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.003	T
PPP2CB	5516	genome.wustl.edu	37	8	30643645	30643645	+	3'UTR	SNP	T	T	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:30643645T>A	ENST00000221138.4	-	0	1486				PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme						apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	AGATCCCAATTTGTTACAGAA	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.*106A>T	8.37:g.30643645T>A			D3DSV4|P11082|Q6FHK5	RNA	SNP	-	NULL	ENST00000221138.4	37	NULL	CCDS6079.1	8																																																																																			PPP2CB	-	-	ENSG00000104695		0.343	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CB	HGNC	protein_coding	OTTHUMT00000376527.2	-	0.00	81	0	T	NM_001009552		30643645	-1	tier1	-	no_errors	ENST00000522113	ensembl	human	putative	74_37	rna	27.94	49	19	SNP	0.999	A
PPP2CB	5516	genome.wustl.edu	37	8	30643971	30643971	+	Intron	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:30643971C>T	ENST00000221138.4	-	7	1308				PPP2CB_ENST00000518564.1_Intron	NM_001009552.1	NP_001009552.1	P62714	PP2AB_HUMAN	protein phosphatase 2, catalytic subunit, beta isozyme						apoptotic mitochondrial changes (GO:0008637)|fibroblast growth factor receptor signaling pathway (GO:0008543)|negative regulation of Ras protein signal transduction (GO:0046580)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|regulation of gene expression (GO:0010468)|response to antibiotic (GO:0046677)|response to endoplasmic reticulum stress (GO:0034976)|response to hydrogen peroxide (GO:0042542)	chromosome, centromeric region (GO:0000775)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	9				KIRC - Kidney renal clear cell carcinoma(542;0.095)|Kidney(114;0.114)	Vitamin E(DB00163)	ATGGGCAAATCACTGCAGATG	0.423																																																	0																																										SO:0001627	intron_variant	0				CCDS6079.1	8p12	2011-05-24	2010-03-05		ENSG00000104695	ENSG00000104695	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9300	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, beta isoform"""	176916	"""protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform"""			8383590	Standard	NM_001009552		Approved	PP2Abeta	uc003xik.3	P62714	OTTHUMG00000163949	ENST00000221138.4:c.858-148G>A	8.37:g.30643971C>T			D3DSV4|P11082|Q6FHK5	RNA	SNP	-	NULL	ENST00000221138.4	37	NULL	CCDS6079.1	8																																																																																			PPP2CB	-	-	ENSG00000104695		0.423	PPP2CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CB	HGNC	protein_coding	OTTHUMT00000376527.2	-	0.00	8	0	C	NM_001009552		30643971	-1	tier1	-	no_errors	ENST00000522113	ensembl	human	putative	74_37	rna	66.67	4	8	SNP	0.005	T
PRDM5	11107	genome.wustl.edu	37	4	121737990	121737990	+	Nonsense_Mutation	SNP	G	G	T	rs187637689		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:121737990G>T	ENST00000264808.3	-	6	980	c.740C>A	c.(739-741)tCg>tAg	p.S247*	PRDM5_ENST00000515109.1_Intron|PRDM5_ENST00000428209.2_Intron	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	247					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						ACAAAACCTCGATGCTGAACT	0.388																																																	0													181.0	187.0	185.0					4																	121737990		2203	4300	6503	SO:0001587	stop_gained	0			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.740C>A	4.37:g.121737990G>T	ENSP00000264808:p.Ser247*		Q0VAI9|Q0VAJ0|Q6NXQ7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_SET_dom,pfscan_Znf_C2H2	p.S247*	ENST00000264808.3	37	c.740	CCDS3716.1	4	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264416	0.80358	.	.	ENSG00000138738	ENST00000264808	.	.	.	5.85	2.91	0.33838	.	0.323249	0.33290	N	0.005064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4286	0.27113	0.3929:0.0:0.6071:0.0	.	.	.	.	X	247	.	ENSP00000264808:S247X	S	-	2	0	PRDM5	121957440	0.999000	0.42202	0.057000	0.19452	0.986000	0.74619	1.198000	0.32223	0.252000	0.21531	-0.345000	0.07892	TCG	PRDM5	-	smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_Znf_C2H2	ENSG00000138738		0.388	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	HGNC	protein_coding	OTTHUMT00000256528.2		0.00	66	0	G			121737990	-1			no_errors	ENST00000264808	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	0.993	T
PSME4	23198	genome.wustl.edu	37	2	54092485	54092486	+	3'UTR	INS	-	-	A	rs398080264|rs56006630	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:54092485_54092486insA	ENST00000404125.1	-	0	5816_5817				PSME4_ENST00000476586.1_5'UTR|PSME4_ENST00000421748.2_3'UTR	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TCAGATGCCTCAAAAAAAAAAA	0.391																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.*230->T	2.37:g.54092496_54092496dupA			Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	RNA	INS	-	NULL	ENST00000404125.1	37	NULL	CCDS33197.2	2																																																																																			PSME4	-	-	ENSG00000068878		0.391	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	HGNC	protein_coding	OTTHUMT00000324163.1		0.00	15	0	-	XM_040158		54092486	-1	tier1		no_errors	ENST00000476586	ensembl	human	known	74_37	rna	25.00	15	5	INS	0.999:0.998	A
PTPRC	5788	genome.wustl.edu	37	1	198711434	198711434	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:198711434G>T	ENST00000367376.2	+	25	2800	c.2629G>T	c.(2629-2631)Gtg>Ttg	p.V877L	PTPRC_ENST00000594404.1_Missense_Mutation_p.V716L|PTPRC_ENST00000352140.3_Missense_Mutation_p.V829L|PTPRC_ENST00000348564.6_Missense_Mutation_p.V718L|PTPRC_ENST00000442510.2_Missense_Mutation_p.V879L	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	877	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						CGAGAACAAAGTGGATGTTTA	0.443																																																	0													230.0	217.0	221.0					1																	198711434		2203	4300	6503	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2629G>T	1.37:g.198711434G>T	ENSP00000356346:p.Val877Leu		A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V879L	ENST00000367376.2	37	c.2635		1	.	.	.	.	.	.	.	.	.	.	G	36	5.691383	0.96793	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	D;T	0.85013	-1.93;2.67	6.06	6.06	0.98353	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.45361	D	0.000376	D	0.89853	0.6835	L	0.35854	1.095	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.76071	0.987;0.987;0.987	D	0.89827	0.3993	10	0.72032	D	0.01	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	718;829;877	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	L	879;829;877;716	ENSP00000356346:V879L;ENSP00000193532:V829L	ENSP00000306782:V716L	V	+	1	0	PTPRC	196978057	1.000000	0.71417	0.896000	0.35187	0.963000	0.63663	4.749000	0.62155	2.879000	0.98667	0.650000	0.86243	GTG	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000081237		0.443	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		-	0.00	94	0	G			198711434	+1	tier1	-	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
PTPRH	5794	genome.wustl.edu	37	19	55697657	55697657	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:55697657C>T	ENST00000376350.3	-	16	2736	c.2714G>A	c.(2713-2715)cGc>cAc	p.R905H	PTPRH_ENST00000263434.5_Missense_Mutation_p.R727H	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	905	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CCACACCAGGCGCCAGAAGTC	0.642																																																	0													40.0	43.0	42.0					19																	55697657		2203	4300	6503	SO:0001583	missense	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.2714G>A	19.37:g.55697657C>T	ENSP00000365528:p.Arg905His		C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R905H	ENST00000376350.3	37	c.2714	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491417	0.84962	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	D;D	0.85088	-1.94;-1.94	5.12	4.08	0.47627	Protein-tyrosine phosphatase, receptor/non-receptor type (4);	0.000000	0.34932	N	0.003574	D	0.88377	0.6420	M	0.80616	2.505	0.48696	D	0.999694	P;D	0.61697	0.919;0.99	B;P	0.49999	0.343;0.628	D	0.89802	0.3976	10	0.87932	D	0	.	13.006	0.58705	0.0:0.9196:0.0:0.0803	.	727;905	C9JCH2;Q9HD43	.;PTPRH_HUMAN	H	905;727	ENSP00000365528:R905H;ENSP00000263434:R727H	ENSP00000263434:R727H	R	-	2	0	PTPRH	60389469	0.989000	0.36119	0.991000	0.47740	0.988000	0.76386	2.897000	0.48664	1.316000	0.45131	0.650000	0.86243	CGC	PTPRH	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000080031		0.642	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	-	0.00	66	0	C			55697657	-1	tier1	-	no_errors	ENST00000376350	ensembl	human	known	74_37	missense	6.25	75	5	SNP	1.000	T
RAX	30062	genome.wustl.edu	37	18	56939807	56939807	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:56939807C>T	ENST00000334889.3	-	2	515	c.329G>A	c.(328-330)cGg>cAg	p.R110Q	RAX_ENST00000256852.7_Intron	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	110					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		TGGGCTCGGCCGTGCCTCCCC	0.687																																					GBM(150;770 1898 17679 24325 37807)												0													52.0	54.0	53.0					18																	56939807		2202	4298	6500	SO:0001583	missense	0			AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.329G>A	18.37:g.56939807C>T	ENSP00000334813:p.Arg110Gln		Q86V11	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.R110Q	ENST00000334889.3	37	c.329	CCDS11972.1	18	.	.	.	.	.	.	.	.	.	.	C	15.63	2.888955	0.52014	.	.	ENSG00000134438	ENST00000334889	D	0.88818	-2.43	6.04	5.15	0.70609	.	0.534119	0.22390	N	0.060686	T	0.78604	0.4309	L	0.27053	0.805	0.09310	N	0.999996	P	0.48089	0.905	B	0.35039	0.194	T	0.68379	-0.5424	10	0.15066	T	0.55	.	13.7287	0.62774	0.1544:0.8456:0.0:0.0	.	110	Q9Y2V3	RX_HUMAN	Q	110	ENSP00000334813:R110Q	ENSP00000334813:R110Q	R	-	2	0	RAX	55090787	0.969000	0.33509	0.916000	0.36221	0.452000	0.32318	2.419000	0.44671	1.523000	0.49018	0.561000	0.74099	CGG	RAX	-	NULL	ENSG00000134438		0.687	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAX	HGNC	protein_coding	OTTHUMT00000256128.2	-	0.00	66	0	C			56939807	-1	tier1	-	no_errors	ENST00000334889	ensembl	human	known	74_37	missense	17.14	58	12	SNP	0.304	T
RBCK1	10616	genome.wustl.edu	37	20	409671	409671	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr20:409671G>T	ENST00000356286.5	+	11	2090	c.1385G>T	c.(1384-1386)tGg>tTg	p.W462L	RBCK1_ENST00000353660.3_Missense_Mutation_p.W420L|RBCK1_ENST00000382181.2_Missense_Mutation_p.W292L	NM_031229.2	NP_112506.2	Q9BYM8	HOIL1_HUMAN	RanBP-type and C3HC4-type zinc finger containing 1	462					negative regulation of necroptotic process (GO:0060546)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(4)	5		all_epithelial(17;0.172)|Lung NSC(37;0.191)|Breast(17;0.231)				GGCTGCGACTGGATCCGCTGC	0.667																																																	0													34.0	35.0	35.0					20																	409671		2203	4300	6503	SO:0001583	missense	0			U67322	CCDS12998.1, CCDS13000.2	20p13	2014-09-17	2006-06-28	2006-06-28	ENSG00000125826	ENSG00000125826		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, RAN-binding domain containing"""	15864	protein-coding gene	gene with protein product	"""heme-oxidized IRP2 ubiquitin ligase 1"""	610924	"""chromosome 20 open reading frame 18"""	C20orf18			Standard	NM_031229		Approved	RBCK2, XAP4, RNF54, ZRANB4, UBCE7IP3, HOIL1	uc002wdp.4	Q9BYM8	OTTHUMG00000031634	ENST00000356286.5:c.1385G>T	20.37:g.409671G>T	ENSP00000348632:p.Trp462Leu		O95623|Q86SL2|Q96BS3|Q9BYM9	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Znf_RING,pfscan_Znf_RanBP2,pfscan_Znf_RING,pfscan_Ubiquitin_supergroup	p.W462L	ENST00000356286.5	37	c.1385	CCDS13000.2	20	.	.	.	.	.	.	.	.	.	.	G	25.5	4.640186	0.87760	.	.	ENSG00000125826	ENST00000356286;ENST00000353660;ENST00000382181	T;T;T	0.61742	0.08;0.08;0.08	5.03	5.03	0.67393	Zinc finger, C6HC-type (1);	0.000000	0.85682	D	0.000000	T	0.67608	0.2911	L	0.39467	1.215	0.80722	D	1	D;P;P	0.89917	1.0;0.952;0.933	D;P;P	0.75020	0.985;0.798;0.872	T	0.66496	-0.5909	10	0.44086	T	0.13	-1.0322	15.8931	0.79315	0.0:0.0:1.0:0.0	.	292;420;462	A6PVK0;Q9BYM8-3;Q9BYM8	.;.;HOIL1_HUMAN	L	462;420;292	ENSP00000348632:W462L;ENSP00000254960:W420L;ENSP00000371616:W292L	ENSP00000254960:W420L	W	+	2	0	RBCK1	357671	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.201000	0.95017	2.619000	0.88677	0.650000	0.86243	TGG	RBCK1	-	pfam_Znf_C6HC	ENSG00000125826		0.667	RBCK1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	RBCK1	HGNC	protein_coding	OTTHUMT00000077461.3		0.00	19	0	G	NM_031229		409671	+1			no_errors	ENST00000356286	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
RBL2	5934	genome.wustl.edu	37	16	53503977	53503977	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:53503977G>C	ENST00000262133.6	+	15	2262	c.2125G>C	c.(2125-2127)Gtg>Ctg	p.V709L	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Intron	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	709	Pocket; binds E1A.|Spacer.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGCTGTCCCTGTGCAGAATGT	0.557																																																	0													77.0	70.0	72.0					16																	53503977		2198	4300	6498	SO:0001583	missense	0			X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2125G>C	16.37:g.53503977G>C	ENSP00000262133:p.Val709Leu		B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.V709L	ENST00000262133.6	37	c.2125	CCDS10748.1	16	.	.	.	.	.	.	.	.	.	.	G	13.17	2.158504	0.38119	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.89552	-2.53	5.54	3.5	0.40072	.	0.344862	0.27581	N	0.018725	T	0.76212	0.3956	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.70722	-0.4794	10	0.33141	T	0.24	-9.6066	11.0268	0.47748	0.0757:0.1403:0.7839:0.0	.	709;419;709	Q8NE70;E9PG04;Q08999	.;.;RBL2_HUMAN	L	709;419	ENSP00000262133:V709L	ENSP00000262133:V709L	V	+	1	0	RBL2	52061478	0.988000	0.35896	0.941000	0.38009	0.977000	0.68977	1.962000	0.40442	1.572000	0.49736	0.650000	0.86243	GTG	RBL2	-	NULL	ENSG00000103479		0.557	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBL2	HGNC	protein_coding	OTTHUMT00000256908.3	-	0.00	84	0	G	NM_005611		53503977	+1	tier1	-	no_errors	ENST00000262133	ensembl	human	known	74_37	missense	41.67	35	25	SNP	0.927	C
RBM11	54033	genome.wustl.edu	37	21	15596828	15596828	+	Silent	SNP	A	A	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr21:15596828A>G	ENST00000400577.3	+	4	411	c.402A>G	c.(400-402)ttA>ttG	p.L134L	RBM11_ENST00000468643.1_3'UTR	NM_144770.3	NP_658983.3	P57052	RBM11_HUMAN	RNA binding motif protein 11	134					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|mRNA processing (GO:0006397)|multicellular organismal development (GO:0007275)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(U) RNA binding (GO:0008266)|protein homodimerization activity (GO:0042803)			endometrium(3)|kidney(3)|lung(7)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16				Epithelial(23;0.000314)|COAD - Colon adenocarcinoma(22;0.00242)|Colorectal(24;0.0129)|Lung(58;0.141)		ATACTTCTTTACCTCAAGAAT	0.289																																																	0													58.0	55.0	56.0					21																	15596828		1790	4059	5849	SO:0001819	synonymous_variant	0			AF130358	CCDS46635.1	21q11	2013-02-12			ENSG00000185272	ENSG00000185272		"""RNA binding motif (RRM) containing"""	9897	protein-coding gene	gene with protein product						12036298	Standard	NM_144770		Approved		uc002yjo.4	P57052	OTTHUMG00000074263	ENST00000400577.3:c.402A>G	21.37:g.15596828A>G			Q6YNC2|Q8NBA1|Q8NFF6	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L134	ENST00000400577.3	37	c.402	CCDS46635.1	21																																																																																			RBM11	-	NULL	ENSG00000185272		0.289	RBM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM11	HGNC	protein_coding	OTTHUMT00000157818.1	-	0.00	49	0	A	NM_144770		15596828	+1	tier1	-	no_errors	ENST00000400577	ensembl	human	known	74_37	silent	37.14	22	13	SNP	1.000	G
RBM46	166863	genome.wustl.edu	37	4	155749035	155749035	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:155749035G>T	ENST00000281722.3	+	5	1653	c.1418G>T	c.(1417-1419)cGc>cTc	p.R473L	RBM46_ENST00000510397.1_3'UTR	NM_144979.3	NP_659416.1	Q8TBY0	RBM46_HUMAN	RNA binding motif protein 46	473							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|skin(3)|urinary_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0854)				AATTTCCATCGCAGCTCAATA	0.363																																																	0													154.0	160.0	158.0					4																	155749035		2203	4300	6503	SO:0001583	missense	0			BC028588	CCDS3790.1, CCDS64085.1, CCDS64086.1	4q32.1	2013-02-12				ENSG00000151962		"""RNA binding motif (RRM) containing"""	28401	protein-coding gene	gene with protein product	"""cancer/testis antigen 68"""					12477932	Standard	NM_144979		Approved	MGC27016, CT68	uc003ioo.4	Q8TBY0		ENST00000281722.3:c.1418G>T	4.37:g.155749035G>T	ENSP00000281722:p.Arg473Leu		B3KWU8|B4DZ27	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.R473L	ENST00000281722.3	37	c.1418	CCDS3790.1	4	.	.	.	.	.	.	.	.	.	.	G	11.28	1.592387	0.28357	.	.	ENSG00000151962	ENST00000281722	T	0.15952	2.38	5.43	5.43	0.79202	.	0.181348	0.37012	N	0.002292	T	0.06917	0.0176	N	0.02011	-0.69	0.80722	D	1	B	0.13145	0.007	B	0.15484	0.013	T	0.24764	-1.0151	10	0.45353	T	0.12	-0.2019	9.5518	0.39315	0.0768:0.1446:0.7786:0.0	.	473	Q8TBY0	RBM46_HUMAN	L	473	ENSP00000281722:R473L	ENSP00000281722:R473L	R	+	2	0	RBM46	155968485	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.986000	0.40677	2.721000	0.93114	0.655000	0.94253	CGC	RBM46	-	NULL	ENSG00000151962		0.363	RBM46-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM46	HGNC	protein_coding	OTTHUMT00000365259.1		0.00	41	0	G	NM_144979		155749035	+1			no_errors	ENST00000281722	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
RBMX2	51634	genome.wustl.edu	37	X	129546511	129546511	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:129546511G>T	ENST00000305536.6	+	6	722	c.658G>T	c.(658-660)Gag>Tag	p.E220*		NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	220	Lys-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						AGAGCCCAGGGAGGGGCAGAA	0.552																																																	0													51.0	52.0	51.0					X																	129546511		1931	4126	6057	SO:0001587	stop_gained	0			AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.658G>T	X.37:g.129546511G>T	ENSP00000339090:p.Glu220*		A8K9Z0|Q5JY82|Q9Y3I8	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E220*	ENST00000305536.6	37	c.658	CCDS43993.1	X	.	.	.	.	.	.	.	.	.	.	G	17.68	3.450389	0.63290	.	.	ENSG00000134597	ENST00000305536;ENST00000538614	.	.	.	4.53	3.66	0.41972	.	4.793380	0.00357	N	0.000023	.	.	.	.	.	.	0.20307	N	0.999914	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	6.6686	0.23056	0.1281:0.0:0.8719:0.0	.	.	.	.	X	220	.	ENSP00000339090:E220X	E	+	1	0	RBMX2	129374192	0.994000	0.37717	0.381000	0.26106	0.163000	0.22366	3.885000	0.56182	2.224000	0.72417	0.600000	0.82982	GAG	RBMX2	-	NULL	ENSG00000134597		0.552	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX2	HGNC	protein_coding	OTTHUMT00000058265.1	-	0.00	47	0	G	NM_016024		129546511	+1	tier1	-	no_errors	ENST00000305536	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	0.167	T
RBP3	5949	genome.wustl.edu	37	10	48382047	48382047	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:48382047G>A	ENST00000224600.4	-	4	3715	c.3602C>T	c.(3601-3603)tCg>tTg	p.S1201L		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1201	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GCTGCCATCCGAGGCCCCCAC	0.647																																																	0													72.0	72.0	72.0					10																	48382047		2203	4300	6503	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3602C>T	10.37:g.48382047G>A	ENSP00000224600:p.Ser1201Leu		Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.S1201L	ENST00000224600.4	37	c.3602	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325098	0.41197	.	.	ENSG00000107618	ENST00000224600	T	0.66099	-0.19	5.69	-3.01	0.05463	Interphotoreceptor retinol-binding (2);	1.046820	0.07465	N	0.901342	T	0.28167	0.0695	N	0.02181	-0.65	0.09310	N	1	B	0.28026	0.198	B	0.22386	0.039	T	0.13791	-1.0496	10	0.30078	T	0.28	-0.6574	5.0714	0.14609	0.0652:0.1889:0.3067:0.4393	.	1201	P10745	RET3_HUMAN	L	1201	ENSP00000224600:S1201L	ENSP00000224600:S1201L	S	-	2	0	RBP3	48002053	0.000000	0.05858	0.000000	0.03702	0.673000	0.39480	0.033000	0.13754	-0.205000	0.10219	0.655000	0.94253	TCG	RBP3	-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd	ENSG00000107618		0.647	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	-	0.00	82	0	G	NM_002900		48382047	-1	tier1	-	no_errors	ENST00000224600	ensembl	human	known	74_37	missense	42.31	30	22	SNP	0.000	A
RFX2	5990	genome.wustl.edu	37	19	6001944	6001944	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:6001944G>C	ENST00000303657.5	-	15	1890	c.1741C>G	c.(1741-1743)Ctg>Gtg	p.L581V	CTC-232P5.1_ENST00000587836.1_RNA|RFX2_ENST00000592546.1_Missense_Mutation_p.L556V|RFX2_ENST00000359161.3_Missense_Mutation_p.L581V	NM_000635.3	NP_000626.2	P48378	RFX2_HUMAN	regulatory factor X, 2 (influences HLA class II expression)	581					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						CACTGGTCCAGGGAGCTCTGC	0.662																																					Colon(38;171 817 19800 47433 48051)												0													57.0	54.0	55.0					19																	6001944		2203	4300	6503	SO:0001583	missense	0				CCDS12157.1, CCDS12158.1	19p13.3	2011-11-23			ENSG00000087903	ENSG00000087903			9983	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 2"", ""DNA binding protein RFX2"", ""HLA class II regulatory factor RFX2"""	142765				1505960	Standard	NM_000635		Approved	FLJ14226	uc002meb.3	P48378		ENST00000303657.5:c.1741C>G	19.37:g.6001944G>C	ENSP00000306335:p.Leu581Val		A8K581|B3KNC4|Q6IQ44|Q8SNA2	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.L581V	ENST00000303657.5	37	c.1741	CCDS12157.1	19	.	.	.	.	.	.	.	.	.	.	G	18.26	3.583796	0.65992	.	.	ENSG00000087903	ENST00000303657;ENST00000359161;ENST00000537791	T	0.51071	0.72	4.2	3.14	0.36123	.	0.159485	0.42964	D	0.000626	T	0.59224	0.2178	L	0.58925	1.835	0.80722	D	1	D;P	0.64830	0.994;0.947	D;P	0.69824	0.966;0.878	T	0.61652	-0.7019	10	0.87932	D	0	-27.6929	8.4276	0.32737	0.1934:0.0:0.8066:0.0	.	556;581	P48378-2;P48378	.;RFX2_HUMAN	V	581;556;368	ENSP00000306335:L581V	ENSP00000306335:L581V	L	-	1	2	RFX2	5952944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.890000	0.56220	2.019000	0.59389	0.609000	0.83330	CTG	RFX2	-	NULL	ENSG00000087903		0.662	RFX2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFX2	HGNC	protein_coding	OTTHUMT00000452687.1	-	0.00	93	0	G	NM_000635		6001944	-1	tier1	-	no_errors	ENST00000303657	ensembl	human	known	74_37	missense	19.15	76	18	SNP	1.000	C
RHOBTB2	23221	genome.wustl.edu	37	8	22852126	22852126	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:22852126C>T	ENST00000519685.1	+	3	313	c.30C>T	c.(28-30)ggC>ggT	p.G10G	RP11-875O11.1_ENST00000523884.1_RNA|RHOBTB2_ENST00000522948.1_5'Flank	NM_001160036.1	NP_001153508.1	Q9BYZ6	RHBT2_HUMAN	Rho-related BTB domain containing 2	361	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	31		Prostate(55;0.0513)|Breast(100;0.214)		Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		GCCCCGATGGCCCCCAGAAGA	0.547																																																	0													127.0	141.0	137.0					8																	22852126		692	1591	2283	SO:0001819	synonymous_variant	0			AF315385	CCDS6034.1, CCDS55210.1, CCDS55211.1	8p21.2	2013-01-08			ENSG00000008853	ENSG00000008853		"""BTB/POZ domain containing"""	18756	protein-coding gene	gene with protein product		607352				11222756	Standard	NM_001160036		Approved	KIAA0717, DBC2	uc011kzp.1	Q9BYZ6	OTTHUMG00000097827	ENST00000519685.1:c.30C>T	8.37:g.22852126C>T			A8K9Z8|D3DSR8|E9PBU2|E9PEI7|O94825|Q8N4A8|Q9BZK6	Silent	SNP	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.G10	ENST00000519685.1	37	c.30	CCDS55210.1	8																																																																																			RHOBTB2	-	NULL	ENSG00000008853		0.547	RHOBTB2-002	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	RHOBTB2	HGNC	protein_coding	OTTHUMT00000375197.2	-	0.00	68	0	C			22852126	+1	tier1	-	no_errors	ENST00000519685	ensembl	human	putative	74_37	silent	10.26	35	4	SNP	0.017	T
RIMS2	9699	genome.wustl.edu	37	8	105001565	105001565	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:105001565G>T	ENST00000436393.2	+	15	2535	c.2294G>T	c.(2293-2295)cGc>cTc	p.R765L	RIMS2_ENST00000262231.10_Missense_Mutation_p.R826L|RIMS2_ENST00000507740.1_Missense_Mutation_p.R779L|RIMS2_ENST00000406091.3_Missense_Mutation_p.R987L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1049					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CGAGGGACCCGCACTATGACC	0.378										HNSCC(12;0.0054)																																							0													132.0	130.0	130.0					8																	105001565		1874	4095	5969	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2294G>T	8.37:g.105001565G>T	ENSP00000390665:p.Arg765Leu		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R987L	ENST00000436393.2	37	c.2960		8	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862636	0.51482	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.20069	2.1;2.63;2.33;2.27;2.19;2.62	5.54	4.64	0.57946	.	.	.	.	.	T	0.37433	0.1003	L	0.61218	1.895	0.80722	D	1	P;P;D;D;B	0.54207	0.942;0.577;0.965;0.957;0.305	P;B;P;P;B	0.54815	0.532;0.235;0.761;0.673;0.051	T	0.26360	-1.0105	9	0.87932	D	0	.	15.1557	0.72739	0.0:0.0:0.8575:0.1425	.	1049;765;826;779;987	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	L	987;1002;987;1049;826;779;779;765	ENSP00000427018:R987L;ENSP00000384892:R987L;ENSP00000262231:R826L;ENSP00000423559:R779L;ENSP00000386228:R779L;ENSP00000390665:R765L	ENSP00000262231:R826L	R	+	2	0	RIMS2	105070741	1.000000	0.71417	0.791000	0.31998	0.135000	0.20990	4.588000	0.60999	1.304000	0.44892	0.484000	0.47621	CGC	RIMS2	-	NULL	ENSG00000176406		0.378	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	143	0	G	NM_001100117		105001565	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	5.56	85	5	SNP	0.981	T
RIN2	54453	genome.wustl.edu	37	20	19956379	19956379	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr20:19956379G>T	ENST00000255006.6	+	8	2006	c.1857G>T	c.(1855-1857)caG>caT	p.Q619H	RIN2_ENST00000440354.2_Intron|RIN2_ENST00000484638.1_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	570	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						ATTTGTCTCAGAGCTCGGAGC	0.498																																																	0													20.0	22.0	21.0					20																	19956379		2031	4193	6224	SO:0001583	missense	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.1857G>T	20.37:g.19956379G>T	ENSP00000255006:p.Gln619His		Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.Q619H	ENST00000255006.6	37	c.1857	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	G	15.76	2.929665	0.52759	.	.	ENSG00000132669	ENST00000255006	T	0.31769	1.48	5.95	5.0	0.66597	.	0.053822	0.85682	D	0.000000	T	0.48314	0.1493	M	0.79123	2.44	0.80722	D	1	P	0.52170	0.951	P	0.54629	0.757	T	0.50800	-0.8785	9	.	.	.	-22.9271	12.1733	0.54172	0.1407:0.0:0.8593:0.0	.	570	Q8WYP3	RIN2_HUMAN	H	619	ENSP00000255006:Q619H	.	Q	+	3	2	RIN2	19904379	1.000000	0.71417	1.000000	0.80357	0.818000	0.46254	1.774000	0.38573	1.533000	0.49186	-0.136000	0.14681	CAG	RIN2	-	NULL	ENSG00000132669		0.498	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1		0.00	66	0	G			19956379	+1			no_errors	ENST00000255006	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
RNF126	55658	genome.wustl.edu	37	19	651750	651750	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:651750C>T	ENST00000292363.5	-	4	459	c.304G>A	c.(304-306)Gct>Act	p.A102T		NM_194460.2	NP_919442.1			ring finger protein 126											lung(1)	1		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTCGTCAGCCTGCGCCCCA	0.697																																																	0													35.0	31.0	33.0					19																	651750		2200	4299	6499	SO:0001583	missense	0			BC025374	CCDS12039.1	19p13.3	2013-01-09				ENSG00000070423		"""RING-type (C3HC4) zinc fingers"""	21151	protein-coding gene	gene with protein product		615177					Standard	NM_194460		Approved	FLJ20552	uc010drs.3	Q9BV68		ENST00000292363.5:c.304G>A	19.37:g.651750C>T	ENSP00000292363:p.Ala102Thr			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A102T	ENST00000292363.5	37	c.304	CCDS12039.1	19	.	.	.	.	.	.	.	.	.	.	c	4.848	0.157611	0.09236	.	.	ENSG00000070423	ENST00000292363;ENST00000340092	T	0.13901	2.55	4.42	-1.98	0.07480	.	0.502189	0.20368	N	0.093704	T	0.05410	0.0143	N	0.19112	0.55	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.37079	-0.9721	10	0.12766	T	0.61	.	2.6277	0.04934	0.1774:0.1791:0.4592:0.1843	.	102	Q9BV68-2	.	T	102	ENSP00000292363:A102T	ENSP00000292363:A102T	A	-	1	0	RNF126	602750	0.001000	0.12720	0.011000	0.14972	0.054000	0.15201	-0.518000	0.06267	-0.156000	0.11079	-0.379000	0.06801	GCT	RNF126	-	NULL	ENSG00000070423		0.697	RNF126-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF126	HGNC	protein_coding	OTTHUMT00000452104.2	-	0.00	52	0	C	NM_017876		651750	-1	tier1	-	no_errors	ENST00000292363	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.000	T
RPL4	6124	genome.wustl.edu	37	15	66791958	66791958	+	Silent	SNP	T	T	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:66791958T>G	ENST00000307961.6	-	10	1163	c.1071A>C	c.(1069-1071)gcA>gcC	p.A357A	SNAPC5_ENST00000395589.2_5'Flank|MIR4512_ENST00000583257.1_RNA|SNAPC5_ENST00000563480.2_5'Flank|SNAPC5_ENST00000307979.7_5'Flank|RPL4_ENST00000568588.1_Silent_p.A263A|SNAPC5_ENST00000566658.1_5'Flank|SNORD18B_ENST00000365659.1_RNA|SNORD18C_ENST00000362704.1_RNA|SNAPC5_ENST00000316634.5_5'Flank	NM_000968.3	NP_000959.2	P36578	RL4_HUMAN	ribosomal protein L4	357					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)|urinary_tract(1)	17						GTGCCGCTGCTGCAGCAGCTG	0.478																																																	0													31.0	35.0	33.0					15																	66791958		2196	4284	6480	SO:0001819	synonymous_variant	0			AB007167	CCDS10218.1	15q22	2011-04-06			ENSG00000174444	ENSG00000174444		"""L ribosomal proteins"""	10353	protein-coding gene	gene with protein product	"""60S ribosomal protein L4"""	180479				9582194, 8268230	Standard	NM_000968		Approved	L4	uc002apv.3	P36578	OTTHUMG00000133193	ENST00000307961.6:c.1071A>C	15.37:g.66791958T>G			A8K502|P39029|Q4VBR0|Q969Z9	Silent	SNP	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom	p.A357	ENST00000307961.6	37	c.1071	CCDS10218.1	15																																																																																			RPL4	-	NULL	ENSG00000174444		0.478	RPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL4	HGNC	protein_coding	OTTHUMT00000256903.2	-	0.00	63	0	T	NM_000968		66791958	-1	tier1	-	no_errors	ENST00000307961	ensembl	human	known	74_37	silent	38.60	34	22	SNP	0.000	G
RPS3A	6189	genome.wustl.edu	37	4	152020849	152020849	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:152020849G>A	ENST00000274065.4	+	1	125	c.45G>A	c.(43-45)aaG>aaA	p.K15K	RPS3A_ENST00000322686.6_Intron|SNORD73_ENST00000364394.1_RNA|RPS3A_ENST00000514682.1_5'UTR|RPS3A_ENST00000509736.1_5'UTR|RPS3A_ENST00000506126.1_5'UTR|RPS3A_ENST00000512690.1_Silent_p.K15K	NM_001006.4	NP_000997.1			ribosomal protein S3A											endometrium(1)|lung(1)|ovary(1)|pancreas(1)	4	all_hematologic(180;0.093)					GCGGCAAAAAGGGAGCCAAGA	0.597											OREG0016360	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													66.0	68.0	67.0					4																	152020849		2203	4300	6503	SO:0001819	synonymous_variant	0			X87373	CCDS3775.1	4q31.2-q31.3	2011-04-05			ENSG00000145425	ENSG00000145425		"""S ribosomal proteins"""	10421	protein-coding gene	gene with protein product		180478		MFTL		8647443, 1398113	Standard	NM_001006		Approved	S3A	uc003ilz.4	P61247	OTTHUMG00000161445	ENST00000274065.4:c.45G>A	4.37:g.152020849G>A		1744		Silent	SNP	pfam_Ribosomal_S3Ae	p.K15	ENST00000274065.4	37	c.45	CCDS3775.1	4																																																																																			RPS3A	-	pfam_Ribosomal_S3Ae	ENSG00000145425		0.597	RPS3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS3A	HGNC	protein_coding	OTTHUMT00000364957.1	-	0.00	90	0	G			152020849	+1	tier1	-	no_errors	ENST00000274065	ensembl	human	known	74_37	silent	22.86	54	16	SNP	1.000	A
RSF1	51773	genome.wustl.edu	37	11	77386180	77386180	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:77386180G>A	ENST00000308488.6	-	14	3765	c.3463C>T	c.(3463-3465)Cca>Tca	p.P1155S	RSF1_ENST00000360355.2_Missense_Mutation_p.P1124S|RSF1_ENST00000480887.1_Missense_Mutation_p.P903S			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1155	Arg-rich.				CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TGCCTCATTGGCCGAGAGGGG	0.473																																																	0													121.0	117.0	118.0					11																	77386180		2200	4292	6492	SO:0001583	missense	0			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3463C>T	11.37:g.77386180G>A	ENSP00000311513:p.Pro1155Ser		Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P1155S	ENST00000308488.6	37	c.3463	CCDS8253.1	11	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693186	0.88735	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000531026	D;D;D;D	0.92149	-2.21;-2.41;-2.25;-2.98	4.97	4.97	0.65823	.	0.000000	0.51477	D	0.000093	D	0.93278	0.7858	L	0.42245	1.32	0.43874	D	0.996488	D	0.76494	0.999	P	0.61397	0.888	D	0.91468	0.5194	10	0.26408	T	0.33	-8.1426	18.0282	0.89275	0.0:0.0:1.0:0.0	.	1155	Q96T23	RSF1_HUMAN	S	1155;903;1124;264	ENSP00000311513:P1155S;ENSP00000434509:P903S;ENSP00000353511:P1124S;ENSP00000433603:P264S	ENSP00000311513:P1155S	P	-	1	0	RSF1	77063828	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.479000	0.60236	2.575000	0.86900	0.650000	0.86243	CCA	RSF1	-	NULL	ENSG00000048649		0.473	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	HGNC	protein_coding	OTTHUMT00000318075.2	-	0.00	58	0	G	NM_016578		77386180	-1	tier1	-	no_errors	ENST00000308488	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
RXFP2	122042	genome.wustl.edu	37	13	32348756	32348756	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr13:32348756G>T	ENST00000298386.2	+	6	568		c.e6-1		RXFP2_ENST00000380314.1_Splice_Site	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		ATTCCTACCAGATTTCTTCAG	0.333																																																	0													144.0	144.0	144.0					13																	32348756		2202	4299	6501	SO:0001630	splice_region_variant	0			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.498-1G>T	13.37:g.32348756G>T			B1ALE9|Q3KU23	Splice_Site	SNP	-	e6-1	ENST00000298386.2	37	c.498-1	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	G	19.94	3.920586	0.73213	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0292	0.86456	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RXFP2	31246756	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.487000	0.66863	2.635000	0.89317	0.650000	0.86243	.	RXFP2	-	-	ENSG00000133105		0.333	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	-	0.00	35	0	G	NM_130806	Intron	32348756	+1	tier1	-	no_errors	ENST00000298386	ensembl	human	known	74_37	splice_site	11.11	24	3	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	38990574	38990574	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:38990574A>C	ENST00000359596.3	+	45	7241	c.7241A>C	c.(7240-7242)aAc>aCc	p.N2414T	RYR1_ENST00000360985.3_Missense_Mutation_p.N2414T|RYR1_ENST00000355481.4_Missense_Mutation_p.N2414T			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2414	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCTGAAGAAAACCGGGTGCAC	0.637																																																	0													114.0	94.0	101.0					19																	38990574		2203	4300	6503	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7241A>C	19.37:g.38990574A>C	ENSP00000352608:p.Asn2414Thr		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.N2414T	ENST00000359596.3	37	c.7241	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	A	12.60	1.987090	0.35036	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97710	-4.5;-4.5;-4.5	3.99	3.99	0.46301	.	0.000000	0.64402	U	0.000001	D	0.95655	0.8587	L	0.60455	1.87	0.36100	D	0.84407	P;B	0.37500	0.597;0.03	B;B	0.34722	0.188;0.031	D	0.97840	1.0268	10	0.87932	D	0	.	12.003	0.53241	1.0:0.0:0.0:0.0	.	2414;2414	P21817-2;P21817	.;RYR1_HUMAN	T	2414	ENSP00000352608:N2414T;ENSP00000347667:N2414T;ENSP00000354254:N2414T	ENSP00000347667:N2414T	N	+	2	0	RYR1	43682414	1.000000	0.71417	1.000000	0.80357	0.641000	0.38312	4.622000	0.61240	1.663000	0.50791	0.247000	0.18012	AAC	RYR1	-	NULL	ENSG00000196218		0.637	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1		0.00	40	0	A			38990574	+1			no_errors	ENST00000359596	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	C
RYR3	6263	genome.wustl.edu	37	15	34115234	34115234	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:34115234G>T	ENST00000389232.4	+	81	11103	c.11033G>T	c.(11032-11034)gGa>gTa	p.G3678V	RYR3_ENST00000415757.3_Missense_Mutation_p.G3673V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3678					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAGGATGCTGGATTCTTTCAA	0.433																																																	0													114.0	109.0	111.0					15																	34115234		1844	4107	5951	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11033G>T	15.37:g.34115234G>T	ENSP00000373884:p.Gly3678Val		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.G3678V	ENST00000389232.4	37	c.11033	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710735	0.68730	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.89875	-2.58	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.94138	0.8120	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76575	0.973;0.988	D	0.94025	0.7296	10	0.62326	D	0.03	.	19.2535	0.93935	0.0:0.0:1.0:0.0	.	3673;3678	Q15413-2;Q15413	.;RYR3_HUMAN	V	3678;3677;3673	ENSP00000373884:G3678V	ENSP00000354735:G3673V	G	+	2	0	RYR3	31902526	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.601000	0.98297	2.780000	0.95670	0.655000	0.94253	GGA	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.433	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	73	0	G			34115234	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	6.49	72	5	SNP	1.000	T
SCN11A	11280	genome.wustl.edu	37	3	38913192	38913194	+	In_Frame_Del	DEL	ACC	ACC	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	ACC	ACC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:38913192_38913194delACC	ENST00000302328.3	-	21	3699_3701	c.3501_3503delGGT	c.(3499-3504)gtggtc>gtc	p.1167_1168VV>V	SCN11A_ENST00000444237.2_In_Frame_Del_p.1167_1168VV>V|SCN11A_ENST00000456224.3_In_Frame_Del_p.1129_1130VV>V|SCN11A_ENST00000450244.1_In_Frame_Del_p.1167_1168VV>V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1167					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GAGAGCATTGACCACCACCTTAT	0.443																																																	0																																										SO:0001651	inframe_deletion	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3501_3503delGGT	3.37:g.38913198_38913200delACC	ENSP00000307599:p.Val1168del		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	In_Frame_Del	DEL	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.V1168in_frame_del	ENST00000302328.3	37	c.3503_3501	CCDS33737.1	3																																																																																			SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.443	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4		0.00	56	0	ACC	NM_014139		38913194	-1	tier1		no_errors	ENST00000302328	ensembl	human	known	74_37	in_frame_del	33.33	24	12	DEL	1.000:1.000:0.039	-
SACM1L	22908	genome.wustl.edu	37	3	45776840	45776840	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:45776840G>A	ENST00000389061.5	+	14	1418	c.1214G>A	c.(1213-1215)cGt>cAt	p.R405H	SACM1L_ENST00000541314.1_Missense_Mutation_p.R344H|SACM1L_ENST00000418611.1_Missense_Mutation_p.R302H	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	405	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TTGTTAGCTCGTCGTTCACTT	0.413																																																	0													159.0	135.0	143.0					3																	45776840		2203	4300	6503	SO:0001583	missense	0			AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.1214G>A	3.37:g.45776840G>A	ENSP00000373713:p.Arg405His		A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.R405H	ENST00000389061.5	37	c.1214	CCDS33745.1	3	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038482	0.55003	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314;ENST00000433336	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.68	3.63	0.41609	Synaptojanin, N-terminal (1);	0.157463	0.64402	N	0.000016	T	0.32255	0.0823	M	0.64630	1.985	0.80722	D	1	B;B;B	0.34103	0.293;0.033;0.437	B;B;B	0.27170	0.057;0.031;0.077	T	0.18085	-1.0348	10	0.51188	T	0.08	-3.7603	10.7926	0.46443	0.1769:0.0:0.8231:0.0	.	344;48;405	B4DK71;B3KX17;Q9NTJ5	.;.;SAC1_HUMAN	H	302;405;344;82	ENSP00000396387:R302H;ENSP00000373713:R405H;ENSP00000443373:R344H;ENSP00000412883:R82H	ENSP00000373713:R405H	R	+	2	0	SACM1L	45751844	1.000000	0.71417	0.559000	0.28332	0.997000	0.91878	4.622000	0.61240	1.148000	0.42385	0.585000	0.79938	CGT	SACM1L	-	pfscan_Syja_N	ENSG00000211456		0.413	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACM1L	HGNC	protein_coding	OTTHUMT00000345065.2	-	0.00	89	0	G	NM_014016		45776840	+1	tier1	-	no_errors	ENST00000389061	ensembl	human	known	74_37	missense	25.64	58	20	SNP	0.983	A
SCN7A	6332	genome.wustl.edu	37	2	167279905	167279906	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:167279905_167279906insT	ENST00000409855.1	-	18	3016_3017	c.2890_2891insA	c.(2890-2892)attfs	p.I964fs		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	964					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TAAAATTTTAATTGTCTTTCTC	0.287																																																	0																																										SO:0001589	frameshift_variant	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2891dupA	2.37:g.167279907_167279907dupT	ENSP00000386796:p.Ile964fs			Frame_Shift_Ins	INS	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.I964fs	ENST00000409855.1	37	c.2891_2890	CCDS46442.1	2																																																																																			SCN7A	-	NULL	ENSG00000136546		0.287	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1		0.00	86	0	-			167279906	-1	tier1		no_errors	ENST00000409855	ensembl	human	known	74_37	frame_shift_ins	36.54	33	19	INS	1.000:0.999	T
SCN7A	6332	genome.wustl.edu	37	2	167279908	167279908	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:167279908G>A	ENST00000409855.1	-	18	3014	c.2888C>T	c.(2887-2889)aCa>aTa	p.T963I		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	963					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	AATTTTAATTGTCTTTCTCTG	0.284																																																	0													38.0	36.0	36.0					2																	167279908		1838	4125	5963	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2888C>T	2.37:g.167279908G>A	ENSP00000386796:p.Thr963Ile			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.T963I	ENST00000409855.1	37	c.2888	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	G	17.03	3.283957	0.59867	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.97430	-4.38	4.65	4.65	0.58169	.	0.102204	0.43416	D	0.000577	D	0.97269	0.9107	L	0.39692	1.235	0.29117	N	0.880501	D	0.76494	0.999	D	0.83275	0.996	D	0.93798	0.7098	10	0.52906	T	0.07	.	15.3904	0.74739	0.0:0.0:1.0:0.0	.	963	Q01118	SCN7A_HUMAN	I	963	ENSP00000386796:T963I	ENSP00000259060:T963I	T	-	2	0	SCN7A	166988154	0.000000	0.05858	1.000000	0.80357	0.961000	0.63080	0.265000	0.18515	2.567000	0.86603	0.585000	0.79938	ACA	SCN7A	-	NULL	ENSG00000136546		0.284	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	86	0	G			167279908	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	missense	45.83	26	22	SNP	1.000	A
SDK2	54549	genome.wustl.edu	37	17	71382003	71382003	+	Missense_Mutation	SNP	C	C	T	rs562611295	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:71382003C>T	ENST00000392650.3	-	32	4552	c.4552G>A	c.(4552-4554)Gtg>Atg	p.V1518M	SDK2_ENST00000388726.3_Missense_Mutation_p.V1518M	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1518	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CGGATTAGCACGGAGGTGGTG	0.637													C|||	2	0.000399361	0.0008	0.0	5008	,	,		15519	0.0		0.0	False		,,,				2504	0.001																0													76.0	65.0	68.0					17																	71382003		2203	4299	6502	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.4552G>A	17.37:g.71382003C>T	ENSP00000376421:p.Val1518Met		A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1518M	ENST00000392650.3	37	c.4552	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438875	0.83885	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.59772	0.24;0.24;0.24	4.57	4.57	0.56435	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.74726	0.3754	M	0.72353	2.195	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	T	0.75130	-0.3426	10	0.39692	T	0.17	.	17.3082	0.87201	0.0:1.0:0.0:0.0	.	1518;1518;1518	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	M	1142;1518;1518;694;1518	ENSP00000376421:V1518M;ENSP00000373378:V1518M;ENSP00000407098:V694M	ENSP00000324967:V1518M	V	-	1	0	SDK2	68893598	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	7.046000	0.76592	2.248000	0.74166	0.655000	0.94253	GTG	SDK2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000069188		0.637	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	-	0.00	51	0	C	NM_019064		71382003	-1	tier1	-	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
SESTD1	91404	genome.wustl.edu	37	2	180047847	180047847	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:180047847C>A	ENST00000428443.3	-	3	440	c.124G>T	c.(124-126)Gag>Tag	p.E42*	SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	42	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			ACACTCAGCTCATCCATATTT	0.358																																																	0													115.0	117.0	116.0					2																	180047847		2203	4300	6503	SO:0001587	stop_gained	0			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.124G>T	2.37:g.180047847C>A	ENSP00000415332:p.Glu42*		Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Nonsense_Mutation	SNP	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.E42*	ENST00000428443.3	37	c.124	CCDS33338.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.786699	0.96937	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.8472	19.4431	0.94831	0.0:1.0:0.0:0.0	.	.	.	.	X	42	.	.	E	-	1	0	SESTD1	179756092	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.246000	0.78247	2.660000	0.90430	0.655000	0.94253	GAG	SESTD1	-	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000187231		0.358	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	HGNC	protein_coding	OTTHUMT00000335916.2	-	0.00	45	0	C	NM_178123		180047847	-1	tier1	-	no_errors	ENST00000428443	ensembl	human	known	74_37	nonsense	37.04	34	20	SNP	1.000	A
SETBP1	26040	genome.wustl.edu	37	18	42643578	42643578	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:42643578C>T	ENST00000282030.5	+	6	5002	c.4706C>T	c.(4705-4707)cCg>cTg	p.P1569L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1569						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CAGTCGCCCCCGCAGCAGCCC	0.682									Schinzel-Giedion syndrome																																								0													8.0	10.0	9.0					18																	42643578		2125	4108	6233	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4706C>T	18.37:g.42643578C>T	ENSP00000282030:p.Pro1569Leu		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.P1569L	ENST00000282030.5	37	c.4706	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	C	6.316	0.426323	0.11987	.	.	ENSG00000152217	ENST00000282030	T	0.68025	-0.3	3.01	2.12	0.27331	.	0.402094	0.19140	N	0.121707	T	0.41650	0.1168	N	0.08118	0	0.37284	D	0.907941	B	0.19706	0.038	B	0.21708	0.036	T	0.26916	-1.0089	10	0.29301	T	0.29	.	7.3934	0.26923	0.2593:0.7407:0.0:0.0	.	1569	Q9Y6X0	SETBP_HUMAN	L	1569	ENSP00000282030:P1569L	ENSP00000282030:P1569L	P	+	2	0	SETBP1	40897576	0.002000	0.14202	0.580000	0.28601	0.947000	0.59692	0.579000	0.23788	0.795000	0.33922	0.561000	0.74099	CCG	SETBP1	-	NULL	ENSG00000152217		0.682	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	12	0	C	NM_001130110		42643578	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.954	T
SH3TC2	79628	genome.wustl.edu	37	5	148407138	148407138	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:148407138G>T	ENST00000515425.1	-	11	2258	c.2157C>A	c.(2155-2157)acC>acA	p.T719T	SH3TC2_ENST00000538184.1_Silent_p.T266T|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000394358.2_Silent_p.T604T|SH3TC2_ENST00000512049.1_Silent_p.T712T	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	719					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGGAGCTTGGTTGTGTTCT	0.572																																																	0													88.0	90.0	90.0					5																	148407138		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.2157C>A	5.37:g.148407138G>T			B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	pfam_SH3_domain,pfam_TPR_1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.T719	ENST00000515425.1	37	c.2157	CCDS4293.1	5																																																																																			SH3TC2	-	NULL	ENSG00000169247		0.572	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	-	0.00	112	0	G	NM_024577		148407138	-1	tier1	-	no_errors	ENST00000515425	ensembl	human	known	74_37	silent	6.45	58	4	SNP	0.024	T
SIGLEC9	27180	genome.wustl.edu	37	19	51629013	51629013	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:51629013G>A	ENST00000250360.3	+	2	648	c.581G>A	c.(580-582)cGc>cAc	p.R194H	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.R194H	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	194	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TCCACCACCCGCTCCTCGGTG	0.652																																																	0													68.0	68.0	68.0					19																	51629013		2203	4300	6503	SO:0001583	missense	0			AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.581G>A	19.37:g.51629013G>A	ENSP00000250360:p.Arg194His		Q6GTU4|Q9BYI9	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.R194H	ENST00000250360.3	37	c.581	CCDS12825.1	19	.	.	.	.	.	.	.	.	.	.	.	0.453	-0.893055	0.02491	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.02974	4.09;4.09	2.88	-5.75	0.02384	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	2.080600	0.02442	N	0.084714	T	0.01454	0.0047	N	0.11789	0.175	0.09310	N	1	B	0.19331	0.035	B	0.11329	0.006	T	0.43940	-0.9360	10	0.08381	T	0.77	.	2.32	0.04208	0.5591:0.1183:0.1585:0.1641	.	194	Q9Y336	SIGL9_HUMAN	H	194	ENSP00000413861:R194H;ENSP00000250360:R194H	ENSP00000250360:R194H	R	+	2	0	SIGLEC9	56320825	0.000000	0.05858	0.001000	0.08648	0.167000	0.22549	-1.597000	0.02089	-1.909000	0.01085	-1.173000	0.01734	CGC	SIGLEC9	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000129450		0.652	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIGLEC9	HGNC	protein_coding	OTTHUMT00000464224.1	-	0.00	58	0	G	NM_014441		51629013	+1	tier1	-	no_errors	ENST00000440804	ensembl	human	known	74_37	missense	24.62	49	16	SNP	0.001	A
SIGLEC8	27181	genome.wustl.edu	37	19	51958907	51958907	+	Silent	SNP	T	T	C			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:51958907T>C	ENST00000321424.3	-	4	882	c.816A>G	c.(814-816)tcA>tcG	p.S272S	SIGLEC8_ENST00000430817.1_Silent_p.S163S|SIGLEC8_ENST00000340550.5_Silent_p.S179S|SIGLEC8_ENST00000597352.1_5'UTR	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	272	Ig-like C2-type 2.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCTCAAGGACTGAAAGAGATG	0.562																																																	0													68.0	68.0	68.0					19																	51958907		2203	4300	6503	SO:0001819	synonymous_variant	0			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.816A>G	19.37:g.51958907T>C			Q7Z728	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S272	ENST00000321424.3	37	c.816	CCDS33086.1	19																																																																																			SIGLEC8	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105366		0.562	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC8	HGNC	protein_coding	OTTHUMT00000463648.2	-	0.00	58	0	T	NM_014442		51958907	-1	tier1	-	no_errors	ENST00000321424	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.000	C
SLC22A24	283238	genome.wustl.edu	37	11	62886453	62886453	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:62886453G>A	ENST00000417740.1	-	4	1202	c.761C>T	c.(760-762)gCc>gTc	p.A254V	SLC22A24_ENST00000326192.5_Missense_Mutation_p.A254V	NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	254					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						GTCCTGAATGGCAAAAGCCAG	0.468																																																	0													181.0	157.0	164.0					11																	62886453		692	1591	2283	SO:0001583	missense	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.761C>T	11.37:g.62886453G>A	ENSP00000396586:p.Ala254Val			Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A254V	ENST00000417740.1	37	c.761		11	.	.	.	.	.	.	.	.	.	.	G	8.243	0.807288	0.16467	.	.	ENSG00000197658	ENST00000417740;ENST00000531535;ENST00000326192	T;T	0.59083	0.29;0.35	3.86	-5.19	0.02832	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.438597	0.24035	N	0.042141	T	0.28699	0.0711	N	0.16567	0.415	0.09310	N	0.99999	B;B	0.22604	0.047;0.072	B;B	0.29267	0.085;0.1	T	0.13335	-1.0513	10	0.22706	T	0.39	.	1.9062	0.03278	0.3659:0.3345:0.181:0.1185	.	254;254	Q8N4F4;C9JC66	S22AO_HUMAN;.	V	254	ENSP00000396586:A254V;ENSP00000321549:A254V	ENSP00000321549:A254V	A	-	2	0	SLC22A24	62643029	0.002000	0.14202	0.233000	0.24025	0.084000	0.17831	-2.853000	0.00731	-0.595000	0.05828	-0.412000	0.06146	GCC	SLC22A24	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197658		0.468	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	-	0.00	46	0	G	NM_173586		62886453	-1	tier1	-	no_errors	ENST00000326192	ensembl	human	known	74_37	missense	54.55	20	24	SNP	0.445	A
SLC6A10P	386757	genome.wustl.edu	37	16	32893871	32893871	+	RNA	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:32893871G>A	ENST00000330048.5	-	0	1386					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		TCGATGACAGGGGACTGGCGG	0.617																																																	0																																												0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32893871G>A				RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.617	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	-	0.00	125	0	G			32893871	-1	tier1	-	no_errors	ENST00000330048	ensembl	human	known	74_37	rna	12.20	108	15	SNP	1.000	A
SLC9A1	6548	genome.wustl.edu	37	1	27426042	27426043	+	3'UTR	DEL	AT	AT	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:27426042_27426043delAT	ENST00000263980.3	-	0	3778_3779				SLC9A1_ENST00000490329.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1						carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GCAAACAATCATATATAGGAGT	0.5																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.*756AT>-	1.37:g.27426046_27426047delAT			B1ALD6|D3DPL4|Q96EM2	RNA	DEL	-	NULL	ENST00000263980.3	37	NULL	CCDS295.1	1																																																																																			SLC9A1	-	-	ENSG00000090020		0.500	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2		0.00	59	0	AT	NM_003047		27426043	-1	tier1		no_errors	ENST00000490329	ensembl	human	known	74_37	rna	12.50	35	5	DEL	0.001:0.001	-
SMARCA4	6597	genome.wustl.edu	37	19	11134230	11134230	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:11134230C>T	ENST00000429416.3	+	21	3177	c.2896C>T	c.(2896-2898)Cgg>Tgg	p.R966W	SMARCA4_ENST00000413806.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000344626.4_Missense_Mutation_p.R966W|SMARCA4_ENST00000590574.1_Missense_Mutation_p.R966W|SMARCA4_ENST00000589677.1_Missense_Mutation_p.R966W|SMARCA4_ENST00000541122.2_Missense_Mutation_p.R966W|SMARCA4_ENST00000450717.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000444061.3_Missense_Mutation_p.R966W|SMARCA4_ENST00000358026.2_Missense_Mutation_p.R966W	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	966					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.R966W(1)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				TCTCATCATCCGGCGTCTCCA	0.567			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	2	Substitution - Missense(1)|Unknown(1)	ovary(1)|lung(1)											68.0	61.0	63.0					19																	11134230		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2896C>T	19.37:g.11134230C>T	ENSP00000395654:p.Arg966Trp		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.R966W	ENST00000429416.3	37	c.2896	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649626	0.87958	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.93426	-3.22;-3.22;-3.22;-3.22;-3.22;-3.22;-3.22	4.9	4.9	0.64082	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.97145	0.9067	M	0.88906	2.99	0.58432	D	0.999998	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.994;0.965;0.999;0.999	D	0.97864	1.0282	10	0.87932	D	0	-18.8931	16.9975	0.86372	0.0:1.0:0.0:0.0	.	966;966;966;966;966;186;966;966	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	W	966;966;1030;966;966;966;966;966	ENSP00000395654:R966W;ENSP00000350720:R966W;ENSP00000343896:R966W;ENSP00000445036:R966W;ENSP00000392837:R966W;ENSP00000397783:R966W;ENSP00000414727:R966W	ENSP00000343896:R966W	R	+	1	2	SMARCA4	10995230	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	4.576000	0.60915	2.542000	0.85734	0.655000	0.94253	CGG	SMARCA4	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000127616		0.567	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	130	0	C	NM_003072		11134230	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	64.08	37	66	SNP	1.000	T
SMARCAL1	50485	genome.wustl.edu	37	2	217315721	217315721	+	Silent	SNP	G	G	T	rs369431487		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:217315721G>T	ENST00000357276.4	+	12	2334	c.2004G>T	c.(2002-2004)cgG>cgT	p.R668R	SMARCAL1_ENST00000358207.5_Silent_p.R668R	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	668					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		CCCCAGGACGGATCAATGCCA	0.582									Schimke Immuno-Osseous Dysplasia																																								0													57.0	59.0	59.0					2																	217315721		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	SIOD	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2004G>T	2.37:g.217315721G>T			A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Silent	SNP	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R668	ENST00000357276.4	37	c.2004	CCDS2403.1	2																																																																																			SMARCAL1	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000138375		0.582	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	HGNC	protein_coding	OTTHUMT00000256671.2	-	0.00	56	0	G			217315721	+1	tier1	-	no_errors	ENST00000357276	ensembl	human	known	74_37	silent	9.62	47	5	SNP	0.976	T
SMC2	10592	genome.wustl.edu	37	9	106887225	106887225	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:106887225G>T	ENST00000286398.7	+	18	2578	c.2290G>T	c.(2290-2292)Gaa>Taa	p.E764*	SMC2_ENST00000303219.8_Nonsense_Mutation_p.E764*|SMC2_ENST00000374793.3_Nonsense_Mutation_p.E764*|SMC2_ENST00000374787.3_Nonsense_Mutation_p.E764*	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	764					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						AAACACTAAAGAAATCCAAAG	0.323																																																	0													45.0	47.0	46.0					9																	106887225		2203	4298	6501	SO:0001587	stop_gained	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2290G>T	9.37:g.106887225G>T	ENSP00000286398:p.Glu764*		Q6IEE0|Q9P1P2	Nonsense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.E764*	ENST00000286398.7	37	c.2290	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	G	42	9.417499	0.99164	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	.	.	.	5.1	5.1	0.69264	.	0.046061	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-25.7136	17.6198	0.88077	0.0:0.0:1.0:0.0	.	.	.	.	X	764	.	ENSP00000286398:E764X	E	+	1	0	SMC2	105927046	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	8.568000	0.90741	2.818000	0.97014	0.591000	0.81541	GAA	SMC2	-	superfamily_P-loop_NTPase	ENSG00000136824		0.323	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	52	0	G			106887225	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	nonsense	5.26	72	4	SNP	1.000	T
SNX18	112574	genome.wustl.edu	37	5	53839223	53839223	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:53839223G>A	ENST00000381410.4	+	2	2026	c.1836G>A	c.(1834-1836)caG>caA	p.Q612Q	SNX18_ENST00000343017.6_3'UTR	NM_001102575.1	NP_001096045.1	Q96RF0	SNX18_HUMAN	sorting nexin 18	465	BAR.				cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|positive regulation of GTPase activity (GO:0043547)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	18		Lung NSC(810;3.46e-05)|Breast(144;0.102)				AAGTTACCCAGAAGTTGGAAG	0.333																																																	0													54.0	53.0	53.0					5																	53839223		1813	4079	5892	SO:0001819	synonymous_variant	0			AF395536	CCDS3962.1, CCDS43317.1, CCDS54851.1	5q11.2	2010-05-12	2008-03-11	2008-03-11	ENSG00000178996	ENSG00000178996		"""Sorting nexins"""	19245	protein-coding gene	gene with protein product			"""sorting nexin associated golgi protein 1"""	SNAG1		16782399, 17761170	Standard	NM_052870		Approved	SH3PX2, SH3PXD3B	uc003jpi.4	Q96RF0	OTTHUMG00000096994	ENST00000381410.4:c.1836G>A	5.37:g.53839223G>A			B4E2B3|H7BXX3|Q05BB3|Q0VG02	Silent	SNP	pfam_Sorting_nexin_WASP-bd-dom,pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,smart_Phox,pirsf_Snx9,pfscan_Phox,pfscan_SH3_domain	p.Q612	ENST00000381410.4	37	c.1836	CCDS43317.1	5																																																																																			SNX18	-	pfam_Sorting_nexin_WASP-bd-dom,pirsf_Snx9	ENSG00000178996		0.333	SNX18-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX18	HGNC	protein_coding	OTTHUMT00000214073.2		0.00	89	0	G			53839223	+1			no_errors	ENST00000381410	ensembl	human	known	74_37	silent	6.52	43	3	SNP	1.000	A
SOCS6	9306	genome.wustl.edu	37	18	67992306	67992306	+	Silent	SNP	C	C	A	rs201422335		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr18:67992306C>A	ENST00000397942.3	+	2	718	c.402C>A	c.(400-402)ccC>ccA	p.P134P	SOCS6_ENST00000582322.1_Silent_p.P134P	NM_004232.3	NP_004223.2	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	134					defense response (GO:0006952)|JAK-STAT cascade (GO:0007259)|negative regulation of signal transduction (GO:0009968)|negative regulation of T cell activation (GO:0050868)|proteasomal protein catabolic process (GO:0010498)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|immunological synapse (GO:0001772)				NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)	22		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				ACTACAGTCCCGCGCCGTGGC	0.597																																					Melanoma(84;1024 1361 24382 36583 42651)												0													37.0	36.0	36.0					18																	67992306		2203	4295	6498	SO:0001819	synonymous_variant	0			AB006968	CCDS11998.1	18q22	2013-02-14	2004-02-25	2004-02-27	ENSG00000170677	ENSG00000170677		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	16833	protein-coding gene	gene with protein product		605118	"""suppressor of cytokine signaling 4"""	SOCS4		9344848, 11042152	Standard	NM_004232		Approved	CIS4, SSI4, HSPC060, STATI4, STAI4, Cish4	uc002lkr.1	O14544	OTTHUMG00000132816	ENST00000397942.3:c.402C>A	18.37:g.67992306C>A			Q8WUM3	Silent	SNP	pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.P134	ENST00000397942.3	37	c.402	CCDS11998.1	18																																																																																			SOCS6	-	NULL	ENSG00000170677		0.597	SOCS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS6	HGNC	protein_coding	OTTHUMT00000256270.2		0.00	36	0	C			67992306	+1			no_errors	ENST00000397942	ensembl	human	known	74_37	silent	7.50	37	3	SNP	0.870	A
SP4	6671	genome.wustl.edu	37	7	21469411	21469411	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:21469411G>T	ENST00000222584.3	+	3	846	c.628G>T	c.(628-630)Gct>Tct	p.A210S		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	210					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TATACTCACAGCTGCTAACAG	0.408																																																	0													80.0	80.0	80.0					7																	21469411		2203	4300	6503	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.628G>T	7.37:g.21469411G>T	ENSP00000222584:p.Ala210Ser		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A210S	ENST00000222584.3	37	c.628	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	G	3.336	-0.135716	0.06711	.	.	ENSG00000105866	ENST00000222584	T	0.08984	3.03	4.79	4.79	0.61399	.	0.156761	0.56097	D	0.000021	T	0.04272	0.0118	N	0.16368	0.405	0.41117	D	0.985781	B	0.27823	0.19	B	0.20184	0.028	T	0.19647	-1.0299	10	0.02654	T	1	.	11.1098	0.48226	0.1339:0.0:0.8661:0.0	.	210	Q02446	SP4_HUMAN	S	210	ENSP00000222584:A210S	ENSP00000222584:A210S	A	+	1	0	SP4	21435936	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	2.772000	0.47678	2.482000	0.83794	0.655000	0.94253	GCT	SP4	-	NULL	ENSG00000105866		0.408	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2		0.00	45	0	G	NM_003112		21469411	+1			no_errors	ENST00000222584	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
SREBF2	6721	genome.wustl.edu	37	22	42262949	42262951	+	In_Frame_Del	DEL	GCA	GCA	-	rs143615881		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr22:42262949_42262951delGCA	ENST00000361204.4	+	2	369_371	c.203_205delGCA	c.(202-207)ggcagc>ggc	p.S74del		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	74	Gly/Pro/Ser-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						ggcagcagtggcagcagcagcag	0.567																																																	0																																										SO:0001651	inframe_deletion	0			U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.203_205delGCA	22.37:g.42262958_42262960delGCA	ENSP00000354476:p.Ser74del		Q05BD5|Q6GTH7|Q86V36|Q9UH04	In_Frame_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S72in_frame_del	ENST00000361204.4	37	c.203_205	CCDS14023.1	22																																																																																			SREBF2	-	NULL	ENSG00000198911		0.567	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	HGNC	protein_coding	OTTHUMT00000321956.1		0.00	48	0	GCA	NM_004599		42262951	+1	tier1		no_errors	ENST00000361204	ensembl	human	known	74_37	in_frame_del	12.50	21	3	DEL	0.037:0.043:0.048	-
SSPO	23145	genome.wustl.edu	37	7	149493534	149493534	+	RNA	SNP	A	A	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:149493534A>T	ENST00000378016.2	+	0	6610							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GAGGTTTGTCAGGGTGTGGCC	0.642																																																	0													96.0	110.0	105.0					7																	149493534		2154	4248	6402			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149493534A>T			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.642	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript			0.00	38	0	A			149493534	+1			no_errors	ENST00000378016	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.925	T
SST	6750	genome.wustl.edu	37	3	187388067	187388067	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr3:187388067G>A	ENST00000287641.3	-	1	120	c.13C>T	c.(13-15)Cgc>Tgc	p.R5C		NM_001048.3	NP_001039.1	P61278	SMS_HUMAN	somatostatin	5					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|hormone-mediated apoptotic signaling pathway (GO:0008628)|hyperosmotic response (GO:0006972)|negative regulation of cell proliferation (GO:0008285)|regulation of cell migration (GO:0030334)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to heat (GO:0009408)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)			kidney(1)|large_intestine(1)|lung(6)|pancreas(1)	9	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.00444)	Cysteamine(DB00847)	CACTGGAGGCGGCAGGACAGC	0.667																																																	0													13.0	13.0	13.0					3																	187388067		2191	4290	6481	SO:0001583	missense	0				CCDS3288.1	3q28	2013-02-28			ENSG00000157005	ENSG00000157005		"""Endogenous ligands"""	11329	protein-coding gene	gene with protein product	"""somatostatin-14"", ""somatostatin-28"", ""prepro-somatostatin"""	182450				6126875, 6142531	Standard	NM_001048		Approved	SMST	uc003frn.3	P61278	OTTHUMG00000156462	ENST00000287641.3:c.13C>T	3.37:g.187388067G>A	ENSP00000287641:p.Arg5Cys		B2R5G3|P01166	Missense_Mutation	SNP	pfam_Somatostatin/Cortistatin_C,pirsf_Somatostatin	p.R5C	ENST00000287641.3	37	c.13	CCDS3288.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.077353	0.94000	.	.	ENSG00000157005	ENST00000287641	T	0.34072	1.38	5.48	5.48	0.80851	.	0.229124	0.44902	D	0.000414	T	0.57446	0.2054	M	0.75777	2.31	0.80722	D	1	D	0.76494	0.999	P	0.57846	0.828	T	0.62139	-0.6917	10	0.87932	D	0	-9.1293	17.9406	0.89025	0.0:0.0:1.0:0.0	.	5	P61278	SMS_HUMAN	C	5	ENSP00000287641:R5C	ENSP00000287641:R5C	R	-	1	0	SST	188870761	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.326000	0.79133	2.560000	0.86352	0.563000	0.77884	CGC	SST	-	pirsf_Somatostatin	ENSG00000157005		0.667	SST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SST	HGNC	protein_coding	OTTHUMT00000344278.1	-	0.00	28	0	G	NM_001048		187388067	-1	tier1	-	no_errors	ENST00000287641	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	A
STAB2	55576	genome.wustl.edu	37	12	104126960	104126960	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:104126960G>T	ENST00000388887.2	+	51	5664	c.5460G>T	c.(5458-5460)aaG>aaT	p.K1820N		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						GAGATGCCAAGGTATTTAGTT	0.453																																																	0													175.0	158.0	164.0					12																	104126960		2203	4300	6503	SO:0001630	splice_region_variant	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.5460+1G>T	12.37:g.104126960G>T				Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.K1820N	ENST00000388887.2	37	c.5460	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838416	0.71373	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.90844	-2.74	5.01	5.01	0.66863	FAS1 domain (5);	0.303615	0.35151	N	0.003419	D	0.93090	0.7800	M	0.89601	3.045	0.49687	D	0.999812	P	0.39717	0.684	B	0.42798	0.398	D	0.92717	0.6188	10	0.30078	T	0.28	.	17.0844	0.86606	0.0:0.0:1.0:0.0	.	1820	Q8WWQ8	STAB2_HUMAN	N	1820;507	ENSP00000373539:K1820N	ENSP00000258495:K507N	K	+	3	2	STAB2	102651090	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	7.717000	0.84732	2.326000	0.78906	0.655000	0.94253	AAG	STAB2	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000136011		0.453	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	29	0	G		Missense_Mutation	104126960	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
STARD9	57519	genome.wustl.edu	37	15	42983271	42983271	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:42983271A>T	ENST00000290607.7	+	23	9552	c.9495A>T	c.(9493-9495)gaA>gaT	p.E3165D		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	3165					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						AATGTTTAGAAAATACCACTA	0.448																																																	0													47.0	41.0	43.0					15																	42983271		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.9495A>T	15.37:g.42983271A>T	ENSP00000290607:p.Glu3165Asp		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E3165D	ENST00000290607.7	37	c.9495	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	A	15.58	2.876991	0.51801	.	.	ENSG00000159433	ENST00000290607	T	0.68903	-0.36	5.54	4.41	0.53225	.	.	.	.	.	T	0.61451	0.2348	L	0.46157	1.445	0.09310	N	1	P	0.40970	0.734	B	0.42798	0.398	T	0.57636	-0.7777	9	0.66056	D	0.02	.	7.6274	0.28220	0.9063:0.0:0.0937:0.0	.	3079	Q9P2P6	STAR9_HUMAN	D	3165	ENSP00000290607:E3165D	ENSP00000290607:E3165D	E	+	3	2	STARD9	40770563	0.746000	0.28272	0.080000	0.20451	0.024000	0.10985	1.796000	0.38794	2.234000	0.73211	0.460000	0.39030	GAA	STARD9	-	NULL	ENSG00000159433		0.448	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	-	0.00	107	0	A			42983271	+1	tier1	-	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	12.35	71	10	SNP	0.030	T
STEAP1B	256227	genome.wustl.edu	37	7	22532994	22532994	+	Silent	SNP	G	G	A	rs571881121		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr7:22532994G>A	ENST00000406890.2	-	3	583	c.489C>T	c.(487-489)taC>taT	p.Y163Y	STEAP1B_ENST00000404369.4_Silent_p.Y182Y	NM_207342.2	NP_997225.1	Q6NZ63	STEAL_HUMAN	STEAP family member 1B	163						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(2)	4						GCCTCATTGCGTAAGACAGAG	0.388													g|||	1	0.000199681	0.0	0.0	5008	,	,		19769	0.0		0.0	False		,,,				2504	0.001																0													153.0	121.0	131.0					7																	22532994		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS55094.1, CCDS56469.1	7p15.3	2011-05-19			ENSG00000105889	ENSG00000105889			41907	protein-coding gene	gene with protein product							Standard	NM_207342		Approved		uc010kum.2	Q6NZ63	OTTHUMG00000152529	ENST00000406890.2:c.489C>T	7.37:g.22532994G>A			B5MCI2	Silent	SNP	pfam_Fe3_Rdtase_TM_dom	p.Y163	ENST00000406890.2	37	c.489	CCDS55094.1	7																																																																																			STEAP1B	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000105889		0.388	STEAP1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STEAP1B	HGNC	protein_coding	OTTHUMT00000326617.2	-	0.00	85	0	G			22532994	-1	tier1	-	no_errors	ENST00000406890	ensembl	human	known	74_37	silent	9.64	75	8	SNP	0.986	A
STON1	11037	genome.wustl.edu	37	2	48808057	48808057	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:48808057C>A	ENST00000406226.1	+	3	480	c.285C>A	c.(283-285)ccC>ccA	p.P95P	STON1_ENST00000404752.1_Silent_p.P95P|STON1-GTF2A1L_ENST00000394754.1_Silent_p.P95P|STON1-GTF2A1L_ENST00000309827.2_Silent_p.P95P|STON1-GTF2A1L_ENST00000402114.2_Silent_p.P95P|STON1-GTF2A1L_ENST00000394751.3_Silent_p.P95P|STON1-GTF2A1L_ENST00000405008.1_Silent_p.P95P|STON1_ENST00000309835.3_Silent_p.P95P	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	95					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTGGCATCCCCAAAGCAGGGA	0.468																																																	0													120.0	122.0	121.0					2																	48808057		2203	4300	6503	SO:0001819	synonymous_variant	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.285C>A	2.37:g.48808057C>A			A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.P95	ENST00000406226.1	37	c.285	CCDS1841.1	2																																																																																			STON1-GTF2A1L	-	NULL	ENSG00000068781		0.468	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323848.2	-	0.00	67	0	C	NM_006873		48808057	+1	tier1	-	no_errors	ENST00000309827	ensembl	human	known	74_37	silent	5.97	63	4	SNP	0.995	A
SULF1	23213	genome.wustl.edu	37	8	70541858	70541858	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:70541858G>T	ENST00000260128.4	+	19	2945	c.2228G>T	c.(2227-2229)gGc>gTc	p.G743V	SULF1_ENST00000458141.2_Missense_Mutation_p.G743V|SULF1_ENST00000419716.3_Missense_Mutation_p.G743V|SULF1_ENST00000402687.4_Missense_Mutation_p.G743V|SULF1_ENST00000521946.1_3'UTR	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	743					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.G743A(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGCCTGCCTGGCCTCACTTGC	0.542																																																	1	Substitution - Missense(1)	lung(1)											131.0	114.0	120.0					8																	70541858		2203	4300	6503	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2228G>T	8.37:g.70541858G>T	ENSP00000260128:p.Gly743Val		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.G743V	ENST00000260128.4	37	c.2228	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793993	0.90453	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	T;T;T;T	0.24350	1.86;1.86;1.86;1.86	4.75	4.75	0.60458	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	T	0.55065	0.1897	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.61783	-0.6992	10	0.72032	D	0.01	.	17.9404	0.89025	0.0:0.0:1.0:0.0	.	743	Q8IWU6	SULF1_HUMAN	V	743	ENSP00000403040:G743V;ENSP00000260128:G743V;ENSP00000385704:G743V;ENSP00000390315:G743V	ENSP00000260128:G743V	G	+	2	0	SULF1	70704412	1.000000	0.71417	0.997000	0.53966	0.930000	0.56654	9.618000	0.98365	2.440000	0.82611	0.655000	0.94253	GGC	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.542	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2		0.00	82	0	G	NM_015170		70541858	+1			no_errors	ENST00000260128	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
SV2A	9900	genome.wustl.edu	37	1	149877572	149877572	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:149877572G>T	ENST00000369146.3	-	12	2395	c.1905C>A	c.(1903-1905)tcC>tcA	p.S635S	SV2A_ENST00000369145.1_Silent_p.S635S	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	635					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	AGGAGACACAGGACATCACGC	0.592																																																	0													95.0	76.0	83.0					1																	149877572		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1905C>A	1.37:g.149877572G>T			D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	p.S635	ENST00000369146.3	37	c.1905	CCDS940.1	1																																																																																			SV2A	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2	ENSG00000159164		0.592	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1		0.00	40	0	G			149877572	-1			no_errors	ENST00000369146	ensembl	human	known	74_37	silent	5.36	53	3	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152718109	152718109	+	Missense_Mutation	SNP	A	A	C	rs201692204	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:152718109A>C	ENST00000367255.5	-	50	7958	c.7357T>G	c.(7357-7359)Ttg>Gtg	p.L2453V	SYNE1_ENST00000448038.1_Missense_Mutation_p.L2460V|SYNE1_ENST00000423061.1_Missense_Mutation_p.L2460V|SYNE1_ENST00000341594.5_Missense_Mutation_p.L2492V|SYNE1_ENST00000265368.4_Missense_Mutation_p.L2453V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2453					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		ACTGAGTCCAAAATGTTCTGT	0.388										HNSCC(10;0.0054)																																							0													124.0	107.0	113.0					6																	152718109		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.7357T>G	6.37:g.152718109A>C	ENSP00000356224:p.Leu2453Val		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L2453V	ENST00000367255.5	37	c.7357	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	10.82	1.458778	0.26248	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.58210	0.44;0.48;0.35;0.47;0.57	6.07	-7.09	0.01553	.	0.000000	0.45361	D	0.000366	T	0.55641	0.1933	M	0.66939	2.045	0.58432	D	0.999994	D;P;P;P	0.76494	0.999;0.853;0.853;0.947	D;B;B;P	0.78314	0.991;0.288;0.288;0.481	T	0.73742	-0.3887	10	0.31617	T	0.26	.	20.7512	0.99720	0.2989:0.0:0.7011:0.0	.	2436;2453;2453;2460	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	2453;2460;2453;2460;2492	ENSP00000356224:L2453V;ENSP00000396024:L2460V;ENSP00000265368:L2453V;ENSP00000390975:L2460V;ENSP00000341887:L2492V	ENSP00000265368:L2453V	L	-	1	2	SYNE1	152759802	0.868000	0.29978	0.001000	0.08648	0.847000	0.48162	-0.034000	0.12225	-1.431000	0.01982	-0.290000	0.09829	TTG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	71	0	A	NM_182961		152718109	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	20.99	64	17	SNP	0.001	C
SYT16	83851	genome.wustl.edu	37	14	62462802	62462802	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:62462802C>A	ENST00000430451.2	+	1	262	c.65C>A	c.(64-66)tCt>tAt	p.S22Y	SYT16_ENST00000446982.2_Missense_Mutation_p.S22Y	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	22					exocytosis (GO:0006887)			p.S22F(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TCCTGGATATCTCGGGTTTAT	0.453																																																	2	Substitution - Missense(2)	lung(2)											94.0	89.0	91.0					14																	62462802		1879	4113	5992	SO:0001583	missense	0			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.65C>A	14.37:g.62462802C>A	ENSP00000394700:p.Ser22Tyr		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	NULL	p.S22Y	ENST00000430451.2	37	c.65	CCDS45121.1	14	.	.	.	.	.	.	.	.	.	.	C	16.30	3.085040	0.55861	.	.	ENSG00000139973	ENST00000446982;ENST00000430451	T;T	0.52057	0.68;3.18	5.01	4.12	0.48240	.	0.146170	0.46758	D	0.000265	T	0.42291	0.1196	L	0.51422	1.61	0.30943	N	0.725601	P;B	0.40638	0.725;0.037	B;B	0.35510	0.204;0.026	T	0.56492	-0.7970	10	0.87932	D	0	-31.7436	15.346	0.74337	0.1406:0.8594:0.0:0.0	.	22;22	B4DZH2;Q17RD7	.;SYT16_HUMAN	Y	22	ENSP00000388023:S22Y;ENSP00000394700:S22Y	ENSP00000394700:S22Y	S	+	2	0	SYT16	61532555	0.963000	0.33076	1.000000	0.80357	0.993000	0.82548	1.710000	0.37920	1.471000	0.48121	0.555000	0.69702	TCT	SYT16	-	NULL	ENSG00000139973		0.453	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1		0.00	37	0	C	NM_031914		62462802	+1			no_errors	ENST00000446982	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	A
SYT3	84258	genome.wustl.edu	37	19	51135719	51135719	+	Silent	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:51135719C>T	ENST00000338916.4	-	2	1131	c.498G>A	c.(496-498)tcG>tcA	p.S166S	SYT3_ENST00000544769.1_Silent_p.S166S|SYT3_ENST00000600079.1_Silent_p.S166S|SYT3_ENST00000593901.1_Silent_p.S166S	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	166					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CCTCTGGATACGAGTCCATGT	0.647																																																	0													26.0	27.0	27.0					19																	51135719		2202	4299	6501	SO:0001819	synonymous_variant	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.498G>A	19.37:g.51135719C>T			Q8N5Z1|Q8N640	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.S166	ENST00000338916.4	37	c.498	CCDS12798.1	19																																																																																			SYT3	-	NULL	ENSG00000213023		0.647	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	-	0.00	68	0	C	NM_032298		51135719	-1	tier1	-	no_errors	ENST00000338916	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.867	T
TACC2	10579	genome.wustl.edu	37	10	123954677	123954677	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:123954677C>A	ENST00000369005.1	+	8	6297	c.5957C>A	c.(5956-5958)cCc>cAc	p.P1986H	TACC2_ENST00000513429.1_Missense_Mutation_p.P132H|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000358010.1_Missense_Mutation_p.P132H|TACC2_ENST00000515273.1_Missense_Mutation_p.P1990H|TACC2_ENST00000360561.3_Missense_Mutation_p.P64H|TACC2_ENST00000368999.1_Missense_Mutation_p.P64H|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000369004.3_Missense_Mutation_p.P64H|TACC2_ENST00000453444.2_Missense_Mutation_p.P1990H|TACC2_ENST00000260733.3_Missense_Mutation_p.P64H|TACC2_ENST00000515603.1_Missense_Mutation_p.P1941H|TACC2_ENST00000334433.3_Missense_Mutation_p.P1986H	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1986	Pro-rich.				astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ACACAGCCACCCCCGGAAGAA	0.637																																																	0													44.0	50.0	48.0					10																	123954677		2203	4300	6503	SO:0001583	missense	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5957C>A	10.37:g.123954677C>A	ENSP00000358001:p.Pro1986His		Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.P1986H	ENST00000369005.1	37	c.5957	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	C	13.96	2.392697	0.42410	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.09163	3.97;3.41;3.96;3.98;3.97;3.41;3.96;3.39;3.4;3.39;3.4;3.01	4.75	3.84	0.44239	.	0.270973	0.19952	N	0.102410	T	0.25195	0.0612	L	0.60455	1.87	0.26162	N	0.97999	D;D;D;D;D;D;D;D	0.76494	0.998;0.999;0.996;0.999;0.99;0.995;0.995;0.999	D;D;P;D;P;P;D;D	0.65010	0.922;0.931;0.759;0.931;0.787;0.839;0.922;0.931	T	0.02743	-1.1116	10	0.87932	D	0	-1.1395	10.6317	0.45541	0.0:0.9068:0.0:0.0932	.	81;1990;64;1941;64;64;132;1986	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;TACC2_HUMAN	H	1986;132;1990;1941;1986;132;1990;1976;64;64;64;64;81	ENSP00000358001:P1986H;ENSP00000425062:P132H;ENSP00000424467:P1990H;ENSP00000427618:P1941H;ENSP00000334280:P1986H;ENSP00000350701:P132H;ENSP00000395048:P1990H;ENSP00000353763:P64H;ENSP00000357995:P64H;ENSP00000422815:P64H;ENSP00000260733:P64H;ENSP00000420967:P81H	ENSP00000260733:P64H	P	+	2	0	TACC2	123944667	0.973000	0.33851	0.174000	0.22961	0.349000	0.29174	3.601000	0.54059	0.981000	0.38548	0.556000	0.70494	CCC	TACC2	-	NULL	ENSG00000138162		0.637	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1		0.00	71	0	C			123954677	+1			no_errors	ENST00000334433	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.933	A
TCOF1	6949	genome.wustl.edu	37	5	149754266	149754266	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:149754266C>A	ENST00000504761.2	+	9	1170	c.1170C>A	c.(1168-1170)ccC>ccA	p.P390P	TCOF1_ENST00000377797.3_Silent_p.P390P|TCOF1_ENST00000451292.1_Silent_p.P390P|TCOF1_ENST00000394269.3_Silent_p.P390P|TCOF1_ENST00000323668.7_Silent_p.P313P|TCOF1_ENST00000445265.2_Silent_p.P313P|TCOF1_ENST00000439160.2_Silent_p.P390P|TCOF1_ENST00000513346.1_Silent_p.P390P			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	390					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCCCAGCGCCCCCTGGGAAGA	0.657																																																	0													35.0	43.0	40.0					5																	149754266		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.1170C>A	5.37:g.149754266C>A			A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.P390	ENST00000504761.2	37	c.1170	CCDS54936.1	5																																																																																			TCOF1	-	pfam_TCS_treacle	ENSG00000070814		0.657	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	-	0.00	86	0	C	NM_001008656		149754266	+1	tier1	-	no_errors	ENST00000451292	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.405	A
TDRD9	122402	genome.wustl.edu	37	14	104431746	104431746	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:104431746C>A	ENST00000409874.4	+	4	545	c.497C>A	c.(496-498)cCg>cAg	p.P166Q	TDRD9_ENST00000339063.5_Missense_Mutation_p.P166Q|TDRD9_ENST00000554571.1_3'UTR	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	166	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				ACTCAGCTCCCGCAGTATATC	0.502																																																	0													84.0	79.0	80.0					14																	104431746		692	1591	2283	SO:0001583	missense	0			AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.497C>A	14.37:g.104431746C>A	ENSP00000387303:p.Pro166Gln		A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Tudor,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,smart_Tudor,pfscan_Tudor,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P166Q	ENST00000409874.4	37	c.497	CCDS9987.2	14	.	.	.	.	.	.	.	.	.	.	C	17.77	3.470820	0.63625	.	.	ENSG00000156414	ENST00000409874;ENST00000339063	T;T	0.03094	4.05;4.05	4.54	4.54	0.55810	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	.	.	.	.	T	0.32102	0.0818	H	0.97440	4.005	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.58188	-0.7680	9	0.87932	D	0	.	17.6618	0.88195	0.0:1.0:0.0:0.0	.	166	Q8NDG6	TDRD9_HUMAN	Q	166	ENSP00000387303:P166Q;ENSP00000343545:P166Q	ENSP00000343545:P166Q	P	+	2	0	TDRD9	103501499	1.000000	0.71417	0.840000	0.33206	0.125000	0.20455	7.776000	0.85560	2.226000	0.72624	0.460000	0.39030	CCG	TDRD9	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000156414		0.502	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRD9	HGNC	protein_coding	OTTHUMT00000328325.3		0.00	54	0	C	NM_153046		104431746	+1			no_errors	ENST00000409874	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	A
TH	7054	genome.wustl.edu	37	11	2192950	2192950	+	Missense_Mutation	SNP	C	C	T	rs201081519		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr11:2192950C>T	ENST00000381178.1	-	1	85	c.67G>A	c.(67-69)Gcc>Acc	p.A23T	TH_ENST00000352909.3_Missense_Mutation_p.A23T|MIR4686_ENST00000584128.1_RNA|TH_ENST00000381175.1_Missense_Mutation_p.A23T|TH_ENST00000333684.5_Missense_Mutation_p.A23T	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	23					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GCCTGCTTGGCGTCCAGCTCA	0.697																																																	0									THR/ALA,THR/ALA,THR/ALA	2,4402	4.2+/-10.8	0,2,2200	70.0	62.0	65.0		67,67,67	1.4	1.0	11		65	0,8598		0,0,4299	yes	missense,missense,missense	TH	NM_000360.3,NM_199292.2,NM_199293.2	58,58,58	0,2,6499	TT,TC,CC		0.0,0.0454,0.0154	benign,benign,benign	23/498,23/529,23/525	2192950	2,13000	2202	4299	6501	SO:0001583	missense	0			X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.67G>A	11.37:g.2192950C>T	ENSP00000370571:p.Ala23Thr		B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_Tyrosine_hydroxylase_CS,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Tyr_3_mOase	p.A23T	ENST00000381178.1	37	c.67	CCDS7731.1	11	.	.	.	.	.	.	.	.	.	.	c	22.1	4.247129	0.80024	4.54E-4	0.0	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.99527	-6.02;-6.02;-6.09;-5.7	3.87	1.4	0.22301	Tyrosine hydroxylase, conserved site (1);	0.703054	0.13153	N	0.409711	D	0.96713	0.8927	L	0.27053	0.805	0.21105	N	0.999789	B;B;B;B;B;B	0.17268	0.012;0.008;0.008;0.021;0.017;0.008	B;B;B;B;B;B	0.12837	0.006;0.002;0.002;0.004;0.008;0.004	D	0.93830	0.7127	10	0.46703	T	0.11	-10.3206	1.9507	0.03366	0.2867:0.4543:0.1408:0.1182	.	23;23;23;23;23;23	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	T	23	ENSP00000370571:A23T;ENSP00000370567:A23T;ENSP00000325951:A23T;ENSP00000328814:A23T	ENSP00000325831:A23T	A	-	1	0	TH	2149526	.	.	1.000000	0.80357	0.966000	0.64601	.	.	0.728000	0.32382	0.550000	0.68814	GCC	TH	-	pfam_Tyrosine_hydroxylase_CS,pirsf_Tyrosine_3-monooxygenase-like	ENSG00000180176		0.697	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TH	HGNC	protein_coding	OTTHUMT00000026597.1	-	0.00	17	0	C	NM_000360		2192950	-1	tier1	rs201081519	no_errors	ENST00000381178	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.999	T
TIMELESS	8914	genome.wustl.edu	37	12	56815969	56815969	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:56815969G>A	ENST00000553532.1	-	20	2595	c.2445C>T	c.(2443-2445)tcC>tcT	p.S815S	TIMELESS_ENST00000554616.1_Intron|TIMELESS_ENST00000229201.4_Silent_p.S814S					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						CTCTGCGACTGGAAGACCTGA	0.517																																																	0													72.0	70.0	71.0					12																	56815969		2203	4300	6503	SO:0001819	synonymous_variant	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2445C>T	12.37:g.56815969G>A				Silent	SNP	pfam_TIMELESS_C,pfam_Timeless	p.S815	ENST00000553532.1	37	c.2445	CCDS8918.1	12																																																																																			TIMELESS	-	pfam_TIMELESS_C	ENSG00000111602		0.517	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	-	0.00	37	0	G	NM_003920		56815969	-1	tier1	-	no_errors	ENST00000553532	ensembl	human	known	74_37	silent	56.41	17	22	SNP	0.000	A
TLE4	7091	genome.wustl.edu	37	9	82336771	82336771	+	Silent	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:82336771C>A	ENST00000376552.2	+	17	2972	c.1954C>A	c.(1954-1956)Cgg>Agg	p.R652R	TLE4_ENST00000265284.6_Silent_p.R627R|TLE4_ENST00000376520.4_Silent_p.R684R|TLE4_ENST00000376544.3_Silent_p.R583R|TLE4_ENST00000376534.4_Silent_p.R289R|TLE4_ENST00000376537.4_Silent_p.R684R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	652					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						GCGCGAGGGGCGGCAGCTGCA	0.562																																																	0													65.0	67.0	67.0					9																	82336771		2203	4300	6503	SO:0001819	synonymous_variant	0			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1954C>A	9.37:g.82336771C>A			F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Silent	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.R684	ENST00000376552.2	37	c.2050	CCDS43837.1	9																																																																																			TLE4	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000106829		0.562	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	HGNC	protein_coding	OTTHUMT00000052792.4	-	0.00	75	0	C	XM_212237		82336771	+1	tier1	-	no_errors	ENST00000376520	ensembl	human	known	74_37	silent	5.97	63	4	SNP	1.000	A
TM9SF1	10548	genome.wustl.edu	37	14	24662056	24662056	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:24662056G>A	ENST00000261789.4	-	3	1123	c.765C>T	c.(763-765)gtC>gtT	p.V255V	TM9SF1_ENST00000528669.1_Silent_p.V255V|TM9SF1_ENST00000556387.1_Silent_p.V464V|TM9SF1_ENST00000524835.1_Silent_p.V168V|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000396854.4_Silent_p.V255V|TM9SF1_ENST00000530611.1_Silent_p.V464V	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	255					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		GCATTAGAATGACAGCCACAA	0.483																																																	0													118.0	104.0	108.0					14																	24662056		2203	4300	6503	SO:0001819	synonymous_variant	0			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.765C>T	14.37:g.24662056G>A			D3DS65|Q86SZ6|Q96FI8	Silent	SNP	pfam_EMP70,pfam_Snf7	p.V464	ENST00000261789.4	37	c.1392	CCDS9617.1	14																																																																																			TM9SF1	-	pfam_EMP70	ENSG00000100926		0.483	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	HGNC	protein_coding	OTTHUMT00000073136.2	-	0.00	73	0	G	NM_006405		24662056	-1	tier1	-	no_errors	ENST00000556387	ensembl	human	known	74_37	silent	51.06	23	24	SNP	1.000	A
TMED10	10972	genome.wustl.edu	37	14	75601607	75601607	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr14:75601607G>T	ENST00000303575.4	-	5	692	c.641C>A	c.(640-642)gCc>gAc	p.A214D	TMED10_ENST00000557670.1_5'UTR|RP11-950C14.7_ENST00000556236.1_RNA	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	214	Interaction with ARF1.|Interaction with COPG1.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		CAATTTCTTGGCCTTGAAGAA	0.488																																																	0													112.0	103.0	106.0					14																	75601607		2203	4300	6503	SO:0001583	missense	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.641C>A	14.37:g.75601607G>T	ENSP00000303145:p.Ala214Asp		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	pfam_GOLD,pfscan_GOLD	p.A214D	ENST00000303575.4	37	c.641	CCDS9840.1	14	.	.	.	.	.	.	.	.	.	.	G	35	5.531166	0.96446	.	.	ENSG00000170348	ENST00000303575	T	0.23147	1.92	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	L	0.56280	1.765	0.80722	D	1	D	0.56287	0.975	P	0.60345	0.873	T	0.02526	-1.1146	10	0.32370	T	0.25	-13.7144	20.5948	0.99439	0.0:0.0:1.0:0.0	.	214	P49755	TMEDA_HUMAN	D	214	ENSP00000303145:A214D	ENSP00000303145:A214D	A	-	2	0	TMED10	74671360	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GCC	TMED10	-	NULL	ENSG00000170348		0.488	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	-	0.00	94	0	G	NM_006827		75601607	-1	tier1	-	no_errors	ENST00000303575	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
TMEM175	84286	genome.wustl.edu	37	4	941669	941669	+	Missense_Mutation	SNP	G	G	A	rs140262376		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:941669G>A	ENST00000264771.4	+	2	327	c.142G>A	c.(142-144)Gcc>Acc	p.A48T	TMEM175_ENST00000508204.1_Intron|TMEM175_ENST00000515740.1_Intron	NM_032326.2	NP_115702.1	Q9BSA9	TM175_HUMAN	transmembrane protein 175	48						integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(1)|large_intestine(2)|lung(6)|pancreas(1)|upper_aerodigestive_tract(3)	14			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTCCATCATCGCCACCGTCAT	0.667																																																	0								G	THR/ALA	0,4406		0,0,2203	59.0	58.0	59.0		142	5.4	1.0	4	dbSNP_134	59	2,8598	2.2+/-6.3	0,2,4298	no	missense	TMEM175	NM_032326.2	58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	48/505	941669	2,13004	2203	4300	6503	SO:0001583	missense	0			BC005158	CCDS3341.1, CCDS75087.1, CCDS75088.1	4p16.3	2008-02-05			ENSG00000127419	ENSG00000127419			28709	protein-coding gene	gene with protein product						12477932	Standard	XM_005272301		Approved	MGC4618	uc003gbq.3	Q9BSA9	OTTHUMG00000118996	ENST00000264771.4:c.142G>A	4.37:g.941669G>A	ENSP00000264771:p.Ala48Thr		D3DVN4|Q8ND13	Missense_Mutation	SNP	pfam_DUF1211_TMEM175	p.A48T	ENST00000264771.4	37	c.142	CCDS3341.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.114535	0.94339	0.0	2.33E-4	ENSG00000127419	ENST00000507319;ENST00000264771;ENST00000514453;ENST00000514546	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.66519	0.2797	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67518	-0.5650	10	0.54805	T	0.06	-0.332	14.7113	0.69235	0.0:0.0:1.0:0.0	.	48	Q9BSA9	TM175_HUMAN	T	48	ENSP00000424746:A48T;ENSP00000264771:A48T;ENSP00000425181:A48T;ENSP00000425763:A48T	ENSP00000264771:A48T	A	+	1	0	TMEM175	931669	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.867000	0.87062	2.539000	0.85634	0.650000	0.86243	GCC	TMEM175	-	pfam_DUF1211_TMEM175	ENSG00000127419		0.667	TMEM175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM175	HGNC	protein_coding	OTTHUMT00000239193.2	-	0.00	78	0	G	NM_032326		941669	+1	tier1	rs140262376	no_errors	ENST00000264771	ensembl	human	known	74_37	missense	40.74	32	22	SNP	1.000	A
TMEM30A	55754	genome.wustl.edu	37	6	75994133	75994133	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr6:75994133G>T	ENST00000230461.6	-	1	551	c.222C>A	c.(220-222)aaC>aaA	p.N74K	RP1-234P15.4_ENST00000607221.1_lincRNA|TMEM30A_ENST00000475111.2_Missense_Mutation_p.N74K	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	74					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TCTCGCGGATGTTGTTGGAGG	0.582																																																	0													66.0	57.0	60.0					6																	75994133		2203	4300	6503	SO:0001583	missense	0			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.222C>A	6.37:g.75994133G>T	ENSP00000230461:p.Asn74Lys		A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.N74K	ENST00000230461.6	37	c.222	CCDS4983.1	6	.	.	.	.	.	.	.	.	.	.	G	25.4	4.639276	0.87760	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000475111	.	.	.	5.11	4.24	0.50183	.	0.046484	0.85682	D	0.000000	T	0.26882	0.0658	L	0.41906	1.305	0.80722	D	1	P;P	0.42296	0.734;0.775	B;B	0.43155	0.287;0.41	T	0.15235	-1.0444	9	0.07482	T	0.82	.	13.7589	0.62954	0.0748:0.0:0.9252:0.0	.	74;74	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	K	74;58;74	.	ENSP00000230461:N74K	N	-	3	2	TMEM30A	76050853	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.554000	0.60760	1.157000	0.42530	-0.137000	0.14449	AAC	TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	ENSG00000112697		0.582	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2	-	0.00	69	0	G	NM_018247		75994133	-1	tier1	-	no_errors	ENST00000230461	ensembl	human	known	74_37	missense	7.04	66	5	SNP	1.000	T
TMEM52	339456	genome.wustl.edu	37	1	1849569	1849569	+	Missense_Mutation	SNP	G	G	A	rs566773598		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:1849569G>A	ENST00000310991.3	-	5	389	c.382C>T	c.(382-384)Cgg>Tgg	p.R128W	TMEM52_ENST00000378602.3_Missense_Mutation_p.R113W	NM_178545.3	NP_848640.1	Q8NDY8	TMM52_HUMAN	transmembrane protein 52	128						integral component of membrane (GO:0016021)				NS(1)|prostate(1)|stomach(1)	3	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;6.04e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.82e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.75e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		AGGGGCAACCGCATGCCCAGT	0.637													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20353	0.0		0.0	False		,,,				2504	0.0																0													62.0	61.0	61.0					1																	1849569		2203	4300	6503	SO:0001583	missense	0			AJ278736	CCDS35.1	1p36.33	2008-02-05			ENSG00000178821	ENSG00000178821			27916	protein-coding gene	gene with protein product							Standard	NM_178545		Approved		uc001aij.2	Q8NDY8	OTTHUMG00000000944	ENST00000310991.3:c.382C>T	1.37:g.1849569G>A	ENSP00000311122:p.Arg128Trp		Q4VXS6|Q6UX25	Missense_Mutation	SNP	NULL	p.R128W	ENST00000310991.3	37	c.382	CCDS35.1	1	.	.	.	.	.	.	.	.	.	.	.	13.05	2.120259	0.37436	.	.	ENSG00000178821	ENST00000378602;ENST00000310991	T;T	0.47869	0.83;0.83	3.78	1.7	0.24286	.	1.297420	0.06001	N	0.647738	T	0.52533	0.1740	L	0.49778	1.585	0.24118	N	0.995814	D;P	0.71674	0.998;0.95	P;B	0.53861	0.736;0.406	T	0.39941	-0.9589	10	0.87932	D	0	-0.2501	5.1404	0.14955	0.0:0.2001:0.527:0.2729	.	128;113	Q8NDY8;Q8NDY8-2	TMM52_HUMAN;.	W	113;128	ENSP00000367865:R113W;ENSP00000311122:R128W	ENSP00000311122:R128W	R	-	1	2	TMEM52	1839429	0.000000	0.05858	0.597000	0.28824	0.136000	0.21042	0.255000	0.18333	0.822000	0.34565	0.511000	0.50034	CGG	TMEM52	-	NULL	ENSG00000178821		0.637	TMEM52-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM52	HGNC	protein_coding	OTTHUMT00000002781.1	-	0.00	101	0	G	NM_178545		1849569	-1	tier1	-	no_errors	ENST00000310991	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.576	A
TNS1	7145	genome.wustl.edu	37	2	218699888	218699888	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:218699888G>T	ENST00000171887.4	-	19	3283	c.2831C>A	c.(2830-2832)cCc>cAc	p.P944H	TNS1_ENST00000430930.1_Splice_Site_p.P944H|TNS1_ENST00000419504.1_Splice_Site_p.P944H	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	944					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GTGCAAATGGGGCTGTGGGAG	0.552																																																	0													55.0	46.0	49.0					2																	218699888		2203	4300	6503	SO:0001630	splice_region_variant	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.2830-1C>A	2.37:g.218699888G>T			Q4ZG71|Q6IPI5	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.P944H	ENST00000171887.4	37	c.2831	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528083	0.85706	.	.	ENSG00000079308	ENST00000171887;ENST00000446688;ENST00000419504;ENST00000430930	D;T;D;D	0.92099	-2.97;2.15;-2.9;-2.94	5.31	5.31	0.75309	.	0.868979	0.10103	N	0.715734	D	0.93119	0.7809	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	P;D;P	0.66196	0.897;0.942;0.862	D	0.90294	0.4325	10	0.38643	T	0.18	.	17.9011	0.88904	0.0:0.0:1.0:0.0	.	944;944;944	Q9HBL0;E9PGF5;E9PF55	TENS1_HUMAN;.;.	H	944;103;944;944	ENSP00000171887:P944H;ENSP00000394171:P103H;ENSP00000408724:P944H;ENSP00000406016:P944H	ENSP00000171887:P944H	P	-	2	0	TNS1	218408133	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.734000	0.55037	2.749000	0.94314	0.655000	0.94253	CCC	TNS1	-	NULL	ENSG00000079308		0.552	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	-	0.00	110	0	G	NM_022648	Missense_Mutation	218699888	-1	tier1	-	no_errors	ENST00000171887	ensembl	human	known	74_37	missense	5.43	87	5	SNP	1.000	T
TOP1MT	116447	genome.wustl.edu	37	8	144403487	144403487	+	Missense_Mutation	SNP	G	G	T	rs72701720	byFrequency	TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:144403487G>T	ENST00000329245.4	-	8	1064	c.1030C>A	c.(1030-1032)Cgc>Agc	p.R344S	TOP1MT_ENST00000519148.1_Missense_Mutation_p.R246S|TOP1MT_ENST00000523676.1_Missense_Mutation_p.R246S|TOP1MT_ENST00000521193.1_Missense_Mutation_p.R246S	NM_052963.2	NP_443195.1	Q969P6	TOP1M_HUMAN	topoisomerase (DNA) I, mitochondrial	344					DNA replication (GO:0006260)|DNA topological change (GO:0006265)	chromosome (GO:0005694)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)			endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	23	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	TGCTCCACGCGGAGGGAACAG	0.607																																																	0													113.0	97.0	102.0					8																	144403487		2202	4300	6502	SO:0001583	missense	0			AF349018	CCDS6400.1, CCDS59115.1	8q24.3	2006-04-12				ENSG00000184428			29787	protein-coding gene	gene with protein product		606387				11526219	Standard	NM_052963		Approved		uc003yxz.4	Q969P6		ENST00000329245.4:c.1030C>A	8.37:g.144403487G>T	ENSP00000328835:p.Arg344Ser		B7ZAR5|E7ES89|Q86ST4|Q86V82	Missense_Mutation	SNP	pfam_TopoI_DNA-bd_euk,pfam_TopoI_cat_euk,superfamily_TopoI_DNA-bd_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk,prints_TopoI	p.R344S	ENST00000329245.4	37	c.1030	CCDS6400.1	8	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205653	0.39003	.	.	ENSG00000184428	ENST00000329245;ENST00000521193;ENST00000519148;ENST00000523676	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	3.97	3.08	0.35506	DNA breaking-rejoining enzyme, catalytic core (1);DNA topoisomerase I, C-terminal, eukaryotic-type (1);DNA topoisomerase I, catalytic core, eukaryotic-type (1);DNA topoisomerase I, C-terminal (1);DNA topoisomerase I, catalytic core, alpha-helical subdomain, eukaryotic-type (1);	0.158659	0.29172	U	0.012927	T	0.77691	0.4168	H	0.96777	3.88	0.58432	D	0.999994	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.77021	-0.2742	10	0.87932	D	0	.	6.0462	0.19762	0.1002:0.0:0.7145:0.1853	.	139;344	E7ESI1;Q969P6	.;TOP1M_HUMAN	S	344;246;246;246	ENSP00000328835:R344S;ENSP00000428369:R246S;ENSP00000429169:R246S;ENSP00000429181:R246S	ENSP00000328835:R344S	R	-	1	0	TOP1MT	144474862	0.956000	0.32656	0.477000	0.27303	0.160000	0.22226	0.260000	0.18424	0.612000	0.30071	0.514000	0.50259	CGC	TOP1MT	-	pfam_TopoI_cat_euk,superfamily_DNA_brk_join_enz,smart_TopoI_euk,prints_TopoI	ENSG00000184428		0.607	TOP1MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP1MT	HGNC	protein_coding	OTTHUMT00000381247.3	-	0.00	70	0	G	NM_052963		144403487	-1	tier1	-	no_errors	ENST00000329245	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.742	T
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	66	0	G	NM_000546		7577539	-1	tier1	rs121912651	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	58.54	17	24	SNP	1.000	A
TRIM7	81786	genome.wustl.edu	37	5	180630635	180630635	+	Silent	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:180630635G>T	ENST00000274773.7	-	2	589	c.528C>A	c.(526-528)ctC>ctA	p.L176L	CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000422067.2_5'UTR|CTC-338M12.1_ENST00000503314.1_RNA|CTC-338M12.6_ENST00000419707.2_RNA|CTC-338M12.6_ENST00000511517.1_RNA|TRIM7_ENST00000393319.3_5'Flank|CTC-338M12.6_ENST00000514784.1_RNA|CTC-338M12.6_ENST00000502812.2_RNA|TRIM7_ENST00000361809.3_5'UTR|TRIM7_ENST00000393315.1_5'UTR|TRIM7_ENST00000334421.5_Silent_p.L176L	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	176						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		TGGACTCCAAGAGCTCCTGTA	0.577																																					Esophageal Squamous(128;2258 2308 35507 48647)												0													61.0	62.0	62.0					5																	180630635		2203	4300	6503	SO:0001819	synonymous_variant	0			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.528C>A	5.37:g.180630635G>T			A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin,prints_Znf_B-box_chordata	p.L176	ENST00000274773.7	37	c.528	CCDS4462.1	5																																																																																			TRIM7	-	NULL	ENSG00000146054		0.577	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	HGNC	protein_coding	OTTHUMT00000253569.3		0.00	14	0	G	NM_203296		180630635	-1			no_errors	ENST00000274773	ensembl	human	known	74_37	silent	11.76	15	2	SNP	0.872	T
TRPM4	54795	genome.wustl.edu	37	19	49703657	49703657	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:49703657C>A	ENST00000252826.5	+	18	2872	c.2746C>A	c.(2746-2748)Ctg>Atg	p.L916M	TRPM4_ENST00000355712.5_Missense_Mutation_p.L562M|TRPM4_ENST00000427978.2_Missense_Mutation_p.L771M	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	916					calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		CAACAAACAGCTGGGGCCCAA	0.617																																																	0													49.0	44.0	46.0					19																	49703657		2203	4300	6503	SO:0001583	missense	0			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.2746C>A	19.37:g.49703657C>A	ENSP00000252826:p.Leu916Met		A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L916M	ENST00000252826.5	37	c.2746	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	C	26.8	4.776827	0.90195	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	D;T;D	0.99042	-5.36;-0.57;-5.36	4.21	4.21	0.49690	Ion transport (1);	0.000000	0.64402	D	0.000004	D	0.99089	0.9687	M	0.70108	2.13	0.58432	D	0.999992	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;1.0	D	0.99497	1.0952	10	0.72032	D	0.01	-15.2844	15.7186	0.77688	0.0:1.0:0.0:0.0	.	562;742;771;916	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	M	916;771;562	ENSP00000252826:L916M;ENSP00000407492:L771M;ENSP00000347944:L562M	ENSP00000252826:L916M	L	+	1	2	TRPM4	54395469	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.405000	0.59741	2.084000	0.62774	0.491000	0.48974	CTG	TRPM4	-	pfam_Ion_trans_dom	ENSG00000130529		0.617	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	-	0.00	49	0	C	NM_017636		49703657	+1	tier1	-	no_errors	ENST00000252826	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
TTC39B	158219	genome.wustl.edu	37	9	15172044	15172044	+	Missense_Mutation	SNP	G	G	T	rs373714994		TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr9:15172044G>T	ENST00000512701.2	-	20	2058	c.2022C>A	c.(2020-2022)caC>caA	p.H674Q	TTC39B_ENST00000355694.2_Missense_Mutation_p.H608Q|TTC39B_ENST00000507285.1_Missense_Mutation_p.H509Q|TTC39B_ENST00000297615.5_Missense_Mutation_p.H605Q|TTC39B_ENST00000380850.4_Missense_Mutation_p.H661Q|TTC39B_ENST00000507993.1_Missense_Mutation_p.H509Q			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	674										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						TTCTCCAGAGGTGAAGAGCTG	0.373																																																	0													105.0	101.0	102.0					9																	15172044		2203	4300	6503	SO:0001583	missense	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.2022C>A	9.37:g.15172044G>T	ENSP00000422496:p.His674Gln		A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.H674Q	ENST00000512701.2	37	c.2022	CCDS6477.2	9	.	.	.	.	.	.	.	.	.	.	G	10.65	1.409138	0.25378	.	.	ENSG00000155158	ENST00000380850;ENST00000297615;ENST00000355694;ENST00000512701;ENST00000507285;ENST00000507993	T;T;T;T;T;T	0.40476	1.57;1.03;1.6;1.57;1.03;1.03	5.56	-0.39	0.12450	.	0.660669	0.15176	N	0.276389	T	0.18002	0.0432	N	0.16903	0.455	0.80722	D	1	B;B;B;B;B	0.18741	0.03;0.018;0.001;0.001;0.001	B;B;B;B;B	0.13407	0.009;0.004;0.001;0.001;0.001	T	0.14559	-1.0468	10	0.16896	T	0.51	-6.7653	0.6938	0.00896	0.2607:0.1263:0.3539:0.2592	.	605;661;606;608;191	F5H705;E9PAQ9;A5PLN1;Q5VTQ0;Q8IXZ6	.;.;.;TT39B_HUMAN;.	Q	661;605;608;674;509;509	ENSP00000370231:H661Q;ENSP00000297615:H605Q;ENSP00000347920:H608Q;ENSP00000422496:H674Q;ENSP00000426539:H509Q;ENSP00000423392:H509Q	ENSP00000297615:H605Q	H	-	3	2	TTC39B	15162044	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	1.337000	0.33862	-0.367000	0.08052	0.655000	0.94253	CAC	TTC39B	-	NULL	ENSG00000155158		0.373	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	-	0.00	51	0	G	NM_152574		15172044	-1	tier1	-	no_errors	ENST00000512701	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.993	T
TTN	7273	genome.wustl.edu	37	2	179443708	179443708	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:179443708C>A	ENST00000591111.1	-	270	63350	c.63126G>T	c.(63124-63126)aaG>aaT	p.K21042N	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K13743N|TTN_ENST00000460472.2_Missense_Mutation_p.K13618N|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K22683N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K13810N|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K20115N|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21042	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGAATCCCTCTTCTCTAGGA	0.453																																																	0													94.0	92.0	92.0					2																	179443708		1961	4137	6098	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63126G>T	2.37:g.179443708C>A	ENSP00000465570:p.Lys21042Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K20115N	ENST00000591111.1	37	c.60345		2	.	.	.	.	.	.	.	.	.	.	C	9.945	1.218433	0.22373	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.76	2.99	0.34606	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.77592	0.4153	H	0.94183	3.505	0.52501	D	0.999953	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.81553	-0.0880	9	0.87932	D	0	.	10.9826	0.47504	0.0:0.6924:0.0:0.3076	.	13618;13743;13810;21042	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	20115;13618;13810;13743;13616	ENSP00000343764:K20115N;ENSP00000434586:K13618N;ENSP00000340554:K13810N;ENSP00000352154:K13743N	ENSP00000340554:K13810N	K	-	3	2	TTN	179151954	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.568000	0.36418	0.777000	0.33496	-0.143000	0.13931	AAG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	56	0	C	NM_133378		179443708	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	7.25	64	5	SNP	1.000	A
TYRO3	7301	genome.wustl.edu	37	15	41870293	41870293	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:41870293C>T	ENST00000263798.3	+	19	2716	c.2492C>T	c.(2491-2493)gCt>gTt	p.A831V	TYRO3_ENST00000559066.1_Missense_Mutation_p.A786V	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	831			A -> T. {ECO:0000269|PubMed:17344846}.		apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TACAGTGGGGCTGGGGATGGC	0.652																																																	0													26.0	30.0	28.0					15																	41870293		2203	4300	6503	SO:0001583	missense	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2492C>T	15.37:g.41870293C>T	ENSP00000263798:p.Ala831Val		O14953|Q86VR3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A831V	ENST00000263798.3	37	c.2492	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	C	12.04	1.819748	0.32145	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.73363	-0.74	5.94	3.89	0.44902	.	0.355104	0.20503	N	0.091050	T	0.57417	0.2052	N	0.24115	0.695	0.24718	N	0.993165	P	0.36282	0.546	B	0.35550	0.205	T	0.48468	-0.9033	10	0.28530	T	0.3	-1.6412	9.1447	0.36925	0.2422:0.6766:0.0:0.0812	.	831	Q06418	TYRO3_HUMAN	V	763;831	ENSP00000263798:A831V	ENSP00000263798:A831V	A	+	2	0	TYRO3	39657585	0.064000	0.20934	0.798000	0.32154	0.446000	0.32137	0.503000	0.22610	1.521000	0.48983	0.650000	0.86243	GCT	TYRO3	-	NULL	ENSG00000092445		0.652	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2	-	0.00	61	0	C			41870293	+1	tier1	-	no_errors	ENST00000263798	ensembl	human	known	74_37	missense	26.03	54	19	SNP	0.216	T
UPK1A	11045	genome.wustl.edu	37	19	36159275	36159275	+	Intron	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:36159275G>T	ENST00000222275.2	+	2	84				UPK1A-AS1_ENST00000443196.1_RNA|UPK1A_ENST00000379013.2_Intron	NM_007000.2	NP_008931.1	O00322	UPK1A_HUMAN	uroplakin 1A						epithelial cell differentiation (GO:0030855)|protein oligomerization (GO:0051259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	monosaccharide binding (GO:0048029)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(2)|stomach(2)	9	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCCAAATGGGGAGGGAACTT	0.612																																																	0																																										SO:0001627	intron_variant	0			AF085807	CCDS12470.1, CCDS62640.1	19q13.1	2013-02-14			ENSG00000105668	ENSG00000105668		"""Tetraspanins"""	12577	protein-coding gene	gene with protein product		611557				9846985, 10404304	Standard	NM_007000		Approved	TSPAN21	uc002oaw.3	O00322	OTTHUMG00000048115	ENST00000222275.2:c.85-81G>T	19.37:g.36159275G>T			Q3KNU5|Q3KNU6	RNA	SNP	-	NULL	ENST00000222275.2	37	NULL	CCDS12470.1	19																																																																																			UPK1A-AS1	-	-	ENSG00000226510		0.612	UPK1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPK1A-AS1	HGNC	protein_coding	OTTHUMT00000109486.3	-	0.00	59	0	G			36159275	-1	tier1	-	no_errors	ENST00000443196	ensembl	human	known	74_37	rna	9.09	40	4	SNP	0.000	T
USP6NL	9712	genome.wustl.edu	37	10	11527902	11527903	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr10:11527902_11527903insA	ENST00000609104.1	-	11	1066_1067	c.672_673insT	c.(670-675)tttgtcfs	p.V225fs	USP6NL_ENST00000277575.5_Frame_Shift_Ins_p.V242fs|USP6NL_ENST00000379237.2_Frame_Shift_Ins_p.V248fs	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	225	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						AAACCTTGGACAAAAAAGCCTA	0.322																																																	0																																										SO:0001589	frameshift_variant	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.673dupT	10.37:g.11527908_11527908dupA	ENSP00000476462:p.Val225fs		A8KA79|Q15400|Q5VV10|Q7L0K9	Frame_Shift_Ins	INS	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.V247fs	ENST00000609104.1	37	c.742_741	CCDS53492.1	10																																																																																			USP6NL	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000148429		0.322	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3		0.00	44	0	-	NM_014688		11527903	-1	tier1		no_errors	ENST00000379237	ensembl	human	known	74_37	frame_shift_ins	15.79	48	9	INS	1.000:1.000	A
UTY	7404	genome.wustl.edu	37	Y	15417345	15417345	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrY:15417345C>G	ENST00000331397.4	-	22	4215	c.3208G>C	c.(3208-3210)Ggg>Cgg	p.G1070R	AC010877.1_ENST00000595988.1_5'Flank|UTY_ENST00000382896.4_Missense_Mutation_p.G1115R|UTY_ENST00000362096.4_Missense_Mutation_p.G1070R|UTY_ENST00000537580.1_Missense_Mutation_p.G991R	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	1070	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						ATGGTATGCCCAACATGGGTT	0.413																																					Colon(103;1740 2135 40732 45171)												0													49.0	54.0	53.0					Y																	15417345		588	1929	2517	SO:0001583	missense	0			AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.3208G>C	Y.37:g.15417345C>G	ENSP00000328939:p.Gly1070Arg		A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G1115R	ENST00000331397.4	37	c.3343	CCDS14783.1	Y																																																																																			UTY	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000183878		0.413	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UTY	HGNC	protein_coding	OTTHUMT00000088394.1	-	0.00	34	0	C	NM_182660		15417345	-1	tier1	-	no_errors	ENST00000382896	ensembl	human	known	74_37	missense	58.06	13	18	SNP	1.000	G
VPS45	11311	genome.wustl.edu	37	1	150082514	150082514	+	Intron	DEL	A	A	-			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr1:150082514delA	ENST00000369130.3	+	14	2039				VPS45_ENST00000484306.1_3'UTR|VPS45_ENST00000535106.1_Intron|VPS45_ENST00000369128.5_Intron	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCCTCCACCAAAAAAAAAAG	0.303																																																	0																																										SO:0001627	intron_variant	0			U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1494-97A>-	1.37:g.150082514delA			D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	RNA	DEL	-	NULL	ENST00000369130.3	37	NULL	CCDS944.1	1																																																																																			VPS45	-	-	ENSG00000136631		0.303	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	HGNC	protein_coding	OTTHUMT00000034964.1		0.00	53	0	A	NM_007259		150082514	+1	tier1		no_errors	ENST00000484306	ensembl	human	known	74_37	rna	10.42	43	5	DEL	0.965	-
VSIG1	340547	genome.wustl.edu	37	X	107320559	107320559	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chrX:107320559G>T	ENST00000217957.5	+	7	1229	c.1112G>T	c.(1111-1113)gGg>gTg	p.G371V	VSIG1_ENST00000415430.3_Missense_Mutation_p.G407V	NM_182607.4	NP_872413.1	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	371						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17						tcagagccTGGGGTTGTAGTT	0.527																																																	0													97.0	94.0	95.0					X																	107320559		2203	4300	6503	SO:0001583	missense	0			BX648658	CCDS14535.1, CCDS55474.1	Xq22.3	2013-01-29			ENSG00000101842	ENSG00000101842		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28675	protein-coding gene	gene with protein product		300620				12477932	Standard	NM_182607		Approved	MGC44287	uc011msk.2	Q86XK7	OTTHUMG00000022175	ENST00000217957.5:c.1112G>T	X.37:g.107320559G>T	ENSP00000217957:p.Gly371Val		C9J4P2|Q6MZS4	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.G407V	ENST00000217957.5	37	c.1220	CCDS14535.1	X	.	.	.	.	.	.	.	.	.	.	G	8.795	0.931469	0.18131	.	.	ENSG00000101842	ENST00000415430;ENST00000217957	T;T	0.76060	-0.99;-0.75	4.2	-5.95	0.02241	.	3.334180	0.01682	N	0.026198	T	0.61426	0.2346	L	0.43152	1.355	0.18873	N	0.999985	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.39165	-0.9627	10	0.48119	T	0.1	.	2.0377	0.03543	0.5068:0.1171:0.1537:0.2225	.	407;371	C9J4P2;Q86XK7	.;VSIG1_HUMAN	V	407;371	ENSP00000402219:G407V;ENSP00000217957:G371V	ENSP00000217957:G371V	G	+	2	0	VSIG1	107207215	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.563000	0.02154	-2.005000	0.00959	-1.144000	0.01866	GGG	VSIG1	-	NULL	ENSG00000101842		0.527	VSIG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VSIG1	HGNC	protein_coding	OTTHUMT00000057858.1	-	0.00	65	0	G	NM_182607		107320559	+1	tier1	-	no_errors	ENST00000415430	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	T
WASH3P	374666	genome.wustl.edu	37	15	102516346	102516346	+	RNA	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr15:102516346G>T	ENST00000557932.1	+	0	1294				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GCATCTCTGGGAAAGGACCTG	0.627																																																	0																																												0					15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102516346G>T				RNA	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			WASH3P	-	-	ENSG00000185596		0.627	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	-	0.00	312	0	G	NM_199163		102516346	+1	tier1	-	no_errors	ENST00000557932	ensembl	human	known	74_37	rna	9.65	233	25	SNP	0.998	T
WDR19	57728	genome.wustl.edu	37	4	39279751	39279751	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr4:39279751G>T	ENST00000399820.3	+	35	3995	c.3841G>T	c.(3841-3843)Ggt>Tgt	p.G1281C	WDR19_ENST00000288634.7_Splice_Site_p.G1121C	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	1281					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)				large_intestine(1)	1						CTGTTTCCAGGGTCGACACAT	0.388																																																	0													78.0	71.0	73.0					4																	39279751		1901	4115	6016	SO:0001630	splice_region_variant	0			AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.3841-1G>T	4.37:g.39279751G>T			B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G1281C	ENST00000399820.3	37	c.3841	CCDS47042.1	4	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366080	0.82463	.	.	ENSG00000157796	ENST00000399820;ENST00000288634	D;D	0.82984	-1.61;-1.67	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.93324	0.7872	M	0.91920	3.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94133	0.7390	9	.	.	.	-22.5277	19.4662	0.94943	0.0:0.0:1.0:0.0	.	1281	Q8NEZ3	WDR19_HUMAN	C	1281;1121	ENSP00000382717:G1281C;ENSP00000288634:G1121C	.	G	+	1	0	WDR19	38956146	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.320000	0.96346	2.616000	0.88540	0.491000	0.48974	GGT	WDR19	-	NULL	ENSG00000157796		0.388	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR19	HGNC	protein_coding	OTTHUMT00000360689.1	-	0.00	69	0	G		Missense_Mutation	39279751	+1	tier1	-	no_errors	ENST00000399820	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	T
WFIKKN1	117166	genome.wustl.edu	37	16	683091	683091	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr16:683091G>T	ENST00000319070.2	+	2	1003	c.681G>T	c.(679-681)gaG>gaT	p.E227D		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	227	Ig-like C2-type.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				ACCAGCGAGAGAACCTGATCA	0.662																																																	0													33.0	35.0	34.0					16																	683091		2190	4283	6473	SO:0001583	missense	0			AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.681G>T	16.37:g.683091G>T	ENSP00000324763:p.Glu227Asp		Q7LDW0|Q8NBQ1|Q96S20	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Ig_V-set,pfam_WAP-type_4-diS_core,pfam_Kazal_dom,pfam_Immunoglobulin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like_dom,prints_Prot_inh_Kunz-m	p.E227D	ENST00000319070.2	37	c.681	CCDS10414.1	16	.	.	.	.	.	.	.	.	.	.	g	12.82	2.053696	0.36277	.	.	ENSG00000127578	ENST00000319070	D	0.95724	-3.79	4.71	3.75	0.43078	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.203716	0.42172	N	0.000753	D	0.90992	0.7167	N	0.17312	0.475	0.35210	D	0.775027	P	0.43938	0.822	P	0.48488	0.579	D	0.90048	0.4147	10	0.32370	T	0.25	.	6.7739	0.23609	0.092:0.0:0.7335:0.1745	.	227	Q96NZ8	WFKN1_HUMAN	D	227	ENSP00000324763:E227D	ENSP00000324763:E227D	E	+	3	2	WFIKKN1	623092	0.913000	0.31002	1.000000	0.80357	0.932000	0.56968	0.090000	0.15025	0.983000	0.38602	0.486000	0.48141	GAG	WFIKKN1	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000127578		0.662	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN1	HGNC	protein_coding	OTTHUMT00000206731.2	-	0.00	44	0	G	NM_053284		683091	+1	tier1	-	no_errors	ENST00000319070	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.997	T
XDH	7498	genome.wustl.edu	37	2	31569643	31569643	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:31569643C>A	ENST00000379416.3	-	30	3391	c.3343G>T	c.(3343-3345)Gaa>Taa	p.E1115*		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	1115					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	ACCCAGTCTTCCCAGGAGCCA	0.512																																					Colon(66;682 1445 30109 40147)												0													153.0	158.0	156.0					2																	31569643		2203	4300	6503	SO:0001587	stop_gained	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.3343G>T	2.37:g.31569643C>A	ENSP00000368727:p.Glu1115*		Q16681|Q16712|Q4PJ16	Nonsense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.E1115*	ENST00000379416.3	37	c.3343	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	C	42	9.538066	0.99199	.	.	ENSG00000158125	ENST00000379416	.	.	.	6.03	4.22	0.49857	.	0.133866	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	12.6179	0.56588	0.0:0.8637:0.0:0.1363	.	.	.	.	X	1115	.	ENSP00000368727:E1115X	E	-	1	0	XDH	31423147	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.740000	0.38228	1.551000	0.49450	0.655000	0.94253	GAA	XDH	-	pfam_AldOxase/xan_DH_Mopterin-bd,superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH	ENSG00000158125		0.512	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	-	0.00	99	0	C	NM_000379		31569643	-1	tier1	-	no_errors	ENST00000379416	ensembl	human	known	74_37	nonsense	14.63	105	18	SNP	1.000	A
XRCC1	7515	genome.wustl.edu	37	19	44056361	44056361	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:44056361C>T	ENST00000262887.5	-	9	1437	c.890G>A	c.(889-891)gGc>gAc	p.G297D	XRCC1_ENST00000543982.1_Missense_Mutation_p.G266D|L34079.3_ENST00000597119.1_RNA			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	297					base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				TCGGGGTTTGCCTGTCACTGC	0.622								Other BER factors																																									0													59.0	54.0	56.0					19																	44056361		2203	4300	6503	SO:0001583	missense	0			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.890G>A	19.37:g.44056361C>T	ENSP00000262887:p.Gly297Asp		Q6IBS4|Q9HCB1	Missense_Mutation	SNP	pfam_Xrcc1_N,pfam_BRCT_dom,superfamily_Galactose-bd-like,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.G297D	ENST00000262887.5	37	c.890	CCDS12624.1	19	.	.	.	.	.	.	.	.	.	.	C	6.235	0.411407	0.11812	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982;ENST00000538738	T;T	0.02525	4.27;4.26	4.71	-3.71	0.04424	.	0.609401	0.16623	N	0.206405	T	0.02610	0.0079	M	0.63428	1.95	0.09310	N	1	B;B	0.26809	0.16;0.112	B;B	0.33690	0.168;0.024	T	0.48547	-0.9026	10	0.09084	T	0.74	-5.9088	1.0551	0.01588	0.1388:0.3058:0.2725:0.2829	.	266;297	F5H8D7;P18887	.;XRCC1_HUMAN	D	311;297;266;297	ENSP00000262887:G297D;ENSP00000443671:G266D	ENSP00000262887:G297D	G	-	2	0	XRCC1	48748201	0.000000	0.05858	0.020000	0.16555	0.013000	0.08279	-1.550000	0.02180	-0.592000	0.05851	0.561000	0.74099	GGC	XRCC1	-	NULL	ENSG00000073050		0.622	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	HGNC	protein_coding	OTTHUMT00000463194.1	-	0.00	81	0	C	NM_006297		44056361	-1	tier1	-	no_errors	ENST00000262887	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.003	T
ZAP70	7535	genome.wustl.edu	37	2	98355845	98355845	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:98355845G>T	ENST00000264972.5	+	14	1959	c.1744G>T	c.(1744-1746)Gat>Tat	p.D582Y	ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000451498.2_Missense_Mutation_p.D275Y|ZAP70_ENST00000442208.1_Missense_Mutation_p.D456Y	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	582	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CAGGTGGGAGGATCGCCCCGA	0.652																																																	0													43.0	40.0	41.0					2																	98355845		2203	4300	6503	SO:0001583	missense	0			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1744G>T	2.37:g.98355845G>T	ENSP00000264972:p.Asp582Tyr		A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.D582Y	ENST00000264972.5	37	c.1744	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451066	0.63290	.	.	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	D;D;D	0.83506	-1.73;-1.73;-1.73	4.51	3.56	0.40772	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.315833	0.22408	N	0.060448	D	0.88962	0.6580	M	0.80508	2.5	0.43061	D	0.994681	D;D	0.69078	0.997;0.992	D;D	0.64595	0.927;0.922	D	0.89571	0.3813	10	0.87932	D	0	.	9.284	0.37746	0.0:0.0:0.7855:0.2145	.	456;582	P43403-3;P43403	.;ZAP70_HUMAN	Y	582;456;275	ENSP00000264972:D582Y;ENSP00000411141:D456Y;ENSP00000400475:D275Y	ENSP00000264972:D582Y	D	+	1	0	ZAP70	97722277	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	4.288000	0.59007	2.236000	0.73375	0.655000	0.94253	GAT	ZAP70	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000115085		0.652	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1	-	0.00	92	0	G			98355845	+1	tier1	-	no_errors	ENST00000264972	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	T
ZFPM2	23414	genome.wustl.edu	37	8	106813630	106813630	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr8:106813630G>T	ENST00000407775.2	+	8	1570	c.1320G>T	c.(1318-1320)aaG>aaT	p.K440N	RP11-152P17.2_ENST00000509144.2_RNA|ZFPM2_ENST00000522296.1_3'UTR|ZFPM2_ENST00000517361.1_Missense_Mutation_p.K308N|ZFPM2_ENST00000378472.4_Missense_Mutation_p.K171N|RP11-152P17.2_ENST00000524045.2_RNA|RP11-152P17.2_ENST00000521622.1_RNA|ZFPM2_ENST00000520492.1_Missense_Mutation_p.K308N|RP11-152P17.2_ENST00000520594.1_RNA|RP11-152P17.2_ENST00000518932.1_RNA|RP11-152P17.2_ENST00000520433.1_RNA	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	440					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			AGCTGGACAAGTGTGAGAAAA	0.453																																																	0													62.0	66.0	65.0					8																	106813630		1927	4142	6069	SO:0001583	missense	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.1320G>T	8.37:g.106813630G>T	ENSP00000384179:p.Lys440Asn		Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K440N	ENST00000407775.2	37	c.1320	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536981	0.45176	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000517361;ENST00000378472	T;T;T;T	0.20463	2.07;2.55;2.55;3.75	5.97	5.1	0.69264	.	0.045004	0.85682	D	0.000000	T	0.20618	0.0496	L	0.46157	1.445	0.54753	D	0.999985	D	0.53151	0.958	P	0.45343	0.477	T	0.03306	-1.1050	10	0.22109	T	0.4	.	9.7412	0.40420	0.1944:0.0:0.8056:0.0	.	440	Q8WW38	FOG2_HUMAN	N	440;308;308;171	ENSP00000384179:K440N;ENSP00000430757:K308N;ENSP00000428720:K308N;ENSP00000367733:K171N	ENSP00000367733:K171N	K	+	3	2	ZFPM2	106882806	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.391000	0.44424	1.545000	0.49373	-0.136000	0.14681	AAG	ZFPM2	-	NULL	ENSG00000169946		0.453	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	-	0.00	49	0	G			106813630	+1	tier1	-	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
ZIK1	284307	genome.wustl.edu	37	19	58096319	58096319	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:58096319G>T	ENST00000597850.1	+	2	248		c.e2-1		ZIK1_ENST00000307468.4_Intron|ZIK1_ENST00000598726.1_Intron|ZIK1_ENST00000536878.2_Intron|ZIK1_ENST00000599456.1_Intron	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCTTTCCACAGGTTACTGTGT	0.552																																																	0													115.0	99.0	105.0					19																	58096319		2203	4300	6503	SO:0001630	splice_region_variant	0			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.34-1G>T	19.37:g.58096319G>T			O43339|Q3SY51|Q3SY53	Splice_Site	SNP	-	e2-1	ENST00000597850.1	37	c.34-1	CCDS33135.1	19	.	.	.	.	.	.	.	.	.	.	G	3.710	-0.059760	0.07317	.	.	ENSG00000171649	ENST00000307468	.	.	.	2.75	1.67	0.24075	.	.	.	.	.	.	.	.	.	.	.	0.23607	N	0.997306	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6394	0.22901	0.0:0.0:0.6888:0.3112	.	.	.	.	.	-1	.	.	.	+	.	.	ZIK1	62788131	0.005000	0.15991	0.004000	0.12327	0.008000	0.06430	0.734000	0.26101	0.675000	0.31264	0.491000	0.48974	.	ZIK1	-	-	ENSG00000171649		0.552	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZIK1	HGNC	protein_coding	OTTHUMT00000466791.1	-	0.00	48	0	G	NM_001010879	Intron	58096319	+1	tier1	-	no_errors	ENST00000597850	ensembl	human	known	74_37	splice_site	11.11	32	4	SNP	0.005	T
ZNF131	7690	genome.wustl.edu	37	5	43173515	43173515	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:43173515G>A	ENST00000399534.1	+	6	1194	c.1150G>A	c.(1150-1152)Gca>Aca	p.A384T	ZNF131_ENST00000509634.1_Missense_Mutation_p.A350T|ZNF131_ENST00000509156.1_Missense_Mutation_p.A384T|ZNF131_ENST00000509931.1_Intron|ZNF131_ENST00000306938.4_Missense_Mutation_p.A350T|ZNF131_ENST00000505606.2_Missense_Mutation_p.A350T			P52739	ZN131_HUMAN	zinc finger protein 131	384					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						TGGAGTAGGGGCAAAAAAAGG	0.398																																																	0													71.0	68.0	69.0					5																	43173515		1893	4140	6033	SO:0001583	missense	0			U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.1150G>A	5.37:g.43173515G>A	ENSP00000382450:p.Ala384Thr		B4DRL3|Q6PIF0	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A384T	ENST00000399534.1	37	c.1150		5	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044463	0.93685	.	.	ENSG00000172262	ENST00000509156;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634	T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71	5.54	5.54	0.83059	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	N	0.13272	0.32	0.58432	D	0.999999	D;D	0.89917	0.997;1.0	D;D	0.87578	0.989;0.998	T	0.10800	-1.0614	10	0.48119	T	0.1	-9.5757	19.4927	0.95059	0.0:0.0:1.0:0.0	.	384;350	P52739;P52739-2	ZN131_HUMAN;.	T	384;350;384;350;350	ENSP00000426504:A384T;ENSP00000305804:A350T;ENSP00000382450:A384T;ENSP00000423945:A350T;ENSP00000421246:A350T	ENSP00000305804:A350T	A	+	1	0	ZNF131	43209272	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.471000	0.80985	2.611000	0.88343	0.557000	0.71058	GCA	ZNF131	-	pfscan_Znf_C2H2	ENSG00000172262		0.398	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	ZNF131	HGNC	protein_coding	OTTHUMT00000367982.1		0.00	54	0	G	NM_003432		43173515	+1			no_errors	ENST00000399534	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
ZNF142	7701	genome.wustl.edu	37	2	219509734	219509734	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:219509734C>A	ENST00000449707.1	-	8	1926	c.1505G>T	c.(1504-1506)aGc>aTc	p.S502I	ZNF142_ENST00000411696.2_Missense_Mutation_p.S502I	NM_001105537.1	NP_001099007.1	P52746	ZN142_HUMAN	zinc finger protein 142	502					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(7)|endometrium(7)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38		Renal(207;0.0474)		Epithelial(149;5.21e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)		CAGCTTGTGGCTGCTCAGCTG	0.552																																					Colon(170;867 1942 8995 15834 18053)												0													52.0	58.0	56.0					2																	219509734		2158	4262	6420	SO:0001583	missense	0			U09849	CCDS42817.1	2q35	2013-01-08	2006-06-13		ENSG00000115568	ENSG00000115568		"""Zinc fingers, C2H2-type"""	12927	protein-coding gene	gene with protein product		604083	"""zinc finger protein 142 (clone pHZ-49)"""				Standard	NM_001105537		Approved	KIAA0236, pHZ-49	uc002vin.4	P52746	OTTHUMG00000154736	ENST00000449707.1:c.1505G>T	2.37:g.219509734C>A	ENSP00000408643:p.Ser502Ile		Q92510	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S502I	ENST00000449707.1	37	c.1505	CCDS42817.1	2	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598680	0.87055	.	.	ENSG00000115568	ENST00000449707;ENST00000411696	T;T	0.40476	1.03;1.03	5.94	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.037067	0.85682	D	0.000000	T	0.46870	0.1415	N	0.12471	0.22	0.48901	D	0.999721	D;D	0.71674	0.998;0.998	D;D	0.85130	0.994;0.997	T	0.47774	-0.9091	10	0.39692	T	0.17	-2.8221	16.6436	0.85155	0.0:0.8704:0.1296:0.0	.	502;339	P52746;A8MWU9	ZN142_HUMAN;.	I	502	ENSP00000408643:S502I;ENSP00000398798:S502I	ENSP00000398798:S502I	S	-	2	0	ZNF142	219217978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.008000	0.70739	2.820000	0.97059	0.650000	0.86243	AGC	ZNF142	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000115568		0.552	ZNF142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF142	HGNC	protein_coding	OTTHUMT00000336833.1	-	0.00	39	0	C	NM_005081		219509734	-1	tier1	-	no_errors	ENST00000411696	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
ZNF18	7566	genome.wustl.edu	37	17	11881520	11881520	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr17:11881520G>T	ENST00000322748.3	-	9	2008	c.1404C>A	c.(1402-1404)taC>taA	p.Y468*	ZNF18_ENST00000454073.3_Nonsense_Mutation_p.Y467*|RP11-1096G20.5_ENST00000580270.1_RNA|ZNF18_ENST00000580306.2_Nonsense_Mutation_p.Y468*	NM_144680.2	NP_653281.2	P17022	ZNF18_HUMAN	zinc finger protein 18	468					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	14				Colorectal(4;3.33e-05)|COAD - Colon adenocarcinoma(4;0.000494)|READ - Rectum adenocarcinoma(10;0.233)		CTTTCCCACAGTAATCACATT	0.448																																																	0													83.0	85.0	84.0					17																	11881520		2203	4300	6503	SO:0001587	stop_gained	0			X52342	CCDS32568.1	17p12	2013-01-09	2006-05-10		ENSG00000154957	ENSG00000154957		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12969	protein-coding gene	gene with protein product		194524	"""zinc finger protein 18 (KOX 11)"""			15702252	Standard	XM_005256786		Approved	ZKSCAN6, KOX11, HDSG1, Zfp535, ZNF535, ZSCAN38	uc002gng.1	P17022	OTTHUMG00000178307	ENST00000322748.3:c.1404C>A	17.37:g.11881520G>T	ENSP00000315664:p.Tyr468*		Q5QHQ3|Q8IYC4|Q8NAH6	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Y468*	ENST00000322748.3	37	c.1404	CCDS32568.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.467577	0.96257	.	.	ENSG00000154957	ENST00000454073;ENST00000322748	.	.	.	5.62	2.1	0.27182	.	0.137207	0.33834	N	0.004512	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-6.6239	2.9525	0.05866	0.1737:0.1428:0.5369:0.1466	.	.	.	.	X	468	.	ENSP00000315664:Y468X	Y	-	3	2	ZNF18	11822245	0.000000	0.05858	0.933000	0.37362	0.976000	0.68499	-1.324000	0.02690	0.745000	0.32763	-0.259000	0.10710	TAC	ZNF18	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000154957		0.448	ZNF18-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF18	HGNC	protein_coding	OTTHUMT00000441450.2		0.00	42	0	G	XM_085596		11881520	-1			no_errors	ENST00000322748	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	0.011	T
ZNF217	7764	genome.wustl.edu	37	20	52193292	52193292	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr20:52193292C>T	ENST00000371471.2	-	4	2436	c.2011G>A	c.(2011-2013)Gca>Aca	p.A671T	RP4-724E16.2_ENST00000424252.1_RNA|ZNF217_ENST00000302342.3_Missense_Mutation_p.A671T			O75362	ZN217_HUMAN	zinc finger protein 217	671					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.A671T(2)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50	all_cancers(1;6.75e-17)|all_epithelial(1;1.76e-18)|Breast(2;3.83e-14)|Lung NSC(4;9.04e-07)|all_lung(4;2.5e-06)|Ovarian(1;0.0398)		BRCA - Breast invasive adenocarcinoma(1;9.88e-17)|Epithelial(1;1.56e-14)|all cancers(1;9.44e-13)|STAD - Stomach adenocarcinoma(23;0.0474)|Colorectal(105;0.198)			CAGTCAGCTGCGGTCTCCGTT	0.483																																																	2	Substitution - Missense(2)	large_intestine(2)											155.0	159.0	157.0					20																	52193292		2203	4300	6503	SO:0001583	missense	0			AF041259	CCDS13443.1	20q13.2	2013-01-08			ENSG00000171940	ENSG00000171940		"""Zinc fingers, C2H2-type"""	13009	protein-coding gene	gene with protein product		602967				9671742	Standard	NM_006526		Approved	ZABC1	uc002xwq.4	O75362	OTTHUMG00000032764	ENST00000371471.2:c.2011G>A	20.37:g.52193292C>T	ENSP00000360526:p.Ala671Thr		E1P5Y6|Q14DB8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A671T	ENST00000371471.2	37	c.2011	CCDS13443.1	20	.	.	.	.	.	.	.	.	.	.	C	1.784	-0.481154	0.04383	.	.	ENSG00000171940	ENST00000371471;ENST00000302342	T;T	0.08008	3.14;3.14	5.03	0.742	0.18341	.	1.092080	0.06895	N	0.804926	T	0.05868	0.0153	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.46205	-0.9208	10	0.11182	T	0.66	-3.4205	5.7814	0.18308	0.1265:0.5884:0.0:0.2851	.	671	O75362	ZN217_HUMAN	T	671	ENSP00000360526:A671T;ENSP00000304308:A671T	ENSP00000304308:A671T	A	-	1	0	ZNF217	51626699	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.383000	0.07398	0.229000	0.21039	0.555000	0.69702	GCA	ZNF217	-	NULL	ENSG00000171940		0.483	ZNF217-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF217	HGNC	protein_coding	OTTHUMT00000079757.2		0.00	81	0	C	NM_006526		52193292	-1			no_errors	ENST00000302342	ensembl	human	known	74_37	missense	5.97	62	4	SNP	0.000	T
ZNF347	84671	genome.wustl.edu	37	19	53644240	53644240	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr19:53644240C>A	ENST00000334197.7	-	5	1909	c.1841G>T	c.(1840-1842)aGg>aTg	p.R614M	ZNF347_ENST00000452676.2_Missense_Mutation_p.R615M|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Missense_Mutation_p.R615M	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	614					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TCGCTGATGCCTTGAAAGGTA	0.388																																					Melanoma(64;205 1597 17324 45721)												0													112.0	107.0	109.0					19																	53644240		2203	4300	6503	SO:0001583	missense	0			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1841G>T	19.37:g.53644240C>A	ENSP00000334146:p.Arg614Met		B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R615M	ENST00000334197.7	37	c.1844	CCDS33097.1	19	.	.	.	.	.	.	.	.	.	.	C	2.531	-0.308612	0.05458	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.26660	1.72;1.72	3.01	-6.02	0.02192	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19805	0.0476	L	0.51422	1.61	0.09310	N	1	P;B	0.44690	0.841;0.239	P;B	0.45881	0.496;0.163	T	0.17319	-1.0373	9	0.34782	T	0.22	.	0.204	0.00148	0.3314:0.221:0.212:0.2356	.	615;614	G5E9N4;Q96SE7	.;ZN347_HUMAN	M	614;615	ENSP00000334146:R614M;ENSP00000405218:R615M	ENSP00000334146:R614M	R	-	2	0	ZNF347	58336052	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-15.353000	0.00000	-4.992000	0.00025	-0.890000	0.02929	AGG	ZNF347	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197937		0.388	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	-	0.00	79	0	C	NM_032584		53644240	-1	tier1	-	no_errors	ENST00000452676	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	A
ZNF354C	30832	genome.wustl.edu	37	5	178507022	178507022	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr5:178507022G>T	ENST00000315475.6	+	5	1895	c.1589G>T	c.(1588-1590)gGg>gTg	p.G530V		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	530					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		AAGGAATATGGGAAACCTTTC	0.373																																																	0													89.0	93.0	92.0					5																	178507022		2203	4300	6503	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1589G>T	5.37:g.178507022G>T	ENSP00000324064:p.Gly530Val		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G530V	ENST00000315475.6	37	c.1589	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	G	13.83	2.355657	0.41700	.	.	ENSG00000177932	ENST00000315475	T	0.66460	-0.21	4.22	2.31	0.28768	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68302	0.2986	M	0.93462	3.42	0.53005	D	0.999963	P	0.39737	0.685	B	0.35413	0.202	T	0.71955	-0.4436	9	0.87932	D	0	-6.3207	4.9418	0.13969	0.2962:0.0:0.7038:0.0	.	530	Q86Y25	Z354C_HUMAN	V	530	ENSP00000324064:G530V	ENSP00000324064:G530V	G	+	2	0	ZNF354C	178439628	1.000000	0.71417	0.932000	0.37286	0.856000	0.48823	2.511000	0.45476	1.022000	0.39626	0.591000	0.81541	GGG	ZNF354C	-	NULL	ENSG00000177932		0.373	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2	-	0.00	61	0	G			178507022	+1	tier1	-	no_errors	ENST00000315475	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.994	T
ZNF513	130557	genome.wustl.edu	37	2	27603102	27603102	+	Silent	SNP	G	G	A			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr2:27603102G>A	ENST00000323703.6	-	2	267	c.69C>T	c.(67-69)gaC>gaT	p.D23D	ZNF513_ENST00000491924.1_5'Flank|ZNF513_ENST00000407879.1_5'UTR	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	23					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGTCGAGGGAGTCTTCAGTAT	0.577																																																	0													58.0	66.0	63.0					2																	27603102		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.69C>T	2.37:g.27603102G>A			A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D23	ENST00000323703.6	37	c.69	CCDS1751.1	2																																																																																			ZNF513	-	NULL	ENSG00000163795		0.577	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	-	0.00	144	0	G	NM_144631		27603102	-1	tier1	-	no_errors	ENST00000323703	ensembl	human	known	74_37	silent	29.63	76	32	SNP	0.998	A
ZNF664	144348	genome.wustl.edu	37	12	124497083	124497083	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FB-01A-11D-A33E-09	TCGA-JY-A6FB-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	138d85b0-61a1-4cbd-ae9e-62acd1b86975	85f3edf1-90bf-4475-ac77-633a9b295eda	g.chr12:124497083G>T	ENST00000539644.1	+	6	2222	c.392G>T	c.(391-393)tGc>tTc	p.C131F	FAM101A_ENST00000545615.1_Intron|ZNF664_ENST00000337815.4_Missense_Mutation_p.C131F|ZNF664_ENST00000392404.3_Missense_Mutation_p.C131F|ZNF664_ENST00000538932.2_Missense_Mutation_p.C131F			Q8N3J9	ZN664_HUMAN	zinc finger protein 664	131					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(5)|lung(6)|skin(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			Epithelial(86;0.000239)|OV - Ovarian serous cystadenocarcinoma(86;0.000247)|all cancers(50;0.00155)|BRCA - Breast invasive adenocarcinoma(302;0.249)		TCAAACCTTTGCATGCATCAG	0.473																																																	0													72.0	83.0	80.0					12																	124497083		2203	4300	6503	SO:0001583	missense	0				CCDS9257.1	12q24.31	2013-05-10			ENSG00000179195	ENSG00000179195		"""Zinc fingers, C2H2-type"""	25406	protein-coding gene	gene with protein product			"""zinc finger protein 176"""	ZNF176		12477932	Standard	NM_001204298		Approved	ZFOC1, DKFZp761B128	uc001uga.3	Q8N3J9	OTTHUMG00000168596	ENST00000539644.1:c.392G>T	12.37:g.124497083G>T	ENSP00000441405:p.Cys131Phe		B3KP97|Q15914|Q3ZCQ7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C131F	ENST00000539644.1	37	c.392	CCDS9257.1	12	.	.	.	.	.	.	.	.	.	.	G	2.559	-0.302274	0.05495	.	.	ENSG00000179195	ENST00000539644;ENST00000392404;ENST00000538932;ENST00000337815;ENST00000535937	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	4.25	4.25	0.50352	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44097	D	0.000492	T	0.04543	0.0124	N	0.10874	0.06	0.09310	N	0.999998	B	0.17465	0.022	B	0.10450	0.005	T	0.30621	-0.9972	10	0.44086	T	0.13	-27.3304	8.241	0.31660	0.1047:0.0:0.8953:0.0	.	131	Q8N3J9	ZN664_HUMAN	F	131;131;131;131;69	ENSP00000441405:C131F;ENSP00000376205:C131F;ENSP00000440645:C131F;ENSP00000337320:C131F	ENSP00000337320:C131F	C	+	2	0	ZNF664	123063036	0.000000	0.05858	0.999000	0.59377	0.994000	0.84299	0.895000	0.28363	2.651000	0.90000	0.655000	0.94253	TGC	ZNF664	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000179195		0.473	ZNF664-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF664	HGNC	protein_coding	OTTHUMT00000400365.1	-	0.00	40	0	G	NM_152437		124497083	+1	tier1	-	no_errors	ENST00000337815	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.134	T
