#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCG2	9429	genome.wustl.edu	37	4	89034705	89034705	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:89034705G>T	ENST00000237612.3	-	9	1489	c.944C>A	c.(943-945)gCc>gAc	p.A315D	ABCG2_ENST00000515655.1_Splice_Site_p.A315D	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	315				Missing (in Ref. 10; BAA92050). {ECO:0000305}.	cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	GATCTCTGTGGCTTTGCAATC	0.393																																																	0													78.0	78.0	78.0					4																	89034705		2203	4300	6503	SO:0001630	splice_region_variant	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.944-1C>A	4.37:g.89034705G>T			A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A315D	ENST00000237612.3	37	c.944	CCDS3628.1	4	.	.	.	.	.	.	.	.	.	.	G	5.771	0.326655	0.10900	.	.	ENSG00000118777	ENST00000515655;ENST00000237612	T;T	0.27557	1.66;1.66	5.67	-0.116	0.13555	.	0.453783	0.25178	N	0.032547	T	0.18467	0.0443	L	0.38175	1.15	0.09310	N	1	B;B	0.17038	0.02;0.001	B;B	0.27170	0.077;0.003	T	0.17258	-1.0375	10	0.30078	T	0.28	.	1.7884	0.03046	0.2869:0.127:0.4552:0.1309	.	315;315	Q9UNQ0-2;Q9UNQ0	.;ABCG2_HUMAN	D	315	ENSP00000426917:A315D;ENSP00000237612:A315D	ENSP00000237612:A315D	A	-	2	0	ABCG2	89253729	0.177000	0.23109	0.000000	0.03702	0.015000	0.08874	0.039000	0.13884	-0.398000	0.07679	-0.321000	0.08615	GCC	ABCG2	-	NULL	ENSG00000118777		0.393	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1	-	0.00	52	0	G	NM_004827	Missense_Mutation	89034705	-1	tier1	-	no_errors	ENST00000237612	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.002	T
ACACB	32	genome.wustl.edu	37	12	109665216	109665216	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:109665216G>T	ENST00000338432.7	+	28	4042	c.3923G>T	c.(3922-3924)aGc>aTc	p.S1308I	ACACB_ENST00000377854.5_Missense_Mutation_p.S1238I|ACACB_ENST00000377848.3_Missense_Mutation_p.S1308I			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1308					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	GAGTTAAACAGCCTGCAGCAC	0.582																																																	0													56.0	48.0	51.0					12																	109665216		2203	4300	6503	SO:0001583	missense	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3923G>T	12.37:g.109665216G>T	ENSP00000341044:p.Ser1308Ile		A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.S1308I	ENST00000338432.7	37	c.3923	CCDS31898.1	12	.	.	.	.	.	.	.	.	.	.	G	33	5.244681	0.95272	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854;ENST00000390027	T;T;T	0.47177	0.85;0.85;0.85	5.38	5.38	0.77491	Acetyl-CoA carboxylase, central domain (1);	0.000000	0.85682	D	0.000000	T	0.72606	0.3481	M	0.82923	2.615	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.74636	-0.3599	10	0.52906	T	0.07	.	19.5107	0.95140	0.0:0.0:1.0:0.0	.	1308	O00763	ACACB_HUMAN	I	1308;1308;1238;539	ENSP00000341044:S1308I;ENSP00000367079:S1308I;ENSP00000367085:S1238I	ENSP00000341044:S1308I	S	+	2	0	ACACB	108149599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.855000	0.99526	2.679000	0.91253	0.655000	0.94253	AGC	ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.582	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	-	0.00	60	0	G	NM_001093		109665216	+1	tier1	-	no_errors	ENST00000338432	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
ACVR2A	92	genome.wustl.edu	37	2	148657054	148657054	+	Silent	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:148657054C>T	ENST00000241416.7	+	3	927	c.291C>T	c.(289-291)agC>agT	p.S97S	ACVR2A_ENST00000404590.1_Silent_p.S97S|ACVR2A_ENST00000535787.1_5'UTR|AC009480.3_ENST00000402410.2_RNA	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	97					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		AAAAAGACAGCCCTGAAGTAT	0.318																																																	0													101.0	108.0	105.0					2																	148657054		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.291C>T	2.37:g.148657054C>T			B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_TGFB_receptor	p.S97	ENST00000241416.7	37	c.291	CCDS33301.1	2																																																																																			ACVR2A	-	pfam_Activin_rcpt,prints_TGFB_receptor	ENSG00000121989		0.318	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2A	HGNC	protein_coding	OTTHUMT00000319051.1	-	0.00	77	0	C	NM_001616		148657054	+1	tier1	-	no_errors	ENST00000241416	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
ADAM18	8749	genome.wustl.edu	37	8	39506020	39506020	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr8:39506020G>T	ENST00000265707.5	+	12	1249	c.1204G>T	c.(1204-1206)Gaa>Taa	p.E402*	ADAM18_ENST00000379866.1_Nonsense_Mutation_p.E378*|ADAM18_ENST00000541111.1_Intron	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	402	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			GGAATCCAATGAAGAATGTGA	0.323																																																	0													69.0	71.0	70.0					8																	39506020		2203	4300	6503	SO:0001587	stop_gained	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1204G>T	8.37:g.39506020G>T	ENSP00000265707:p.Glu402*		B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.E402*	ENST00000265707.5	37	c.1204	CCDS6113.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.562797	0.98361	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	.	.	.	5.55	5.55	0.83447	.	0.000000	0.49305	D	0.000150	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.8661	0.70416	0.0:0.0:1.0:0.0	.	.	.	.	X	402;378;334	.	ENSP00000265707:E402X	E	+	1	0	ADAM18	39625177	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	4.255000	0.58804	2.890000	0.99128	0.585000	0.79938	GAA	ADAM18	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000168619		0.323	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	-	0.00	52	0	G	NM_014237		39506020	+1	tier1	-	no_errors	ENST00000265707	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	0.998	T
ADAM29	11086	genome.wustl.edu	37	4	175898248	175898248	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:175898248G>T	ENST00000359240.3	+	5	2242	c.1572G>T	c.(1570-1572)ttG>ttT	p.L524F	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.L524F|ADAM29_ENST00000404450.4_Missense_Mutation_p.L524F|ADAM29_ENST00000445694.1_Missense_Mutation_p.L524F	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	524	Cys-rich.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		ACAAAGAATTGAACACCTTAG	0.418																																					Ovarian(140;1727 1835 21805 25838 41440)												0													84.0	87.0	86.0					4																	175898248		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1572G>T	4.37:g.175898248G>T	ENSP00000352177:p.Leu524Phe		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L524F	ENST00000359240.3	37	c.1572	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011241	0.35511	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.26067	1.76;1.76;1.76;1.76	3.48	-4.32	0.03688	ADAM, cysteine-rich (2);	1.724340	0.04595	U	0.397384	T	0.31451	0.0797	L	0.35723	1.085	0.09310	N	1	D	0.58620	0.983	P	0.59546	0.859	T	0.37572	-0.9700	9	.	.	.	.	6.6723	0.23076	0.5453:0.1285:0.3263:0.0	.	524	Q9UKF5	ADA29_HUMAN	F	524	ENSP00000352177:L524F;ENSP00000414544:L524F;ENSP00000384229:L524F;ENSP00000423517:L524F	.	L	+	3	2	ADAM29	176134823	0.652000	0.27349	0.001000	0.08648	0.002000	0.02628	-0.262000	0.08682	-1.064000	0.03172	-0.148000	0.13756	TTG	ADAM29	-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich	ENSG00000168594		0.418	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding			0.00	19	0	G			175898248	+1			no_errors	ENST00000359240	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.005	T
AOC1	26	genome.wustl.edu	37	7	150555061	150555061	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:150555061G>T	ENST00000493429.1	+	4	2087	c.1503G>T	c.(1501-1503)ctG>ctT	p.L501L	AOC1_ENST00000360937.4_Silent_p.L501L|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000467291.1_Silent_p.L501L|AOC1_ENST00000416793.2_Silent_p.L501L			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	501					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	GCACTCGCCTGCACACCCACC	0.597																																																	0													57.0	63.0	61.0					7																	150555061		2177	4265	6442	SO:0001819	synonymous_variant	0			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1503G>T	7.37:g.150555061G>T			C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.L501	ENST00000493429.1	37	c.1503	CCDS43679.1	7																																																																																			AOC1	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000002726		0.597	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AOC1	HGNC	protein_coding	OTTHUMT00000350628.1	-	0.00	55	0	G	NM_001091		150555061	+1	tier1	-	no_errors	ENST00000416793	ensembl	human	known	74_37	silent	7.69	60	5	SNP	0.952	T
ARMC4P1	101060171	genome.wustl.edu	37	10	27552121	27552121	+	RNA	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:27552121G>A	ENST00000576034.1	+	0	377									armadillo repeat containing 4 pseudogene 1																		GGCGCCCTCCGCATTTGAATC	0.378																																																	0																																												0					10p12.1	2012-12-19			ENSG00000238021	ENSG00000238021			44937	pseudogene	pseudogene							Standard	XM_006709935		Approved				OTTHUMG00000017856		10.37:g.27552121G>A				RNA	SNP	-	NULL	ENST00000576034.1	37	NULL		10																																																																																			ARMC4P1	-	-	ENSG00000238021		0.378	ARMC4P1-002	KNOWN	basic	processed_transcript	ARMC4P1	HGNC	pseudogene	OTTHUMT00000436997.1	-	0.00	30	0	G			27552121	+1	tier1	-	no_errors	ENST00000576034	ensembl	human	known	74_37	rna	16.00	21	4	SNP	1.000	A
ASF1B	55723	genome.wustl.edu	37	19	14231429	14231429	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:14231429T>G	ENST00000263382.3	-	4	950	c.451A>C	c.(451-453)Atc>Ctc	p.I151L	PRKACA_ENST00000590853.1_5'Flank|PRKACA_ENST00000308677.4_5'Flank|CTB-55O6.10_ENST00000590715.1_RNA|ASF1B_ENST00000592798.1_Missense_Mutation_p.I92L	NM_018154.2	NP_060624.1	Q9NVP2	ASF1B_HUMAN	anti-silencing function 1B histone chaperone	151	Interaction with CHAF1B.|Interaction with histone H3. {ECO:0000250}.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(2)|large_intestine(2)|lung(2)|ovary(1)	7						TCCCAGTTGATATGGAAGCGG	0.607																																																	0													74.0	64.0	67.0					19																	14231429		2203	4300	6503	SO:0001583	missense	0			AF279307	CCDS12306.1	19p13.12	2013-05-01	2013-05-01		ENSG00000105011	ENSG00000105011			20996	protein-coding gene	gene with protein product		609190	"""ASF1 anti-silencing function 1 homolog B (S. cerevisiae)"""			11897662, 11470414	Standard	NM_018154		Approved	FLJ10604	uc002mye.3	Q9NVP2	OTTHUMG00000150401	ENST00000263382.3:c.451A>C	19.37:g.14231429T>G	ENSP00000263382:p.Ile151Leu		Q53G51|Q9NVZ0	Missense_Mutation	SNP	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	p.I151L	ENST00000263382.3	37	c.451	CCDS12306.1	19	.	.	.	.	.	.	.	.	.	.	T	35	5.511404	0.96386	.	.	ENSG00000105011	ENST00000263382	.	.	.	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.89615	0.6766	H	0.95645	3.7	0.80722	D	1	P	0.39326	0.668	D	0.74674	0.984	D	0.91378	0.5125	9	0.87932	D	0	.	14.107	0.65096	0.0:0.0:0.0:1.0	.	151	Q9NVP2	ASF1B_HUMAN	L	151	.	ENSP00000263382:I151L	I	-	1	0	ASF1B	14092429	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.680000	0.84062	2.209000	0.71365	0.533000	0.62120	ATC	ASF1B	-	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	ENSG00000105011		0.607	ASF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASF1B	HGNC	protein_coding	OTTHUMT00000317946.1	-	0.00	57	0	T	NM_018154		14231429	-1	tier1	-	no_errors	ENST00000263382	ensembl	human	known	74_37	missense	69.77	13	30	SNP	1.000	G
ATAD2B	54454	genome.wustl.edu	37	2	24033337	24033337	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:24033337C>T	ENST00000238789.5	-	18	2646	c.2303G>A	c.(2302-2304)cGc>cAc	p.R768H	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	768						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGCAATAAGCGTGGCCTGTA	0.413																																																	0													73.0	74.0	74.0					2																	24033337		1980	4166	6146	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2303G>A	2.37:g.24033337C>T	ENSP00000238789:p.Arg768His		B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.R768H	ENST00000238789.5	37	c.2303	CCDS46227.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.9|22.9	4.347660|4.347660	0.82022|0.82022	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789	.|D	.|0.94537	.|-3.45	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.853589	.|0.10478	.|N	.|0.670009	D|D	0.96090|0.96090	0.8726|0.8726	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.986;0.997	.|P;P	.|0.58331	.|0.691;0.837	D|D	0.94117|0.94117	0.7376|0.7376	5|10	.|0.46703	.|T	.|0.11	.|.	19.7937|19.7937	0.96469|0.96469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|768;768	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	T|H	49|768	.|ENSP00000238789:R768H	.|ENSP00000238789:R768H	A|R	-|-	1|2	0|0	ATAD2B|ATAD2B	23886841|23886841	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.325000|0.325000	0.28411|0.28411	7.818000|7.818000	0.86416|0.86416	2.749000|2.749000	0.94314|0.94314	0.655000|0.655000	0.94253|0.94253	GCT|CGC	ATAD2B	-	superfamily_P-loop_NTPase	ENSG00000119778		0.413	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1		0.00	47	0	C	NM_017552		24033337	-1			no_errors	ENST00000238789	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ATG5	9474	genome.wustl.edu	37	6	106740953	106740953	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:106740953G>T	ENST00000369076.3	-	4	588	c.265C>A	c.(265-267)Ctt>Att	p.L89I	ATG5_ENST00000343245.3_Missense_Mutation_p.L89I|ATG5_ENST00000369070.1_Missense_Mutation_p.L11I|ATG5_ENST00000360666.4_Intron	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	89					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		GATGCAAGAAGATCAAATAGC	0.294																																																	0													113.0	113.0	113.0					6																	106740953		2203	4299	6502	SO:0001583	missense	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.265C>A	6.37:g.106740953G>T	ENSP00000358072:p.Leu89Ile		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Atg5	p.L89I	ENST00000369076.3	37	c.265	CCDS5055.1	6	.	.	.	.	.	.	.	.	.	.	G	18.83	3.706916	0.68615	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.6	5.6	0.85130	.	0.123008	0.53938	D	0.000056	T	0.72028	0.3410	M	0.86028	2.79	0.80722	D	1	B;B;B	0.30793	0.211;0.295;0.211	P;B;P	0.45913	0.497;0.328;0.497	T	0.74269	-0.3720	9	0.52906	T	0.07	-13.4536	12.1521	0.54055	0.08:0.0:0.92:0.0	.	89;11;89	A9UGY9;Q9H1Y0-2;Q9H1Y0	.;.;ATG5_HUMAN	I	89;89;11	.	ENSP00000343313:L89I	L	-	1	0	ATG5	106847646	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.772000	0.55325	2.800000	0.96347	0.655000	0.94253	CTT	ATG5	-	pfam_Atg5	ENSG00000057663		0.294	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	-	0.00	55	0	G	NM_004849		106740953	-1	tier1	-	no_errors	ENST00000343245	ensembl	human	known	74_37	missense	5.68	83	5	SNP	1.000	T
ATP2B4	493	genome.wustl.edu	37	1	203708868	203708868	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:203708868G>T	ENST00000357681.5	+	21	4627	c.3504G>T	c.(3502-3504)ctG>ctT	p.L1168L	ATP2B4_ENST00000367218.3_3'UTR|ATP2B4_ENST00000367219.3_3'UTR|ATP2B4_ENST00000341360.2_3'UTR|ATP2B4_ENST00000391954.2_3'UTR	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1204					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGGTGCTCCTGTTGGATGGTG	0.517																																																	0													113.0	103.0	106.0					1																	203708868		2203	4300	6503	SO:0001819	synonymous_variant	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3504G>T	1.37:g.203708868G>T			B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.L1168	ENST00000357681.5	37	c.3504	CCDS1440.1	1																																																																																			ATP2B4	-	NULL	ENSG00000058668		0.517	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	-	0.00	61	0	G	NM_001001396		203708868	+1	tier1	-	no_errors	ENST00000357681	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.000	T
ATP8A1	10396	genome.wustl.edu	37	4	42554533	42554533	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:42554533G>A	ENST00000381668.5	-	17	1739	c.1508C>T	c.(1507-1509)gCa>gTa	p.A503V	ATP8A1_ENST00000264449.10_Missense_Mutation_p.A488V	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	503					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TGGAGATGCTGCTTGATAAAT	0.353																																																	0													134.0	126.0	129.0					4																	42554533		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.1508C>T	4.37:g.42554533G>A	ENSP00000371084:p.Ala503Val		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.A503V	ENST00000381668.5	37	c.1508	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.453461	0.96223	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.69306	-0.39;-0.39	5.75	5.75	0.90469	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86777	0.6014	M	0.93106	3.38	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.78314	0.983;0.991;0.991	D	0.88758	0.3255	10	0.62326	D	0.03	.	19.94	0.97155	0.0:0.0:1.0:0.0	.	488;488;503	B4DII6;Q32M35;Q9Y2Q0	.;.;AT8A1_HUMAN	V	503;488	ENSP00000371084:A503V;ENSP00000264449:A488V	ENSP00000264449:A488V	A	-	2	0	ATP8A1	42249290	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.762000	0.91711	2.721000	0.93114	0.650000	0.86243	GCA	ATP8A1	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.353	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	38	0	G	NM_006095		42554533	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	71.43	12	30	SNP	1.000	A
B4GALT1	2683	genome.wustl.edu	37	9	33113550	33113550	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:33113550G>T	ENST00000379731.4	-	6	1285	c.1099C>A	c.(1099-1101)Ctc>Atc	p.L367I	B4GALT1_ENST00000541851.1_Missense_Mutation_p.L114I|B4GALT1_ENST00000535206.1_Intron	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	367					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	CCATCAGAGAGCATTGTCTCC	0.438																																																	0													166.0	142.0	150.0					9																	33113550		2203	4300	6503	SO:0001583	missense	0			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.1099C>A	9.37:g.33113550G>T	ENSP00000369055:p.Leu367Ile		B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.L367I	ENST00000379731.4	37	c.1099	CCDS6535.1	9	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921165	0.33908	.	.	ENSG00000086062	ENST00000379731;ENST00000541701;ENST00000541851	T;T	0.35421	1.31;1.31	6.08	1.42	0.22433	.	0.817760	0.11455	N	0.562380	T	0.21881	0.0527	L	0.34521	1.04	0.09310	N	0.999998	B	0.02656	0.0	B	0.08055	0.003	T	0.25710	-1.0124	10	0.42905	T	0.14	-15.1832	0.725	0.00947	0.3138:0.1312:0.3636:0.1914	.	367	P15291	B4GT1_HUMAN	I	367;324;114	ENSP00000369055:L367I;ENSP00000445037:L114I	ENSP00000369055:L367I	L	-	1	0	B4GALT1	33103550	0.002000	0.14202	0.399000	0.26333	0.996000	0.88848	-0.082000	0.11304	0.328000	0.23435	0.655000	0.94253	CTC	B4GALT1	-	pfam_Galactosyl_T_C	ENSG00000086062		0.438	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1	-	0.00	47	0	G	NM_001497		33113550	-1	tier1	-	no_errors	ENST00000379731	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.029	T
BAIAP3	8938	genome.wustl.edu	37	16	1391467	1391467	+	Silent	SNP	C	C	T	rs147169956		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:1391467C>T	ENST00000324385.5	+	8	971	c.813C>T	c.(811-813)ccC>ccT	p.P271P	BAIAP3_ENST00000568887.1_Silent_p.P208P|BAIAP3_ENST00000426824.3_Silent_p.P236P|BAIAP3_ENST00000421665.2_Silent_p.P236P|BAIAP3_ENST00000562208.1_Silent_p.P213P|BAIAP3_ENST00000397489.1_Silent_p.P253P|BAIAP3_ENST00000397488.2_Silent_p.P253P	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	271	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCCTGAACCCCGTCTGGAAGG	0.677																																																	0								C	,,,,	0,4396		0,0,2198	68.0	60.0	62.0		708,708,639,624,813	-5.2	0.5	16	dbSNP_134	62	2,8592	2.2+/-6.3	0,2,4295	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BAIAP3	NM_001199096.1,NM_001199097.1,NM_001199098.1,NM_001199099.1,NM_003933.4	,,,,	0,2,6493	TT,TC,CC		0.0233,0.0,0.0154	,,,,	236/1117,236/1153,213/1130,208/1125,271/1188	1391467	2,12988	2198	4297	6495	SO:0001819	synonymous_variant	0			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.813C>T	16.37:g.1391467C>T			A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	pfam_C2_dom,pfam_Munc13_subgr_dom-2,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P271	ENST00000324385.5	37	c.813	CCDS10434.1	16																																																																																			BAIAP3	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000007516		0.677	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	-	0.00	13	0	C			1391467	+1	tier1	rs147169956	no_errors	ENST00000324385	ensembl	human	known	74_37	silent	78.95	4	15	SNP	0.241	T
BEND4	389206	genome.wustl.edu	37	4	42145781	42145781	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:42145781G>T	ENST00000502486.1	-	3	1297	c.718C>A	c.(718-720)Caa>Aaa	p.Q240K	BEND4_ENST00000504360.1_Missense_Mutation_p.Q236K	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	240										NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						GAAGTTTGTTGTTTCCTTTGC	0.448																																																	0													121.0	125.0	124.0					4																	42145781		1926	4137	6063	SO:0001583	missense	0			AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.718C>A	4.37:g.42145781G>T	ENSP00000421169:p.Gln240Lys		A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	pfam_BEN_domain	p.Q240K	ENST00000502486.1	37	c.718	CCDS47048.1	4	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005320	0.54254	.	.	ENSG00000188848	ENST00000411720;ENST00000502486;ENST00000504360	.	.	.	5.52	5.52	0.82312	.	0.215214	0.40385	N	0.001108	T	0.49218	0.1544	N	0.19112	0.55	0.58432	D	0.99999	D;P;D	0.56035	0.974;0.915;0.974	P;B;P	0.48189	0.57;0.366;0.57	T	0.55341	-0.8156	9	0.72032	D	0.01	-12.3555	19.4558	0.94889	0.0:0.0:1.0:0.0	.	162;240;240	Q6ZU67-3;Q6ZU67;Q6ZU67-2	.;BEND4_HUMAN;.	K	111;240;236	.	ENSP00000412495:Q111K	Q	-	1	0	BEND4	41840538	1.000000	0.71417	0.975000	0.42487	0.015000	0.08874	7.527000	0.81931	2.611000	0.88343	0.655000	0.94253	CAA	BEND4	-	NULL	ENSG00000188848		0.448	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND4	HGNC	protein_coding	OTTHUMT00000360975.2	-	0.00	41	0	G	NM_207406		42145781	-1	tier1	-	no_errors	ENST00000502486	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	T
BOC	91653	genome.wustl.edu	37	3	112997652	112997652	+	Intron	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:112997652C>T	ENST00000495514.1	+	11	2517				BOC_ENST00000355385.3_Intron|BOC_ENST00000497495.1_3'UTR|BOC_ENST00000273395.4_Intron			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GCAGCAGGGACGGACGCGCAG	0.602																																																	0													24.0	26.0	25.0					3																	112997652		2138	4188	6326	SO:0001627	intron_variant	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1813+22C>T	3.37:g.112997652C>T			A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	RNA	SNP	-	NULL	ENST00000495514.1	37	NULL	CCDS2971.1	3																																																																																			BOC	-	-	ENSG00000144857		0.602	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	-	0.00	73	0	C	NM_033254		112997652	+1	tier1	-	no_errors	ENST00000497495	ensembl	human	known	74_37	rna	5.97	63	4	SNP	0.000	T
MALRD1	340895	genome.wustl.edu	37	10	19636823	19636823	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:19636823C>T	ENST00000454679.2	+	10	1913	c.1913C>T	c.(1912-1914)gCa>gTa	p.A638V				Q5VYJ5	MALR1_HUMAN		638	MAM 4. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						GAGCCAGCAGCAGATCACACT	0.448																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.1913C>T	10.37:g.19636823C>T	ENSP00000412763:p.Ala638Val		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.A638V	ENST00000454679.2	37	c.1913		10	.	.	.	.	.	.	.	.	.	.	C	7.492	0.650781	0.14516	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	T;T	0.02140	4.43;4.43	4.88	2.91	0.33838	.	.	.	.	.	T	0.03915	0.0110	.	.	.	0.33034	D	0.530519	.	.	.	.	.	.	T	0.34129	-0.9841	5	.	.	.	.	10.4398	0.44457	0.0:0.8728:0.0:0.1272	.	.	.	.	V	651;638	ENSP00000366477:A651V;ENSP00000412763:A638V	.	A	+	2	0	C10orf112	19676829	0.973000	0.33851	0.143000	0.22291	0.694000	0.40290	0.978000	0.29488	0.532000	0.28657	0.591000	0.81541	GCA	C10orf112	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000204740		0.448	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	63	0	C			19636823	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.444	T
C16orf96	342346	genome.wustl.edu	37	16	4638333	4638333	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:4638333G>T	ENST00000444310.4	+	9	2592		c.e9+1			NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						GAACACCAAGGTGAATGCCCC	0.448																																																	0													135.0	121.0	125.0					16																	4638333		692	1591	2283	SO:0001630	splice_region_variant	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.2592+1G>T	16.37:g.4638333G>T				Splice_Site	SNP	-	e9+1	ENST00000444310.4	37	c.2592+1	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934711	0.34189	.	.	ENSG00000205832	ENST00000444310	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7481	0.77962	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C16orf96	4578334	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	6.335000	0.72949	2.790000	0.95986	0.655000	0.94253	.	C16orf96	-	-	ENSG00000205832		0.448	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	44	0	G	NM_001145011	Intron	4638333	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	splice_site	9.30	39	4	SNP	1.000	T
C1orf127	148345	genome.wustl.edu	37	1	11017133	11017133	+	Intron	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:11017133A>G	ENST00000377008.4	-	7	724				C1orf127_ENST00000377004.4_Missense_Mutation_p.L242P			Q8N9H9	CA127_HUMAN	chromosome 1 open reading frame 127											NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(5)	32	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CACCAGCCATAGTGGCAGGAG	0.577																																																	0													26.0	37.0	34.0					1																	11017133		692	1591	2283	SO:0001627	intron_variant	0			AK094437	CCDS53267.1	1p36.22	2008-02-05			ENSG00000175262	ENSG00000175262			26730	protein-coding gene	gene with protein product						14702039	Standard	NM_001170754		Approved	FLJ37118	uc010oao.2	Q8N9H9	OTTHUMG00000002032	ENST00000377008.4:c.277+508T>C	1.37:g.11017133A>G			A0AVG8|A6NKM7|Q5VXJ2	Missense_Mutation	SNP	superfamily_DNA-bd_dom_put	p.L242P	ENST00000377008.4	37	c.725		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.92|13.92	2.381232|2.381232	0.42207|0.42207	.|.	.|.	ENSG00000175262|ENSG00000175262	ENST00000377004|ENST00000520253	T|.	0.39056|.	1.1|.	5.39|5.39	4.27|4.27	0.50696|0.50696	.|.	.|.	.|.	.|.	.|.	T|T	0.40498|0.40498	0.1119|0.1119	N|N	0.19112|0.19112	0.55|0.55	0.51012|0.51012	D|D	0.999904|0.999904	D;D|.	0.71674|.	0.998;0.998|.	P;P|.	0.56474|.	0.799;0.799|.	T|T	0.15093|0.15093	-1.0449|-1.0449	9|5	0.72032|.	D|.	0.01|.	.|.	9.4499|9.4499	0.38721|0.38721	0.916:0.0:0.084:0.0|0.916:0.0:0.084:0.0	.|.	93;93|.	B7ZLG7;Q8N9H9-2|.	.;.|.	P|H	242|220	ENSP00000366203:L242P|.	ENSP00000366203:L242P|.	L|Y	-|-	2|1	0|0	C1orf127|C1orf127	10939720|10939720	0.511000|0.511000	0.26179|0.26179	0.048000|0.048000	0.18961|0.18961	0.632000|0.632000	0.37999|0.37999	2.099000|2.099000	0.41767|0.41767	0.891000|0.891000	0.36235|0.36235	0.459000|0.459000	0.35465|0.35465	CTA|TAT	C1orf127	-	NULL	ENSG00000175262		0.577	C1orf127-202	KNOWN	basic	protein_coding	C1orf127	HGNC	protein_coding		-	0.00	55	0	A	NM_173507		11017133	-1	tier1	-	no_errors	ENST00000377004	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.601	G
DPAGT1	1798	genome.wustl.edu	37	11	118981809	118981809	+	5'Flank	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:118981809G>T	ENST00000409993.2	-	0	0				C2CD2L_ENST00000336702.3_Missense_Mutation_p.K243N|C2CD2L_ENST00000528586.1_5'UTR			Q9H3H5	GPT_HUMAN	dolichyl-phosphate (UDP-N-acetylglucosamine) N-acetylglucosaminephosphotransferase 1 (GlcNAc-1-P transferase)						cellular protein metabolic process (GO:0044267)|dolichol biosynthetic process (GO:0019408)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|protein oligomerization (GO:0051259)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	phospho-N-acetylmuramoyl-pentapeptide-transferase activity (GO:0008963)|transferase activity, transferring glycosyl groups (GO:0016757)|UDP-N-acetylglucosamine-dolichyl-phosphate N-acetylglucosaminephosphotransferase activity (GO:0003975)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	17	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		AACTGATCAAGGATGCCATAG	0.547																																																	0													164.0	159.0	161.0					11																	118981809		2200	4295	6495	SO:0001631	upstream_gene_variant	0			Z82022	CCDS8411.1	11q23.3	2007-12-14			ENSG00000172269	ENSG00000172269	2.7.8.15		2995	protein-coding gene	gene with protein product		191350		DPAGT2, DPAGT		8244387	Standard	NM_001382		Approved	GPT, D11S366, DGPT, ALG7, CDG-Ij	uc001pvi.3	Q9H3H5	OTTHUMG00000153533		11.37:g.118981809G>T	Exception_encountered		O15216|Q86WV9|Q9BWE6	Missense_Mutation	SNP	superfamily_C2_dom	p.K243N	ENST00000409993.2	37	c.729	CCDS8411.1	11	.	.	.	.	.	.	.	.	.	.	G	11.90	1.776830	0.31411	.	.	ENSG00000172375	ENST00000336702	T	0.80033	-1.33	4.56	1.69	0.24217	.	0.159081	0.56097	D	0.000038	T	0.65790	0.2725	N	0.19112	0.55	0.80722	D	1	B;B	0.21452	0.056;0.056	B;B	0.26202	0.067;0.067	T	0.57883	-0.7734	10	0.72032	D	0.01	-24.2214	7.4265	0.27102	0.3437:0.0:0.6563:0.0	.	243;243	O14523;O14523-2	C2C2L_HUMAN;.	N	243	ENSP00000338885:K243N	ENSP00000338885:K243N	K	+	3	2	C2CD2L	118487019	1.000000	0.71417	0.996000	0.52242	0.828000	0.46876	2.289000	0.43523	0.188000	0.20168	-0.379000	0.06801	AAG	C2CD2L	-	NULL	ENSG00000172375		0.547	DPAGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C2CD2L	HGNC	protein_coding	OTTHUMT00000331527.2	-	0.00	39	0	G	NM_001382		118981809	+1	tier1	-	no_errors	ENST00000336702	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
C2orf78	388960	genome.wustl.edu	37	2	74043283	74043283	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:74043283G>T	ENST00000409561.1	+	3	2054	c.1933G>T	c.(1933-1935)Gat>Tat	p.D645Y		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	645								p.D615N(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						GAAAAAGATCGATATGAAAAC	0.507																																																	1	Substitution - Missense(1)	large_intestine(1)											55.0	56.0	55.0					2																	74043283		1872	4101	5973	SO:0001583	missense	0			AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.1933G>T	2.37:g.74043283G>T	ENSP00000387124:p.Asp645Tyr			Missense_Mutation	SNP	NULL	p.D645Y	ENST00000409561.1	37	c.1933	CCDS46338.1	2	.	.	.	.	.	.	.	.	.	.	G	9.207	1.029926	0.19512	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	T	0.50813	0.73	4.9	2.96	0.34315	.	0.602207	0.14612	N	0.308955	T	0.53465	0.1798	M	0.65975	2.015	0.09310	N	1	D	0.53312	0.959	P	0.52856	0.711	T	0.45071	-0.9286	10	0.72032	D	0.01	-5.4529	6.307	0.21145	0.1011:0.187:0.7119:0.0	.	645	A6NCI8	CB078_HUMAN	Y	645;615	ENSP00000387124:D645Y	ENSP00000340692:D615Y	D	+	1	0	C2orf78	73896791	0.297000	0.24408	0.014000	0.15608	0.000000	0.00434	2.360000	0.44151	1.209000	0.43321	-0.251000	0.11542	GAT	C2orf78	-	NULL	ENSG00000187833		0.507	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf78	HGNC	protein_coding	OTTHUMT00000328083.1		0.00	23	0	G	NM_001080474		74043283	+1			no_errors	ENST00000409561	ensembl	human	novel	74_37	missense	8.33	22	2	SNP	0.004	T
C5orf27	202299	genome.wustl.edu	37	5	95194542	95194542	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:95194542G>T	ENST00000436592.1	+	4	757	c.109G>T	c.(109-111)Gga>Tga	p.G37*	AC008592.5_ENST00000503091.1_RNA|C5orf27_ENST00000357880.3_Nonsense_Mutation_p.G37*					chromosome 5 open reading frame 27																		CAAACCTCAAGGACAGGACTT	0.572											OREG0016708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													98.0	77.0	83.0					5																	95194542		692	1591	2283	SO:0001587	stop_gained	0			AY168789		5q15	2014-04-16			ENSG00000236882	ENSG00000236882			24687	other	unknown							Standard	NR_026936		Approved	FLJ38821, FIS	uc003klp.3	Q52M75	OTTHUMG00000122084	ENST00000436592.1:c.109G>T	5.37:g.95194542G>T	ENSP00000423049:p.Gly37*	1311		Nonsense_Mutation	SNP	NULL	p.G37*	ENST00000436592.1	37	c.109		5	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230397	0.79688	.	.	ENSG00000236882	ENST00000357880;ENST00000436592	.	.	.	3.59	-4.22	0.03800	.	.	.	.	.	.	.	.	.	.	.	0.51482	D	0.999925	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	0.7361	0.00965	0.1874:0.2905:0.1918:0.3303	.	.	.	.	X	37	.	ENSP00000427188:G37X	G	+	1	0	C5orf27	95220298	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.529000	0.02223	-1.118000	0.02961	-0.291000	0.09656	GGA	C5orf27	-	NULL	ENSG00000236882		0.572	C5orf27-001	KNOWN	basic|appris_principal	protein_coding	C5orf27	HGNC	protein_coding	OTTHUMT00000242845.3	-	0.00	49	0	G	NM_175616		95194542	+1	tier1	-	no_errors	ENST00000357880	ensembl	human	known	74_37	nonsense	11.63	38	5	SNP	0.000	T
CABP1	9478	genome.wustl.edu	37	12	121093650	121093651	+	Intron	INS	-	-	CA			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:121093650_121093651insCA	ENST00000316803.3	+	2	788				CABP1_ENST00000453000.1_Frame_Shift_Ins_p.V13fs|CABP1_ENST00000351200.2_Intron|CABP1_ENST00000288616.3_Intron	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					gtgtgtgtgtgtgtgcgcatgt	0.545																																																	0																																										SO:0001627	intron_variant	0			AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-4030->CA	12.37:g.121093650_121093651insCA			O95663|Q8N6H5|Q9NZU8	Frame_Shift_Ins	INS	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.V13fs	ENST00000316803.3	37	c.37_38	CCDS31913.1	12																																																																																			CABP1	-	NULL	ENSG00000157782		0.545	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	HGNC	protein_coding	OTTHUMT00000345822.1		0.00	57	0	-	NM_001033677		121093651	+1	tier1		no_errors	ENST00000453000	ensembl	human	putative	74_37	frame_shift_ins	11.11	32	4	INS	0.000:0.000	CA
CACNA1A	773	genome.wustl.edu	37	19	13342533	13342533	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:13342533G>T	ENST00000360228.5	-	35	5390	c.5391C>A	c.(5389-5391)tgC>tgA	p.C1797*	CACNA1A_ENST00000574822.1_5'UTR|CACNA1A_ENST00000573710.2_Nonsense_Mutation_p.C1798*	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1798					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CCAGAAACGAGCAGAGGAAGA	0.517																																																	0													67.0	68.0	67.0					19																	13342533		2006	4182	6188	SO:0001587	stop_gained	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5391C>A	19.37:g.13342533G>T	ENSP00000353362:p.Cys1797*		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.C1797*	ENST00000360228.5	37	c.5391	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	45	11.913749	0.99617	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	.	.	.	4.61	1.3	0.21679	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1472	0.20293	0.4456:0.0:0.5544:0.0	.	.	.	.	X	1797;1803;1798;1798	.	ENSP00000317661:C1798X	C	-	3	2	CACNA1A	13203533	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.227000	0.32576	0.930000	0.37217	0.555000	0.69702	TGC	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.517	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	41	0	G	NM_000068		13342533	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	nonsense	10.00	36	4	SNP	1.000	T
CALCOCO2	10241	genome.wustl.edu	37	17	46937763	46937763	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:46937763G>T	ENST00000258947.3	+	11	1197	c.1096G>T	c.(1096-1098)Gga>Tga	p.G366*	CALCOCO2_ENST00000509507.1_Nonsense_Mutation_p.G387*|CALCOCO2_ENST00000508679.1_Nonsense_Mutation_p.G294*|CALCOCO2_ENST00000416445.2_Nonsense_Mutation_p.G324*|CALCOCO2_ENST00000448105.2_Nonsense_Mutation_p.G390*	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	366					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						TTCAGATGAAGGAGGCGCAAG	0.458																																																	0													123.0	117.0	119.0					17																	46937763		2203	4300	6503	SO:0001587	stop_gained	0			BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.1096G>T	17.37:g.46937763G>T	ENSP00000258947:p.Gly366*		B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Nonsense_Mutation	SNP	pfam_CoCoA	p.G366*	ENST00000258947.3	37	c.1096	CCDS11538.1	17	.	.	.	.	.	.	.	.	.	.	G	14.22	2.470960	0.43942	.	.	ENSG00000136436	ENST00000258947;ENST00000509507;ENST00000448105;ENST00000416445;ENST00000508679	.	.	.	5.56	2.43	0.29744	.	0.804992	0.11068	N	0.603297	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-0.6	5.0411	0.14460	0.1836:0.1743:0.6421:0.0	.	.	.	.	X	366;387;390;324;294	.	ENSP00000258947:G366X	G	+	1	0	CALCOCO2	44292762	0.012000	0.17670	0.026000	0.17262	0.016000	0.09150	0.377000	0.20552	0.677000	0.31305	0.650000	0.86243	GGA	CALCOCO2	-	NULL	ENSG00000136436		0.458	CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCOCO2	HGNC	protein_coding	OTTHUMT00000360866.1	-	0.00	51	0	G	NM_005831		46937763	+1	tier1	-	no_errors	ENST00000258947	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	0.001	T
CAMSAP1	157922	genome.wustl.edu	37	9	138719368	138719368	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:138719368G>A	ENST00000389532.4	-	8	1172	c.1108C>T	c.(1108-1110)Cgc>Tgc	p.R370C	CAMSAP1_ENST00000312405.6_Missense_Mutation_p.R92C|CAMSAP1_ENST00000483991.1_5'Flank|CAMSAP1_ENST00000409386.3_Missense_Mutation_p.R381C	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	370					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		AGGAAACTGCGTTTGGTCGCG	0.592																																																	0													94.0	72.0	80.0					9																	138719368		2203	4300	6503	SO:0001583	missense	0			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.1108C>T	9.37:g.138719368G>A	ENSP00000374183:p.Arg370Cys		A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.R381C	ENST00000389532.4	37	c.1141	CCDS35176.2	9	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361627	0.82353	.	.	ENSG00000130559	ENST00000389532;ENST00000312405;ENST00000409386	T;T;T	0.21191	2.13;2.02;2.1	5.11	4.22	0.49857	.	0.061353	0.64402	D	0.000002	T	0.45438	0.1342	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.944;0.983	T	0.46762	-0.9168	10	0.87932	D	0	-32.5522	10.1645	0.42871	0.0725:0.0:0.7921:0.1354	.	370;381	Q5T5Y3;Q5T5Y3-3	CAMP1_HUMAN;.	C	370;92;381	ENSP00000374183:R370C;ENSP00000312463:R92C;ENSP00000386420:R381C	ENSP00000312463:R92C	R	-	1	0	CAMSAP1	137859189	1.000000	0.71417	0.994000	0.49952	0.983000	0.72400	7.354000	0.79424	1.161000	0.42604	0.655000	0.94253	CGC	CAMSAP1	-	NULL	ENSG00000130559		0.592	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMSAP1	HGNC	protein_coding	OTTHUMT00000055024.2	-	0.00	42	0	G	XM_351857		138719368	-1	tier1	-	no_errors	ENST00000409386	ensembl	human	known	74_37	missense	42.31	45	33	SNP	1.000	A
PDIA3	2923	genome.wustl.edu	37	15	44036443	44036443	+	5'Flank	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:44036443G>T	ENST00000300289.5	+	0	0				PDIA3_ENST00000538521.1_5'Flank|CATSPER2P1_ENST00000381680.2_RNA	NM_005313.4	NP_005304.3	P30101	PDIA3_HUMAN	protein disulfide isomerase family A, member 3						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein N-linked glycosylation via asparagine (GO:0018279)|protein retention in ER lumen (GO:0006621)|proteolysis (GO:0006508)|response to endoplasmic reticulum stress (GO:0034976)|signal transduction (GO:0007165)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|phospholipase C activity (GO:0004629)|poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(2)|skin(1)	17		all_cancers(109;2.61e-15)|all_epithelial(112;1.12e-12)|Lung NSC(122;2.17e-08)|all_lung(180;2.45e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.48e-07)		GAAACATACAGAGTGGAGTTC	0.358																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS10101.1	15q15	2009-11-20	2005-06-29	2005-03-03	ENSG00000167004	ENSG00000167004	5.3.4.1	"""Protein disulfide isomerases"""	4606	protein-coding gene	gene with protein product		602046	"""glucose regulated protein, 58kDa"", ""protein disulfide isomerase-associated 3"""	GRP58		8974399	Standard	NM_005313		Approved	P58, ERp61, ERp57, ERp60, GRP57, PI-PLC, HsT17083	uc001zsu.3	P30101	OTTHUMG00000044444		15.37:g.44036443G>T	Exception_encountered		Q13453|Q14255|Q8IYF8|Q9UMU7	RNA	SNP	-	NULL	ENST00000300289.5	37	NULL	CCDS10101.1	15																																																																																			CATSPER2P1	-	-	ENSG00000205771		0.358	PDIA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER2P1	HGNC	protein_coding	OTTHUMT00000103532.3	-	0.00	59	0	G	NM_005313		44036443	-1	tier1	-	no_errors	ENST00000429276	ensembl	human	known	74_37	rna	5.80	65	4	SNP	0.003	T
CCDC30	728621	genome.wustl.edu	37	1	43110363	43110363	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:43110363G>T	ENST00000340612.4	+	12	1775		c.e12-1		CCDC30_ENST00000342022.4_Splice_Site|CCDC30_ENST00000390640.4_Splice_Site|CCDC30_ENST00000428554.2_Splice_Site|CCDC30_ENST00000507855.1_Splice_Site			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GCCATTCTTAGGGTACTTTAC	0.388																																																	0													64.0	61.0	62.0					1																	43110363		2203	4300	6503	SO:0001630	splice_region_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1776-1G>T	1.37:g.43110363G>T			Q14F06|Q5VVM5	Splice_Site	SNP	-	e12-1	ENST00000340612.4	37	c.1776-1	CCDS30690.1	1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137852	0.56936	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9516	0.71080	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC30	42882950	1.000000	0.71417	0.985000	0.45067	0.659000	0.38960	4.951000	0.63610	2.657000	0.90304	0.655000	0.94253	.	CCDC30	-	-	ENSG00000186409		0.388	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding	OTTHUMT00000019524.3	-	0.00	47	0	G	NM_025030	Intron	43110363	+1	tier1	-	no_errors	ENST00000340612	ensembl	human	known	74_37	splice_site	7.27	51	4	SNP	0.983	T
CCNI	10983	genome.wustl.edu	37	4	77969388	77969388	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:77969388G>T	ENST00000237654.4	-	7	1694	c.1118C>A	c.(1117-1119)cCt>cAt	p.P373H	CCNI_ENST00000537948.1_Missense_Mutation_p.P359H	NM_006835.2	NP_006826.1	Q14094	CCNI_HUMAN	cyclin I	373					regulation of cell cycle (GO:0051726)|spermatogenesis (GO:0007283)					NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	9						GACAGAAACAGGCTGCAAAGG	0.413																																																	0													98.0	96.0	96.0					4																	77969388		2203	4300	6503	SO:0001583	missense	0			D50310	CCDS3580.1	4q21.1	2014-07-03			ENSG00000118816	ENSG00000118816			1595	protein-coding gene	gene with protein product						7493655	Standard	NM_006835		Approved	CCNI1	uc003hkm.3	Q14094	OTTHUMG00000130106	ENST00000237654.4:c.1118C>A	4.37:g.77969388G>T	ENSP00000237654:p.Pro373His		B2R6M0|B7Z6X4	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.P373H	ENST00000237654.4	37	c.1118	CCDS3580.1	4	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991008	0.74703	.	.	ENSG00000118816	ENST00000237654;ENST00000537948	T;T	0.38401	1.18;1.14	5.57	5.57	0.84162	.	0.047188	0.85682	D	0.000000	T	0.51991	0.1707	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74674	0.984;0.975	T	0.53697	-0.8402	10	0.87932	D	0	-8.1184	19.5565	0.95351	0.0:0.0:1.0:0.0	.	359;373	B7Z6X4;Q14094	.;CCNI_HUMAN	H	373;359	ENSP00000237654:P373H;ENSP00000441001:P359H	ENSP00000237654:P373H	P	-	2	0	CCNI	78188412	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.314000	0.89980	2.614000	0.88457	0.563000	0.77884	CCT	CCNI	-	NULL	ENSG00000118816		0.413	CCNI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNI	HGNC	protein_coding	OTTHUMT00000252412.2	-	0.00	45	0	G	NM_006835		77969388	-1	tier1	-	no_errors	ENST00000237654	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
CD36	948	genome.wustl.edu	37	7	80302143	80302143	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:80302143C>A	ENST00000435819.1	+	15	1867	c.1183C>A	c.(1183-1185)Cca>Aca	p.P395T	CD36_ENST00000433696.2_Missense_Mutation_p.P356T|CD36_ENST00000447544.2_Missense_Mutation_p.P395T|CD36_ENST00000538969.1_Missense_Mutation_p.P335T|CD36_ENST00000432207.1_Missense_Mutation_p.P395T|CD36_ENST00000309881.7_Missense_Mutation_p.P395T|CD36_ENST00000394788.3_Missense_Mutation_p.P395T|CD36_ENST00000534394.1_Missense_Mutation_p.P319T|CD36_ENST00000544133.1_3'UTR			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	395					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						ATTGGTCAAGCCATCAGAAAA	0.313																																																	0													63.0	63.0	63.0					7																	80302143		2201	4297	6498	SO:0001583	missense	0			Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1183C>A	7.37:g.80302143C>A	ENSP00000399421:p.Pro395Thr		D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	pfam_CD36,prints_CD36_antigen,prints_CD36	p.P395T	ENST00000435819.1	37	c.1183	CCDS34673.1	7	.	.	.	.	.	.	.	.	.	.	C	19.28	3.798056	0.70567	.	.	ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000433696	T;T;T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64	5.21	5.21	0.72293	.	0.155704	0.64402	D	0.000020	D	0.86871	0.6037	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.88533	0.3104	9	.	.	.	-22.4231	18.7286	0.91724	0.0:1.0:0.0:0.0	.	395	P16671	CD36_HUMAN	T	395;395;319;395;395;395;395;335;356	ENSP00000399421:P395T;ENSP00000308165:P395T;ENSP00000431296:P319T;ENSP00000378268:P395T;ENSP00000415743:P395T;ENSP00000411411:P395T;ENSP00000392298:P395T;ENSP00000439543:P335T;ENSP00000401863:P356T	.	P	+	1	0	CD36	80140079	0.978000	0.34361	1.000000	0.80357	0.737000	0.42083	3.358000	0.52284	2.569000	0.86673	0.591000	0.81541	CCA	CD36	-	pfam_CD36	ENSG00000135218		0.313	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD36	HGNC	protein_coding	OTTHUMT00000339767.6	-	0.00	66	0	C	NM_001001547		80302143	+1	tier1	-	no_errors	ENST00000309881	ensembl	human	known	74_37	missense	53.77	48	57	SNP	1.000	A
CEP128	145508	genome.wustl.edu	37	14	81372310	81372310	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr14:81372310C>T	ENST00000555265.1	-	5	725	c.350G>A	c.(349-351)gGc>gAc	p.G117D	CEP128_ENST00000327841.2_Missense_Mutation_p.G57D|CEP128_ENST00000281129.3_Missense_Mutation_p.G117D|CEP128_ENST00000216517.6_Missense_Mutation_p.G117D			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	117						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TGACCCAGTGCCACCATCAAG	0.358																																																	0													79.0	74.0	76.0					14																	81372310		2203	4300	6503	SO:0001583	missense	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.350G>A	14.37:g.81372310C>T	ENSP00000451162:p.Gly117Asp		B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.G117D	ENST00000555265.1	37	c.350	CCDS32130.1	14	.	.	.	.	.	.	.	.	.	.	C	4.688	0.127838	0.08981	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000216517;ENST00000327841;ENST00000555529;ENST00000556042	T;T;T;T;T	0.46451	1.47;1.47;0.88;0.87;0.88	5.92	0.114	0.14639	.	0.352841	0.26738	N	0.022742	T	0.20210	0.0486	L	0.27053	0.805	0.18873	N	0.999983	B;B;B	0.15141	0.006;0.012;0.006	B;B;B	0.16289	0.009;0.015;0.009	T	0.16719	-1.0393	10	0.09590	T	0.72	.	3.5889	0.07981	0.242:0.4096:0.2634:0.085	.	117;117;117	G3V3F4;Q6ZU80-3;Q6ZU80	.;.;CE128_HUMAN	D	117;117;117;117;57;117;117	ENSP00000281129:G117D;ENSP00000451162:G117D;ENSP00000216517:G117D;ENSP00000451137:G117D;ENSP00000451214:G117D	ENSP00000216517:G117D	G	-	2	0	CEP128	80442063	0.218000	0.23608	0.712000	0.30502	0.019000	0.09904	0.382000	0.20635	0.065000	0.16485	0.650000	0.86243	GGC	CEP128	-	NULL	ENSG00000100629		0.358	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1		0.00	27	0	C	NM_152446		81372310	-1			no_errors	ENST00000281129	ensembl	human	known	74_37	missense	8.33	22	2	SNP	0.030	T
CEP290	80184	genome.wustl.edu	37	12	88508920	88508920	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:88508920C>A	ENST00000552810.1	-	19	2207	c.1864G>T	c.(1864-1866)Gat>Tat	p.D622Y	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.D624Y	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	622					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)		p.D624Y(1)		breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						CTTTCTAAATCTCTTTCTTTT	0.249																																																	1	Substitution - Missense(1)	lung(1)											53.0	50.0	51.0					12																	88508920		1787	4051	5838	SO:0001583	missense	0			AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.1864G>T	12.37:g.88508920C>A	ENSP00000448012:p.Asp622Tyr		Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	NULL	p.D624Y	ENST00000552810.1	37	c.1870	CCDS55858.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300506	0.81136	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998;ENST00000545139	T;T	0.80393	-1.37;-1.37	5.35	5.35	0.76521	.	0.055527	0.64402	D	0.000001	D	0.84524	0.5491	L	0.44542	1.39	0.80722	D	1	D;D	0.59767	0.986;0.986	P;P	0.57152	0.814;0.742	D	0.85471	0.1173	10	0.62326	D	0.03	.	19.4455	0.94844	0.0:1.0:0.0:0.0	.	622;622	Q05BJ6;O15078	.;CE290_HUMAN	Y	622;624;622;524	ENSP00000448012:D622Y;ENSP00000308021:D624Y	ENSP00000308021:D624Y	D	-	1	0	CEP290	87033051	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.009000	0.70745	2.666000	0.90696	0.650000	0.86243	GAT	CEP290	-	NULL	ENSG00000198707		0.249	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP290	HGNC	protein_coding	OTTHUMT00000406344.1		0.00	28	0	C	NM_025114		88508920	-1			no_errors	ENST00000309041	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	A
CERS6	253782	genome.wustl.edu	37	2	169404190	169404190	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:169404190G>T	ENST00000305747.6	+	2	842	c.255G>T	c.(253-255)aaG>aaT	p.K85N	CERS6_ENST00000392687.4_Missense_Mutation_p.K85N	NM_203463.2	NP_982288.1	Q6ZMG9	CERS6_HUMAN	ceramide synthase 6	85					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TTCTGGAAAAGGTCTTCACTG	0.453																																																	0													103.0	84.0	90.0					2																	169404190		2203	4300	6503	SO:0001583	missense	0			BX393696	CCDS2228.1, CCDS58734.1	2q31	2011-07-11	2011-07-08	2011-07-08	ENSG00000172292	ENSG00000172292		"""Homeoboxes / CERS class"""	23826	protein-coding gene	gene with protein product		615336	"""LAG1 longevity assurance homolog 6 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 6"""	LASS6			Standard	NM_203463		Approved		uc002uec.2	Q6ZMG9	OTTHUMG00000132183	ENST00000305747.6:c.255G>T	2.37:g.169404190G>T	ENSP00000306579:p.Lys85Asn		Q32M63|Q8N617	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.K85N	ENST00000305747.6	37	c.255	CCDS2228.1	2	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287869	0.59976	.	.	ENSG00000172292	ENST00000305747;ENST00000392687	D;D	0.96491	-4.03;-4.03	5.78	4.9	0.64082	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97087	0.9048	M	0.64630	1.985	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.992;0.995	D	0.96218	0.9158	10	0.38643	T	0.18	-23.3987	10.6484	0.45634	0.1546:0.0:0.8454:0.0	.	85;85	Q32M63;Q6ZMG9	.;CERS6_HUMAN	N	85	ENSP00000306579:K85N;ENSP00000376453:K85N	ENSP00000306579:K85N	K	+	3	2	CERS6	169112436	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.584000	0.53936	1.451000	0.47736	0.585000	0.79938	AAG	CERS6	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_Homeobox_dom	ENSG00000172292		0.453	CERS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS6	HGNC	protein_coding	OTTHUMT00000255235.2		0.00	71	0	G	NM_203463		169404190	+1			no_errors	ENST00000392687	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
CKB	1152	genome.wustl.edu	37	14	103988794	103988794	+	Missense_Mutation	SNP	G	G	T	rs550707844		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr14:103988794G>T	ENST00000348956.2	-	2	394	c.37C>A	c.(37-39)Cgc>Agc	p.R13S	RP11-600F24.7_ENST00000568177.1_RNA	NM_001823.4	NP_001814.2	P12277	KCRB_HUMAN	creatine kinase, brain	13	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular chloride ion homeostasis (GO:0030644)|cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			lung(2)|prostate(1)	3		Melanoma(154;0.155)	Epithelial(46;0.14)		Creatine(DB00148)	GCCGGGAAGCGCAGCTTCAGT	0.706																																					Esophageal Squamous(186;2492 2823 49929 50127)												0													58.0	51.0	53.0					14																	103988794		2202	4300	6502	SO:0001583	missense	0				CCDS9981.1	14q32.32	2012-10-02			ENSG00000166165	ENSG00000166165	2.7.3.2		1991	protein-coding gene	gene with protein product		123280		CKBB			Standard	NM_001823		Approved		uc001ynf.2	P12277	OTTHUMG00000171786	ENST00000348956.2:c.37C>A	14.37:g.103988794G>T	ENSP00000299198:p.Arg13Ser		A8K236|B2R5R4|Q2LE07|Q6FG40|Q9UC66	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.R13S	ENST00000348956.2	37	c.37	CCDS9981.1	14	.	.	.	.	.	.	.	.	.	.	G	13.20	2.165752	0.38217	.	.	ENSG00000166165	ENST00000348956;ENST00000428256;ENST00000553878	T;T	0.62788	-0.0;-0.0	4.17	2.28	0.28536	ATP:guanido phosphotransferase, N-terminal (3);	0.201519	0.39687	N	0.001298	T	0.43077	0.1231	N	0.22421	0.69	0.32313	N	0.563446	B	0.14805	0.011	B	0.14578	0.011	T	0.43196	-0.9406	10	0.54805	T	0.06	0.7127	6.2483	0.20832	0.0947:0.0:0.3957:0.5095	.	13	P12277	KCRB_HUMAN	S	13	ENSP00000299198:R13S;ENSP00000451904:R13S	ENSP00000299198:R13S	R	-	1	0	CKB	103058547	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.647000	0.46639	0.408000	0.25621	0.297000	0.19635	CGC	CKB	-	superfamily_ATP-guanido_PTrfase_N	ENSG00000166165		0.706	CKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKB	HGNC	protein_coding	OTTHUMT00000415111.1	-	0.00	19	0	G			103988794	-1	tier1	-	no_errors	ENST00000348956	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
CLASP2	23122	genome.wustl.edu	37	3	33580287	33580287	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:33580287G>T	ENST00000468888.2	-	33	3622	c.3576C>A	c.(3574-3576)ggC>ggA	p.G1192G	CLASP2_ENST00000399362.4_Silent_p.G1191G|CLASP2_ENST00000480013.1_Silent_p.G971G|CLASP2_ENST00000359576.5_Silent_p.G1183G|CLASP2_ENST00000307312.7_Silent_p.G673G|CLASP2_ENST00000461133.3_Silent_p.G951G|CLASP2_ENST00000539981.1_Silent_p.G961G			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	972	Interaction with RSN and localization to the Golgi and kinetochores.|Required for cortical localization.				axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						TTACTGAATCGCCATCATCTT	0.313																																																	0													65.0	58.0	60.0					3																	33580287		1813	4077	5890	SO:0001819	synonymous_variant	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.3576C>A	3.37:g.33580287G>T			Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Silent	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.G1191	ENST00000468888.2	37	c.3573		3																																																																																			CLASP2	-	superfamily_ARM-type_fold	ENSG00000163539		0.313	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000344320.4		0.00	37	0	G	NM_001207044		33580287	-1			no_errors	ENST00000399362	ensembl	human	known	74_37	silent	5.26	54	3	SNP	0.634	T
CLCA4	22802	genome.wustl.edu	37	1	87031663	87031663	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:87031663G>T	ENST00000370563.3	+	6	956	c.914G>T	c.(913-915)aGa>aTa	p.R305I	CLCA4_ENST00000263723.5_Missense_Mutation_p.R18I	NM_012128.3	NP_036260.2	Q14CN2	CLCA4_HUMAN	chloride channel accessory 4	305					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44		Lung NSC(277;0.238)		all cancers(265;0.0202)|Epithelial(280;0.0404)		ATCAGTCAAAGAATTGTGTGC	0.423																																																	0													136.0	130.0	132.0					1																	87031663		1902	4131	6033	SO:0001583	missense	0			AF127035	CCDS41355.1	1p31-p22	2012-02-26	2009-01-29		ENSG00000016602	ENSG00000016602			2018	protein-coding gene	gene with protein product			"""chloride channel, calcium activated, family member 4"", ""chloride channel regulator 4"""			10437792	Standard	NM_012128		Approved	CaCC2	uc009wcs.3	Q14CN2	OTTHUMG00000010260	ENST00000370563.3:c.914G>T	1.37:g.87031663G>T	ENSP00000359594:p.Arg305Ile		A8MQC9|B7Z1Q5|Q6UX81|Q9UNF7	Missense_Mutation	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,superfamily_Fibronectin_type3,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.R305I	ENST00000370563.3	37	c.914	CCDS41355.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.230529	0.95207	.	.	ENSG00000016602	ENST00000370563;ENST00000263723	D;D	0.89196	-2.48;-2.48	6.17	6.17	0.99709	von Willebrand factor, type A (1);	0.000000	0.85682	D	0.000000	D	0.95500	0.8538	M	0.90082	3.085	0.58432	D	0.999995	D	0.56521	0.976	D	0.69654	0.965	D	0.95059	0.8194	10	0.72032	D	0.01	-38.0711	20.4745	0.99168	0.0:0.0:1.0:0.0	.	305	Q14CN2	CLCA4_HUMAN	I	305;18	ENSP00000359594:R305I;ENSP00000263723:R18I	ENSP00000263723:R18I	R	+	2	0	CLCA4	86804251	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	7.370000	0.79589	2.941000	0.99782	0.655000	0.94253	AGA	CLCA4	-	smart_VWF_A,tigrfam_CaCC_prot	ENSG00000016602		0.423	CLCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA4	HGNC	protein_coding	OTTHUMT00000028292.1	-	0.00	71	0	G	NM_012128		87031663	+1	tier1	-	no_errors	ENST00000370563	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.994	T
CLEC4G	339390	genome.wustl.edu	37	19	7794764	7794764	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:7794764C>T	ENST00000328853.5	-	8	754	c.686G>A	c.(685-687)cGc>cAc	p.R229H	CLEC4G_ENST00000598081.1_5'Flank	NM_001244856.1|NM_198492.3	NP_001231785.1|NP_940894.1	Q6UXB4	CLC4G_HUMAN	C-type lectin domain family 4, member G	229	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(1)	6						GCCCAGATGGCGCACAGCCCT	0.637																																					Esophageal Squamous(146;540 1807 3349 19438 30853)												0													66.0	61.0	63.0					19																	7794764		2203	4300	6503	SO:0001583	missense	0			AY358431	CCDS12185.1	19p13.2	2010-04-27	2008-11-04			ENSG00000182566		"""C-type lectin domain containing"""	24591	protein-coding gene	gene with protein product			"""C-type lectin superfamily 4, member G"""			12975309	Standard	NM_198492		Approved	UNQ431, LSECtin	uc002mhp.4	Q6UXB4		ENST00000328853.5:c.686G>A	19.37:g.7794764C>T	ENSP00000327599:p.Arg229His			Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.R229H	ENST00000328853.5	37	c.686	CCDS12185.1	19	.	.	.	.	.	.	.	.	.	.	C	19.39	3.817601	0.70912	.	.	ENSG00000182566	ENST00000328853;ENST00000381308	T	0.01106	5.33	5.53	4.49	0.54785	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.38058	N	0.001830	T	0.03263	0.0095	L	0.33245	0.995	0.23162	N	0.998193	D	0.89917	1.0	D	0.70227	0.968	T	0.38908	-0.9639	10	0.56958	D	0.05	.	12.1708	0.54157	0.171:0.829:0.0:0.0	.	229	Q6UXB4	CLC4G_HUMAN	H	229;113	ENSP00000327599:R229H	ENSP00000327599:R229H	R	-	2	0	CLEC4G	7700764	0.062000	0.20869	0.447000	0.26932	0.121000	0.20230	0.799000	0.27028	1.455000	0.47813	-0.261000	0.10672	CGC	CLEC4G	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000182566		0.637	CLEC4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4G	HGNC	protein_coding	OTTHUMT00000461989.1		0.00	80	0	C	NM_198492		7794764	-1			no_errors	ENST00000328853	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.423	T
CLIP1	6249	genome.wustl.edu	37	12	122862043	122862043	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:122862043G>T	ENST00000540338.1	-	2	591	c.550C>A	c.(550-552)Ccg>Acg	p.P184T	CLIP1_ENST00000361654.4_Missense_Mutation_p.P184T|CLIP1_ENST00000302528.7_Missense_Mutation_p.P184T|CLIP1_ENST00000358808.2_Missense_Mutation_p.P184T|CLIP1_ENST00000537178.1_Missense_Mutation_p.P184T			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	184	Ser-rich.				microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTGCTGATCGGAGGCGTAGCT	0.507																																																	0													178.0	159.0	166.0					12																	122862043		2203	4300	6503	SO:0001583	missense	0				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.550C>A	12.37:g.122862043G>T	ENSP00000439093:p.Pro184Thr		A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.P184T	ENST00000540338.1	37	c.550	CCDS58285.1	12	.	.	.	.	.	.	.	.	.	.	G	1.983	-0.433693	0.04669	.	.	ENSG00000130779	ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304;ENST00000537004	T;T;T;T;T;T	0.73575	-0.76;-0.76;-0.76;-0.76;-0.76;-0.76	5.81	5.81	0.92471	Cytoskeleton-associated protein, Gly-rich domain (1);	0.228569	0.46145	D	0.000309	T	0.60753	0.2293	N	0.14661	0.345	0.45295	D	0.99829	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.15484	0.004;0.012;0.012;0.013	T	0.55829	-0.8079	10	0.13470	T	0.59	-8.2886	20.0912	0.97820	0.0:0.0:1.0:0.0	.	184;184;184;184	F6VGP8;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	T	184;184;29;184;184;184;184	ENSP00000303585:P184T;ENSP00000351665:P184T;ENSP00000445531:P184T;ENSP00000439093:P184T;ENSP00000437786:P184T;ENSP00000441409:P184T	ENSP00000303585:P184T	P	-	1	0	CLIP1	121427996	1.000000	0.71417	0.881000	0.34555	0.070000	0.16714	5.360000	0.66086	2.746000	0.94184	0.591000	0.81541	CCG	CLIP1	-	superfamily_CAP-Gly_domain	ENSG00000130779		0.507	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1		0.00	69	0	G	NM_002956		122862043	-1			no_errors	ENST00000540338	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.999	T
CNGA2	1260	genome.wustl.edu	37	X	150906969	150906969	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chrX:150906969C>A	ENST00000329903.4	+	1	47	c.14C>A	c.(13-15)aCc>aAc	p.T5N		NM_005140.1	NP_005131.1	Q16280	CNGA2_HUMAN	cyclic nucleotide gated channel alpha 2	5					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|endometrium(4)|large_intestine(5)|lung(34)|prostate(2)	49	Acute lymphoblastic leukemia(192;6.56e-05)					ACCGAAAAAACCAATGGTGTG	0.522																																																	0													183.0	140.0	155.0					X																	150906969		2203	4300	6503	SO:0001583	missense	0			S76067	CCDS14701.1	Xq27	2011-07-05			ENSG00000183862	ENSG00000183862		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2149	protein-coding gene	gene with protein product		300338		CNCA1, CNCA		7532814, 16382102	Standard	NM_005140		Approved	CNG2, OCNC1, OCNCa, OCNCALPHA, OCNCalpha, FLJ46312	uc004fey.1	Q16280	OTTHUMG00000024173	ENST00000329903.4:c.14C>A	X.37:g.150906969C>A	ENSP00000328478:p.Thr5Asn		A0AVD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.T5N	ENST00000329903.4	37	c.14	CCDS14701.1	X	.	.	.	.	.	.	.	.	.	.	C	4.797	0.148167	0.09134	.	.	ENSG00000183862	ENST00000329903	D	0.97303	-4.33	4.85	3.99	0.46301	.	1.034710	0.07658	N	0.933094	D	0.91768	0.7396	N	0.08118	0	0.19300	N	0.99998	B	0.09022	0.002	B	0.06405	0.002	D	0.84527	0.0631	10	0.51188	T	0.08	.	7.9608	0.30070	0.0:0.8873:0.0:0.1127	.	5	Q16280	CNGA2_HUMAN	N	5	ENSP00000328478:T5N	ENSP00000328478:T5N	T	+	2	0	CNGA2	150657625	0.988000	0.35896	0.987000	0.45799	0.005000	0.04900	1.445000	0.35079	1.044000	0.40200	-0.192000	0.12808	ACC	CNGA2	-	NULL	ENSG00000183862		0.522	CNGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA2	HGNC	protein_coding	OTTHUMT00000060888.1	-	0.00	19	0	C	NM_005140		150906969	+1	tier1	-	no_errors	ENST00000329903	ensembl	human	known	74_37	missense	40.54	22	15	SNP	0.976	A
CNIH4	29097	genome.wustl.edu	37	1	224544861	224544861	+	Intron	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:224544861A>G	ENST00000465271.1	+	1	144				CNIH4_ENST00000366857.5_Intron|CNIH4_ENST00000468318.1_Intron|CNIH4_ENST00000366858.3_Intron|CNIH4_ENST00000366856.3_Intron	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4						intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		CGGAGCGGGTAGGAGAGGCTG	0.776																																																	0																																										SO:0001627	intron_variant	0				CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.69+166A>G	1.37:g.224544861A>G			A8K1Q8|B2R553|Q9H0X8	RNA	SNP	-	NULL	ENST00000465271.1	37	NULL	CCDS1543.1	1																																																																																			CNIH4	-	-	ENSG00000143771		0.776	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH4	HGNC	protein_coding	OTTHUMT00000091754.1	-	0.00	10	0	A	NM_014184		224544861	+1	tier1	-	no_errors	ENST00000477413	ensembl	human	known	74_37	rna	52.94	8	9	SNP	0.000	G
CNOT6L	246175	genome.wustl.edu	37	4	78694306	78694306	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:78694306T>C	ENST00000504123.1	-	4	459	c.329A>G	c.(328-330)aAt>aGt	p.N110S	CNOT6L_ENST00000264903.4_Missense_Mutation_p.N110S|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	110	Required for interaction with CNOT1, CNOT3 and CNOT7.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						CAGATTGTTATTTAAAAGCAA	0.303																																																	0													41.0	39.0	40.0					4																	78694306		1783	4059	5842	SO:0001583	missense	0			AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.329A>G	4.37:g.78694306T>C	ENSP00000424896:p.Asn110Ser		Q9UF92	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Leu-rich_rpt,superfamily_Endo/exonuclease/phosphatase,smart_Leu-rich_rpt_typical-subtyp	p.N110S	ENST00000504123.1	37	c.329		4	.	.	.	.	.	.	.	.	.	.	T	11.32	1.603167	0.28534	.	.	ENSG00000138767	ENST00000504123;ENST00000264903;ENST00000512485;ENST00000515441	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.78	3.57	0.40892	.	0.000000	0.85682	D	0.000000	T	0.15478	0.0373	N	0.00258	-1.755	0.80722	D	1	B;B	0.23735	0.09;0.029	B;B	0.30943	0.122;0.086	T	0.06534	-1.0821	10	0.20046	T	0.44	-11.5532	10.6888	0.45858	0.1433:0.0:0.0:0.8567	.	110;110	B4E2S0;Q96LI5	.;CNO6L_HUMAN	S	110;110;117;110	ENSP00000424896:N110S;ENSP00000264903:N110S;ENSP00000425571:N117S;ENSP00000426269:N110S	ENSP00000264903:N110S	N	-	2	0	CNOT6L	78913330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.255000	0.72466	0.645000	0.30675	0.454000	0.30748	AAT	CNOT6L	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000138767		0.303	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	CNOT6L	HGNC	protein_coding	OTTHUMT00000362515.1	-	0.00	157	0	T			78694306	-1	tier1	-	no_errors	ENST00000264903	ensembl	human	known	74_37	missense	63.50	50	87	SNP	1.000	C
COG4	25839	genome.wustl.edu	37	16	70531202	70531202	+	Missense_Mutation	SNP	C	C	T	rs200052272		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:70531202C>T	ENST00000323786.5	-	11	1424	c.1403G>A	c.(1402-1404)cGg>cAg	p.R468Q		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	464					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				GGACAGAGCCCGCCCAATGCA	0.532																																																	0													167.0	147.0	154.0					16																	70531202		2198	4300	6498	SO:0001583	missense	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1403G>A	16.37:g.70531202C>T	ENSP00000315775:p.Arg468Gln		B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.R468Q	ENST00000323786.5	37	c.1403	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	C	37	5.984007	0.97173	.	.	ENSG00000103051	ENST00000323786;ENST00000338984;ENST00000539961	T	0.67865	-0.29	5.98	5.98	0.97165	Conserved oligomeric Golgi complex, subunit 4 (2);	0.000000	0.85682	D	0.000000	T	0.80597	0.4653	L	0.55017	1.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80464	-0.1371	10	0.87932	D	0	-18.798	20.4581	0.99154	0.0:1.0:0.0:0.0	.	374;463;464	Q8N8L9;Q6PIW8;Q9H9E3	.;.;COG4_HUMAN	Q	468;464;126	ENSP00000315775:R468Q	ENSP00000315775:R468Q	R	-	2	0	COG4	69088703	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.298000	0.78815	2.835000	0.97688	0.650000	0.86243	CGG	COG4	-	pfam_COG_su4,smart_COG_su4	ENSG00000103051		0.532	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3		0.00	23	0	C			70531202	-1			no_errors	ENST00000323786	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
COG6	57511	genome.wustl.edu	37	13	40261702	40261702	+	Missense_Mutation	SNP	C	C	T	rs148869108		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr13:40261702C>T	ENST00000455146.3	+	9	901	c.851C>T	c.(850-852)gCg>gTg	p.A284V	COG6_ENST00000416691.1_Missense_Mutation_p.A284V	NM_020751.2	NP_065802.1	Q9Y2V7	COG6_HUMAN	component of oligomeric golgi complex 6	284					glycosylation (GO:0070085)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				NS(1)|kidney(2)|large_intestine(5)|lung(4)|skin(1)	13		Lung NSC(96;0.000124)|Breast(139;0.0199)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.03e-09)|Epithelial(112;7e-07)|OV - Ovarian serous cystadenocarcinoma(117;0.00015)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.0168)		TTTATTGATGCGCTCACAAGA	0.418																																																	0								C	VAL/ALA,VAL/ALA	0,4406		0,0,2203	95.0	96.0	96.0		851,851	5.7	1.0	13	dbSNP_134	96	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	COG6	NM_001145079.1,NM_020751.2	64,64	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	284/616,284/658	40261702	1,13005	2203	4300	6503	SO:0001583	missense	0			AK026638	CCDS9370.1, CCDS45042.1	13q13.2	2011-08-01			ENSG00000133103	ENSG00000133103		"""Components of oligomeric golgi complex"""	18621	protein-coding gene	gene with protein product		606977				11980916	Standard	NM_020751		Approved	COD2, KIAA1134	uc001uxh.2	Q9Y2V7	OTTHUMG00000016768	ENST00000455146.3:c.851C>T	13.37:g.40261702C>T	ENSP00000397441:p.Ala284Val		Q5T0U1|Q6AI19|Q86V49|Q9ULT5	Missense_Mutation	SNP	pfam_COG6	p.A284V	ENST00000455146.3	37	c.851	CCDS9370.1	13	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910341	0.92107	0.0	1.16E-4	ENSG00000133103	ENST00000416691;ENST00000255468;ENST00000455146	T;T	0.61392	0.11;0.11	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.79464	0.4450	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.948	T	0.79619	-0.1728	10	0.44086	T	0.13	-21.5914	18.7723	0.91898	0.0:1.0:0.0:0.0	.	305;284	Q5T0U2;Q9Y2V7	.;COG6_HUMAN	V	284;315;284	ENSP00000403733:A284V;ENSP00000397441:A284V	ENSP00000255468:A315V	A	+	2	0	COG6	39159702	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	7.276000	0.78559	2.676000	0.91093	0.591000	0.81541	GCG	COG6	-	pfam_COG6	ENSG00000133103		0.418	COG6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COG6	HGNC	protein_coding	OTTHUMT00000044622.3	-	0.00	32	0	C			40261702	+1	tier1	rs148869108	no_errors	ENST00000455146	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130110482	130110482	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:130110482G>T	ENST00000432398.2	+	7	3371	c.2877G>T	c.(2875-2877)aaG>aaT	p.K959N	COL6A5_ENST00000265379.6_Missense_Mutation_p.K959N	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	959	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						CCAACCAAAAGGAACTTGAGG	0.403																																																	0													72.0	55.0	60.0					3																	130110482		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.2877G>T	3.37:g.130110482G>T	ENSP00000390895:p.Lys959Asn		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.K959N	ENST00000432398.2	37	c.2877		3	.	.	.	.	.	.	.	.	.	.	G	8.911	0.958787	0.18507	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.83506	-1.73;-1.73	5.71	-11.4	0.00090	.	.	.	.	.	T	0.58395	0.2119	N	0.05383	-0.06	0.09310	N	1	B	0.18310	0.027	B	0.20384	0.029	T	0.47169	-0.9138	9	0.21014	T	0.42	.	8.735	0.34523	0.3604:0.0:0.0784:0.5612	.	959	A8TX70-2	.	N	959	ENSP00000390895:K959N;ENSP00000265379:K959N	ENSP00000265379:K959N	K	+	3	2	COL6A5	131593172	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-6.023000	0.00085	-2.619000	0.00441	0.650000	0.86243	AAG	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.403	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding			0.00	18	0	G	NM_153264		130110482	+1			no_errors	ENST00000265379	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.000	T
COPA	1314	genome.wustl.edu	37	1	160278920	160278920	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:160278920delG	ENST00000241704.7	-	13	1419	c.1190delC	c.(1189-1191)cctfs	p.P397fs	COPA_ENST00000368069.3_Frame_Shift_Del_p.P397fs	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	397					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCATCTTTAGGGATGGTGTA	0.443																																																	0													220.0	192.0	201.0					1																	160278920		2203	4300	6503	SO:0001589	frameshift_variant	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1190delC	1.37:g.160278920delG	ENSP00000241704:p.Pro397fs		Q5T201|Q8IXZ9	Frame_Shift_Del	DEL	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P397fs	ENST00000241704.7	37	c.1190	CCDS1202.1	1																																																																																			COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.443	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	88	0	G	NM_004371		160278920	-1	tier1		no_errors	ENST00000368069	ensembl	human	known	74_37	frame_shift_del	28.99	98	40	DEL	1.000	-
COQ9	57017	genome.wustl.edu	37	16	57484920	57484920	+	Intron	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:57484920G>T	ENST00000262507.6	+	2	142				COQ9_ENST00000567384.1_3'UTR|COQ9_ENST00000567933.1_Intron|COQ9_ENST00000567072.1_Intron	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9						mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						CTTCTCTGTTGAATGTCCCTG	0.537																																																	0													42.0	35.0	38.0					16																	57484920		2198	4300	6498	SO:0001627	intron_variant	0			BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.74-32G>T	16.37:g.57484920G>T			A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	RNA	SNP	-	NULL	ENST00000262507.6	37	NULL	CCDS32459.1	16																																																																																			COQ9	-	-	ENSG00000088682		0.537	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ9	HGNC	protein_coding	OTTHUMT00000432598.3	-	0.00	61	0	G	NM_020312		57484920	+1	tier1	-	no_errors	ENST00000567384	ensembl	human	putative	74_37	rna	6.67	56	4	SNP	0.000	T
COX7C	1350	genome.wustl.edu	37	5	85913793	85913794	+	5'UTR	INS	-	-	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:85913793_85913794insA	ENST00000509578.1	+	0	21_22				COX7C_ENST00000515763.1_5'UTR|COX7C_ENST00000247655.3_5'UTR|MIR3607_ENST00000362392.1_RNA			P15954	COX7C_HUMAN	cytochrome c oxidase subunit VIIc						cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|lung(1)	2		all_cancers(142;7e-06)|Lung NSC(167;0.000601)|all_lung(232;0.000693)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;1.56e-40)|Epithelial(54;3.17e-34)|all cancers(79;3.36e-29)		ACAAGGTCGTGAAAAAAAAGGT	0.55																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC001005	CCDS4063.1	5q14	2011-07-04			ENSG00000127184	ENSG00000127184	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2292	protein-coding gene	gene with protein product		603774				10072584	Standard	NM_001867		Approved		uc003kir.3	P15954	OTTHUMG00000119049	ENST00000509578.1:c.-79->A	5.37:g.85913801_85913801dupA			Q6NR81	RNA	INS	-	NULL	ENST00000509578.1	37	NULL	CCDS4063.1	5																																																																																			COX7C	-	-	ENSG00000127184		0.550	COX7C-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	COX7C	HGNC	protein_coding	OTTHUMT00000369746.1		0.00	57	0	-	NM_001867		85913794	+1	tier1		no_errors	ENST00000505430	ensembl	human	known	74_37	rna	7.69	24	2	INS	0.001:0.000	A
CREBBP	1387	genome.wustl.edu	37	16	3820588	3820588	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:3820588G>A	ENST00000262367.5	-	14	3672	c.2863C>T	c.(2863-2865)Cag>Tag	p.Q955*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.Q917*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	955					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CCAGGAGGCTGGGCGTGCACA	0.587			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													130.0	158.0	149.0					16																	3820588		2197	4300	6497	SO:0001587	stop_gained	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.2863C>T	16.37:g.3820588G>A	ENSP00000262367:p.Gln955*		D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Q955*	ENST00000262367.5	37	c.2863	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	49	15.619671	0.99839	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	.	.	.	5.87	5.87	0.94306	.	0.079503	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-15.1014	20.5827	0.99408	0.0:0.0:1.0:0.0	.	.	.	.	X	955;985;917	.	ENSP00000262367:Q955X	Q	-	1	0	CREBBP	3760589	1.000000	0.71417	0.975000	0.42487	0.927000	0.56198	8.841000	0.92131	2.941000	0.99782	0.655000	0.94253	CAG	CREBBP	-	NULL	ENSG00000005339		0.587	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	43	0	G	NM_004380		3820588	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	nonsense	82.50	7	33	SNP	1.000	A
DBT	1629	genome.wustl.edu	37	1	100680382	100680382	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:100680382G>T	ENST00000370132.4	-	7	943	c.930C>A	c.(928-930)ttC>ttA	p.F310L	DBT_ENST00000370131.3_Missense_Mutation_p.F310L	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	310					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		CCTTTAAGAAGAAAGGCATAA	0.373																																																	0													71.0	69.0	70.0					1																	100680382		2203	4300	6503	SO:0001583	missense	0			BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.930C>A	1.37:g.100680382G>T	ENSP00000359151:p.Phe310Leu		B2R811|Q5VVL8	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl	p.F310L	ENST00000370132.4	37	c.930	CCDS767.1	1	.	.	.	.	.	.	.	.	.	.	G	19.76	3.886884	0.72410	.	.	ENSG00000137992	ENST00000543138;ENST00000370132;ENST00000370131	T;T	0.42900	0.96;0.96	5.54	-0.167	0.13347	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.35364	0.0929	M	0.72353	2.195	0.80722	D	1	P;P	0.46277	0.501;0.875	B;P	0.50352	0.198;0.638	T	0.33752	-0.9856	10	0.46703	T	0.11	-15.3379	11.1288	0.48334	0.3851:0.0:0.6149:0.0	.	129;310	F5H1F9;P11182	.;ODB2_HUMAN	L	129;310;310	ENSP00000359151:F310L;ENSP00000359150:F310L	ENSP00000359150:F310L	F	-	3	2	DBT	100452970	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	2.231000	0.43009	0.060000	0.16281	0.655000	0.94253	TTC	DBT	-	pfam_2-oxoacid_DH_actylTfrase	ENSG00000137992		0.373	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBT	HGNC	protein_coding	OTTHUMT00000030101.2	-	0.00	31	0	G	NM_001918		100680382	-1	tier1	-	no_errors	ENST00000370132	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.999	T
DCST1	149095	genome.wustl.edu	37	1	155023261	155023261	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:155023261C>T	ENST00000295542.1	+	17	2134	c.2038C>T	c.(2038-2040)Cgg>Tgg	p.R680W	ADAM15_ENST00000368413.1_5'Flank|ADAM15_ENST00000449910.2_5'Flank|ADAM15_ENST00000356955.2_5'Flank|ADAM15_ENST00000531455.1_5'Flank|ADAM15_ENST00000368410.2_5'Flank|ADAM15_ENST00000447332.3_5'Flank|ADAM15_ENST00000360674.4_5'Flank|ADAM15_ENST00000271836.6_5'Flank|ADAM15_ENST00000359280.4_5'Flank|ADAM15_ENST00000355956.2_5'Flank|DCST1_ENST00000423025.2_Missense_Mutation_p.R655W|ADAM15_ENST00000368412.3_5'Flank	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	680						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CATGCGGCAGCGGTGCCCGGT	0.677											OREG0013846	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													28.0	29.0	28.0					1																	155023261		2202	4300	6502	SO:0001583	missense	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.2038C>T	1.37:g.155023261C>T	ENSP00000295542:p.Arg680Trp	1767	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.R680W	ENST00000295542.1	37	c.2038	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.236432	0.58886	.	.	ENSG00000163357	ENST00000295542;ENST00000423025	T;T	0.22945	1.93;1.93	5.22	1.79	0.24919	Zinc finger, RING-type (2);	1.723590	0.02904	N	0.135730	T	0.09468	0.0233	L	0.46157	1.445	0.19300	N	0.999979	P;P	0.51653	0.947;0.947	B;B	0.40534	0.332;0.332	T	0.11012	-1.0605	10	0.38643	T	0.18	-5.8027	5.1983	0.15250	0.3007:0.5245:0.0:0.1748	.	655;680	E9PHV3;Q5T197	.;DCST1_HUMAN	W	680;655	ENSP00000295542:R680W;ENSP00000387369:R655W	ENSP00000295542:R680W	R	+	1	2	DCST1	153289885	0.011000	0.17503	0.832000	0.32986	0.977000	0.68977	0.553000	0.23391	0.540000	0.28808	0.655000	0.94253	CGG	DCST1	-	pfscan_Znf_RING	ENSG00000163357		0.677	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1		0.00	38	0	C	NM_152494		155023261	+1			no_errors	ENST00000295542	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.002	T
DMRTA1	63951	genome.wustl.edu	37	9	22451252	22451252	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:22451252C>A	ENST00000325870.2	+	2	1082	c.857C>A	c.(856-858)tCa>tAa	p.S286*		NM_022160.2	NP_071443.2	Q5VZB9	DMRTA_HUMAN	DMRT-like family A1	286					male mating behavior (GO:0060179)|ovarian follicle development (GO:0001541)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(5;4.09e-243)|Acute lymphoblastic leukemia(3;8.25e-150)|all_hematologic(3;4.25e-147)|Esophageal squamous(3;2.32e-09)|Renal(3;1.71e-07)|Breast(3;2.07e-06)|Hepatocellular(5;0.00563)		GBM - Glioblastoma multiforme(1;5.12e-278)|Lung(24;8.2e-52)|LUSC - Lung squamous cell carcinoma(38;1.46e-37)|OV - Ovarian serous cystadenocarcinoma(39;0.0517)		GGAGAGCAATCAGGAGGTGAA	0.458																																																	0													71.0	67.0	68.0					9																	22451252		2203	4300	6503	SO:0001587	stop_gained	0			AJ290954	CCDS6514.1	9p21.3	2008-05-15			ENSG00000176399	ENSG00000176399			13826	protein-coding gene	gene with protein product		614803					Standard	NM_022160		Approved		uc003zpp.1	Q5VZB9	OTTHUMG00000019693	ENST00000325870.2:c.857C>A	9.37:g.22451252C>A	ENSP00000319651:p.Ser286*		A1L481|Q8N8Y9|Q9H4B9	Nonsense_Mutation	SNP	pfam_DM_DNA-bd,pfam_DMA,superfamily_DM_DNA-bd,superfamily_UBA-like,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.S286*	ENST00000325870.2	37	c.857	CCDS6514.1	9	.	.	.	.	.	.	.	.	.	.	C	38	6.712073	0.97780	.	.	ENSG00000176399	ENST00000325870	.	.	.	5.87	5.87	0.94306	.	0.307941	0.32231	N	0.006383	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.1406	13.3498	0.60595	0.0:0.9242:0.0:0.0758	.	.	.	.	X	286	.	ENSP00000319651:S286X	S	+	2	0	DMRTA1	22441252	1.000000	0.71417	0.998000	0.56505	0.852000	0.48524	3.637000	0.54324	2.941000	0.99782	0.655000	0.94253	TCA	DMRTA1	-	NULL	ENSG00000176399		0.458	DMRTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTA1	HGNC	protein_coding	OTTHUMT00000051935.2		0.00	25	0	C			22451252	+1			no_errors	ENST00000325870	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20981174	20981174	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:20981174C>A	ENST00000261383.3	-	52	8397	c.8398G>T	c.(8398-8400)Gag>Tag	p.E2800*	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2800	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGATGCTCTCCATGACCAGT	0.597																																																	0													149.0	130.0	137.0					16																	20981174		2201	4300	6501	SO:0001587	stop_gained	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8398G>T	16.37:g.20981174C>A	ENSP00000261383:p.Glu2800*		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.E2800*	ENST00000261383.3	37	c.8398	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	47	13.523846	0.99747	.	.	ENSG00000158486	ENST00000261383	.	.	.	5.79	5.79	0.91817	.	0.132210	0.49305	D	0.000152	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	20.0998	0.97870	0.0:1.0:0.0:0.0	.	.	.	.	X	2800	.	ENSP00000261383:E2800X	E	-	1	0	DNAH3	20888675	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	5.925000	0.70062	2.755000	0.94549	0.644000	0.83932	GAG	DNAH3	-	NULL	ENSG00000158486		0.597	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	74	0	C	NM_017539		20981174	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	nonsense	8.00	46	4	SNP	1.000	A
DNAH5	1767	genome.wustl.edu	37	5	13766214	13766214	+	Missense_Mutation	SNP	A	A	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:13766214A>C	ENST00000265104.4	-	59	10076	c.9972T>G	c.(9970-9972)gaT>gaG	p.D3324E	DNAH5_ENST00000504001.3_Intron	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3324	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCAGTACGCAATCCATGATCC	0.522									Kartagener syndrome																																								0													115.0	112.0	113.0					5																	13766214		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9972T>G	5.37:g.13766214A>C	ENSP00000265104:p.Asp3324Glu		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.D3324E	ENST00000265104.4	37	c.9972	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445798	0.84101	.	.	ENSG00000039139	ENST00000265104	T	0.55930	0.49	5.63	-1.69	0.08186	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.63651	0.2529	L	0.58969	1.84	0.58432	D	0.999995	D	0.89917	1.0	D	0.91635	0.999	T	0.62737	-0.6791	10	0.39692	T	0.17	.	13.7651	0.62990	0.1959:0.0:0.8041:0.0	.	3324	Q8TE73	DYH5_HUMAN	E	3324	ENSP00000265104:D3324E	ENSP00000265104:D3324E	D	-	3	2	DNAH5	13819214	0.999000	0.42202	0.992000	0.48379	0.892000	0.51952	0.456000	0.21859	-0.098000	0.12285	0.456000	0.33151	GAT	DNAH5	-	NULL	ENSG00000039139		0.522	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	65	0	A	NM_001369		13766214	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	60.00	41	63	SNP	0.998	C
DNAH9	1770	genome.wustl.edu	37	17	11797759	11797759	+	Silent	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:11797759G>A	ENST00000262442.4	+	59	11420	c.11352G>A	c.(11350-11352)acG>acA	p.T3784T	DNAH9_ENST00000608377.1_Silent_p.T96T|DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Silent_p.T3784T	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3784					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGTGCAGACGGGCACCGCCA	0.512																																																	0													89.0	89.0	89.0					17																	11797759		2203	4300	6503	SO:0001819	synonymous_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11352G>A	17.37:g.11797759G>A			A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T3784	ENST00000262442.4	37	c.11352	CCDS11160.1	17																																																																																			DNAH9	-	NULL	ENSG00000007174		0.512	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	43	0	G	NM_001372		11797759	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	silent	25.81	46	16	SNP	0.766	A
DOCK2	1794	genome.wustl.edu	37	5	169097578	169097578	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:169097578G>T	ENST00000256935.8	+	4	281	c.201G>T	c.(199-201)aaG>aaT	p.K67N		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	67	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCCACATCAAGGAAGTGACAG	0.358																																																	0													103.0	98.0	100.0					5																	169097578		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.201G>T	5.37:g.169097578G>T	ENSP00000256935:p.Lys67Asn		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.K67N	ENST00000256935.8	37	c.201	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	18.50	3.638238	0.67130	.	.	ENSG00000134516	ENST00000256935	T	0.05025	3.51	5.59	0.966	0.19667	Src homology-3 domain (3);	0.102149	0.64402	D	0.000004	T	0.16428	0.0395	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.00422	-1.1749	10	0.51188	T	0.08	.	8.8254	0.35052	0.5491:0.0:0.4509:0.0	.	67	Q92608	DOCK2_HUMAN	N	67	ENSP00000256935:K67N	ENSP00000256935:K67N	K	+	3	2	DOCK2	169030156	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.898000	0.39809	0.245000	0.21373	0.563000	0.77884	AAG	DOCK2	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000134516		0.358	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	38	0	G	NM_004946		169097578	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.998	T
DRP2	1821	genome.wustl.edu	37	X	100507655	100507655	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chrX:100507655G>T	ENST00000395209.3	+	17	2454	c.1927G>T	c.(1927-1929)Gcc>Tcc	p.A643S	DRP2_ENST00000541709.1_Missense_Mutation_p.A565S|DRP2_ENST00000402866.1_Missense_Mutation_p.A643S|DRP2_ENST00000538510.1_Missense_Mutation_p.A643S	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	643					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GACAGGCAGGGCCAGCAAAGG	0.532																																																	0													126.0	90.0	103.0					X																	100507655		2203	4300	6503	SO:0001583	missense	0			U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1927G>T	X.37:g.100507655G>T	ENSP00000378635:p.Ala643Ser		A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.A643S	ENST00000395209.3	37	c.1927	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104541	0.56291	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82	6.08	6.08	0.98989	Zinc finger, ZZ-type (3);	0.100164	0.64402	D	0.000002	T	0.81767	0.4892	N	0.03238	-0.38	0.43152	D	0.994924	B	0.29552	0.248	B	0.30179	0.112	T	0.79408	-0.1816	10	0.37606	T	0.19	-13.2305	19.5098	0.95137	0.0:0.0:1.0:0.0	.	643	Q13474	DRP2_HUMAN	S	643;643;565;643	ENSP00000385038:A643S;ENSP00000378635:A643S;ENSP00000444752:A565S;ENSP00000441051:A643S	ENSP00000378635:A643S	A	+	1	0	DRP2	100394311	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.352000	0.73027	2.562000	0.86427	0.600000	0.82982	GCC	DRP2	-	pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_Znf_ZZ	ENSG00000102385		0.532	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	HGNC	protein_coding	OTTHUMT00000057522.3		0.00	13	0	G	NM_001939		100507655	+1			no_errors	ENST00000395209	ensembl	human	known	74_37	missense	9.62	47	5	SNP	1.000	T
DSN1	79980	genome.wustl.edu	37	20	35384224	35384224	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:35384224G>T	ENST00000426836.1	-	9	1106	c.734C>A	c.(733-735)aCt>aAt	p.T245N	DSN1_ENST00000373740.3_Missense_Mutation_p.T173N|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000373750.4_Missense_Mutation_p.T245N|DSN1_ENST00000373745.3_Missense_Mutation_p.T245N|DSN1_ENST00000373734.4_Missense_Mutation_p.T138N|DSN1_ENST00000448110.2_Missense_Mutation_p.T229N	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	245					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				TTTGGCCTCAGTTGATCCTCT	0.338																																																	0													98.0	96.0	97.0					20																	35384224		2203	4300	6503	SO:0001583	missense	0			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.734C>A	20.37:g.35384224G>T	ENSP00000389810:p.Thr245Asn		B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Missense_Mutation	SNP	pfam_Dsn1/Mis13	p.T245N	ENST00000426836.1	37	c.734	CCDS13286.1	20	.	.	.	.	.	.	.	.	.	.	G	6.242	0.412748	0.11812	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734;ENST00000449595	.	.	.	4.74	1.64	0.23874	.	0.975523	0.08390	N	0.953055	T	0.26340	0.0643	N	0.19112	0.55	0.18873	N	0.999987	B;B	0.10296	0.001;0.003	B;B	0.10450	0.003;0.005	T	0.25882	-1.0119	9	0.49607	T	0.09	-25.7805	4.2301	0.10599	0.1931:0.0:0.6258:0.1811	.	138;245	Q5JW55;Q9H410	.;DSN1_HUMAN	N	245;245;229;178;245;173;138;229	.	ENSP00000362838:T178N	T	-	2	0	DSN1	34817638	0.938000	0.31826	0.246000	0.24233	0.311000	0.27955	1.393000	0.34497	0.289000	0.22422	0.460000	0.39030	ACT	DSN1	-	pfam_Dsn1/Mis13	ENSG00000149636		0.338	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	HGNC	protein_coding	OTTHUMT00000079043.2		0.00	25	0	G	NM_024918		35384224	-1			no_errors	ENST00000373745	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.459	T
DST	667	genome.wustl.edu	37	6	56437732	56437732	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:56437732G>A	ENST00000361203.3	-	48	12741	c.12734C>T	c.(12733-12735)gCt>gTt	p.A4245V	DST_ENST00000244364.6_Missense_Mutation_p.A1833V|DST_ENST00000446842.2_Missense_Mutation_p.A3921V|DST_ENST00000370769.4_Missense_Mutation_p.A4247V|DST_ENST00000312431.6_3'UTR|DST_ENST00000370754.5_Missense_Mutation_p.A4425V|DST_ENST00000421834.2_Missense_Mutation_p.A2159V|DST_ENST00000370788.2_Missense_Mutation_p.A2159V			Q03001	DYST_HUMAN	dystonin	4245					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGAAAACCGAGCAGACAAGTC	0.388																																																	0													113.0	98.0	103.0					6																	56437732		1866	4116	5982	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12734C>T	6.37:g.56437732G>A	ENSP00000354508:p.Ala4245Val		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A4425V	ENST00000361203.3	37	c.13274		6	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458602	0.26248	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.78	-4.99	0.03010	.	1.308000	0.05475	N	0.553864	T	0.05731	0.0150	N	0.08118	0	0.23376	N	0.997805	B;B;B;B;B	0.06786	0.0;0.0;0.001;0.0;0.0	B;B;B;B;B	0.10450	0.0;0.002;0.004;0.0;0.005	T	0.25813	-1.0121	9	0.25751	T	0.34	.	9.6334	0.39793	0.269:0.2937:0.4373:0.0	.	2159;4247;4425;4245;1833	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	1833;4425;4247;2159;3921;2159;4245	ENSP00000244364:A1833V;ENSP00000359790:A4425V;ENSP00000359805:A4247V;ENSP00000400883:A2159V;ENSP00000393645:A3921V;ENSP00000359824:A2159V;ENSP00000354508:A4245V	ENSP00000244364:A1833V	A	-	2	0	DST	56545691	0.000000	0.05858	0.010000	0.14722	0.914000	0.54420	0.366000	0.20365	-1.265000	0.02449	-0.312000	0.09012	GCT	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.388	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	41	0	G	NM_001723		56437732	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	28.66	112	45	SNP	0.000	A
DTNA	1837	genome.wustl.edu	37	18	32418785	32418785	+	Silent	SNP	C	C	A	rs199867593		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr18:32418785C>A	ENST00000399113.3	+	12	1249	c.1249C>A	c.(1249-1251)Cgg>Agg	p.R417R	DTNA_ENST00000399121.5_Intron|DTNA_ENST00000598142.1_Intron|DTNA_ENST00000269192.7_Silent_p.R126R|DTNA_ENST00000599844.1_Intron|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000283365.9_Intron|DTNA_ENST00000601125.1_Intron|DTNA_ENST00000598334.1_Intron|DTNA_ENST00000595022.1_Intron|DTNA_ENST00000444659.1_Silent_p.R417R|DTNA_ENST00000591182.1_Intron|DTNA_ENST00000597599.1_Intron|DTNA_ENST00000269191.6_Silent_p.R417R|DTNA_ENST00000348997.5_Silent_p.R414R|DTNA_ENST00000556414.3_Intron|DTNA_ENST00000399097.3_Intron|DTNA_ENST00000269190.7_Silent_p.R418R|DTNA_ENST00000598774.1_Intron|DTNA_ENST00000597674.1_Intron			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	417	Syntrophin-binding region.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R418W(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CAACATGCTCCGGAACAACCC	0.512																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											176.0	129.0	145.0					18																	32418785		2203	4300	6503	SO:0001819	synonymous_variant	0			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1249C>A	18.37:g.32418785C>A			A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Silent	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Distrobrevin,pfscan_Znf_ZZ	p.R418	ENST00000399113.3	37	c.1252	CCDS59311.1	18																																																																																			DTNA	-	pirsf_Distrobrevin	ENSG00000134769		0.512	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	DTNA	HGNC	protein_coding	OTTHUMT00000255422.2		0.00	43	0	C	NM_001390		32418785	+1			no_errors	ENST00000269190	ensembl	human	known	74_37	silent	7.32	38	3	SNP	1.000	A
DUSP7	1849	genome.wustl.edu	37	3	52090157	52090157	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:52090157C>G	ENST00000495880.1	-	1	409	c.226G>C	c.(226-228)Gac>Cac	p.D76H	DUSP7_ENST00000296483.6_Missense_Mutation_p.D25H			Q16829	DUS7_HUMAN	dual specificity phosphatase 7	76	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of MAP kinase activity (GO:0043407)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	17				BRCA - Breast invasive adenocarcinoma(193;5.14e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGCCGGCAGTCGAGCAGCAGC	0.726																																																	0													12.0	13.0	13.0					3																	52090157		2189	4290	6479	SO:0001583	missense	0			X93921	CCDS33766.1, CCDS33766.2	3p21	2011-06-09			ENSG00000164086	ENSG00000164086		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3073	protein-coding gene	gene with protein product		602749				8626780, 9205128	Standard	NM_001947		Approved	MKP-X, PYST2	uc003dct.3	Q16829	OTTHUMG00000157819	ENST00000495880.1:c.226G>C	3.37:g.52090157C>G	ENSP00000417183:p.Asp76His		Q2M3J7|Q8NFJ0	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.D25H	ENST00000495880.1	37	c.73	CCDS33766.2	3	.	.	.	.	.	.	.	.	.	.	C	26.1	4.700142	0.88924	.	.	ENSG00000164086	ENST00000495880;ENST00000296483;ENST00000469623	D;D;D	0.86297	-2.1;-2.1;-2.1	4.44	3.57	0.40892	Rhodanese-like (5);	0.117922	0.56097	D	0.000035	D	0.91446	0.7300	M	0.62209	1.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91433	0.5167	10	0.87932	D	0	.	12.0383	0.53438	0.0:0.9143:0.0:0.0857	.	25;76	Q16829-2;Q16829	.;DUS7_HUMAN	H	76;25;9	ENSP00000417183:D76H;ENSP00000296483:D25H;ENSP00000418566:D9H	ENSP00000296483:D25H	D	-	1	0	DUSP7	52065197	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	5.654000	0.67974	0.879000	0.35944	0.655000	0.94253	GAC	DUSP7	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom	ENSG00000164086		0.726	DUSP7-001	NOVEL	basic|CCDS	protein_coding	DUSP7	HGNC	protein_coding	OTTHUMT00000349697.1	-	0.00	10	0	C	NM_001947		52090157	-1	tier1	-	no_errors	ENST00000296483	ensembl	human	known	74_37	missense	100.00	0	5	SNP	1.000	G
DYX1C1	161582	genome.wustl.edu	37	15	55759136	55759136	+	Missense_Mutation	SNP	G	G	T	rs146811023		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:55759136G>T	ENST00000321149.3	-	5	996	c.629C>A	c.(628-630)gCt>gAt	p.A210D	DYX1C1_ENST00000448430.2_Missense_Mutation_p.A210D|DYX1C1_ENST00000348518.3_Missense_Mutation_p.A210D|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000457155.2_Missense_Mutation_p.A210D|DYX1C1_ENST00000380679.1_Missense_Mutation_p.A210D	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	210					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)	p.A210V(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		ACCTTTTGGAGCAAGATTTCT	0.279																																																	1	Substitution - Missense(1)	skin(1)											40.0	44.0	43.0					15																	55759136		2191	4277	6468	SO:0001583	missense	0				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.629C>A	15.37:g.55759136G>T	ENSP00000323275:p.Ala210Asp		Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	pfam_TPR_1,pfam_CS_dom,superfamily_HSP20-like_chaperone,smart_TPR_repeat,pfscan_CS_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A210D	ENST00000321149.3	37	c.629	CCDS10154.1	15	.	.	.	.	.	.	.	.	.	.	G	4.014	-0.000061	0.07819	.	.	ENSG00000256061	ENST00000420792;ENST00000448430;ENST00000380679;ENST00000457155;ENST00000321149;ENST00000348518	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	3.61	3.61	0.41365	.	1.373380	0.04913	U	0.453548	T	0.31420	0.0796	L	0.27053	0.805	0.27005	N	0.964816	B;B;B	0.14438	0.002;0.001;0.01	B;B;B	0.09377	0.004;0.001;0.004	T	0.10222	-1.0639	10	0.11485	T	0.65	.	11.0758	0.48030	0.0:0.0:1.0:0.0	.	210;210;210	Q8WXU2-3;Q8WXU2;Q8WXU2-2	.;DYXC1_HUMAN;.	D	210	ENSP00000403412:A210D;ENSP00000370054:A210D;ENSP00000402640:A210D;ENSP00000323275:A210D;ENSP00000299561:A210D	ENSP00000323275:A210D	A	-	2	0	DYX1C1	53546428	0.325000	0.24660	0.857000	0.33713	0.049000	0.14656	1.805000	0.38883	2.309000	0.77851	0.563000	0.77884	GCT	DYX1C1	-	NULL	ENSG00000256061		0.279	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYX1C1	HGNC	protein_coding	OTTHUMT00000254976.1		0.00	28	0	G	NM_130810		55759136	-1			no_errors	ENST00000321149	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.895	T
EML4	27436	genome.wustl.edu	37	2	42513409	42513409	+	Splice_Site	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:42513409C>A	ENST00000318522.5	+	10	1274	c.1012C>A	c.(1012-1014)Cct>Act	p.P338T	EML4_ENST00000402711.2_Splice_Site_p.P280T|EML4_ENST00000401738.3_Splice_Site_p.P349T	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	338					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)		p.P338S(1)	EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						GTTTTTGCAGCCTCTACAACC	0.443			T	ALK	NSCLC																																			Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	1	Substitution - Missense(1)	prostate(1)											152.0	128.0	136.0					2																	42513409		2203	4300	6503	SO:0001630	splice_region_variant	0			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.1012-1C>A	2.37:g.42513409C>A			A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P338T	ENST00000318522.5	37	c.1012	CCDS1807.1	2	.	.	.	.	.	.	.	.	.	.	C	19.03	3.748211	0.69533	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738	T;T;T	0.41400	1.0;1.08;1.05	4.94	4.94	0.65067	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.101787	0.64402	D	0.000002	T	0.54838	0.1883	L	0.44542	1.39	0.80722	D	1	B;D;D	0.69078	0.105;0.997;0.997	B;P;P	0.60682	0.065;0.804;0.878	T	0.55029	-0.8204	10	0.49607	T	0.09	-13.2362	18.5327	0.90999	0.0:1.0:0.0:0.0	.	280;349;338	B5MCW9;B5MBZ0;Q9HC35	.;.;EMAL4_HUMAN	T	338;280;349	ENSP00000320663:P338T;ENSP00000385059:P280T;ENSP00000384939:P349T	ENSP00000320663:P338T	P	+	1	0	EML4	42366913	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.815000	0.38981	2.438000	0.82558	0.650000	0.86243	CCT	EML4	-	superfamily_Quinonprotein_ADH-like_supfam,smart_WD40_repeat	ENSG00000143924		0.443	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	HGNC	protein_coding	OTTHUMT00000250463.3		0.00	29	0	C	NM_019063	Missense_Mutation	42513409	+1			no_errors	ENST00000318522	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	A
ENPP1	5167	genome.wustl.edu	37	6	132201052	132201052	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:132201052G>A	ENST00000360971.2	+	20	1998	c.1978G>A	c.(1978-1980)Gga>Aga	p.G660R		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	660	Nuclease.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TTTACCCTATGGAAGACCTAG	0.383																																					Colon(104;336 1535 5856 11019 33782)												0													138.0	131.0	134.0					6																	132201052		2203	4300	6503	SO:0001583	missense	0			M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1978G>A	6.37:g.132201052G>A	ENSP00000354238:p.Gly660Arg		Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.G660R	ENST00000360971.2	37	c.1978	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057576	0.76074	.	.	ENSG00000197594	ENST00000360971	D	0.86432	-2.12	5.69	5.69	0.88448	Extracellular Endonuclease, subunit A (1);	0.000000	0.85682	D	0.000000	D	0.85813	0.5784	M	0.72118	2.19	0.80722	D	1	B	0.31859	0.343	B	0.36030	0.216	D	0.86304	0.1682	10	0.87932	D	0	-17.1497	19.3914	0.94584	0.0:0.0:1.0:0.0	.	660	P22413	ENPP1_HUMAN	R	660	ENSP00000354238:G660R	ENSP00000354238:G660R	G	+	1	0	ENPP1	132242745	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.095000	0.89535	2.684000	0.91462	0.563000	0.77884	GGA	ENPP1	-	NULL	ENSG00000197594		0.383	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	HGNC	protein_coding	OTTHUMT00000042238.2	-	0.00	39	0	G			132201052	+1	tier1	-	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	30.77	36	16	SNP	1.000	A
PAPSS2	9060	genome.wustl.edu	37	10	89419638	89419639	+	5'UTR	INS	-	-	GCT	rs540045493|rs368634218|rs540138599	byFrequency	TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:89419638_89419639insGCT	ENST00000361175.4	+	0	269_270				RP11-57C13.3_ENST00000354527.2_RNA|PAPSS2_ENST00000427144.2_5'Flank|PAPSS2_ENST00000456849.1_5'UTR|RP11-57C13.6_ENST00000438082.1_lincRNA	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		GTCCGGCAgccgctgctgctgc	0.708														1002	0.20008	0.2852	0.1628	5008	,	,		8101	0.0585		0.2435	False		,,,				2504	0.2127																0																																										SO:0001623	5_prime_UTR_variant	0			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.-100->GCT	10.37:g.89419645_89419647dupGCT			Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	RNA	INS	-	NULL	ENST00000361175.4	37	NULL	CCDS7385.1	10																																																																																			RP11-57C13.3	-	-	ENSG00000196566		0.708	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000196566	Clone_based_vega_gene	protein_coding	OTTHUMT00000049229.1		0.00	12	0	-			89419639	-1	tier1		no_errors	ENST00000354527	ensembl	human	known	74_37	rna	55.56	8	10	INS	0.000:0.000	GCT
RP1-29C18.10	0	genome.wustl.edu	37	22	49947591	49947591	+	RNA	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr22:49947591G>T	ENST00000391625.2	+	0	1364																											GGAGGCTGGCGCCTGGGCCAA	0.617																																																	0																																												0																															22.37:g.49947591G>T				RNA	SNP	-	NULL	ENST00000391625.2	37	NULL		22																																																																																			RP1-29C18.10	-	-	ENSG00000212939		0.617	RP1-29C18.10-001	KNOWN	basic	antisense	ENSG00000212939	Clone_based_vega_gene	antisense	OTTHUMT00000317431.1	-	0.00	57	0	G			49947591	+1	tier1	-	no_errors	ENST00000391625	ensembl	human	known	74_37	rna	6.15	61	4	SNP	0.001	T
RP11-15H20.6	0	genome.wustl.edu	37	19	23444867	23444867	+	RNA	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:23444867C>T	ENST00000397094.1	-	0	569				RP11-15H20.7_ENST00000594653.1_lincRNA																							caatgcccagcgatgtcacaa	0.502																																																	0																																												0																															19.37:g.23444867C>T				RNA	SNP	-	NULL	ENST00000397094.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	C	4.543	0.100787	0.08731	.	.	ENSG00000213971	ENST00000397094	.	.	.	0.158	-0.317	0.12736	.	.	.	.	.	T	0.42698	0.1214	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48317	-0.9046	3	0.87932	D	0	.	.	.	.	.	.	.	.	T	138	.	ENSP00000380282:A138T	A	-	1	0	AC092329.1	23236707	0.050000	0.20438	0.038000	0.18304	0.038000	0.13279	-0.938000	0.03938	-1.029000	0.03317	-1.021000	0.02439	GCT	RP11-15H20.6	-	-	ENSG00000213971		0.502	RP11-15H20.6-009	KNOWN	basic	lincRNA	ENSG00000213971	Clone_based_vega_gene	processed_transcript	OTTHUMT00000465752.1	-	0.00	32	0	C			23444867	-1	tier1	-	no_errors	ENST00000397094	ensembl	human	known	74_37	rna	15.00	17	3	SNP	0.044	T
RPS7	6201	genome.wustl.edu	37	2	3628262	3628262	+	Intron	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:3628262C>G	ENST00000304921.5	+	7	671				SNORA73_ENST00000516722.1_RNA|RPS7_ENST00000403564.1_Intron|RPS7_ENST00000406376.1_Intron	NM_001011.3	NP_001002.1	P62081	RS7_HUMAN	ribosomal protein S7						cellular protein metabolic process (GO:0044267)|cytoplasmic translation (GO:0002181)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(2)|urinary_tract(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0963)|Epithelial(75;0.208)		GTCGTGAAGACTGCTGCAGAC	0.488																																																	0																																										SO:0001627	intron_variant	0				CCDS1648.1	2p25	2011-04-05			ENSG00000171863	ENSG00000171863		"""S ribosomal proteins"""	10440	protein-coding gene	gene with protein product		603658				8522193, 10625621	Standard	NM_001011		Approved	S7	uc002qxw.3	P62081	OTTHUMG00000090305	ENST00000304921.5:c.508-133C>G	2.37:g.3628262C>G			P23821|P24818|Q57Z92|Q6IPH1	RNA	SNP	-	NULL	ENST00000304921.5	37	NULL	CCDS1648.1	2																																																																																			SNORA73	-	-	ENSG00000252531		0.488	RPS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000252531	RFAM	protein_coding	OTTHUMT00000206667.1	-	0.00	42	0	C	NM_001011		3628262	+1	tier1	-	no_errors	ENST00000516722	ensembl	human	novel	74_37	rna	96.77	1	30	SNP	0.000	G
KCNC2	3747	genome.wustl.edu	37	12	75436195	75436196	+	3'UTR	DEL	GC	GC	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	GC	GC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:75436195_75436196delGC	ENST00000549446.1	-	0	3286_3287				RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000341669.3_Intron|RP11-81K13.1_ENST00000550049.1_RNA|RP11-81K13.1_ENST00000547040.1_RNA|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000550433.1_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	CTCCAATACAGCATTTTTGAAG	0.342																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*690GC>-	12.37:g.75436195_75436196delGC			B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	RNA	DEL	-	NULL	ENST00000549446.1	37	NULL	CCDS9007.1	12																																																																																			RP11-81K13.1	-	-	ENSG00000257434		0.342	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257434	Clone_based_vega_gene	protein_coding	OTTHUMT00000405581.2		0.00	34	0	GC	NM_153748		75436196	+1	tier1		no_errors	ENST00000547040	ensembl	human	known	74_37	rna	43.33	17	13	DEL	0.973:0.974	-
KCNC2	3747	genome.wustl.edu	37	12	75436199	75436200	+	3'UTR	INS	-	-	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:75436199_75436200insC	ENST00000549446.1	-	0	3282_3283				RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000341669.3_Intron|RP11-81K13.1_ENST00000550049.1_RNA|RP11-81K13.1_ENST00000547040.1_RNA|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000550433.1_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	AATACAGCATTTTTGAAGAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*686->G	12.37:g.75436199_75436200insC			B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	RNA	INS	-	NULL	ENST00000549446.1	37	NULL	CCDS9007.1	12																																																																																			RP11-81K13.1	-	-	ENSG00000257434		0.351	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257434	Clone_based_vega_gene	protein_coding	OTTHUMT00000405581.2		0.00	34	0	-	NM_153748		75436200	+1	tier1		no_errors	ENST00000547040	ensembl	human	known	74_37	rna	52.00	12	13	INS	0.933:0.875	C
KCNC2	3747	genome.wustl.edu	37	12	75436201	75436201	+	3'UTR	SNP	T	T	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:75436201T>G	ENST00000549446.1	-	0	3281				RP11-81K13.1_ENST00000549762.1_RNA|KCNC2_ENST00000341669.3_Intron|RP11-81K13.1_ENST00000550049.1_RNA|RP11-81K13.1_ENST00000547040.1_RNA|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|KCNC2_ENST00000550433.1_Intron	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	TACAGCATTTTTGAAGAAAAG	0.358																																																	0													51.0	50.0	50.0					12																	75436201		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*684A>C	12.37:g.75436201T>G			B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	RNA	SNP	-	NULL	ENST00000549446.1	37	NULL	CCDS9007.1	12																																																																																			RP11-81K13.1	-	-	ENSG00000257434		0.358	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257434	Clone_based_vega_gene	protein_coding	OTTHUMT00000405581.2	-	0.00	33	0	T	NM_153748		75436201	+1	tier1	-	no_errors	ENST00000547040	ensembl	human	known	74_37	rna	52.00	12	13	SNP	0.630	G
CRTC3	64784	genome.wustl.edu	37	15	91147582	91147582	+	Intron	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:91147582C>T	ENST00000268184.6	+	5	417				CTD-3065B20.3_ENST00000559839.1_RNA|CRTC3_ENST00000558619.1_Intron|CRTC3_ENST00000420329.2_Intron			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3						energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TGTGGATTGACTTCTTTTCCT	0.458			T	MAML2	salivary gland mucoepidermoid																																			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0													107.0	104.0	105.0					15																	91147582		2198	4298	6496	SO:0001627	intron_variant	0				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.414-35C>T	15.37:g.91147582C>T			Q6DK61|Q6DK62|Q8NF38|Q9H6U2	RNA	SNP	-	NULL	ENST00000268184.6	37	NULL	CCDS32331.1	15																																																																																			CTD-3065B20.3	-	-	ENSG00000259314		0.458	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000259314	Clone_based_vega_gene	protein_coding	OTTHUMT00000417716.2	-	0.00	62	0	C	NM_022769		91147582	-1	tier1	-	no_errors	ENST00000559839	ensembl	human	known	74_37	rna	32.67	68	33	SNP	0.016	T
UCKL1	54963	genome.wustl.edu	37	20	62585043	62585044	+	Intron	INS	-	-	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:62585043_62585044insA	ENST00000354216.6	-	1	156				UCKL1_ENST00000358711.3_Intron|UCKL1_ENST00000369892.3_Intron|UCKL1_ENST00000369908.5_5'Flank|AL118506.1_ENST00000595604.1_Frame_Shift_Ins_p.Q13fs	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1						CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					actctatctccaaaaaaaaaag	0.545																																																	0																																										SO:0001627	intron_variant	0			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.113+2568->T	20.37:g.62585053_62585053dupA			B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Frame_Shift_Ins	INS	NULL	p.K17fs	ENST00000354216.6	37	c.37_38	CCDS13547.1	20																																																																																			AL118506.1	-	NULL	ENSG00000267848		0.545	UCKL1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000267848	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000080236.1		0.00	19	0	-	NM_017859		62585044	+1	tier1		no_errors	ENST00000595604	ensembl	human	known	74_37	frame_shift_ins	10.34	52	6	INS	0.023:0.024	A
DPH5	51611	genome.wustl.edu	37	1	101456193	101456193	+	Intron	DEL	A	A	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:101456193delA	ENST00000370109.3	-	8	747				AC093157.1_ENST00000593496.1_Frame_Shift_Del_p.K65fs|DPH5_ENST00000488176.1_Intron|DPH5_ENST00000370105.3_Intron|DPH5_ENST00000342173.7_Intron|DPH5_ENST00000427040.2_Intron	NM_001077394.1|NM_001077395.1|NM_015958.2	NP_001070862.1|NP_001070863.1|NP_057042.2	Q9H2P9	DPH5_HUMAN	diphthamide biosynthesis 5						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		diphthine synthase activity (GO:0004164)			endometrium(2)|large_intestine(1)|lung(4)	7		all_epithelial(167;3.1e-06)|all_lung(203;0.000414)|Lung NSC(277;0.000946)		Epithelial(280;0.0385)|all cancers(265;0.043)|COAD - Colon adenocarcinoma(174;0.151)|Colorectal(144;0.173)|Lung(183;0.198)		AACTGCTATTAAAAAAAAAAG	0.413																																																	0									,,	118,28,3432		2,0,114,1,26,1646	39.0	39.0	39.0		,,	0.1	0.9	1		41	13,69,7776		1,0,11,0,69,3848	no	intron,intron,intron	DPH5	NM_015958.2,NM_001077395.1,NM_001077394.1	,,	3,0,125,1,95,5494	A1A1,A1A2,A1R,A2A2,A2R,RR		1.0435,4.0805,1.9937	,,	,,	101456193	131,97,11208	1860	4106	5966	SO:0001627	intron_variant	0			AF132964	CCDS41358.1, CCDS41359.1	1p21.2	2013-05-02	2013-05-02		ENSG00000117543	ENSG00000117543			24270	protein-coding gene	gene with protein product		611075	"""DPH5 homolog (S. cerevisiae)"""			15485916, 23486472	Standard	NM_015958		Approved	CGI-30	uc001dtt.2	Q9H2P9	OTTHUMG00000010829	ENST00000370109.3:c.635-6T>-	1.37:g.101456193delA			A8JZY6|D3DT62|Q9P017|Q9P0I4|Q9Y319	Frame_Shift_Del	DEL	NULL	p.R66fs	ENST00000370109.3	37	c.187	CCDS41358.1	1																																																																																			AC093157.1	-	NULL	ENSG00000269175		0.413	DPH5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000269175	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000029881.1		0.00	38	0	A	NM_015958		101456193	+1	tier1		no_errors	ENST00000593496	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	0.002	-
SRP19	6728	genome.wustl.edu	37	5	112196886	112196886	+	5'Flank	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:112196886A>G	ENST00000505459.1	+	0	0				CTC-554D6.1_ENST00000520401.1_Intron|SRP19_ENST00000515463.1_5'Flank|CTC-487M23.8_ENST00000506997.1_5'Flank|SRP19_ENST00000282999.3_5'Flank	NM_001204193.1|NM_003135.2	NP_001191122.1|NP_003126.1	P09132	SRP19_HUMAN	signal recognition particle 19kDa						cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|large_intestine(1)	3		all_cancers(142;0.00328)|all_epithelial(76;6.39e-05)|Prostate(80;0.00174)|Colorectal(10;0.00372)|Ovarian(225;0.156)		Epithelial(69;1.7e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.17e-08)|all cancers(49;3.96e-07)|Colorectal(14;0.0056)|COAD - Colon adenocarcinoma(37;0.0104)		GTCAGAGACTAGAGATCCTGG	0.577																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS4108.1, CCDS56375.1, CCDS56376.1, CCDS75286.1	5q21-q22	2008-07-18	2002-08-29		ENSG00000153037	ENSG00000153037			11300	protein-coding gene	gene with protein product		182175	"""signal recognition particle 19kD"""			2460823	Standard	NM_003135		Approved		uc011cvu.2	P09132	OTTHUMG00000128805		5.37:g.112196886A>G	Exception_encountered		B2R4E9|D6RCQ5|Q05D77|Q96FG6	RNA	SNP	-	NULL	ENST00000505459.1	37	NULL	CCDS4108.1	5																																																																																			CTC-487M23.8	-	-	ENSG00000272869		0.577	SRP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272869	Clone_based_vega_gene	protein_coding	OTTHUMT00000250737.3	-	0.00	54	0	A	NM_003135		112196886	+1	tier1	-	no_errors	ENST00000503445	ensembl	human	known	74_37	rna	47.37	20	18	SNP	0.000	G
EPB41L1	2036	genome.wustl.edu	37	20	34778583	34778583	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:34778583G>T	ENST00000338074.2	+	11	1325	c.1164G>T	c.(1162-1164)gtG>gtT	p.V388V	EPB41L1_ENST00000441639.1_Silent_p.V326V|EPB41L1_ENST00000373941.1_Silent_p.V388V|EPB41L1_ENST00000373950.2_Silent_p.V291V|EPB41L1_ENST00000202028.5_Silent_p.V326V|EPB41L1_ENST00000373946.3_Silent_p.V357V	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	388					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					GCTTCCTGGTGATGGGCTCCA	0.637																																																	0													41.0	41.0	41.0					20																	34778583		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.1164G>T	20.37:g.34778583G>T			O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	pfam_Band_4.1_C,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_SAB_dom,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pirsf_Band_41_protein,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V388	ENST00000338074.2	37	c.1164	CCDS13271.1	20																																																																																			EPB41L1	-	pfam_FERM-adjacent,pirsf_Band_41_protein	ENSG00000088367		0.637	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L1	HGNC	protein_coding	OTTHUMT00000078978.3		0.00	40	0	G	NM_012156		34778583	+1			no_errors	ENST00000338074	ensembl	human	known	74_37	silent	5.63	67	4	SNP	1.000	T
EPHB6	2051	genome.wustl.edu	37	7	142562397	142562398	+	Frame_Shift_Ins	INS	-	-	C	rs145544148		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:142562397_142562398insC	ENST00000392957.2	+	7	1626_1627	c.839_840insC	c.(838-843)agccccfs	p.SP280fs	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Frame_Shift_Ins_p.SP280fs	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	280	Cys-rich.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					GCAGGAGGCAGCCCCCCCAGGC	0.688																																																	0																																										SO:0001589	frameshift_variant	0			D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.846dupC	7.37:g.142562404_142562404dupC	ENSP00000376684:p.Ser280fs		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Frame_Shift_Ins	INS	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R283fs	ENST00000392957.2	37	c.839_840	CCDS5873.2	7																																																																																			EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000106123		0.688	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1		0.00	24	0	-			142562398	+1	tier1		no_errors	ENST00000392957	ensembl	human	known	74_37	frame_shift_ins	5.26	36	2	INS	0.980:0.997	C
EXOSC7	23016	genome.wustl.edu	37	3	45046822	45046822	+	Silent	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:45046822G>A	ENST00000265564.7	+	6	579	c.531G>A	c.(529-531)tcG>tcA	p.S177S	CLEC3B_ENST00000490386.1_Intron|EXOSC7_ENST00000461361.1_3'UTR	NM_015004.3	NP_055819.2	Q15024	EXOS7_HUMAN	exosome component 7	177					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(193;0.00911)|KIRC - Kidney renal clear cell carcinoma(197;0.0509)|Kidney(197;0.064)		AAGAGGGGTCGAAGGACATTG	0.423																																																	0													259.0	226.0	237.0					3																	45046822		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012831	CCDS2725.1	3p21.32	2010-05-07			ENSG00000075914	ENSG00000075914	3.1.13.-		28112	protein-coding gene	gene with protein product		606488				11719186, 11812149	Standard	NR_023353		Approved	hRrp42p, Rrp42p, RRP42, EAP1, KIAA0116, p8	uc003coi.2	Q15024	OTTHUMG00000133095	ENST00000265564.7:c.531G>A	3.37:g.45046822G>A			Q96E72	Silent	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.S177	ENST00000265564.7	37	c.531	CCDS2725.1	3																																																																																			EXOSC7	-	NULL	ENSG00000075914		0.423	EXOSC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC7	HGNC	protein_coding	OTTHUMT00000256754.2	-	0.00	48	0	G	NM_015004		45046822	+1	tier1	-	no_errors	ENST00000265564	ensembl	human	known	74_37	silent	61.29	24	38	SNP	0.004	A
FAAH2	158584	genome.wustl.edu	37	X	57458421	57458421	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chrX:57458421C>G	ENST00000374900.4	+	8	1187	c.1067C>G	c.(1066-1068)tCt>tGt	p.S356C	FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	356						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						ATGAAGTACTCTTTTCAGTTG	0.328										HNSCC(52;0.14)																																							0													120.0	96.0	104.0					X																	57458421		2203	4300	6503	SO:0001583	missense	0			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.1067C>G	X.37:g.57458421C>G	ENSP00000364035:p.Ser356Cys		Q86VT2|Q96N98	Missense_Mutation	SNP	pfam_Amidase,superfamily_Amidase_dom	p.S356C	ENST00000374900.4	37	c.1067	CCDS14375.1	X	.	.	.	.	.	.	.	.	.	.	c	14.70	2.614912	0.46631	.	.	ENSG00000165591	ENST00000374900	T	0.55413	0.52	2.39	2.39	0.29439	Amidase signature domain (2);	0.266617	0.30068	U	0.010487	T	0.65196	0.2668	M	0.79926	2.475	0.38738	D	0.953826	D	0.57571	0.98	P	0.58520	0.84	T	0.69745	-0.5062	10	0.72032	D	0.01	.	8.2058	0.31454	0.0:1.0:0.0:0.0	.	356	Q6GMR7	FAAH2_HUMAN	C	356	ENSP00000364035:S356C	ENSP00000364035:S356C	S	+	2	0	FAAH2	57475146	0.999000	0.42202	0.996000	0.52242	0.971000	0.66376	1.719000	0.38011	0.945000	0.37605	0.462000	0.41574	TCT	FAAH2	-	pfam_Amidase,superfamily_Amidase_dom	ENSG00000165591		0.328	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	-	0.00	16	0	C	NM_174912		57458421	+1	tier1	-	no_errors	ENST00000374900	ensembl	human	known	74_37	missense	26.14	65	23	SNP	1.000	G
FAM13A	10144	genome.wustl.edu	37	4	89772174	89772174	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:89772174G>T	ENST00000264344.5	-	7	1211	c.1004C>A	c.(1003-1005)cCc>cAc	p.P335H	FAM13A_ENST00000511976.1_Intron|FAM13A_ENST00000502459.1_5'UTR	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	335					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						TGCCAACCTGGGTACCAACTT	0.438																																																	0													163.0	162.0	162.0					4																	89772174		2203	4300	6503	SO:0001583	missense	0			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1004C>A	4.37:g.89772174G>T	ENSP00000264344:p.Pro335His		B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P335H	ENST00000264344.5	37	c.1004	CCDS34029.1	4	.	.	.	.	.	.	.	.	.	.	G	4.324	0.059513	0.08339	.	.	ENSG00000138640	ENST00000264344	T	0.62639	0.01	4.33	3.47	0.39725	.	0.667233	0.14682	N	0.304689	T	0.41743	0.1172	N	0.14661	0.345	0.80722	D	1	B	0.30664	0.289	B	0.23150	0.044	T	0.37641	-0.9697	10	0.46703	T	0.11	.	10.3392	0.43868	0.0:0.199:0.801:0.0	.	335	O94988	FA13A_HUMAN	H	335	ENSP00000264344:P335H	ENSP00000264344:P335H	P	-	2	0	FAM13A	89991197	0.949000	0.32298	0.882000	0.34594	0.264000	0.26372	1.349000	0.33998	1.398000	0.46701	0.650000	0.86243	CCC	FAM13A	-	NULL	ENSG00000138640		0.438	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	HGNC	protein_coding	OTTHUMT00000363371.1		0.00	29	0	G			89772174	-1			no_errors	ENST00000264344	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.879	T
FAM13B	51306	genome.wustl.edu	37	5	137323168	137323168	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:137323168C>A	ENST00000033079.3	-	9	1479	c.1028G>T	c.(1027-1029)gGg>gTg	p.G343V	FAM13B_ENST00000425075.2_Missense_Mutation_p.G225V|FAM13B_ENST00000420893.2_Missense_Mutation_p.G343V	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	343					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AGATCCTTCCCCATCACAATG	0.299																																																	0													102.0	87.0	92.0					5																	137323168		2202	4300	6502	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1028G>T	5.37:g.137323168C>A	ENSP00000033079:p.Gly343Val		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.G343V	ENST00000033079.3	37	c.1028	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	13.85	2.359863	0.41801	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.22539	3.05;1.95;3.05	5.9	4.99	0.66335	.	0.630590	0.16709	N	0.202774	T	0.15955	0.0384	L	0.36672	1.1	0.45747	D	0.998642	B;B;B	0.30361	0.277;0.13;0.09	B;B;B	0.32289	0.143;0.136;0.068	T	0.08932	-1.0698	10	0.30854	T	0.27	-3.4911	5.8415	0.18637	0.0:0.6824:0.0:0.3176	.	225;343;343	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	V	343;225;343	ENSP00000033079:G343V;ENSP00000394669:G225V;ENSP00000388521:G343V	ENSP00000033079:G343V	G	-	2	0	FAM13B	137351067	0.973000	0.33851	1.000000	0.80357	0.995000	0.86356	0.962000	0.29280	1.366000	0.46076	0.650000	0.86243	GGG	FAM13B	-	NULL	ENSG00000031003		0.299	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1		0.00	23	0	C			137323168	-1			no_errors	ENST00000033079	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
FAM72B	653820	genome.wustl.edu	37	1	120839839	120839839	+	Silent	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:120839839T>C	ENST00000369390.3	+	1	835	c.6T>C	c.(4-6)tcT>tcC	p.S2S	RP11-439A17.7_ENST00000412759.1_RNA|FAM72B_ENST00000355228.4_Silent_p.S2S|FAM72B_ENST00000471903.2_Intron	NM_001100910.1	NP_001094380.1	Q86X60	FA72B_HUMAN	family with sequence similarity 72, member B	2										large_intestine(1)|lung(2)	3	all_neural(166;0.181)	all_lung(203;7.27e-05)|Lung NSC(69;0.000389)|all_epithelial(167;0.068)		Lung(183;0.0327)|LUSC - Lung squamous cell carcinoma(189;0.19)		ACGCCATGTCTACCAACATTT	0.443																																																	0													6.0	7.0	7.0					1																	120839839		1624	3651	5275	SO:0001819	synonymous_variant	0			AL357493	CCDS72848.1	1p12	2014-05-06			ENSG00000188610	ENSG00000188610			24805	protein-coding gene	gene with protein product		614711					Standard	NM_001100910		Approved	RP11-439A17.6	uc009whp.3	Q86X60	OTTHUMG00000185025	ENST00000369390.3:c.6T>C	1.37:g.120839839T>C			B2RPQ5|Q5QP15	Silent	SNP	NULL	p.S2	ENST00000369390.3	37	c.6	CCDS41374.1	1																																																																																			FAM72B	-	NULL	ENSG00000188610		0.443	FAM72B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM72B	HGNC	protein_coding	OTTHUMT00000098437.1		0.00	27	0	T			120839839	+1			no_errors	ENST00000369390	ensembl	human	known	74_37	silent	7.32	38	3	SNP	1.000	C
FCRLB	127943	genome.wustl.edu	37	1	161695655	161695655	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:161695655G>T	ENST00000367948.2	+	6	567	c.352G>T	c.(352-354)Gag>Tag	p.E118*	FCRLB_ENST00000367944.3_Nonsense_Mutation_p.E111*|FCRLB_ENST00000367946.3_Nonsense_Mutation_p.E118*|FCRLB_ENST00000392158.1_Nonsense_Mutation_p.E118*|FCRLB_ENST00000367945.1_Nonsense_Mutation_p.E111*|FCRLB_ENST00000336830.5_Nonsense_Mutation_p.E118*			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	118	Ig-like C2-type 2.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			GTTCGAGGGTGAGCCGCTAGT	0.602																																																	0													87.0	82.0	83.0					1																	161695655		2203	4300	6503	SO:0001587	stop_gained	0			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.352G>T	1.37:g.161695655G>T	ENSP00000356925:p.Glu118*		A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Nonsense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.E118*	ENST00000367948.2	37	c.352	CCDS30927.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.503652	0.98325	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	.	.	.	4.51	4.51	0.55191	.	0.242590	0.28600	N	0.014771	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.7124	0.57098	0.0:0.0:1.0:0.0	.	.	.	.	X	118;118;111;118;111;118	.	ENSP00000338598:E118X	E	+	1	0	FCRLB	159962279	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	4.659000	0.61504	2.038000	0.60285	0.455000	0.32223	GAG	FCRLB	-	smart_Ig_sub	ENSG00000162746		0.602	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRLB	HGNC	protein_coding	OTTHUMT00000083585.1		0.00	64	0	G	NM_152378		161695655	+1			no_errors	ENST00000367948	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
FERMT1	55612	genome.wustl.edu	37	20	6065919	6065919	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:6065919G>C	ENST00000217289.4	-	12	2175	c.1387C>G	c.(1387-1389)Caa>Gaa	p.Q463E	FERMT1_ENST00000536936.1_Missense_Mutation_p.Q206E|FERMT1_ENST00000478194.1_5'UTR	NM_017671.4	NP_060141.3	Q9BQL6	FERM1_HUMAN	fermitin family member 1	463	FERM.|PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell adhesion (GO:0007155)|establishment of epithelial cell polarity (GO:0090162)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	17						GCCATCCATTGGGCGTATTGA	0.527																																																	0													68.0	58.0	61.0					20																	6065919		2203	4300	6503	SO:0001583	missense	0			AK000123	CCDS13098.1	20p12.3	2013-01-10	2010-06-24	2007-12-14	ENSG00000101311	ENSG00000101311		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	15889	protein-coding gene	gene with protein product	"""kindlin-1"", ""kinderlin"""	607900	"""chromosome 20 open reading frame 42"", ""fermitin family homolog 1 (Drosophila)"""	C20orf42		12697302, 12789646	Standard	NM_017671		Approved	FLJ20116, URP1, KIND1, UNC112A	uc002wmr.3	Q9BQL6	OTTHUMG00000031826	ENST00000217289.4:c.1387C>G	20.37:g.6065919G>C	ENSP00000217289:p.Gln463Glu		D3DW10|Q8IX34|Q8IYH2|Q9NWM2|Q9NXQ3	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q463E	ENST00000217289.4	37	c.1387	CCDS13098.1	20	.	.	.	.	.	.	.	.	.	.	g	8.820	0.937248	0.18206	.	.	ENSG00000101311	ENST00000217289;ENST00000536936;ENST00000339538	D;D	0.95656	-3.77;-3.77	5.25	0.0791	0.14414	Band 4.1 domain (1);FERM central domain (2);Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.366612	0.29307	N	0.012539	D	0.89842	0.6832	L	0.27053	0.805	0.19775	N	0.999951	B	0.16603	0.018	B	0.25987	0.065	T	0.80957	-0.1150	10	0.37606	T	0.19	0.2563	9.4439	0.38686	0.0739:0.0:0.4127:0.5134	.	463	Q9BQL6	FERM1_HUMAN	E	463;206;463	ENSP00000217289:Q463E;ENSP00000441063:Q206E	ENSP00000217289:Q463E	Q	-	1	0	FERMT1	6013919	0.977000	0.34250	0.312000	0.25196	0.856000	0.48823	2.145000	0.42207	0.260000	0.21731	-0.322000	0.08575	CAA	FERMT1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000101311		0.527	FERMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERMT1	HGNC	protein_coding	OTTHUMT00000077908.2	-	0.00	44	0	G	NM_017671		6065919	-1	tier1	-	no_errors	ENST00000217289	ensembl	human	known	74_37	missense	19.67	49	12	SNP	0.337	C
GABRG1	2565	genome.wustl.edu	37	4	46060358	46060358	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:46060358delA	ENST00000295452.4	-	7	959	c.792delT	c.(790-792)tttfs	p.F264fs		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	264					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.F264fs*3(1)		breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TGCTCAGGTCAAAAAAAATTG	0.294																																																	1	Deletion - Frameshift(1)	large_intestine(1)											94.0	97.0	96.0					4																	46060358		2203	4300	6503	SO:0001589	frameshift_variant	0			BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.792delT	4.37:g.46060358delA	ENSP00000295452:p.Phe264fs		Q5H9T8	Frame_Shift_Del	DEL	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg1_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F264fs	ENST00000295452.4	37	c.792	CCDS3470.1	4																																																																																			GABRG1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000163285		0.294	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG1	HGNC	protein_coding	OTTHUMT00000250470.1		0.00	39	0	A	NM_173536		46060358	-1	tier1		no_errors	ENST00000295452	ensembl	human	known	74_37	frame_shift_del	8.33	33	3	DEL	1.000	-
GALNT5	11227	genome.wustl.edu	37	2	158115477	158115477	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:158115477G>T	ENST00000259056.4	+	1	1368	c.883G>T	c.(883-885)Gag>Tag	p.E295*		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	295					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						ATCTATTAATGAGACACCTTT	0.388																																																	0													69.0	73.0	72.0					2																	158115477		2203	4300	6503	SO:0001587	stop_gained	0			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.883G>T	2.37:g.158115477G>T	ENSP00000259056:p.Glu295*		A5PKZ1|Q9UGK7|Q9UHL6	Nonsense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E295*	ENST00000259056.4	37	c.883	CCDS2203.1	2	.	.	.	.	.	.	.	.	.	.	G	42	9.725077	0.99248	.	.	ENSG00000136542	ENST00000259056	.	.	.	5.52	3.72	0.42706	.	1.743380	0.03824	N	0.268052	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	11.1054	0.48199	0.1531:0.0:0.8469:0.0	.	.	.	.	X	295	.	ENSP00000259056:E295X	E	+	1	0	GALNT5	157823723	0.302000	0.24454	0.831000	0.32960	0.701000	0.40568	1.287000	0.33284	0.805000	0.34159	0.561000	0.74099	GAG	GALNT5	-	NULL	ENSG00000136542		0.388	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT5	HGNC	protein_coding	OTTHUMT00000254925.2	-	0.00	37	0	G	NM_014568		158115477	+1	tier1	-	no_errors	ENST00000259056	ensembl	human	known	74_37	nonsense	9.30	39	4	SNP	0.943	T
GID8	54994	genome.wustl.edu	37	20	61572954	61572954	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:61572954A>T	ENST00000266069.3	+	2	247	c.100A>T	c.(100-102)Atg>Ttg	p.M34L		NM_017896.2	NP_060366.1	Q9NWU2	GID8_HUMAN	GID complex subunit 8	34	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.					cell junction (GO:0030054)|nucleus (GO:0005634)											CCGCCTCATCATGAACTACCT	0.438																																																	0													100.0	97.0	98.0					20																	61572954		2203	4300	6503	SO:0001583	missense	0			AK000609	CCDS13510.1	20q13.33	2013-07-31	2013-07-31	2012-07-20	ENSG00000101193	ENSG00000101193			15857	protein-coding gene	gene with protein product		611625	"""chromosome 20 open reading frame 11"", ""GID complex subunit 8 homolog (S. cerevisiae)"""	C20orf11		12559565	Standard	NM_017896		Approved	FLJ20602, bA305P22.1, TWA1	uc002ydy.3	Q9NWU2	OTTHUMG00000032949	ENST00000266069.3:c.100A>T	20.37:g.61572954A>T	ENSP00000266069:p.Met34Leu		E1P5I3|Q8N5M5	Missense_Mutation	SNP	pfam_CTLH/CRA,pfam_LisH_dimerisation_subgr,smart_LisH_dimerisation,smart_CTLH_C,smart_CRA_dom,pfscan_LisH_dimerisation,pfscan_CTLH_C	p.M34L	ENST00000266069.3	37	c.100	CCDS13510.1	20	.	.	.	.	.	.	.	.	.	.	A	27.2	4.805630	0.90623	.	.	ENSG00000101193	ENST00000266069;ENST00000412152	T	0.74209	-0.82	5.61	5.61	0.85477	LisH dimerisation motif (2);LisH dimerisation motif, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.76821	0.4041	L	0.55990	1.75	0.80722	D	1	P	0.50617	0.937	P	0.49276	0.605	T	0.78432	-0.2206	10	0.51188	T	0.08	-31.6553	15.7896	0.78343	1.0:0.0:0.0:0.0	.	34	Q9NWU2	CT011_HUMAN	L	34	ENSP00000266069:M34L	ENSP00000266069:M34L	M	+	1	0	C20orf11	61043399	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.882000	0.92420	2.141000	0.66446	0.491000	0.48974	ATG	GID8	-	pfam_LisH_dimerisation_subgr,smart_LisH_dimerisation,pfscan_LisH_dimerisation	ENSG00000101193		0.438	GID8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GID8	HGNC	protein_coding	OTTHUMT00000080097.2	-	0.00	59	0	A	NM_017896		61572954	+1	tier1	-	no_errors	ENST00000266069	ensembl	human	known	74_37	missense	50.42	59	60	SNP	1.000	T
GJB7	375519	genome.wustl.edu	37	6	87994440	87994440	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:87994440C>T	ENST00000525899.1	-	3	536	c.191G>A	c.(190-192)tGt>tAt	p.C64Y	GJB7_ENST00000296882.3_Missense_Mutation_p.C64Y	NM_198568.2	NP_940970.1	Q6PEY0	CXB7_HUMAN	gap junction protein, beta 7, 25kDa	64					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)	5		all_cancers(76;1.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;7.38e-10)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00323)		BRCA - Breast invasive adenocarcinoma(108;0.0167)		GTCATCAAAACACACATTTTT	0.463																																																	0													121.0	111.0	114.0					6																	87994440		2203	4300	6503	SO:0001583	missense	0			AJ414563	CCDS5008.1	6q15	2008-02-05	2007-11-06			ENSG00000164411		"""Ion channels / Gap junction proteins (connexins)"""	16690	protein-coding gene	gene with protein product	"""connexin 25"""	611921	"""gap junction protein, beta 7"""				Standard	NM_198568		Approved	CX25, bA136M9.1	uc003plo.2	Q6PEY0		ENST00000525899.1:c.191G>A	6.37:g.87994440C>T	ENSP00000435355:p.Cys64Tyr		B3KXL0|Q96KP0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.C64Y	ENST00000525899.1	37	c.191	CCDS5008.1	6	.	.	.	.	.	.	.	.	.	.	C	15.40	2.823288	0.50739	.	.	ENSG00000164411	ENST00000525899;ENST00000296882;ENST00000369576	D;D;D	0.99745	-6.61;-6.61;-6.61	4.84	4.84	0.62591	Connexin, N-terminal (2);	0.000000	0.85682	U	0.000000	D	0.99816	0.9919	H	0.94698	3.57	0.54753	D	0.999982	D	0.89917	1.0	D	0.97110	1.0	D	0.96804	0.9591	10	0.87932	D	0	.	16.5201	0.84311	0.0:1.0:0.0:0.0	.	64	Q6PEY0	CXB7_HUMAN	Y	64	ENSP00000435355:C64Y;ENSP00000296882:C64Y;ENSP00000358589:C64Y	ENSP00000296882:C64Y	C	-	2	0	GJB7	88051159	1.000000	0.71417	1.000000	0.80357	0.152000	0.21847	7.317000	0.79018	2.227000	0.72691	0.561000	0.74099	TGT	GJB7	-	pfam_Connexin_N,smart_Connexin_N,prints_Connexin	ENSG00000164411		0.463	GJB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB7	HGNC	protein_coding	OTTHUMT00000394780.1	-	0.00	37	0	C			87994440	-1	tier1	-	no_errors	ENST00000296882	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	T
GK5	256356	genome.wustl.edu	37	3	141923397	141923397	+	Intron	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:141923397T>C	ENST00000392993.2	-	4	563				GK5_ENST00000466685.3_5'UTR|GK5_ENST00000544571.1_Intron	NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)						glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						TTGGCTATTATTAAACTTCAC	0.378																																																	0																																										SO:0001627	intron_variant	0			BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.411+139A>G	3.37:g.141923397T>C			B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	RNA	SNP	-	NULL	ENST00000392993.2	37	NULL	CCDS33871.1	3																																																																																			GK5	-	-	ENSG00000175066		0.378	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK5	HGNC	protein_coding	OTTHUMT00000353999.1	-	0.00	60	0	T	NM_001039547		141923397	-1	tier1	-	no_errors	ENST00000466685	ensembl	human	known	74_37	rna	89.58	10	86	SNP	0.000	C
GLB1L2	89944	genome.wustl.edu	37	11	134240261	134240261	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:134240261T>C	ENST00000535456.2	+	12	1371	c.1183T>C	c.(1183-1185)Tct>Cct	p.S395P	GLB1L2_ENST00000339772.7_Missense_Mutation_p.S395P|GLB1L2_ENST00000389881.3_Missense_Mutation_p.S395P|GLB1L2_ENST00000529077.1_3'UTR	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	395					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		CTTGTACCTGTCTCTGTGGGA	0.607																																																	0													203.0	170.0	181.0					11																	134240261		2201	4297	6498	SO:0001583	missense	0				CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.1183T>C	11.37:g.134240261T>C	ENSP00000444628:p.Ser395Pro		A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.S395P	ENST00000535456.2	37	c.1183	CCDS31724.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	5.629|5.629	0.300813|0.300813	0.10678|0.10678	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881|ENST00000525089	D;D;D|.	0.97378|.	-4.36;-4.36;-4.36|.	5.06|5.06	2.79|2.79	0.32731|0.32731	.|.	0.064380|.	0.64402|.	D|.	0.000004|.	T|T	0.42698|0.42698	0.1214|0.1214	L|L	0.33710|0.33710	1.025|1.025	0.46131|0.46131	D|D	0.998888|0.998888	B|.	0.18166|.	0.026|.	B|.	0.15484|.	0.013|.	T|T	0.17899|0.17899	-1.0354|-1.0354	10|5	0.17832|.	T|.	0.49|.	-22.1455|-22.1455	5.5552|5.5552	0.17113|0.17113	0.0:0.2888:0.0:0.7112|0.0:0.2888:0.0:0.7112	.|.	395|.	Q8IW92|.	GLBL2_HUMAN|.	P|A	395|333	ENSP00000344659:S395P;ENSP00000444628:S395P;ENSP00000374531:S395P|.	ENSP00000344659:S395P|.	S|V	+|+	1|2	0|0	GLB1L2|GLB1L2	133745471|133745471	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.222000|0.222000	0.24845|0.24845	2.243000|2.243000	0.43115|0.43115	1.032000|1.032000	0.39892|0.39892	0.523000|0.523000	0.50628|0.50628	TCT|GTC	GLB1L2	-	NULL	ENSG00000149328		0.607	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L2	HGNC	protein_coding	OTTHUMT00000393629.2	-	0.00	82	0	T	NM_138342		134240261	+1	tier1	-	no_errors	ENST00000339772	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	C
GOLGA6L17P	642402	genome.wustl.edu	37	15	85053137	85053137	+	RNA	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:85053137C>T	ENST00000414190.2	-	0	315					NR_003246.2																						TTTTTTTTTTCAATTCCTTGA	0.398																																																	0																																												0																															15.37:g.85053137C>T				RNA	SNP	-	NULL	ENST00000414190.2	37	NULL		15																																																																																			GOLGA6L5	-	-	ENSG00000230373		0.398	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	GOLGA6L5	HGNC	pseudogene	OTTHUMT00000418579.1	-	0.00	75	0	C			85053137	-1	tier1	-	no_errors	ENST00000414190	ensembl	human	known	74_37	rna	7.38	138	11	SNP	0.120	T
GPR158	57512	genome.wustl.edu	37	10	25887177	25887177	+	Silent	SNP	G	G	T	rs567691480	byFrequency	TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:25887177G>T	ENST00000376351.3	+	11	2981	c.2622G>T	c.(2620-2622)ccG>ccT	p.P874P	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	874					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						AGTCGGTGCCGTTGGTGTGCA	0.483																																																	0													89.0	92.0	91.0					10																	25887177		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.2622G>T	10.37:g.25887177G>T			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.P874	ENST00000376351.3	37	c.2622	CCDS31166.1	10																																																																																			GPR158	-	NULL	ENSG00000151025		0.483	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2		0.00	51	0	G	XM_166110		25887177	+1			no_errors	ENST00000376351	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.001	T
GPR98	84059	genome.wustl.edu	37	5	90001286	90001286	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:90001286G>T	ENST00000405460.2	+	37	8552	c.8456G>T	c.(8455-8457)aGt>aTt	p.S2819I		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2819	Calx-beta 20. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.S2819I(1)		NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTAGAAGCCAGTGATGAACCA	0.413																																																	1	Substitution - Missense(1)	lung(1)											192.0	182.0	185.0					5																	90001286		1934	4156	6090	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8456G>T	5.37:g.90001286G>T	ENSP00000384582:p.Ser2819Ile		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.S2819I	ENST00000405460.2	37	c.8456	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.079860|5.079860	0.94050|0.94050	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.31247|.	1.5|.	5.78|5.78	5.78|5.78	0.91487|0.91487	Na-Ca exchanger/integrin-beta4 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83487|0.83487	0.5265|0.5265	M|M	0.84511|0.84511	2.7|2.7	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	D|D	0.84040|0.84040	0.0364|0.0364	10|5	0.87932|.	D|.	0|.	.|.	20.0204|20.0204	0.97499|0.97499	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	2819;2819|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	I|L	2819|385	ENSP00000384582:S2819I|.	ENSP00000296619:S2819I|.	S|V	+|+	2|1	0|0	GPR98|GPR98	90037042|90037042	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.962000|0.962000	0.63368|0.63368	9.248000|9.248000	0.95456|0.95456	2.729000|2.729000	0.93468|0.93468	0.650000|0.650000	0.86243|0.86243	AGT|GTG	GPR98	-	smart_Calx_beta	ENSG00000164199		0.413	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2		0.00	30	0	G	NM_032119		90001286	+1			no_errors	ENST00000405460	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
GRM3	2913	genome.wustl.edu	37	7	86274134	86274134	+	5'UTR	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:86274134G>A	ENST00000361669.2	+	0	905				GRM3_ENST00000394720.2_5'Flank|GRM3_ENST00000546348.1_Missense_Mutation_p.A16T|GRM3_ENST00000536043.1_Silent_p.P10P|GRM3_ENST00000439827.1_5'Flank	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					CAGGCTCACCGCCGCCGCTGC	0.627																																					GBM(52;969 1098 3139 52280)												0																																										SO:0001623	5_prime_UTR_variant	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.-195G>A	7.37:g.86274134G>A			Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt	p.A16T	ENST00000361669.2	37	c.46	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	11.03	1.520003	0.27211	.	.	ENSG00000198822	ENST00000546348	D	0.87966	-2.32	5.3	2.53	0.30540	.	.	.	.	.	T	0.80592	0.4652	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.72257	-0.4346	8	0.62326	D	0.03	.	7.3728	0.26810	0.2751:0.0:0.7249:0.0	.	16	B7Z204	.	T	16	ENSP00000444064:A16T	ENSP00000444064:A16T	A	+	1	0	GRM3	86112070	0.844000	0.29557	0.955000	0.39395	0.940000	0.58332	0.342000	0.19926	0.244000	0.21351	0.655000	0.94253	GCC	GRM3	-	NULL	ENSG00000198822		0.627	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	-	0.00	41	0	G			86274134	+1	tier1	-	no_errors	ENST00000546348	ensembl	human	known	74_37	missense	23.21	43	13	SNP	0.992	A
HERC4	26091	genome.wustl.edu	37	10	69834989	69834989	+	5'UTR	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:69834989G>T	ENST00000395198.3	-	0	51				HERC4_ENST00000412272.2_5'UTR|HERC4_ENST00000395187.2_5'Flank|HERC4_ENST00000373700.4_5'UTR|HERC4_ENST00000492996.2_5'UTR	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4						cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ggaagaacgggaggcaagcgg	0.662																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.-197C>A	10.37:g.69834989G>T			Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	RNA	SNP	-	NULL	ENST00000395198.3	37	NULL	CCDS41533.1	10																																																																																			HERC4	-	-	ENSG00000148634		0.662	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1	-	0.00	83	0	G	NM_015601		69834989	-1	tier1	-	no_errors	ENST00000395185	ensembl	human	known	74_37	rna	54.76	38	46	SNP	0.013	T
HIF3A	64344	genome.wustl.edu	37	19	46832499	46832499	+	Silent	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:46832499C>G	ENST00000377670.4	+	12	1507	c.1476C>G	c.(1474-1476)ccC>ccG	p.P492P	HIF3A_ENST00000244303.6_Silent_p.P423P|HIF3A_ENST00000600383.1_Silent_p.P423P|HIF3A_ENST00000472815.1_Intron|HIF3A_ENST00000339613.2_Silent_p.P436P|HIF3A_ENST00000420102.2_Silent_p.P441P|HIF3A_ENST00000300862.3_Silent_p.P490P|AC007193.10_ENST00000596807.1_RNA	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	492	NTAD.|ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		TGCTGGCCCCCTACATCTCCA	0.622																																																	0													83.0	76.0	78.0					19																	46832499		2203	4300	6503	SO:0001819	synonymous_variant	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1476C>G	19.37:g.46832499C>G			B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Silent	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.P492	ENST00000377670.4	37	c.1476	CCDS12681.2	19																																																																																			HIF3A	-	pfam_HIF_alpha_subunit	ENSG00000124440		0.622	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	-	0.00	37	0	C			46832499	+1	tier1	-	no_errors	ENST00000377670	ensembl	human	known	74_37	silent	72.34	13	34	SNP	0.997	G
HLA-DPB2	3116	genome.wustl.edu	37	6	33084929	33084929	+	RNA	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:33084929G>T	ENST00000435074.1	+	0	361									major histocompatibility complex, class II, DP beta 2 (pseudogene)																		GAACGGAAGCGAGCCGAGGTG	0.597																																																	0																																												0			M23911		6p21.3	2012-10-02			ENSG00000224557	ENSG00000224557		"""Histocompatibility complex"""	4941	pseudogene	pseudogene				HLA-DP2B		3036829	Standard	NR_001435		Approved	DP2B, DPB2	uc003ocv.1		OTTHUMG00000031080		6.37:g.33084929G>T				RNA	SNP	-	NULL	ENST00000435074.1	37	NULL		6																																																																																			HLA-DPB2	-	-	ENSG00000224557		0.597	HLA-DPB2-002	KNOWN	basic	processed_transcript	HLA-DPB2	HGNC	pseudogene	OTTHUMT00000276666.1	-	0.00	74	0	G	NR_001435		33084929	+1	tier1	-	no_errors	ENST00000435074	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.004	T
HMCN1	83872	genome.wustl.edu	37	1	186114919	186114919	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:186114919C>G	ENST00000271588.4	+	93	14701	c.14472C>G	c.(14470-14472)agC>agG	p.S4824R	HMCN1_ENST00000367492.2_Missense_Mutation_p.S4824R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4824	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATAGTTGGAGCCAGTGCTCTG	0.502																																																	0													72.0	71.0	71.0					1																	186114919		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14472C>G	1.37:g.186114919C>G	ENSP00000271588:p.Ser4824Arg		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.S4824R	ENST00000271588.4	37	c.14472	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.649117	0.67358	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.63744	-0.06;-0.06	5.44	3.53	0.40419	.	0.165343	0.64402	D	0.000002	T	0.75361	0.3839	M	0.92219	3.285	0.37395	D	0.91261	P	0.42203	0.773	P	0.48598	0.583	T	0.80434	-0.1384	10	0.56958	D	0.05	.	10.8008	0.46487	0.1309:0.8003:0.0:0.0688	.	4824	Q96RW7	HMCN1_HUMAN	R	4824	ENSP00000271588:S4824R;ENSP00000356462:S4824R	ENSP00000271588:S4824R	S	+	3	2	HMCN1	184381542	0.488000	0.25996	0.627000	0.29227	0.953000	0.61014	1.008000	0.29872	0.628000	0.30357	0.655000	0.94253	AGC	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.502	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	82	0	C	NM_031935		186114919	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	34.55	72	38	SNP	0.931	G
IBSP	3381	genome.wustl.edu	37	4	88723664	88723664	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:88723664A>G	ENST00000226284.5	+	3	126	c.59A>G	c.(58-60)aAa>aGa	p.K20R		NM_004967.3	NP_004958.2	P21815	SIAL_HUMAN	integrin-binding sialoprotein	20					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|membrane-bounded vesicle (GO:0031988)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)	21		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AAACAGATGAAAAATTTGCAT	0.274																																																	0													43.0	46.0	45.0					4																	88723664		2200	4294	6494	SO:0001583	missense	0				CCDS3624.1	4q21.1	2008-07-28	2008-07-28		ENSG00000029559	ENSG00000029559			5341	protein-coding gene	gene with protein product	"""bone sialoprotein"", ""bone sialoprotein II"""	147563				8406493	Standard	NM_004967		Approved	BSP, SP-II, BSP-II	uc003hqx.4	P21815	OTTHUMG00000130600	ENST00000226284.5:c.59A>G	4.37:g.88723664A>G	ENSP00000226284:p.Lys20Arg			Missense_Mutation	SNP	pfam_BSP_II	p.K20R	ENST00000226284.5	37	c.59	CCDS3624.1	4	.	.	.	.	.	.	.	.	.	.	A	17.88	3.498495	0.64298	.	.	ENSG00000029559	ENST00000226284	T	0.13089	2.62	5.22	5.22	0.72569	.	0.078533	0.53938	D	0.000045	T	0.33469	0.0864	M	0.67953	2.075	0.33975	D	0.647268	D	0.76494	0.999	D	0.87578	0.998	T	0.46938	-0.9155	10	0.44086	T	0.13	.	11.7736	0.51972	1.0:0.0:0.0:0.0	.	20	P21815	SIAL_HUMAN	R	20	ENSP00000226284:K20R	ENSP00000226284:K20R	K	+	2	0	IBSP	88942688	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.687000	0.54692	2.104000	0.64026	0.482000	0.46254	AAA	IBSP	-	pfam_BSP_II	ENSG00000029559		0.274	IBSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IBSP	HGNC	protein_coding	OTTHUMT00000253050.2	-	0.00	50	0	A			88723664	+1	tier1	-	no_errors	ENST00000226284	ensembl	human	known	74_37	missense	68.63	16	35	SNP	1.000	G
ICAM5	7087	genome.wustl.edu	37	19	10402942	10402942	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:10402942G>A	ENST00000221980.4	+	4	968	c.905G>A	c.(904-906)tGc>tAc	p.C302Y		NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin	302	Ig-like C2-type 3.				phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CAGCTGGTCTGCAACGTCACC	0.642																																																	0													35.0	28.0	30.0					19																	10402942		2203	4299	6502	SO:0001583	missense	0			U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.905G>A	19.37:g.10402942G>A	ENSP00000221980:p.Cys302Tyr		Q9Y6F3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_ICAM_N,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom,prints_ICAM_VCAM_N,prints_ICAM	p.C302Y	ENST00000221980.4	37	c.905	CCDS12233.1	19	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537848	0.85917	.	.	ENSG00000105376	ENST00000221980	T	0.79845	-1.31	5.54	5.54	0.83059	Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.85093	0.5618	M	0.85630	2.765	0.48452	D	0.999654	P	0.39831	0.69	B	0.43360	0.417	D	0.87402	0.2370	10	0.87932	D	0	-34.394	15.0337	0.71728	0.0:0.0:1.0:0.0	.	302	Q9UMF0	ICAM5_HUMAN	Y	302	ENSP00000221980:C302Y	ENSP00000221980:C302Y	C	+	2	0	ICAM5	10263942	0.999000	0.42202	0.997000	0.53966	0.730000	0.41778	4.877000	0.63086	2.635000	0.89317	0.485000	0.47835	TGC	ICAM5	-	NULL	ENSG00000105376		0.642	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM5	HGNC	protein_coding	OTTHUMT00000451217.1	-	0.00	155	0	G	NM_003259		10402942	+1	tier1	-	no_errors	ENST00000221980	ensembl	human	known	74_37	missense	11.76	75	10	SNP	1.000	A
IGF2R	3482	genome.wustl.edu	37	6	160494796	160494796	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:160494796G>A	ENST00000356956.1	+	35	5103	c.4955G>A	c.(4954-4956)tGt>tAt	p.C1652Y		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1652					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CAGACCGAATGTTCCGTGAGG	0.403																																																	0													151.0	131.0	138.0					6																	160494796		2203	4300	6503	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4955G>A	6.37:g.160494796G>A	ENSP00000349437:p.Cys1652Tyr		Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.C1652Y	ENST00000356956.1	37	c.4955	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	G	18.95	3.732621	0.69189	.	.	ENSG00000197081	ENST00000356956	T	0.39406	1.08	5.7	5.7	0.88788	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.70002	0.3174	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76666	-0.2875	10	0.87932	D	0	-22.3109	19.8351	0.96655	0.0:0.0:1.0:0.0	.	1652	P11717	MPRI_HUMAN	Y	1652	ENSP00000349437:C1652Y	ENSP00000349437:C1652Y	C	+	2	0	IGF2R	160414786	1.000000	0.71417	0.008000	0.14137	0.560000	0.35617	8.645000	0.91049	2.687000	0.91594	0.655000	0.94253	TGT	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.403	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	-	0.00	28	0	G	NM_000876		160494796	+1	tier1	-	no_errors	ENST00000356956	ensembl	human	known	74_37	missense	34.62	17	9	SNP	0.757	A
IPO7	10527	genome.wustl.edu	37	11	9459723	9459723	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:9459723G>T	ENST00000379719.3	+	22	2728	c.2586G>T	c.(2584-2586)ttG>ttT	p.L862F		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	862					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		GACAGATTTTGCCGGCTTTTA	0.398																																																	0													146.0	164.0	158.0					11																	9459723		2201	4294	6495	SO:0001583	missense	0			AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2586G>T	11.37:g.9459723G>T	ENSP00000369042:p.Leu862Phe		A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Cse1,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L862F	ENST00000379719.3	37	c.2586	CCDS31425.1	11	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752316	0.31046	.	.	ENSG00000205339	ENST00000379719	T	0.69306	-0.39	5.36	2.13	0.27403	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66499	0.2795	L	0.48642	1.525	0.58432	D	0.999994	D	0.56746	0.977	P	0.60345	0.873	T	0.60905	-0.7170	10	0.22706	T	0.39	.	6.0609	0.19837	0.2216:0.0:0.5653:0.2132	.	862	O95373	IPO7_HUMAN	F	862	ENSP00000369042:L862F	ENSP00000369042:L862F	L	+	3	2	IPO7	9416299	1.000000	0.71417	1.000000	0.80357	0.002000	0.02628	1.526000	0.35964	0.648000	0.30732	-0.237000	0.12165	TTG	IPO7	-	superfamily_ARM-type_fold	ENSG00000205339		0.398	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO7	HGNC	protein_coding	OTTHUMT00000386022.1		0.00	68	0	G	NM_006391		9459723	+1			no_errors	ENST00000379719	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.997	T
IGSF9B	22997	genome.wustl.edu	37	11	133789698	133789698	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:133789698G>T	ENST00000321016.8	-	18	4152	c.3922C>A	c.(3922-3924)Cga>Aga	p.R1308R	IGSF9B_ENST00000533871.2_Silent_p.R1308R			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	1308	Pro-rich.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		CCCGTCCTTCGAGGGGAAGGC	0.677																																																	0													19.0	23.0	22.0					11																	133789698		1981	4137	6118	SO:0001819	synonymous_variant	0			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.3922C>A	11.37:g.133789698G>T			G5EA26	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1308	ENST00000321016.8	37	c.3922		11																																																																																			IGSF9B	-	NULL	ENSG00000080854		0.677	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding			0.00	36	0	G	XM_290502		133789698	-1			no_errors	ENST00000321016	ensembl	human	known	74_37	silent	6.98	40	3	SNP	1.000	T
KCNH7	90134	genome.wustl.edu	37	2	163292018	163292018	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:163292018G>T	ENST00000332142.5	-	8	1743	c.1644C>A	c.(1642-1644)ggC>ggA	p.G548G	KCNH7_ENST00000328032.4_Silent_p.G541G	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	548					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GAACAGCAGCGCCATATTCTG	0.463																																					GBM(196;1492 2208 17507 24132 45496)												0													82.0	78.0	80.0					2																	163292018		2203	4300	6503	SO:0001819	synonymous_variant	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1644C>A	2.37:g.163292018G>T			Q53QU4|Q53TB7|Q53TP9|Q8IV15	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.G548	ENST00000332142.5	37	c.1644	CCDS2219.1	2																																																																																			KCNH7	-	pfam_Ion_trans_dom	ENSG00000184611		0.463	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1		0.00	16	0	G	NM_033272		163292018	-1			no_errors	ENST00000332142	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.215	T
KIAA0100	9703	genome.wustl.edu	37	17	26959178	26959178	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:26959178G>T	ENST00000528896.2	-	21	3959	c.3885C>A	c.(3883-3885)gtC>gtA	p.V1295V	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Silent_p.V1152V|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Silent_p.V1152V	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1295						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TAGGCCTTGTGACACTTGTCC	0.468																																																	0													215.0	202.0	206.0					17																	26959178		2203	4300	6503	SO:0001819	synonymous_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.3885C>A	17.37:g.26959178G>T			A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.V1295	ENST00000528896.2	37	c.3885	CCDS32595.1	17																																																																																			KIAA0100	-	NULL	ENSG00000007202		0.468	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	-	0.00	64	0	G	NM_014680		26959178	-1	tier1	-	no_errors	ENST00000528896	ensembl	human	known	74_37	silent	6.49	72	5	SNP	0.922	T
KIAA1217	56243	genome.wustl.edu	37	10	24762672	24762672	+	Silent	SNP	A	A	G	rs369181477		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:24762672A>G	ENST00000376454.3	+	6	1392	c.1362A>G	c.(1360-1362)aaA>aaG	p.K454K	KIAA1217_ENST00000396446.1_Silent_p.K172K|KIAA1217_ENST00000458595.1_Silent_p.K454K|KIAA1217_ENST00000376462.1_Silent_p.K374K|KIAA1217_ENST00000307544.6_Silent_p.K172K|KIAA1217_ENST00000430453.2_Silent_p.K375K|KIAA1217_ENST00000396445.1_Silent_p.K172K|KIAA1217_ENST00000376451.2_Silent_p.K172K|KIAA1217_ENST00000376452.3_Silent_p.K454K	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	454					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						ACAGACAGAAATCAAGGAAAT	0.498																																																	0								A	,,	0,4406		0,0,2203	85.0	71.0	76.0		1122,1362,1362	-4.8	0.0	10		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	KIAA1217	NM_001098500.1,NM_001098501.1,NM_019590.3	,,	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	,,	374/1265,454/1310,454/1944	24762672	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.1362A>G	10.37:g.24762672A>G			A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	pfam_AIP3_C	p.K454	ENST00000376454.3	37	c.1362	CCDS31165.1	10																																																																																			KIAA1217	-	NULL	ENSG00000120549		0.498	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	-	0.00	48	0	A	NM_019590		24762672	+1	tier1	-	no_errors	ENST00000376454	ensembl	human	known	74_37	silent	40.00	6	4	SNP	0.153	G
KIAA1467	57613	genome.wustl.edu	37	12	13224300	13224300	+	Silent	SNP	C	C	G	rs374898629		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:13224300C>G	ENST00000197268.8	+	10	1614	c.1494C>G	c.(1492-1494)gcC>gcG	p.A498A		NM_020853.1	NP_065904.1	A2RU67	K1467_HUMAN	KIAA1467	498						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(4)	36		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		TCTTCTGGGCCGAAGGGCTGT	0.537																																																	0													95.0	89.0	91.0					12																	13224300		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040900	CCDS31750.1	12p13.1	2006-01-23				ENSG00000084444			29288	protein-coding gene	gene with protein product						10819331	Standard	XM_005253450		Approved		uc001rbi.3	A2RU67		ENST00000197268.8:c.1494C>G	12.37:g.13224300C>G			Q49AF2|Q5CZ81|Q6ZUV7|Q9P261	Silent	SNP	superfamily_Quinonprotein_ADH-like_supfam	p.A498	ENST00000197268.8	37	c.1494	CCDS31750.1	12																																																																																			KIAA1467	-	NULL	ENSG00000084444		0.537	KIAA1467-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1467	HGNC	protein_coding	OTTHUMT00000401007.1	-	0.00	35	0	C	NM_020853		13224300	+1	tier1	-	no_errors	ENST00000197268	ensembl	human	known	74_37	silent	51.72	14	15	SNP	0.134	G
KIAA1549	57670	genome.wustl.edu	37	7	138603427	138603427	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:138603427C>T	ENST00000422774.1	-	2	993	c.945G>A	c.(943-945)tgG>tgA	p.W315*	KIAA1549_ENST00000440172.1_Nonsense_Mutation_p.W315*|KIAA1549_ENST00000242365.4_Nonsense_Mutation_p.W265*			Q9HCM3	K1549_HUMAN	KIAA1549	315						integral component of membrane (GO:0016021)		p.W315C(1)|p.W265C(1)	KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CACTTGTGGCCCAAACCTCCT	0.522			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	2	Substitution - Missense(2)	lung(2)											93.0	100.0	97.0					7																	138603427		2034	4185	6219	SO:0001587	stop_gained	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.945G>A	7.37:g.138603427C>T	ENSP00000416040:p.Trp315*		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Nonsense_Mutation	SNP	NULL	p.W315*	ENST00000422774.1	37	c.945	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.254215	0.97417	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	.	.	.	4.19	4.19	0.49359	.	2.428320	0.02548	N	0.095322	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	7.1359	0.25527	0.0:0.8751:0.0:0.1249	.	.	.	.	X	315;265;315	.	ENSP00000242365:W265X	W	-	3	0	KIAA1549	138253967	0.006000	0.16342	0.014000	0.15608	0.628000	0.37860	1.210000	0.32370	2.172000	0.68678	0.561000	0.74099	TGG	KIAA1549	-	NULL	ENSG00000122778		0.522	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1		0.00	28	0	C			138603427	-1			no_errors	ENST00000422774	ensembl	human	known	74_37	nonsense	5.13	37	2	SNP	0.030	T
KIF19	124602	genome.wustl.edu	37	17	72324594	72324594	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:72324594G>T	ENST00000389916.4	+	2	208	c.70G>T	c.(70-72)Gca>Tca	p.A24S		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	24	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						CATCAGCGTGGCAGAGCTGGA	0.617																																																	0													49.0	44.0	46.0					17																	72324594		2203	4299	6502	SO:0001583	missense	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.70G>T	17.37:g.72324594G>T	ENSP00000374566:p.Ala24Ser		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A24S	ENST00000389916.4	37	c.70	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344160	0.41498	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.74315	-0.6;-0.83	4.96	1.52	0.23074	Kinesin, motor domain (4);	0.283859	0.18804	U	0.130709	T	0.42585	0.1209	N	0.01576	-0.805	0.38679	D	0.952503	B;B;B;B	0.11235	0.003;0.004;0.0;0.0	B;B;B;B	0.21151	0.009;0.033;0.008;0.003	T	0.25467	-1.0131	10	0.25751	T	0.34	.	6.7996	0.23744	0.0864:0.0:0.6091:0.3044	.	24;24;24;24	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	S	24	ENSP00000449134:A24S;ENSP00000374566:A24S	ENSP00000374566:A24S	A	+	1	0	KIF19	69836189	0.994000	0.37717	0.999000	0.59377	0.998000	0.95712	1.573000	0.36472	1.072000	0.40860	0.650000	0.86243	GCA	KIF19	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000196169		0.617	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	-	0.00	46	0	G	NM_153209		72324594	+1	tier1	-	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.992	T
KIFC3	3801	genome.wustl.edu	37	16	57793062	57793062	+	Intron	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:57793062C>T	ENST00000379655.4	-	19	2734				KIFC3_ENST00000543930.1_Silent_p.*685*|KIFC3_ENST00000540079.2_Silent_p.*725*|KIFC3_ENST00000445690.2_Silent_p.*827*|KIFC3_ENST00000541240.1_Silent_p.*849*|KIFC3_ENST00000562903.1_Silent_p.*688*|KIFC3_ENST00000465878.2_Silent_p.*688*|KIFC3_ENST00000421376.2_Silent_p.*688*|KIFC3_ENST00000539578.1_Silent_p.*769*	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3						ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CCCCAGCCGTCAGGCTGAAAT	0.647																																																	0													24.0	36.0	32.0					16																	57793062		692	1590	2282	SO:0001627	intron_variant	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.2477-241G>A	16.37:g.57793062C>T			A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.*827	ENST00000379655.4	37	c.2480	CCDS10789.2	16																																																																																			KIFC3	-	NULL	ENSG00000140859		0.647	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2		0.00	106	0	C	NM_005550		57793062	-1			no_errors	ENST00000445690	ensembl	human	known	74_37	silent	5.00	76	4	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118365439	118365439	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:118365439G>T	ENST00000389506.5	+	18	5311	c.5311G>T	c.(5311-5313)Gtc>Ttc	p.V1771F	KMT2A_ENST00000534358.1_Missense_Mutation_p.V1774F|KMT2A_ENST00000354520.4_Missense_Mutation_p.V1733F			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1771					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ATGGTTCAGTGTCAAAAAGTC	0.328																																																	0													115.0	106.0	109.0					11																	118365439		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.5311G>T	11.37:g.118365439G>T	ENSP00000374157:p.Val1771Phe		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.V1771F	ENST00000389506.5	37	c.5311	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633335	0.67015	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.83506	-1.73;-1.73;-1.65	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.87779	0.6263	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.987	D	0.87290	0.2298	10	0.52906	T	0.07	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	1774;1771	E9PQG7;Q03164	.;MLL1_HUMAN	F	1774;1771;1733;681	ENSP00000436786:V1774F;ENSP00000374157:V1771F;ENSP00000346516:V1733F	ENSP00000346516:V1733F	V	+	1	0	MLL	117870649	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.042000	0.89430	2.826000	0.97356	0.655000	0.94253	GTC	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.328	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2		0.00	18	0	G	NM_005933		118365439	+1			no_errors	ENST00000389506	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
L3MBTL1	26013	genome.wustl.edu	37	20	42142257	42142257	+	Silent	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:42142257C>A	ENST00000427442.2	+	2	207	c.48C>A	c.(46-48)ccC>ccA	p.P16P	L3MBTL1_ENST00000444063.1_5'Flank|L3MBTL1_ENST00000373134.1_5'Flank|L3MBTL1_ENST00000418998.1_Silent_p.P16P|L3MBTL1_ENST00000373135.3_5'Flank			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	0					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CTCACCTGCCCGCAACTGCCT	0.577																																																	0																																										SO:0001819	synonymous_variant	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.48C>A	20.37:g.42142257C>A			B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Silent	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.P16	ENST00000427442.2	37	c.48	CCDS46602.2	20																																																																																			L3MBTL1	-	NULL	ENSG00000185513		0.577	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3		0.00	23	0	C	NM_032107		42142257	+1			no_errors	ENST00000418998	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.000	A
LARP1	23367	genome.wustl.edu	37	5	154172210	154172210	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:154172210G>T	ENST00000336314.4	+	4	386	c.362G>T	c.(361-363)cGt>cTt	p.R121L		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	198					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCCTACCCGTAAACTGCCA	0.498																																																	0													195.0	183.0	187.0					5																	154172210		2203	4300	6503	SO:0001583	missense	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.362G>T	5.37:g.154172210G>T	ENSP00000336721:p.Arg121Leu		O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.R121L	ENST00000336314.4	37	c.362	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647466	0.67358	.	.	ENSG00000155506	ENST00000336314;ENST00000518297	T;T	0.41400	1.89;1.0	5.93	5.06	0.68205	.	0.112447	0.64402	D	0.000012	T	0.49270	0.1547	L	0.41492	1.28	0.46849	D	0.999221	P;D	0.55800	0.555;0.973	B;P	0.57101	0.115;0.813	T	0.39860	-0.9593	10	0.31617	T	0.26	-8.0234	14.8626	0.70392	0.0686:0.0:0.9314:0.0	.	198;121	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	L	121;198	ENSP00000336721:R121L;ENSP00000428589:R198L	ENSP00000336721:R121L	R	+	2	0	LARP1	154152403	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.070000	0.76763	1.497000	0.48584	0.655000	0.94253	CGT	LARP1	-	NULL	ENSG00000155506		0.498	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1		0.00	48	0	G	NM_033551		154172210	+1			no_errors	ENST00000336314	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.995	T
LEPR	3953	genome.wustl.edu	37	1	66075771	66075771	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:66075771G>T	ENST00000349533.6	+	13	2079	c.1894G>T	c.(1894-1896)Gtt>Ttt	p.V632F	LEPR_ENST00000371060.3_Missense_Mutation_p.V632F|LEPR_ENST00000371059.3_Missense_Mutation_p.V632F|LEPR_ENST00000344610.8_Missense_Mutation_p.V632F|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000462765.1_3'UTR|LEPR_ENST00000371058.1_Missense_Mutation_p.V632F	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGCCTACACAGTTGTCATGGA	0.413																																																	0													120.0	115.0	117.0					1																	66075771		2203	4300	6503	SO:0001583	missense	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.1894G>T	1.37:g.66075771G>T	ENSP00000330393:p.Val632Phe		Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V632F	ENST00000349533.6	37	c.1894	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	G	15.56	2.868650	0.51588	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86	5.22	2.04	0.26737	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.365648	0.30879	N	0.008685	T	0.44456	0.1294	M	0.69823	2.125	0.09310	N	1	P;P;D	0.56035	0.923;0.862;0.974	P;P;P	0.55923	0.59;0.787;0.691	T	0.35624	-0.9781	10	0.72032	D	0.01	-1.9851	10.7765	0.46353	0.0712:0.3708:0.558:0.0	.	632;632;632	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	F	632	ENSP00000340884:V632F;ENSP00000330393:V632F;ENSP00000360099:V632F;ENSP00000360098:V632F;ENSP00000360097:V632F	ENSP00000340884:V632F	V	+	1	0	LEPR	65848359	0.012000	0.17670	0.023000	0.16930	0.855000	0.48748	0.997000	0.29731	0.543000	0.28864	0.650000	0.86243	GTT	LEPR	-	superfamily_Fibronectin_type3	ENSG00000116678		0.413	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1		0.00	70	0	G	NM_002303		66075771	+1			no_errors	ENST00000349533	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.001	T
LHX6	26468	genome.wustl.edu	37	9	124967012	124967012	+	3'UTR	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:124967012C>T	ENST00000373755.2	-	0	1227				LHX6_ENST00000559895.1_3'UTR|LHX6_ENST00000373754.2_Missense_Mutation_p.V339M|LHX6_ENST00000394319.4_3'UTR|LHX6_ENST00000340587.3_Missense_Mutation_p.V368M|LHX6_ENST00000464484.2_Missense_Mutation_p.V26M|LHX6_ENST00000541397.2_Missense_Mutation_p.V357M|LHX6_ENST00000482062.1_3'UTR	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6						cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						GGGGCGCCCACGGGCAGATGC	0.677																																																	0													24.0	28.0	27.0					9																	124967012		2203	4298	6501	SO:0001624	3_prime_UTR_variant	0			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.*27G>A	9.37:g.124967012C>T			A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.V368M	ENST00000373755.2	37	c.1102	CCDS56583.1	9	.	.	.	.	.	.	.	.	.	.	C	9.690	1.151561	0.21371	.	.	ENSG00000106852	ENST00000373754;ENST00000340587;ENST00000541397	D;D;D	0.87256	-2.23;-2.09;-2.14	5.52	-0.963	0.10330	.	.	.	.	.	T	0.79678	0.4487	.	.	.	0.18873	N	0.999982	B	0.12013	0.005	B	0.10450	0.005	T	0.62015	-0.6943	8	0.33141	T	0.24	.	12.7188	0.57129	0.0:0.5542:0.0:0.4458	.	368	Q9UPM6-4	.	M	339;368;357	ENSP00000362859:V339M;ENSP00000340137:V368M;ENSP00000441464:V357M	ENSP00000340137:V368M	V	-	1	0	LHX6	124006833	0.452000	0.25713	0.773000	0.31616	0.840000	0.47671	-0.419000	0.07071	-0.430000	0.07318	0.655000	0.94253	GTG	LHX6	-	NULL	ENSG00000106852		0.677	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	LHX6	HGNC	protein_coding	OTTHUMT00000053924.2		0.00	75	0	C	NM_014368		124967012	-1			no_errors	ENST00000340587	ensembl	human	known	74_37	missense	5.43	87	5	SNP	0.990	T
LIN7A	8825	genome.wustl.edu	37	12	81242083	81242083	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:81242083C>A	ENST00000552864.1	-	3	422	c.220G>T	c.(220-222)Gaa>Taa	p.E74*		NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)	74	L27. {ECO:0000255|PROSITE- ProRule:PRU00365}.				exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						GTTATCGTTTCATGCATATAT	0.323																																																	0													79.0	75.0	77.0					12																	81242083		2203	4299	6502	SO:0001587	stop_gained	0			AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.220G>T	12.37:g.81242083C>A	ENSP00000447488:p.Glu74*		A4FTY3|Q147W1|Q6LES3|Q7LDS4	Nonsense_Mutation	SNP	pfam_PDZ,pfam_L27_C,superfamily_PDZ,smart_L27,smart_PDZ,pirsf_Lin-7_homologue,pfscan_L27,pfscan_PDZ	p.E74*	ENST00000552864.1	37	c.220	CCDS9021.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.866139|4.866139	0.91511|0.91511	.|.	.|.	ENSG00000111052|ENSG00000111052	ENST00000552864;ENST00000549417|ENST00000552093	.|.	.|.	.|.	5.8|5.8	5.8|5.8	0.92144|0.92144	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.80025	.|0.4548	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77678	.|-0.2498	.|3	0.72032|.	D|.	0.01|.	-17.795|-17.795	20.0637|20.0637	0.97700|0.97700	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|I	74;68|39	.|.	ENSP00000261203:E74X|.	E|M	-|-	1|3	0|0	LIN7A|LIN7A	79766214|79766214	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.487000|7.487000	0.81328|0.81328	2.751000|2.751000	0.94390|0.94390	0.650000|0.650000	0.86243|0.86243	GAA|ATG	LIN7A	-	pfam_L27_C,smart_L27,pirsf_Lin-7_homologue,pfscan_L27	ENSG00000111052		0.323	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN7A	HGNC	protein_coding	OTTHUMT00000407760.1		0.00	46	0	C			81242083	-1			no_errors	ENST00000552864	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	1.000	A
LINC00471	151477	genome.wustl.edu	37	2	232373896	232373896	+	RNA	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:232373896G>T	ENST00000313064.2	-	0	522					NR_024079.1		Q8N535	CB052_HUMAN	long intergenic non-protein coding RNA 471																		CACTGTTCCTGTCTTCATTCT	0.512																																																	0													252.0	237.0	242.0					2																	232373896		2203	4300	6503			0			BC033054		2q37.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000181798	ENSG00000181798		"""Long non-coding RNAs"""	28668	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 52"""	C2orf52		12477932	Standard	NR_024079		Approved	MGC43122	uc002vrx.1	Q8N535	OTTHUMG00000133227		2.37:g.232373896G>T				RNA	SNP	-	NULL	ENST00000313064.2	37	NULL		2																																																																																			LINC00471	-	-	ENSG00000181798		0.512	LINC00471-001	KNOWN	basic	processed_transcript	LINC00471	HGNC	processed_transcript	OTTHUMT00000256963.2	-	0.00	61	0	G	NM_173513		232373896	-1	tier1	-	no_errors	ENST00000313064	ensembl	human	known	74_37	rna	5.97	63	4	SNP	0.000	T
LINC00623	728855	genome.wustl.edu	37	1	149581062	149581063	+	RNA	INS	-	-	A	rs200727473		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:149581062_149581063insA	ENST00000598569.1	+	0	539_540																											TTTGTAAAAAGAAAAAAAAAAA	0.272																																																	0																																												0																															1.37:g.149581073_149581073dupA				RNA	INS	-	NULL	ENST00000598569.1	37	NULL		1																																																																																			RP11-353N4.6	-	-	ENSG00000269501		0.272	RP11-353N4.6-002	KNOWN	basic	processed_transcript	LINC00623	Clone_based_vega_gene	pseudogene	OTTHUMT00000462966.1		0.00	63	0	0			149581063	+1			no_errors	ENST00000598569	ensembl	human	known	74_37	rna	5.11	130	7	INS	0.000:0.000	A
LMNB1	4001	genome.wustl.edu	37	5	126113416	126113416	+	Silent	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:126113416C>T	ENST00000261366.5	+	1	577	c.216C>T	c.(214-216)ggC>ggT	p.G72G	RP11-434D11.4_ENST00000509185.2_lincRNA|LMNB1_ENST00000460265.1_3'UTR|LMNB1_ENST00000395354.1_Silent_p.G72G	NM_001198557.1|NM_005573.3	NP_001185486.1|NP_005564.1	P20700	LMNB1_HUMAN	lamin B1	72	Linker 1.|Rod.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	lamin filament (GO:0005638)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.103)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.033)|OV - Ovarian serous cystadenocarcinoma(64;0.0398)|all cancers(49;0.0903)		AGGTGCGCGGCCGTGAGCTCA	0.701																																																	0													5.0	6.0	6.0					5																	126113416		1984	3931	5915	SO:0001819	synonymous_variant	0			L37737	CCDS4140.1	5q23.2	2013-01-16			ENSG00000113368	ENSG00000113368		"""Intermediate filaments type V, lamins"""	6637	protein-coding gene	gene with protein product		150340				7557986, 8838815	Standard	NM_005573		Approved		uc003kud.2	P20700	OTTHUMG00000128969	ENST00000261366.5:c.216C>T	5.37:g.126113416C>T			B2R6J6|Q3SYN7|Q96EI6	Silent	SNP	pfam_IF,pfam_Lamin_tail_dom	p.G72	ENST00000261366.5	37	c.216	CCDS4140.1	5																																																																																			LMNB1	-	pfam_IF	ENSG00000113368		0.701	LMNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMNB1	HGNC	protein_coding	OTTHUMT00000250956.2	-	0.00	12	0	C	NM_005573		126113416	+1	tier1	-	no_errors	ENST00000261366	ensembl	human	known	74_37	silent	62.50	3	5	SNP	1.000	T
LMNB2	84823	genome.wustl.edu	37	19	2456775	2456775	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:2456775G>T	ENST00000582871.1	-	1	183	c.97C>A	c.(97-99)Ctc>Atc	p.L33I	LMNB2_ENST00000325327.3_Missense_Mutation_p.L53I|AC005624.2_ENST00000587826.1_lincRNA	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	33	Coil 1A.|Rod.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGTCGTTGAGCTCGCGCAGC	0.721																																																	0													12.0	11.0	11.0					19																	2456775		2154	4223	6377	SO:0001583	missense	0			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.97C>A	19.37:g.2456775G>T	ENSP00000462730:p.Leu33Ile		O75292|Q14734|Q96DF6	Missense_Mutation	SNP	pfam_IF,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.L53I	ENST00000582871.1	37	c.157		19	.	.	.	.	.	.	.	.	.	.	g	34	5.295256	0.95574	.	.	ENSG00000176619	ENST00000325327	.	.	.	3.32	3.32	0.38043	Filament (1);	0.078225	0.51477	U	0.000081	D	0.86318	0.5904	H	0.95850	3.73	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90506	0.4477	9	0.87932	D	0	.	13.3971	0.60861	0.0:0.0:1.0:0.0	.	33	Q03252	LMNB2_HUMAN	I	33	.	ENSP00000327054:L33I	L	-	1	0	LMNB2	2407775	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.673000	0.91186	1.718000	0.51419	0.299000	0.19835	CTC	LMNB2	-	pfam_IF	ENSG00000176619		0.721	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	HGNC	protein_coding		-	0.00	16	0	G	NM_032737		2456775	-1	tier1	-	no_errors	ENST00000325327	ensembl	human	known	74_37	missense	57.14	3	4	SNP	1.000	T
LMO2	4005	genome.wustl.edu	37	11	33881097	33881097	+	Nonsense_Mutation	SNP	G	G	T	rs377285988		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:33881097G>T	ENST00000395833.3	-	3	711	c.282C>A	c.(280-282)tgC>tgA	p.C94*	LMO2_ENST00000257818.2_Nonsense_Mutation_p.C163*	NM_001142315.1|NM_001142316.1	NP_001135787.1|NP_001135788.1	P25791	RBTN2_HUMAN	LIM domain only 2 (rhombotin-like 1)	94	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cellular response to thyroid hormone stimulus (GO:0097067)|embryonic hemopoiesis (GO:0035162)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|cofactor binding (GO:0048037)|E-box binding (GO:0070888)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)|urinary_tract(1)	14						CACAGGATGCGCAGAGACCGT	0.512			T	TRD@	T-ALL																																			Dom	yes		11	11p13	4005	LIM domain only 2 (rhombotin-like 1) (RBTN2)		L	0													78.0	73.0	74.0					11																	33881097		2202	4298	6500	SO:0001587	stop_gained	0			X61118	CCDS7888.2, CCDS44567.1	11p13	2008-07-18			ENSG00000135363	ENSG00000135363			6642	protein-coding gene	gene with protein product	"""T-cell translocation gene 2"", ""rhombotin-like 1"""	180385		RBTNL1		2034676	Standard	NM_005574		Approved	TTG2, RHOM2, RBTN2	uc010rem.2	P25791	OTTHUMG00000157176	ENST00000395833.3:c.282C>A	11.37:g.33881097G>T	ENSP00000379175:p.Cys94*		Q9HD58	Nonsense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.C163*	ENST00000395833.3	37	c.489	CCDS44567.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.902137	0.97087	.	.	ENSG00000135363	ENST00000395833;ENST00000257818	.	.	.	5.38	-9.57	0.00562	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9503	0.64113	0.6686:0.0772:0.2542:0.0	.	.	.	.	X	94;163	.	ENSP00000257818:C163X	C	-	3	2	LMO2	33837673	0.000000	0.05858	0.338000	0.25549	0.003000	0.03518	-1.575000	0.02131	-1.864000	0.01148	-0.892000	0.02923	TGC	LMO2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000135363		0.512	LMO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO2	HGNC	protein_coding	OTTHUMT00000347777.1	-	0.00	32	0	G	NM_005574		33881097	-1	tier1	-	no_errors	ENST00000257818	ensembl	human	known	74_37	nonsense	10.81	33	4	SNP	0.168	T
LNPEP	4012	genome.wustl.edu	37	5	96332092	96332092	+	Splice_Site	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:96332092A>G	ENST00000231368.5	+	7	2099		c.e7-1		LNPEP_ENST00000395770.3_Splice_Site	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CTCTCCCCCCAGTGGTTTGGC	0.358																																																	0													100.0	98.0	99.0					5																	96332092		2203	4300	6503	SO:0001630	splice_region_variant	0			D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.1408-1A>G	5.37:g.96332092A>G			O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Splice_Site	SNP	-	e7-2	ENST00000231368.5	37	c.1408-2	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759924	0.49468	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0958	0.72232	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LNPEP	96357848	1.000000	0.71417	0.996000	0.52242	0.610000	0.37248	9.209000	0.95087	2.100000	0.63781	0.460000	0.39030	.	LNPEP	-	-	ENSG00000113441		0.358	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	HGNC	protein_coding	OTTHUMT00000250624.1		0.00	92	0	A	NM_005575	Intron	96332092	+1			no_errors	ENST00000231368	ensembl	human	known	74_37	splice_site	5.60	118	7	SNP	1.000	G
LONRF2	164832	genome.wustl.edu	37	2	100900818	100900818	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:100900818A>T	ENST00000393437.3	-	12	2846	c.2207T>A	c.(2206-2208)aTc>aAc	p.I736N	LONRF2_ENST00000409647.1_Missense_Mutation_p.I493N	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	736	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CTTACGCGTGATGATGACTAA	0.532																																																	0													29.0	25.0	27.0					2																	100900818		2202	4300	6502	SO:0001583	missense	0			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.2207T>A	2.37:g.100900818A>T	ENSP00000377086:p.Ile736Asn		B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.I736N	ENST00000393437.3	37	c.2207	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	A	20.6	4.017920	0.75275	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.85955	-1.88;-2.05	5.24	4.05	0.47172	.	0.350136	0.28718	N	0.014364	D	0.85239	0.5651	L	0.46157	1.445	0.35716	D	0.816809	D	0.57899	0.981	P	0.51999	0.687	D	0.87983	0.2744	10	0.59425	D	0.04	-3.529	12.0834	0.53684	0.856:0.144:0.0:0.0	.	736	Q1L5Z9	LONF2_HUMAN	N	736;493	ENSP00000377086:I736N;ENSP00000386823:I493N	ENSP00000377086:I736N	I	-	2	0	LONRF2	100267250	1.000000	0.71417	0.005000	0.12908	0.838000	0.47535	6.750000	0.74888	0.801000	0.34066	0.533000	0.62120	ATC	LONRF2	-	NULL	ENSG00000170500		0.532	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2		0.00	36	0	A	NM_198461		100900818	-1			no_errors	ENST00000393437	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.998	T
LPCAT3	10162	genome.wustl.edu	37	12	7086807	7086807	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:7086807G>T	ENST00000261407.4	-	10	1226	c.1141C>A	c.(1141-1143)Ctg>Atg	p.L381M	U47924.30_ENST00000606112.1_lincRNA|LPCAT3_ENST00000535021.1_Intron	NM_005768.5	NP_005759.4	Q6P1A2	MBOA5_HUMAN	lysophosphatidylcholine acyltransferase 3	381					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|regulation of plasma lipoprotein particle levels (GO:0097006)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	17						AAGCAGACCAGGTATCCTGAG	0.498																																																	0													104.0	110.0	108.0					12																	7086807		2203	4300	6503	SO:0001583	missense	0			U72515	CCDS8572.1	12p13.31	2010-05-12	2008-06-24	2008-06-24	ENSG00000111684	ENSG00000111684			30244	protein-coding gene	gene with protein product		611950	"""O-acyltransferase (membrane bound) domain containing 5"", ""membrane bound O-acyltransferase domain containing 5"""	OACT5, MBOAT5		8723724, 9074930, 18195019	Standard	NM_005768		Approved	C3F, nessy	uc001qsi.3	Q6P1A2	OTTHUMG00000168970	ENST00000261407.4:c.1141C>A	12.37:g.7086807G>T	ENSP00000261407:p.Leu381Met		B2RDH0|B7Z3N3|Q7KZS1|Q92980|Q9BW40	Missense_Mutation	SNP	pfam_MBOAT_fam	p.L381M	ENST00000261407.4	37	c.1141	CCDS8572.1	12	.	.	.	.	.	.	.	.	.	.	G	18.38	3.612027	0.66672	.	.	ENSG00000111684	ENST00000261407	T	0.75477	-0.94	5.29	5.29	0.74685	.	0.264979	0.31335	N	0.007822	T	0.81259	0.4785	M	0.65975	2.015	0.48288	D	0.99962	D	0.58970	0.984	P	0.60541	0.876	T	0.82478	-0.0437	10	0.66056	D	0.02	-17.1569	9.6279	0.39761	0.1544:0.0:0.8456:0.0	.	381	Q6P1A2	MBOA5_HUMAN	M	381	ENSP00000261407:L381M	ENSP00000261407:L381M	L	-	1	2	LPCAT3	6957068	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.141000	0.31528	2.478000	0.83669	0.561000	0.74099	CTG	LPCAT3	-	pfam_MBOAT_fam	ENSG00000111684		0.498	LPCAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT3	HGNC	protein_coding	OTTHUMT00000401812.1		0.00	53	0	G	NM_005768		7086807	-1			no_errors	ENST00000261407	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170070332	170070332	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:170070332G>T	ENST00000263816.3	-	36	6160	c.5875C>A	c.(5875-5877)Cag>Aag	p.Q1959K		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1959					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.Q1959K(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGGAAAGCTGGTGTACCAGG	0.403																																																	1	Substitution - Missense(1)	ovary(1)											84.0	83.0	83.0					2																	170070332		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5875C>A	2.37:g.170070332G>T	ENSP00000263816:p.Gln1959Lys		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.Q1959K	ENST00000263816.3	37	c.5875	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	2.054	-0.416959	0.04766	.	.	ENSG00000081479	ENST00000263816	D	0.90900	-2.75	5.96	2.21	0.28008	Six-bladed beta-propeller, TolB-like (1);	0.320644	0.38778	N	0.001567	T	0.76140	0.3946	N	0.11201	0.11	0.37474	D	0.915714	B	0.02656	0.0	B	0.01281	0.0	T	0.63937	-0.6524	10	0.06625	T	0.88	.	9.1396	0.36894	0.1196:0.2266:0.6538:0.0	.	1959	P98164	LRP2_HUMAN	K	1959	ENSP00000263816:Q1959K	ENSP00000263816:Q1959K	Q	-	1	0	LRP2	169778578	0.997000	0.39634	0.301000	0.25044	0.612000	0.37316	2.644000	0.46613	0.135000	0.18707	-0.156000	0.13503	CAG	LRP2	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.403	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2		0.00	35	0	G	NM_004525		170070332	-1			no_errors	ENST00000263816	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.343	T
LRRD1	401387	genome.wustl.edu	37	7	91793876	91793876	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:91793876C>G	ENST00000458448.1	-	2	841	c.641G>C	c.(640-642)aGg>aCg	p.R214T	LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000422722.1_Intron|LRRD1_ENST00000454089.2_5'UTR|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000430130.2_Missense_Mutation_p.R214T			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	214					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						ATTTAATATCCTTAAATTATG	0.328																																																	0													29.0	24.0	26.0					7																	91793876		692	1584	2276	SO:0001583	missense	0			BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.641G>C	7.37:g.91793876C>G	ENSP00000405987:p.Arg214Thr		B7ZMM9|Q49AT9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,pfscan_Death_domain	p.R214T	ENST00000458448.1	37	c.641	CCDS55124.1	7	.	.	.	.	.	.	.	.	.	.	C	5.754	0.323454	0.10900	.	.	ENSG00000240720	ENST00000458448;ENST00000430130	T;T	0.10288	2.89;2.89	5.91	-0.443	0.12249	.	.	.	.	.	T	0.04182	0.0116	N	0.05608	-0.01	0.53688	D	0.999972	B	0.25850	0.136	B	0.24701	0.055	T	0.46992	-0.9151	9	0.11182	T	0.66	.	7.056	0.25099	0.0:0.3356:0.1978:0.4667	.	214	A4D1F6	LRRD1_HUMAN	T	214	ENSP00000405987:R214T;ENSP00000411568:R214T	ENSP00000411568:R214T	R	-	2	0	LRRD1	91631812	0.011000	0.17503	0.964000	0.40570	0.996000	0.88848	-0.484000	0.06528	-0.392000	0.07751	0.650000	0.86243	AGG	LRRD1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000240720		0.328	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRD1	HGNC	protein_coding	OTTHUMT00000342027.2	-	0.00	50	0	C	NM_001045475		91793876	-1	tier1	-	no_errors	ENST00000430130	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.636	G
LTBP1	4052	genome.wustl.edu	37	2	33484653	33484653	+	Splice_Site	SNP	A	A	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:33484653A>C	ENST00000404816.2	+	13	2748		c.e13-1		LTBP1_ENST00000407925.1_Splice_Site|LTBP1_ENST00000418533.2_Splice_Site|LTBP1_ENST00000354476.3_Splice_Site|LTBP1_ENST00000404525.1_Splice_Site|LTBP1_ENST00000402934.1_Splice_Site|LTBP1_ENST00000390003.4_Splice_Site			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1						extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TTCTGGTTTTAGTGGCAACTG	0.299																																																	0													108.0	111.0	110.0					2																	33484653		2202	4300	6502	SO:0001630	splice_region_variant	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2396-1A>C	2.37:g.33484653A>C			A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Splice_Site	SNP	-	e13-2	ENST00000404816.2	37	c.2396-2	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	A	16.44	3.123699	0.56613	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000413303;ENST00000468091	.	.	.	5.06	3.9	0.45041	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5433	0.33406	0.9102:0.0:0.0898:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LTBP1	33338157	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.318000	0.65829	0.861000	0.35504	0.528000	0.53228	.	LTBP1	-	-	ENSG00000049323		0.299	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	37	0	A	NM_206943	Intron	33484653	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	splice_site	23.81	48	15	SNP	1.000	C
MACF1	23499	genome.wustl.edu	37	1	39802265	39802265	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:39802265G>T	ENST00000372915.3	+	36	10107	c.10020G>T	c.(10018-10020)atG>atT	p.M3340I	MACF1_ENST00000564288.1_Missense_Mutation_p.M3335I|MACF1_ENST00000289893.4_Missense_Mutation_p.M1775I|MACF1_ENST00000567887.1_Missense_Mutation_p.M3372I|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3340					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTCCCTTCATGACTGCACCTG	0.458																																																	0													60.0	58.0	59.0					1																	39802265		2201	4299	6500	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.10020G>T	1.37:g.39802265G>T	ENSP00000362006:p.Met3340Ile		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.M3372I	ENST00000372915.3	37	c.10116		1	.	.	.	.	.	.	.	.	.	.	G	7.410	0.634453	0.14322	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.60040	0.22;1.28	5.33	0.715	0.18186	.	2.007260	0.01809	N	0.033347	T	0.32852	0.0843	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12760	-1.0535	10	0.20046	T	0.44	.	0.7015	0.00908	0.2353:0.1888:0.3824:0.1935	.	3340	Q9UPN3	MACF1_HUMAN	I	3340;1775	ENSP00000362006:M3340I;ENSP00000289893:M1775I	ENSP00000289893:M1775I	M	+	3	0	MACF1	39574852	0.010000	0.17322	0.007000	0.13788	0.052000	0.14988	0.458000	0.21892	0.246000	0.21394	-1.314000	0.01303	ATG	MACF1	-	superfamily_RNaseH-like_dom	ENSG00000127603		0.458	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	43	0	G	NM_033044		39802265	+1	tier1	-	no_errors	ENST00000567887	ensembl	human	putative	74_37	missense	5.88	64	4	SNP	0.006	T
LTC4S	4056	genome.wustl.edu	37	5	179221199	179221199	+	Intron	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:179221199C>A	ENST00000292596.10	+	1	153				MAML1_ENST00000503050.1_3'UTR|LTC4S_ENST00000401985.3_Intron	NM_145867.1	NP_665874.1	Q16873	LTC4S_HUMAN	leukotriene C4 synthase						arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	enzyme activator activity (GO:0008047)|glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|leukotriene-C4 synthase activity (GO:0004464)|lipid binding (GO:0008289)			haematopoietic_and_lymphoid_tissue(1)	1	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Glutathione(DB00143)	TTGCCCTCTGCCCCCTAGGCC	0.637																																																	0													25.0	26.0	26.0					5																	179221199		692	1591	2283	SO:0001627	intron_variant	0			U11552	CCDS34316.1	5q35	2009-07-10			ENSG00000213316	ENSG00000213316	4.4.1.20		6719	protein-coding gene	gene with protein product		246530				8052639	Standard	NM_145867		Approved	MGC33147	uc003mko.3	Q16873	OTTHUMG00000150314	ENST00000292596.10:c.58+60C>A	5.37:g.179221199C>A			Q8N6P0|Q9UC73|Q9UD18	RNA	SNP	-	NULL	ENST00000292596.10	37	NULL	CCDS34316.1	5																																																																																			MAML1	-	-	ENSG00000161021		0.637	LTC4S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML1	HGNC	protein_coding	OTTHUMT00000317536.2	-	0.00	51	0	C	NM_000897		179221199	+1	tier1	-	no_errors	ENST00000503050	ensembl	human	known	74_37	rna	69.44	11	25	SNP	0.001	A
MARCH8	220972	genome.wustl.edu	37	10	45953909	45953909	+	Silent	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:45953909C>T	ENST00000319836.3	-	7	1403	c.654G>A	c.(652-654)caG>caA	p.Q218Q	MARCH8_ENST00000395771.3_Silent_p.Q218Q|MARCH8_ENST00000453424.2_Silent_p.Q500Q|MARCH8_ENST00000476962.1_5'UTR|MARCH8_ENST00000395769.2_Silent_p.Q218Q	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	218					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						ACACTTTACACTGAACATACA	0.393																																					NSCLC(102;658 1594 2173 16344 34808)												0													105.0	106.0	106.0					10																	45953909		2203	4300	6503	SO:0001819	synonymous_variant	0			AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.654G>A	10.37:g.45953909C>T			B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.Q218	ENST00000319836.3	37	c.654	CCDS7213.1	10	.	.	.	.	.	.	.	.	.	.	C	6.712	0.499994	0.12762	.	.	ENSG00000165406	ENST00000453424	.	.	.	5.47	2.61	0.31194	.	.	.	.	.	T	0.57036	0.2026	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48514	-0.9029	4	.	.	.	-21.7186	7.9157	0.29816	0.0:0.6745:0.0:0.3255	.	.	.	.	M	383	.	.	V	-	1	0	MARCH8	45273915	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	0.933000	0.28897	0.284000	0.22305	-0.122000	0.15005	GTG	MARCH8	-	NULL	ENSG00000165406		0.393	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH8	HGNC	protein_coding	OTTHUMT00000051217.1	-	0.00	46	0	C	NM_145021		45953909	-1	tier1	-	no_errors	ENST00000319836	ensembl	human	known	74_37	silent	6.78	55	4	SNP	1.000	T
MEF2D	4209	genome.wustl.edu	37	1	156449488	156449488	+	Missense_Mutation	SNP	G	G	T	rs34630845		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:156449488G>T	ENST00000348159.4	-	5	977	c.497C>A	c.(496-498)cCt>cAt	p.P166H	MEF2D_ENST00000353795.3_Missense_Mutation_p.P120H|MEF2D_ENST00000340875.5_Missense_Mutation_p.P165H|MEF2D_ENST00000360595.3_Missense_Mutation_p.P166H|MEF2D_ENST00000464356.2_Missense_Mutation_p.P165H|MEF2D_ENST00000368240.2_Missense_Mutation_p.P166H	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	166					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CACCAGGGAAGGGGTGACCAG	0.642																																																	0													33.0	32.0	33.0					1																	156449488		2077	4096	6173	SO:0001583	missense	0			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.497C>A	1.37:g.156449488G>T	ENSP00000271555:p.Pro166His		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.P166H	ENST00000348159.4	37	c.497	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750756	0.69533	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000454816	T;T;T;T;T;T	0.60040	0.22;0.24;0.24;0.59;0.24;0.26	5.52	5.52	0.82312	.	0.227351	0.45867	D	0.000327	T	0.42539	0.1207	L	0.27053	0.805	0.38454	D	0.947046	D;P;B	0.56035	0.974;0.844;0.168	P;B;B	0.52856	0.711;0.396;0.045	T	0.35968	-0.9767	10	0.32370	T	0.25	-8.1457	11.8805	0.52574	0.0:0.0:0.7276:0.2724	.	171;166;166	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	H	166;165;166;120;166;165	ENSP00000271555:P166H;ENSP00000343159:P165H;ENSP00000357223:P166H;ENSP00000344705:P120H;ENSP00000353803:P166H;ENSP00000388505:P165H	ENSP00000343159:P165H	P	-	2	0	MEF2D	154716112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.963000	0.63694	2.605000	0.88082	0.655000	0.94253	CCT	MEF2D	-	NULL	ENSG00000116604		0.642	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2		0.00	61	0	G	NM_005920		156449488	-1			no_errors	ENST00000348159	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	T
MFSD9	84804	genome.wustl.edu	37	2	103353149	103353149	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:103353149C>A	ENST00000258436.5	-	1	164	c.121G>T	c.(121-123)Gga>Tga	p.G41*	TMEM182_ENST00000409528.1_5'Flank|TMEM182_ENST00000409173.1_5'Flank	NM_032718.3	NP_116107.3	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing 9	41					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(3)|large_intestine(7)|liver(1)|lung(6)|ovary(2)|skin(1)	20						CGGCGGGCTCCGACGGCACCG	0.662																																																	0													33.0	40.0	37.0					2																	103353149		2202	4300	6502	SO:0001587	stop_gained	0				CCDS2063.1	2q12.1	2007-01-12			ENSG00000135953	ENSG00000135953			28158	protein-coding gene	gene with protein product							Standard	NM_032718		Approved	MGC11332	uc002tcb.2	Q8NBP5	OTTHUMG00000130781	ENST00000258436.5:c.121G>T	2.37:g.103353149C>A	ENSP00000258436:p.Gly41*		Q4ZG89|Q53TU0|Q96GQ4|Q9BRI8	Nonsense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Tet-R_TetA/multi-R_MdtG	p.G41*	ENST00000258436.5	37	c.121	CCDS2063.1	2	.	.	.	.	.	.	.	.	.	.	G	11.61	1.691258	0.30052	.	.	ENSG00000135953	ENST00000258436	.	.	.	4.35	-4.49	0.03504	.	1.653830	0.03793	N	0.263190	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	5.2248	9.5725	0.39436	0.0962:0.6664:0.1283:0.1091	.	.	.	.	X	41	.	ENSP00000258436:G41X	G	-	1	0	MFSD9	102719581	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.050000	0.01404	-1.219000	0.02597	-0.225000	0.12378	GGA	MFSD9	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000135953		0.662	MFSD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD9	HGNC	protein_coding	OTTHUMT00000253295.2	-	0.00	68	0	C	NM_032718		103353149	-1	tier1	-	no_errors	ENST00000258436	ensembl	human	known	74_37	nonsense	16.30	77	15	SNP	0.000	A
MGAT5B	146664	genome.wustl.edu	37	17	74942515	74942515	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:74942515G>T	ENST00000569840.2	+	16	2480	c.1906G>T	c.(1906-1908)Gcc>Tcc	p.A636S	MGAT5B_ENST00000428789.2_Missense_Mutation_p.A645S|MGAT5B_ENST00000301618.4_Missense_Mutation_p.A634S	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	636					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)	p.A634S(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GCGGATCCACGCCTACATCCA	0.642																																																	1	Substitution - Missense(1)	lung(1)											86.0	61.0	69.0					17																	74942515		2203	4300	6503	SO:0001583	missense	0			AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1906G>T	17.37:g.74942515G>T	ENSP00000456037:p.Ala636Ser		Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.A645S	ENST00000569840.2	37	c.1933	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946304	0.92593	.	.	ENSG00000167889	ENST00000301618;ENST00000428789	T;T	0.48201	0.83;0.82	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.71104	-0.4689	10	0.62326	D	0.03	-27.3562	16.8173	0.85737	0.0:0.0:1.0:0.0	.	41;645;634	Q3V5L5-4;Q3V5L5-2;Q3V5L5-5	.;.;.	S	634;645	ENSP00000301618:A634S;ENSP00000391227:A645S	ENSP00000301618:A634S	A	+	1	0	MGAT5B	72454110	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.800000	0.85949	2.202000	0.70862	0.563000	0.77884	GCC	MGAT5B	-	NULL	ENSG00000167889		0.642	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	HGNC	protein_coding	OTTHUMT00000460624.2		0.00	49	0	G	NM_144677		74942515	+1			no_errors	ENST00000428789	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
MLH3	27030	genome.wustl.edu	37	14	75514257	75514257	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr14:75514257C>T	ENST00000556740.1	-	1	2137	c.2102G>A	c.(2101-2103)aGc>aAc	p.S701N	MLH3_ENST00000355774.2_Missense_Mutation_p.S701N|MLH3_ENST00000555671.1_5'Flank|MLH3_ENST00000238662.7_Missense_Mutation_p.S701N|MLH3_ENST00000544985.1_5'Flank|MLH3_ENST00000556257.1_Missense_Mutation_p.S701N|MLH3_ENST00000380968.2_5'UTR			Q9UHC1	MLH3_HUMAN	mutL homolog 3	701					ATP catabolic process (GO:0006200)|female meiosis I (GO:0007144)|male meiosis (GO:0007140)|mismatch repair (GO:0006298)|protein localization (GO:0008104)|reciprocal meiotic recombination (GO:0007131)|synaptonemal complex assembly (GO:0007130)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|mismatch repair complex (GO:0032300)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|mismatched DNA binding (GO:0030983)|satellite DNA binding (GO:0003696)|single-stranded DNA binding (GO:0003697)	p.S701T(2)		breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	44				BRCA - Breast invasive adenocarcinoma(234;0.00688)		TGATTTTTTGCTACCTTCCTG	0.348								Mismatch excision repair (MMR)																																									2	Substitution - Missense(2)	lung(2)											89.0	90.0	90.0					14																	75514257		2203	4300	6503	SO:0001583	missense	0			AF195657	CCDS9837.1, CCDS32123.1	14q24.3	2014-09-17	2013-09-12			ENSG00000119684			7128	protein-coding gene	gene with protein product		604395	"""mutL (E. coli) homolog 3"", ""mutL homolog 3 (E. coli)"""			10615123	Standard	XR_245681		Approved		uc001xrd.1	Q9UHC1		ENST00000556740.1:c.2102G>A	14.37:g.75514257C>T	ENSP00000452316:p.Ser701Asn		P49751|Q56DK9|Q9P292|Q9UHC0	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_WW_dom,smart_MutL_C	p.S701N	ENST00000556740.1	37	c.2102	CCDS32123.1	14	.	.	.	.	.	.	.	.	.	.	C	8.581	0.882359	0.17467	.	.	ENSG00000119684	ENST00000355774;ENST00000238662;ENST00000556257;ENST00000556740	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	6.07	1.96	0.26148	.	0.809703	0.12253	N	0.485491	T	0.23572	0.0570	L	0.60455	1.87	0.09310	N	0.999995	B;B	0.34015	0.435;0.309	B;B	0.33620	0.167;0.055	T	0.19451	-1.0305	10	0.20519	T	0.43	0.6274	2.1586	0.03819	0.1507:0.3952:0.2922:0.1619	.	701;701	Q9UHC1-2;Q9UHC1	.;MLH3_HUMAN	N	701	ENSP00000348020:S701N;ENSP00000238662:S701N;ENSP00000451540:S701N;ENSP00000452316:S701N	ENSP00000238662:S701N	S	-	2	0	MLH3	74584010	0.000000	0.05858	0.004000	0.12327	0.057000	0.15508	0.130000	0.15850	0.422000	0.26005	0.655000	0.94253	AGC	MLH3	-	NULL	ENSG00000119684		0.348	MLH3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH3	HGNC	protein_coding	OTTHUMT00000415006.1	-	0.00	51	0	C	NM_014381		75514257	-1	tier1	-	no_errors	ENST00000355774	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.001	T
MORC2	22880	genome.wustl.edu	37	22	31330769	31330769	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr22:31330769G>T	ENST00000397641.3	-	19	2600	c.2192C>A	c.(2191-2193)cCg>cAg	p.P731Q	MORC2-AS1_ENST00000441558.1_RNA|MORC2_ENST00000469915.1_5'Flank|MORC2_ENST00000215862.4_Splice_Site_p.P669Q			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	731						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.P669L(1)		breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						GCGTCTCACCGGGGAGAGTTT	0.522																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											169.0	177.0	174.0					22																	31330769		2203	4300	6503	SO:0001630	splice_region_variant	0			AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2193+1C>A	22.37:g.31330769G>T			B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.P731Q	ENST00000397641.3	37	c.2192		22	.	.	.	.	.	.	.	.	.	.	G	1.177	-0.639209	0.03557	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.10763	2.84;2.84	5.52	-0.728	0.11162	.	1.049510	0.07357	N	0.883472	T	0.07593	0.0191	L	0.40543	1.245	0.27914	N	0.938529	B	0.02656	0.0	B	0.04013	0.001	T	0.45279	-0.9272	10	0.12103	T	0.63	.	4.1609	0.10284	0.3811:0.0:0.3695:0.2494	.	731	Q9Y6X9	MORC2_HUMAN	Q	731;669	ENSP00000380763:P731Q;ENSP00000215862:P669Q	ENSP00000215862:P669Q	P	-	2	0	MORC2	29660769	0.073000	0.21202	0.027000	0.17364	0.297000	0.27493	0.142000	0.16096	0.027000	0.15297	0.561000	0.74099	CCG	MORC2	-	NULL	ENSG00000133422		0.522	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	HGNC	protein_coding	OTTHUMT00000321710.2		0.00	48	0	G	NM_014941	Missense_Mutation	31330769	-1			no_errors	ENST00000397641	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.022	T
MOS	4342	genome.wustl.edu	37	8	57025930	57025930	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr8:57025930G>T	ENST00000311923.1	-	1	611	c.612C>A	c.(610-612)ccC>ccA	p.P204P		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	204	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			AGATGTTCGCGGGCTTCAGGT	0.483																																					Esophageal Squamous(124;373 2870 4778)												0													60.0	57.0	58.0					8																	57025930		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.612C>A	8.37:g.57025930G>T			Q3KPG9|Q3KPH0	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P204	ENST00000311923.1	37	c.612	CCDS6164.1	8																																																																																			MOS	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000172680		0.483	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOS	HGNC	protein_coding	OTTHUMT00000378174.1		0.00	17	0	G	NM_005372		57025930	-1			no_errors	ENST00000311923	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.002	T
MRPL14	64928	genome.wustl.edu	37	6	44081844	44081844	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:44081844G>T	ENST00000372014.3	-	3	305	c.174C>A	c.(172-174)atC>atA	p.I58I		NM_032111.2	NP_115487.2	Q6P1L8	RM14_HUMAN	mitochondrial ribosomal protein L14	58					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	12	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0181)			TATAGACATGGATGCAGCGAG	0.562																																																	0													191.0	192.0	191.0					6																	44081844		2203	4300	6503	SO:0001819	synonymous_variant	0			AB051339	CCDS34460.1	6p21.3	2012-09-13			ENSG00000180992	ENSG00000180992		"""Mitochondrial ribosomal proteins / large subunits"""	14279	protein-coding gene	gene with protein product		611827					Standard	XM_005249300		Approved	RPML32, MRP-L32	uc003owp.3	Q6P1L8	OTTHUMG00000014756	ENST00000372014.3:c.174C>A	6.37:g.44081844G>T			B2R575|Q96Q72	Silent	SNP	pfam_Ribosomal_L14b/L23e,superfamily_Ribosomal_L14_dom	p.I58	ENST00000372014.3	37	c.174	CCDS34460.1	6																																																																																			MRPL14	-	pfam_Ribosomal_L14b/L23e,superfamily_Ribosomal_L14_dom	ENSG00000180992		0.562	MRPL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL14	HGNC	protein_coding	OTTHUMT00000040707.1	-	0.00	26	0	G	NM_032111		44081844	-1	tier1	-	no_errors	ENST00000372014	ensembl	human	known	74_37	silent	20.00	12	3	SNP	1.000	T
MRPL20	55052	genome.wustl.edu	37	1	1337597	1337597	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:1337597C>T	ENST00000344843.7	-	4	411	c.316G>A	c.(316-318)Gcc>Acc	p.A106T	CCNL2_ENST00000400809.3_5'Flank|MRPL20_ENST00000493287.1_5'UTR|CCNL2_ENST00000408918.4_5'Flank	NM_017971.3	NP_060441.2	Q9BYC9	RM20_HUMAN	mitochondrial ribosomal protein L20	106					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCGTAGATGGCCAGATCCGCT	0.537																																																	0													88.0	82.0	84.0					1																	1337597		2203	4297	6500	SO:0001583	missense	0			AB049644	CCDS26.1	1p36.3-p36.2	2012-09-13			ENSG00000242485	ENSG00000242485		"""Mitochondrial ribosomal proteins / large subunits"""	14478	protein-coding gene	gene with protein product		611833					Standard	NM_017971		Approved	FLJ10024	uc001afo.4	Q9BYC9	OTTHUMG00000002916	ENST00000344843.7:c.316G>A	1.37:g.1337597C>T	ENSP00000341082:p.Ala106Thr		B2RE41|B7Z746	Missense_Mutation	SNP	pfam_Ribosomal_L20,prints_Ribosomal_L20,tigrfam_Ribosomal_L20	p.A106T	ENST00000344843.7	37	c.316	CCDS26.1	1	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807874	0.70797	.	.	ENSG00000242485	ENST00000344843	.	.	.	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	H	0.97186	3.955	0.80722	D	1	D	0.54047	0.964	D	0.66196	0.942	D	0.91968	0.5584	9	0.87932	D	0	-9.4427	16.9051	0.86124	0.0:1.0:0.0:0.0	.	106	Q9BYC9	RM20_HUMAN	T	106	.	ENSP00000341082:A106T	A	-	1	0	MRPL20	1327460	1.000000	0.71417	0.993000	0.49108	0.416000	0.31233	6.407000	0.73280	2.231000	0.72958	0.467000	0.42956	GCC	MRPL20	-	pfam_Ribosomal_L20,prints_Ribosomal_L20,tigrfam_Ribosomal_L20	ENSG00000242485		0.537	MRPL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL20	HGNC	protein_coding	OTTHUMT00000008139.1		0.00	22	0	C	NM_017971		1337597	-1			no_errors	ENST00000344843	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
MTCH2	23788	genome.wustl.edu	37	11	47653238	47653238	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:47653238G>T	ENST00000302503.3	-	6	552	c.395C>A	c.(394-396)tCt>tAt	p.S132Y	MTCH2_ENST00000534074.1_5'Flank|MTCH2_ENST00000542981.1_Intron	NM_014342.3	NP_055157.1	Q9Y6C9	MTCH2_HUMAN	mitochondrial carrier 2	132					protein localization to mitochondrion (GO:0070585)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	11						GGTAGCAGCAGAACGAGCGAT	0.433																																																	0													172.0	138.0	150.0					11																	47653238		2201	4298	6499	SO:0001583	missense	0			AF085361	CCDS7943.1	11p11.2	2013-05-22	2011-05-19		ENSG00000109919	ENSG00000109919		"""Solute carriers"""	17587	protein-coding gene	gene with protein product	"""solute carrier family 25, member 50"""	613221	"""mitochondrial carrier homolog 2 (C. elegans)"""				Standard	NM_014342		Approved	SLC25A50	uc010rho.2	Q9Y6C9	OTTHUMG00000166926	ENST00000302503.3:c.395C>A	11.37:g.47653238G>T	ENSP00000303222:p.Ser132Tyr		B2R7L8	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.S132Y	ENST00000302503.3	37	c.395	CCDS7943.1	11	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903542	0.92035	.	.	ENSG00000109919	ENST00000302503;ENST00000530428;ENST00000530558	T;T	0.79554	-1.28;-1.28	5.71	5.71	0.89125	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.88336	0.6409	M	0.89904	3.07	0.80722	D	1	P	0.37276	0.589	P	0.45610	0.487	D	0.88156	0.2854	10	0.44086	T	0.13	.	18.6391	0.91389	0.0:0.0:1.0:0.0	.	132	Q9Y6C9	MTCH2_HUMAN	Y	132;123;111	ENSP00000303222:S132Y;ENSP00000432043:S123Y	ENSP00000303222:S132Y	S	-	2	0	MTCH2	47609814	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.913000	0.87471	2.709000	0.92574	0.655000	0.94253	TCT	MTCH2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000109919		0.433	MTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTCH2	HGNC	protein_coding	OTTHUMT00000391921.2	-	0.00	41	0	G	NM_014342		47653238	-1	tier1	-	no_errors	ENST00000302503	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
MTRF1	9617	genome.wustl.edu	37	13	41826879	41826879	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr13:41826879C>T	ENST00000379480.4	-	5	699	c.599G>A	c.(598-600)tGc>tAc	p.C200Y	MTRF1_ENST00000379477.1_Missense_Mutation_p.C200Y|MTRF1_ENST00000239852.6_5'UTR|MTRF1_ENST00000430347.2_Missense_Mutation_p.C213Y	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	200					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		AAATTGTTGGCAGATGTCACC	0.333																																																	0													56.0	53.0	54.0					13																	41826879		2202	4299	6501	SO:0001583	missense	0			AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.599G>A	13.37:g.41826879C>T	ENSP00000368793:p.Cys200Tyr		B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	pfam_Pep_chain_release_fac_I_II,pfam_PCRF,smart_PCRF	p.C213Y	ENST00000379480.4	37	c.638	CCDS9378.1	13	.	.	.	.	.	.	.	.	.	.	C	19.50	3.838742	0.71373	.	.	ENSG00000120662	ENST00000379480;ENST00000379477;ENST00000430347;ENST00000452359	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.88	5.88	0.94601	Peptide chain release factor (2);	0.000000	0.85682	D	0.000000	T	0.62648	0.2445	M	0.63428	1.95	0.80722	D	1	D;D	0.64830	0.994;0.964	P;P	0.62014	0.897;0.832	T	0.62973	-0.6740	10	0.87932	D	0	-8.0782	20.1989	0.98252	0.0:1.0:0.0:0.0	.	213;200	B4DG01;O75570	.;RF1M_HUMAN	Y	200;200;213;200	ENSP00000368793:C200Y;ENSP00000368790:C200Y;ENSP00000400031:C213Y;ENSP00000399279:C200Y	ENSP00000368790:C200Y	C	-	2	0	MTRF1	40724879	1.000000	0.71417	1.000000	0.80357	0.499000	0.33736	7.202000	0.77856	2.784000	0.95788	0.591000	0.81541	TGC	MTRF1	-	pfam_PCRF,smart_PCRF	ENSG00000120662		0.333	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRF1	HGNC	protein_coding	OTTHUMT00000044666.3	-	0.00	45	0	C	NM_004294		41826879	-1	tier1	-	no_errors	ENST00000430347	ensembl	human	known	74_37	missense	70.91	15	39	SNP	1.000	T
MUC4	4585	genome.wustl.edu	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																																	0													10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T3990N	ENST00000463781.3	37	c.11969	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	58	0	G	NM_018406		195506482	-1	tier1	rs113936020	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.003	T
MYO16	23026	genome.wustl.edu	37	13	109617123	109617124	+	Frame_Shift_Ins	INS	-	-	T	rs201689443		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr13:109617123_109617124insT	ENST00000357550.2	+	19	2217_2218	c.2176_2177insT	c.(2176-2178)cgafs	p.R726fs	MYO16_ENST00000457511.2_Frame_Shift_Ins_p.R238fs|MYO16_ENST00000356711.2_Frame_Shift_Ins_p.R726fs|MYO16_ENST00000251041.5_Frame_Shift_Ins_p.R726fs	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TATGATAATACGACGACATACC	0.411																																																	0																																										SO:0001589	frameshift_variant	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	Exception_encountered	13.37:g.109617123_109617124insT	ENSP00000350160:p.Arg726fs			Frame_Shift_Ins	INS	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R726fs	ENST00000357550.2	37	c.2176_2177	CCDS32008.1	13																																																																																			MYO16	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000041515		0.411	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1		0.00	67	0	-	NM_015011		109617124	+1	tier1		no_errors	ENST00000356711	ensembl	human	known	74_37	frame_shift_ins	32.72	109	53	INS	0.055:0.194	T
N4BP2	55728	genome.wustl.edu	37	4	40104792	40104792	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:40104792G>T	ENST00000261435.6	+	4	1743	c.1327G>T	c.(1327-1329)Gtt>Ttt	p.V443F		NM_018177.4	NP_060647.2	Q86UW6	N4BP2_HUMAN	NEDD4 binding protein 2	443					nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|endonuclease activity (GO:0004519)			breast(4)|endometrium(3)|kidney(12)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	60						ACTAGTTCTTGTTCTTCTCAG	0.363																																																	0													65.0	71.0	69.0					4																	40104792		2198	4298	6496	SO:0001583	missense	0			AB037834	CCDS3457.1	4p14	2008-01-18			ENSG00000078177	ENSG00000078177			29851	protein-coding gene	gene with protein product	"""BCL-3 binding protein"""					10718198, 11717310	Standard	NM_018177		Approved	B3BP	uc003guy.4	Q86UW6	OTTHUMG00000128599	ENST00000261435.6:c.1327G>T	4.37:g.40104792G>T	ENSP00000261435:p.Val443Phe		A0AVR3|Q9NVK2|Q9P2D4	Missense_Mutation	SNP	pfam_DUF1771,pfam_Smr/MutS2_C,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Smr/MutS2_C,pfscan_CUE,pfscan_Smr/MutS2_C	p.V443F	ENST00000261435.6	37	c.1327	CCDS3457.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.96|16.96	3.267321|3.267321	0.59540|0.59540	.|.	.|.	ENSG00000078177|ENSG00000078177	ENST00000513269|ENST00000261435;ENST00000381804	.|T	.|0.56103	.|0.48	6.07|6.07	5.24|5.24	0.73138|0.73138	.|.	.|0.178893	.|0.48767	.|D	.|0.000178	T|T	0.64951|0.64951	0.2645|0.2645	L|L	0.51853|0.51853	1.615|1.615	0.51767|0.51767	D|D	0.999938|0.999938	.|D;D	.|0.76494	.|0.998;0.999	.|D;D	.|0.71414	.|0.954;0.973	T|T	0.67741|0.67741	-0.5592|-0.5592	5|10	.|0.87932	.|D	.|0	-14.0965|-14.0965	11.5159|11.5159	0.50520|0.50520	0.1366:0.0:0.8634:0.0|0.1366:0.0:0.8634:0.0	.|.	.|443;443	.|Q86UW6-2;Q86UW6	.|.;N4BP2_HUMAN	F|F	89|443;363	.|ENSP00000261435:V443F	.|ENSP00000261435:V443F	C|V	+|+	2|1	0|0	N4BP2|N4BP2	39781187|39781187	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.619000|0.619000	0.37552|0.37552	3.127000|3.127000	0.50484|0.50484	1.576000|1.576000	0.49790|0.49790	0.655000|0.655000	0.94253|0.94253	TGT|GTT	N4BP2	-	superfamily_P-loop_NTPase	ENSG00000078177		0.363	N4BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2	HGNC	protein_coding	OTTHUMT00000250458.2		0.00	39	0	G	NM_018177		40104792	+1			no_errors	ENST00000261435	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101755521	101755521	+	Splice_Site	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr13:101755521A>G	ENST00000251127.6	-	26	3139		c.e26+1			NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ATTCTCACATACCAAAAAAAT	0.428																																																	0													105.0	113.0	110.0					13																	101755521		2203	4300	6503	SO:0001630	splice_region_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3057+1T>C	13.37:g.101755521A>G			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Splice_Site	SNP	-	e25+2	ENST00000251127.6	37	c.3057+2	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	15.38	2.816307	0.50527	.	.	ENSG00000102452	ENST00000251127	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0866	0.72158	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NALCN	100553522	1.000000	0.71417	0.969000	0.41365	0.376000	0.30014	8.763000	0.91715	2.015000	0.59207	0.528000	0.53228	.	NALCN	-	-	ENSG00000102452		0.428	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	40	0	A	NM_052867	Intron	101755521	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	splice_site	8.05	79	7	SNP	1.000	G
NR1H2	7376	genome.wustl.edu	37	19	50839874	50839875	+	Intron	INS	-	-	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:50839874_50839875insT	ENST00000600978.1	+	2	74				NR1H2_ENST00000542413.1_Intron|NAPSB_ENST00000527780.1_RNA			P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2						cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GAGGCCCAATATCCCATCGGGG	0.545																																																	0																																										SO:0001627	intron_variant	0			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000600978.1:c.75-1384->T	19.37:g.50839875_50839875dupT			A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	RNA	INS	-	NULL	ENST00000600978.1	37	NULL		19																																																																																			NAPSB	-	-	ENSG00000131401		0.545	NR1H2-012	KNOWN	basic	processed_transcript	NAPSB	HGNC	protein_coding	OTTHUMT00000464783.1		0.00	115	0	-			50839875	-1	tier1		no_errors	ENST00000527780	ensembl	human	known	74_37	rna	59.26	44	64	INS	0.957:0.960	T
NCOA7	135112	genome.wustl.edu	37	6	126176272	126176272	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:126176272G>T	ENST00000368357.3	+	4	509	c.157G>T	c.(157-159)Gac>Tac	p.D53Y	NCOA7_ENST00000392477.2_Missense_Mutation_p.D53Y|NCOA7_ENST00000487635.1_3'UTR|NCOA7_ENST00000229634.9_Intron	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	53					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)	p.D53H(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TTTAGAGCCAGACAAGTGCAA	0.378																																																	1	Substitution - Missense(1)	lung(1)											187.0	203.0	197.0					6																	126176272		2203	4300	6503	SO:0001583	missense	0			AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.157G>T	6.37:g.126176272G>T	ENSP00000357341:p.Asp53Tyr		B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	pfam_TLDc,pfam_LysM_dom,pfam_GRAM,smart_LysM_dom,smart_TLDc	p.D53Y	ENST00000368357.3	37	c.157	CCDS5132.1	6	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537134	0.65085	.	.	ENSG00000111912	ENST00000368357;ENST00000431092;ENST00000392477;ENST00000453302;ENST00000417494;ENST00000428318;ENST00000419660	T;T;T;T	0.59224	2.28;2.28;0.28;0.44	5.39	5.39	0.77823	.	0.182796	0.37955	N	0.001871	T	0.56659	0.2000	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.69078	0.992;0.997;0.97;0.963	P;D;P;P	0.63033	0.873;0.91;0.79;0.642	T	0.61382	-0.7074	10	0.72032	D	0.01	-30.4561	17.5251	0.87798	0.0:0.0:1.0:0.0	.	53;53;53;53	Q8NI08-6;Q8NI08-2;Q8NI08-4;Q8NI08	.;.;.;NCOA7_HUMAN	Y	53	ENSP00000357341:D53Y;ENSP00000376269:D53Y;ENSP00000406363:D53Y;ENSP00000408211:D53Y	ENSP00000357341:D53Y	D	+	1	0	NCOA7	126217965	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	5.806000	0.69150	2.810000	0.96702	0.650000	0.86243	GAC	NCOA7	-	NULL	ENSG00000111912		0.378	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA7	HGNC	protein_coding	OTTHUMT00000042083.4		0.00	37	0	G	XM_059748		126176272	+1			no_errors	ENST00000368357	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
NFASC	23114	genome.wustl.edu	37	1	204990510	204990510	+	3'UTR	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:204990510C>G	ENST00000401399.1	+	0	8765				NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000367171.4_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AGCTGCTGTTCCTCCTATCAG	0.473																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*4843C>G	1.37:g.204990510C>G			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			NFASC	-	-	ENSG00000163531		0.473	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	-	0.00	53	0	C	NM_001005388		204990510	+1	tier1	-	no_errors	ENST00000495396	ensembl	human	known	74_37	rna	7.25	64	5	SNP	0.000	G
NID1	4811	genome.wustl.edu	37	1	236212189	236212189	+	Missense_Mutation	SNP	G	G	T	rs202192927		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:236212189G>T	ENST00000264187.6	-	2	408	c.326C>A	c.(325-327)gCg>gAg	p.A109E	NID1_ENST00000366595.3_Missense_Mutation_p.A109E	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	109	NIDO. {ECO:0000255|PROSITE- ProRule:PRU00570}.				basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	GTCCAAGTCCGCCAGGAAAGG	0.567																																																	0													67.0	74.0	71.0					1																	236212189		2203	4300	6503	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.326C>A	1.37:g.236212189G>T	ENSP00000264187:p.Ala109Glu		Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.A109E	ENST00000264187.6	37	c.326	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.567338	0.65651	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	D;D	0.90385	-2.02;-2.66	4.81	3.89	0.44902	Nidogen, extracellular domain (2);	0.158566	0.56097	D	0.000030	D	0.94262	0.8157	M	0.81341	2.54	0.38718	D	0.95337	D;P	0.64830	0.994;0.922	P;P	0.61477	0.889;0.726	D	0.95466	0.8547	10	0.87932	D	0	.	13.4174	0.60976	0.0768:0.0:0.9232:0.0	.	109;109	P14543-2;P14543	.;NID1_HUMAN	E	109	ENSP00000264187:A109E;ENSP00000355554:A109E	ENSP00000264187:A109E	A	-	2	0	NID1	234278812	1.000000	0.71417	0.863000	0.33907	0.537000	0.34900	4.324000	0.59228	1.223000	0.43536	0.655000	0.94253	GCG	NID1	-	smart_Nidogen_extracell_dom	ENSG00000116962		0.567	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2		0.00	40	0	G	NM_002508		236212189	-1			no_errors	ENST00000264187	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.977	T
NPAS4	266743	genome.wustl.edu	37	11	66190289	66190289	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:66190289G>C	ENST00000311034.2	+	4	751	c.575G>C	c.(574-576)tGt>tCt	p.C192S		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	192					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						ACAGCTTTCTGTGCCCCTCTG	0.627																																																	0													88.0	87.0	88.0					11																	66190289		2200	4295	6495	SO:0001583	missense	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.575G>C	11.37:g.66190289G>C	ENSP00000311196:p.Cys192Ser		B7ZL81|Q8N8S5|Q8N9Q9	Missense_Mutation	SNP	pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.C192S	ENST00000311034.2	37	c.575	CCDS8138.1	11	.	.	.	.	.	.	.	.	.	.	G	27.3	4.823394	0.90873	.	.	ENSG00000174576	ENST00000311034	T	0.53857	0.6	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000006	T	0.76335	0.3973	M	0.87097	2.86	0.80722	D	1	D	0.60575	0.988	D	0.70016	0.967	T	0.78826	-0.2051	10	0.54805	T	0.06	-6.5234	17.4135	0.87493	0.0:0.0:1.0:0.0	.	192	Q8IUM7	NPAS4_HUMAN	S	192	ENSP00000311196:C192S	ENSP00000311196:C192S	C	+	2	0	NPAS4	65946865	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.720000	0.74723	2.702000	0.92279	0.655000	0.94253	TGT	NPAS4	-	NULL	ENSG00000174576		0.627	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	-	0.00	25	0	G	NM_178864		66190289	+1	tier1	-	no_errors	ENST00000311034	ensembl	human	known	74_37	missense	26.92	19	7	SNP	1.000	C
NTN4	59277	genome.wustl.edu	37	12	96063915	96063915	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:96063915G>T	ENST00000343702.4	-	8	1966	c.1518C>A	c.(1516-1518)tgC>tgA	p.C506*	PGAM1P5_ENST00000552554.1_RNA|NTN4_ENST00000553059.1_Intron|NTN4_ENST00000344911.4_Nonsense_Mutation_p.C469*|NTN4_ENST00000538383.1_Nonsense_Mutation_p.C469*	NM_021229.3	NP_067052.2	Q9HB63	NET4_HUMAN	netrin 4	506	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				axon guidance (GO:0007411)|extracellular matrix organization (GO:0030198)|neuron remodeling (GO:0016322)|regulation of branching involved in salivary gland morphogenesis by extracellular matrix-epithelial cell signaling (GO:0060668)	basement membrane (GO:0005604)|plasma membrane (GO:0005886)				NS(2)|breast(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						CCTTACATTCGCATTTACCTA	0.343																																																	0													95.0	85.0	88.0					12																	96063915		2203	4300	6503	SO:0001587	stop_gained	0			AF119916	CCDS9054.1	12q22	2013-03-01			ENSG00000074527	ENSG00000074527		"""Netrins"""	13658	protein-coding gene	gene with protein product	"""beta-netrin"", ""Netrin-4"""	610401				11038171	Standard	NM_021229		Approved		uc001tei.3	Q9HB63	OTTHUMG00000170290	ENST00000343702.4:c.1518C>A	12.37:g.96063915G>T	ENSP00000340998:p.Cys506*		B2RNC2|Q658K9|Q7L3F1|Q7L9D6|Q7Z5B6|Q9BZP1|Q9NT44|Q9P133	Nonsense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_Netrin_module_non-TIMP,pfscan_EGF_laminin,pfscan_Laminin_N,pfscan_Netrin_domain	p.C506*	ENST00000343702.4	37	c.1518	CCDS9054.1	12	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924240	0.92319	.	.	ENSG00000074527	ENST00000343702;ENST00000344911;ENST00000538383	.	.	.	5.98	2.25	0.28309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.4088	0.49913	0.8039:0.0:0.1961:0.0	.	.	.	.	X	506;469;469	.	ENSP00000340998:C506X	C	-	3	2	NTN4	94588046	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	0.985000	0.29578	0.156000	0.19299	-1.405000	0.01134	TGC	NTN4	-	superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain	ENSG00000074527		0.343	NTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTN4	HGNC	protein_coding	OTTHUMT00000408372.1		0.00	22	0	G	NM_021229		96063915	-1			no_errors	ENST00000343702	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	0.999	T
OGFRL1	79627	genome.wustl.edu	37	6	72011135	72011135	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:72011135G>T	ENST00000370435.4	+	7	873	c.739G>T	c.(739-741)Ggt>Tgt	p.G247C	RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA|RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	247						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						TAAAAGCCTTGGTGAGCTTGG	0.383																																																	0													182.0	208.0	199.0					6																	72011135		2203	4300	6503	SO:0001583	missense	0				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.739G>T	6.37:g.72011135G>T	ENSP00000359464:p.Gly247Cys		Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	pfam_OGF_rcpt	p.G247C	ENST00000370435.4	37	c.739	CCDS34482.1	6	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761108	0.89932	.	.	ENSG00000119900	ENST00000370435	T	0.53423	0.62	6.04	6.04	0.98038	Opioid growth factor receptor (OGFr) conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62969	-0.6741	10	0.56958	D	0.05	-18.6506	20.5948	0.99439	0.0:0.0:1.0:0.0	.	247	Q5TC84	OGRL1_HUMAN	C	247	ENSP00000359464:G247C	ENSP00000359464:G247C	G	+	1	0	OGFRL1	72067856	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.869000	0.99810	2.873000	0.98535	0.563000	0.77884	GGT	OGFRL1	-	pfam_OGF_rcpt	ENSG00000119900		0.383	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFRL1	HGNC	protein_coding	OTTHUMT00000041153.2	-	0.00	44	0	G	NM_024576		72011135	+1	tier1	-	no_errors	ENST00000370435	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
OR2T2	401992	genome.wustl.edu	37	1	248616883	248616883	+	Missense_Mutation	SNP	T	T	A	rs143551105	byFrequency	TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:248616883T>A	ENST00000342927.3	+	1	807	c.785T>A	c.(784-786)cTg>cAg	p.L262Q		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCAACGTGCTGCCCCACTCC	0.537																																																	0													21.0	19.0	20.0					1																	248616883		2179	4264	6443	SO:0001583	missense	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.785T>A	1.37:g.248616883T>A	ENSP00000343062:p.Leu262Gln		B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L262Q	ENST00000342927.3	37	c.785	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	t	9.878	1.200859	0.22121	.	.	ENSG00000196240	ENST00000342927	T	0.37584	1.19	3.5	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35291	N	0.003307	T	0.28962	0.0719	N	0.04260	-0.245	0.19300	N	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.06092	-1.0846	10	0.30078	T	0.28	.	5.2576	0.15555	0.1723:0.0:0.1769:0.6508	.	262	Q6IF00	OR2T2_HUMAN	Q	262	ENSP00000343062:L262Q	ENSP00000343062:L262Q	L	+	2	0	OR2T2	246683506	0.000000	0.05858	0.864000	0.33941	0.263000	0.26337	0.284000	0.18864	1.431000	0.47355	0.374000	0.22700	CTG	OR2T2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196240		0.537	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	-	0.00	26	0	T	NM_001004136		248616883	+1	tier1	rs143551105	no_errors	ENST00000342927	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.339	A
OR5C1	392391	genome.wustl.edu	37	9	125552143	125552143	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:125552143G>A	ENST00000373680.2	+	1	994	c.932G>A	c.(931-933)cGa>cAa	p.R311Q		NM_001001923.1	NP_001001923.1	Q8NGR4	OR5C1_HUMAN	olfactory receptor, family 5, subfamily C, member 1	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(5)|lung(6)|pancreas(1)|prostate(5)|skin(1)	20						ACCTGGAGCCGATTCCACTGT	0.602																																																	0													55.0	48.0	51.0					9																	125552143		2203	4300	6503	SO:0001583	missense	0			AF399514	CCDS35131.1	9q34.2	2012-08-09			ENSG00000148215	ENSG00000148215		"""GPCR / Class A : Olfactory receptors"""	8331	protein-coding gene	gene with protein product				OR5C2P			Standard	NM_001001923		Approved	OR9-F, hRPK-465_F_21	uc011lzd.2	Q8NGR4	OTTHUMG00000020622	ENST00000373680.2:c.932G>A	9.37:g.125552143G>A	ENSP00000362784:p.Arg311Gln		B2RN54|B9EGT0|Q96RC4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R311Q	ENST00000373680.2	37	c.932	CCDS35131.1	9	.	.	.	.	.	.	.	.	.	.	G	16.62	3.172902	0.57584	.	.	ENSG00000148215	ENST00000373680	T	0.39056	1.1	5.22	2.34	0.29019	.	0.000000	0.29822	U	0.011104	T	0.30324	0.0761	L	0.39326	1.205	0.09310	N	0.999997	B	0.20052	0.041	B	0.08055	0.003	T	0.25047	-1.0143	10	0.72032	D	0.01	.	6.9559	0.24570	0.2929:0.0:0.7071:0.0	.	311	Q8NGR4	OR5C1_HUMAN	Q	311	ENSP00000362784:R311Q	ENSP00000362784:R311Q	R	+	2	0	OR5C1	124591964	0.004000	0.15560	0.026000	0.17262	0.005000	0.04900	1.257000	0.32932	0.337000	0.23665	-0.136000	0.14681	CGA	OR5C1	-	NULL	ENSG00000148215		0.602	OR5C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5C1	HGNC	protein_coding	OTTHUMT00000053953.1	-	0.00	27	0	G			125552143	+1	tier1	-	no_errors	ENST00000373680	ensembl	human	known	74_37	missense	38.89	22	14	SNP	0.247	A
PAFAH1B1	5048	genome.wustl.edu	37	17	2587317	2587317	+	3'UTR	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:2587317G>A	ENST00000397195.5	+	0	3905				RP11-74E22.5_ENST00000610120.1_RNA|PAFAH1B1_ENST00000572915.2_3'UTR|RN7SL608P_ENST00000492377.2_RNA	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						TTCCCCTGCAGCACACAGCGA	0.453																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.*2221G>A	17.37:g.2587317G>A				RNA	SNP	-	NULL	ENST00000397195.5	37	NULL	CCDS32528.1	17																																																																																			PAFAH1B1	-	-	ENSG00000007168		0.453	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	HGNC	protein_coding	OTTHUMT00000437797.2	-	0.00	35	0	G	NM_000430		2587317	+1	tier1	-	no_errors	ENST00000572915	ensembl	human	known	74_37	rna	68.18	14	30	SNP	0.640	A
PARD3	56288	genome.wustl.edu	37	10	34625163	34625163	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:34625163C>A	ENST00000374789.3	-	18	2903	c.2578G>T	c.(2578-2580)Gag>Tag	p.E860*	PARD3_ENST00000374776.1_Nonsense_Mutation_p.E814*|PARD3_ENST00000466092.1_5'UTR|PARD3_ENST00000340077.5_Nonsense_Mutation_p.E857*|PARD3_ENST00000374788.3_Nonsense_Mutation_p.E857*|PARD3_ENST00000374790.3_Nonsense_Mutation_p.E800*|PARD3_ENST00000346874.4_Nonsense_Mutation_p.E860*|PARD3_ENST00000544292.1_Nonsense_Mutation_p.E573*|PARD3_ENST00000545260.1_Nonsense_Mutation_p.E770*|PARD3_ENST00000350537.4_Nonsense_Mutation_p.E814*|PARD3_ENST00000374794.3_Intron|PARD3_ENST00000374773.1_Nonsense_Mutation_p.E827*|PARD3_ENST00000545693.1_Nonsense_Mutation_p.E844*	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	860	Interacts with PRKCI and PRKCZ. {ECO:0000250}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				AGTTTAGTCTCGTCAGCTACT	0.413																																																	0													249.0	200.0	217.0					10																	34625163		2203	4300	6503	SO:0001587	stop_gained	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2578G>T	10.37:g.34625163C>A	ENSP00000363921:p.Glu860*		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Nonsense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E860*	ENST00000374789.3	37	c.2578	CCDS7178.1	10	.	.	.	.	.	.	.	.	.	.	C	45	11.345933	0.99549	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292	.	.	.	5.99	5.99	0.97316	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	.	.	.	X	844;770;860;857;860;814;800;814;857;827;573	.	ENSP00000341844:E857X	E	-	1	0	PARD3	34665169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.092000	0.76930	2.840000	0.97914	0.655000	0.94253	GAG	PARD3	-	NULL	ENSG00000148498		0.413	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1		0.00	41	0	C	NM_019619		34625163	-1			no_errors	ENST00000374789	ensembl	human	known	74_37	nonsense	7.69	24	2	SNP	1.000	A
PCDHGB6	56100	genome.wustl.edu	37	5	140789354	140789354	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:140789354G>A	ENST00000520790.1	+	1	1585	c.1585G>A	c.(1585-1587)Gcg>Acg	p.A529T	PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	529	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGCGCCTTCGCGCTCACGCT	0.692																																																	0													17.0	20.0	19.0					5																	140789354		2005	4162	6167	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.1585G>A	5.37:g.140789354G>A	ENSP00000428603:p.Ala529Thr		Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A529T	ENST00000520790.1	37	c.1585	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	10.43	1.349016	0.24426	.	.	ENSG00000253305	ENST00000520790	T	0.01821	4.62	5.36	-2.5	0.06384	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.00906	0.0030	N	0.01410	-0.885	0.21627	N	0.999611	B;B	0.20164	0.042;0.034	B;B	0.14578	0.011;0.006	T	0.49051	-0.8979	9	0.87932	D	0	.	11.6796	0.51451	0.0634:0.6268:0.2181:0.0918	.	529;529	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	T	529	ENSP00000428603:A529T	ENSP00000428603:A529T	A	+	1	0	PCDHGB6	140769538	0.000000	0.05858	0.573000	0.28510	0.157000	0.22087	-2.687000	0.00833	-0.945000	0.03681	-0.502000	0.04539	GCG	PCDHGB6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253305		0.692	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1	-	0.00	38	0	G	NM_018926		140789354	+1	tier1	-	no_errors	ENST00000520790	ensembl	human	known	74_37	missense	82.35	6	28	SNP	0.876	A
PCLO	27445	genome.wustl.edu	37	7	82585187	82585187	+	Silent	SNP	G	G	A	rs367988765		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:82585187G>A	ENST00000333891.9	-	5	5419	c.5082C>T	c.(5080-5082)gaC>gaT	p.D1694D	PCLO_ENST00000423517.2_Silent_p.D1694D	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.D1694D(2)|p.D1625D(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTGGCTCTTCGTCAAAATACA	0.438																																																	3	Substitution - coding silent(3)	endometrium(3)						A	,	1,3719		0,1,1859	92.0	84.0	87.0		5082,5082	0.4	1.0	7		87	0,8190		0,0,4095	no	coding-synonymous,coding-synonymous	PCLO	NM_014510.2,NM_033026.5	,	0,1,5954	AA,AG,GG		0.0,0.0269,0.0084	,	1694/4936,1694/5143	82585187	1,11909	1860	4095	5955	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5082C>T	7.37:g.82585187G>A				Silent	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.D1694	ENST00000333891.9	37	c.5082	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	25	0	G	NM_014510		82585187	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	34.88	28	15	SNP	0.995	A
PDDC1	347862	genome.wustl.edu	37	11	770841	770841	+	3'UTR	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:770841G>T	ENST00000319863.8	-	0	740				PDDC1_ENST00000442059.2_3'UTR|PDDC1_ENST00000526325.1_Intron|PDDC1_ENST00000529966.1_5'UTR|PDDC1_ENST00000397472.2_Intron|PDDC1_ENST00000524550.1_3'UTR	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1							extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGCCTGAGACGGGGCTGCCTC	0.612																																																	0													53.0	51.0	52.0					11																	770841		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.*56C>A	11.37:g.770841G>T			B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	RNA	SNP	-	NULL	ENST00000319863.8	37	NULL	CCDS7713.1	11																																																																																			PDDC1	-	-	ENSG00000177225		0.612	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDDC1	HGNC	protein_coding	OTTHUMT00000258051.2	-	0.00	47	0	G	NM_182612		770841	-1	tier1	-	no_errors	ENST00000529966	ensembl	human	known	74_37	rna	9.09	50	5	SNP	0.000	T
PHLDB3	653583	genome.wustl.edu	37	19	43999428	43999428	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:43999428G>A	ENST00000292140.5	-	8	1375	c.1015C>T	c.(1015-1017)Ccc>Tcc	p.P339S		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	339							enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				GCCGGGTTGGGCTCAGAGAAG	0.577																																																	0													45.0	50.0	48.0					19																	43999428		2018	4170	6188	SO:0001583	missense	0				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1015C>T	19.37:g.43999428G>A	ENSP00000292140:p.Pro339Ser		Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P339S	ENST00000292140.5	37	c.1015	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	G	4.915	0.170049	0.09339	.	.	ENSG00000176531	ENST00000292140	T	0.48201	0.82	3.85	-0.0113	0.13993	.	.	.	.	.	T	0.27349	0.0671	N	0.17082	0.46	0.20563	N	0.999882	B;B	0.13594	0.0;0.008	B;B	0.11329	0.005;0.006	T	0.18335	-1.0340	9	0.34782	T	0.22	.	6.0096	0.19567	0.4143:0.0:0.5857:0.0	.	43;339	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	S	339	ENSP00000292140:P339S	ENSP00000292140:P339S	P	-	1	0	PHLDB3	48691268	0.692000	0.27719	0.364000	0.25888	0.184000	0.23303	0.160000	0.16462	0.100000	0.17581	0.585000	0.79938	CCC	PHLDB3	-	NULL	ENSG00000176531		0.577	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	-	0.00	58	0	G			43999428	-1	tier1	-	no_errors	ENST00000292140	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.381	A
PEG3	5178	genome.wustl.edu	37	19	57325172	57325172	+	Silent	SNP	G	G	T	rs189053356		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:57325172G>T	ENST00000326441.9	-	10	5001	c.4638C>A	c.(4636-4638)atC>atA	p.I1546I	ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000423103.2_Silent_p.I1546I|PEG3_ENST00000593695.1_Silent_p.I1420I|PEG3_ENST00000598410.1_Silent_p.I1422I	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1546					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.I1546M(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGGCACGTTCGATGTAGCCTG	0.517																																																	2	Substitution - Missense(2)	lung(2)											151.0	129.0	137.0					19																	57325172		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4638C>A	19.37:g.57325172G>T			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.I1546	ENST00000326441.9	37	c.4638	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.517	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2		0.00	31	0	G			57325172	-1			no_errors	ENST00000326441	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.000	T
PLSCR4	57088	genome.wustl.edu	37	3	145912920	145912920	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:145912920G>T	ENST00000354952.2	-	8	1176	c.936C>A	c.(934-936)tgC>tgA	p.C312*	PLSCR4_ENST00000383083.2_Nonsense_Mutation_p.C222*|PLSCR4_ENST00000446574.2_Nonsense_Mutation_p.C312*|PLSCR4_ENST00000433593.2_Nonsense_Mutation_p.C207*|PLSCR4_ENST00000493382.1_Nonsense_Mutation_p.C312*	NM_020353.2	NP_065086.2	Q9NRQ2	PLS4_HUMAN	phospholipid scramblase 4	312					cellular response to lipopolysaccharide (GO:0071222)|phospholipid scrambling (GO:0017121)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|enzyme binding (GO:0019899)|phospholipid scramblase activity (GO:0017128)			kidney(1)|large_intestine(6)|lung(9)|urinary_tract(1)	17						CAATGAGGAAGCAAGCTCCAA	0.398																																																	0													126.0	108.0	114.0					3																	145912920		2203	4300	6503	SO:0001587	stop_gained	0			AF199023	CCDS3133.1, CCDS54651.1	3q24	2008-07-18			ENSG00000114698	ENSG00000114698			16497	protein-coding gene	gene with protein product		607612				10930526	Standard	NM_020353		Approved		uc003evt.4	Q9NRQ2	OTTHUMG00000159415	ENST00000354952.2:c.936C>A	3.37:g.145912920G>T	ENSP00000347038:p.Cys312*		A8K2E9|Q2TTR3|Q658L3|Q6ZR73|Q7Z505	Nonsense_Mutation	SNP	pfam_Scramblase	p.C312*	ENST00000354952.2	37	c.936	CCDS3133.1	3	.	.	.	.	.	.	.	.	.	.	G	16.80	3.221993	0.58560	.	.	ENSG00000114698	ENST00000354952;ENST00000383083;ENST00000433593;ENST00000446574;ENST00000493382	.	.	.	4.62	2.81	0.32909	.	0.000000	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.58	0.27959	0.2715:0.0:0.7285:0.0	.	.	.	.	X	312;222;207;312;312	.	ENSP00000347038:C312X	C	-	3	2	PLSCR4	147395610	1.000000	0.71417	1.000000	0.80357	0.311000	0.27955	1.544000	0.36158	0.664000	0.31047	0.491000	0.48974	TGC	PLSCR4	-	pfam_Scramblase	ENSG00000114698		0.398	PLSCR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLSCR4	HGNC	protein_coding	OTTHUMT00000355172.1	-	0.00	32	0	G	NM_020353		145912920	-1	tier1	-	no_errors	ENST00000354952	ensembl	human	known	74_37	nonsense	7.69	48	4	SNP	1.000	T
POM121L9P	29774	genome.wustl.edu	37	22	24657660	24657660	+	RNA	SNP	G	G	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr22:24657660G>C	ENST00000414583.2	+	0	2077					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CTACCTCGCAGGGCTCAGCAG	0.647																																																	0																																												0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24657660G>C				Splice_Site	SNP	-	NULL	ENST00000414583.2	37	c.NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.647	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	-	0.00	84	0	G	NM_014549		24657660	+1	tier1	-	no_errors	ENST00000414583	ensembl	human	known	74_37	splice_site	47.62	32	30	SNP	0.000	C
PPM1E	22843	genome.wustl.edu	37	17	57049601	57049601	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr17:57049601G>T	ENST00000308249.2	+	5	1210	c.1081G>T	c.(1081-1083)Gtt>Ttt	p.V361F		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	86					protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GGGCCAAGCTGTTGAACTAAT	0.443																																																	0													111.0	99.0	103.0					17																	57049601		2203	4300	6503	SO:0001583	missense	0			AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.1081G>T	17.37:g.57049601G>T	ENSP00000312411:p.Val361Phe		Q8N8J9|Q96DB8	Missense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.V361F	ENST00000308249.2	37	c.1081	CCDS11613.1	17	.	.	.	.	.	.	.	.	.	.	G	28.8	4.953496	0.92660	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.10573	2.86	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.35799	0.0944	M	0.74546	2.27	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.83275	0.975;0.996	T	0.06935	-1.0799	10	0.54805	T	0.06	-18.6608	18.8738	0.92327	0.0:0.0:1.0:0.0	.	370;361	Q8WY54-3;Q8WY54-2	.;.	F	361;212	ENSP00000312411:V361F	ENSP00000312411:V361F	V	+	1	0	PPM1E	54404383	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.869000	0.99810	2.441000	0.82636	0.462000	0.41574	GTT	PPM1E	-	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	ENSG00000175175		0.443	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	HGNC	protein_coding	OTTHUMT00000445458.1	-	0.00	52	0	G	NM_014906		57049601	+1	tier1	-	no_errors	ENST00000308249	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
PQLC1	80148	genome.wustl.edu	37	18	77710831	77710831	+	Silent	SNP	G	G	T	rs201497747		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr18:77710831G>T	ENST00000397778.2	-	2	278	c.96C>A	c.(94-96)ccC>ccA	p.P32P	PQLC1_ENST00000409073.1_5'Flank|PQLC1_ENST00000357575.4_Silent_p.P32P|PQLC1_ENST00000590381.1_Silent_p.P32P	NM_025078.4	NP_079354.2	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1	32	PQ-loop 1.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	9		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		GCGGGACGTAGGGCACCACCC	0.667																																																	0													49.0	43.0	45.0					18																	77710831		2201	4299	6500	SO:0001819	synonymous_variant	0			AK123870	CCDS12020.1, CCDS54192.1, CCDS54193.1	18q23	2004-01-14			ENSG00000122490	ENSG00000122490			26188	protein-coding gene	gene with protein product						12477932	Standard	NM_025078		Approved	FLJ22378	uc002lnl.2	Q8N2U9	OTTHUMG00000132921	ENST00000397778.2:c.96C>A	18.37:g.77710831G>T			B7Z7D9|G5E989|Q9H6D0	Silent	SNP	smart_CTNS	p.P32	ENST00000397778.2	37	c.96	CCDS12020.1	18																																																																																			PQLC1	-	smart_CTNS	ENSG00000122490		0.667	PQLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PQLC1	HGNC	protein_coding	OTTHUMT00000256434.1	-	0.00	34	0	G	NM_025078		77710831	-1	tier1	rs201497747	no_errors	ENST00000397778	ensembl	human	known	74_37	silent	16.67	20	4	SNP	0.499	T
PRDX1	5052	genome.wustl.edu	37	1	45977030	45977030	+	Missense_Mutation	SNP	T	T	G	rs11544936		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:45977030T>G	ENST00000262746.1	-	6	910	c.571A>C	c.(571-573)Agc>Cgc	p.S191R	PRDX1_ENST00000372079.1_Missense_Mutation_p.S89R|PRDX1_ENST00000319248.8_Missense_Mutation_p.S191R	NM_002574.3|NM_181696.2	NP_002565.1|NP_859047.1	Q06830	PRDX1_HUMAN	peroxiredoxin 1	191				S -> T (in Ref. 2). {ECO:0000305}.	cell proliferation (GO:0008283)|erythrocyte homeostasis (GO:0034101)|hydrogen peroxide catabolic process (GO:0042744)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of NF-kappaB import into nucleus (GO:0042345)|regulation of stress-activated MAPK cascade (GO:0032872)|removal of superoxide radicals (GO:0019430)|retina homeostasis (GO:0001895)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)	heme binding (GO:0020037)|peroxidase activity (GO:0004601)|poly(A) RNA binding (GO:0044822)|thioredoxin peroxidase activity (GO:0008379)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)					TATTCTTTGCTCTTTTGGACA	0.463																																																	0													207.0	215.0	212.0					1																	45977030		2203	4300	6503	SO:0001583	missense	0			BC021683	CCDS522.1	1p34.1	2008-02-05			ENSG00000117450	ENSG00000117450			9352	protein-coding gene	gene with protein product		176763		PAGA		8496166	Standard	NM_181697		Approved	NKEFA	uc021omw.1	Q06830	OTTHUMG00000007738	ENST00000262746.1:c.571A>C	1.37:g.45977030T>G	ENSP00000262746:p.Ser191Arg		B5BU26|D3DPZ8|P35703|Q2V576|Q5T154|Q5T155	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Redoxin,pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	p.S191R	ENST00000262746.1	37	c.571	CCDS522.1	1	.	.	.	.	.	.	.	.	.	.	T	30	5.058131	0.93846	.	.	ENSG00000117450	ENST00000262746;ENST00000319248;ENST00000372079	T;T;T	0.31247	1.5;1.5;1.5	5.04	5.04	0.67666	Peroxiredoxin, C-terminal (1);Thioredoxin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	M	0.93420	3.415	0.80722	D	1	D	0.54601	0.967	P	0.58577	0.841	T	0.73839	-0.3856	10	0.87932	D	0	-16.3351	14.8036	0.69935	0.0:0.0:0.0:1.0	.	191	Q06830	PRDX1_HUMAN	R	191;191;89	ENSP00000262746:S191R;ENSP00000361152:S191R;ENSP00000361150:S89R	ENSP00000262746:S191R	S	-	1	0	PRDX1	45749617	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.800000	0.85949	1.900000	0.55004	0.379000	0.24179	AGC	PRDX1	-	pfam_Peroxiredoxin_C,superfamily_Thioredoxin-like_fold	ENSG00000117450		0.463	PRDX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX1	HGNC	protein_coding	OTTHUMT00000020845.1	-	0.00	23	0	T	NM_181697		45977030	-1	tier1	-	no_errors	ENST00000262746	ensembl	human	known	74_37	missense	65.38	9	17	SNP	1.000	G
PRPF18	8559	genome.wustl.edu	37	10	13672330	13672330	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:13672330A>G	ENST00000378572.3	+	10	1179	c.1019A>G	c.(1018-1020)aAt>aGt	p.N340S	RP11-295P9.3_ENST00000596044.1_Missense_Mutation_p.N16S	NM_003675.3	NP_003666.1	Q99633	PRP18_HUMAN	pre-mRNA processing factor 18	340					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	potassium channel inhibitor activity (GO:0019870)			central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(5)|prostate(1)	17						GTGGAGTACAATGCACTGTGA	0.398																																																	0													190.0	165.0	174.0					10																	13672330		2203	4300	6503	SO:0001583	missense	0			U51990	CCDS7100.1	10p12.33	2013-06-10	2013-06-10		ENSG00000165630	ENSG00000165630			17351	protein-coding gene	gene with protein product		604993	"""PRP18 pre-mRNA processing factor 18 homolog (yeast)"", ""PRP18 pre-mRNA processing factor 18 homolog (S. cerevisiae)"""			9000057	Standard	XM_005252634		Approved	hPrp18	uc001imp.3	Q99633	OTTHUMG00000017702	ENST00000378572.3:c.1019A>G	10.37:g.13672330A>G	ENSP00000367835:p.Asn340Ser		Q5T9P9|Q9BUI9	Missense_Mutation	SNP	pfam_Prp18,pfam_PRP4-like,superfamily_Prp18,smart_SFM	p.N340S	ENST00000378572.3	37	c.1019	CCDS7100.1	10	.	.	.	.	.	.	.	.	.	.	A	15.01	2.706449	0.48412	.	.	ENSG00000165630	ENST00000378572	.	.	.	5.66	5.66	0.87406	.	0.043520	0.85682	D	0.000000	T	0.42177	0.1191	N	0.22421	0.69	0.80722	D	1	B	0.27229	0.172	B	0.16289	0.015	T	0.30822	-0.9965	9	0.17832	T	0.49	-40.4128	15.8912	0.79299	1.0:0.0:0.0:0.0	.	340	Q99633	PRP18_HUMAN	S	340	.	ENSP00000367835:N340S	N	+	2	0	PRPF18	13712336	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	8.045000	0.89436	2.158000	0.67659	0.482000	0.46254	AAT	PRPF18	-	NULL	ENSG00000165630		0.398	PRPF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF18	HGNC	protein_coding	OTTHUMT00000046879.1	-	0.00	61	0	A			13672330	+1	tier1	-	no_errors	ENST00000378572	ensembl	human	known	74_37	missense	42.19	37	27	SNP	1.000	G
PRR23A	729627	genome.wustl.edu	37	3	138724446	138724446	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:138724446A>G	ENST00000383163.2	-	1	664	c.665T>C	c.(664-666)cTt>cCt	p.L222P	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	222	Pro-rich.									endometrium(3)|kidney(1)|lung(7)	11						AGGCTCCAGAAGGCGGAATTC	0.682																																																	0													34.0	40.0	38.0					3																	138724446		692	1591	2283	SO:0001583	missense	0				CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.665T>C	3.37:g.138724446A>G	ENSP00000372649:p.Leu222Pro			Missense_Mutation	SNP	pfam_UPF0572	p.L222P	ENST00000383163.2	37	c.665	CCDS46923.1	3	.	.	.	.	.	.	.	.	.	.	A	10.79	1.450505	0.26074	.	.	ENSG00000206260	ENST00000383163	.	.	.	3.23	2.02	0.26589	.	0.660827	0.12704	N	0.446062	T	0.52725	0.1752	L	0.59436	1.845	0.09310	N	0.999999	D	0.63046	0.992	D	0.64144	0.922	T	0.35176	-0.9799	9	0.87932	D	0	.	5.6575	0.17650	0.7587:0.0:0.0:0.2413	.	222	A6NEV1	PR23A_HUMAN	P	222	.	ENSP00000372649:L222P	L	-	2	0	PRR23A	140207136	0.001000	0.12720	0.001000	0.08648	0.146000	0.21551	0.957000	0.29215	0.603000	0.29913	0.482000	0.46254	CTT	PRR23A	-	pfam_UPF0572	ENSG00000206260		0.682	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR23A	HGNC	protein_coding	OTTHUMT00000361503.1	-	0.00	124	0	A	NM_001134659		138724446	-1	tier1	-	no_errors	ENST00000383163	ensembl	human	known	74_37	missense	23.19	105	32	SNP	0.001	G
PTPRZ1	5803	genome.wustl.edu	37	7	121679506	121679506	+	Splice_Site	SNP	A	A	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:121679506A>C	ENST00000393386.2	+	20	5913		c.e20-1		PTPRZ1_ENST00000449182.1_Splice_Site	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1						axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TTTCTTTTGCAGAGAAAATGT	0.428																																																	0													81.0	80.0	80.0					7																	121679506		2203	4300	6503	SO:0001630	splice_region_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.5503-1A>C	7.37:g.121679506A>C			A4D0W5|C9JFM0|O76043|Q9UDR6	Splice_Site	SNP	-	e20-2	ENST00000393386.2	37	c.5503-2	CCDS34740.1	7	.	.	.	.	.	.	.	.	.	.	A	23.4	4.414254	0.83449	.	.	ENSG00000106278	ENST00000393386;ENST00000449182	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3015	0.82820	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPRZ1	121466742	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.287000	0.95975	2.239000	0.73571	0.533000	0.62120	.	PTPRZ1	-	-	ENSG00000106278		0.428	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	-	0.00	22	0	A	NM_002851	Intron	121679506	+1	tier1	-	no_errors	ENST00000393386	ensembl	human	known	74_37	splice_site	33.33	34	17	SNP	1.000	C
QSER1	79832	genome.wustl.edu	37	11	32987900	32987900	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:32987900A>G	ENST00000399302.2	+	9	4972	c.4637A>G	c.(4636-4638)aAg>aGg	p.K1546R	QSER1_ENST00000527788.1_Missense_Mutation_p.K1307R	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1546										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AGAGCAATGAAGGAAACCTTT	0.418																																																	0													131.0	124.0	126.0					11																	32987900		1851	4093	5944	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.4637A>G	11.37:g.32987900A>G	ENSP00000382241:p.Lys1546Arg		Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.K1546R	ENST00000399302.2	37	c.4637	CCDS41631.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.0|25.0	4.590753|4.590753	0.86851|0.86851	.|.	.|.	ENSG00000060749|ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788|ENST00000524678	T;T|.	0.52526|.	0.66;0.66|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.58850|0.58850	0.2151|0.2151	L|L	0.38175|0.38175	1.15|1.15	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D|.	0.89917|.	1.0;0.972;1.0|.	D;P;D|.	0.91635|.	0.998;0.831;0.999|.	T|T	0.55471|0.55471	-0.8136|-0.8136	10|5	0.41790|.	T|.	0.15|.	.|.	15.7828|15.7828	0.78275|0.78275	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1307;1307;1546|.	C9JJ88;Q2KHR3-2;Q2KHR3|.	.;.;QSER1_HUMAN|.	R|G	1546;1307;1307|567	ENSP00000382241:K1546R;ENSP00000432766:K1307R|.	ENSP00000078652:K1307R|.	K|R	+|+	2|1	0|2	QSER1|QSER1	32944476|32944476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	8.352000|8.352000	0.90075|0.90075	2.125000|2.125000	0.65367|0.65367	0.482000|0.482000	0.46254|0.46254	AAG|AGG	QSER1	-	NULL	ENSG00000060749		0.418	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	-	0.00	71	0	A	NM_024774		32987900	+1	tier1	-	no_errors	ENST00000399302	ensembl	human	known	74_37	missense	25.32	59	20	SNP	1.000	G
RAB17	64284	genome.wustl.edu	37	2	238485970	238485970	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:238485970G>T	ENST00000264601.3	-	4	994	c.365C>A	c.(364-366)cCa>cAa	p.P122Q	RAB17_ENST00000409822.1_5'UTR|RAB17_ENST00000538644.1_5'UTR|RAB17_ENST00000409576.1_Intron	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	122					cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		GACTTCTCCTGGGTGCAGCTC	0.537																																					Colon(56;987 1029 6466 13943 27336)												0													75.0	67.0	69.0					2																	238485970		2203	4300	6503	SO:0001583	missense	0			AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.365C>A	2.37:g.238485970G>T	ENSP00000264601:p.Pro122Gln		Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P122Q	ENST00000264601.3	37	c.365	CCDS2520.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.029|8.029	0.761290|0.761290	0.15914|0.15914	.|.	.|.	ENSG00000124839|ENSG00000124839	ENST00000264601;ENST00000411462|ENST00000430445	T;T|.	0.65364|.	-0.15;0.26|.	4.61|4.61	1.62|1.62	0.23740|0.23740	Small GTP-binding protein domain (1);|.	0.421388|.	0.20021|.	N|.	0.100913|.	T|T	0.32971|0.32971	0.0847|0.0847	L|L	0.41415|0.41415	1.275|1.275	0.31223|0.31223	N|N	0.697287|0.697287	P|.	0.40266|.	0.71|.	B|.	0.39068|.	0.289|.	T|T	0.35351|0.35351	-0.9792|-0.9792	10|5	0.72032|.	D|.	0.01|.	0.3428|0.3428	3.5282|3.5282	0.07766|0.07766	0.2146:0.0:0.5875:0.1979|0.2146:0.0:0.5875:0.1979	.|.	122|.	Q9H0T7|.	RAB17_HUMAN|.	Q|K	122;100|82	ENSP00000264601:P122Q;ENSP00000400240:P100Q|.	ENSP00000264601:P122Q|.	P|Q	-|-	2|1	0|0	RAB17|RAB17	238150709|238150709	1.000000|1.000000	0.71417|0.71417	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	3.575000|3.575000	0.53870|0.53870	0.391000|0.391000	0.25143|0.25143	-0.346000|-0.346000	0.07831|0.07831	CCA|CAG	RAB17	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124839		0.537	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB17	HGNC	protein_coding	OTTHUMT00000257084.2	-	0.00	22	0	G			238485970	-1	tier1	-	no_errors	ENST00000264601	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.065	T
ARR3	407	genome.wustl.edu	37	X	69503403	69503403	+	IGR	SNP	C	C	T	rs141218284		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chrX:69503403C>T	ENST00000307959.8	+	0	1292				RAB41_ENST00000374473.2_Silent_p.H128H|RAB41_ENST00000276066.4_Silent_p.H127H	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)						endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						GGGTAGAACACGTGCGAGCAG	0.388																																																	0								C		0,3835		0,0,1632,571	154.0	139.0	144.0		381	0.9	0.0	X	dbSNP_134	144	1,6727		0,1,2427,1872	no	coding-synonymous	RAB41	NM_001032726.2		0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095		127/222	69503403	1,10562	2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768		X.37:g.69503403C>T			B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.H128	ENST00000307959.8	37	c.384	CCDS14399.1	X																																																																																			RAB41	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000147127		0.388	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB41	HGNC	protein_coding	OTTHUMT00000057055.2		0.00	15	0	C	NM_004312		69503403	+1			no_errors	ENST00000374473	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.997	T
RAD50	10111	genome.wustl.edu	37	5	131931369	131931369	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:131931369G>T	ENST00000265335.6	+	13	2461	c.2074G>T	c.(2074-2076)Gct>Tct	p.A692S	RAD50_ENST00000378823.3_Missense_Mutation_p.A553S			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	692	Zinc-hook. {ECO:0000255|PROSITE- ProRule:PRU00471}.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAGACAGAGGCTGAGTTACA	0.443								Homologous recombination																																									0													96.0	85.0	89.0					5																	131931369		2203	4300	6503	SO:0001583	missense	0			Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.2074G>T	5.37:g.131931369G>T	ENSP00000265335:p.Ala692Ser		B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	pfam_Rad50_Zn_hook,superfamily_P-loop_NTPase,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50_eukaryotes	p.A692S	ENST00000265335.6	37	c.2074	CCDS34233.1	5	.	.	.	.	.	.	.	.	.	.	G	8.067	0.769404	0.15983	.	.	ENSG00000113522	ENST00000378823;ENST00000265335;ENST00000453394	T;T;T	0.41065	1.01;1.01;1.01	6.07	3.35	0.38373	Zinc hook, Rad50 (1);Rad50 zinc hook (1);	0.109197	0.64402	D	0.000007	T	0.18800	0.0451	N	0.11106	0.095	0.49130	D	0.99975	B	0.06786	0.001	B	0.11329	0.006	T	0.08391	-1.0724	10	0.07030	T	0.85	0.7768	7.4755	0.27374	0.1876:0.0:0.6955:0.117	.	692	Q92878	RAD50_HUMAN	S	553;692;631	ENSP00000368100:A553S;ENSP00000265335:A692S;ENSP00000400049:A631S	ENSP00000265335:A692S	A	+	1	0	RAD50	131959268	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	1.616000	0.36933	0.450000	0.26774	0.655000	0.94253	GCT	RAD50	-	pfam_Rad50_Zn_hook,superfamily_P-loop_NTPase,superfamily_Prefoldin,pfscan_Zn_hook_Rad50,tigrfam_Rad50_eukaryotes	ENSG00000113522		0.443	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD50	HGNC	protein_coding	OTTHUMT00000132566.5	-	0.00	42	0	G	NM_005732		131931369	+1	tier1	-	no_errors	ENST00000265335	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
RFC1	5981	genome.wustl.edu	37	4	39318600	39318600	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:39318600G>T	ENST00000381897.1	-	10	1271	c.1138C>A	c.(1138-1140)Caa>Aaa	p.Q380K	RFC1_ENST00000349703.2_Missense_Mutation_p.Q380K	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	380					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CGATAAGCTTGATAATTAGTG	0.403																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)												0													137.0	134.0	135.0					4																	39318600		2203	4300	6503	SO:0001583	missense	0			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.1138C>A	4.37:g.39318600G>T	ENSP00000371321:p.Gln380Lys		A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	pfam_DNA_replication_fac_RFC1_C,pfam_BRCT_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,superfamily_P-loop_NTPase,superfamily_BRCT_dom,smart_BRCT_dom,smart_AAA+_ATPase,pirsf_DNA_replication_fac_C_lsu,pfscan_BRCT_dom	p.Q380K	ENST00000381897.1	37	c.1138	CCDS56329.1	4	.	.	.	.	.	.	.	.	.	.	G	5.111	0.206193	0.09704	.	.	ENSG00000035928	ENST00000381897;ENST00000349703;ENST00000504554	T;T;T	0.56275	0.47;0.47;1.03	5.78	5.78	0.91487	.	0.390122	0.29932	N	0.010823	T	0.46210	0.1381	L	0.54323	1.7	0.39883	D	0.973668	B;B	0.16396	0.003;0.017	B;B	0.11329	0.001;0.006	T	0.40136	-0.9579	10	0.09084	T	0.74	-18.0858	14.807	0.69965	0.0:0.0:0.8559:0.1441	.	380;380	P35251;P35251-2	RFC1_HUMAN;.	K	380;380;12	ENSP00000371321:Q380K;ENSP00000261424:Q380K;ENSP00000422129:Q12K	ENSP00000261424:Q380K	Q	-	1	0	RFC1	38994995	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.987000	0.40687	2.738000	0.93877	0.591000	0.81541	CAA	RFC1	-	superfamily_P-loop_NTPase,pirsf_DNA_replication_fac_C_lsu	ENSG00000035928		0.403	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFC1	HGNC	protein_coding	OTTHUMT00000216808.1	-	0.00	63	0	G	NM_002913		39318600	-1	tier1	-	no_errors	ENST00000381897	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.998	T
RGS17	26575	genome.wustl.edu	37	6	153365046	153365046	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:153365046G>C	ENST00000367225.2	-	1	132	c.108C>G	c.(106-108)tgC>tgG	p.C36W	RGS17_ENST00000206262.1_Missense_Mutation_p.C36W			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	36	Poly-Cys.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		AGGAGCAGCTGCAACAACAGC	0.507																																					Esophageal Squamous(78;500 1236 6775 24364 49058)												0													161.0	152.0	155.0					6																	153365046		2203	4300	6503	SO:0001583	missense	0			AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.108C>G	6.37:g.153365046G>C	ENSP00000356194:p.Cys36Trp		Q5TF49|Q8TD61|Q9UJS8	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.C36W	ENST00000367225.2	37	c.108	CCDS5244.1	6	.	.	.	.	.	.	.	.	.	.	G	15.65	2.894974	0.52121	.	.	ENSG00000091844	ENST00000367225;ENST00000206262	T;T	0.53857	0.6;0.6	5.29	2.53	0.30540	.	0.469863	0.28067	N	0.016727	T	0.61874	0.2382	M	0.83223	2.63	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.64419	-0.6412	10	0.51188	T	0.08	0.23	10.3089	0.43697	0.2157:0.0:0.7843:0.0	.	36	Q9UGC6	RGS17_HUMAN	W	36	ENSP00000356194:C36W;ENSP00000206262:C36W	ENSP00000206262:C36W	C	-	3	2	RGS17	153406739	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.762000	0.38451	0.229000	0.21039	0.460000	0.39030	TGC	RGS17	-	NULL	ENSG00000091844		0.507	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS17	HGNC	protein_coding	OTTHUMT00000042773.2	-	0.00	35	0	G			153365046	-1	tier1	-	no_errors	ENST00000206262	ensembl	human	known	74_37	missense	45.83	13	11	SNP	1.000	C
RNF185	91445	genome.wustl.edu	37	22	31556291	31556291	+	Splice_Site	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr22:31556291T>C	ENST00000326132.6	+	1	111		c.e1+2		RNF185_ENST00000426256.2_Splice_Site|RNF185_ENST00000266252.7_Splice_Site|MIR3928_ENST00000583386.1_RNA	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185						autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						CGGAGGCAGGTATGTGAGGGG	0.622																																																	0																																										SO:0001630	splice_region_variant	0				CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.-49+2T>C	22.37:g.31556291T>C			A8K5C1|A9X3T8|Q8N900	Splice_Site	SNP	-	e0+2	ENST00000326132.6	37	c.1+2	CCDS13890.1	22																																																																																			RNF185	-	-	ENSG00000138942		0.622	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF185	HGNC	protein_coding	OTTHUMT00000321927.2	-	0.00	17	0	T	NM_152267	Intron	31556291	+1	tier1	-	no_errors	ENST00000326132	ensembl	human	known	74_37	splice_site	70.00	3	7	SNP	0.930	C
RNF40	9810	genome.wustl.edu	37	16	30779971	30779971	+	Silent	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:30779971C>T	ENST00000324685.6	+	14	2446	c.2011C>T	c.(2011-2013)Ctg>Ttg	p.L671L	RNF40_ENST00000563683.1_Silent_p.L631L|RNF40_ENST00000357890.5_Silent_p.L571L|RNF40_ENST00000402121.3_Silent_p.L363L	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	671					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GGAGATGAAACTGCTGCTGGA	0.592																																																	0													66.0	65.0	65.0					16																	30779971		2197	4300	6497	SO:0001819	synonymous_variant	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.2011C>T	16.37:g.30779971C>T			Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Silent	SNP	smart_Znf_RING,pfscan_Znf_RING	p.L671	ENST00000324685.6	37	c.2011	CCDS10691.1	16																																																																																			RNF40	-	NULL	ENSG00000103549		0.592	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	-	0.00	27	0	C	NM_014771		30779971	+1	tier1	-	no_errors	ENST00000324685	ensembl	human	known	74_37	silent	78.12	7	25	SNP	1.000	T
RNPC3	55599	genome.wustl.edu	37	1	104076467	104076467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:104076467delA	ENST00000533099.1	+	4	583	c.347delA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000423855.2_Frame_Shift_Del_p.E116fs|RNPC3_ENST00000524631.1_Frame_Shift_Del_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TCAGGCTCTGAAAAAAAAAAA	0.318																																																	0										85,435,1262		6,1,72,18,398,396	50.0	39.0	43.0			4.6	0.6	1		49	197,914,2651		20,3,154,16,879,809	no	codingComplex	RNPC3	NM_017619.3		26,4,226,34,1277,1205	A1A1,A1A2,A1R,A2A2,A2R,RR		29.5322,29.1807,29.4192			104076467	282,1349,3913	692	1590	2282	SO:0001589	frameshift_variant	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.347delA	1.37:g.104076467delA	ENSP00000432886:p.Glu116fs		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K119fs	ENST00000533099.1	37	c.347	CCDS781.1	1																																																																																			RNPC3	-	NULL	ENSG00000185946		0.318	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1		0.00	28	0	A	NM_017619		104076467	+1	tier1		no_errors	ENST00000423855	ensembl	human	known	74_37	frame_shift_del	9.38	29	3	DEL	0.784	-
RYR3	6263	genome.wustl.edu	37	15	33955036	33955036	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:33955036G>T	ENST00000389232.4	+	35	5375	c.5305G>T	c.(5305-5307)Gag>Tag	p.E1769*	RYR3_ENST00000415757.3_Nonsense_Mutation_p.E1769*	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1769	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGCAGAAAAGGAGGAAGTGAC	0.567																																																	0													163.0	179.0	174.0					15																	33955036		2071	4216	6287	SO:0001587	stop_gained	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5305G>T	15.37:g.33955036G>T	ENSP00000373884:p.Glu1769*		O15175|Q15412	Nonsense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.E1769*	ENST00000389232.4	37	c.5305	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	45	11.830751	0.99607	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	.	.	.	3.94	3.94	0.45596	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	16.9111	0.86140	0.0:0.0:1.0:0.0	.	.	.	.	X	1769	.	ENSP00000354735:E1769X	E	+	1	0	RYR3	31742328	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.970000	0.76099	2.509000	0.84616	0.655000	0.94253	GAG	RYR3	-	NULL	ENSG00000198838		0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1		0.00	78	0	G			33955036	+1			no_errors	ENST00000389232	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	34015021	34015021	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr15:34015021C>T	ENST00000389232.4	+	44	6795	c.6725C>T	c.(6724-6726)gCa>gTa	p.A2242V	RYR3_ENST00000415757.3_Missense_Mutation_p.A2242V|Y_RNA_ENST00000363138.1_RNA	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2242	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGGCTCTTGGCAGCCATGCAG	0.577																																																	0													84.0	92.0	90.0					15																	34015021		1970	4129	6099	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.6725C>T	15.37:g.34015021C>T	ENSP00000373884:p.Ala2242Val		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.A2242V	ENST00000389232.4	37	c.6725	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240236	0.39598	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98221	-4.8;-4.8	4.93	4.93	0.64822	.	0.125893	0.52532	D	0.000071	D	0.96907	0.8990	L	0.49640	1.575	0.54753	D	0.999989	B;B	0.22851	0.021;0.076	B;B	0.27608	0.021;0.081	D	0.95208	0.8323	10	0.52906	T	0.07	.	18.336	0.90288	0.0:1.0:0.0:0.0	.	2242;2242	Q15413-2;Q15413	.;RYR3_HUMAN	V	2242	ENSP00000373884:A2242V;ENSP00000399610:A2242V	ENSP00000354735:A2242V	A	+	2	0	RYR3	31802313	1.000000	0.71417	0.952000	0.39060	0.165000	0.22458	4.672000	0.61597	2.553000	0.86117	0.555000	0.69702	GCA	RYR3	-	NULL	ENSG00000198838		0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	45	0	C			34015021	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	8.33	43	4	SNP	0.995	T
SALL4	57167	genome.wustl.edu	37	20	50401201	50401201	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:50401201G>A	ENST00000217086.4	-	4	2876	c.2765C>T	c.(2764-2766)gCg>gTg	p.A922V	SALL4_ENST00000371539.3_Missense_Mutation_p.A145V|SALL4_ENST00000395997.3_Missense_Mutation_p.A485V	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	922					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A922V(1)		endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GTTATTGTTCGCCCCGTGTGT	0.468																																																	1	Substitution - Missense(1)	large_intestine(1)											81.0	72.0	75.0					20																	50401201		2203	4300	6503	SO:0001583	missense	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2765C>T	20.37:g.50401201G>A	ENSP00000217086:p.Ala922Val		A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A922V	ENST00000217086.4	37	c.2765	CCDS13438.1	20	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901649	0.33535	.	.	ENSG00000101115	ENST00000217086;ENST00000395997;ENST00000371539	T;T;T	0.35048	3.0;3.0;1.33	3.56	3.56	0.40772	Zinc finger, C2H2 (1);	0.000000	0.42821	D	0.000641	T	0.42359	0.1199	L	0.36672	1.1	0.30361	N	0.783777	D;P;P	0.76494	0.999;0.783;0.527	D;B;B	0.70716	0.97;0.058;0.054	T	0.18116	-1.0347	10	0.13108	T	0.6	-22.8172	10.9269	0.47195	0.0:0.0:1.0:0.0	.	485;145;922	A2A2D8;Q6Y8G5;Q9UJQ4	.;.;SALL4_HUMAN	V	922;485;145	ENSP00000217086:A922V;ENSP00000379319:A485V;ENSP00000360594:A145V	ENSP00000217086:A922V	A	-	2	0	SALL4	49834608	1.000000	0.71417	0.873000	0.34254	0.681000	0.39784	2.406000	0.44557	2.303000	0.77524	0.561000	0.74099	GCG	SALL4	-	pfscan_Znf_C2H2	ENSG00000101115		0.468	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	-	0.00	31	0	G			50401201	-1	tier1	-	no_errors	ENST00000217086	ensembl	human	known	74_37	missense	48.19	43	40	SNP	0.968	A
SH3RF1	57630	genome.wustl.edu	37	4	170077739	170077741	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	ATG	ATG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:170077739_170077741delATG	ENST00000284637.9	-	3	824_826	c.483_485delCAT	c.(481-486)atcatt>att	p.161_162II>I	SH3RF1_ENST00000508685.1_5'UTR	NM_020870.3	NP_065921.2	Q7Z6J0	SH3R1_HUMAN	SH3 domain containing ring finger 1	161	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|protein ubiquitination (GO:0016567)|regulation of JNK cascade (GO:0046328)	cell projection (GO:0042995)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31		Prostate(90;0.00267)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)		TCTTCGCAAAATGATGATGTCAC	0.394																																																	0																																										SO:0001651	inframe_deletion	0			BC033203	CCDS34099.1	4q32.3	2013-01-09	2006-02-13	2006-02-13	ENSG00000154447	ENSG00000154447		"""RING-type (C3HC4) zinc fingers"""	17650	protein-coding gene	gene with protein product	"""plenty of SH3 domains"""		"""SH3 multiple domains 2"""	SH3MD2		9482736	Standard	NM_020870		Approved	POSH, RNF142, KIAA1494	uc003isa.1	Q7Z6J0	OTTHUMG00000161010	ENST00000284637.9:c.483_485delCAT	4.37:g.170077745_170077747delATG	ENSP00000284637:p.Ile162del		Q05BT2|Q8IW46|Q9HAM2|Q9P234	In_Frame_Del	DEL	pfam_SH3_domain,pfam_SH3_2,pfam_Znf_C3HC4_RING-type,superfamily_SH3_domain,smart_Znf_RING,smart_SH3_domain,pfscan_SH3_domain,pfscan_Znf_RING,prints_p67phox,prints_SH3_domain	p.I162in_frame_del	ENST00000284637.9	37	c.485_483	CCDS34099.1	4																																																																																			SH3RF1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox	ENSG00000154447		0.394	SH3RF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3RF1	HGNC	protein_coding	OTTHUMT00000363382.3		0.00	36	0	ATG	NM_020870		170077741	-1	tier1		no_errors	ENST00000284637	ensembl	human	known	74_37	in_frame_del	52.94	32	36	DEL	1.000:1.000:1.000	-
SLC35F2	54733	genome.wustl.edu	37	11	107663383	107663383	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:107663383C>A	ENST00000525815.1	-	8	1503	c.1083G>T	c.(1081-1083)aaG>aaT	p.K361N	SLC35F2_ENST00000265836.7_Missense_Mutation_p.K213N|SLC35F2_ENST00000375682.4_Missense_Mutation_p.K314N|SLC35F2_ENST00000429869.1_Missense_Mutation_p.K361N|SLC35F2_ENST00000525071.1_3'UTR	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	361					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		TCTCCTCCAGCTTCAGCCCCA	0.602																																																	0													52.0	56.0	55.0					11																	107663383		1973	4167	6140	SO:0001583	missense	0				CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.1083G>T	11.37:g.107663383C>A	ENSP00000436785:p.Lys361Asn		Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	pfam_SLC35_F1/F2/F6,pfam_DMT,pfam_UAA,pfam_Tpt_PEP_trans_dom	p.K361N	ENST00000525815.1	37	c.1083	CCDS41709.1	11	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535451	0.85812	.	.	ENSG00000110660	ENST00000525815;ENST00000265836;ENST00000375682;ENST00000429869	.	.	.	5.13	5.13	0.70059	.	0.177661	0.49916	D	0.000133	T	0.51449	0.1675	N	0.22421	0.69	0.42504	D	0.992947	D	0.59357	0.985	P	0.53102	0.718	T	0.50423	-0.8830	9	0.36615	T	0.2	.	16.7271	0.85424	0.0:1.0:0.0:0.0	.	361	Q8IXU6	S35F2_HUMAN	N	361;213;314;361	.	ENSP00000265836:K213N	K	-	3	2	SLC35F2	107168593	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	1.750000	0.38329	2.535000	0.85469	0.655000	0.94253	AAG	SLC35F2	-	pfam_SLC35_F1/F2/F6	ENSG00000110660		0.602	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F2	HGNC	protein_coding	OTTHUMT00000389417.1	-	0.00	52	0	C	NM_017515		107663383	-1	tier1	-	no_errors	ENST00000429869	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	A
SLC52A3	113278	genome.wustl.edu	37	20	744539	744539	+	Missense_Mutation	SNP	G	G	A	rs143511669		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:744539G>A	ENST00000217254.7	-	3	917	c.676C>T	c.(676-678)Ctc>Ttc	p.L226F	SLC52A3_ENST00000381944.3_Missense_Mutation_p.L226F|SLC52A3_ENST00000473664.1_Intron	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	226					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										ATGGATAGGAGGAGGAAGAAG	0.607																																																	0								G	PHE/LEU	1,4405	2.1+/-5.4	0,1,2202	78.0	68.0	72.0		676	3.0	1.0	20	dbSNP_134	72	0,8600		0,0,4300	no	missense	C20orf54	NM_033409.3	22	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	226/470	744539	1,13005	2203	4300	6503	SO:0001583	missense	0			AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.676C>T	20.37:g.744539G>A	ENSP00000217254:p.Leu226Phe		A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	pfam_Endogenous_retrovirus_rcpt	p.L226F	ENST00000217254.7	37	c.676	CCDS13007.1	20	.	.	.	.	.	.	.	.	.	.	G	7.205	0.594212	0.13875	2.27E-4	0.0	ENSG00000101276	ENST00000217254;ENST00000381944	T;T	0.78924	-1.22;-1.22	4.95	2.97	0.34412	.	0.202442	0.43579	D	0.000547	T	0.66287	0.2774	L	0.47716	1.5	0.52099	D	0.999941	P;B	0.35894	0.526;0.131	B;B	0.36666	0.23;0.07	T	0.56282	-0.8005	10	0.10902	T	0.67	-7.3211	8.56	0.33505	0.0815:0.0:0.7663:0.1523	.	226;226	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	F	226	ENSP00000217254:L226F;ENSP00000371370:L226F	ENSP00000217254:L226F	L	-	1	0	C20orf54	692539	0.993000	0.37304	0.994000	0.49952	0.587000	0.36485	1.513000	0.35823	0.489000	0.27749	-0.314000	0.08810	CTC	SLC52A3	-	NULL	ENSG00000101276		0.607	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC52A3	HGNC	protein_coding	OTTHUMT00000077482.2	-	0.00	47	0	G	NM_033409		744539	-1	tier1	rs143511669	no_errors	ENST00000217254	ensembl	human	known	74_37	missense	10.39	69	8	SNP	0.999	A
SMC1A	8243	genome.wustl.edu	37	X	53409124	53409124	+	Intron	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chrX:53409124C>A	ENST00000322213.4	-	22	3565				SMC1A_ENST00000469129.1_5'UTR	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A						DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TCAGTCTCTTCGTCAACTGCC	0.567																																																	0													47.0	39.0	42.0					X																	53409124		2203	4300	6503	SO:0001627	intron_variant	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.3437+28G>T	X.37:g.53409124C>A			O14995|Q16351|Q2M228	RNA	SNP	-	NULL	ENST00000322213.4	37	NULL	CCDS14352.1	X																																																																																			SMC1A	-	-	ENSG00000072501		0.567	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	-	0.00	34	0	C	NM_006306		53409124	-1	tier1	-	no_errors	ENST00000469129	ensembl	human	known	74_37	rna	9.52	38	4	SNP	0.017	A
SMG5	23381	genome.wustl.edu	37	1	156231157	156231157	+	Missense_Mutation	SNP	G	G	T	rs374473521		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:156231157G>T	ENST00000361813.5	-	14	2218	c.2074C>A	c.(2074-2076)Ctg>Atg	p.L692M	SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	692					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GCAGGCAACAGATTCAGCAAC	0.562																																																	0													100.0	93.0	95.0					1																	156231157		2203	4300	6503	SO:0001583	missense	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.2074C>A	1.37:g.156231157G>T	ENSP00000355261:p.Leu692Met		D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1,smart_PIN_dom	p.L692M	ENST00000361813.5	37	c.2074	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.012118	0.75046	.	.	ENSG00000198952	ENST00000361813	T	0.34072	1.38	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000003	T	0.47619	0.1455	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.11842	-1.0571	10	0.28530	T	0.3	-20.1095	18.6787	0.91539	0.0:0.0:1.0:0.0	.	692	Q9UPR3	SMG5_HUMAN	M	692	ENSP00000355261:L692M	ENSP00000355261:L692M	L	-	1	2	SMG5	154497781	1.000000	0.71417	0.962000	0.40283	0.996000	0.88848	5.533000	0.67160	2.757000	0.94681	0.561000	0.74099	CTG	SMG5	-	NULL	ENSG00000198952		0.562	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1		0.00	50	0	G	NM_015327		156231157	-1			no_errors	ENST00000361813	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
SNRNP25	79622	genome.wustl.edu	37	16	105489	105489	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:105489G>T	ENST00000383018.3	+	2	261	c.100G>T	c.(100-102)Gcc>Tcc	p.A34S	SNRNP25_ENST00000493672.1_3'UTR|POLR3K_ENST00000293860.5_5'Flank	NM_024571.3	NP_078847.1	Q9BV90	SNR25_HUMAN	small nuclear ribonucleoprotein 25kDa (U11/U12)	34					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)		p.A34S(1)		large_intestine(1)|lung(2)	3						CTCCCAAATAGCCCTAGAATA	0.498																																																	1	Substitution - Missense(1)	large_intestine(1)											207.0	180.0	189.0					16																	105489		2203	4300	6503	SO:0001583	missense	0			BC001381	CCDS10396.1	16p13.3	2011-10-11	2008-10-29	2008-10-29	ENSG00000161981	ENSG00000161981			14161	protein-coding gene	gene with protein product	"""U11/U12 snRNP 25K"""		"""chromosome 16 open reading frame 33"""	C16orf33		15146077	Standard	NM_024571		Approved		uc002cfj.4	Q9BV90	OTTHUMG00000060720	ENST00000383018.3:c.100G>T	16.37:g.105489G>T	ENSP00000372482:p.Ala34Ser		Q1W6H3|Q6IEF8|Q9H5W4	Missense_Mutation	SNP	pfscan_Ubiquitin_supergroup	p.A34S	ENST00000383018.3	37	c.100	CCDS10396.1	16	.	.	.	.	.	.	.	.	.	.	.	15.08	2.728610	0.48833	.	.	ENSG00000161981	ENST00000293861;ENST00000383018;ENST00000417493	.	.	.	5.58	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.75236	0.3822	L	0.61387	1.9	0.58432	D	0.999999	D	0.89917	1.0	D	0.85130	0.997	T	0.75918	-0.3148	9	0.48119	T	0.1	-14.2556	13.1714	0.59599	0.0772:0.0:0.9228:0.0	.	34	Q9BV90	SNR25_HUMAN	S	25;34;25	.	ENSP00000293861:A25S	A	+	1	0	SNRNP25	45489	1.000000	0.71417	1.000000	0.80357	0.303000	0.27691	8.545000	0.90657	1.379000	0.46325	-0.251000	0.11542	GCC	SNRNP25	-	NULL	ENSG00000161981		0.498	SNRNP25-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNRNP25	HGNC	protein_coding			0.00	35	0	G	NM_024571		105489	+1			no_errors	ENST00000383018	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	T
SOCS4	122809	genome.wustl.edu	37	14	55509975	55509975	+	Silent	SNP	A	A	C	rs535547343		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr14:55509975A>C	ENST00000395472.2	+	2	548	c.216A>C	c.(214-216)tcA>tcC	p.S72S	SOCS4_ENST00000339298.2_Silent_p.S72S|SOCS4_ENST00000555846.1_Silent_p.S72S	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	72					intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						ACAGCTGTTCATCCATTGAGT	0.423																																																	0													163.0	150.0	155.0					14																	55509975		2203	4300	6503	SO:0001819	synonymous_variant	0			AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.216A>C	14.37:g.55509975A>C				Silent	SNP	pfam_SOCS,pfam_SOCS_C,pfam_SH2,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.S72	ENST00000395472.2	37	c.216	CCDS9722.1	14																																																																																			SOCS4	-	pfam_SOCS	ENSG00000180008		0.423	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS4	HGNC	protein_coding	OTTHUMT00000276910.1	-	0.00	54	0	A			55509975	+1	tier1	-	no_errors	ENST00000339298	ensembl	human	known	74_37	silent	75.93	13	41	SNP	0.956	C
SP100	6672	genome.wustl.edu	37	2	231367806	231367806	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:231367806G>T	ENST00000264052.5	+	20	2101	c.1746G>T	c.(1744-1746)ttG>ttT	p.L582F	SP100_ENST00000340126.4_Missense_Mutation_p.L582F|SP100_ENST00000409112.1_Missense_Mutation_p.L582F	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen	582					cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.L582F(2)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CTAGACCTTTGAAAAGAAGAA	0.284																																																	2	Substitution - Missense(2)	breast(2)											76.0	79.0	78.0					2																	231367806		2203	4299	6502	SO:0001583	missense	0			AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1746G>T	2.37:g.231367806G>T	ENSP00000264052:p.Leu582Phe		B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Missense_Mutation	SNP	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom	p.L582F	ENST00000264052.5	37	c.1746	CCDS2477.1	2	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581148	0.46006	.	.	ENSG00000067066	ENST00000264052;ENST00000409112;ENST00000340126;ENST00000414648	T;T;T	0.80033	2.31;-1.33;0.25	4.32	0.437	0.16555	.	0.439657	0.14474	N	0.317387	T	0.77585	0.4152	L	0.27053	0.805	0.18873	N	0.999985	D;D;D	0.69078	0.995;0.997;0.991	D;P;P	0.66497	0.944;0.881;0.881	T	0.64575	-0.6375	10	0.49607	T	0.09	.	3.9968	0.09561	0.3068:0.1862:0.5069:0.0	.	582;582;582	P23497-4;P23497;E7EUA7	.;SP100_HUMAN;.	F	582;582;582;65	ENSP00000264052:L582F;ENSP00000386427:L582F;ENSP00000343023:L582F	ENSP00000264052:L582F	L	+	3	2	SP100	231076050	0.018000	0.18449	0.002000	0.10522	0.682000	0.39822	0.292000	0.19011	0.066000	0.16515	0.563000	0.77884	TTG	SP100	-	NULL	ENSG00000067066		0.284	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	HGNC	protein_coding	OTTHUMT00000256914.2		0.00	35	0	G	NM_003113		231367806	+1			no_errors	ENST00000340126	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.002	T
RP11-383M4.6	0	genome.wustl.edu	37	9	84547572	84547572	+	lincRNA	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr9:84547572C>A	ENST00000585776.1	-	0	1039				RP11-383M4.2_ENST00000427387.1_lincRNA|SPATA31D4_ENST00000341875.4_RNA																							TACATTTGAGCAAGAAATTTG	0.443																																																	0																																												0																															9.37:g.84547572C>A				RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			SPATA31D4	-	-	ENSG00000189357		0.443	RP11-383M4.6-001	KNOWN	basic	lincRNA	SPATA31D4	HGNC	lincRNA	OTTHUMT00000453562.1		0.00	45	0	C			84547572	+1			no_errors	ENST00000341875	ensembl	human	known	74_37	rna	10.91	49	6	SNP	0.017	A
ST6GAL2	84620	genome.wustl.edu	37	2	107423380	107423380	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr2:107423380G>T	ENST00000409382.3	-	6	1954	c.1344C>A	c.(1342-1344)tgC>tgA	p.C448*	ST6GAL2_ENST00000361686.4_Nonsense_Mutation_p.C448*	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	448					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GCACCTCTCTGCACATGGACA	0.512																																																	0													51.0	47.0	48.0					2																	107423380		2203	4300	6503	SO:0001587	stop_gained	0			AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1344C>A	2.37:g.107423380G>T	ENSP00000386942:p.Cys448*		D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Nonsense_Mutation	SNP	pfam_Glyco_trans_29,superfamily_Glyco_hydro/deAcase_b/a-brl	p.C448*	ENST00000409382.3	37	c.1344	CCDS2073.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	9.982201|9.982201	0.99310|0.99310	.|.	.|.	ENSG00000144057|ENSG00000144057	ENST00000361686;ENST00000409382|ENST00000361803	.|.	.|.	.|.	5.8|5.8	2.01|2.01	0.26516|0.26516	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.58148	.|0.2102	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.49744	.|-0.8907	.|4	0.02654|.	T|.	1|.	-45.3596|-45.3596	9.3881|9.3881	0.38356|0.38356	0.3734:0.0:0.6266:0.0|0.3734:0.0:0.6266:0.0	.|.	.|.	.|.	.|.	X|K	448|14	.|.	ENSP00000355273:C448X|.	C|Q	-|-	3|1	2|0	ST6GAL2|ST6GAL2	106789812|106789812	0.835000|0.835000	0.29415|0.29415	0.867000|0.867000	0.34043|0.34043	0.985000|0.985000	0.73830|0.73830	1.173000|1.173000	0.31920|0.31920	0.089000|0.089000	0.17243|0.17243	0.655000|0.655000	0.94253|0.94253	TGC|CAG	ST6GAL2	-	pfam_Glyco_trans_29	ENSG00000144057		0.512	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ST6GAL2	HGNC	protein_coding	OTTHUMT00000330065.1	-	0.00	22	0	G	NM_032528		107423380	-1	tier1	-	no_errors	ENST00000361686	ensembl	human	known	74_37	nonsense	15.38	22	4	SNP	0.611	T
STAB1	23166	genome.wustl.edu	37	3	52554457	52554457	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:52554457G>T	ENST00000321725.6	+	53	5617	c.5541G>T	c.(5539-5541)caG>caT	p.Q1847H		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	1847	FAS1 6. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		GCATTGTGCAGCGGCACTTGC	0.612																																																	0													72.0	67.0	68.0					3																	52554457		2203	4300	6503	SO:0001583	missense	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.5541G>T	3.37:g.52554457G>T	ENSP00000312946:p.Gln1847His		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.Q1847H	ENST00000321725.6	37	c.5541	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	22.1	4.246413	0.80024	.	.	ENSG00000010327	ENST00000321725	D	0.90900	-2.75	6.07	4.27	0.50696	FAS1 domain (5);	0.239573	0.43747	D	0.000534	D	0.93890	0.8045	M	0.73217	2.22	0.40939	D	0.984458	D	0.76494	0.999	D	0.74023	0.982	D	0.93660	0.6981	10	0.66056	D	0.02	.	10.7743	0.46340	0.1354:0.0:0.8646:0.0	.	1847	Q9NY15	STAB1_HUMAN	H	1847	ENSP00000312946:Q1847H	ENSP00000312946:Q1847H	Q	+	3	2	STAB1	52529497	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.239000	0.43079	0.880000	0.35969	0.655000	0.94253	CAG	STAB1	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain	ENSG00000010327		0.612	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2		0.00	25	0	G	NM_015136		52554457	+1			no_errors	ENST00000321725	ensembl	human	known	74_37	missense	21.05	15	4	SNP	1.000	T
STMN3	50861	genome.wustl.edu	37	20	62273557	62273557	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr20:62273557G>T	ENST00000370053.1	-	4	468	c.387C>A	c.(385-387)agC>agA	p.S129R	STMN3_ENST00000540534.1_Missense_Mutation_p.S118R	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	129	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			CCGCCTGGCGGCTGAAGTTGT	0.657																																																	0													32.0	29.0	30.0					20																	62273557		2201	4300	6501	SO:0001583	missense	0			AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.387C>A	20.37:g.62273557G>T	ENSP00000359070:p.Ser129Arg		B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	p.S129R	ENST00000370053.1	37	c.387	CCDS13529.1	20	.	.	.	.	.	.	.	.	.	.	g	16.70	3.195403	0.58126	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	5.27	4.33	0.51752	.	0.066079	0.56097	U	0.000024	T	0.79329	0.4427	M	0.85945	2.785	0.50467	D	0.999875	D	0.67145	0.996	D	0.67382	0.951	T	0.81996	-0.0676	9	0.52906	T	0.07	-12.9121	13.882	0.63688	0.0743:0.0:0.9257:0.0	.	129	Q9NZ72	STMN3_HUMAN	R	129;118	.	ENSP00000359070:S129R	S	-	3	2	STMN3	61744001	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	6.153000	0.71819	1.236000	0.43740	-0.243000	0.11985	AGC	STMN3	-	pfam_Stathmin_fam,superfamily_Stathmin_fam,pirsf_Stathmin_fam,prints_Stathmin_fam	ENSG00000197457		0.657	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STMN3	HGNC	protein_coding	OTTHUMT00000080163.1		0.00	51	0	G	NM_015894		62273557	-1			no_errors	ENST00000370053	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
STXBP3	6814	genome.wustl.edu	37	1	109319002	109319002	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:109319002A>G	ENST00000370008.3	+	8	691	c.641A>G	c.(640-642)aAg>aGg	p.K214R	STXBP3_ENST00000485167.1_3'UTR	NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	214	Mediates interaction with DOC2B. {ECO:0000250}.				blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		GTTGAAAAAAAGCTTGAAGAC	0.313																																																	0													59.0	58.0	59.0					1																	109319002		2201	4300	6501	SO:0001583	missense	0			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.641A>G	1.37:g.109319002A>G	ENSP00000359025:p.Lys214Arg		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.K214R	ENST00000370008.3	37	c.641	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370656	0.61624	.	.	ENSG00000116266	ENST00000370008	T	0.78126	-1.15	5.97	5.97	0.96955	.	0.193186	0.52532	D	0.000062	T	0.67804	0.2932	L	0.45352	1.415	0.44079	D	0.996838	P	0.44946	0.846	P	0.46389	0.515	T	0.67428	-0.5673	10	0.26408	T	0.33	-4.3973	16.1087	0.81244	1.0:0.0:0.0:0.0	.	214	O00186	STXB3_HUMAN	R	214	ENSP00000359025:K214R	ENSP00000359025:K214R	K	+	2	0	STXBP3	109120525	1.000000	0.71417	0.992000	0.48379	0.958000	0.62258	4.223000	0.58587	2.281000	0.76405	0.533000	0.62120	AAG	STXBP3	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000116266		0.313	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1		0.00	50	0	A	NM_007269		109319002	+1			no_errors	ENST00000370008	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	G
STYXL1	51657	genome.wustl.edu	37	7	75659797	75659798	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:75659797_75659798insA	ENST00000248600.1	-	2	386_387	c.44_45insT	c.(43-45)atcfs	p.I15fs	STYXL1_ENST00000460184.2_5'UTR|STYXL1_ENST00000359697.3_Frame_Shift_Ins_p.I15fs|STYXL1_ENST00000451157.1_Frame_Shift_Ins_p.I15fs|STYXL1_ENST00000360591.3_Frame_Shift_Ins_p.I15fs|STYXL1_ENST00000431581.1_Frame_Shift_Ins_p.I15fs|STYXL1_ENST00000340062.5_Frame_Shift_Ins_p.I15fs	NM_016086.2	NP_057170.1	Q9Y6J8	STYL1_HUMAN	serine/threonine/tyrosine interacting-like 1	15					intracellular signal transduction (GO:0035556)|protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	10						CCTGATTCAGGATGTTGTAAAG	0.411																																																	0																																										SO:0001589	frameshift_variant	0			AF069762	CCDS5580.1	7q11.23	2011-06-09	2005-09-22	2005-09-22	ENSG00000127952	ENSG00000127952		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	18165	protein-coding gene	gene with protein product			"""dual specificity phosphatase 24 (putative)"""	DUSP24		9757831	Standard	NM_016086		Approved	MK-STYX	uc003uel.3	Q9Y6J8	OTTHUMG00000130459	ENST00000248600.1:c.45dupT	7.37:g.75659798_75659798dupA	ENSP00000248600:p.Ile15fs		Q9UBP1|Q9UK06|Q9UK07|Q9UKG2|Q9UKG3	Frame_Shift_Ins	INS	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat	p.L16fs	ENST00000248600.1	37	c.45_44	CCDS5580.1	7																																																																																			STYXL1	-	superfamily_Rhodanese-like_dom	ENSG00000127952		0.411	STYXL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STYXL1	HGNC	protein_coding	OTTHUMT00000344825.1		0.00	63	0	-	NM_016086		75659798	-1	tier1		no_errors	ENST00000248600	ensembl	human	known	74_37	frame_shift_ins	35.00	78	42	INS	1.000:1.000	A
SUN1	23353	genome.wustl.edu	37	7	889579	889579	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:889579G>C	ENST00000405266.1	+	6	702	c.678G>C	c.(676-678)aaG>aaC	p.K226N	SUN1_ENST00000389574.3_Intron|SUN1_ENST00000413514.2_Intron|SUN1_ENST00000456758.2_Missense_Mutation_p.K378N|SUN1_ENST00000401592.1_Intron|SUN1_ENST00000425407.2_Intron|SUN1_ENST00000452783.2_Intron			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	226	EMD-binding.|SYNE2-binding.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTAAGGGCAAGAGGCACCTCG	0.627																																																	0													17.0	16.0	16.0					7																	889579		875	1986	2861	SO:0001583	missense	0			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.678G>C	7.37:g.889579G>C	ENSP00000384116:p.Lys226Asn		A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	pfam_SUN1,pfam_Sad1_UNC_C	p.K378N	ENST00000405266.1	37	c.1134		7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.46|16.46|16.46	3.130040|3.130040|3.130040	0.56721|0.56721|0.56721	.|.|.	.|.|.	ENSG00000164828|ENSG00000164828|ENSG00000164828	ENST00000433212|ENST00000456758;ENST00000405266;ENST00000297445|ENST00000419312	.|T;T|.	.|0.25085|.	.|1.82;1.92|.	5.54|5.54|5.54	5.54|5.54|5.54	0.83059|0.83059|0.83059	.|.|.	.|0.391272|.	.|0.30109|.	.|N|.	.|0.010385|.	T|T|T	0.75391|0.75391|0.75391	0.3843|0.3843|0.3843	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D|.	.|0.59767|.	.|0.986|.	.|P|.	.|0.49637|.	.|0.617|.	T|T|T	0.72852|0.72852|0.72852	-0.4167|-0.4167|-0.4167	4|9|4	.|0.29301|.	.|T|.	.|0.29|.	-18.0317|-18.0317|-18.0317	19.4332|19.4332|19.4332	0.94779|0.94779|0.94779	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|378|.	.|A4D2Q0|.	.|.|.	Q|N|T	38|378;226;226|95	.|ENSP00000388743:K378N;ENSP00000384116:K226N|.	.|ENSP00000297445:K226N|.	E|K|R	+|+|+	1|3|2	0|2|0	SUN1|SUN1|SUN1	856105|856105|856105	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.049000|0.049000|0.049000	0.19019|0.19019|0.19019	0.033000|0.033000|0.033000	0.12548|0.12548|0.12548	5.430000|5.430000|5.430000	0.66501|0.66501|0.66501	2.768000|2.768000|2.768000	0.95171|0.95171|0.95171	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GAG|AAG|AGA	SUN1	-	NULL	ENSG00000164828		0.627	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	SUN1	HGNC	protein_coding	OTTHUMT00000322566.1	-	0.00	18	0	G	NM_025154		889579	+1	tier1	-	no_errors	ENST00000456758	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.992	C
TACC1	6867	genome.wustl.edu	37	8	38677795	38677795	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr8:38677795C>G	ENST00000317827.4	+	3	1412	c.1033C>G	c.(1033-1035)Ctg>Gtg	p.L345V	TACC1_ENST00000520973.1_Missense_Mutation_p.L150V|TACC1_ENST00000330691.6_Intron|TACC1_ENST00000520615.1_Missense_Mutation_p.L150V|TACC1_ENST00000520340.1_Missense_Mutation_p.L309V|TACC1_ENST00000520611.1_5'Flank|TACC1_ENST00000443286.2_Missense_Mutation_p.L361V|TACC1_ENST00000379931.3_Missense_Mutation_p.L345V|TACC1_ENST00000518415.1_Missense_Mutation_p.L300V|TACC1_ENST00000522752.1_Intron|TACC1_ENST00000276520.8_Intron|TACC1_ENST00000348567.4_Intron|TACC1_ENST00000519416.1_Missense_Mutation_p.L150V	NM_006283.2	NP_006274.2	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing protein 1	345	Interaction with YEATS4.				cell cycle (GO:0007049)|cell division (GO:0051301)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				breast(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(3)	17		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			TGGCAGGAAACTGGGTAGCAC	0.507																																																	0													91.0	96.0	95.0					8																	38677795		2203	4300	6503	SO:0001583	missense	0			AF049910	CCDS6109.1, CCDS47845.1, CCDS55224.1	8p11	2012-12-20			ENSG00000147526	ENSG00000147526			11522	protein-coding gene	gene with protein product		605301					Standard	NM_006283		Approved		uc010lwp.3	O75410	OTTHUMG00000164018	ENST00000317827.4:c.1033C>G	8.37:g.38677795C>G	ENSP00000321703:p.Leu345Val		B2RBD9|D3DSX6|Q6Y687|Q86YG7|Q8IUJ2|Q8IUJ3|Q8IUJ4|Q8IZG2|Q8NEY7|Q9UPP9	Missense_Mutation	SNP	pfam_TACC	p.L345V	ENST00000317827.4	37	c.1033	CCDS6109.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.287|9.287	1.049526|1.049526	0.19827|0.19827	.|.	.|.	ENSG00000147526|ENSG00000147526	ENST00000519416;ENST00000520615;ENST00000443388;ENST00000443286;ENST00000518415;ENST00000522904;ENST00000317827;ENST00000379931;ENST00000520973|ENST00000521866	T;T;T;T;T;T;T;T|.	0.10192|.	2.96;2.94;3.08;3.08;2.9;3.1;3.11;2.92|.	5.27|5.27	2.35|2.35	0.29111|0.29111	.|.	0.761266|.	0.12106|.	N|.	0.499050|.	T|T	0.39682|0.39682	0.1087|0.1087	L|L	0.52364|0.52364	1.645|1.645	0.09310|0.09310	N|N	1|1	B;B;B;B;B;B;B;B|.	0.27823|.	0.128;0.105;0.19;0.03;0.053;0.03;0.104;0.051|.	B;B;B;B;B;B;B;B|.	0.29267|.	0.1;0.053;0.058;0.022;0.039;0.038;0.036;0.068|.	T|T	0.25012|0.25012	-1.0144|-1.0144	10|5	0.34782|.	T|.	0.22|.	1.8417|1.8417	6.009|6.009	0.19565|0.19565	0.152:0.6863:0.0:0.1617|0.152:0.6863:0.0:0.1617	.|.	150;150;150;361;345;345;150;300|.	B7Z3G3;E7EVI4;B4DH49;B4E302;O75410-2;O75410;E7ET87;O75410-7|.	.;.;.;.;.;TACC1_HUMAN;.;.|.	V|K	150;150;150;361;300;317;345;345;150|119	ENSP00000428687:L150V;ENSP00000428450:L150V;ENSP00000393647:L361V;ENSP00000428706:L300V;ENSP00000430355:L317V;ENSP00000321703:L345V;ENSP00000369263:L345V;ENSP00000430959:L150V|.	ENSP00000321703:L345V|.	L|N	+|+	1|3	2|2	TACC1|TACC1	38796952|38796952	0.070000|0.070000	0.21116|0.21116	0.800000|0.800000	0.32199|0.32199	0.375000|0.375000	0.29983|0.29983	1.304000|1.304000	0.33482|0.33482	1.209000|1.209000	0.43321|0.43321	-0.251000|-0.251000	0.11542|0.11542	CTG|AAC	TACC1	-	NULL	ENSG00000147526		0.507	TACC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TACC1	HGNC	protein_coding	OTTHUMT00000376768.1	-	0.00	53	0	C	NM_006283		38677795	+1	tier1	-	no_errors	ENST00000379931	ensembl	human	known	74_37	missense	31.63	67	31	SNP	0.606	G
TEC	7006	genome.wustl.edu	37	4	48169925	48169925	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr4:48169925C>A	ENST00000381501.3	-	7	698	c.541G>T	c.(541-543)Gaa>Taa	p.E181*		NM_003215.2	NP_003206.2	P42680	TEC_HUMAN	tec protein tyrosine kinase	181	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				B cell receptor signaling pathway (GO:0050853)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of platelet activation (GO:0010543)|tissue regeneration (GO:0042246)	cell-cell junction (GO:0005911)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31						ACGATTTCTTCACTATTATCT	0.383																																																	0													163.0	156.0	159.0					4																	48169925		2203	4300	6503	SO:0001587	stop_gained	0			D29767	CCDS3481.1	4p12	2013-02-14			ENSG00000135605	ENSG00000135605		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	11719	protein-coding gene	gene with protein product		600583				7934162	Standard	NM_003215		Approved	PSCTK4	uc003gxz.3	P42680	OTTHUMG00000128623	ENST00000381501.3:c.541G>T	4.37:g.48169925C>A	ENSP00000370912:p.Glu181*		B7ZKZ6|Q3MIS5	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.E181*	ENST00000381501.3	37	c.541	CCDS3481.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673319	0.88445	.	.	ENSG00000135605	ENST00000381501	.	.	.	5.71	5.71	0.89125	.	0.246015	0.41001	D	0.000979	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	18.0269	0.89272	0.0:1.0:0.0:0.0	.	.	.	.	X	181	.	ENSP00000370912:E181X	E	-	1	0	TEC	47864682	1.000000	0.71417	0.991000	0.47740	0.230000	0.25150	6.331000	0.72929	2.710000	0.92621	0.491000	0.48974	GAA	TEC	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000135605		0.383	TEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEC	HGNC	protein_coding	OTTHUMT00000250492.3		0.00	31	0	C			48169925	-1			no_errors	ENST00000381501	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	0.998	A
THBS2	7058	genome.wustl.edu	37	6	169648945	169648945	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:169648945C>T	ENST00000366787.3	-	4	425	c.176G>A	c.(175-177)cGc>cAc	p.R59H		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	59	Heparin-binding. {ECO:0000255}.|Laminin G-like.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.R59H(1)		NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GTAGTCAAAGCGCACGAAGCG	0.592																																					Esophageal Squamous(91;219 1934 18562 44706)												1	Substitution - Missense(1)	large_intestine(1)											126.0	104.0	111.0					6																	169648945		2203	4300	6503	SO:0001583	missense	0				CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.176G>A	6.37:g.169648945C>T	ENSP00000355751:p.Arg59His		A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R59H	ENST00000366787.3	37	c.176	CCDS34574.1	6	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173667	0.78452	.	.	ENSG00000186340	ENST00000366787;ENST00000435791	T;T	0.02258	4.37;4.37	4.42	4.42	0.53409	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.37530	U	0.002054	T	0.07413	0.0187	M	0.72894	2.215	0.51012	D	0.999903	D	0.89917	1.0	D	0.87578	0.998	T	0.21008	-1.0258	10	0.49607	T	0.09	-51.1463	17.4031	0.87466	0.0:1.0:0.0:0.0	.	59	P35442	TSP2_HUMAN	H	59	ENSP00000355751:R59H;ENSP00000398928:R59H	ENSP00000355751:R59H	R	-	2	0	THBS2	169390870	1.000000	0.71417	0.405000	0.26409	0.389000	0.30415	7.304000	0.78882	2.180000	0.69256	0.462000	0.41574	CGC	THBS2	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000186340		0.592	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS2	HGNC	protein_coding	OTTHUMT00000105439.1	-	0.00	49	0	C	NM_003247		169648945	-1	tier1	-	no_errors	ENST00000366787	ensembl	human	known	74_37	missense	37.21	27	16	SNP	1.000	T
TPM3P9	147804	genome.wustl.edu	37	19	53945817	53945817	+	RNA	SNP	A	A	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:53945817A>T	ENST00000424846.3	+	0	814				ZNF761_ENST00000454407.1_RNA	NR_003148.3				tropomyosin 3 pseudogene 9																		CTCTGTACACAAAGGATGCTG	0.498																																																	0																																												0					19q13.42	2012-07-04			ENSG00000241015	ENSG00000241015			44142	pseudogene	pseudogene							Standard	NR_003148		Approved				OTTHUMG00000157312		19.37:g.53945817A>T				RNA	SNP	-	NULL	ENST00000424846.3	37	NULL		19																																																																																			TPM3P9	-	-	ENSG00000241015		0.498	TPM3P9-002	KNOWN	basic	processed_transcript	TPM3P9	HGNC	pseudogene	OTTHUMT00000347070.1	-	0.00	62	0	A	NR_003148		53945817	+1	tier1	-	no_errors	ENST00000424846	ensembl	human	known	74_37	rna	73.91	24	68	SNP	0.999	T
AVIL	10677	genome.wustl.edu	37	12	58196399	58196399	+	Intron	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:58196399G>T	ENST00000257861.3	-	16	2393				TSFM_ENST00000543727.1_Missense_Mutation_p.Q211H|AVIL_ENST00000550083.1_5'Flank|AVIL_ENST00000537081.1_Intron|TSFM_ENST00000550559.1_3'UTR|RP11-571M6.17_ENST00000602802.1_lincRNA|TSFM_ENST00000548851.1_Intron	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin						actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					acttcttgcagaacacctcct	0.393																																																	0																																										SO:0001627	intron_variant	0			AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.1963-268C>A	12.37:g.58196399G>T			B2RAU7|Q2NKM9	Missense_Mutation	SNP	pfam_Transl_elong_EFTs/EF1B_dimer,pfam_UBA/Ts_N,superfamily_Transl_elong_EFTs/EF1B_dimer,superfamily_UBA-like	p.Q211H	ENST00000257861.3	37	c.633	CCDS8959.1	12	.	.	.	.	.	.	.	.	.	.	G	3.870	-0.028026	0.07589	.	.	ENSG00000123297	ENST00000543727	.	.	.	3.53	-5.09	0.02920	.	.	.	.	.	T	0.13457	0.0326	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.18713	-1.0328	6	0.31617	T	0.26	.	2.3686	0.04325	0.2489:0.1588:0.4363:0.1559	.	.	.	.	H	211	.	ENSP00000439342:Q211H	Q	+	3	2	TSFM	56482666	0.000000	0.05858	0.000000	0.03702	0.061000	0.15899	-0.189000	0.09629	-1.174000	0.02754	-0.379000	0.06801	CAG	TSFM	-	NULL	ENSG00000123297		0.393	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSFM	HGNC	protein_coding	OTTHUMT00000409276.1	-	0.00	34	0	G	NM_006576		58196399	+1	tier1	-	no_errors	ENST00000543727	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
TSTA3	7264	genome.wustl.edu	37	8	144696991	144696991	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr8:144696991G>T	ENST00000425753.2	-	4	459	c.356C>A	c.(355-357)cCt>cAt	p.P119H	TSTA3_ENST00000529064.1_Missense_Mutation_p.P119H	NM_003313.3	NP_003304.1	Q13630	FCL_HUMAN	tissue specific transplantation antigen P35B	119					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|cytolysis (GO:0019835)|GDP-mannose metabolic process (GO:0019673)|leukocyte cell-cell adhesion (GO:0007159)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	coenzyme binding (GO:0050662)|electron carrier activity (GO:0009055)|GDP-4-dehydro-D-rhamnose reductase activity (GO:0042356)|GDP-L-fucose synthase activity (GO:0050577)|isomerase activity (GO:0016853)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|skin(1)	9	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.17e-38)|Epithelial(56;7.17e-37)|all cancers(56;2.46e-32)|Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CGTCTTGTCAGGGAAGATACA	0.637																																																	0													103.0	89.0	94.0					8																	144696991		2203	4300	6503	SO:0001583	missense	0			U58766	CCDS6408.1	8q24.3	2012-02-22			ENSG00000104522	ENSG00000104522	1.1.1.271	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	12390	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 4E, member 1"", ""GDP-L-fucose synthase"""	137020				7803801, 1348494, 19027726	Standard	NM_003313		Approved	FX, P35B, SDR4E1	uc003yzb.2	Q13630	OTTHUMG00000165159	ENST00000425753.2:c.356C>A	8.37:g.144696991G>T	ENSP00000398803:p.Pro119His		B2R8Y7|D3DWK5|Q567Q9|Q9UDG7	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct	p.P119H	ENST00000425753.2	37	c.356	CCDS6408.1	8	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784027	0.90282	.	.	ENSG00000104522	ENST00000529064;ENST00000425753;ENST00000529048;ENST00000533817	D;D;D;D	0.94138	-3.36;-3.36;-3.36;-3.36	4.85	4.85	0.62838	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.98143	0.9387	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99833	1.1055	10	0.87932	D	0	-11.2838	16.5412	0.84385	0.0:0.0:1.0:0.0	.	119;119	B4DZW9;Q13630	.;FCL_HUMAN	H	119	ENSP00000435386:P119H;ENSP00000398803:P119H;ENSP00000431587:P119H;ENSP00000437012:P119H	ENSP00000398803:P119H	P	-	2	0	TSTA3	144768134	1.000000	0.71417	0.996000	0.52242	0.860000	0.49131	6.280000	0.72626	2.235000	0.73313	0.467000	0.42956	CCT	TSTA3	-	pfam_Epimerase_deHydtase	ENSG00000104522		0.637	TSTA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSTA3	HGNC	protein_coding	OTTHUMT00000382263.1		0.00	42	0	G	NM_003313		144696991	-1			no_errors	ENST00000425753	ensembl	human	known	74_37	missense	5.41	69	4	SNP	1.000	T
TWF2	11344	genome.wustl.edu	37	3	52265239	52265239	+	Silent	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr3:52265239G>T	ENST00000305533.5	-	5	630	c.387C>A	c.(385-387)ctC>ctA	p.L129L	TLR9_ENST00000494383.1_5'Flank|TLR9_ENST00000597542.1_5'UTR|TWF2_ENST00000499914.2_Silent_p.L129L	NM_007284.3	NP_009215.1	Q6IBS0	TWF2_HUMAN	twinfilin actin-binding protein 2	129	ADF-H 1. {ECO:0000255|PROSITE- ProRule:PRU00599}.				barbed-end actin filament capping (GO:0051016)|cell projection organization (GO:0030030)|cellular response to growth factor stimulus (GO:0071363)|cellular response to retinoic acid (GO:0071300)|negative regulation of actin filament polymerization (GO:0030837)|positive regulation of axon extension (GO:0045773)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of microvillus length (GO:0032532)|sequestering of actin monomers (GO:0042989)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|myofibril (GO:0030016)|perinuclear region of cytoplasm (GO:0048471)|stereocilium (GO:0032420)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;2.43e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CAGCAAAAGAGAGGTCATCCT	0.617																																																	0													75.0	76.0	75.0					3																	52265239		2203	4300	6503	SO:0001819	synonymous_variant	0			Y17169	CCDS2849.1	3p21.1	2013-04-25	2013-04-25	2006-11-13	ENSG00000247596	ENSG00000247596			9621	protein-coding gene	gene with protein product		607433	"""protein tyrosine kinase 9-like (A6-related protein)"", ""PTK9L protein tyrosine kinase 9-like (A6-related protein)"", ""twinfilin, actin-binding protein, homolog 2 (Drosophila)"""	PTK9L		10406962, 12807912	Standard	NM_007284		Approved	A6RP, A6r		Q6IBS0	OTTHUMG00000158105	ENST00000305533.5:c.387C>A	3.37:g.52265239G>T			Q9Y3F5	Silent	SNP	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.L129	ENST00000305533.5	37	c.387	CCDS2849.1	3																																																																																			TWF2	-	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	ENSG00000247596		0.617	TWF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWF2	HGNC	protein_coding	OTTHUMT00000350199.2	-	0.00	79	0	G			52265239	-1	tier1	-	no_errors	ENST00000305533	ensembl	human	known	74_37	silent	5.75	82	5	SNP	1.000	T
UPF1	5976	genome.wustl.edu	37	19	18968316	18968316	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:18968316G>A	ENST00000599848.1	+	15	2398	c.2189G>A	c.(2188-2190)gGc>gAc	p.G730D	UPF1_ENST00000262803.5_Missense_Mutation_p.G719D			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	730					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TTCTACGAGGGCTCCCTCCAG	0.627																																																	0													38.0	36.0	37.0					19																	18968316		2203	4300	6503	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2189G>A	19.37:g.18968316G>A	ENSP00000470142:p.Gly730Asp		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.G730D	ENST00000599848.1	37	c.2189		19	.	.	.	.	.	.	.	.	.	.	G	27.8	4.866447	0.91511	.	.	ENSG00000005007	ENST00000262803	D	0.93488	-3.23	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.96676	0.8915	M	0.82193	2.58	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.74674	0.984;0.972	D	0.97431	1.0015	10	0.87932	D	0	-41.2005	16.3833	0.83489	0.0:0.0:1.0:0.0	.	730;719	Q92900;Q92900-2	RENT1_HUMAN;.	D	719	ENSP00000262803:G719D	ENSP00000262803:G719D	G	+	2	0	UPF1	18829316	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.369000	0.97156	2.218000	0.71995	0.561000	0.74099	GGC	UPF1	-	superfamily_P-loop_NTPase	ENSG00000005007		0.627	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1		0.00	62	0	G	NM_002911		18968316	+1			no_errors	ENST00000599848	ensembl	human	known	74_37	missense	6.45	56	4	SNP	1.000	A
USP48	84196	genome.wustl.edu	37	1	22007546	22007546	+	Intron	SNP	T	T	C			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr1:22007546T>C	ENST00000308271.9	-	26	3707				USP48_ENST00000374732.3_Intron|USP48_ENST00000529637.1_Intron|USP48_ENST00000479177.1_5'UTR|USP48_ENST00000400301.1_Intron	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48						ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		aaaagtcaaatactgacagga	0.403																																																	0																																										SO:0001627	intron_variant	0			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.3059-219A>G	1.37:g.22007546T>C			B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	RNA	SNP	-	NULL	ENST00000308271.9	37	NULL	CCDS30623.1	1																																																																																			USP48	-	-	ENSG00000090686		0.403	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	HGNC	protein_coding	OTTHUMT00000021372.1	-	0.00	15	0	T	NM_032236		22007546	-1	tier1	-	no_errors	ENST00000479177	ensembl	human	known	74_37	rna	77.27	5	17	SNP	0.001	C
USP6NL	9712	genome.wustl.edu	37	10	11505102	11505102	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr10:11505102G>T	ENST00000609104.1	-	15	2219	c.1825C>A	c.(1825-1827)Cct>Act	p.P609T	USP6NL_ENST00000379237.2_Missense_Mutation_p.P632T|USP6NL_ENST00000277575.5_Missense_Mutation_p.P626T	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	609					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TGACTTGGAGGCTGTACTTTA	0.542																																																	0													66.0	65.0	65.0					10																	11505102		1950	4146	6096	SO:0001583	missense	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1825C>A	10.37:g.11505102G>T	ENSP00000476462:p.Pro609Thr		A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P632T	ENST00000609104.1	37	c.1894	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	G	5.932	0.355924	0.11239	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.04970	3.52;3.53	5.78	3.92	0.45320	.	0.256098	0.34906	N	0.003582	T	0.08223	0.0205	L	0.56769	1.78	0.25105	N	0.990757	B;B	0.28350	0.067;0.208	B;B	0.30029	0.025;0.11	T	0.22765	-1.0207	10	0.36615	T	0.2	.	9.0181	0.36182	0.1188:0.0:0.6596:0.2216	.	609;626	Q92738;Q92738-2	US6NL_HUMAN;.	T	609;626;609	ENSP00000277575:P626T;ENSP00000368539:P609T	ENSP00000277575:P626T	P	-	1	0	USP6NL	11545108	1.000000	0.71417	0.966000	0.40874	0.002000	0.02628	1.720000	0.38022	0.363000	0.24346	-1.357000	0.01221	CCT	USP6NL	-	NULL	ENSG00000148429		0.542	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3	-	0.00	94	0	G	NM_014688		11505102	-1	tier1	-	no_errors	ENST00000379237	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.994	T
UTRN	7402	genome.wustl.edu	37	6	145156978	145156978	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr6:145156978G>T	ENST00000367545.3	+	69	9728	c.9728G>T	c.(9727-9729)aGc>aTc	p.S3243I	UTRN_ENST00000367526.4_Missense_Mutation_p.S798I	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3243					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TCCCCAGTGAGCCAGCCGCAG	0.547																																																	0													120.0	124.0	123.0					6																	145156978		2203	4300	6503	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.9728G>T	6.37:g.145156978G>T	ENSP00000356515:p.Ser3243Ile		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.S3243I	ENST00000367545.3	37	c.9728	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.558241	0.96514	.	.	ENSG00000152818	ENST00000367545;ENST00000367526;ENST00000455022	D;D;D	0.84146	-1.81;-1.81;-1.81	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000006	D	0.90848	0.7125	M	0.79805	2.47	0.58432	D	0.999993	D	0.63880	0.993	P	0.58130	0.833	D	0.90971	0.4820	10	0.72032	D	0.01	.	20.2768	0.98488	0.0:0.0:1.0:0.0	.	3243	P46939	UTRO_HUMAN	I	3243;798;155	ENSP00000356515:S3243I;ENSP00000356496:S798I;ENSP00000387927:S155I	ENSP00000356496:S798I	S	+	2	0	UTRN	145198671	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.762000	0.98944	2.808000	0.96608	0.650000	0.86243	AGC	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.547	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1		0.00	62	0	G			145156978	+1			no_errors	ENST00000367545	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
VPS37C	55048	genome.wustl.edu	37	11	60899899	60899899	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:60899899T>G	ENST00000301765.5	-	5	693	c.461A>C	c.(460-462)cAg>cCg	p.Q154P		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	154	VPS37 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00646}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						CACCACTTCCTGGAGCTTTTC	0.657																																																	0													11.0	13.0	12.0					11																	60899899		2193	4296	6489	SO:0001583	missense	0			AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.461A>C	11.37:g.60899899T>G	ENSP00000301765:p.Gln154Pro		Q8N3K4	Missense_Mutation	SNP	pfam_Mod_r	p.Q154P	ENST00000301765.5	37	c.461	CCDS31573.1	11	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489248	0.84962	.	.	ENSG00000167987	ENST00000301765;ENST00000540084	T	0.56941	0.43	4.9	4.9	0.64082	Modifier of rudimentary, Modr (1);	0.199280	0.45126	D	0.000385	T	0.72455	0.3462	M	0.80332	2.49	0.58432	D	0.999996	D	0.71674	0.998	D	0.78314	0.991	T	0.76870	-0.2799	10	0.72032	D	0.01	-20.9666	13.1078	0.59257	0.0:0.0:0.0:1.0	.	154	A5D8V6	VP37C_HUMAN	P	154	ENSP00000301765:Q154P	ENSP00000301765:Q154P	Q	-	2	0	VPS37C	60656475	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.958000	0.63660	1.840000	0.53500	0.379000	0.24179	CAG	VPS37C	-	NULL	ENSG00000167987		0.657	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37C	HGNC	protein_coding	OTTHUMT00000396467.1	-	0.00	54	0	T	NM_017966		60899899	-1	tier1	-	no_errors	ENST00000301765	ensembl	human	known	74_37	missense	10.00	54	6	SNP	1.000	G
WDR66	144406	genome.wustl.edu	37	12	122361696	122361696	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr12:122361696G>T	ENST00000288912.4	+	3	1401	c.547G>T	c.(547-549)Gag>Tag	p.E183*	WDR66_ENST00000397454.2_Nonsense_Mutation_p.E183*	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	183							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		AGGAGAGCTTGAGGAGAAAAC	0.478																																					Esophageal Squamous(85;849 1794 49757 52143)												0													102.0	98.0	100.0					12																	122361696		1859	4093	5952	SO:0001587	stop_gained	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.547G>T	12.37:g.122361696G>T	ENSP00000288912:p.Glu183*		C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E183*	ENST00000288912.4	37	c.547	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.231628	0.79688	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	.	.	.	3.86	0.76	0.18442	.	4.066800	0.00682	N	0.000697	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	3.9557	0.09388	0.2563:0.2986:0.4451:0.0	.	.	.	.	X	183	.	ENSP00000288912:E183X	E	+	1	0	WDR66	120846079	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-0.023000	0.12456	0.285000	0.22329	0.460000	0.39030	GAG	WDR66	-	NULL	ENSG00000158023		0.478	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	-	0.00	41	0	G	NM_144668		122361696	+1	tier1	-	no_errors	ENST00000288912	ensembl	human	known	74_37	nonsense	6.06	62	4	SNP	0.000	T
WRN	7486	genome.wustl.edu	37	8	30922442	30922442	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr8:30922442G>A	ENST00000298139.5	+	5	616	c.367G>A	c.(367-369)Gga>Aga	p.G123R		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	123	3'-5' exonuclease.|Interaction with WRNIP1. {ECO:0000250}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TTTTCCCCAGGGATTAAAAAT	0.323			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	0													63.0	69.0	67.0					8																	30922442		2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.367G>A	8.37:g.30922442G>A	ENSP00000298139:p.Gly123Arg		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.G123R	ENST00000298139.5	37	c.367	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	24.7	4.559684	0.86335	.	.	ENSG00000165392	ENST00000298139	T	0.63913	-0.07	5.82	5.82	0.92795	-5&apos (2);Ribonuclease H-like (1); exonuclease (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.76004	0.3927	L	0.47716	1.5	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	T	0.76713	-0.2858	10	0.87932	D	0	-27.6826	19.6831	0.95971	0.0:0.0:1.0:0.0	.	123	Q14191	WRN_HUMAN	R	123	ENSP00000298139:G123R	ENSP00000298139:G123R	G	+	1	0	WRN	31041984	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.537000	0.82033	2.739000	0.93911	0.655000	0.94253	GGA	WRN	-	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	ENSG00000165392		0.323	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1	-	0.00	78	0	G			30922442	+1	tier1	-	no_errors	ENST00000298139	ensembl	human	known	74_37	missense	48.48	34	32	SNP	1.000	A
YIPF5	81555	genome.wustl.edu	37	5	143545145	143545145	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr5:143545145G>T	ENST00000274496.5	-	3	268	c.134C>A	c.(133-135)tCg>tAg	p.S45*	YIPF5_ENST00000513112.1_5'UTR|YIPF5_ENST00000448443.2_Nonsense_Mutation_p.S45*	NM_001271732.1|NM_030799.7	NP_001258661.1|NP_110426.4	Q969M3	YIPF5_HUMAN	Yip1 domain family, member 5	45					protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum exit site (GO:0070971)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)		p.S45L(1)		large_intestine(2)|lung(5)|ovary(1)|skin(1)	9		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			GCCTTGCTGCGAATAGTCATA	0.408																																																	1	Substitution - Missense(1)	large_intestine(1)											157.0	138.0	144.0					5																	143545145		2203	4300	6503	SO:0001587	stop_gained	0			AF318329	CCDS4279.1, CCDS64277.1	5q31.3	2009-01-12			ENSG00000145817	ENSG00000145817		"""Yip1 domain family"""	24877	protein-coding gene	gene with protein product		611483				12975309, 18718466	Standard	NM_001024947		Approved	SMAP-5, FinGER5	uc003lnl.5	Q969M3	OTTHUMG00000129679	ENST00000274496.5:c.134C>A	5.37:g.143545145G>T	ENSP00000274496:p.Ser45*		D3DQF5|Q4VSN6|Q53EX4|Q8NHE5|Q9H338|Q9H3U4	Nonsense_Mutation	SNP	pfam_Yip1	p.S45*	ENST00000274496.5	37	c.134	CCDS4279.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.065483	0.97251	.	.	ENSG00000145817	ENST00000274496;ENST00000377986;ENST00000448443;ENST00000536767	.	.	.	6.02	5.14	0.70334	.	0.251992	0.41294	D	0.000915	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.6498	11.1335	0.48360	0.0675:0.1264:0.8061:0.0	.	.	.	.	X	45	.	ENSP00000274496:S45X	S	-	2	0	YIPF5	143525338	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	6.562000	0.73960	2.857000	0.98124	0.650000	0.86243	TCG	YIPF5	-	NULL	ENSG00000145817		0.408	YIPF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF5	HGNC	protein_coding	OTTHUMT00000251882.1		0.00	24	0	G	NM_030799		143545145	-1			no_errors	ENST00000274496	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	0.996	T
ZC3H7A	29066	genome.wustl.edu	37	16	11861320	11861320	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:11861320G>T	ENST00000396516.2	-	12	1672	c.1475C>A	c.(1474-1476)cCa>cAa	p.P492Q	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.P492Q			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	492						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TGTTGGTCTTGGACGTATTTT	0.279																																																	0													142.0	136.0	138.0					16																	11861320		2196	4300	6496	SO:0001583	missense	0			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1475C>A	16.37:g.11861320G>T	ENSP00000379773:p.Pro492Gln		D3DUG5|Q9NPE9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P492Q	ENST00000396516.2	37	c.1475	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753344	0.89753	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.11277	2.79;2.79	5.77	5.77	0.91146	.	0.048145	0.85682	D	0.000000	T	0.36524	0.0970	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.03750	-1.1007	10	0.87932	D	0	.	18.9808	0.92755	0.0:0.0:1.0:0.0	.	213;492	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	Q	492	ENSP00000347999:P492Q;ENSP00000379773:P492Q	ENSP00000347999:P492Q	P	-	2	0	ZC3H7A	11768821	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.729000	0.93468	0.467000	0.42956	CCA	ZC3H7A	-	NULL	ENSG00000122299		0.279	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	HGNC	protein_coding	OTTHUMT00000437066.1	-	0.00	34	0	G	NM_014153		11861320	-1	tier1	-	no_errors	ENST00000355758	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72993830	72993830	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr16:72993830G>T	ENST00000268489.5	-	2	887	c.215C>A	c.(214-216)tCc>tAc	p.S72Y	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	72			S -> A (in dbSNP:rs7193297). {ECO:0000269|PubMed:7592926}.		brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGCGGGCTCGGAGGGGGGCCC	0.701																																																	0													12.0	16.0	15.0					16																	72993830		2186	4285	6471	SO:0001583	missense	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.215C>A	16.37:g.72993830G>T	ENSP00000268489:p.Ser72Tyr		D3DWS8|O15101|Q13719	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.S72Y	ENST00000268489.5	37	c.215	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	G	5.641	0.302884	0.10678	.	.	ENSG00000140836	ENST00000268489	T	0.73681	-0.77	5.11	5.11	0.69529	.	0.000000	0.49916	D	0.000135	T	0.67363	0.2885	N	0.14661	0.345	0.80722	D	1	D	0.59357	0.985	P	0.48921	0.595	T	0.69942	-0.5008	10	0.37606	T	0.19	.	18.5506	0.91063	0.0:0.0:1.0:0.0	.	72	Q15911	ZFHX3_HUMAN	Y	72	ENSP00000268489:S72Y	ENSP00000268489:S72Y	S	-	2	0	ZFHX3	71551331	0.674000	0.27549	0.999000	0.59377	0.207000	0.24258	3.878000	0.56130	2.379000	0.81126	0.462000	0.41574	TCC	ZFHX3	-	NULL	ENSG00000140836		0.701	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	-	0.00	51	0	G	NM_006885		72993830	-1	tier1	-	no_errors	ENST00000268489	ensembl	human	known	74_37	missense	20.00	48	12	SNP	0.996	T
ZNF383	163087	genome.wustl.edu	37	19	37721365	37721365	+	Splice_Site	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:37721365G>T	ENST00000589413.1	+	5	592		c.e5+1		ZNF383_ENST00000590503.1_Splice_Site|ZNF383_ENST00000352998.3_Splice_Site			Q8NA42	ZN383_HUMAN	zinc finger protein 383						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATGGCTGAGGTGAGTTGATG	0.408																																																	0													154.0	131.0	138.0					19																	37721365		2203	4300	6503	SO:0001630	splice_region_variant	0			AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.9+1G>T	19.37:g.37721365G>T			Q6X2C7	Splice_Site	SNP	-	e1+1	ENST00000589413.1	37	c.9+1	CCDS12501.1	19	.	.	.	.	.	.	.	.	.	.	G	14.94	2.685247	0.47991	.	.	ENSG00000188283	ENST00000352998	.	.	.	2.88	2.88	0.33553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.4666	0.38817	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF383	42413205	1.000000	0.71417	0.793000	0.32043	0.519000	0.34347	2.150000	0.42254	1.936000	0.56123	0.462000	0.41574	.	ZNF383	-	-	ENSG00000188283		0.408	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF383	HGNC	protein_coding	OTTHUMT00000458141.1	-	0.00	34	0	G	NM_152604	Intron	37721365	+1	tier1	-	no_errors	ENST00000352998	ensembl	human	known	74_37	splice_site	10.81	33	4	SNP	0.824	T
ZNF546	339327	genome.wustl.edu	37	19	40521651	40521651	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:40521651G>T	ENST00000347077.4	+	7	2690	c.2474G>T	c.(2473-2475)aGa>aTa	p.R825I	ZNF546_ENST00000600094.1_Missense_Mutation_p.R799I|ZNF546_ENST00000596894.1_Intron	NM_178544.3	NP_848639.2	Q86UE3	ZN546_HUMAN	zinc finger protein 546	825					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R825I(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(15)|lung(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	34	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TTACATCAGAGAAATCATATT	0.333																																																	1	Substitution - Missense(1)	large_intestine(1)											49.0	52.0	51.0					19																	40521651		2203	4299	6502	SO:0001583	missense	0			BC045649	CCDS12548.1	19q13.2	2013-01-08				ENSG00000187187		"""Zinc fingers, C2H2-type"", ""-"""	28671	protein-coding gene	gene with protein product				ZNF49		12477932	Standard	XM_005258853		Approved	MGC43537	uc002oms.2	Q86UE3		ENST00000347077.4:c.2474G>T	19.37:g.40521651G>T	ENSP00000339823:p.Arg825Ile		A8K913	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R825I	ENST00000347077.4	37	c.2474	CCDS12548.1	19	.	.	.	.	.	.	.	.	.	.	g	11.80	1.747164	0.30955	.	.	ENSG00000187187	ENST00000347077;ENST00000392042	T	0.10005	2.92	2.95	0.804	0.18697	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11495	0.0280	M	0.76002	2.32	0.37656	D	0.922592	B	0.33379	0.41	B	0.26770	0.073	T	0.09037	-1.0693	9	0.87932	D	0	.	6.4023	0.21646	0.2699:0.0:0.7301:0.0	.	825	Q86UE3	ZN546_HUMAN	I	825;434	ENSP00000339823:R825I	ENSP00000339823:R825I	R	+	2	0	ZNF546	45213491	.	.	0.967000	0.41034	0.981000	0.71138	.	.	0.277000	0.22141	0.655000	0.94253	AGA	ZNF546	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187187		0.333	ZNF546-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF546	HGNC	protein_coding	OTTHUMT00000462495.2		0.00	25	0	G	NM_178544		40521651	+1			no_errors	ENST00000347077	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
ZNF616	90317	genome.wustl.edu	37	19	52618714	52618714	+	Missense_Mutation	SNP	C	C	A	rs1045852		TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:52618714C>A	ENST00000600228.1	-	4	1964	c.1703G>T	c.(1702-1704)cGg>cTg	p.R568L	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		ATGAATTCTCCGATGCACTGT	0.433																																																	0													114.0	100.0	104.0					19																	52618714		2203	4300	6503	SO:0001583	missense	0			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1703G>T	19.37:g.52618714C>A	ENSP00000471000:p.Arg568Leu		B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R568L	ENST00000600228.1	37	c.1703	CCDS33090.1	19	.	.	.	.	.	.	.	.	.	.	C	5.738	0.320593	0.10845	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.08	-2.15	0.07102	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12987	0.0315	N	0.01771	-0.73	0.09310	N	1	B	0.02656	0.0	B	0.12156	0.007	T	0.21042	-1.0257	8	0.56958	D	0.05	.	5.7839	0.18322	0.0:0.33:0.0:0.67	rs1045852;rs1045852	568	Q08AN1	ZN616_HUMAN	L	568	.	ENSP00000328722:R568L	R	-	2	0	ZNF616	57310526	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	-1.766000	0.01797	-0.667000	0.05303	-0.680000	0.03767	CGG	ZNF616	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204611		0.433	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	HGNC	protein_coding	OTTHUMT00000462451.1		0.00	17	0	C	XM_030892		52618714	-1			no_errors	ENST00000600228	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.042	A
ZNF528	84436	genome.wustl.edu	37	19	52909833	52909833	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr19:52909833C>T	ENST00000360465.3	+	6	634	c.208C>T	c.(208-210)Cag>Tag	p.Q70*	ZNF528_ENST00000598192.1_Nonsense_Mutation_p.Q70*|ZNF528_ENST00000594530.1_Nonsense_Mutation_p.Q70*|ZNF528_ENST00000391788.2_Nonsense_Mutation_p.Q60*	NM_032423.2	NP_115799.2	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	70	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(6)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	39				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		CTGGACTCTGCAGAGTGAAGA	0.473																																																	0													109.0	105.0	106.0					19																	52909833		2203	4300	6503	SO:0001587	stop_gained	0			AB058730	CCDS33091.1	19q13	2013-01-08			ENSG00000167555	ENSG00000167555		"""Zinc fingers, C2H2-type"", ""-"""	29384	protein-coding gene	gene with protein product		615580				11347906	Standard	NM_032423		Approved	KIAA1827	uc002pzh.3	Q3MIS6	OTTHUMG00000156494	ENST00000360465.3:c.208C>T	19.37:g.52909833C>T	ENSP00000353652:p.Gln70*		B3KPN4|Q86T88|Q96JK0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q70*	ENST00000360465.3	37	c.208	CCDS33091.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.3|23.3	4.403008|4.403008	0.83230|0.83230	.|.	.|.	ENSG00000167555|ENSG00000167555	ENST00000448954|ENST00000391788;ENST00000391787;ENST00000360465	.|.	.|.	.|.	1.89|1.89	-1.29|-1.29	0.09288|0.09288	.|.	.|.	.|.	.|.	.|.	T|.	0.25044|.	0.0608|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41016|.	-0.9532|.	3|.	.|0.13853	.|T	.|0.58	.|.	7.4141|7.4141	0.27034|0.27034	0.0:0.5046:0.4954:0.0|0.0:0.5046:0.4954:0.0	.|.	.|.	.|.	.|.	V|X	39|60;70;70	.|.	.|ENSP00000353652:Q70X	A|Q	+|+	2|1	0|0	ZNF528|ZNF528	57601645|57601645	0.006000|0.006000	0.16342|0.16342	0.001000|0.001000	0.08648|0.08648	0.028000|0.028000	0.11728|0.11728	-0.044000|-0.044000	0.12023|0.12023	-0.347000|-0.347000	0.08299|0.08299	0.313000|0.313000	0.20887|0.20887	GCA|CAG	ZNF528	-	pfscan_Krueppel-associated_box	ENSG00000167555		0.473	ZNF528-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF528	HGNC	protein_coding	OTTHUMT00000344336.1	-	0.00	66	0	C	NM_032423		52909833	+1	tier1	-	no_errors	ENST00000360465	ensembl	human	known	74_37	nonsense	6.35	59	4	SNP	0.000	T
ZNHIT1	10467	genome.wustl.edu	37	7	100861637	100861637	+	Intron	SNP	C	C	T			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr7:100861637C>T	ENST00000305105.2	+	1	550				PLOD3_ENST00000223127.3_5'Flank|ZNHIT1_ENST00000492315.1_3'UTR	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1						negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					tcactgcagcctcgatttcct	0.493																																																	0																																										SO:0001627	intron_variant	0			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.22+139C>T	7.37:g.100861637C>T			Q6IB12	RNA	SNP	-	NULL	ENST00000305105.2	37	NULL	CCDS5716.1	7																																																																																			ZNHIT1	-	-	ENSG00000106400		0.493	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT1	HGNC	protein_coding	OTTHUMT00000347488.1	-	0.00	16	0	C	NM_006349		100861637	+1	tier1	-	no_errors	ENST00000461205	ensembl	human	known	74_37	rna	42.86	8	6	SNP	0.001	T
ZW10	9183	genome.wustl.edu	37	11	113631036	113631036	+	Silent	SNP	A	A	G			TCGA-JY-A6FE-01A-11D-A33E-09	TCGA-JY-A6FE-10A-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	735e3c66-d6fa-49f4-9606-625fd049b8a7	3607aeab-8869-4f79-98ea-8214dcbd16ab	g.chr11:113631036A>G	ENST00000200135.3	-	5	619	c.475T>C	c.(475-477)Ttg>Ctg	p.L159L		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	159	Interaction with RINT1.				ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		AGAGATTTCAATATTTTTAAA	0.378																																																	0													102.0	97.0	99.0					11																	113631036		2201	4296	6497	SO:0001819	synonymous_variant	0			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.475T>C	11.37:g.113631036A>G			A1A528	Silent	SNP	pfam_RZZ-complex_Zw10	p.L159	ENST00000200135.3	37	c.475	CCDS8363.1	11																																																																																			ZW10	-	pfam_RZZ-complex_Zw10	ENSG00000086827		0.378	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZW10	HGNC	protein_coding	OTTHUMT00000398700.1	-	0.00	32	0	A	NM_004724		113631036	-1	tier1	-	no_errors	ENST00000200135	ensembl	human	known	74_37	silent	36.36	21	12	SNP	0.939	G
