#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACCS	84680	genome.wustl.edu	37	11	44089274	44089274	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:44089274G>A	ENST00000263776.8	+	2	531	c.97G>A	c.(97-99)Gaa>Aaa	p.E33K	ACCS_ENST00000432284.2_Missense_Mutation_p.E33K|ACCS_ENST00000533208.1_3'UTR	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	33					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GGAAGATCTGGAAGGAGAATG	0.572																																					Esophageal Squamous(158;148 1889 8077 23160 41213)												0													84.0	85.0	85.0					11																	44089274		2203	4300	6503	SO:0001583	missense	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.97G>A	11.37:g.44089274G>A	ENSP00000263776:p.Glu33Lys		B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.E33K	ENST00000263776.8	37	c.97	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	G	10.66	1.412855	0.25465	.	.	ENSG00000110455	ENST00000524990;ENST00000263776;ENST00000432284;ENST00000533404	T;T;T;T	0.60424	1.02;0.19;1.02;0.74	5.27	0.9	0.19278	.	1.013140	0.07889	N	0.970830	T	0.44582	0.1300	L	0.57536	1.79	0.09310	N	1	P;B	0.39022	0.655;0.085	B;B	0.35039	0.194;0.026	T	0.29088	-1.0023	10	0.20519	T	0.43	-1.9716	1.9359	0.03337	0.1724:0.3129:0.3638:0.1508	.	33;33	B4E219;Q96QU6	.;1A1L1_HUMAN	K	33	ENSP00000434156:E33K;ENSP00000263776:E33K;ENSP00000391775:E33K;ENSP00000435919:E33K	ENSP00000263776:E33K	E	+	1	0	ACCS	44045850	0.168000	0.22989	0.040000	0.18447	0.358000	0.29455	1.427000	0.34881	0.290000	0.22444	-0.165000	0.13383	GAA	ACCS	-	NULL	ENSG00000110455		0.572	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	-	0.00	58	0	G	NM_032592		44089274	+1	tier1	-	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	27.87	43	17	SNP	0.004	A
ADNP2	22850	genome.wustl.edu	37	18	77895502	77895502	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:77895502G>C	ENST00000262198.4	+	4	2661	c.2206G>C	c.(2206-2208)Gca>Cca	p.A736P		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	736					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		GGCAGCGTGTGCACCATTTCT	0.498																																																	0													156.0	150.0	152.0					18																	77895502		2203	4300	6503	SO:0001583	missense	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2206G>C	18.37:g.77895502G>C	ENSP00000262198:p.Ala736Pro		A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.A736P	ENST00000262198.4	37	c.2206	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266319	0.59540	.	.	ENSG00000101544	ENST00000262198	.	.	.	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000002	T	0.78842	0.4347	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.78102	-0.2335	8	.	.	.	-23.6928	18.7205	0.91691	0.0:0.0:1.0:0.0	.	736	Q6IQ32	ADNP2_HUMAN	P	736	.	.	A	+	1	0	ADNP2	75996493	1.000000	0.71417	0.154000	0.22540	0.191000	0.23601	8.445000	0.90326	2.649000	0.89929	0.650000	0.86243	GCA	ADNP2	-	NULL	ENSG00000101544		0.498	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	-	0.00	42	0	G	NM_014913		77895502	+1	tier1	-	no_errors	ENST00000262198	ensembl	human	known	74_37	missense	22.45	36	11	SNP	0.998	C
AKAP10	11216	genome.wustl.edu	37	17	19861383	19861383	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:19861383G>T	ENST00000225737.6	-	4	978	c.821C>A	c.(820-822)gCc>gAc	p.A274D	AKAP10_ENST00000572155.1_5'Flank|AKAP10_ENST00000395536.3_Missense_Mutation_p.A274D	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	274	RGS 1. {ECO:0000255|PROSITE- ProRule:PRU00171}.				blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ATTTCTACTGGCTACTGTAAG	0.418																																																	0													145.0	143.0	144.0					17																	19861383		2203	4300	6503	SO:0001583	missense	0			AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.821C>A	17.37:g.19861383G>T	ENSP00000225737:p.Ala274Asp		B2R650|Q96AJ7	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	p.A274D	ENST00000225737.6	37	c.821	CCDS11214.1	17	.	.	.	.	.	.	.	.	.	.	G	10.61	1.399597	0.25291	.	.	ENSG00000108599	ENST00000225737;ENST00000395536	T	0.16743	2.32	6.08	4.08	0.47627	Regulator of G protein signalling (2);Regulator of G protein signalling superfamily (1);	0.214234	0.51477	D	0.000099	T	0.09247	0.0228	N	0.08118	0	0.34276	D	0.681622	B;P;B	0.37781	0.157;0.608;0.213	B;B;B	0.37601	0.091;0.254;0.171	T	0.29458	-1.0011	10	0.30078	T	0.28	-1.5201	11.5352	0.50633	0.0676:0.1254:0.807:0.0	.	274;274;274	E7EMD6;Q2XPN4;O43572	.;.;AKA10_HUMAN	D	274	ENSP00000225737:A274D	ENSP00000225737:A274D	A	-	2	0	AKAP10	19801975	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	3.360000	0.52299	0.882000	0.36016	0.591000	0.81541	GCC	AKAP10	-	superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	ENSG00000108599		0.418	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP10	HGNC	protein_coding	OTTHUMT00000132380.2	-	0.00	75	0	G	NM_007202		19861383	-1	tier1	-	no_errors	ENST00000225737	ensembl	human	known	74_37	missense	6.58	71	5	SNP	1.000	T
ALDH1B1	219	genome.wustl.edu	37	9	38396960	38396960	+	Silent	SNP	C	C	T	rs535405575		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:38396960C>T	ENST00000377698.3	+	2	1368	c.1215C>T	c.(1213-1215)ggC>ggT	p.G405G		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	405					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)	p.G405G(1)		NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		TCTTTGGTGGCGTGCAGGATG	0.542																																																	1	Substitution - coding silent(1)	large_intestine(1)											109.0	88.0	95.0					9																	38396960		2203	4300	6503	SO:0001819	synonymous_variant	0			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.1215C>T	9.37:g.38396960C>T			B2R8F0|Q8WX76|Q9BV45	Silent	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.G405	ENST00000377698.3	37	c.1215	CCDS6615.1	9																																																																																			ALDH1B1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000137124		0.542	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1B1	HGNC	protein_coding	OTTHUMT00000052492.1		0.00	48	0	C			38396960	+1			no_errors	ENST00000377698	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.000	T
ALPK2	115701	genome.wustl.edu	37	18	56202661	56202661	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:56202661C>T	ENST00000361673.3	-	5	4971	c.4758G>A	c.(4756-4758)caG>caA	p.Q1586Q	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1586						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TTCCCCTTTTCTGTGAAACAG	0.468																																																	0													121.0	115.0	117.0					18																	56202661		2203	4300	6503	SO:0001819	synonymous_variant	0			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4758G>A	18.37:g.56202661C>T			Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.Q1586	ENST00000361673.3	37	c.4758	CCDS11966.2	18																																																																																			ALPK2	-	NULL	ENSG00000198796		0.468	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1		0.00	24	0	C	NM_052947		56202661	-1			no_errors	ENST00000361673	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.004	T
APC2	10297	genome.wustl.edu	37	19	1457140	1457140	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:1457140C>G	ENST00000535453.1	+	8	2818	c.1105C>G	c.(1105-1107)Cgc>Ggc	p.R369G	CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000238483.4_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.R369G			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGAGATGCGCGTCCTGCA	0.726																																																	0													9.0	10.0	9.0					19																	1457140		2174	4254	6428	SO:0001583	missense	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1105C>G	19.37:g.1457140C>G	ENSP00000442954:p.Arg369Gly		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.R369G	ENST00000535453.1	37	c.1105	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830019	0.71258	.	.	ENSG00000115266	ENST00000233607;ENST00000535453	T;T	0.63580	-0.05;-0.05	4.36	3.26	0.37387	Armadillo-type fold (1);	0.063982	0.56097	D	0.000028	T	0.75243	0.3823	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.77416	-0.2596	10	0.87932	D	0	-21.9607	9.665	0.39979	0.3458:0.6542:0.0:0.0	.	368;369	O95996-3;O95996	.;APC2_HUMAN	G	369	ENSP00000233607:R369G;ENSP00000442954:R369G	ENSP00000233607:R369G	R	+	1	0	APC2	1408140	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.445000	0.35079	2.256000	0.74724	0.561000	0.74099	CGC	APC2	-	superfamily_ARM-type_fold	ENSG00000115266		0.726	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	-	0.00	17	0	C	NM_005883		1457140	+1	tier1	-	no_errors	ENST00000233607	ensembl	human	known	74_37	missense	44.44	5	4	SNP	1.000	G
APOL3	80833	genome.wustl.edu	37	22	36537664	36537664	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr22:36537664C>T	ENST00000349314.2	-	3	830	c.793G>A	c.(793-795)Gta>Ata	p.V265I	APOL3_ENST00000397287.2_Missense_Mutation_p.V65I|APOL3_ENST00000487423.1_5'Flank|APOL3_ENST00000424878.2_Missense_Mutation_p.V65I|APOL3_ENST00000361710.2_Missense_Mutation_p.V65I|APOL3_ENST00000397293.2_Missense_Mutation_p.V194I	NM_145640.2	NP_663615.1	O95236	APOL3_HUMAN	apolipoprotein L, 3	265					inflammatory response (GO:0006954)|lipoprotein metabolic process (GO:0042157)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|signal transducer activity (GO:0004871)			endometrium(2)|large_intestine(1)|lung(1)|stomach(1)	5						TCCTTAAATACCTTCAATCGG	0.463																																																	0													93.0	86.0	88.0					22																	36537664		2203	4300	6503	SO:0001583	missense	0			AF305227	CCDS13922.1, CCDS13924.1	22q13.1	2013-01-24			ENSG00000128284	ENSG00000128284		"""Apolipoproteins"""	14868	protein-coding gene	gene with protein product		607253				11374903	Standard	NM_145640		Approved	CG12-1, APOLIII	uc003aot.3	O95236	OTTHUMG00000150632	ENST00000349314.2:c.793G>A	22.37:g.36537664C>T	ENSP00000344577:p.Val265Ile		B1AHI4|B1AHI5|Q5U5N4|Q9BQ82|Q9BQA3	Missense_Mutation	SNP	pfam_ApoL	p.V265I	ENST00000349314.2	37	c.793	CCDS13922.1	22	.	.	.	.	.	.	.	.	.	.	C	10.05	1.244859	0.22796	.	.	ENSG00000128284	ENST00000397293;ENST00000424878;ENST00000349314;ENST00000361710;ENST00000397287	T;T;T;T;T	0.03607	3.87;3.87;3.87;3.87;3.87	4.01	-2.46	0.06461	.	2.581820	0.01293	N	0.010064	T	0.04497	0.0123	L	0.43923	1.385	0.09310	N	1	B;B	0.34349	0.45;0.395	B;B	0.36418	0.224;0.143	T	0.35176	-0.9799	10	0.37606	T	0.19	.	4.25	0.10689	0.0:0.3777:0.3256:0.2967	.	265;194	O95236;O95236-2	APOL3_HUMAN;.	I	194;65;265;65;65	ENSP00000380461:V194I;ENSP00000415779:V65I;ENSP00000344577:V265I;ENSP00000355164:V65I;ENSP00000380456:V65I	ENSP00000344577:V265I	V	-	1	0	APOL3	34867610	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.734000	0.01848	-0.422000	0.07405	0.478000	0.44815	GTA	APOL3	-	pfam_ApoL	ENSG00000128284		0.463	APOL3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APOL3	HGNC	protein_coding	OTTHUMT00000319268.1	-	0.00	23	0	C	NM_145641		36537664	-1	tier1	-	no_errors	ENST00000349314	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.000	T
AR	367	genome.wustl.edu	37	X	66765195	66765195	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:66765195G>A	ENST00000374690.3	+	1	731	c.207G>A	c.(205-207)caG>caA	p.Q69Q	AR_ENST00000504326.1_Silent_p.Q69Q|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Silent_p.Q69Q	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	69	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	agcagcagcagcagcagcagc	0.677									Androgen Insensitivity Syndrome																																								0													4.0	7.0	6.0					X																	66765195		1415	2820	4235	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.207G>A	X.37:g.66765195G>A			A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.Q69	ENST00000374690.3	37	c.207	CCDS14387.1	X																																																																																			AR	-	pfam_Andrgn_rcpt	ENSG00000169083		0.677	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1		0.00	50	0	G	NM_000044		66765195	+1			no_errors	ENST00000374690	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.995	A
ARHGEF17	9828	genome.wustl.edu	37	11	73021802	73021802	+	Missense_Mutation	SNP	C	C	T	rs369681028		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:73021802C>T	ENST00000263674.3	+	1	2469	c.2119C>T	c.(2119-2121)Cgc>Tgc	p.R707C	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	707	Poly-Arg.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						AGGTGCCCTCCGCCGACGACG	0.647																																																	0								C	CYS/ARG	1,4399	2.1+/-5.4	0,1,2199	36.0	35.0	35.0		2119	4.4	1.0	11		35	0,8586		0,0,4293	no	missense	ARHGEF17	NM_014786.3	180	0,1,6492	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	707/2064	73021802	1,12985	2200	4293	6493	SO:0001583	missense	0			AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.2119C>T	11.37:g.73021802C>T	ENSP00000263674:p.Arg707Cys		B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.R707C	ENST00000263674.3	37	c.2119	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	C	16.66	3.184879	0.57909	2.27E-4	0.0	ENSG00000110237	ENST00000263674	T	0.73681	-0.77	4.42	4.42	0.53409	.	0.000000	0.64402	D	0.000009	T	0.79429	0.4444	L	0.29908	0.895	0.54753	D	0.999985	D	0.89917	1.0	D	0.83275	0.996	T	0.82448	-0.0452	10	0.87932	D	0	-11.9428	15.7554	0.78018	0.0:1.0:0.0:0.0	.	707	Q96PE2	ARHGH_HUMAN	C	707	ENSP00000263674:R707C	ENSP00000263674:R707C	R	+	1	0	ARHGEF17	72699450	1.000000	0.71417	0.995000	0.50966	0.397000	0.30659	5.498000	0.66931	2.277000	0.76020	0.561000	0.74099	CGC	ARHGEF17	-	NULL	ENSG00000110237		0.647	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	HGNC	protein_coding	OTTHUMT00000397365.1	-	0.00	43	0	C	NM_014786		73021802	+1	tier1	-	no_errors	ENST00000263674	ensembl	human	known	74_37	missense	48.21	29	27	SNP	1.000	T
ARHGEF39	84904	genome.wustl.edu	37	9	35662990	35662990	+	Missense_Mutation	SNP	C	C	T	rs147148814		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:35662990C>T	ENST00000378387.3	-	6	743	c.626G>A	c.(625-627)cGt>cAt	p.R209H	ARHGEF39_ENST00000490970.1_Intron|ARHGEF39_ENST00000378395.2_Missense_Mutation_p.R173H|ARHGEF39_ENST00000343259.3_Intron	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	209					positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										AGCCTGGACACGCCGAAGGTG	0.522																																																	0								C	HIS/ARG	0,4406		0,0,2203	83.0	70.0	74.0		626	4.9	0.9	9	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	C9orf100	NM_032818.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	209/336	35662990	1,13005	2203	4300	6503	SO:0001583	missense	0			AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.626G>A	9.37:g.35662990C>T	ENSP00000367638:p.Arg209His		Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R209H	ENST00000378387.3	37	c.626	CCDS6584.2	9	.	.	.	.	.	.	.	.	.	.	C	20.2	3.943768	0.73672	0.0	1.16E-4	ENSG00000137135	ENST00000378387;ENST00000378395	T;T	0.30182	1.54;1.54	5.83	4.93	0.64822	Dbl homology (DH) domain (2);	0.000000	0.85682	D	0.000000	T	0.50017	0.1591	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.45745	-0.9240	10	0.34782	T	0.22	-17.8897	10.7632	0.46277	0.0:0.9126:0.0:0.0874	.	209	Q8N4T4	CI100_HUMAN	H	209;173	ENSP00000367638:R209H;ENSP00000367648:R173H	ENSP00000367638:R209H	R	-	2	0	C9orf100	35652990	0.966000	0.33281	0.876000	0.34364	0.941000	0.58515	4.642000	0.61383	1.451000	0.47736	0.650000	0.86243	CGT	ARHGEF39	-	superfamily_DH-domain	ENSG00000137135		0.522	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF39	HGNC	protein_coding	OTTHUMT00000052330.1	-	0.00	44	0	C	NM_032818		35662990	-1	tier1	rs147148814	no_errors	ENST00000378387	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.423	T
ARID1A	8289	genome.wustl.edu	37	1	27097621	27097622	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:27097621_27097622insA	ENST00000324856.7	+	12	3581_3582	c.3210_3211insA	c.(3211-3213)aaafs	p.K1071fs	ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.K688fs|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.K1071fs|ARID1A_ENST00000540690.1_5'Flank	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1071	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.K1072fs*21(2)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TCAACAAGAACAAAAAATGGCG	0.48			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	2	Deletion - Frameshift(2)	ovary(1)|endometrium(1)																																								SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3216dupA	1.37:g.27097627_27097627dupA	ENSP00000320485:p.Lys1071fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.W1072fs	ENST00000324856.7	37	c.3210_3211	CCDS285.1	1																																																																																			ARID1A	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000117713		0.480	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2		0.00	54	0	-	NM_139135		27097622	+1	tier1		no_errors	ENST00000324856	ensembl	human	known	74_37	frame_shift_ins	27.87	44	17	INS	1.000:1.000	A
ARSB	411	genome.wustl.edu	37	5	78135223	78135223	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:78135223T>A	ENST00000264914.4	-	6	1705	c.1169A>T	c.(1168-1170)gAg>gTg	p.E390V	ARSB_ENST00000396151.3_Missense_Mutation_p.E390V|ARSB_ENST00000565165.1_Missense_Mutation_p.E390V	NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	390					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		ATGCAGCAGCTCAATTCTGGG	0.413																																					Melanoma(169;563 1968 25780 26156 52266)												0													129.0	129.0	129.0					5																	78135223		2203	4300	6503	SO:0001583	missense	0			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1169A>T	5.37:g.78135223T>A	ENSP00000264914:p.Glu390Val		B2RC20|Q8N322|Q9UDI9	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.E390V	ENST00000264914.4	37	c.1169	CCDS4043.1	5	.	.	.	.	.	.	.	.	.	.	T	19.59	3.856924	0.71834	.	.	ENSG00000113273	ENST00000264914;ENST00000396151	D;D	0.96491	-4.03;-4.03	5.78	5.78	0.91487	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.048876	0.85682	D	0.000000	D	0.97914	0.9314	M	0.80183	2.485	0.58432	D	0.999998	D;D	0.76494	0.999;0.998	D;D	0.81914	0.98;0.995	D	0.98541	1.0632	10	0.66056	D	0.02	.	14.0514	0.64739	0.0:0.0:0.0:1.0	.	390;390	Q8N322;P15848	.;ARSB_HUMAN	V	390	ENSP00000264914:E390V;ENSP00000379455:E390V	ENSP00000264914:E390V	E	-	2	0	ARSB	78170979	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	4.993000	0.63895	2.207000	0.71202	0.459000	0.35465	GAG	ARSB	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000113273		0.413	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSB	HGNC	protein_coding	OTTHUMT00000226932.2	-	0.00	36	0	T	NM_000046		78135223	-1	tier1	-	no_errors	ENST00000264914	ensembl	human	known	74_37	missense	30.61	34	15	SNP	1.000	A
ASH1L	55870	genome.wustl.edu	37	1	155450046	155450046	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:155450046A>T	ENST00000368346.3	-	3	3254	c.2615T>A	c.(2614-2616)aTt>aAt	p.I872N	ASH1L_ENST00000392403.3_Missense_Mutation_p.I872N			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	872					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AGGGATTTCAATTTCTGGCTG	0.428																																																	0													125.0	133.0	130.0					1																	155450046		2203	4300	6503	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2615T>A	1.37:g.155450046A>T	ENSP00000357330:p.Ile872Asn		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.I872N	ENST00000368346.3	37	c.2615		1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319442	0.41096	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.90385	-2.66;-2.66	5.31	5.31	0.75309	.	0.067409	0.64402	D	0.000014	T	0.78181	0.4243	N	0.08118	0	0.80722	D	1	P;P	0.50528	0.894;0.936	B;P	0.44990	0.276;0.466	D	0.84128	0.0410	10	0.52906	T	0.07	.	15.0957	0.72232	1.0:0.0:0.0:0.0	.	872;872	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	N	872	ENSP00000357330:I872N;ENSP00000376204:I872N	ENSP00000357330:I872N	I	-	2	0	ASH1L	153716670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.502000	0.81614	2.234000	0.73211	0.528000	0.53228	ATT	ASH1L	-	NULL	ENSG00000116539		0.428	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1		0.00	29	0	A	NM_018489		155450046	-1			no_errors	ENST00000368346	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
ATHL1	80162	genome.wustl.edu	37	11	293646	293646	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:293646C>T	ENST00000409548.2	+	10	1648	c.1533C>T	c.(1531-1533)ttC>ttT	p.F511F	ATHL1_ENST00000409655.1_Intron|ATHL1_ENST00000409479.1_Silent_p.F538F	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	511					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CAGTCCCCTTCTCCCTGAGTC	0.612																																																	0													80.0	86.0	84.0					11																	293646		2203	4300	6503	SO:0001819	synonymous_variant	0			AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1533C>T	11.37:g.293646C>T			Q658X8|Q8TEG9|Q9H635	Silent	SNP	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	p.F511	ENST00000409548.2	37	c.1533	CCDS31322.2	11																																																																																			ATHL1	-	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	ENSG00000142102		0.612	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATHL1	HGNC	protein_coding	OTTHUMT00000330164.3	-	0.00	26	0	C	NM_025092		293646	+1	tier1	-	no_errors	ENST00000409548	ensembl	human	known	74_37	silent	35.48	20	11	SNP	0.994	T
BAI1	575	genome.wustl.edu	37	8	143623556	143623556	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:143623556G>A	ENST00000517894.1	+	28	4855	c.3961G>A	c.(3961-3963)Ggt>Agt	p.G1321S	BAI1_ENST00000323289.5_Missense_Mutation_p.G1321S			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1321					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G1321S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CTCCTTCGTCGGTGACGGGGA	0.667																																																	1	Substitution - Missense(1)	endometrium(1)											58.0	65.0	63.0					8																	143623556		2024	4168	6192	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3961G>A	8.37:g.143623556G>A	ENSP00000430945:p.Gly1321Ser			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.G1321S	ENST00000517894.1	37	c.3961		8	.	.	.	.	.	.	.	.	.	.	g	12.03	1.815154	0.32053	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.27720	1.65;1.65	4.26	3.27	0.37495	.	0.205025	0.42053	U	0.000780	T	0.09069	0.0224	N	0.03608	-0.345	0.26608	N	0.972884	P	0.48640	0.913	B	0.34038	0.174	T	0.16394	-1.0404	10	0.12103	T	0.63	.	8.8736	0.35332	0.0:0.0:0.5215:0.4784	.	1321	E9PBK0	.	S	1321	ENSP00000430945:G1321S;ENSP00000313046:G1321S	ENSP00000313046:G1321S	G	+	1	0	BAI1	143620558	1.000000	0.71417	0.246000	0.24233	0.721000	0.41392	5.009000	0.63998	1.910000	0.55303	0.586000	0.80456	GGT	BAI1	-	NULL	ENSG00000181790		0.667	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	-	0.00	72	0	G	NM_001702		143623556	+1	tier1	-	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	28.91	91	37	SNP	0.991	A
BASP1	10409	genome.wustl.edu	37	5	17275448	17275448	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:17275448G>T	ENST00000322611.3	+	2	383	c.123G>T	c.(121-123)gaG>gaT	p.E41D		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	41					diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						AGGAGAGTGAGCCCCAGGCGG	0.657																																																	0													23.0	29.0	27.0					5																	17275448		2196	4288	6484	SO:0001583	missense	0			AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.123G>T	5.37:g.17275448G>T	ENSP00000319281:p.Glu41Asp		B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Missense_Mutation	SNP	pfam_BASP1	p.E41D	ENST00000322611.3	37	c.123	CCDS3888.1	5	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349180	0.24426	.	.	ENSG00000176788	ENST00000322611;ENST00000447228	T	0.46063	0.88	4.57	1.67	0.24075	.	0.229900	0.28847	N	0.013953	T	0.32912	0.0845	L	0.54323	1.7	0.40517	D	0.980791	B	0.12013	0.005	B	0.17433	0.018	T	0.08411	-1.0723	10	0.29301	T	0.29	-9.9424	6.5528	0.22444	0.1719:0.1486:0.6796:0.0	.	41	P80723	BASP1_HUMAN	D	41	ENSP00000319281:E41D	ENSP00000319281:E41D	E	+	3	2	BASP1	17328448	1.000000	0.71417	0.426000	0.26672	0.521000	0.34408	1.631000	0.37092	0.013000	0.14918	0.455000	0.32223	GAG	BASP1	-	pfam_BASP1	ENSG00000176788		0.657	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BASP1	HGNC	protein_coding	OTTHUMT00000253716.2	-	0.00	23	0	G			17275448	+1	tier1	-	no_errors	ENST00000322611	ensembl	human	known	74_37	missense	41.67	13	10	SNP	0.978	T
BCAM	4059	genome.wustl.edu	37	19	45322020	45322020	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:45322020G>A	ENST00000270233.6	+	10	1239	c.1217G>A	c.(1216-1218)gGc>gAc	p.G406D	BCAM_ENST00000589651.1_Missense_Mutation_p.G406D	NM_001013257.2|NM_005581.4	NP_001013275.1|NP_005572.2	P50895	BCAM_HUMAN	basal cell adhesion molecule (Lutheran blood group)	406	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	laminin binding (GO:0043236)|laminin receptor activity (GO:0005055)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22	Lung NSC(12;0.000789)|all_lung(12;0.00218)	Ovarian(192;0.0728)|all_neural(266;0.112)				CTGGGCGATGGCCCCATGCTG	0.642																																																	0													124.0	108.0	113.0					19																	45322020		2203	4300	6503	SO:0001583	missense	0			X83425	CCDS12644.1, CCDS42575.1	19q12-q13	2014-07-18	2006-02-23	2006-01-12		ENSG00000187244		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6722	protein-coding gene	gene with protein product		612773	"""Lutheran blood group (Auberger b antigen included)"", ""basal cell adhesion molecule (Lu and Au blood groups)"""	LU			Standard	NM_005581		Approved	CD239	uc002ozu.4	P50895		ENST00000270233.6:c.1217G>A	19.37:g.45322020G>A	ENSP00000270233:p.Gly406Asp		A8MYF9|A9YWT5|A9YWT6|Q86VC7	Missense_Mutation	SNP	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G406D	ENST00000270233.6	37	c.1217	CCDS12644.1	19	.	.	.	.	.	.	.	.	.	.	.	13.95	2.389199	0.42410	.	.	ENSG00000187244	ENST00000270233;ENST00000391955	T;T	0.13307	2.6;2.6	4.6	3.56	0.40772	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.12092	0.0294	L	0.35793	1.09	0.26922	N	0.966661	B	0.24618	0.107	B	0.26770	0.073	T	0.17837	-1.0356	9	0.45353	T	0.12	-7.4215	9.0356	0.36284	0.1046:0.0:0.8954:0.0	.	406	P50895	BCAM_HUMAN	D	406	ENSP00000270233:G406D;ENSP00000375817:G406D	ENSP00000270233:G406D	G	+	2	0	BCAM	50013860	0.930000	0.31532	0.401000	0.26359	0.362000	0.29581	2.018000	0.40991	1.078000	0.41014	0.491000	0.48974	GGC	BCAM	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000187244		0.642	BCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAM	HGNC	protein_coding	OTTHUMT00000453220.1	-	0.00	35	0	G	NM_005581		45322020	+1	tier1	-	no_errors	ENST00000270233	ensembl	human	known	74_37	missense	8.00	45	4	SNP	0.645	A
BCAP31	10134	genome.wustl.edu	37	X	152967491	152967491	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:152967491G>A	ENST00000345046.6	-	7	1080	c.673C>T	c.(673-675)Cgc>Tgc	p.R225C	BCAP31_ENST00000441714.1_Missense_Mutation_p.R225C|BCAP31_ENST00000458587.2_Missense_Mutation_p.R292C	NM_001256447.1	NP_001243376.1	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31	225					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein localization to endoplasmic reticulum exit site (GO:0070973)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|membrane (GO:0016020)				endometrium(2)|large_intestine(2)|lung(2)|prostate(1)	7	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGCAAGCGGTCGTACTCC	0.577																																																	0													50.0	42.0	45.0					X																	152967491		2203	4300	6503	SO:0001583	missense	0			X81109	CCDS14727.1, CCDS48191.1	Xq28	2005-10-11			ENSG00000185825	ENSG00000185825			16695	protein-coding gene	gene with protein product		300398					Standard	NM_001139441		Approved	DXS1357E, BAP31, 6C6-Ag, CDM	uc011mza.1	P51572	OTTHUMG00000024218	ENST00000345046.6:c.673C>T	X.37:g.152967491G>A	ENSP00000343458:p.Arg225Cys		B3KQ79|D3DWV5|Q13836|Q96CF0	Missense_Mutation	SNP	pfam_Bap31	p.R292C	ENST00000345046.6	37	c.874	CCDS14727.1	X	.	.	.	.	.	.	.	.	.	.	g	16.61	3.169899	0.57584	.	.	ENSG00000185825	ENST00000441714;ENST00000345046;ENST00000426131;ENST00000458587	T;T;T	0.30448	1.53;1.53;1.53	5.38	5.38	0.77491	.	0.053124	0.85682	D	0.000000	T	0.58821	0.2149	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.991;0.998	T	0.65319	-0.6197	10	0.87932	D	0	-5.5695	12.5291	0.56104	0.0:0.0:0.8329:0.1671	.	225;292	P51572;B3KQ79	BAP31_HUMAN;.	C	225;225;292;292	ENSP00000405417:R225C;ENSP00000343458:R225C;ENSP00000392330:R292C	ENSP00000343458:R225C	R	-	1	0	BCAP31	152620685	1.000000	0.71417	0.998000	0.56505	0.514000	0.34195	4.104000	0.57790	2.254000	0.74563	0.525000	0.51046	CGC	BCAP31	-	NULL	ENSG00000185825		0.577	BCAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAP31	HGNC	protein_coding	OTTHUMT00000061071.1	-	0.00	76	0	G	NM_005745		152967491	-1	tier1	-	no_errors	ENST00000458587	ensembl	human	known	74_37	missense	36.04	71	40	SNP	1.000	A
BCL7A	605	genome.wustl.edu	37	12	122468610	122468610	+	Nonsense_Mutation	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:122468610A>T	ENST00000261822.4	+	2	303	c.97A>T	c.(97-99)Aag>Tag	p.K33*	BCL7A_ENST00000538010.1_Nonsense_Mutation_p.K33*	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	33					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CCTCAGGGAGAAGAAATGGGT	0.577			T	MYC	BNHL																																GBM(17;197 467 16477 23242 44349)			Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	0													142.0	119.0	127.0					12																	122468610		2203	4300	6503	SO:0001587	stop_gained	0			X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.97A>T	12.37:g.122468610A>T	ENSP00000261822:p.Lys33*		B4DJN6|B7ZB21|Q13843|Q14CT7	Nonsense_Mutation	SNP	pfam_BCL7	p.K33*	ENST00000261822.4	37	c.97	CCDS53841.1	12	.	.	.	.	.	.	.	.	.	.	A	38	7.037649	0.98021	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1871	0.73012	1.0:0.0:0.0:0.0	.	.	.	.	X	33	.	ENSP00000261822:K33X	K	+	1	0	BCL7A	120952993	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	8.506000	0.90518	2.234000	0.73211	0.459000	0.35465	AAG	BCL7A	-	pfam_BCL7	ENSG00000110987		0.577	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	BCL7A	HGNC	protein_coding	OTTHUMT00000401712.1		0.00	41	0	A			122468610	+1			no_errors	ENST00000538010	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
BLK	640	genome.wustl.edu	37	8	11414253	11414253	+	Missense_Mutation	SNP	G	G	A	rs1042687		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:11414253G>A	ENST00000259089.4	+	9	1451	c.859G>A	c.(859-861)Gtg>Atg	p.V287M	RP11-148O21.3_ENST00000527922.1_RNA|BLK_ENST00000529894.1_Missense_Mutation_p.V216M|RP11-148O21.2_ENST00000533322.1_RNA|RP11-148O21.4_ENST00000528629.1_RNA	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			V -> M (in Ref. 1; CAA83965). {ECO:0000305}.	B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		TGAGGCCAACGTGATGAAGGC	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		18213	0.0		0.0	False		,,,				2504	0.001																0								G	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	103.0	82.0	89.0		859	0.3	1.0	8	dbSNP_86	89	1,8599	1.2+/-3.3	0,1,4299	no	missense	BLK	NM_001715.2	21	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	benign	287/506	11414253	3,13003	2203	4300	6503	SO:0001583	missense	0			BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.859G>A	8.37:g.11414253G>A	ENSP00000259089:p.Val287Met		Q16291|Q96IN1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.V287M	ENST00000259089.4	37	c.859	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	G	7.121	0.577954	0.13686	4.54E-4	1.16E-4	ENSG00000136573	ENST00000259089;ENST00000427279;ENST00000529894	D;D	0.83591	-1.74;-1.74	3.53	0.343	0.16001	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.482456	0.15014	N	0.285375	T	0.65123	0.2661	N	0.20483	0.58	0.80722	D	1	B	0.21071	0.051	B	0.16289	0.015	T	0.53885	-0.8375	10	0.59425	D	0.04	.	1.8366	0.03141	0.1515:0.3605:0.309:0.1791	rs1042687;rs1042687	287	P51451	BLK_HUMAN	M	287;287;216	ENSP00000259089:V287M;ENSP00000433663:V216M	ENSP00000259089:V287M	V	+	1	0	BLK	11451662	0.090000	0.21635	0.998000	0.56505	0.314000	0.28054	-0.087000	0.11215	-0.045000	0.13468	-0.519000	0.04390	GTG	BLK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000136573		0.562	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	HGNC	protein_coding	OTTHUMT00000207460.1		0.00	50	0	G			11414253	+1			no_errors	ENST00000259089	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
BLNK	29760	genome.wustl.edu	37	10	97960771	97960771	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:97960771G>T	ENST00000224337.5	-	14	1119	c.978C>A	c.(976-978)ccC>ccA	p.P326P	BLNK_ENST00000371176.2_Silent_p.P303P|BLNK_ENST00000427367.2_Silent_p.P326P|BLNK_ENST00000413476.2_Silent_p.P326P	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	326					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		ATGAAAAGCTGGGTAGGGGCC	0.398																																																	0													124.0	136.0	132.0					10																	97960771		2203	4300	6503	SO:0001819	synonymous_variant	0			AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.978C>A	10.37:g.97960771G>T			O75498|O75499|Q2MD49	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2	p.P326	ENST00000224337.5	37	c.978	CCDS7446.1	10																																																																																			BLNK	-	NULL	ENSG00000095585		0.398	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	HGNC	protein_coding	OTTHUMT00000049593.1	-	0.00	30	0	G	NM_013314		97960771	-1	tier1	-	no_errors	ENST00000224337	ensembl	human	known	74_37	silent	27.78	26	10	SNP	0.005	T
C17orf58	284018	genome.wustl.edu	37	17	65989137	65989137	+	Intron	SNP	G	G	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:65989137G>C	ENST00000449250.2	-	2	293				C17orf58_ENST00000536693.1_Missense_Mutation_p.D42E|RP11-855A2.5_ENST00000580729.1_lincRNA|C17orf58_ENST00000334461.7_Missense_Mutation_p.D42E			Q2M2W7	CQ058_HUMAN	chromosome 17 open reading frame 58											lung(2)	2	all_cancers(12;4.57e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CATATGCAGCGTCATTCAGGT	0.507																																																	0													80.0	79.0	80.0					17																	65989137		1912	4133	6045	SO:0001627	intron_variant	0			AK026583	CCDS42375.1, CCDS45765.1	17q24.2	2012-10-11			ENSG00000186665	ENSG00000186665			27568	protein-coding gene	gene with protein product						12477932	Standard	NM_181656		Approved		uc002jgi.4	Q2M2W7	OTTHUMG00000179782	ENST00000449250.2:c.103+22C>G	17.37:g.65989137G>C			A8MQV2	Missense_Mutation	SNP	NULL	p.D42E	ENST00000449250.2	37	c.126	CCDS45765.1	17	.	.	.	.	.	.	.	.	.	.	G	7.178	0.589096	0.13812	.	.	ENSG00000186665	ENST00000334461;ENST00000536693	.	.	.	3.02	-0.404	0.12396	.	1.046080	0.07460	N	0.900512	T	0.21468	0.0517	.	.	.	0.09310	N	1	B	0.23377	0.084	B	0.26310	0.068	T	0.29518	-1.0009	8	0.31617	T	0.26	.	2.5676	0.04787	0.2751:0.0:0.4951:0.2299	.	42	Q2M2W7-2	.	E	42	.	ENSP00000334741:D42E	D	-	3	2	C17orf58	63419599	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.020000	0.12525	-0.132000	0.11557	0.542000	0.68232	GAC	C17orf58	-	NULL	ENSG00000186665		0.507	C17orf58-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf58	HGNC	protein_coding	OTTHUMT00000448104.1	-	0.00	44	0	G	NM_181656		65989137	-1	tier1	-	no_errors	ENST00000334461	ensembl	human	known	74_37	missense	30.43	32	14	SNP	0.000	C
C1orf87	127795	genome.wustl.edu	37	1	60506762	60506762	+	Silent	SNP	G	G	T	rs74843231	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:60506762G>T	ENST00000371201.3	-	4	491	c.384C>A	c.(382-384)acC>acA	p.T128T	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	128							calcium ion binding (GO:0005509)	p.T128T(1)		breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						ACTGGTCTCCGGTTGGTACAG	0.507																																					NSCLC(75;811 1386 4923 13371 51772)												1	Substitution - coding silent(1)	stomach(1)											115.0	97.0	103.0					1																	60506762		2203	4300	6503	SO:0001819	synonymous_variant	0			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.384C>A	1.37:g.60506762G>T			Q6ZU07|Q8IVS0	Silent	SNP	NULL	p.T128	ENST00000371201.3	37	c.384	CCDS614.1	1																																																																																			C1orf87	-	NULL	ENSG00000162598		0.507	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	HGNC	protein_coding	OTTHUMT00000024943.1		0.00	32	0	G	NM_152377		60506762	-1			no_errors	ENST00000371201	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.527	T
C2CD4C	126567	genome.wustl.edu	37	19	407400	407400	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:407400C>T	ENST00000332235.6	-	2	1135	c.962G>A	c.(961-963)cGc>cAc	p.R321H		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	321	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.									large_intestine(1)|pancreas(1)	2						CACCCGCAGGCGGGCCTGGCC	0.761																																																	0													2.0	3.0	3.0					19																	407400		544	1319	1863	SO:0001583	missense	0			AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.962G>A	19.37:g.407400C>T	ENSP00000328677:p.Arg321His		Q8N3H7	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R321H	ENST00000332235.6	37	c.962	CCDS45890.1	19	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083128	0.76642	.	.	ENSG00000183186	ENST00000332235	T	0.79554	-1.28	3.74	3.74	0.42951	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.89774	0.6812	M	0.85373	2.75	0.58432	D	0.999993	D	0.89917	1.0	D	0.73708	0.981	D	0.91654	0.5337	10	0.66056	D	0.02	.	14.8631	0.70394	0.0:1.0:0.0:0.0	.	321	Q8TF44	C2C4C_HUMAN	H	321	ENSP00000328677:R321H	ENSP00000328677:R321H	R	-	2	0	C2CD4C	358400	0.998000	0.40836	0.997000	0.53966	0.699000	0.40488	5.442000	0.66575	1.790000	0.52503	0.561000	0.74099	CGC	C2CD4C	-	superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000183186		0.761	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD4C	HGNC	protein_coding	OTTHUMT00000451789.2	-	0.00	16	0	C	XM_065166		407400	-1	tier1	-	no_errors	ENST00000332235	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	T
C3orf17	25871	genome.wustl.edu	37	3	112729516	112729516	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:112729516T>C	ENST00000314400.5	-	7	1140	c.949A>G	c.(949-951)Aac>Gac	p.N317D	C3orf17_ENST00000472762.1_5'UTR|C3orf17_ENST00000383675.2_Missense_Mutation_p.N247D|C3orf17_ENST00000393857.2_Missense_Mutation_p.N181D	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	317					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						TTCAGCTGGTTGCAGAAAGCC	0.383																																																	0													93.0	89.0	90.0					3																	112729516		2203	4300	6503	SO:0001583	missense	0			AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.949A>G	3.37:g.112729516T>C	ENSP00000320251:p.Asn317Asp		D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Missense_Mutation	SNP	NULL	p.N317D	ENST00000314400.5	37	c.949	CCDS33824.1	3	.	.	.	.	.	.	.	.	.	.	T	14.37	2.514149	0.44763	.	.	ENSG00000163608	ENST00000314400;ENST00000383675;ENST00000393857	T;T;T	0.30981	1.51;1.51;1.51	5.87	4.72	0.59763	.	0.526878	0.22331	N	0.061476	T	0.19644	0.0472	N	0.22421	0.69	0.30218	N	0.79707	B;B;B;B	0.25904	0.058;0.063;0.137;0.137	B;B;B;B	0.25140	0.025;0.025;0.058;0.058	T	0.13072	-1.0523	10	0.31617	T	0.26	-3.6836	8.5462	0.33424	0.0:0.0864:0.0:0.9136	.	206;114;247;317	E7EN80;E7EQH6;Q6NW34-2;Q6NW34	.;.;.;CC017_HUMAN	D	317;247;181	ENSP00000320251:N317D;ENSP00000373173:N247D;ENSP00000377438:N181D	ENSP00000320251:N317D	N	-	1	0	C3orf17	114212206	0.985000	0.35326	1.000000	0.80357	0.726000	0.41606	1.496000	0.35638	1.063000	0.40649	0.533000	0.62120	AAC	C3orf17	-	NULL	ENSG00000163608		0.383	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf17	HGNC	protein_coding	OTTHUMT00000354405.3		0.00	33	0	T	NM_015412		112729516	-1			no_errors	ENST00000314400	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.996	C
C6	729	genome.wustl.edu	37	5	41154084	41154084	+	Missense_Mutation	SNP	C	C	G	rs375320778		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:41154084C>G	ENST00000263413.3	-	15	2382	c.2118G>C	c.(2116-2118)aaG>aaC	p.K706N	C6_ENST00000337836.5_Missense_Mutation_p.K706N	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	706	C5b-binding domain.|CCP 2.|Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCACAACTGGCTTGATGCACT	0.413																																																	0													106.0	96.0	99.0					5																	41154084		2203	4300	6503	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.2118G>C	5.37:g.41154084C>G	ENSP00000263413:p.Lys706Asn			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.K706N	ENST00000263413.3	37	c.2118	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065388	0.55432	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	T;T	0.41400	1.0;1.0	5.59	2.84	0.33178	Complement control module (3);Sushi/SCR/CCP (2);	0.323086	0.34986	N	0.003534	T	0.54791	0.1880	M	0.72894	2.215	0.40426	D	0.979899	D	0.53462	0.96	P	0.58077	0.832	T	0.54556	-0.8276	10	0.52906	T	0.07	-3.7325	9.9914	0.41874	0.0:0.724:0.0:0.276	.	706	P13671	CO6_HUMAN	N	706	ENSP00000338861:K706N;ENSP00000263413:K706N	ENSP00000263413:K706N	K	-	3	2	C6	41189841	0.993000	0.37304	0.933000	0.37362	0.641000	0.38312	0.210000	0.17455	0.305000	0.22832	0.650000	0.86243	AAG	C6	-	superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000039537		0.413	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1		0.00	44	0	C			41154084	-1			no_errors	ENST00000263413	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.998	G
C9orf9	11092	genome.wustl.edu	37	9	135763819	135763819	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:135763819C>T	ENST00000372136.3	+	4	937	c.490C>T	c.(490-492)Cag>Tag	p.Q164*	C9orf9_ENST00000350499.6_Nonsense_Mutation_p.Q164*|C9orf9_ENST00000356311.5_Nonsense_Mutation_p.Q164*			Q96E40	CI009_HUMAN	chromosome 9 open reading frame 9	164						cytoplasmic microtubule (GO:0005881)		p.?(1)		cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|GBM - Glioblastoma multiforme(294;4.84e-07)|Epithelial(140;1.28e-06)		CAAGGTGCTGCAGCACGTGAG	0.632																																																	1	Unknown(1)	bone(1)											51.0	40.0	44.0					9																	135763819		2203	4300	6503	SO:0001587	stop_gained	0				CCDS6955.1	9q34.13	2012-03-06			ENSG00000165698	ENSG00000165698			1367	protein-coding gene	gene with protein product							Standard	NM_018956		Approved		uc004cby.1	Q96E40	OTTHUMG00000020847	ENST00000372136.3:c.490C>T	9.37:g.135763819C>T	ENSP00000361209:p.Gln164*		Q9UGQ0	Nonsense_Mutation	SNP	NULL	p.Q164*	ENST00000372136.3	37	c.490		9	.	.	.	.	.	.	.	.	.	.	C	32	5.149945	0.94645	.	.	ENSG00000165698	ENST00000372136;ENST00000356311;ENST00000350499	.	.	.	5.23	5.23	0.72850	.	0.325164	0.31167	N	0.008130	.	.	.	.	.	.	0.33999	D	0.650016	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-21.3144	11.8704	0.52517	0.0:0.9146:0.0:0.0854	.	.	.	.	X	164	.	ENSP00000298546:Q164X	Q	+	1	0	C9orf9	134753640	0.938000	0.31826	0.994000	0.49952	0.067000	0.16453	0.695000	0.25527	2.425000	0.82216	0.561000	0.74099	CAG	C9orf9	-	NULL	ENSG00000165698		0.632	C9orf9-001	KNOWN	basic	protein_coding	C9orf9	HGNC	protein_coding	OTTHUMT00000054806.1	-	0.00	63	0	C	NM_018956		135763819	+1	tier1	-	no_errors	ENST00000356311	ensembl	human	known	74_37	nonsense	26.51	61	22	SNP	0.797	T
CACNA2D3	55799	genome.wustl.edu	37	3	55108159	55108159	+	Frame_Shift_Del	DEL	G	G	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:55108159delG	ENST00000474759.1	+	38	3250	c.3202delG	c.(3202-3204)gggfs	p.G1069fs	CACNA2D3_ENST00000478261.1_3'UTR|CACNA2D3_ENST00000490478.1_Frame_Shift_Del_p.G975fs|CACNA2D3_ENST00000415676.2_Frame_Shift_Del_p.G1069fs|CACNA2D3_ENST00000288197.5_Frame_Shift_Del_p.G1069fs	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	1069						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	AAGGGAGTGTGGGGGTGCGCC	0.542																																																	0													136.0	135.0	135.0					3																	55108159		2062	4172	6234	SO:0001589	frameshift_variant	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.3202delG	3.37:g.55108159delG	ENSP00000419101:p.Gly1069fs		B2RPL6|Q9NY16|Q9NY18	Frame_Shift_Del	DEL	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.G1069fs	ENST00000474759.1	37	c.3202	CCDS54598.1	3																																																																																			CACNA2D3	-	NULL	ENSG00000157445		0.542	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1		0.00	32	0	G			55108159	+1	tier1		no_errors	ENST00000288197	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	1.000	-
CAPG	822	genome.wustl.edu	37	2	85625215	85625215	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:85625215G>T	ENST00000409921.1	-	8	841	c.775C>A	c.(775-777)Ctt>Att	p.L259I	CAPG_ENST00000409670.1_Missense_Mutation_p.L274I|CAPG_ENST00000483659.1_5'UTR|CAPG_ENST00000263867.4_Missense_Mutation_p.L274I|CAPG_ENST00000409724.1_Missense_Mutation_p.L274I			Q9BPX3	CND3_HUMAN	capping protein (actin filament), gelsolin-like	0					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)	11						AGCAGTTCAAGGGCAAATGGG	0.552																																																	0													223.0	193.0	203.0					2																	85625215		2203	4300	6503	SO:0001583	missense	0			M94345	CCDS1974.1, CCDS58715.1	2p11.2	2008-06-04			ENSG00000042493	ENSG00000042493			1474	protein-coding gene	gene with protein product	"""macrophage capping protein"""	153615		AFCP		1322908, 12754261	Standard	NM_001747		Approved	MCP	uc010fgi.2	P40121	OTTHUMG00000130183	ENST00000409921.1:c.775C>A	2.37:g.85625215G>T	ENSP00000387063:p.Leu259Ile		Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.L274I	ENST00000409921.1	37	c.820	CCDS58715.1	2	.	.	.	.	.	.	.	.	.	.	G	11.54	1.670148	0.29693	.	.	ENSG00000042493	ENST00000542681;ENST00000263867;ENST00000453973;ENST00000409921;ENST00000409670;ENST00000409724	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.52	-0.105	0.13601	Gelsolin domain (1);	1.346850	0.04569	N	0.392847	T	0.39118	0.1066	L	0.27053	0.805	0.09310	N	1	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.12837	0.008;0.003;0.002	T	0.35525	-0.9785	10	0.72032	D	0.01	.	4.9307	0.13916	0.3444:0.3884:0.2672:0.0	.	253;259;274	B4DU58;B8ZZS7;P40121	.;.;CAPG_HUMAN	I	253;274;29;259;274;274	ENSP00000263867:L274I;ENSP00000397381:L29I;ENSP00000387063:L259I;ENSP00000386315:L274I;ENSP00000386965:L274I	ENSP00000263867:L274I	L	-	1	0	CAPG	85478726	0.000000	0.05858	0.097000	0.21041	0.687000	0.40016	-0.017000	0.12590	-0.024000	0.13941	0.555000	0.69702	CTT	CAPG	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin	ENSG00000042493		0.552	CAPG-004	NOVEL	basic|exp_conf|CCDS	protein_coding	CAPG	HGNC	protein_coding	OTTHUMT00000329383.1	-	0.00	52	0	G	NM_001747		85625215	-1	tier1	-	no_errors	ENST00000263867	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.001	T
CBLN2	147381	genome.wustl.edu	37	18	70205937	70205937	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:70205937T>A	ENST00000269503.4	-	4	1201	c.428A>T	c.(427-429)tAt>tTt	p.Y143F	CBLN2_ENST00000584764.1_Missense_Mutation_p.Y27F|CBLN2_ENST00000583651.1_5'UTR|CBLN2_ENST00000581073.1_Missense_Mutation_p.Y29F|CBLN2_ENST00000585159.1_Missense_Mutation_p.Y143F	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	143	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				GCTGAAGCTATAAATCCCTTT	0.403																																																	0													123.0	116.0	118.0					18																	70205937		2203	4300	6503	SO:0001583	missense	0			BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.428A>T	18.37:g.70205937T>A	ENSP00000269503:p.Tyr143Phe		Q53Z56	Missense_Mutation	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.Y143F	ENST00000269503.4	37	c.428	CCDS11999.1	18	.	.	.	.	.	.	.	.	.	.	T	16.09	3.023317	0.54683	.	.	ENSG00000141668	ENST00000269503	T	0.72505	-0.66	5.51	5.51	0.81932	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.89839	0.6831	H	0.97315	3.98	0.58432	D	0.999999	D	0.76494	0.999	D	0.91635	0.999	D	0.93386	0.6747	10	0.87932	D	0	-7.1343	15.9314	0.79663	0.0:0.0:0.0:1.0	.	143	Q8IUK8	CBLN2_HUMAN	F	143	ENSP00000269503:Y143F	ENSP00000269503:Y143F	Y	-	2	0	CBLN2	68356917	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.990000	0.88215	2.217000	0.71921	0.482000	0.46254	TAT	CBLN2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000141668		0.403	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN2	HGNC	protein_coding	OTTHUMT00000256288.1		0.00	43	0	T	NM_182511		70205937	-1			no_errors	ENST00000269503	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	A
CEP83	51134	genome.wustl.edu	37	12	94729531	94729531	+	Intron	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:94729531T>A	ENST00000397809.5	-	12	1893				CCDC41_ENST00000397807.2_Intron|CCDC41_ENST00000339839.5_Intron	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN							cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						GAATGCCTGTTTGACACCAGA	0.308																																																	0																																										SO:0001627	intron_variant	0																														ENST00000397809.5:c.1344-91A>T	12.37:g.94729531T>A			A4FVB1|Q08AP1	RNA	SNP	-	NULL	ENST00000397809.5	37	NULL	CCDS41820.1	12																																																																																			CCDC41	-	-	ENSG00000173588		0.308	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC41	HGNC	protein_coding	OTTHUMT00000408147.3	-	0.00	22	0	T			94729531	-1	tier1	-	no_errors	ENST00000546587	ensembl	human	known	74_37	rna	28.00	18	7	SNP	0.000	A
CCDC88A	55704	genome.wustl.edu	37	2	55529121	55529121	+	Missense_Mutation	SNP	G	G	A	rs200839306		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:55529121G>A	ENST00000436346.1	-	27	5400	c.4559C>T	c.(4558-4560)aCg>aTg	p.T1520M	CCDC88A_ENST00000413716.2_Missense_Mutation_p.T1519M|CCDC88A_ENST00000336838.6_Missense_Mutation_p.T1519M|CCDC88A_ENST00000422883.2_Intron|CCDC88A_ENST00000263630.8_Missense_Mutation_p.T1492M	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	1520					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CCTTTTACCCGTTGAAATATC	0.463																																																	0													115.0	111.0	113.0					2																	55529121		2203	4300	6503	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.4559C>T	2.37:g.55529121G>A	ENSP00000410608:p.Thr1520Met		A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.T1520M	ENST00000436346.1	37	c.4559		2	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268356	0.23136	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000412148;ENST00000413716;ENST00000426576	T;T;T;T;T;T	0.49432	2.43;2.57;2.65;0.78;2.4;1.36	5.38	5.38	0.77491	.	0.465514	0.17962	U	0.156160	T	0.47801	0.1465	N	0.24115	0.695	0.80722	D	1	B;D;D;P;D;D	0.61080	0.102;0.989;0.986;0.939;0.988;0.989	B;P;P;P;P;P	0.51582	0.03;0.674;0.454;0.466;0.666;0.674	T	0.38866	-0.9641	10	0.33940	T	0.23	2.0E-4	19.5473	0.95305	0.0:0.0:1.0:0.0	.	1519;1492;1437;1520;1519;1491	B7ZM78;Q3V6T2-2;D6W5D1;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.;.;.;GRDN_HUMAN;.;.	M	1519;1492;1520;537;1519;695	ENSP00000338728:T1519M;ENSP00000263630:T1492M;ENSP00000410608:T1520M;ENSP00000390012:T537M;ENSP00000404431:T1519M;ENSP00000405080:T695M	ENSP00000263630:T1492M	T	-	2	0	CCDC88A	55382625	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.684000	0.68197	2.701000	0.92244	0.460000	0.39030	ACG	CCDC88A	-	NULL	ENSG00000115355		0.463	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		-	0.00	44	0	G	NM_017571		55529121	-1	tier1	rs200839306	no_errors	ENST00000436346	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
CDKL1	8814	genome.wustl.edu	37	14	50808938	50808938	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr14:50808938G>A	ENST00000216378.2	-	5	1013	c.369C>T	c.(367-369)tgC>tgT	p.C123C	CDKL1_ENST00000395834.1_Silent_p.C123C|CDKL1_ENST00000356146.1_5'UTR	NM_001282236.1	NP_001269165.1	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1 (CDC2-related kinase)	122	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				heart development (GO:0007507)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|stomach(1)	12	all_epithelial(31;0.000746)|Breast(41;0.0102)					CTCTATGTATGCACTAGTGTA	0.333																																																	0													116.0	101.0	106.0					14																	50808938		2203	4300	6503	SO:0001819	synonymous_variant	0			AF390028	CCDS9699.1, CCDS73637.1	14q21.3	2011-11-04			ENSG00000100490	ENSG00000100490		"""Cyclin-dependent kinases"""	1781	protein-coding gene	gene with protein product		603441				1639063, 7595554	Standard	XM_005268157		Approved	KKIALRE	uc010anu.2	Q00532	OTTHUMG00000140290	ENST00000216378.2:c.369C>T	14.37:g.50808938G>A			Q2M3A4|Q6QUA0|Q8WXQ5	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C123	ENST00000216378.2	37	c.369		14																																																																																			CDKL1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000100490		0.333	CDKL1-003	PUTATIVE	basic|exp_conf	protein_coding	CDKL1	HGNC	protein_coding	OTTHUMT00000382103.1		0.00	36	0	G			50808938	-1			no_errors	ENST00000395834	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	A
CFTR	1080	genome.wustl.edu	37	7	117251832	117251832	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:117251832G>T	ENST00000003084.6	+	20	3469	c.3337G>T	c.(3337-3339)Gct>Tct	p.A1113S	CFTR_ENST00000454343.1_Missense_Mutation_p.A1052S|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1113	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	CTTCTTCATTGCTGTTACCTT	0.333									Cystic Fibrosis																																								0													96.0	84.0	88.0					7																	117251832		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3337G>T	7.37:g.117251832G>T	ENSP00000003084:p.Ala1113Ser		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.A1113S	ENST00000003084.6	37	c.3337	CCDS5773.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.95|15.95	2.984253|2.984253	0.53827|0.53827	.|.	.|.	ENSG00000001626|ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809|ENST00000468795	D;D;D|.	0.91792|.	-2.91;-2.91;-2.91|.	5.38|5.38	3.4|3.4	0.38934|0.38934	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.464948|.	0.25442|.	N|.	0.030651|.	T|T	0.60856|0.60856	0.2301|0.2301	L|L	0.58969|0.58969	1.84|1.84	0.36544|0.36544	D|D	0.871454|0.871454	B|.	0.24317|.	0.101|.	B|.	0.43680|.	0.427|.	T|T	0.65623|0.65623	-0.6123|-0.6123	10|5	0.40728|.	T|.	0.16|.	-4.2848|-4.2848	9.9452|9.9452	0.41604|0.41604	0.0719:0.2634:0.6647:0.0|0.0719:0.2634:0.6647:0.0	.|.	1113|.	P13569|.	CFTR_HUMAN|.	S|F	1113;1052;1083|54	ENSP00000003084:A1113S;ENSP00000403677:A1052S;ENSP00000389119:A1083S|.	ENSP00000003084:A1113S|.	A|L	+|+	1|3	0|2	CFTR|CFTR	117039068|117039068	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.564000|4.564000	0.60830|0.60830	1.357000|1.357000	0.45904|0.45904	0.650000|0.650000	0.86243|0.86243	GCT|TTG	CFTR	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	ENSG00000001626		0.333	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	-	0.00	69	0	G	NM_000492		117251832	+1	tier1	-	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
CGN	57530	genome.wustl.edu	37	1	151509295	151509295	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:151509295G>T	ENST00000271636.7	+	20	3529	c.3396G>T	c.(3394-3396)caG>caT	p.Q1132H		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1126					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGAAGGCCCAGCGTGAGGTGG	0.567																																																	0													141.0	143.0	142.0					1																	151509295		2203	4300	6503	SO:0001583	missense	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3396G>T	1.37:g.151509295G>T	ENSP00000271636:p.Gln1132His		A6H8L3|A7MD22|Q5T386|Q9NR25	Missense_Mutation	SNP	pfam_Myosin_tail	p.Q1132H	ENST00000271636.7	37	c.3396	CCDS999.1	1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633415	0.67015	.	.	ENSG00000143375	ENST00000271636	D	0.82711	-1.64	5.41	2.03	0.26663	Myosin tail (1);	0.554944	0.20226	N	0.096593	D	0.87208	0.6120	M	0.85462	2.755	0.28336	N	0.921562	D	0.76494	0.999	D	0.80764	0.994	T	0.80843	-0.1201	10	0.87932	D	0	-12.0343	11.1261	0.48320	0.246:0.0:0.754:0.0	.	1126	Q9P2M7	CING_HUMAN	H	1132	ENSP00000271636:Q1132H	ENSP00000271636:Q1132H	Q	+	3	2	CGN	149775919	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.335000	0.33839	0.659000	0.30945	0.655000	0.94253	CAG	CGN	-	pfam_Myosin_tail	ENSG00000143375		0.567	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	-	0.00	35	0	G	NM_020770		151509295	+1	tier1	-	no_errors	ENST00000271636	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.999	T
CHST7	56548	genome.wustl.edu	37	X	46434207	46434207	+	Silent	SNP	A	A	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:46434207A>C	ENST00000276055.3	+	1	989	c.841A>C	c.(841-843)Agg>Cgg	p.R281R		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	281					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			breast(3)|endometrium(2)|kidney(1)|lung(2)	8						CCGCGACCCGAGGGCGGTGCA	0.662																																																	0													59.0	41.0	47.0					X																	46434207		2202	4299	6501	SO:0001819	synonymous_variant	0			AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.841A>C	X.37:g.46434207A>C			O75667	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.R281	ENST00000276055.3	37	c.841	CCDS14268.1	X																																																																																			CHST7	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000147119		0.662	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST7	HGNC	protein_coding	OTTHUMT00000056362.1	-	0.00	15	0	A	NM_019886		46434207	+1	tier1	-	no_errors	ENST00000276055	ensembl	human	known	74_37	silent	22.22	21	6	SNP	0.399	C
CIITA	4261	genome.wustl.edu	37	16	11001372	11001372	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:11001372C>T	ENST00000324288.8	+	11	2156	c.2023C>T	c.(2023-2025)Cta>Tta	p.L675L	CIITA_ENST00000381835.5_Intron|CIITA_ENST00000537380.1_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	675	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						TCAAAGTACCCTACAGGAGGA	0.682			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0													37.0	38.0	38.0					16																	11001372		2197	4300	6497	SO:0001819	synonymous_variant	0			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2023C>T	16.37:g.11001372C>T			A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Silent	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,prints_MHC_II_transact	p.L675	ENST00000324288.8	37	c.2023	CCDS10544.1	16																																																																																			CIITA	-	pfscan_NACHT_NTPase,prints_MHC_II_transact	ENSG00000179583		0.682	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	-	0.00	16	0	C	NM_000246		11001372	+1	tier1	-	no_errors	ENST00000324288	ensembl	human	known	74_37	silent	57.89	8	11	SNP	0.574	T
CIITA	4261	genome.wustl.edu	37	16	11002890	11002890	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:11002890G>A	ENST00000324288.8	+	12	2795	c.2662G>A	c.(2662-2664)Gcc>Acc	p.A888T	CIITA_ENST00000381835.5_Missense_Mutation_p.A304T|CIITA_ENST00000537380.1_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	888					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						CCACAGGGCTGCCTTGAGCGA	0.577			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0													53.0	43.0	46.0					16																	11002890		2197	4300	6497	SO:0001583	missense	0			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2662G>A	16.37:g.11002890G>A	ENSP00000316328:p.Ala888Thr		A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,prints_MHC_II_transact	p.A888T	ENST00000324288.8	37	c.2662	CCDS10544.1	16	.	.	.	.	.	.	.	.	.	.	G	16.02	3.003929	0.54254	.	.	ENSG00000179583	ENST00000324288;ENST00000381835	T;T	0.73047	-0.71;1.64	4.85	-2.71	0.05986	.	0.722290	0.12313	N	0.480058	T	0.53786	0.1818	L	0.44542	1.39	0.09310	N	1	P;B;B	0.44946	0.846;0.212;0.212	B;B;B	0.38842	0.283;0.114;0.079	T	0.50294	-0.8845	10	0.20046	T	0.44	.	8.6886	0.34254	0.1009:0.0:0.1708:0.7282	.	304;888;888	E9PFE0;A0N0N9;P33076	.;.;C2TA_HUMAN	T	888;304	ENSP00000316328:A888T;ENSP00000371257:A304T	ENSP00000316328:A888T	A	+	1	0	CIITA	10910391	0.177000	0.23109	0.004000	0.12327	0.916000	0.54674	0.724000	0.25954	-0.269000	0.09298	0.491000	0.48974	GCC	CIITA	-	NULL	ENSG00000179583		0.577	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	-	0.00	35	0	G	NM_000246		11002890	+1	tier1	-	no_errors	ENST00000324288	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.004	A
CIRBP	1153	genome.wustl.edu	37	19	1270231	1270232	+	Intron	INS	-	-	C	rs528531066|rs398033678|rs551218131|rs377634662|rs562310205|rs56378951|rs370038626	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:1270231_1270232insC	ENST00000588030.1	+	2	254				CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000587323.1_Intron|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP_ENST00000589710.1_Intron|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000587896.1_Intron|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000586773.1_5'Flank|CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000413636.2_Intron|CIRBP_ENST00000588230.1_Intron|CIRBP_ENST00000444172.2_Intron|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000586472.1_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGACAGCCAGCCCCCCCCCCA	0.624																																																	0																																										SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-695->C	19.37:g.1270241_1270241dupC			B3KT17|B4E2X2	RNA	INS	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-	ENSG00000267493		0.624	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1		0.00	13	0	-	NM_001280		1270232	-1	tier1		no_errors	ENST00000585832	ensembl	human	known	74_37	rna	10.71	25	3	INS	0.001:0.002	C
CIRBP	1153	genome.wustl.edu	37	19	1270232	1270232	+	Intron	DEL	C	C	-	rs528531066|rs398033678|rs377634662|rs56378951|rs562310205	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:1270232delC	ENST00000588030.1	+	2	254				CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000587323.1_Intron|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP_ENST00000589710.1_Intron|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000587896.1_Intron|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000586773.1_5'Flank|CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000413636.2_Intron|CIRBP_ENST00000588230.1_Intron|CIRBP_ENST00000444172.2_Intron|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000586472.1_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGACAGCCAGCCCCCCCCCCA	0.622																																																	0																																										SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-695C>-	19.37:g.1270232delC			B3KT17|B4E2X2	RNA	DEL	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-	ENSG00000267493		0.622	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1		0.00	13	0	C	NM_001280		1270232	-1	tier1		no_errors	ENST00000585832	ensembl	human	known	74_37	rna	10.71	25	3	DEL	0.002	-
CLCN2	1181	genome.wustl.edu	37	3	184069853	184069853	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:184069853C>T	ENST00000265593.4	-	22	2534	c.2363G>A	c.(2362-2364)tGc>tAc	p.C788Y	CLCN2_ENST00000457512.1_Missense_Mutation_p.C788Y|CLCN2_ENST00000434054.2_Missense_Mutation_p.C744Y|EIF2B5_ENST00000444495.1_Intron|CLCN2_ENST00000344937.7_Missense_Mutation_p.C771Y|CLCN2_ENST00000423355.2_3'UTR	NM_004366.5	NP_004357.3	P51788	CLCN2_HUMAN	chloride channel, voltage-sensitive 2	788					cell differentiation involved in salivary gland development (GO:0060689)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|retina development in camera-type eye (GO:0060041)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(4)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	ATCAATTTTGCAGTCACTGAA	0.552																																																	0													160.0	145.0	150.0					3																	184069853		2203	4300	6503	SO:0001583	missense	0			S77770	CCDS3263.1, CCDS54690.1, CCDS54691.1, CCDS54692.1	3q27.1	2013-09-19	2012-02-23		ENSG00000114859	ENSG00000114859		"""Ion channels / Chloride channels : Voltage-sensitive"""	2020	protein-coding gene	gene with protein product		600570	"""chloride channel 2"""			7795595	Standard	NM_004366		Approved	CLC2, EJM6, ClC-2	uc003foi.4	P51788	OTTHUMG00000156747	ENST00000265593.4:c.2363G>A	3.37:g.184069853C>T	ENSP00000265593:p.Cys788Tyr		B4DQT9|B4DZ58|E9PBD9|E9PCD2|O14864|Q6IPA9|Q8WU13	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_CBS_dom,superfamily_Cl-channel_core,prints_Cl-channel_volt-gated,prints_Cl-channel-2	p.C788Y	ENST00000265593.4	37	c.2363	CCDS3263.1	3	.	.	.	.	.	.	.	.	.	.	c	24.5	4.539231	0.85917	.	.	ENSG00000114859	ENST00000265593;ENST00000344937;ENST00000434054;ENST00000457512	D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.97464	0.9170	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.996	D;D;D;P	0.68353	0.935;0.935;0.957;0.828	D	0.97960	1.0337	10	0.87932	D	0	-24.0596	18.3639	0.90384	0.0:1.0:0.0:0.0	.	744;788;771;788	E9PBD9;E9PCD2;P51788-3;P51788	.;.;.;CLCN2_HUMAN	Y	788;771;744;788	ENSP00000265593:C788Y;ENSP00000345056:C771Y;ENSP00000400425:C744Y;ENSP00000391928:C788Y	ENSP00000265593:C788Y	C	-	2	0	CLCN2	185552547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.714000	0.47202	2.640000	0.89533	0.462000	0.41574	TGC	CLCN2	-	NULL	ENSG00000114859		0.552	CLCN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCN2	HGNC	protein_coding	OTTHUMT00000345571.1	-	0.00	27	0	C			184069853	-1	tier1	-	no_errors	ENST00000265593	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139601151	139601151	+	3'UTR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:139601151G>A	ENST00000303045.6	-	0	5672				COL22A1_ENST00000435777.1_3'UTR|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCAGTTACGCGTCAGATGGGG	0.408										HNSCC(7;0.00092)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.*345C>T	8.37:g.139601151G>A			B7ZMH0|C9K0G4|Q8IVT9	RNA	SNP	-	NULL	ENST00000303045.6	37	NULL	CCDS6376.1	8																																																																																			COL22A1	-	-	ENSG00000169436		0.408	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	-	0.00	23	0	G	XM_291257		139601151	-1	tier1	-	no_errors	ENST00000341807	ensembl	human	known	74_37	rna	29.27	29	12	SNP	0.000	A
COL2A1	1280	genome.wustl.edu	37	12	48367925	48367925	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:48367925G>A	ENST00000380518.3	-	53	4428	c.4264C>T	c.(4264-4266)Cgg>Tgg	p.R1422W	COL2A1_ENST00000337299.6_Missense_Mutation_p.R1353W|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1422	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCCTCTGCCCGGATCTCCACG	0.587																																																	0													107.0	91.0	96.0					12																	48367925		2203	4300	6503	SO:0001583	missense	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.4264C>T	12.37:g.48367925G>A	ENSP00000369889:p.Arg1422Trp		A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.R1422W	ENST00000380518.3	37	c.4264	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	G	15.68	2.906460	0.52333	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	T;T	0.74002	-0.8;-0.8	5.06	4.07	0.47477	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.86814	0.6023	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.88332	0.2969	10	0.87932	D	0	.	12.4158	0.55492	0.0:0.0:0.4351:0.5649	.	1353;1422	P02458-1;P02458	.;CO2A1_HUMAN	W	1422;1353;1353	ENSP00000369889:R1422W;ENSP00000338213:R1353W	ENSP00000338213:R1353W	R	-	1	2	COL2A1	46654192	0.999000	0.42202	1.000000	0.80357	0.999000	0.98932	0.587000	0.23909	1.033000	0.39918	0.655000	0.94253	CGG	COL2A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000139219		0.587	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2		0.00	34	0	G	NM_001844		48367925	-1			no_errors	ENST00000380518	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
COPB1	1315	genome.wustl.edu	37	11	14498481	14498481	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:14498481C>T	ENST00000249923.3	-	12	1739	c.1439G>A	c.(1438-1440)cGc>cAc	p.R480H	RNU7-49P_ENST00000516182.1_RNA|COPB1_ENST00000526191.1_5'Flank|COPB1_ENST00000439561.2_Missense_Mutation_p.R480H	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	480					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						AAGGGACCTGCGGATCTCAGT	0.373																																																	0													162.0	150.0	154.0					11																	14498481		2200	4294	6494	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.1439G>A	11.37:g.14498481C>T	ENSP00000249923:p.Arg480His		D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	p.R480H	ENST00000249923.3	37	c.1439	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.466331	0.96257	.	.	ENSG00000129083	ENST00000249923;ENST00000439561;ENST00000534234	T;T;T	0.26223	1.75;1.75;1.75	5.63	5.63	0.86233	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59622	0.2207	M	0.91196	3.185	0.80722	D	1	D	0.63880	0.993	P	0.62885	0.908	T	0.65940	-0.6046	10	0.48119	T	0.1	-2.7546	19.6772	0.95941	0.0:1.0:0.0:0.0	.	480	P53618	COPB_HUMAN	H	480	ENSP00000249923:R480H;ENSP00000397873:R480H;ENSP00000436383:R480H	ENSP00000249923:R480H	R	-	2	0	COPB1	14455057	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.656000	0.90262	0.655000	0.94253	CGC	COPB1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_COPB1	ENSG00000129083		0.373	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	-	0.00	27	0	C	NM_016451		14498481	-1	tier1	-	no_errors	ENST00000249923	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
CPA2	1358	genome.wustl.edu	37	7	129906763	129906763	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:129906763G>A	ENST00000222481.4	+	1	97	c.42G>A	c.(40-42)ggG>ggA	p.G14G		NM_001869.2	NP_001860.2	P48052	CBPA2_HUMAN	carboxypeptidase A2 (pancreatic)	14					protein catabolic process in the vacuole (GO:0007039)	extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Melanoma(18;0.0435)					CCCTTTTTGGGCATATCTACT	0.418																																																	0													246.0	222.0	230.0					7																	129906763		2203	4300	6503	SO:0001819	synonymous_variant	0			U19977	CCDS5817.2	7q32	2012-02-10			ENSG00000158516	ENSG00000158516	3.4.17.15		2297	protein-coding gene	gene with protein product		600688				7896805, 10860668	Standard	NM_001869		Approved		uc003vpq.3	P48052	OTTHUMG00000157019	ENST00000222481.4:c.42G>A	7.37:g.129906763G>A			A4D1M4|C9JIK1|Q53XS1|Q96A12|Q96QN3|Q9UCF1	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.G14	ENST00000222481.4	37	c.42	CCDS5817.2	7																																																																																			CPA2	-	NULL	ENSG00000158516		0.418	CPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA2	HGNC	protein_coding	OTTHUMT00000347124.2	-	0.00	62	0	G	NM_001869		129906763	+1	tier1	-	no_errors	ENST00000222481	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.786	A
CRTC3	64784	genome.wustl.edu	37	15	91181743	91181743	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:91181743G>A	ENST00000268184.6	+	12	1336	c.1332G>A	c.(1330-1332)ccG>ccA	p.P444P	RP11-387D10.2_ENST00000559531.1_RNA|CRTC3_ENST00000420329.2_Silent_p.P444P			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	444	Poly-Pro.				energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			AGGTGTCGCCGCCACCCCCTT	0.632			T	MAML2	salivary gland mucoepidermoid																																			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0													68.0	69.0	68.0					15																	91181743		2198	4298	6496	SO:0001819	synonymous_variant	0				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1332G>A	15.37:g.91181743G>A			Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Silent	SNP	NULL	p.P444	ENST00000268184.6	37	c.1332	CCDS32331.1	15																																																																																			CRTC3	-	NULL	ENSG00000140577		0.632	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CRTC3	HGNC	protein_coding	OTTHUMT00000417716.2		0.00	20	0	G	NM_022769		91181743	+1			no_errors	ENST00000268184	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.007	A
CYTH1	9267	genome.wustl.edu	37	17	76672223	76672223	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:76672223C>T	ENST00000446868.3	-	14	1217	c.1147G>A	c.(1147-1149)Gaa>Aaa	p.E383K	CYTH1_ENST00000585509.1_Missense_Mutation_p.E324K|CYTH1_ENST00000589297.1_Missense_Mutation_p.E324K|CYTH1_ENST00000361101.4_Missense_Mutation_p.E383K|CYTH1_ENST00000591455.1_Missense_Mutation_p.E382K|CYTH1_ENST00000586175.1_5'UTR|CYTH1_ENST00000589296.1_Intron			Q15438	CYH1_HUMAN	cytohesin 1	383					establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						GCGAGCATTTCGTAGAAAGGG	0.567																																																	0													80.0	60.0	66.0					17																	76672223		2203	4300	6503	SO:0001583	missense	0			M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.1147G>A	17.37:g.76672223C>T	ENSP00000389095:p.Glu383Lys		A6NFW7|B7Z1T4|Q9P123|Q9P124	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.E383K	ENST00000446868.3	37	c.1147		17	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781198	0.90282	.	.	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000539525;ENST00000537048;ENST00000262763	T;T	0.13420	2.59;2.59	5.08	5.08	0.68730	.	0.179594	0.48286	D	0.000192	T	0.25975	0.0633	M	0.77616	2.38	0.80722	D	1	B	0.30104	0.268	B	0.35655	0.207	T	0.06826	-1.0805	10	0.66056	D	0.02	.	18.4292	0.90619	0.0:1.0:0.0:0.0	.	382	Q15438-2	.	K	383;383;324;324;382	ENSP00000389095:E383K;ENSP00000354398:E383K	ENSP00000262763:E382K	E	-	1	0	CYTH1	74183818	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.659000	0.83766	2.521000	0.84997	0.591000	0.81541	GAA	CYTH1	-	NULL	ENSG00000108669		0.567	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CYTH1	HGNC	protein_coding	OTTHUMT00000317099.1	-	0.00	24	0	C	NM_004762		76672223	-1	tier1	-	no_errors	ENST00000361101	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6645094	6645094	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:6645094C>T	ENST00000299441.3	-	21	8224	c.7813G>A	c.(7813-7815)Gca>Aca	p.A2605T	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2605	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGGTAGGATGCTCGGGTAAAG	0.587																																																	0													209.0	185.0	193.0					11																	6645094		2201	4296	6497	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.7813G>A	11.37:g.6645094C>T	ENSP00000299441:p.Ala2605Thr		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A2605T	ENST00000299441.3	37	c.7813	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479408	0.26511	.	.	ENSG00000166341	ENST00000299441	T	0.37584	1.19	5.13	2.1	0.27182	Cadherin (2);Cadherin-like (1);	0.160012	0.29565	N	0.011792	T	0.19087	0.0458	L	0.28344	0.845	0.27399	N	0.954905	B	0.09022	0.002	B	0.06405	0.002	T	0.17410	-1.0370	10	0.13108	T	0.6	.	5.4642	0.16634	0.1215:0.5809:0.2145:0.0831	.	2605	Q96JQ0	PCD16_HUMAN	T	2605	ENSP00000299441:A2605T	ENSP00000299441:A2605T	A	-	1	0	DCHS1	6601670	0.059000	0.20769	0.945000	0.38365	0.992000	0.81027	0.486000	0.22340	0.743000	0.32719	0.650000	0.86243	GCA	DCHS1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000166341		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	42	0	C	NM_003737		6645094	-1	tier1	-	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.323	T
DDX54	79039	genome.wustl.edu	37	12	113603800	113603800	+	Silent	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:113603800T>C	ENST00000306014.5	-	13	1479	c.1452A>G	c.(1450-1452)ccA>ccG	p.P484P	DDX54_ENST00000314045.7_Silent_p.P484P	NM_024072.3	NP_076977.3	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	484					ATP catabolic process (GO:0006200)|intracellular estrogen receptor signaling pathway (GO:0030520)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCACACTCTGTGGCACCCGAC	0.662																																																	0													51.0	52.0	52.0					12																	113603800		2203	4300	6503	SO:0001819	synonymous_variant	0			AF144056	CCDS31907.1, CCDS44984.1	12q24.11	2006-01-30				ENSG00000123064		"""DEAD-boxes"""	20084	protein-coding gene	gene with protein product		611665				12466272	Standard	NM_001111322		Approved	MGC2835, APR-5, DP97	uc001tuq.4	Q8TDD1	OTTHUMG00000169676	ENST00000306014.5:c.1452A>G	12.37:g.113603800T>C			Q86YT8|Q9BRZ1	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DBP10CT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P484	ENST00000306014.5	37	c.1452	CCDS31907.1	12																																																																																			DDX54	-	NULL	ENSG00000123064		0.662	DDX54-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DDX54	HGNC	protein_coding	OTTHUMT00000405435.1	-	0.00	76	0	T	NM_024072		113603800	-1	tier1	-	no_errors	ENST00000314045	ensembl	human	known	74_37	silent	5.88	80	5	SNP	0.243	C
DFFB	1677	genome.wustl.edu	37	1	3782553	3782553	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:3782553C>T	ENST00000378209.3	+	3	742	c.419C>T	c.(418-420)cCg>cTg	p.P140L	DFFB_ENST00000338895.3_Missense_Mutation_p.P140L	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	140					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		GAGGACCCGCCGTGGTTTGAA	0.627																																																	0													8.0	10.0	10.0					1																	3782553		2108	4203	6311	SO:0001583	missense	0				CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.419C>T	1.37:g.3782553C>T	ENSP00000367454:p.Pro140Leu		O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	pfam_Apoptosis_DFF40,pfam_CIDE-N_dom,smart_CIDE-N_dom,pfscan_CIDE-N_dom	p.P140L	ENST00000378209.3	37	c.419	CCDS52.1	1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996985	0.35226	.	.	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000339350;ENST00000378206	T;T	0.31247	1.5;1.5	5.12	3.04	0.35103	Apoptosis, DNA fragmentation factor 40kDa (1);	0.529452	0.21769	N	0.069391	T	0.25791	0.0628	L	0.46157	1.445	0.09310	N	0.999998	D;D;B;P	0.53151	0.958;0.958;0.19;0.91	B;B;B;B	0.41299	0.278;0.353;0.013;0.147	T	0.10086	-1.0645	10	0.37606	T	0.19	-16.5034	11.2813	0.49197	0.3687:0.6312:0.0:0.0	.	164;76;140;140	B4DZS0;Q5SR21;O76075-2;O76075	.;.;.;DFFB_HUMAN	L	140;140;76;76	ENSP00000367454:P140L;ENSP00000339524:P140L	ENSP00000339524:P140L	P	+	2	0	DFFB	3772413	0.054000	0.20591	0.432000	0.26747	0.977000	0.68977	1.828000	0.39111	1.058000	0.40530	0.462000	0.41574	CCG	DFFB	-	pfam_Apoptosis_DFF40	ENSG00000169598		0.627	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DFFB	HGNC	protein_coding	OTTHUMT00000009821.2	-	0.00	133	0	C	NM_001282669		3782553	+1	tier1	-	no_errors	ENST00000378209	ensembl	human	known	74_37	missense	35.38	84	46	SNP	0.014	T
DHX8	1659	genome.wustl.edu	37	17	41571170	41571170	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:41571170C>T	ENST00000262415.3	+	8	1200	c.1128C>T	c.(1126-1128)gtC>gtT	p.V376V	DHX8_ENST00000540306.1_Silent_p.V376V	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	376					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TGTCCCTTGTCAGTGCTCCTG	0.517																																					NSCLC(56;1548 1661 49258 49987)												0													148.0	155.0	152.0					17																	41571170		2203	4300	6503	SO:0001819	synonymous_variant	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1128C>T	17.37:g.41571170C>T				Silent	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V376	ENST00000262415.3	37	c.1128	CCDS11464.1	17																																																																																			DHX8	-	NULL	ENSG00000067596		0.517	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	51	0	C			41571170	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	silent	34.25	48	25	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13692122	13692122	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:13692122C>T	ENST00000265104.4	-	79	13950	c.13846G>A	c.(13846-13848)Ggg>Agg	p.G4616R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4616					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGGGCAACCCCACGGAGCACC	0.488									Kartagener syndrome																																								0													112.0	104.0	107.0					5																	13692122		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.13846G>A	5.37:g.13692122C>T	ENSP00000265104:p.Gly4616Arg		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G4616R	ENST00000265104.4	37	c.13846	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.506510	0.96386	.	.	ENSG00000039139	ENST00000265104	T	0.15603	2.41	5.76	5.76	0.90799	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.60157	0.2247	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74054	-0.3788	10	0.87932	D	0	.	19.9618	0.97254	0.0:1.0:0.0:0.0	.	4616	Q8TE73	DYH5_HUMAN	R	4616	ENSP00000265104:G4616R	ENSP00000265104:G4616R	G	-	1	0	DNAH5	13745122	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	7.818000	0.86416	2.722000	0.93159	0.650000	0.86243	GGG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.488	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	39	0	C	NM_001369		13692122	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	32.73	37	18	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13793738	13793738	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:13793738C>T	ENST00000265104.4	-	49	8214	c.8110G>A	c.(8110-8112)Gca>Aca	p.A2704T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2704	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATCATGGCTGCCAAAAACTGG	0.468									Kartagener syndrome																																								0													148.0	148.0	148.0					5																	13793738		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8110G>A	5.37:g.13793738C>T	ENSP00000265104:p.Ala2704Thr		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A2704T	ENST00000265104.4	37	c.8110	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.394303	0.96009	.	.	ENSG00000039139	ENST00000265104	T	0.50001	0.76	5.7	5.7	0.88788	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	T	0.75287	0.3829	M	0.88450	2.955	0.80722	D	1	D	0.67145	0.996	D	0.74023	0.982	T	0.79574	-0.1747	10	0.87932	D	0	.	19.8349	0.96652	0.0:1.0:0.0:0.0	.	2704	Q8TE73	DYH5_HUMAN	T	2704	ENSP00000265104:A2704T	ENSP00000265104:A2704T	A	-	1	0	DNAH5	13846738	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.687000	0.84139	2.691000	0.91804	0.557000	0.71058	GCA	DNAH5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000039139		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	46	0	C	NM_001369		13793738	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	5.49	86	5	SNP	1.000	T
DRC1	92749	genome.wustl.edu	37	2	26672862	26672862	+	Splice_Site	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:26672862A>T	ENST00000288710.2	+	12	1583		c.e12-1			NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1						axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											CCTTCTCCCCAGGGGTTCCTC	0.587																																																	0													61.0	57.0	58.0					2																	26672862		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.1510-1A>T	2.37:g.26672862A>T			A8K1N8|Q53R91|Q53TA3|Q8NDI5	Splice_Site	SNP	-	e12-2	ENST00000288710.2	37	c.1510-2	CCDS1723.1	2	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769037	0.69992	.	.	ENSG00000157856	ENST00000288710;ENST00000439066	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0687	0.59048	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CCDC164	26526366	1.000000	0.71417	0.996000	0.52242	0.869000	0.49853	7.261000	0.78400	2.073000	0.62155	0.397000	0.26171	.	DRC1	-	-	ENSG00000157856		0.587	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRC1	HGNC	protein_coding	OTTHUMT00000246862.1	-	0.00	46	0	A	NM_145038	Intron	26672862	+1	tier1	-	no_errors	ENST00000288710	ensembl	human	known	74_37	splice_site	42.31	30	22	SNP	1.000	T
DTNBP1	84062	genome.wustl.edu	37	6	15533520	15533520	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:15533520G>A	ENST00000344537.5	-	8	790	c.618C>T	c.(616-618)gaC>gaT	p.D206D	DTNBP1_ENST00000338950.5_Silent_p.D206D|DTNBP1_ENST00000462989.2_Silent_p.D50D|DTNBP1_ENST00000355917.3_Silent_p.D207D	NM_032122.4	NP_115498.2	Q96EV8	DTBP1_HUMAN	dystrobrevin binding protein 1	206	Dysbindin.				actin cytoskeleton reorganization (GO:0031532)|anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|blood coagulation (GO:0007596)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|neuron projection morphogenesis (GO:0048812)|platelet dense granule organization (GO:0060155)|positive regulation of gene expression (GO:0010628)|positive regulation of neurotransmitter secretion (GO:0001956)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of dopamine secretion (GO:0014059)	axon (GO:0030424)|BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|growth cone (GO:0030426)|neuron projection (GO:0043005)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)|synaptic vesicle membrane (GO:0030672)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|skin(2)	14	Breast(50;0.0289)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.211)			ACTGCTCCATGTCCTGCTGGA	0.602									Hermansky-Pudlak syndrome																																								0													146.0	124.0	131.0					6																	15533520		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	HPS, HPS1-8	AF394226	CCDS4534.1, CCDS4535.1, CCDS75404.1, CCDS75405.1	6p22.3	2013-09-27			ENSG00000047579	ENSG00000047579		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17328	protein-coding gene	gene with protein product	"""dysbindin-1"", ""biogenesis of lysosomal organelles complex-1, subunit 8"""	607145				11316798	Standard	NM_032122		Approved	Dysbindin, My031, HPS7, DBND, BLOC1S8	uc003nbm.3	Q96EV8	OTTHUMG00000014295	ENST00000344537.5:c.618C>T	6.37:g.15533520G>A			A8K3V3|Q5THY3|Q5THY4|Q96NV2|Q9H0U2|Q9H3J5	Silent	SNP	pfam_Dysbindin,superfamily_Trp_syn_b_sub_like_PLP_eny_SF	p.D207	ENST00000344537.5	37	c.621	CCDS4534.1	6																																																																																			DTNBP1	-	pfam_Dysbindin	ENSG00000047579		0.602	DTNBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DTNBP1	HGNC	protein_coding	OTTHUMT00000039933.2	-	0.00	48	0	G	NM_032122		15533520	-1	tier1	-	no_errors	ENST00000355917	ensembl	human	known	74_37	silent	31.88	47	22	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56417955	56417955	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:56417955T>A	ENST00000361203.3	-	57	15009	c.15002A>T	c.(15001-15003)cAg>cTg	p.Q5001L	DST_ENST00000370788.2_Missense_Mutation_p.Q2915L|DST_ENST00000370769.4_Missense_Mutation_p.Q5003L|DST_ENST00000421834.2_Missense_Mutation_p.Q2915L|DST_ENST00000370754.5_Missense_Mutation_p.Q5181L|DST_ENST00000244364.6_Missense_Mutation_p.Q2589L|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Missense_Mutation_p.Q4677L			Q03001	DYST_HUMAN	dystonin	5001					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CATTTCCTTCTGCAGAGACTT	0.398																																																	0													178.0	178.0	178.0					6																	56417955		1848	4103	5951	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.15002A>T	6.37:g.56417955T>A	ENSP00000354508:p.Gln5001Leu		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.Q5181L	ENST00000361203.3	37	c.15542		6	.	.	.	.	.	.	.	.	.	.	T	15.36	2.809689	0.50421	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.34667	1.35;1.35;1.35;1.35;1.35;1.35;1.35	5.76	5.76	0.90799	.	0.000000	0.49916	D	0.000121	T	0.40040	0.1101	L	0.42686	1.345	0.27803	N	0.94241	D;D;D;P;B	0.76494	0.987;0.999;0.999;0.956;0.141	D;D;D;P;B	0.85130	0.953;0.997;0.997;0.702;0.091	T	0.12863	-1.0531	9	0.17832	T	0.49	.	16.3634	0.83296	0.0:0.0:0.0:1.0	.	2915;5003;5181;5001;2589	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	L	2589;5181;5003;2915;4677;2915;5001	ENSP00000244364:Q2589L;ENSP00000359790:Q5181L;ENSP00000359805:Q5003L;ENSP00000400883:Q2915L;ENSP00000393645:Q4677L;ENSP00000359824:Q2915L;ENSP00000354508:Q5001L	ENSP00000244364:Q2589L	Q	-	2	0	DST	56525914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.223000	0.72257	2.324000	0.78689	0.533000	0.62120	CAG	DST	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000151914		0.398	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	54	0	T	NM_001723		56417955	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	6.90	53	4	SNP	1.000	A
DYNLT3	6990	genome.wustl.edu	37	X	37700359	37700359	+	Splice_Site	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:37700359C>A	ENST00000378578.4	-	4	323		c.e4-1		TM4SF2_ENST00000465127.1_Intron|DYNLT3_ENST00000378581.3_Splice_Site|DYNLT3_ENST00000432389.2_Splice_Site	NM_006520.2	NP_006511.1	P51808	DYLT3_HUMAN	dynein, light chain, Tctex-type 3						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)|transport (GO:0006810)	cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	motor activity (GO:0003774)			endometrium(1)|lung(1)|skin(1)	3						GCACAGGTCACTGCAAATAAA	0.448																																																	0													72.0	65.0	67.0					X																	37700359		2201	4300	6501	SO:0001630	splice_region_variant	0			U02556	CCDS14243.1	Xp21	2013-01-18	2005-11-25	2005-11-25	ENSG00000165169	ENSG00000165169		"""Cytoplasmic dyneins"""	11694	protein-coding gene	gene with protein product		300302	"""t-complex-associated-testis-expressed 1-like"""	TCTE1L		8004092	Standard	NM_006520		Approved	TCTEX1L	uc004dds.3	P51808	OTTHUMG00000033172	ENST00000378578.4:c.197-1G>T	X.37:g.37700359C>A			Q6ICS3	Splice_Site	SNP	-	e4-1	ENST00000378578.4	37	c.197-1	CCDS14243.1	X	.	.	.	.	.	.	.	.	.	.	C	22.3	4.277631	0.80692	.	.	ENSG00000165169	ENST00000378581;ENST00000378578;ENST00000432389	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9156	0.79512	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DYNLT3	37585303	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.789000	0.75110	2.560000	0.86352	0.594000	0.82650	.	DYNLT3	-	-	ENSG00000165169		0.448	DYNLT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNLT3	HGNC	protein_coding	OTTHUMT00000080876.1	-	0.00	59	0	C	NM_006520	Intron	37700359	-1	tier1	-	no_errors	ENST00000378581	ensembl	human	known	74_37	splice_site	6.45	58	4	SNP	1.000	A
ECI1	1632	genome.wustl.edu	37	16	2293218	2293218	+	Missense_Mutation	SNP	C	C	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:2293218C>G	ENST00000301729.4	-	6	618	c.571G>C	c.(571-573)Gac>Cac	p.D191H	ECI1_ENST00000562238.1_Missense_Mutation_p.D174H|RP11-304L19.11_ENST00000565709.1_RNA|ECI1_ENST00000570258.1_Missense_Mutation_p.D132H	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	191					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)			endometrium(1)|large_intestine(2)|lung(6)	9						TCCAGGGTGTCTTTCAACCTG	0.662																																																	0													46.0	48.0	47.0					16																	2293218		2198	4298	6496	SO:0001583	missense	0				CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.571G>C	16.37:g.2293218C>G	ENSP00000301729:p.Asp191His		A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Missense_Mutation	SNP	pfam_Crotonase_core_superfam	p.D191H	ENST00000301729.4	37	c.571	CCDS10464.1	16	.	.	.	.	.	.	.	.	.	.	C	24.4	4.521987	0.85600	.	.	ENSG00000167969	ENST00000301729	D	0.85484	-1.99	4.9	4.9	0.64082	Crotonase, core (1);	0.048822	0.85682	D	0.000000	D	0.92244	0.7540	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;0.968	D;P	0.87578	0.998;0.701	D	0.92857	0.6302	10	0.62326	D	0.03	-53.6555	15.6263	0.76859	0.0:1.0:0.0:0.0	.	174;191	P42126-2;P42126	.;ECI1_HUMAN	H	191	ENSP00000301729:D191H	ENSP00000301729:D191H	D	-	1	0	ECI1	2233219	1.000000	0.71417	0.722000	0.30670	0.054000	0.15201	7.411000	0.80078	2.550000	0.86006	0.591000	0.81541	GAC	ECI1	-	pfam_Crotonase_core_superfam	ENSG00000167969		0.662	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECI1	HGNC	protein_coding	OTTHUMT00000250768.1	-	0.00	71	0	C			2293218	-1	tier1	-	no_errors	ENST00000301729	ensembl	human	known	74_37	missense	37.08	56	33	SNP	1.000	G
EEF2K	29904	genome.wustl.edu	37	16	22295238	22295238	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:22295238C>T	ENST00000263026.5	+	18	2573	c.2099C>T	c.(2098-2100)gCg>gTg	p.A700V	RP11-141O15.1_ENST00000562376.1_RNA|RP11-141O15.1_ENST00000568125.1_RNA	NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	700					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GCAGAGGCAGCGATGGAAGCC	0.562																																					NSCLC(195;1411 2157 20319 27471 51856)												0													31.0	26.0	28.0					16																	22295238		2193	4293	6486	SO:0001583	missense	0			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.2099C>T	16.37:g.22295238C>T	ENSP00000263026:p.Ala700Val		Q8N588	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.A700V	ENST00000263026.5	37	c.2099	CCDS10604.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.639551	0.96693	.	.	ENSG00000103319	ENST00000263026	T	0.35048	1.33	5.71	5.71	0.89125	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67047	-0.5769	10	0.87932	D	0	-21.326	19.8575	0.96767	0.0:1.0:0.0:0.0	.	700	O00418	EF2K_HUMAN	V	700	ENSP00000263026:A700V	ENSP00000263026:A700V	A	+	2	0	EEF2K	22202739	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	7.416000	0.80143	2.698000	0.92095	0.561000	0.74099	GCG	EEF2K	-	pirsf_Elongation_factor_2_kinase	ENSG00000103319		0.562	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	HGNC	protein_coding	OTTHUMT00000211580.2	-	0.00	57	0	C	NM_013302		22295238	+1	tier1	-	no_errors	ENST00000263026	ensembl	human	known	74_37	missense	5.32	89	5	SNP	1.000	T
EIF5B	9669	genome.wustl.edu	37	2	99977973	99977973	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:99977973T>A	ENST00000289371.6	+	4	811	c.609T>A	c.(607-609)aaT>aaA	p.N203K		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	203					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGAAAAAAAATCAGAAAAACA	0.358																																					Colon(162;2388 2567 2705 3444)												0													42.0	43.0	43.0					2																	99977973		1819	4076	5895	SO:0001583	missense	0			AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.609T>A	2.37:g.99977973T>A	ENSP00000289371:p.Asn203Lys		O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.N203K	ENST00000289371.6	37	c.609	CCDS42721.1	2	.	.	.	.	.	.	.	.	.	.	T	12.01	1.810241	0.32053	.	.	ENSG00000158417	ENST00000289371	T	0.41065	1.01	5.92	2.33	0.28932	.	.	.	.	.	T	0.29652	0.0740	L	0.41492	1.28	0.47698	D	0.999498	B	0.13594	0.008	B	0.10450	0.005	T	0.05582	-1.0876	8	.	.	.	-19.6218	7.5803	0.27961	0.0:0.3857:0.0:0.6143	.	203	O60841	IF2P_HUMAN	K	203	ENSP00000289371:N203K	.	N	+	3	2	EIF5B	99344405	0.995000	0.38212	0.999000	0.59377	0.972000	0.66771	0.228000	0.17814	0.503000	0.28060	0.533000	0.62120	AAT	EIF5B	-	NULL	ENSG00000158417		0.358	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	HGNC	protein_coding	OTTHUMT00000330364.2		0.00	38	0	T	NM_015904		99977973	+1			no_errors	ENST00000289371	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
ELOVL6	79071	genome.wustl.edu	37	4	110972735	110972735	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:110972735G>T	ENST00000394607.3	-	5	720	c.557C>A	c.(556-558)gCa>gAa	p.A186E	ELOVL6_ENST00000302274.3_Missense_Mutation_p.A186E			Q9H5J4	ELOV6_HUMAN	ELOVL fatty acid elongase 6	186					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty acid biosynthetic process (GO:0042759)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)	8				OV - Ovarian serous cystadenocarcinoma(123;0.00462)		TCGGAAACCTGCCGCCCGCAA	0.532																																																	0													70.0	62.0	65.0					4																	110972735		2203	4300	6503	SO:0001583	missense	0			AK027031	CCDS3690.1	4q25	2011-05-25	2011-05-25		ENSG00000170522	ENSG00000170522			15829	protein-coding gene	gene with protein product		611546	"""ELOVL family member 6, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast)"""			11567032	Standard	NM_024090		Approved	FLJ23378, MGC5487, LCE	uc003hzz.3	Q9H5J4	OTTHUMG00000132547	ENST00000394607.3:c.557C>A	4.37:g.110972735G>T	ENSP00000378105:p.Ala186Glu		Q4W5L0|Q8NCD1	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.A186E	ENST00000394607.3	37	c.557	CCDS3690.1	4	.	.	.	.	.	.	.	.	.	.	G	19.59	3.855372	0.71719	.	.	ENSG00000170522	ENST00000394607;ENST00000302274	T;T	0.23348	1.91;1.91	5.97	3.25	0.37280	.	0.139283	0.64402	D	0.000004	T	0.51568	0.1682	M	0.88105	2.93	0.54753	D	0.999983	D	0.58620	0.983	D	0.68483	0.958	T	0.50717	-0.8795	10	0.30854	T	0.27	-17.2151	10.6179	0.45462	0.2126:0.0:0.7874:0.0	.	186	Q9H5J4	ELOV6_HUMAN	E	186	ENSP00000378105:A186E;ENSP00000304736:A186E	ENSP00000304736:A186E	A	-	2	0	ELOVL6	111192184	1.000000	0.71417	0.005000	0.12908	0.762000	0.43233	9.775000	0.98995	0.382000	0.24878	0.655000	0.94253	GCA	ELOVL6	-	pfam_GNS1_SUR4	ENSG00000170522		0.532	ELOVL6-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELOVL6	HGNC	protein_coding	OTTHUMT00000255748.1	-	0.00	50	0	G	NM_024090		110972735	-1	tier1	-	no_errors	ENST00000394607	ensembl	human	known	74_37	missense	38.46	32	20	SNP	0.956	T
ELP6	54859	genome.wustl.edu	37	3	47545863	47545863	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:47545863C>T	ENST00000296149.4	-	4	450	c.280G>A	c.(280-282)Gtc>Atc	p.V94I	ELP6_ENST00000446787.1_Missense_Mutation_p.V21I|ELP6_ENST00000439305.1_Missense_Mutation_p.V21I	NM_001031703.2	NP_001026873.2	Q0PNE2	ELP6_HUMAN	elongator acetyltransferase complex subunit 6	94					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Elongator holoenzyme complex (GO:0033588)											GCCTGGAAGACGACGTCCACT	0.592																																																	0													62.0	68.0	66.0					3																	47545863		2036	4186	6222	SO:0001583	missense	0			AK000218	CCDS43082.1	3p21.31	2012-08-14	2012-08-08	2012-08-08	ENSG00000163832	ENSG00000163832		"""Elongator acetyltransferase complex subunits"""	25976	protein-coding gene	gene with protein product		615020	"""transmembrane protein 103"", ""chromosome 3 open reading frame 75"""	TMEM103, C3orf75		22854966	Standard	XM_005265241		Approved	FLJ20211	uc003crk.3	Q0PNE2	OTTHUMG00000133521	ENST00000296149.4:c.280G>A	3.37:g.47545863C>T	ENSP00000296149:p.Val94Ile		Q9BW57|Q9NXJ3	Missense_Mutation	SNP	pfam_UPF0405	p.V94I	ENST00000296149.4	37	c.280	CCDS43082.1	3	.	.	.	.	.	.	.	.	.	.	C	6.462	0.453351	0.12283	.	.	ENSG00000163832	ENST00000296149;ENST00000450051;ENST00000446787;ENST00000439305;ENST00000412761;ENST00000444760;ENST00000425291;ENST00000449409;ENST00000414236	.	.	.	6.06	0.929	0.19449	.	0.537578	0.21414	N	0.074938	T	0.10078	0.0247	N	0.08118	0	0.24433	N	0.994568	B;B;B	0.22800	0.001;0.075;0.018	B;B;B	0.15484	0.002;0.006;0.013	T	0.15896	-1.0421	9	0.15952	T	0.53	-0.0025	0.4412	0.00487	0.3275:0.199:0.2848:0.1887	.	70;94;94	B4DP60;C9JAS1;Q0PNE2	.;.;CC075_HUMAN	I	94;70;21;21;21;21;21;21;21	.	ENSP00000296149:V94I	V	-	1	0	C3orf75	47520867	0.993000	0.37304	0.985000	0.45067	0.032000	0.12392	0.212000	0.17497	0.159000	0.19401	-0.256000	0.11100	GTC	ELP6	-	pfam_UPF0405	ENSG00000163832		0.592	ELP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP6	HGNC	protein_coding	OTTHUMT00000257493.1	-	0.00	37	0	C	NM_017713		47545863	-1	tier1	-	no_errors	ENST00000296149	ensembl	human	known	74_37	missense	36.73	31	18	SNP	0.985	T
BCRP7	100133163	genome.wustl.edu	37	22	18844883	18844883	+	3'UTR	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr22:18844883C>T	ENST00000412938.1	+	0	3133																											GGGCAGCTCACGGAAATACAG	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*3130C>T	22.37:g.18844883C>T				RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008132.13	-	-	ENSG00000161103		0.582	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1	-	0.00	348	0	C			18844883	+1	tier1	-	no_errors	ENST00000412938	ensembl	human	known	74_37	rna	9.61	348	37	SNP	0.998	T
C1orf167	284498	genome.wustl.edu	37	1	11837351	11837351	+	3'UTR	SNP	G	G	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:11837351G>C	ENST00000484153.1	+	0	1550				RP11-56N19.5_ENST00000376620.3_RNA|C1orf167_ENST00000433342.1_Intron			Q5SNV9	CA167_HUMAN	chromosome 1 open reading frame 167											central_nervous_system(1)	1						GTGGCGATCAGGAGAAGCCAG	0.587																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL834308		1p36.22	2012-04-20			ENSG00000215910	ENSG00000215910			25262	protein-coding gene	gene with protein product						12370778	Standard	XM_006710065		Approved	DKFZp434E1410, RP11-56N19.2	uc001asy.1	Q5SNV9	OTTHUMG00000002228	ENST00000484153.1:c.*1547G>C	1.37:g.11837351G>C			Q8NDA9|Q8NDF3	RNA	SNP	-	NULL	ENST00000484153.1	37	NULL		1																																																																																			RP11-56N19.5	-	-	ENSG00000177553		0.587	C1orf167-001	KNOWN	basic	processed_transcript	ENSG00000177553	Clone_based_vega_gene	protein_coding	OTTHUMT00000006326.2	-	0.00	52	0	G			11837351	-1	tier1	-	no_errors	ENST00000376620	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.001	C
SMG1P4	100507526	genome.wustl.edu	37	16	21916099	21916099	+	IGR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:21916099G>A								snoU13 (15108 upstream) : UQCRC2 (47881 downstream)																							AGAAAAATGCGGCATTTAACC	0.383																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.21916099G>A				RNA	SNP	-	NULL		37	NULL		16																																																																																			RP11-645C24.2	-	-	ENSG00000185710	0	0.383					ENSG00000185710	Clone_based_vega_gene			-	0.00	64	0	G			21916099	-1	tier1	-	no_errors	ENST00000517529	ensembl	human	known	74_37	rna	39.34	37	24	SNP	0.232	A
LINC01597	400841	genome.wustl.edu	37	20	29516303	29516303	+	lincRNA	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr20:29516303G>A	ENST00000380888.3	-	0	606																											agccgactccgcggctgcagc	0.662																																																	0																																												0																															20.37:g.29516303G>A				RNA	SNP	-	NULL	ENST00000380888.3	37	NULL		20																																																																																			RP4-610C12.4	-	-	ENSG00000205611		0.662	RP4-610C12.4-001	KNOWN	basic	lincRNA	ENSG00000205611	Clone_based_vega_gene	lincRNA	OTTHUMT00000256907.1	-	0.00	12	0	G			29516303	-1	tier1	-	no_errors	ENST00000380888	ensembl	human	known	74_37	rna	37.50	10	6	SNP	0.001	A
SCRIB	23513	genome.wustl.edu	37	8	144872406	144872406	+	IGR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:144872406G>A	ENST00000320476.3	-	0	5143				SCRIB_ENST00000546337.1_5'Flank|RP11-429J17.8_ENST00000534089.1_RNA|RP11-429J17.8_ENST00000532625.1_RNA|RP11-429J17.8_ENST00000527139.1_RNA	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein						activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CCCTGAGGCCGGAGACGATGT	0.657																																					Pancreas(51;966 1133 10533 14576 29674)												0																																										SO:0001628	intergenic_variant	0			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154		8.37:g.144872406G>A			Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	RNA	SNP	-	NULL	ENST00000320476.3	37	NULL	CCDS6411.1	8																																																																																			RP11-429J17.8	-	-	ENSG00000214733		0.657	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000214733	Clone_based_vega_gene	protein_coding	OTTHUMT00000382215.1	-	0.00	40	0	G	NM_015356		144872406	+1	tier1	-	no_errors	ENST00000527139	ensembl	human	known	74_37	rna	23.08	70	21	SNP	0.000	A
AC003968.1	0	genome.wustl.edu	37	7	125680343	125680343	+	RNA	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:125680343G>T	ENST00000408491.1	+	0	61																											gccagcgggagccaggaacag	0.627																																																	0																																												0																															7.37:g.125680343G>T				RNA	SNP	-	NULL	ENST00000408491.1	37	NULL		7																																																																																			AC003968.1	-	-	ENSG00000221418		0.627	AC003968.1-201	NOVEL	basic	miRNA	ENSG00000221418	Clone_based_ensembl_gene	miRNA		-	0.00	47	0	G			125680343	+1	tier1	-	no_errors	ENST00000408491	ensembl	human	novel	74_37	rna	29.63	57	24	SNP	0.063	T
AL358813.2	0	genome.wustl.edu	37	1	149673265	149673265	+	5'Flank	SNP	C	C	G	rs71620900	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:149673265C>G	ENST00000369173.2	+	0	0				RP11-353N4.5_ENST00000608683.1_lincRNA|RNU1-68P_ENST00000517116.1_RNA|RP11-353N4.4_ENST00000443602.2_lincRNA																							CGGGTCGCCGCGTCCGGAGCC	0.697																																																	0																																										SO:0001631	upstream_gene_variant	0																															1.37:g.149673265C>G	Exception_encountered			RNA	SNP	-	NULL	ENST00000369173.2	37	NULL		1																																																																																			RP11-353N4.4	-	-	ENSG00000223759		0.697	AL358813.2-201	NOVEL	basic|appris_principal	protein_coding	ENSG00000223759	Clone_based_vega_gene	protein_coding		-	0.00	11	0	C			149673265	+1	tier1	-	no_errors	ENST00000443602	ensembl	human	known	74_37	rna	31.25	11	5	SNP	0.001	G
CTD-2090I13.1	0	genome.wustl.edu	37	1	227618722	227618722	+	lincRNA	DEL	A	A	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:227618722delA	ENST00000445817.1	+	0	1957																											TTTATATACCAAAAAAAAAAA	0.433																																																	0																																												0																															1.37:g.227618722delA				RNA	DEL	-	NULL	ENST00000445817.1	37	NULL		1																																																																																			CTD-2090I13.1	-	-	ENSG00000234277		0.433	CTD-2090I13.1-001	KNOWN	basic	lincRNA	ENSG00000234277	Clone_based_vega_gene	lincRNA	OTTHUMT00000091688.1		0.00	14	0	A			227618722	+1	tier1		no_errors	ENST00000445817	ensembl	human	known	74_37	rna	25.00	9	3	DEL	0.163	-
BX088651.1	0	genome.wustl.edu	37	9	44401879	44401879	+	3'UTR	SNP	A	A	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:44401879A>C	ENST00000540551.1	-	0	548				RP11-475I24.3_ENST00000435586.1_lincRNA																							TGCAGAAGATAGGTGCCTGCT	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000540551.1:c.*11T>G	9.37:g.44401879A>C				RNA	SNP	-	NULL	ENST00000540551.1	37	NULL		9																																																																																			RP11-475I24.3	-	-	ENSG00000237357		0.582	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237357	Clone_based_vega_gene	protein_coding		-	0.00	98	0	A			44401879	+1	tier1	-	no_errors	ENST00000428895	ensembl	human	known	74_37	rna	17.78	74	16	SNP	0.014	C
RP11-146E13.4	0	genome.wustl.edu	37	14	19856372	19856372	+	lincRNA	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr14:19856372A>G	ENST00000548109.1	+	0	72																											TATACGTGGGAAAAAAAAAAG	0.358																																																	0																																												0																															14.37:g.19856372A>G				RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-	ENSG00000244306		0.358	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1		0.00	23	0	A			19856372	-1			no_errors	ENST00000551334	ensembl	human	known	74_37	rna	10.26	35	4	SNP	0.001	G
MGAM2	93432	genome.wustl.edu	37	7	141831824	141831824	+	Missense_Mutation	SNP	G	G	A	rs568239061	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:141831824G>A	ENST00000477922.3	+	6	568	c.514G>A	c.(514-516)Gtg>Atg	p.V172M	RP11-1220K2.2_ENST00000550469.2_Missense_Mutation_p.V172M																endometrium(1)|lung(5)	6						GAGCTATTACGTGGAGGTTAC	0.393													G|||	3	0.000599042	0.0	0.0	5008	,	,		14676	0.0		0.0	False		,,,				2504	0.0031																0																																										SO:0001583	missense	0																														ENST00000477922.3:c.514G>A	7.37:g.141831824G>A	ENSP00000420449:p.Val172Met			Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.V172M	ENST00000477922.3	37	c.514		7	.	.	.	.	.	.	.	.	.	.	G	12.93	2.085200	0.36758	.	.	ENSG00000257743	ENST00000550469;ENST00000477922	D	0.83914	-1.78	4.55	-9.11	0.00711	Glycoside hydrolase-type carbohydrate-binding (1);	.	.	.	.	D	0.83815	0.5336	.	.	.	.	.	.	D	0.76494	0.999	P	0.60415	0.874	T	0.82041	-0.0654	7	0.87932	D	0	.	4.8267	0.13419	0.4311:0.3576:0.1316:0.0797	.	172	Q2M2H8	MGAL2_HUMAN	M	172	ENSP00000447431:V172M	ENSP00000380641:V172M	V	+	1	0	RP11-1220K2.2	141478293	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.576000	0.02129	-3.474000	0.00156	-0.515000	0.04445	GTG	RP11-1220K2.2	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257743		0.393	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	Clone_based_vega_gene	protein_coding	OTTHUMT00000351325.3	-	0.00	55	0	G			141831824	+1	tier1	-	no_errors	ENST00000477922	ensembl	human	putative	74_37	missense	32.39	48	23	SNP	0.000	A
GREM1	26585	genome.wustl.edu	37	15	33010353	33010353	+	5'UTR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:33010353G>A	ENST00000300177.4	+	0	179				RP11-758N13.1_ENST00000558441.1_lincRNA|GREM1_ENST00000560830.1_5'UTR|GREM1_ENST00000560677.1_5'UTR	NM_001191322.1|NM_001191323.1|NM_013372.6	NP_001178251.1|NP_001178252.1|NP_037504.1	O60565	GREM1_HUMAN	gremlin 1, DAN family BMP antagonist						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell morphogenesis (GO:0000902)|collagen fibril organization (GO:0030199)|determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone mineralization (GO:0030502)|negative regulation of bone mineralization involved in bone maturation (GO:1900158)|negative regulation of bone remodeling (GO:0046851)|negative regulation of bone trabecula formation (GO:1900155)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast proliferation (GO:0090291)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-tyrosine autophosphorylation (GO:1900086)|positive regulation of receptor activity (GO:2000273)|positive regulation of receptor internalization (GO:0002092)|positive regulation of telomerase activity (GO:0051973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|regulation of epithelial to mesenchymal transition (GO:0010717)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|receptor agonist activity (GO:0048018)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)	10		all_lung(180;1.49e-09)		all cancers(64;2.97e-18)|Epithelial(43;3.15e-12)|GBM - Glioblastoma multiforme(186;2.32e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0107)		AGGACCCGCCGCACTGACAGG	0.741																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS10029.1, CCDS53927.1	15q13.3	2014-02-07	2013-02-26	2004-05-07	ENSG00000166923	ENSG00000166923			2001	protein-coding gene	gene with protein product		603054	"""cysteine knot superfamily 1, BMP antagonist 1"", ""gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis)"", ""gremlin 1"", ""colorectal adenoma and carcinoma 1"""	CKTSF1B1, CRAC1		9660951, 10026205, 22561515	Standard	NM_013372		Approved	DRM, gremlin, DAND2, HMPS	uc001zhe.2	O60565	OTTHUMG00000129319	ENST00000300177.4:c.-11G>A	15.37:g.33010353G>A			Q52LV3|Q8N914|Q8N936	RNA	SNP	-	NULL	ENST00000300177.4	37	NULL	CCDS10029.1	15																																																																																			RP11-758N13.1	-	-	ENSG00000259721		0.741	GREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259721	Clone_based_vega_gene	protein_coding	OTTHUMT00000251455.2	-	0.00	15	0	G	NM_013372		33010353	-1	tier1	-	no_errors	ENST00000558441	ensembl	human	known	74_37	rna	26.32	14	5	SNP	0.002	A
KMT2E	55904	genome.wustl.edu	37	7	104745797	104745797	+	Intron	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:104745797A>G	ENST00000311117.3	+	18	2741				KMT2E_ENST00000334877.4_Intron|KMT2E_ENST00000257745.4_Intron|KMT2E_ENST00000334914.7_Intron|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CATTTTAGATAATACACCAAT	0.254																																																	0																																										SO:0001627	intron_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2197-89A>G	7.37:g.104745797A>G			B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	RNA	SNP	-	NULL	ENST00000311117.3	37	NULL	CCDS34723.1	7																																																																																			CTB-152G17.6	-	-	ENSG00000272918		0.254	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272918	Clone_based_vega_gene	protein_coding	OTTHUMT00000348697.1	-	0.00	30	0	A			104745797	-1	tier1	-	no_errors	ENST00000607968	ensembl	human	known	74_37	rna	33.33	18	9	SNP	0.000	G
ERBB2IP	55914	genome.wustl.edu	37	5	65338949	65338949	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:65338949G>A	ENST00000284037.5	+	16	1740	c.1351G>A	c.(1351-1353)Gag>Aag	p.E451K	ERBB2IP_ENST00000380935.1_Missense_Mutation_p.E451K|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.E451K|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.E451K|ERBB2IP_ENST00000380943.2_Missense_Mutation_p.E451K|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.E451K|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.E451K|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.E451K|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.E451K	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	451					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		TTCATTGTGGGAGGAACAGAG	0.353																																																	0													80.0	77.0	78.0					5																	65338949		2203	4299	6502	SO:0001583	missense	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.1351G>A	5.37:g.65338949G>A	ENSP00000284037:p.Glu451Lys		A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.E451K	ENST00000284037.5	37	c.1351	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.423499	0.96111	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.64757	0.2627	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D	0.76494	0.999;0.991;0.998;0.997;0.997;0.999;0.997	D;P;D;P;D;D;D	0.79784	0.958;0.771;0.993;0.87;0.985;0.966;0.916	T	0.65307	-0.6200	10	0.87932	D	0	.	20.0085	0.97443	0.0:0.0:1.0:0.0	.	451;451;451;451;451;451;451	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	K	451	ENSP00000284037:E451K;ENSP00000370330:E451K;ENSP00000370326:E451K;ENSP00000370323:E451K;ENSP00000370322:E451K;ENSP00000370325:E451K;ENSP00000422766:E451K;ENSP00000426632:E451K;ENSP00000422015:E451K	ENSP00000284037:E451K	E	+	1	0	ERBB2IP	65374705	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.388000	0.97237	2.814000	0.96858	0.650000	0.86243	GAG	ERBB2IP	-	NULL	ENSG00000112851		0.353	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	-	0.00	61	0	G	NM_018695		65338949	+1	tier1	-	no_errors	ENST00000284037	ensembl	human	known	74_37	missense	33.72	57	29	SNP	1.000	A
ERN2	10595	genome.wustl.edu	37	16	23712332	23712332	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:23712332G>A	ENST00000256797.4	-	12	1619	c.1451C>T	c.(1450-1452)gCt>gTt	p.A484V	ERN2_ENST00000457008.2_Intron	NM_033266.3	NP_150296.3			endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		AGTGAGGCTAGCTGCCAGCAG	0.572																																																	0													85.0	81.0	83.0					16																	23712332		2197	4300	6497	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000256797.4:c.1451C>T	16.37:g.23712332G>A	ENSP00000256797:p.Ala484Val			Missense_Mutation	SNP	pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.A484V	ENST00000256797.4	37	c.1451	CCDS32407.1	16	.	.	.	.	.	.	.	.	.	.	G	9.394	1.076322	0.20227	.	.	ENSG00000134398	ENST00000256797	T	0.59224	0.28	5.25	4.27	0.50696	.	0.344154	0.31020	N	0.008408	T	0.38108	0.1028	N	0.20986	0.625	0.23953	N	0.996362	B;B	0.25719	0.007;0.132	B;B	0.17098	0.004;0.017	T	0.11084	-1.0602	10	0.18710	T	0.47	.	10.3133	0.43721	0.0964:0.0:0.9036:0.0	.	436;436	Q76MJ5;A5YM65	ERN2_HUMAN;.	V	484	ENSP00000256797:A484V	ENSP00000256797:A484V	A	-	2	0	ERN2	23619833	0.960000	0.32886	0.828000	0.32881	0.968000	0.65278	2.305000	0.43664	2.601000	0.87937	0.561000	0.74099	GCT	ERN2	-	NULL	ENSG00000134398		0.572	ERN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434887.1	-	0.00	46	0	G			23712332	-1	tier1	-	no_errors	ENST00000256797	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.585	A
AC026369.1	0	genome.wustl.edu	37	12	148811	148811	+	IGR	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:148811G>T	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							tagtgagactgtgtctccata	0.433																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.148811G>T				RNA	SNP	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			FAM138D	-	-	ENSG00000206114		0.433	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding			0.00	38	0	G			148811	-1			no_errors	ENST00000320165	ensembl	human	known	74_37	rna	7.14	65	5	SNP	0.177	T
FAM13B	51306	genome.wustl.edu	37	5	137289026	137289026	+	Splice_Site	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:137289026T>A	ENST00000033079.3	-	15	2232	c.1781A>T	c.(1780-1782)aAg>aTg	p.K594M	FAM13B_ENST00000425075.2_Splice_Site_p.K498M|FAM13B_ENST00000420893.2_Splice_Site_p.K594M	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	594					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						CAAACCTACCTTGCTATTTCT	0.368																																																	0													204.0	197.0	199.0					5																	137289026		2203	4300	6503	SO:0001630	splice_region_variant	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1782+1A>T	5.37:g.137289026T>A			D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.K594M	ENST00000033079.3	37	c.1781	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	T	21.3	4.124506	0.77436	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95788	-3.81;1.25;-3.81	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.97182	0.9079	M	0.66939	2.045	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.999	D	0.97833	1.0264	10	0.72032	D	0.01	-10.1138	15.2957	0.73906	0.0:0.0:0.0:1.0	.	498;594;594	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	M	594;498;594	ENSP00000033079:K594M;ENSP00000394669:K498M;ENSP00000388521:K594M	ENSP00000033079:K594M	K	-	2	0	FAM13B	137316925	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	3.967000	0.56802	2.001000	0.58596	0.477000	0.44152	AAG	FAM13B	-	NULL	ENSG00000031003		0.368	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	-	0.00	55	0	T		Missense_Mutation	137289026	-1	tier1	-	no_errors	ENST00000033079	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	A
FANK1	92565	genome.wustl.edu	37	10	127677338	127677338	+	Intron	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:127677338C>T	ENST00000368693.1	+	3	420				FANK1_ENST00000368695.1_Intron|FANK1_ENST00000368689.1_Intron|FANK1_ENST00000449042.2_Missense_Mutation_p.T131I			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TTTGGCCTTACCAGAAGCAGA	0.388																																																	0																																										SO:0001627	intron_variant	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.316+94C>T	10.37:g.127677338C>T			Q6UXY9|Q6X7T6	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T131I	ENST00000368693.1	37	c.392	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	4.441	0.081618	0.08533	.	.	ENSG00000203780	ENST00000449042	T	0.36878	1.23	3.16	1.29	0.21616	.	.	.	.	.	T	0.19525	0.0469	.	.	.	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.25012	-1.0144	7	.	.	.	.	5.148	0.14994	0.0:0.7285:0.0:0.2715	.	131	B7Z939	.	I	131	ENSP00000411388:T131I	.	T	+	2	0	FANK1	127667328	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.018000	0.12568	0.349000	0.23975	0.650000	0.86243	ACC	FANK1	-	NULL	ENSG00000203780		0.388	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		-	0.00	17	0	C	NM_145235		127677338	+1	tier1	-	no_errors	ENST00000449042	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.000	T
FAXC	84553	genome.wustl.edu	37	6	99729215	99729215	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:99729215C>T	ENST00000389677.5	-	6	1337	c.1055G>A	c.(1054-1056)aGc>aAc	p.S352N	FAXC_ENST00000538471.1_Missense_Mutation_p.S72N|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)	352						integral component of membrane (GO:0016021)											GTGGGTTTTGCTGCCTTCGCT	0.483																																																	0													113.0	108.0	109.0					6																	99729215		2203	4300	6503	SO:0001583	missense	0			BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.1055G>A	6.37:g.99729215C>T	ENSP00000374328:p.Ser352Asn		B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.S352N	ENST00000389677.5	37	c.1055	CCDS34500.1	6	.	.	.	.	.	.	.	.	.	.	C	18.41	3.617057	0.66672	.	.	ENSG00000146267	ENST00000389677;ENST00000538471	.	.	.	5.29	4.4	0.53042	.	0.224329	0.46442	D	0.000296	T	0.40423	0.1116	L	0.44542	1.39	0.45490	D	0.998451	B	0.17667	0.023	B	0.14578	0.011	T	0.34925	-0.9809	9	0.40728	T	0.16	-24.5395	15.6978	0.77515	0.0:0.8627:0.1373:0.0	.	352	Q5TGI0	CF168_HUMAN	N	352;72	.	ENSP00000374328:S352N	S	-	2	0	C6orf168	99835936	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.592000	0.61027	1.177000	0.42855	0.655000	0.94253	AGC	FAXC	-	NULL	ENSG00000146267		0.483	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	HGNC	protein_coding	OTTHUMT00000041589.4		0.00	15	0	C	NM_032511		99729215	-1			no_errors	ENST00000389677	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
FGA	2243	genome.wustl.edu	37	4	155505987	155505988	+	Splice_Site	INS	-	-	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:155505987_155505988insA	ENST00000302053.3	-	6	1970		c.e6-2			NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain						blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CATCACAGTCTAAAAAAAAAAT	0.366																																					NSCLC(143;340 1922 20892 22370 48145)												0																																										SO:0001630	splice_region_variant	0				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1892-2->T	4.37:g.155505997_155505997dupA			A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Splice_Site	INS	-	e6-2	ENST00000302053.3	37	c.1892-3_1892-2	CCDS3787.1	4																																																																																			FGA	-	-	ENSG00000171560		0.366	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1		0.00	37	0	-	NM_000508	Intron	155505988	-1	tier1		no_errors	ENST00000302053	ensembl	human	known	74_37	splice_site_ins	6.25	30	2	INS	1.000:1.000	A
FHOD3	80206	genome.wustl.edu	37	18	34261459	34261460	+	Frame_Shift_Del	DEL	AG	AG	-	rs144071785		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:34261459_34261460delAG	ENST00000359247.4	+	12	1371_1372	c.1371_1372delAG	c.(1369-1374)gcagagfs	p.E458fs	FHOD3_ENST00000257209.4_Frame_Shift_Del_p.E458fs|FHOD3_ENST00000445677.1_Frame_Shift_Del_p.E420fs|FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Frame_Shift_Del_p.E633fs	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	458					actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				CACTGGCAGCAGAGAGAGAGAG	0.46																																																	0																																										SO:0001589	frameshift_variant	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1371_1372delAG	18.37:g.34261469_34261470delAG	ENSP00000352186:p.Glu458fs		A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Frame_Shift_Del	DEL	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.R461fs	ENST00000359247.4	37	c.1371_1372		18																																																																																			FHOD3	-	NULL	ENSG00000134775		0.460	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1		0.00	49	0	AG	XM_371114		34261460	+1	tier1		no_errors	ENST00000257209	ensembl	human	known	74_37	frame_shift_del	10.71	50	6	DEL	0.879:1.000	-
FMO1	2326	genome.wustl.edu	37	1	171247904	171247904	+	Missense_Mutation	SNP	G	G	T	rs377169079		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:171247904G>T	ENST00000354841.4	+	4	652	c.521G>T	c.(520-522)cGg>cTg	p.R174L	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000367750.3_Missense_Mutation_p.R174L|FMO1_ENST00000402921.2_Missense_Mutation_p.R111L	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	174					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TTTCATAGCCGGCAATATAAG	0.398																																																	0													79.0	84.0	82.0					1																	171247904		2203	4300	6503	SO:0001583	missense	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.521G>T	1.37:g.171247904G>T	ENSP00000346901:p.Arg174Leu		A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.R174L	ENST00000354841.4	37	c.521	CCDS1294.1	1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.403756	0.83230	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000402921;ENST00000354841	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.66	5.66	0.87406	.	0.067011	0.64402	D	0.000018	T	0.65026	0.2652	M	0.67517	2.055	0.43317	D	0.995336	D;P;D	0.89917	1.0;0.801;1.0	D;P;D	0.79784	0.993;0.482;0.986	T	0.63786	-0.6558	10	0.35671	T	0.21	1.1855	11.9371	0.52880	0.0804:0.0:0.9196:0.0	.	111;174;174	B7Z3P4;B2RCG5;Q01740	.;.;FMO1_HUMAN	L	174;174;111;174	ENSP00000356724:R174L;ENSP00000406982:R174L;ENSP00000385543:R111L;ENSP00000346901:R174L	ENSP00000346901:R174L	R	+	2	0	FMO1	169514528	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.158000	0.58150	2.665000	0.90641	0.563000	0.77884	CGG	FMO1	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000010932		0.398	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1		0.00	43	0	G	NM_002021		171247904	+1			no_errors	ENST00000354841	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.963	T
FREM2	341640	genome.wustl.edu	37	13	39358714	39358714	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr13:39358714C>T	ENST00000280481.7	+	6	6004	c.5788C>T	c.(5788-5790)Ccg>Tcg	p.P1930S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1930	Calx-beta 2.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TGGAACTGTGCCGACTTCCGT	0.418																																																	0													108.0	99.0	102.0					13																	39358714		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5788C>T	13.37:g.39358714C>T	ENSP00000280481:p.Pro1930Ser		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.P1930S	ENST00000280481.7	37	c.5788	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526275	0.85600	.	.	ENSG00000150893	ENST00000280481	T	0.19669	2.13	6.02	6.02	0.97574	Na-Ca exchanger/integrin-beta4 (2);	0.052003	0.85682	D	0.000000	T	0.36799	0.0980	L	0.49350	1.555	0.80722	D	1	D;P	0.58620	0.983;0.954	P;P	0.56788	0.789;0.806	T	0.00655	-1.1624	10	0.19590	T	0.45	.	20.547	0.99278	0.0:1.0:0.0:0.0	.	1930;1930	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	S	1930	ENSP00000280481:P1930S	ENSP00000280481:P1930S	P	+	1	0	FREM2	38256714	1.000000	0.71417	0.996000	0.52242	0.923000	0.55619	7.731000	0.84895	2.850000	0.98022	0.650000	0.86243	CCG	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.418	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2		0.00	18	0	C	NM_207361		39358714	+1			no_errors	ENST00000280481	ensembl	human	known	74_37	missense	11.63	38	5	SNP	1.000	T
FSD1	79187	genome.wustl.edu	37	19	4323073	4323073	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:4323073G>T	ENST00000221856.6	+	11	1277	c.1130G>T	c.(1129-1131)aGc>aTc	p.S377I	STAP2_ENST00000597593.1_5'Flank|FSD1_ENST00000597590.1_Missense_Mutation_p.S377I	NM_024333.2	NP_077309.1	Q9BTV5	FSD1_HUMAN	fibronectin type III and SPRY domain containing 1	377	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.034)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCTACCGCAGCCTGGGCCGC	0.667																																																	0													33.0	31.0	32.0					19																	4323073		2203	4298	6501	SO:0001583	missense	0			AF316829	CCDS12127.1	19p13.3	2013-02-11	2005-03-01			ENSG00000105255		"""Fibronectin type III domain containing"""	13745	protein-coding gene	gene with protein product		609828	"""fibronectin type 3 and SPRY domain containing 1"""			11267680	Standard	NM_024333		Approved	MGC3213, MIR1	uc002lzy.2	Q9BTV5		ENST00000221856.6:c.1130G>T	19.37:g.4323073G>T	ENSP00000221856:p.Ser377Ile		B2RDT0|Q9BXN0|Q9HAG4	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.S377I	ENST00000221856.6	37	c.1130	CCDS12127.1	19	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288556	0.80914	.	.	ENSG00000105255	ENST00000221856	T	0.67171	-0.25	4.55	4.55	0.56014	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.106533	0.64402	D	0.000008	D	0.84229	0.5426	H	0.94886	3.595	0.41814	D	0.989982	D	0.55605	0.972	D	0.65010	0.931	D	0.87780	0.2611	10	0.72032	D	0.01	.	10.8478	0.46753	0.0:0.1923:0.8077:0.0	.	377	Q9BTV5	FSD1_HUMAN	I	377	ENSP00000221856:S377I	ENSP00000221856:S377I	S	+	2	0	FSD1	4274073	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.484000	0.45242	2.097000	0.63578	0.485000	0.47835	AGC	FSD1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000105255		0.667	FSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSD1	HGNC	protein_coding	OTTHUMT00000458091.1	-	0.00	56	0	G	NM_024333		4323073	+1	tier1	-	no_errors	ENST00000221856	ensembl	human	known	74_37	missense	26.32	42	15	SNP	1.000	T
GAB3	139716	genome.wustl.edu	37	X	153925438	153925438	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:153925438C>T	ENST00000369575.3	-	7	1424	c.1393G>A	c.(1393-1395)Gca>Aca	p.A465T	GAB3_ENST00000424127.2_Missense_Mutation_p.A466T|GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	465					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GTAAGAGATGCATGTTCCCGG	0.532																																																	0													147.0	123.0	131.0					X																	153925438		2203	4300	6503	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1393G>A	X.37:g.153925438C>T	ENSP00000358588:p.Ala465Thr		A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A466T	ENST00000369575.3	37	c.1396	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	C	1.869	-0.460774	0.04508	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.22945	1.93;1.93;1.93	5.1	-4.32	0.03688	.	0.563413	0.19097	N	0.122806	T	0.12944	0.0314	L	0.31752	0.955	0.09310	N	1	B;B;B	0.15141	0.012;0.004;0.012	B;B;B	0.15052	0.012;0.009;0.012	T	0.20472	-1.0274	10	0.22706	T	0.39	-17.99	7.2992	0.26411	0.1075:0.397:0.0:0.4955	.	466;466;465	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	T	465;466;466	ENSP00000358588:A465T;ENSP00000358581:A466T;ENSP00000399588:A466T	ENSP00000358581:A466T	A	-	1	0	GAB3	153578632	0.035000	0.19736	0.000000	0.03702	0.121000	0.20230	-0.054000	0.11826	-0.966000	0.03587	-0.191000	0.12829	GCA	GAB3	-	NULL	ENSG00000160219		0.532	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	-	0.00	47	0	C	NM_001081573		153925438	-1	tier1	-	no_errors	ENST00000424127	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.003	T
GABRB1	2560	genome.wustl.edu	37	4	47408862	47408862	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:47408862G>T	ENST00000295454.3	+	8	1291	c.999G>T	c.(997-999)ggG>ggT	p.G333G	GABRB1_ENST00000538619.1_Silent_p.G263G	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	333					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TCTTCTTTGGGAAAGGCCCTC	0.398																																																	0													146.0	142.0	144.0					4																	47408862		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.999G>T	4.37:g.47408862G>T			B2R6U7|D6REL3|Q16166|Q8TBK3	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.G333	ENST00000295454.3	37	c.999	CCDS3474.1	4																																																																																			GABRB1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000163288		0.398	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	-	0.00	36	0	G			47408862	+1	tier1	-	no_errors	ENST00000295454	ensembl	human	known	74_37	silent	7.69	47	4	SNP	0.750	T
GALNTL5	168391	genome.wustl.edu	37	7	151716773	151716773	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:151716773T>C	ENST00000392800.2	+	9	1473	c.1219T>C	c.(1219-1221)Tac>Cac	p.Y407H	GALNTL5_ENST00000431418.2_Missense_Mutation_p.Y407H	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	407					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		ATATGTCACCTACGGAAATAT	0.408																																																	0													108.0	105.0	106.0					7																	151716773		2203	4300	6503	SO:0001583	missense	0			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.1219T>C	7.37:g.151716773T>C	ENSP00000376548:p.Tyr407His		Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.Y407H	ENST00000392800.2	37	c.1219	CCDS5929.1	7	.	.	.	.	.	.	.	.	.	.	T	13.93	2.383634	0.42308	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59224	0.28;0.28	4.91	4.91	0.64330	.	0.323390	0.22777	N	0.055779	T	0.73249	0.3563	M	0.79343	2.45	0.35932	D	0.832608	D;D	0.76494	0.998;0.999	D;D	0.67231	0.927;0.95	T	0.81470	-0.0918	10	0.87932	D	0	.	10.8533	0.46782	0.0:0.0:0.0:1.0	.	158;407	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	H	407	ENSP00000392582:Y407H;ENSP00000376548:Y407H	ENSP00000376548:Y407H	Y	+	1	0	GALNTL5	151347706	0.961000	0.32948	0.012000	0.15200	0.037000	0.13140	4.458000	0.60095	2.041000	0.60428	0.528000	0.53228	TAC	GALNTL5	-	NULL	ENSG00000106648		0.408	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	HGNC	protein_coding	OTTHUMT00000348395.1	-	0.00	40	0	T	NM_145292		151716773	+1	tier1	-	no_errors	ENST00000392800	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.883	C
GCC2	9648	genome.wustl.edu	37	2	109087535	109087535	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:109087535G>T	ENST00000309863.6	+	6	2464	c.1750G>T	c.(1750-1752)Gaa>Taa	p.E584*		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	584					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						CATGTTAAAAGAATTAGAAGG	0.289																																																	0													25.0	28.0	27.0					2																	109087535		1990	4172	6162	SO:0001587	stop_gained	0			BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.1750G>T	2.37:g.109087535G>T	ENSP00000307939:p.Glu584*		A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Nonsense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,smart_GRIP,pfscan_GRIP	p.E584*	ENST00000309863.6	37	c.1750	CCDS33268.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.301424	0.97453	.	.	ENSG00000135968	ENST00000309863;ENST00000409896;ENST00000393318	.	.	.	5.62	5.62	0.85841	.	0.249011	0.39020	N	0.001486	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	20.0205	0.97499	0.0:0.0:1.0:0.0	.	.	.	.	X	584;547;329	.	ENSP00000307939:E584X	E	+	1	0	GCC2	108453967	1.000000	0.71417	0.995000	0.50966	0.928000	0.56348	6.157000	0.71846	2.801000	0.96364	0.650000	0.86243	GAA	GCC2	-	NULL	ENSG00000135968		0.289	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	GCC2	HGNC	protein_coding	OTTHUMT00000358516.3		0.00	35	0	G	NM_014635		109087535	+1			no_errors	ENST00000309863	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
GDI2	2665	genome.wustl.edu	37	10	5808472	5808472	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:5808472T>C	ENST00000380191.4	-	9	1411	c.1121A>G	c.(1120-1122)gAa>gGa	p.E374G	GDI2_ENST00000380132.4_Missense_Mutation_p.E378G|GDI2_ENST00000380181.3_Missense_Mutation_p.E329G|GDI2_ENST00000479928.1_5'UTR	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	374					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						TTCAATTGGTTCCAAGAGCTC	0.463																																																	0													122.0	114.0	116.0					10																	5808472		2203	4300	6503	SO:0001583	missense	0			D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.1121A>G	10.37:g.5808472T>C	ENSP00000369538:p.Glu374Gly		O43928|Q5SX88|Q9UQM6	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	p.E378G	ENST00000380191.4	37	c.1133	CCDS7071.1	10	.	.	.	.	.	.	.	.	.	.	T	2.411	-0.335431	0.05278	.	.	ENSG00000057608	ENST00000380191;ENST00000380132;ENST00000380181	D;D;D	0.84442	-1.85;-1.85;-1.85	5.83	5.83	0.93111	.	0.187516	0.56097	D	0.000027	T	0.68449	0.3002	N	0.05230	-0.09	0.58432	D	0.999996	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.65915	-0.6052	10	0.02654	T	1	-12.0258	15.862	0.79032	0.0:0.0:0.0:1.0	.	378;329;374	E7EU23;Q5SX88;P50395	.;.;GDIB_HUMAN	G	374;378;329	ENSP00000369538:E374G;ENSP00000369475:E378G;ENSP00000369528:E329G	ENSP00000369475:E378G	E	-	2	0	GDI2	5848478	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.005000	0.63972	2.227000	0.72691	0.528000	0.53228	GAA	GDI2	-	pfam_GDP_dissociation_inhibitor	ENSG00000057608		0.463	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI2	HGNC	protein_coding	OTTHUMT00000046580.1	-	0.00	51	0	T	NM_001494		5808472	-1	tier1	-	no_errors	ENST00000380132	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	C
GEMIN7	79760	genome.wustl.edu	37	19	45593410	45593410	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:45593410G>A	ENST00000270257.4	+	3	285	c.38G>A	c.(37-39)cGg>cAg	p.R13Q	CTB-179K24.3_ENST00000586556.1_RNA|PPP1R37_ENST00000421905.1_5'Flank|PPP1R37_ENST00000221462.4_5'Flank|GEMIN7_ENST00000391951.2_Missense_Mutation_p.R13Q|GEMIN7_ENST00000591747.1_Missense_Mutation_p.R13Q|GEMIN7_ENST00000591607.1_Missense_Mutation_p.R13Q|CTB-179K24.3_ENST00000586744.1_RNA	NM_001007269.1|NM_001007270.1|NM_024707.2	NP_001007270.1|NP_001007271.1|NP_078983.1	Q9H840	GEMI7_HUMAN	gem (nuclear organelle) associated protein 7	13					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				endometrium(1)|kidney(1)|lung(4)|ovary(1)	7		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0131)		CCTGTGCTCCGGCTGCCCCGG	0.557																																																	0													83.0	92.0	89.0					19																	45593410		2202	4298	6500	SO:0001583	missense	0			AK024018	CCDS12654.1	19q13.32	2008-02-05				ENSG00000142252			20045	protein-coding gene	gene with protein product		607419				12065586	Standard	NM_024707		Approved	FLJ13956	uc002pap.1	Q9H840		ENST00000270257.4:c.38G>A	19.37:g.45593410G>A	ENSP00000270257:p.Arg13Gln		Q6IA34	Missense_Mutation	SNP	pfam_SMN_gemin7	p.R13Q	ENST00000270257.4	37	c.38	CCDS12654.1	19	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048857	0.75846	.	.	ENSG00000142252	ENST00000270257;ENST00000391951	.	.	.	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.78194	0.4245	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80783	-0.1228	9	0.72032	D	0.01	-1.6605	15.8965	0.79338	0.0:0.0:1.0:0.0	.	13	Q9H840	GEMI7_HUMAN	Q	13	.	ENSP00000270257:R13Q	R	+	2	0	GEMIN7	50285250	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	8.054000	0.89451	2.353000	0.79882	0.549000	0.68633	CGG	GEMIN7	-	NULL	ENSG00000142252		0.557	GEMIN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN7	HGNC	protein_coding	OTTHUMT00000457533.1	-	0.00	85	0	G			45593410	+1	tier1	-	no_errors	ENST00000270257	ensembl	human	known	74_37	missense	42.86	48	36	SNP	1.000	A
GLRB	2743	genome.wustl.edu	37	4	158073901	158073901	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:158073901G>T	ENST00000264428.4	+	9	1206	c.936G>T	c.(934-936)gaG>gaT	p.E312D	GLRB_ENST00000512619.1_Intron|GLRB_ENST00000509282.1_Missense_Mutation_p.E312D|GLRB_ENST00000541722.1_Intron	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	312					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TGGCCTCTGAGTGCACAACCC	0.463																																																	0													195.0	189.0	191.0					4																	158073901		2203	4300	6503	SO:0001583	missense	0			U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.936G>T	4.37:g.158073901G>T	ENSP00000264428:p.Glu312Asp		A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Glycine_rcpt_B,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E312D	ENST00000264428.4	37	c.936	CCDS3796.1	4	.	.	.	.	.	.	.	.	.	.	G	16.49	3.138178	0.56936	.	.	ENSG00000109738	ENST00000264428;ENST00000509282	D;D	0.85484	-1.99;-1.99	5.61	4.65	0.58169	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.150830	0.64402	D	0.000015	D	0.84447	0.5474	L	0.31065	0.9	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	D	0.83710	0.0187	10	0.62326	D	0.03	.	3.6539	0.08213	0.3447:0.0:0.6553:0.0	.	312	P48167	GLRB_HUMAN	D	312	ENSP00000264428:E312D;ENSP00000427186:E312D	ENSP00000264428:E312D	E	+	3	2	GLRB	158293351	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	2.708000	0.47152	2.642000	0.89623	0.650000	0.86243	GAG	GLRB	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000109738		0.463	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRB	HGNC	protein_coding	OTTHUMT00000366507.1	-	0.00	58	0	G	NM_000824		158073901	+1	tier1	-	no_errors	ENST00000264428	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
GOLGA3	2802	genome.wustl.edu	37	12	133351713	133351713	+	Intron	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:133351713G>A	ENST00000450791.2	-	21	4327				GOLGA3_ENST00000456883.2_Missense_Mutation_p.A1386V|GOLGA3_ENST00000204726.3_Intron			Q08378	GOGA3_HUMAN	golgin A3						intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CGGGAGGGACGCGGGCCTGAG	0.602																																																	0													38.0	37.0	37.0					12																	133351713		2203	4300	6503	SO:0001627	intron_variant	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.4143+13C>T	12.37:g.133351713G>A			A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.A1386V	ENST00000450791.2	37	c.4157	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	10.19	1.281094	0.23392	.	.	ENSG00000090615	ENST00000456883	T	0.22945	1.93	4.75	-9.51	0.00581	.	.	.	.	.	T	0.10035	0.0246	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.18461	-1.0336	8	0.27082	T	0.32	.	1.7854	0.03040	0.3399:0.3641:0.1151:0.1808	.	1386	Q08378-2	.	V	1386	ENSP00000409303:A1386V	ENSP00000409303:A1386V	A	-	2	0	GOLGA3	131861786	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.509000	0.00447	-2.702000	0.00398	0.655000	0.94253	GCG	GOLGA3	-	NULL	ENSG00000090615		0.602	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	17	0	G	NM_005895		133351713	-1	tier1	-	no_errors	ENST00000456883	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.000	A
GPR132	29933	genome.wustl.edu	37	14	105518385	105518385	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr14:105518385G>T	ENST00000329797.3	-	4	1000	c.89C>A	c.(88-90)gCc>gAc	p.A30D	GPR132_ENST00000392585.2_Missense_Mutation_p.A21D|GPR132_ENST00000539291.2_Missense_Mutation_p.A30D|GPR132_ENST00000546679.1_5'UTR	NM_001278694.1|NM_001278696.1|NM_013345.2	NP_001265623.1|NP_001265625.1|NP_037477.1	Q9UNW8	GP132_HUMAN	G protein-coupled receptor 132	30					G1/S transition of mitotic cell cycle (GO:0000082)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	18		all_cancers(154;0.0953)|Melanoma(154;0.155)|all_epithelial(191;0.219)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.02)|all cancers(159;0.0419)|OV - Ovarian serous cystadenocarcinoma(161;0.0521)		GCAGGTCTTGGCGGAGAGGCC	0.637																																																	0													57.0	62.0	60.0					14																	105518385		2203	4300	6503	SO:0001583	missense	0			AF083955	CCDS9997.1, CCDS61567.1	14q32.3	2012-08-21			ENSG00000183484	ENSG00000183484		"""GPCR / Class A : Orphans"""	17482	protein-coding gene	gene with protein product	"""G2 accumulation"""	606167				12086852	Standard	NM_013345		Approved	G2A	uc001yqd.3	Q9UNW8	OTTHUMG00000140173	ENST00000329797.3:c.89C>A	14.37:g.105518385G>T	ENSP00000328818:p.Ala30Asp		A8K7X7|B4E144|Q9BSU2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_G2A_lysphc_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A30D	ENST00000329797.3	37	c.89	CCDS9997.1	14	.	.	.	.	.	.	.	.	.	.	G	10.25	1.298078	0.23650	.	.	ENSG00000183484	ENST00000329797;ENST00000392585;ENST00000539291	T;T;T	0.36340	1.26;1.27;1.26	3.1	-0.615	0.11587	.	2.198330	0.02041	N	0.049272	T	0.19805	0.0476	N	0.14661	0.345	0.09310	N	1	B;B	0.24823	0.112;0.089	B;B	0.18871	0.016;0.023	T	0.10800	-1.0614	10	0.12430	T	0.62	.	5.6478	0.17598	0.0:0.4161:0.3723:0.2116	.	21;30	B4E144;Q9UNW8	.;GP132_HUMAN	D	30;21;30	ENSP00000328818:A30D;ENSP00000376364:A21D;ENSP00000438094:A30D	ENSP00000328818:A30D	A	-	2	0	GPR132	104589430	0.020000	0.18652	0.000000	0.03702	0.014000	0.08584	2.095000	0.41729	0.096000	0.17463	0.313000	0.20887	GCC	GPR132	-	NULL	ENSG00000183484		0.637	GPR132-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR132	HGNC	protein_coding	OTTHUMT00000409278.1		0.00	50	0	G	NM_013345		105518385	-1			no_errors	ENST00000329797	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.000	T
GPR26	2849	genome.wustl.edu	37	10	125426291	125426291	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:125426291C>T	ENST00000284674.1	+	1	421	c.368C>T	c.(367-369)gCg>gTg	p.A123V		NM_153442.3	NP_703143.1	Q8NDV2	GPR26_HUMAN	G protein-coupled receptor 26	123					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	20		Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)				CTCCGCGACGCGGCGCTCATG	0.701																																																	0													10.0	11.0	10.0					10																	125426291		2185	4277	6462	SO:0001583	missense	0				CCDS7636.1	10q26.2-q26.3	2012-08-21			ENSG00000154478	ENSG00000154478		"""GPCR / Class A : Orphans"""	4481	protein-coding gene	gene with protein product		604847					Standard	NM_153442		Approved		uc001lhh.3	Q8NDV2	OTTHUMG00000019204	ENST00000284674.1:c.368C>T	10.37:g.125426291C>T	ENSP00000284674:p.Ala123Val		Q2M2E2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A123V	ENST00000284674.1	37	c.368	CCDS7636.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.203812	0.95033	.	.	ENSG00000154478	ENST00000284674	T	0.40225	1.04	4.11	4.11	0.48088	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.62073	0.2398	M	0.76002	2.32	0.80722	D	1	D	0.76494	0.999	D	0.65573	0.936	T	0.63497	-0.6624	10	0.34782	T	0.22	-22.085	16.5501	0.84470	0.0:1.0:0.0:0.0	.	123	Q8NDV2	GPR26_HUMAN	V	123	ENSP00000284674:A123V	ENSP00000284674:A123V	A	+	2	0	GPR26	125416281	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.537000	0.82033	2.125000	0.65367	0.655000	0.94253	GCG	GPR26	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000154478		0.701	GPR26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR26	HGNC	protein_coding	OTTHUMT00000050850.1	-	0.00	13	0	C			125426291	+1	tier1	-	no_errors	ENST00000284674	ensembl	human	known	74_37	missense	47.62	11	10	SNP	1.000	T
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664015	+	RNA	SNP	C	C	G	rs202030378|rs372212945	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:72664015C>G	ENST00000425256.1	-	0	885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCC	0.507																																																	0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664015C>G				RNA	SNP	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.507	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1		0.00	12	0	C	NR_002164		72664015	-1			no_errors	ENST00000425256	ensembl	human	known	74_37	rna	35.71	9	5	SNP	0.912	G
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG				RNA	INS	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1		0.00	12	0	0	NR_002164		72664016	-1			no_errors	ENST00000425256	ensembl	human	known	74_37	rna	21.43	11	3	INS	0.912:0.964	G
HDGFL1	154150	genome.wustl.edu	37	6	22570346	22570347	+	In_Frame_Ins	INS	-	-	GGC	rs370190435|rs536582109	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:22570346_22570347insGGC	ENST00000230012.3	+	1	669_670	c.542_543insGGC	c.(541-546)agggcg>agGGCggcg	p.188_189insA	HDGFL1_ENST00000510882.2_In_Frame_Ins_p.188_189insA	NM_138574.2	NP_612641.2	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	188	Ala-rich.|Glu-rich.									kidney(1)|large_intestine(3)|lung(7)	11	Ovarian(93;0.163)					gaagcggagagggcggcggcgg	0.767														170	0.0339457	0.0182	0.049	5008	,	,		12340	0.0159		0.0547	False		,,,				2504	0.0419																0																																										SO:0001652	inframe_insertion	0			AK056824	CCDS34347.1	6p22.2	2008-02-05	2005-04-07	2005-04-07	ENSG00000112273	ENSG00000112273			21095	protein-coding gene	gene with protein product			"""PWWP domain containing 1"""	PWWP1			Standard	NM_138574		Approved	dJ309H15.1	uc003nds.3	Q5TGJ6	OTTHUMG00000016206	ENST00000230012.3:c.561_563dupGGC	6.37:g.22570353_22570355dupGGC	ENSP00000230012:p.Ala189_Ala190dup		Q96MJ6	In_Frame_Ins	INS	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	p.185in_frame_insA	ENST00000230012.3	37	c.542_543	CCDS34347.1	6																																																																																			HDGFL1	-	NULL	ENSG00000112273		0.767	HDGFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGFL1	HGNC	protein_coding	OTTHUMT00000043500.1		0.00	13	0	-	NM_138574		22570347	+1	tier1		no_errors	ENST00000230012	ensembl	human	known	74_37	in_frame_ins	40.00	6	4	INS	0.000:0.000	GGC
HDLBP	3069	genome.wustl.edu	37	2	242170211	242170211	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:242170211C>T	ENST00000391975.1	-	25	3664	c.3437G>A	c.(3436-3438)cGc>cAc	p.R1146H	HDLBP_ENST00000310931.4_Missense_Mutation_p.R1146H|HDLBP_ENST00000427183.2_Missense_Mutation_p.R1113H|HDLBP_ENST00000391976.2_Missense_Mutation_p.R1146H	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	1146	KH 14. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		GGCTTTGCCGCGGGCACCAAT	0.587																																																	0													118.0	92.0	101.0					2																	242170211		2203	4300	6503	SO:0001583	missense	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.3437G>A	2.37:g.242170211C>T	ENSP00000375836:p.Arg1146His		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.R1146H	ENST00000391975.1	37	c.3437	CCDS2547.1	2	.	.	.	.	.	.	.	.	.	.	C	15.82	2.945546	0.53079	.	.	ENSG00000115677	ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000442730	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.53	1.76	0.24704	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.048348	0.85682	N	0.000000	T	0.52075	0.1712	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.951;0.993	T	0.48758	-0.9007	10	0.87932	D	0	-7.4633	7.0424	0.25027	0.1223:0.6818:0.0:0.1959	.	1113;1146	E7EM71;Q00341	.;VIGLN_HUMAN	H	1146;1146;1146;1113;10	ENSP00000375836:R1146H;ENSP00000375837:R1146H;ENSP00000312042:R1146H;ENSP00000399139:R1113H;ENSP00000411211:R10H	ENSP00000312042:R1146H	R	-	2	0	HDLBP	241818884	1.000000	0.71417	0.000000	0.03702	0.003000	0.03518	7.613000	0.82986	0.055000	0.16094	-0.156000	0.13503	CGC	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.587	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5	-	0.00	59	0	C	NM_203346		242170211	-1	tier1	-	no_errors	ENST00000310931	ensembl	human	known	74_37	missense	16.07	47	9	SNP	0.951	T
HGFAC	3083	genome.wustl.edu	37	4	3443800	3443800	+	Silent	SNP	G	G	C	rs372137428		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:3443800G>C	ENST00000382774.3	+	1	187	c.72G>C	c.(70-72)ctG>ctC	p.L24L	HGFAC_ENST00000511533.1_Silent_p.L24L	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	24					proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		TCCTCCTCCTGCTGCTGCTGC	0.716													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13355	0.0		0.0	False		,,,				2504	0.0																0								G		5,3433		0,5,1714	13.0	16.0	15.0		72	0.1	1.0	4		15	0,7164		0,0,3582	no	coding-synonymous	HGFAC	NM_001528.2		0,5,5296	CC,CG,GG		0.0,0.1454,0.0472		24/656	3443800	5,10597	1719	3582	5301	SO:0001819	synonymous_variant	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.72G>C	4.37:g.3443800G>C			Q14726|Q2M1W7|Q53X47	Silent	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EG-like_dom,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L24	ENST00000382774.3	37	c.72	CCDS3369.1	4																																																																																			HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA	ENSG00000109758		0.716	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3	-	0.00	37	0	G			3443800	+1	tier1	-	no_errors	ENST00000382774	ensembl	human	known	74_37	silent	10.71	50	6	SNP	0.998	C
HIBCH	26275	genome.wustl.edu	37	2	191175496	191175496	+	Missense_Mutation	SNP	G	G	T	rs542648871		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:191175496G>T	ENST00000359678.5	-	2	356	c.62C>A	c.(61-63)aCc>aAc	p.T21N	HIBCH_ENST00000392332.3_Missense_Mutation_p.T21N	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	21					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			GTGCAGTATGGTATTAGTCCT	0.333																																																	0													169.0	145.0	153.0					2																	191175496		2203	4300	6503	SO:0001583	missense	0			U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.62C>A	2.37:g.191175496G>T	ENSP00000352706:p.Thr21Asn		D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	pfam_Crotonase_core_superfam	p.T21N	ENST00000359678.5	37	c.62	CCDS2304.1	2	.	.	.	.	.	.	.	.	.	.	G	4.264	0.048018	0.08243	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.58060	0.37;0.36;0.36	4.17	1.58	0.23477	.	1.887440	0.02038	N	0.049043	T	0.48572	0.1507	L	0.61218	1.895	0.49582	D	0.9998	B;B	0.19935	0.028;0.04	B;B	0.22386	0.039;0.026	T	0.35549	-0.9784	10	0.18276	T	0.48	-13.2588	3.5661	0.07900	0.7017:0.0:0.1058:0.1925	.	21;21	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	N	21;21;75	ENSP00000376144:T21N;ENSP00000352706:T21N;ENSP00000387247:T75N	ENSP00000352706:T21N	T	-	2	0	HIBCH	190883741	0.466000	0.25823	0.565000	0.28409	0.994000	0.84299	0.800000	0.27042	0.380000	0.24823	-0.300000	0.09419	ACC	HIBCH	-	NULL	ENSG00000198130		0.333	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIBCH	HGNC	protein_coding	OTTHUMT00000255933.1		0.00	78	0	G			191175496	-1			no_errors	ENST00000359678	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.676	T
HLA-B	3106	genome.wustl.edu	37	6	31323325	31323325	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:31323325C>A	ENST00000412585.2	-	4	692	c.664G>T	c.(664-666)Gag>Tag	p.E222*		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	222	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						AGGGTGGCCTCATGGTCAGAG	0.577									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0													83.0	85.0	85.0					6																	31323325		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.664G>T	6.37:g.31323325C>A	ENSP00000399168:p.Glu222*		Q29764	Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.E222*	ENST00000412585.2	37	c.664	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	N	19.69	3.873956	0.72180	.	.	ENSG00000234745	ENST00000412585;ENST00000428231;ENST00000452596;ENST00000434333	.	.	.	3.16	-0.179	0.13299	.	0.494102	0.15702	U	0.248898	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.8306	0.13437	0.0:0.4273:0.437:0.1357	.	.	.	.	X	222;101;101;233	.	ENSP00000399168:E222X	E	-	1	0	HLA-B	31431304	0.001000	0.12720	0.071000	0.20095	0.581000	0.36288	0.031000	0.13710	0.169000	0.19679	0.442000	0.29010	GAG	HLA-B	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000234745		0.577	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	-	0.00	92	0	C	NM_005514		31323325	-1	tier1	-	no_errors	ENST00000412585	ensembl	human	known	74_37	nonsense	32.48	79	38	SNP	0.028	A
HTRA3	94031	genome.wustl.edu	37	4	8295892	8295892	+	Missense_Mutation	SNP	C	C	T	rs377511028		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:8295892C>T	ENST00000307358.2	+	6	1219	c.1015C>T	c.(1015-1017)Cgg>Tgg	p.R339W	HTRA3_ENST00000382512.3_Missense_Mutation_p.R339W	NM_053044.3	NP_444272.1	P83110	HTRA3_HUMAN	HtrA serine peptidase 3	339	Serine protease.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|prostate(1)|urinary_tract(1)	18						CCGCATCACACGGTTCCTCAC	0.587																																																	0								C	TRP/ARG	0,4406		0,0,2203	118.0	82.0	94.0		1015	3.3	1.0	4		94	1,8597	1.2+/-3.3	0,1,4298	no	missense	HTRA3	NM_053044.3	101	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	339/454	8295892	1,13003	2203	4299	6502	SO:0001583	missense	0			AY040094	CCDS3400.1, CCDS75105.1	4p16.1	2008-02-05			ENSG00000170801	ENSG00000170801			30406	protein-coding gene	gene with protein product	"""pregnancy-related serine protease"""	608785				12513693, 14500695	Standard	XM_005248040		Approved	Tasp, Prsp	uc003gla.3	P83110	OTTHUMG00000090561	ENST00000307358.2:c.1015C>T	4.37:g.8295892C>T	ENSP00000303766:p.Arg339Trp		Q7Z7A2	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Kazal_dom,pfam_PDZ,superfamily_Trypsin-like_Pept_dom,superfamily_PDZ,smart_IGFBP-like,smart_Kazal_dom,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.R339W	ENST00000307358.2	37	c.1015	CCDS3400.1	4	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066484	0.36470	0.0	1.16E-4	ENSG00000170801	ENST00000307358;ENST00000382512	T;T	0.15718	2.4;2.4	3.33	3.33	0.38152	Peptidase cysteine/serine, trypsin-like (1);	0.347493	0.26895	U	0.021944	T	0.20129	0.0484	N	0.24115	0.695	0.26786	N	0.96951	D;D	0.76494	0.995;0.999	P;P	0.56916	0.462;0.809	T	0.02378	-1.1168	10	0.87932	D	0	-8.5824	10.1306	0.42676	0.2003:0.7997:0.0:0.0	.	339;339	P83110;P83110-2	HTRA3_HUMAN;.	W	339	ENSP00000303766:R339W;ENSP00000371952:R339W	ENSP00000303766:R339W	R	+	1	2	HTRA3	8346792	0.090000	0.21635	0.964000	0.40570	0.055000	0.15305	2.643000	0.46604	1.410000	0.46936	0.313000	0.20887	CGG	HTRA3	-	superfamily_Trypsin-like_Pept_dom	ENSG00000170801		0.587	HTRA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA3	HGNC	protein_coding	OTTHUMT00000092669.1		0.00	38	0	C	NM_053044		8295892	+1			no_errors	ENST00000307358	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.360	T
HYOU1	10525	genome.wustl.edu	37	11	118925330	118925330	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:118925330C>T	ENST00000404233.3	-	7	678	c.554G>A	c.(553-555)cGc>cAc	p.R185H	HYOU1_ENST00000543287.1_Missense_Mutation_p.R98H|HYOU1_ENST00000525859.1_Missense_Mutation_p.R185H|HYOU1_ENST00000529972.1_Missense_Mutation_p.R185H	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	185					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CACAGCTCGGCGCTCGGCCTG	0.587																																																	0													67.0	61.0	63.0					11																	118925330		2200	4295	6495	SO:0001583	missense	0			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.554G>A	11.37:g.118925330C>T	ENSP00000384144:p.Arg185His		A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.R185H	ENST00000404233.3	37	c.554	CCDS8408.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.488260	0.96323	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.03242	4.0;4.0;4.0;4.0;4.0	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.31263	0.0791	H	0.96015	3.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.51926	-0.8643	10	0.87932	D	0	-10.0695	18.7741	0.91902	0.0:1.0:0.0:0.0	.	176;229;185;185	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	H	185;176;185;185;34;185;228;98;185	ENSP00000384144:R185H;ENSP00000437313:R185H;ENSP00000433397:R185H;ENSP00000442727:R98H;ENSP00000431874:R185H	ENSP00000278752:R176H	R	-	2	0	HYOU1	118430540	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.417000	0.80156	2.430000	0.82344	0.557000	0.71058	CGC	HYOU1	-	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	ENSG00000149428		0.587	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1	-	0.00	35	0	C	NM_006389		118925330	-1	tier1	-	no_errors	ENST00000404233	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
IFI44L	10964	genome.wustl.edu	37	1	79093944	79093944	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:79093944G>T	ENST00000370751.5	+	2	523	c.344G>T	c.(343-345)cGt>cTt	p.R115L	IFI44L_ENST00000476521.1_Intron|IFI44L_ENST00000342282.3_Intron	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	115					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CTGGTGTGTCGTTTATCGAAA	0.308																																																	0													43.0	44.0	43.0					1																	79093944		2203	4296	6499	SO:0001583	missense	0			AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.344G>T	1.37:g.79093944G>T	ENSP00000359787:p.Arg115Leu		Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R115L	ENST00000370751.5	37	c.344	CCDS687.2	1	.	.	.	.	.	.	.	.	.	.	G	3.584	-0.084933	0.07097	.	.	ENSG00000137959	ENST00000370751;ENST00000450498	T;T	0.13901	3.13;2.55	3.59	-4.89	0.03103	.	3.159790	0.01371	N	0.012599	T	0.01592	0.0051	N	0.22421	0.69	0.09310	N	1	B	0.20052	0.041	B	0.17979	0.02	T	0.35871	-0.9771	10	0.11485	T	0.65	.	0.4702	0.00530	0.3041:0.1388:0.2844:0.2727	.	115	Q53G44	IF44L_HUMAN	L	115;92	ENSP00000359787:R115L;ENSP00000400784:R92L	ENSP00000359787:R115L	R	+	2	0	IFI44L	78866532	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.281000	0.08456	-1.101000	0.03027	-0.474000	0.04947	CGT	IFI44L	-	NULL	ENSG00000137959		0.308	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44L	HGNC	protein_coding	OTTHUMT00000026834.3		0.00	58	0	G	NM_006820		79093944	+1			no_errors	ENST00000370751	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.000	T
IFNGR1	3459	genome.wustl.edu	37	6	137522074	137522074	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:137522074delA	ENST00000367739.4	-	6	926	c.805delT	c.(805-807)tatfs	p.Y269fs	IFNGR1_ENST00000543628.1_Frame_Shift_Del_p.Y241fs	NM_000416.2	NP_000407.1	P15260	INGR1_HUMAN	interferon gamma receptor 1	269					cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)|signal transduction (GO:0007165)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|vesicle (GO:0031982)	interferon-gamma receptor activity (GO:0004906)			central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	18	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTCTTAATATAAAAACAGATG	0.294																																																	0													36.0	37.0	37.0					6																	137522074		2203	4297	6500	SO:0001589	frameshift_variant	0				CCDS5185.1	6q23-q24	2014-09-17			ENSG00000027697	ENSG00000027697		"""Interferons"", ""CD molecules"""	5439	protein-coding gene	gene with protein product		107470		IFNGR			Standard	NM_000416		Approved	CD119	uc003qho.2	P15260	OTTHUMG00000015656	ENST00000367739.4:c.805delT	6.37:g.137522074delA	ENSP00000356713:p.Tyr269fs		B4DFT7|E1P587|Q53Y96	Frame_Shift_Del	DEL	pfam_Interferon_gamma_pox/mammal,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,prints_Interferon_gamma_rcpt_asu	p.Y269fs	ENST00000367739.4	37	c.805	CCDS5185.1	6																																																																																			IFNGR1	-	pfam_Interferon_gamma_pox/mammal	ENSG00000027697		0.294	IFNGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR1	HGNC	protein_coding	OTTHUMT00000042401.1		0.00	46	0	A			137522074	-1	tier1		no_errors	ENST00000367739	ensembl	human	known	74_37	frame_shift_del	47.06	27	24	DEL	0.000	-
IL7	3574	genome.wustl.edu	37	8	79710313	79710313	+	Silent	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:79710313T>C	ENST00000263851.4	-	2	741	c.141A>G	c.(139-141)caA>caG	p.Q47Q	IL7_ENST00000379113.2_Silent_p.Q47Q|IL7_ENST00000520269.1_Silent_p.Q47Q	NM_000880.3|NM_001199886.1|NM_001199887.1	NP_000871.1|NP_001186815.1|NP_001186816.1	P13232	IL7_HUMAN	interleukin 7	47					bone resorption (GO:0045453)|cell-cell signaling (GO:0007267)|homeostasis of number of cells within a tissue (GO:0048873)|humoral immune response (GO:0006959)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|organ morphogenesis (GO:0009887)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T cell differentiation (GO:0045582)|regulation of gene expression (GO:0010468)|T cell lineage commitment (GO:0002360)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|interleukin-7 receptor binding (GO:0005139)			endometrium(2)|large_intestine(2)|lung(1)	5						ATACCAATAATTGATCGATGC	0.338																																																	0													137.0	126.0	130.0					8																	79710313		2203	4300	6503	SO:0001819	synonymous_variant	0			J04156	CCDS6224.1, CCDS56541.1, CCDS75755.1, CCDS75756.1	8q12-q13	2008-07-03				ENSG00000104432		"""Interleukins and interleukin receptors"""	6023	protein-coding gene	gene with protein product		146660					Standard	NM_000880		Approved	IL-7	uc003ybg.3	P13232		ENST00000263851.4:c.141A>G	8.37:g.79710313T>C			A0N0L3|Q5FBY5|Q5FBY9	Silent	SNP	pfam_IL-7/IL-9_fam,smart_IL-7,pirsf_IL-7,prints_IL-7	p.Q47	ENST00000263851.4	37	c.141	CCDS6224.1	8																																																																																			IL7	-	pfam_IL-7/IL-9_fam,smart_IL-7,pirsf_IL-7,prints_IL-7	ENSG00000104432		0.338	IL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7	HGNC	protein_coding	OTTHUMT00000379429.1	-	0.00	22	0	T			79710313	-1	tier1	-	no_errors	ENST00000263851	ensembl	human	known	74_37	silent	20.00	28	7	SNP	0.005	C
IRS4	8471	genome.wustl.edu	37	X	107976167	107976167	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:107976167C>T	ENST00000372129.2	-	1	3484	c.3408G>A	c.(3406-3408)gcG>gcA	p.A1136A	RP6-24A23.6_ENST00000563887.1_5'Flank	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	1136	Ala-rich.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GCGCGGAGGCCGCAGCTACAA	0.642																																																	0													30.0	35.0	34.0					X																	107976167		2196	4283	6479	SO:0001819	synonymous_variant	0			AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.3408G>A	X.37:g.107976167C>T				Silent	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1,prints_Insln_rcpt_S1	p.A1136	ENST00000372129.2	37	c.3408	CCDS14544.1	X																																																																																			IRS4	-	NULL	ENSG00000133124		0.642	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS4	HGNC	protein_coding	OTTHUMT00000057879.1	-	0.00	42	0	C	NM_003604		107976167	-1	tier1	-	no_errors	ENST00000372129	ensembl	human	known	74_37	silent	24.44	34	11	SNP	0.019	T
ITGA9	3680	genome.wustl.edu	37	3	37821442	37821442	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:37821442G>T	ENST00000264741.5	+	25	2973	c.2717G>T	c.(2716-2718)aGt>aTt	p.S906I	AC093415.2_ENST00000438136.1_RNA	NM_002207.2	NP_002198.2	Q13797	ITA9_HUMAN	integrin, alpha 9	906					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|neutrophil chemotaxis (GO:0030593)|wound healing (GO:0042060)	basal plasma membrane (GO:0009925)|integrin alpha9-beta1 complex (GO:0034679)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(17)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|urinary_tract(1)	44				KIRC - Kidney renal clear cell carcinoma(284;0.165)|Kidney(284;0.197)		TGTAACTTTAGTGCTCTTGCT	0.373																																																	0													121.0	121.0	121.0					3																	37821442		2203	4300	6503	SO:0001583	missense	0			L24158	CCDS2669.1	3p21.3	2010-03-23			ENSG00000144668	ENSG00000144668		"""Integrins"""	6145	protein-coding gene	gene with protein product	"""integrin, alpha 4-like"""	603963				8245132, 8290272	Standard	NM_002207		Approved	RLC, ITGA4L, ALPHA-RLC	uc003chd.3	Q13797	OTTHUMG00000130815	ENST00000264741.5:c.2717G>T	3.37:g.37821442G>T	ENSP00000264741:p.Ser906Ile		Q14638	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.S906I	ENST00000264741.5	37	c.2717	CCDS2669.1	3	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744103	0.89663	.	.	ENSG00000144668	ENST00000264741	T	0.50277	0.75	5.91	5.91	0.95273	.	0.129143	0.64402	D	0.000001	T	0.50582	0.1624	L	0.51422	1.61	0.58432	D	0.999999	P	0.34909	0.475	B	0.38921	0.285	T	0.51132	-0.8744	10	0.66056	D	0.02	.	19.07	0.93130	0.0:0.0:1.0:0.0	.	906	Q13797	ITA9_HUMAN	I	906	ENSP00000264741:S906I	ENSP00000264741:S906I	S	+	2	0	ITGA9	37796446	1.000000	0.71417	0.907000	0.35723	0.996000	0.88848	6.592000	0.74095	2.793000	0.96121	0.655000	0.94253	AGT	ITGA9	-	NULL	ENSG00000144668		0.373	ITGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA9	HGNC	protein_coding	OTTHUMT00000253361.1		0.00	25	0	G	NM_002207		37821442	+1			no_errors	ENST00000264741	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
KCNAB2	8514	genome.wustl.edu	37	1	6157447	6157447	+	Intron	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:6157447G>T	ENST00000164247.1	+	15	1578				KCNAB2_ENST00000341524.1_Intron|KCNAB2_ENST00000378083.3_Intron|KCNAB2_ENST00000378097.1_Intron|KCNAB2_ENST00000458166.2_Intron|KCNAB2_ENST00000378092.1_Intron|KCNAB2_ENST00000378087.3_Intron|KCNAB2_ENST00000602612.1_Missense_Mutation_p.R348S|KCNAB2_ENST00000378111.1_Intron|KCNAB2_ENST00000352527.1_Intron	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2						hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		CTGGGCAGAGGGCCCATCCCA	0.637																																																	0													36.0	30.0	32.0					1																	6157447		2020	4018	6038	SO:0001627	intron_variant	0			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.1014+30G>T	1.37:g.6157447G>T			A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB2,prints_K_chnl_volt-dep_bsu_KCNAB1,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.R348S	ENST00000164247.1	37	c.1044	CCDS55.1	1																																																																																			KCNAB2	-	NULL	ENSG00000069424		0.637	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	HGNC	protein_coding	OTTHUMT00000002114.3	-	0.00	44	0	G	NM_172130		6157447	+1	tier1	-	no_errors	ENST00000602612	ensembl	human	putative	74_37	missense	8.51	43	4	SNP	0.007	T
KCNB2	9312	genome.wustl.edu	37	8	73480515	73480515	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:73480515G>T	ENST00000523207.1	+	2	1134	c.546G>T	c.(544-546)ttG>ttT	p.L182F		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	182					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	TGTGGGACTTGCTGGAGAAAC	0.468																																																	0													82.0	88.0	86.0					8																	73480515		2201	4300	6501	SO:0001583	missense	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.546G>T	8.37:g.73480515G>T	ENSP00000430846:p.Leu182Phe		Q7Z7D0|Q9BXD3	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.L182F	ENST00000523207.1	37	c.546	CCDS6209.1	8	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332263	0.41297	.	.	ENSG00000182674	ENST00000523207	D	0.97888	-4.59	5.77	4.89	0.63831	.	0.430727	0.14357	U	0.324710	D	0.96620	0.8897	M	0.72479	2.2	0.49798	D	0.999822	B	0.23854	0.092	B	0.30105	0.111	D	0.95228	0.8340	10	0.62326	D	0.03	.	9.4993	0.39008	0.0715:0.0:0.7844:0.1441	.	182	Q92953	KCNB2_HUMAN	F	182	ENSP00000430846:L182F	ENSP00000430846:L182F	L	+	3	2	KCNB2	73643069	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.946000	0.49050	1.541000	0.49316	0.655000	0.94253	TTG	KCNB2	-	prints_K_chnl_volt-dep_Kv2	ENSG00000182674		0.468	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	-	0.00	39	0	G	NM_004770		73480515	+1	tier1	-	no_errors	ENST00000523207	ensembl	human	known	74_37	missense	27.03	54	20	SNP	1.000	T
KDM3A	55818	genome.wustl.edu	37	2	86705840	86705840	+	Silent	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:86705840A>G	ENST00000409556.1	+	16	2663	c.2298A>G	c.(2296-2298)tcA>tcG	p.S766S	KDM3A_ENST00000542128.1_Silent_p.S714S|KDM3A_ENST00000312912.5_Silent_p.S766S|KDM3A_ENST00000409064.1_Silent_p.S766S			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	766					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						AGCCAGCCTCAAAGGAAGACC	0.363																																					NSCLC(96;1150 1523 6936 46253 49736)												0													98.0	88.0	92.0					2																	86705840		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.2298A>G	2.37:g.86705840A>G			D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S766	ENST00000409556.1	37	c.2298	CCDS1990.1	2																																																																																			KDM3A	-	NULL	ENSG00000115548		0.363	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2		0.00	53	0	A	NM_018433		86705840	+1			no_errors	ENST00000312912	ensembl	human	known	74_37	silent	5.00	57	3	SNP	1.000	G
KDM3B	51780	genome.wustl.edu	37	5	137759943	137759943	+	Missense_Mutation	SNP	G	G	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:137759943G>C	ENST00000314358.5	+	16	4352	c.4152G>C	c.(4150-4152)tgG>tgC	p.W1384C	KDM3B_ENST00000394866.1_Missense_Mutation_p.W1040C|KDM3B_ENST00000542866.1_Missense_Mutation_p.W416C	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1384					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CTCACTCCTGGCTTTGTGATG	0.483																																																	0													114.0	99.0	104.0					5																	137759943		2203	4300	6503	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4152G>C	5.37:g.137759943G>C	ENSP00000326563:p.Trp1384Cys		A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.W1384C	ENST00000314358.5	37	c.4152	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267371	0.80469	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.70986	-0.53;-0.53;-0.53	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.85682	0.5753	M	0.80332	2.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.87192	0.2235	10	0.87932	D	0	-39.7662	19.3586	0.94425	0.0:0.0:1.0:0.0	.	1040;1384	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	C	1384;1174;1040;416	ENSP00000326563:W1384C;ENSP00000378335:W1040C;ENSP00000439462:W416C	ENSP00000326563:W1384C	W	+	3	0	KDM3B	137787842	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.869000	0.99810	2.567000	0.86603	0.563000	0.77884	TGG	KDM3B	-	NULL	ENSG00000120733		0.483	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	-	0.00	54	0	G	NM_016604		137759943	+1	tier1	-	no_errors	ENST00000314358	ensembl	human	known	74_37	missense	41.11	53	37	SNP	1.000	C
KIAA0408	9729	genome.wustl.edu	37	6	127770975	127770975	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:127770975G>T	ENST00000483725.3	-	4	906	c.570C>A	c.(568-570)aaC>aaA	p.N190K	SOGA3_ENST00000556132.1_3'UTR|SOGA3_ENST00000481848.2_3'UTR	NM_014702.4	NP_055517.3	Q6ZU52	K0408_HUMAN	KIAA0408	190										endometrium(3)|large_intestine(7)|lung(15)|ovary(1)|pancreas(1)|skin(1)	28				GBM - Glioblastoma multiforme(226;0.0217)|all cancers(137;0.13)		ACCTTCTATGGTTAGACCGCT	0.373																																																	0													119.0	116.0	117.0					6																	127770975		2203	4300	6503	SO:0001583	missense	0			AB007868	CCDS34531.1	6q22.33	2012-11-29			ENSG00000189367	ENSG00000189367			21636	protein-coding gene	gene with protein product							Standard	NM_014702		Approved		uc011ebs.2	Q6ZU52	OTTHUMG00000166439	ENST00000483725.3:c.570C>A	6.37:g.127770975G>T	ENSP00000435150:p.Asn190Lys		B3KRE5|E1P573|O43158|Q5TF20|Q7L2M2	Missense_Mutation	SNP	NULL	p.N190K	ENST00000483725.3	37	c.570	CCDS34531.1	6	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258592	0.59321	.	.	ENSG00000189367	ENST00000483725;ENST00000487331	T;T	0.52057	1.18;0.68	5.71	3.94	0.45596	.	0.368951	0.21653	U	0.071153	T	0.39358	0.1075	L	0.55481	1.735	0.31114	N	0.709612	D	0.59767	0.986	P	0.53035	0.716	T	0.37033	-0.9723	10	0.72032	D	0.01	-6.0735	10.8221	0.46610	0.2068:0.0:0.7932:0.0	.	190	Q6ZU52	K0408_HUMAN	K	190;202	ENSP00000435150:N190K;ENSP00000434384:N202K	ENSP00000435150:N190K	N	-	3	2	KIAA0408	127812668	1.000000	0.71417	0.994000	0.49952	0.997000	0.91878	1.372000	0.34261	0.772000	0.33382	0.655000	0.94253	AAC	KIAA0408	-	NULL	ENSG00000189367		0.373	KIAA0408-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA0408	HGNC	protein_coding	OTTHUMT00000042145.3	-	0.00	34	0	G	NM_014702		127770975	-1	tier1	-	no_errors	ENST00000483725	ensembl	human	novel	74_37	missense	7.55	49	4	SNP	0.996	T
KIAA1109	84162	genome.wustl.edu	37	4	123147861	123147861	+	Splice_Site	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:123147861G>A	ENST00000264501.4	+	24	3166		c.e24-1		KIAA1109_ENST00000495260.1_Splice_Site|KIAA1109_ENST00000455637.1_Splice_Site|KIAA1109_ENST00000388738.3_Splice_Site			Q2LD37	K1109_HUMAN	KIAA1109						regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						ATTATCTGTAGCTGGCATGCC	0.403																																																	0													216.0	206.0	210.0					4																	123147861		1992	4176	6168	SO:0001630	splice_region_variant	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.2794-1G>A	4.37:g.123147861G>A			Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Splice_Site	SNP	-	e22-1	ENST00000264501.4	37	c.2794-1	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	G	25.1	4.600889	0.87055	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637;ENST00000424425	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8624	0.96787	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA1109	123367311	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	9.399000	0.97285	2.709000	0.92574	0.585000	0.79938	.	KIAA1109	-	-	ENSG00000138688		0.403	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	-	0.00	44	0	G	NM_020797	Intron	123147861	+1	tier1	-	no_errors	ENST00000264501	ensembl	human	known	74_37	splice_site	48.08	27	25	SNP	1.000	A
KIAA1191	57179	genome.wustl.edu	37	5	175775305	175775305	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:175775305C>A	ENST00000298569.4	-	7	1047	c.514G>T	c.(514-516)Gcc>Tcc	p.A172S	KIAA1191_ENST00000393725.2_Missense_Mutation_p.A153S|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000533553.1_Missense_Mutation_p.S28I|KIAA1191_ENST00000510164.1_Missense_Mutation_p.A172S|KIAA1191_ENST00000393728.2_5'UTR	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	172						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GTGGACTGGGCTGATGCAGGC	0.502																																																	0													144.0	124.0	131.0					5																	175775305		2203	4300	6503	SO:0001583	missense	0			BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.514G>T	5.37:g.175775305C>A	ENSP00000298569:p.Ala172Ser		B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Missense_Mutation	SNP	NULL	p.A172S	ENST00000298569.4	37	c.514	CCDS4399.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.352|9.352	1.065829|1.065829	0.20067|0.20067	.|.	.|.	ENSG00000122203|ENSG00000122203	ENST00000298569;ENST00000393725;ENST00000510164|ENST00000533553	.|.	.|.	.|.	5.3|5.3	1.3|1.3	0.21679|0.21679	.|.	0.538627|.	0.21006|.	N|.	0.081773|.	T|T	0.45577|0.45577	0.1349|0.1349	L|L	0.61218|0.61218	1.895|1.895	0.18873|0.18873	N|N	0.999989|0.999989	B|.	0.15473|.	0.013|.	B|.	0.19391|.	0.025|.	T|T	0.41034|0.41034	-0.9531|-0.9531	9|6	0.62326|0.87932	D|D	0.03|0	-0.7788|-0.7788	7.0778|7.0778	0.25213|0.25213	0.0:0.6611:0.1224:0.2164|0.0:0.6611:0.1224:0.2164	.|.	172|.	Q96A73|.	K1191_HUMAN|.	S|I	172;153;172|28	.|.	ENSP00000298569:A172S|ENSP00000433506:S28I	A|S	-|-	1|2	0|0	KIAA1191|KIAA1191	175707911|175707911	0.001000|0.001000	0.12720|0.12720	0.050000|0.050000	0.19076|0.19076	0.788000|0.788000	0.44548|0.44548	-0.015000|-0.015000	0.12634|0.12634	0.010000|0.010000	0.14839|0.14839	0.591000|0.591000	0.81541|0.81541	GCC|AGC	KIAA1191	-	NULL	ENSG00000122203		0.502	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1191	HGNC	protein_coding	OTTHUMT00000253146.2	-	0.00	76	0	C	NM_020444		175775305	-1	tier1	-	no_errors	ENST00000298569	ensembl	human	known	74_37	missense	13.33	65	10	SNP	0.422	A
KIAA1407	57577	genome.wustl.edu	37	3	113684161	113684161	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:113684161delT	ENST00000295878.3	-	17	2798	c.2652delA	c.(2650-2652)aaafs	p.K884fs		NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	884										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CTTTCATAAATTTTACAAACT	0.398																																																	0													101.0	106.0	105.0					3																	113684161		2203	4300	6503	SO:0001589	frameshift_variant	0			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2652delA	3.37:g.113684161delT	ENSP00000295878:p.Lys884fs		B4DYL1|Q9P2E0	Frame_Shift_Del	DEL	NULL	p.K884fs	ENST00000295878.3	37	c.2652	CCDS2977.1	3																																																																																			KIAA1407	-	NULL	ENSG00000163617		0.398	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2		0.00	25	0	T	NM_020817		113684161	-1	tier1		no_errors	ENST00000295878	ensembl	human	known	74_37	frame_shift_del	5.00	38	2	DEL	0.000	-
KIAA1549	57670	genome.wustl.edu	37	7	138603524	138603524	+	Nonsense_Mutation	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:138603524A>T	ENST00000422774.1	-	2	896	c.848T>A	c.(847-849)tTa>tAa	p.L283*	KIAA1549_ENST00000242365.4_Nonsense_Mutation_p.L233*|KIAA1549_ENST00000440172.1_Nonsense_Mutation_p.L283*			Q9HCM3	K1549_HUMAN	KIAA1549	283						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CCGGGAGCTTAAAAAAAGGGT	0.517			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)			Dom	yes		7	7q34	57670	KIAA1549		O	0													34.0	35.0	35.0					7																	138603524		1847	4087	5934	SO:0001587	stop_gained	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.848T>A	7.37:g.138603524A>T	ENSP00000416040:p.Leu283*		B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Nonsense_Mutation	SNP	NULL	p.L283*	ENST00000422774.1	37	c.848	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	A	15.09	2.729838	0.48833	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	.	.	.	0.559	-0.678	0.11353	.	0.973510	0.08403	N	0.951049	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	.	.	.	.	.	.	.	X	283;233;283	.	ENSP00000242365:L233X	L	-	2	0	KIAA1549	138254064	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.277000	0.08502	-0.347000	0.08299	-0.366000	0.07423	TTA	KIAA1549	-	NULL	ENSG00000122778		0.517	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	-	0.00	18	0	A			138603524	-1	tier1	-	no_errors	ENST00000422774	ensembl	human	known	74_37	nonsense	39.29	17	11	SNP	0.001	T
KIAA1683	80726	genome.wustl.edu	37	19	18368333	18368333	+	Missense_Mutation	SNP	C	C	T	rs548939159		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:18368333C>T	ENST00000600328.3	-	4	3393	c.3200G>A	c.(3199-3201)cGc>cAc	p.R1067H	KIAA1683_ENST00000600359.3_Missense_Mutation_p.R1021H|KIAA1683_ENST00000392413.4_Missense_Mutation_p.R1254H|PDE4C_ENST00000596647.1_5'Flank|PDE4C_ENST00000355502.3_5'Flank			Q9H0B3	K1683_HUMAN	KIAA1683	1067						mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.R1067H(1)		breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ATGACAGGTGCGAGGGCTGGA	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		17258	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	prostate(1)											16.0	16.0	16.0					19																	18368333		2194	4288	6482	SO:0001583	missense	0			AB051470	CCDS32958.1, CCDS46017.1, CCDS46018.1	19p13.1	2008-02-05				ENSG00000130518			29350	protein-coding gene	gene with protein product						11214970, 11230166	Standard	NM_025249		Approved		uc010ebn.2	Q9H0B3		ENST00000600328.3:c.3200G>A	19.37:g.18368333C>T	ENSP00000470780:p.Arg1067His		B4DYH2|E9PDE0|E9PH54|Q2KHR5|Q8N4G8|Q96M14|Q9C0I0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.R1254H	ENST00000600328.3	37	c.3761	CCDS32958.1	19	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018906	0.54576	.	.	ENSG00000130518	ENST00000392413;ENST00000359737;ENST00000427634;ENST00000392412;ENST00000358422;ENST00000411671	T;T;T	0.08807	3.54;3.55;3.05	4.39	3.35	0.38373	.	0.000000	0.34700	N	0.003758	T	0.15522	0.0374	L	0.36672	1.1	0.21499	N	0.999664	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.987	T	0.02184	-1.1199	10	0.46703	T	0.11	-26.4116	7.2834	0.26324	0.0:0.8797:0.0:0.1203	.	1254;1067	E9PDE0;Q9H0B3	.;K1683_HUMAN	H	1254;1067;1021;331;452;681	ENSP00000376213:R1254H;ENSP00000352774:R1067H;ENSP00000404501:R1021H	ENSP00000351198:R452H	R	-	2	0	KIAA1683	18229333	1.000000	0.71417	0.999000	0.59377	0.349000	0.29174	2.094000	0.41719	2.001000	0.58596	0.462000	0.41574	CGC	KIAA1683	-	NULL	ENSG00000130518		0.682	KIAA1683-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1683	HGNC	protein_coding	OTTHUMT00000466312.3		0.00	22	0	C			18368333	-1			no_errors	ENST00000392413	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.997	T
KIAA2022	340533	genome.wustl.edu	37	X	73960195	73960195	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:73960195G>T	ENST00000055682.6	-	3	4808	c.4197C>A	c.(4195-4197)agC>agA	p.S1399R		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1399					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CATTGCTTTTGCTCACACCCT	0.448																																																	0													187.0	153.0	164.0					X																	73960195		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4197C>A	X.37:g.73960195G>T	ENSP00000055682:p.Ser1399Arg		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.S1399R	ENST00000055682.6	37	c.4197	CCDS35337.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.950|9.950	1.219777|1.219777	0.22373|0.22373	.|.	.|.	ENSG00000050030|ENSG00000050030	ENST00000424929|ENST00000373468;ENST00000055682	.|T;T	.|0.36157	.|1.27;1.27	5.36|5.36	3.3|3.3	0.37823|0.37823	.|.	.|0.399117	.|0.28736	.|N	.|0.014305	T|T	0.21468|0.21468	0.0517|0.0517	L|L	0.29908|0.29908	0.895|0.895	0.30890|0.30890	N|N	0.730499|0.730499	.|P	.|0.36909	.|0.573	.|B	.|0.33521	.|0.165	T|T	0.22452|0.22452	-1.0216|-1.0216	5|10	.|0.72032	.|D	.|0.01	-3.997|-3.997	3.8799|3.8799	0.09074|0.09074	0.3646:0.1794:0.456:0.0|0.3646:0.1794:0.456:0.0	.|.	.|1399	.|Q5QGS0	.|K2022_HUMAN	K|R	1|1399	.|ENSP00000362567:S1399R;ENSP00000055682:S1399R	.|ENSP00000055682:S1399R	Q|S	-|-	1|3	0|2	KIAA2022|KIAA2022	73876920|73876920	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.941000|0.941000	0.58515|0.58515	1.764000|1.764000	0.38471|0.38471	0.881000|0.881000	0.35993|0.35993	0.544000|0.544000	0.68410|0.68410	CAA|AGC	KIAA2022	-	NULL	ENSG00000050030		0.448	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	40	0	G	NM_001008537		73960195	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	36.11	46	26	SNP	1.000	T
KIF24	347240	genome.wustl.edu	37	9	34306372	34306372	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:34306372G>T	ENST00000402558.2	-	2	715	c.691C>A	c.(691-693)Cgc>Agc	p.R231S	KIF24_ENST00000379166.2_Missense_Mutation_p.R231S|KIF24_ENST00000379174.3_Missense_Mutation_p.R231S|KIF24_ENST00000345050.2_Missense_Mutation_p.R231S			Q5T7B8	KIF24_HUMAN	kinesin family member 24	231	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cilium assembly (GO:0042384)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)	centriole (GO:0005814)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(13)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	32			LUSC - Lung squamous cell carcinoma(29;0.0107)			CCCAGGGGGCGTTTTCGAACA	0.378																																																	0													185.0	177.0	179.0					9																	34306372		1815	4081	5896	SO:0001583	missense	0			AK001795	CCDS6551.2	9p13.3	2013-01-10			ENSG00000186638	ENSG00000186638		"""Kinesins"", ""Sterile alpha motif (SAM) domain containing"""	19916	protein-coding gene	gene with protein product		613747	"""chromosome 9 open reading frame 48"""	C9orf48		12477932	Standard	NM_194313		Approved	bA571F15.4, FLJ10933, FLJ43884	uc003zua.4	Q5T7B8	OTTHUMG00000019810	ENST00000402558.2:c.691C>A	9.37:g.34306372G>T	ENSP00000384433:p.Arg231Ser		Q2TB93|Q5T7B5|Q5T7B7|Q6ZU97|Q6ZUZ2|Q86XZ0|Q9NV43	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_SAM_type1,superfamily_P-loop_NTPase,superfamily_SAM/pointed,smart_Kinesin_motor_dom,pfscan_SAM,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R231S	ENST00000402558.2	37	c.691	CCDS6551.2	9	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803251	0.90623	.	.	ENSG00000186638	ENST00000402558;ENST00000379174;ENST00000379166;ENST00000345050;ENST00000420188	D;T;D;T	0.85088	-1.94;1.32;-1.94;1.32	5.74	5.74	0.90152	Kinesin, motor domain (4);	0.000000	0.43110	D	0.000614	D	0.96065	0.8718	H	0.98883	4.36	0.31773	N	0.631851	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95902	0.8916	10	0.51188	T	0.08	.	19.9179	0.97070	0.0:0.0:1.0:0.0	.	231;231	Q5T7B8-4;Q5T7B8	.;KIF24_HUMAN	S	231	ENSP00000384433:R231S;ENSP00000368472:R231S;ENSP00000368464:R231S;ENSP00000340179:R231S	ENSP00000340179:R231S	R	-	1	0	KIF24	34296372	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	7.033000	0.76504	2.723000	0.93209	0.655000	0.94253	CGC	KIF24	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000186638		0.378	KIF24-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF24	HGNC	protein_coding	OTTHUMT00000052150.5		0.00	28	0	G			34306372	-1			no_errors	ENST00000379166	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
KMT2A	4297	genome.wustl.edu	37	11	118343016	118343017	+	Frame_Shift_Ins	INS	-	-	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:118343016_118343017insG	ENST00000389506.5	+	3	1142_1143	c.1142_1143insG	c.(1141-1146)aaggggfs	p.KG381fs	KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.KG381fs|KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.KG381fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	381					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGGGCAAAAAAGGGGGCTCAAA	0.426																																																	0																																										SO:0001589	frameshift_variant	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.1147dupG	11.37:g.118343021_118343021dupG	ENSP00000374157:p.Lys381fs		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.A383fs	ENST00000389506.5	37	c.1142_1143	CCDS31686.1	11																																																																																			KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.426	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2		0.00	27	0	-	NM_005933		118343017	+1	tier1		no_errors	ENST00000389506	ensembl	human	known	74_37	frame_shift_ins	27.27	16	6	INS	1.000:1.000	G
KMT2A	4297	genome.wustl.edu	37	11	118348808	118348808	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:118348808G>A	ENST00000389506.5	+	5	3461	c.3461G>A	c.(3460-3462)cGg>cAg	p.R1154Q	KMT2A_ENST00000534358.1_Missense_Mutation_p.R1154Q|KMT2A_ENST00000354520.4_Missense_Mutation_p.R1154Q			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1154					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CGATCGAGGCGGTGTGGGCAG	0.507																																																	0													179.0	178.0	178.0					11																	118348808		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3461G>A	11.37:g.118348808G>A	ENSP00000374157:p.Arg1154Gln		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.R1154Q	ENST00000389506.5	37	c.3461	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	G	29.0	4.968262	0.92855	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000533790	D;T;D;D	0.86769	-2.13;0.65;-2.13;-2.17	6.06	6.06	0.98353	Zinc finger, CXXC-type (2);	0.000000	0.85682	D	0.000000	D	0.94221	0.8145	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93910	0.7196	10	0.87932	D	0	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	1154;1154	E9PQG7;Q03164	.;MLL1_HUMAN	Q	1154;1187;1154;1154;64;232	ENSP00000436786:R1154Q;ENSP00000432391:R1187Q;ENSP00000374157:R1154Q;ENSP00000346516:R1154Q	ENSP00000346516:R1154Q	R	+	2	0	MLL	117854018	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.807000	0.99171	2.882000	0.98803	0.655000	0.94253	CGG	KMT2A	-	pfam_Znf_CXXC,pirsf_MeTrfase_trithorax,pfscan_Znf_CXXC	ENSG00000118058		0.507	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	62	0	G	NM_005933		118348808	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	40.43	28	19	SNP	1.000	A
KMT2D	8085	genome.wustl.edu	37	12	49425503	49425503	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:49425503G>A	ENST00000301067.7	-	39	12984	c.12985C>T	c.(12985-12987)Cag>Tag	p.Q4329*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4329	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTGGGAAGCTGGGAGCTGGGG	0.622																																																	0													51.0	53.0	52.0					12																	49425503		1942	4131	6073	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.12985C>T	12.37:g.49425503G>A	ENSP00000301067:p.Gln4329*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q4329*	ENST00000301067.7	37	c.12985	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	52	19.235110	0.99916	.	.	ENSG00000167548	ENST00000301067	.	.	.	3.22	3.22	0.36961	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.2796	0.15668	0.1216:0.2138:0.6645:0.0	.	.	.	.	X	4329	.	ENSP00000301067:Q4329X	Q	-	1	0	MLL2	47711770	0.038000	0.19896	0.997000	0.53966	0.716000	0.41182	1.041000	0.30291	1.760000	0.52011	0.655000	0.94253	CAG	KMT2D	-	NULL	ENSG00000167548		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	53	0	G			49425503	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense	22.58	46	14	SNP	0.985	A
KRT85	3891	genome.wustl.edu	37	12	52757174	52757174	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:52757174G>A	ENST00000257901.3	-	5	882	c.807C>T	c.(805-807)gcC>gcT	p.A269A	KRT85_ENST00000544265.1_Silent_p.A57A	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	269	Coil 1B.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTGAGATGTGGGCTTGGAGAA	0.547																																																	0													135.0	83.0	100.0					12																	52757174		2203	4300	6503	SO:0001819	synonymous_variant	0			X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.807C>T	12.37:g.52757174G>A			Q9NSB1	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.A269	ENST00000257901.3	37	c.807	CCDS8824.1	12																																																																																			KRT85	-	pfam_IF	ENSG00000135443		0.547	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT85	HGNC	protein_coding	OTTHUMT00000405184.1	-	0.00	34	0	G	NM_002283		52757174	-1	tier1	-	no_errors	ENST00000257901	ensembl	human	known	74_37	silent	37.68	43	26	SNP	0.959	A
KRT5	3852	genome.wustl.edu	37	12	52910941	52910941	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:52910941T>C	ENST00000252242.4	-	6	1558	c.1168A>G	c.(1168-1170)Aac>Gac	p.N390D		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	390	Coil 2.|Rod.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		ATCATCCGGTTCATCTCAGAG	0.522																																																	0													136.0	128.0	130.0					12																	52910941		2203	4300	6503	SO:0001583	missense	0				CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1168A>G	12.37:g.52910941T>C	ENSP00000252242:p.Asn390Asp		Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.N390D	ENST00000252242.4	37	c.1168	CCDS8830.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.256715|5.256715	0.95336|0.95336	.|.	.|.	ENSG00000186081|ENSG00000186081	ENST00000548409|ENST00000252242;ENST00000456000	.|D	.|0.89270	.|-2.49	5.63|5.63	5.63|5.63	0.86233|0.86233	.|Filament (1);	.|0.000000	.|0.64402	.|D	.|0.000006	D|D	0.96303|0.96303	0.8794|0.8794	H|H	0.95884|0.95884	3.735|3.735	0.43830|0.43830	D|D	0.996408|0.996408	.|D	.|0.76494	.|0.999	.|D	.|0.76575	.|0.988	D|D	0.97461|0.97461	1.0034|1.0034	5|10	.|0.66056	.|D	.|0.02	.|.	15.8544|15.8544	0.78965|0.78965	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|390	.|P13647	.|K2C5_HUMAN	G|D	97|390;355	.|ENSP00000252242:N390D	.|ENSP00000252242:N390D	E|N	-|-	2|1	0|0	KRT5|KRT5	51197208|51197208	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.286000|6.286000	0.72665|0.72665	2.140000|2.140000	0.66376|0.66376	0.533000|0.533000	0.62120|0.62120	GAA|AAC	KRT5	-	pfam_IF,superfamily_Prefoldin	ENSG00000186081		0.522	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT5	HGNC	protein_coding	OTTHUMT00000405312.1		0.00	16	0	T			52910941	-1			no_errors	ENST00000252242	ensembl	human	known	74_37	missense	20.93	34	9	SNP	1.000	C
KRTAP2-3	730755	genome.wustl.edu	37	17	39216185	39216185	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:39216185C>T	ENST00000391418.2	-	1	159	c.118G>A	c.(118-120)Gtg>Atg	p.V40M		NM_001165252.1	NP_001158724.1	P0C7H8	KRA23_HUMAN	keratin associated protein 2-3	40	10 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GGGCGGCACACGGTGGTCTGG	0.746																																																	0													1.0	2.0	2.0					17																	39216185		316	980	1296	SO:0001583	missense	0			BC012486	CCDS54123.1	17q21.2	2012-08-03			ENSG00000212724	ENSG00000212724		"""Keratin associated proteins"""	18906	protein-coding gene	gene with protein product							Standard	NM_001165252		Approved	KAP2.3	uc002hvx.3	P0C7H8	OTTHUMG00000133655	ENST00000391418.2:c.118G>A	17.37:g.39216185C>T	ENSP00000375237:p.Val40Met			Missense_Mutation	SNP	pfam_Keratin-assoc	p.V40M	ENST00000391418.2	37	c.118	CCDS54123.1	17	.	.	.	.	.	.	.	.	.	.	.	24.6	4.544652	0.86022	.	.	ENSG00000212724	ENST00000391418	T	0.32988	1.43	5.63	5.63	0.86233	.	0.800555	0.09823	U	0.751210	T	0.58104	0.2099	.	.	.	0.31327	N	0.685271	D	0.89917	1.0	D	0.77004	0.989	T	0.57551	-0.7792	9	0.87932	D	0	.	15.2393	0.73455	0.0:1.0:0.0:0.0	.	40	Q9BYR9	KRA24_HUMAN	M	40	ENSP00000375237:V40M	ENSP00000375237:V40M	V	-	1	0	KRTAP2-3	36469711	0.971000	0.33674	1.000000	0.80357	0.995000	0.86356	0.916000	0.28651	2.672000	0.90937	0.556000	0.70494	GTG	KRTAP2-3	-	pfam_Keratin-assoc	ENSG00000212724		0.746	KRTAP2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP2-3	HGNC	protein_coding	OTTHUMT00000257692.1	-	0.00	42	0	C	NM_001165252		39216185	-1	tier1	-	no_errors	ENST00000391418	ensembl	human	known	74_37	missense	39.06	39	25	SNP	1.000	T
LAIR2	3904	genome.wustl.edu	37	19	55020248	55020248	+	Missense_Mutation	SNP	G	G	C	rs12949		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:55020248G>C	ENST00000301202.2	+	4	490	c.368G>C	c.(367-369)aGc>aCc	p.S123T	LAIR2_ENST00000351841.2_Intron	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	123						extracellular region (GO:0005576)		p.S123T(1)		central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		TTTACAGAAAGCTCTGGAGGC	0.627																																																	1	Substitution - Missense(1)	kidney(1)											54.0	63.0	60.0					19																	55020248		2127	4276	6403	SO:0001583	missense	0			AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.368G>C	19.37:g.55020248G>C	ENSP00000301202:p.Ser123Thr		Q6PEZ4	Missense_Mutation	SNP	smart_Ig_sub	p.S123T	ENST00000301202.2	37	c.368	CCDS12897.1	19	97	0.044413919413919416	28	0.056910569105691054	13	0.03591160220994475	7	0.012237762237762238	49	0.06464379947229551	C	0.004	-2.301275	0.00243	.	.	ENSG00000167618	ENST00000301202	T	0.00523	6.83	1.4	-1.19	0.09585	.	.	.	.	.	T	0.00039	0.0001	N	0.02539	-0.55	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.23154	-1.0196	9	0.14252	T	0.57	.	0.4992	0.00576	0.2475:0.3218:0.2448:0.1859	rs3177589;rs17343215	123	Q6ISS4	LAIR2_HUMAN	T	123	ENSP00000301202:S123T	ENSP00000301202:S123T	S	+	2	0	LAIR2	59712060	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.594000	0.02094	-0.745000	0.04772	-0.980000	0.02579	AGC	LAIR2	-	NULL	ENSG00000167618		0.627	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR2	HGNC	protein_coding	OTTHUMT00000140801.1		0.00	49	0	G			55020248	+1			no_errors	ENST00000301202	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.001	C
LHCGR	3973	genome.wustl.edu	37	2	48914886	48914886	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:48914886G>T	ENST00000294954.7	-	11	2071	c.2050C>A	c.(2050-2052)Cac>Aac	p.H684N	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.H622N|LHCGR_ENST00000401907.1_3'UTR|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000405626.1_Missense_Mutation_p.H657N	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	684					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CCTTGACAGTGCAATGTGGAC	0.383																																																	0													123.0	117.0	119.0					2																	48914886		2203	4300	6503	SO:0001583	missense	0				CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.2050C>A	2.37:g.48914886G>T	ENSP00000294954:p.His684Asn		Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.H684N	ENST00000294954.7	37	c.2050	CCDS1842.1	2	.	.	.	.	.	.	.	.	.	.	G	1.027	-0.683159	0.03353	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	T;T;T	0.75821	-0.97;-0.81;-0.87	5.4	2.31	0.28768	.	0.880679	0.10017	N	0.726475	T	0.50343	0.1610	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32268	-0.9913	9	.	.	.	.	2.6265	0.04931	0.0894:0.2191:0.3736:0.3179	.	684	P22888	LSHR_HUMAN	N	622;684;657	ENSP00000344301:H622N;ENSP00000294954:H684N;ENSP00000386033:H657N	.	H	-	1	0	LHCGR	48768390	0.428000	0.25522	0.204000	0.23530	0.266000	0.26442	1.116000	0.31221	0.788000	0.33755	0.585000	0.79938	CAC	LHCGR	-	prints_LSH_rcpt	ENSG00000138039		0.383	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	HGNC	protein_coding	OTTHUMT00000251364.4		0.00	47	0	G	NM_000233.3		48914886	-1			no_errors	ENST00000294954	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.053	T
TOX	9760	genome.wustl.edu	37	8	60031650	60031650	+	5'UTR	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:60031650G>T	ENST00000361421.1	-	0	117				RP11-25K19.1_ENST00000518993.1_RNA|RP11-25K19.1_ENST00000523683.1_RNA|RP11-25K19.1_ENST00000517898.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box							nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GGGCTCAGGAGTAAAAGAAAC	0.413																																					Pancreas(161;610 1969 17913 21374 22725)												0																																										SO:0001623	5_prime_UTR_variant	0				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.-104C>A	8.37:g.60031650G>T			Q96AV5	RNA	SNP	-	NULL	ENST00000361421.1	37	NULL	CCDS34897.1	8																																																																																			RP11-25K19.1	-	-	ENSG00000167912		0.413	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100505501	Clone_based_vega_gene	protein_coding	OTTHUMT00000378307.1	-	0.00	13	0	G	NM_014729		60031650	+1	tier1	-	no_errors	ENST00000523683	ensembl	human	known	74_37	rna	27.27	16	6	SNP	1.000	T
LINC01207	100505989	genome.wustl.edu	37	4	165722353	165722353	+	lincRNA	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:165722353A>G	ENST00000507311.1	+	0	529					NR_038834.1																						ATGATCTCATAGCCACCGATa	0.388																																																	0																																												0																															4.37:g.165722353A>G				RNA	SNP	-	NULL	ENST00000507311.1	37	NULL		4																																																																																			RP11-294O2.2	-	-	ENSG00000248771		0.388	RP11-294O2.2-001	KNOWN	basic	lincRNA	LOC100505989	Clone_based_vega_gene	lincRNA	OTTHUMT00000364323.1	-	0.00	38	0	A			165722353	+1	tier1	-	no_errors	ENST00000507311	ensembl	human	known	74_37	rna	7.41	50	4	SNP	0.041	G
LOC728715	728715	genome.wustl.edu	37	12	9728362	9728362	+	RNA	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:9728362G>T	ENST00000520314.1	+	0	7361																											CATCTAGTAAGAAAATGAAAA	0.353																																																	0																																												0																															12.37:g.9728362G>T				RNA	SNP	-	NULL	ENST00000520314.1	37	NULL		12																																																																																			RP11-726G1.1	-	-	ENSG00000214776		0.353	RP11-726G1.1-002	KNOWN	basic	processed_transcript	LOC728715	Clone_based_vega_gene	pseudogene	OTTHUMT00000381543.1	-	0.00	72	0	G			9728362	+1	tier1	-	no_errors	ENST00000520314	ensembl	human	known	74_37	rna	32.63	64	31	SNP	0.088	T
LOC728715	728715	genome.wustl.edu	37	12	9728368	9728368	+	RNA	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:9728368G>A	ENST00000520314.1	+	0	7367																											GTAAGAAAATGAAAACCTGAA	0.348																																																	0																																												0																															12.37:g.9728368G>A				RNA	SNP	-	NULL	ENST00000520314.1	37	NULL		12																																																																																			RP11-726G1.1	-	-	ENSG00000214776		0.348	RP11-726G1.1-002	KNOWN	basic	processed_transcript	LOC728715	Clone_based_vega_gene	pseudogene	OTTHUMT00000381543.1	-	0.00	70	0	G			9728368	+1	tier1	-	no_errors	ENST00000520314	ensembl	human	known	74_37	rna	34.44	59	31	SNP	0.031	A
LRP12	29967	genome.wustl.edu	37	8	105509702	105509702	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:105509702T>C	ENST00000276654.5	-	5	1186	c.1078A>G	c.(1078-1080)Aat>Gat	p.N360D	LRP12_ENST00000424843.2_Missense_Mutation_p.N341D|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	360	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGCAGCATTCACTTTATCA	0.433																																																	0													98.0	98.0	98.0					8																	105509702		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1078A>G	8.37:g.105509702T>C	ENSP00000276654:p.Asn360Asp		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.N341D	ENST00000276654.5	37	c.1021	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	T	19.95	3.922180	0.73213	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.29142	1.58;1.58	5.9	5.9	0.94986	CUB (5);	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	L	0.28115	0.83	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79108	0.987;0.992	T	0.09530	-1.0670	10	0.05959	T	0.93	-29.7919	16.3264	0.82983	0.0:0.0:0.0:1.0	.	341;360	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	D	341;360	ENSP00000399148:N341D;ENSP00000276654:N360D	ENSP00000276654:N360D	N	-	1	0	LRP12	105578878	1.000000	0.71417	0.795000	0.32087	0.974000	0.67602	7.466000	0.80914	2.259000	0.74868	0.374000	0.22700	AAT	LRP12	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000147650		0.433	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	33	0	T	NM_013437		105509702	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	C
LRPPRC	10128	genome.wustl.edu	37	2	44190729	44190729	+	Nonsense_Mutation	SNP	G	G	A	rs567388360		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:44190729G>A	ENST00000260665.7	-	12	1543	c.1486C>T	c.(1486-1488)Cag>Tag	p.Q496*	LRPPRC_ENST00000409659.1_Nonsense_Mutation_p.Q496*|LRPPRC_ENST00000409946.1_Nonsense_Mutation_p.Q496*	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	496					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GTACTCACCTGCAAAATGGCT	0.363													G|||	1	0.000199681	0.0	0.0	5008	,	,		17654	0.0		0.0	False		,,,				2504	0.001																0													99.0	96.0	97.0					2																	44190729		2203	4300	6503	SO:0001587	stop_gained	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.1486C>T	2.37:g.44190729G>A	ENSP00000260665:p.Gln496*		A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Nonsense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.Q496*	ENST00000260665.7	37	c.1486	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	G	17.91	3.505538	0.64410	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659	.	.	.	4.75	1.84	0.25277	.	0.183612	0.48767	D	0.000161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-6.7346	9.5074	0.39056	0.0:0.2394:0.486:0.2746	.	.	.	.	X	396;496;496;496	.	ENSP00000260665:Q496X	Q	-	1	0	LRPPRC	44044233	1.000000	0.71417	0.964000	0.40570	0.100000	0.18952	2.113000	0.41902	0.182000	0.20032	-0.257000	0.10917	CAG	LRPPRC	-	NULL	ENSG00000138095		0.363	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1		0.00	42	0	G	NM_133259		44190729	-1			no_errors	ENST00000260665	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	0.998	A
LRRC4C	57689	genome.wustl.edu	37	11	40137317	40137317	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:40137317G>A	ENST00000278198.2	-	2	2489	c.526C>T	c.(526-528)Cga>Tga	p.R176*	LRRC4C_ENST00000528697.1_Nonsense_Mutation_p.R176*|LRRC4C_ENST00000530763.1_Nonsense_Mutation_p.R176*|LRRC4C_ENST00000527150.1_Nonsense_Mutation_p.R176*			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	176					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				AAGTCTAGTCGGCGCAAAGAA	0.423																																																	0													92.0	91.0	91.0					11																	40137317		2203	4300	6503	SO:0001587	stop_gained	0			AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.526C>T	11.37:g.40137317G>A	ENSP00000278198:p.Arg176*		A8K0T1|Q7L0N3	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R176*	ENST00000278198.2	37	c.526	CCDS31464.1	11	.	.	.	.	.	.	.	.	.	.	G	38	7.162653	0.98107	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	.	.	.	5.82	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8889	0.52618	0.0:0.0:0.694:0.306	.	.	.	.	X	176	.	ENSP00000278198:R176X	R	-	1	2	LRRC4C	40093893	0.999000	0.42202	1.000000	0.80357	0.993000	0.82548	1.985000	0.40668	2.754000	0.94517	0.650000	0.86243	CGA	LRRC4C	-	NULL	ENSG00000148948		0.423	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC4C	HGNC	protein_coding	OTTHUMT00000389499.1	-	0.00	30	0	G	NM_020929		40137317	-1	tier1	-	no_errors	ENST00000527150	ensembl	human	known	74_37	nonsense	33.33	26	13	SNP	1.000	A
LRRC66	339977	genome.wustl.edu	37	4	52861635	52861635	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:52861635C>T	ENST00000343457.3	-	4	1559	c.1553G>A	c.(1552-1554)cGt>cAt	p.R518H		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	518						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CATTAGTTCACGGTTACCGGC	0.527																																																	0													103.0	110.0	108.0					4																	52861635		2111	4239	6350	SO:0001583	missense	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1553G>A	4.37:g.52861635C>T	ENSP00000341944:p.Arg518His			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R518H	ENST00000343457.3	37	c.1553	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	C	3.603	-0.081241	0.07141	.	.	ENSG00000188993	ENST00000343457	D	0.81739	-1.53	4.06	0.192	0.15134	.	2.683060	0.01400	N	0.013577	T	0.58032	0.2094	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50709	-0.8796	10	0.35671	T	0.21	0.0563	4.0882	0.09957	0.0:0.2015:0.191:0.6075	.	518	Q68CR7	LRC66_HUMAN	H	518	ENSP00000341944:R518H	ENSP00000341944:R518H	R	-	2	0	LRRC66	52556392	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.078000	0.14761	-0.026000	0.13895	-0.312000	0.09012	CGT	LRRC66	-	NULL	ENSG00000188993		0.527	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1		0.00	39	0	C	NM_001024611		52861635	-1			no_errors	ENST00000343457	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.000	T
LRRK1	79705	genome.wustl.edu	37	15	101554585	101554585	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:101554585C>T	ENST00000388948.3	+	11	1843	c.1484C>T	c.(1483-1485)aCc>aTc	p.T495I	LRRK1_ENST00000284395.5_Missense_Mutation_p.T492I	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GAGAAGTGGACCTGCAGGCAG	0.567																																																	0													87.0	92.0	91.0					15																	101554585		1936	4142	6078	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.1484C>T	15.37:g.101554585C>T	ENSP00000373600:p.Thr495Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.T495I	ENST00000388948.3	37	c.1484	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533724	0.45073	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.57595	0.39;0.39	5.46	4.52	0.55395	.	0.190394	0.42821	D	0.000645	T	0.44540	0.1298	L	0.33668	1.02	0.30385	N	0.781598	B	0.30793	0.295	B	0.38842	0.283	T	0.49293	-0.8955	10	0.37606	T	0.19	.	9.1171	0.36764	0.1769:0.6737:0.1494:0.0	.	495	Q38SD2	LRRK1_HUMAN	I	495;492	ENSP00000373600:T495I;ENSP00000284395:T492I	ENSP00000284395:T492I	T	+	2	0	LRRK1	99372108	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.253000	0.51469	1.245000	0.43885	0.549000	0.68633	ACC	LRRK1	-	NULL	ENSG00000154237		0.567	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	-	0.00	26	0	C	NM_024652		101554585	+1	tier1	-	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
MAGEC1	9947	genome.wustl.edu	37	X	140993740	140993740	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:140993740G>T	ENST00000285879.4	+	4	836	c.550G>T	c.(550-552)Gag>Tag	p.E184*	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	184										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GAGTTCCCCTGAGAGTACTCA	0.488										HNSCC(15;0.026)																																							0													80.0	91.0	87.0					X																	140993740		2203	4299	6502	SO:0001587	stop_gained	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.550G>T	X.37:g.140993740G>T	ENSP00000285879:p.Glu184*		A0PK03|O75451|Q8TCV4	Nonsense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E184*	ENST00000285879.4	37	c.550	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	g	16.21	3.059274	0.55325	.	.	ENSG00000155495	ENST00000285879	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	2.1454	0.03786	0.0:0.3284:0.3471:0.3245	.	.	.	.	X	184	.	ENSP00000285879:E184X	E	+	1	0	MAGEC1	140821406	0.055000	0.20627	0.033000	0.17914	0.033000	0.12548	0.593000	0.23999	0.054000	0.16065	0.054000	0.15206	GAG	MAGEC1	-	NULL	ENSG00000155495		0.488	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	151	0	G	NM_005462		140993740	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	nonsense	22.26	213	61	SNP	0.100	T
MAGI3	260425	genome.wustl.edu	37	1	114184871	114184871	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:114184871G>A	ENST00000307546.9	+	10	1774	c.1699G>A	c.(1699-1701)Gca>Aca	p.A567T	MAGI3_ENST00000369617.4_Missense_Mutation_p.A592T|MAGI3_ENST00000369615.1_Missense_Mutation_p.A567T|MAGI3_ENST00000369611.4_Missense_Mutation_p.A567T	NM_001142782.1	NP_001136254.1	Q5TCQ9	MAGI3_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 3	592					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|nucleotide phosphorylation (GO:0046939)|positive regulation of JUN kinase activity (GO:0043507)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	41	Lung SC(450;0.184)	all_cancers(81;2.34e-09)|all_epithelial(167;7.41e-09)|all_lung(203;7.13e-06)|Lung NSC(69;1.2e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGTATCCATGGCATCGTCAGG	0.498																																																	0													115.0	116.0	116.0					1																	114184871		2203	4300	6503	SO:0001583	missense	0			AF213259	CCDS860.1, CCDS44196.1	1p12-p11.2	2008-02-05			ENSG00000081026	ENSG00000081026			29647	protein-coding gene	gene with protein product		615943				10997877, 10748157	Standard	NM_152900		Approved	MAGI-3	uc001edk.3	Q5TCQ9	OTTHUMG00000011737	ENST00000307546.9:c.1699G>A	1.37:g.114184871G>A	ENSP00000304604:p.Ala567Thr		Q5TCQ8|Q5TCR0|Q9H2V6|Q9H5Y8|Q9HBC4|Q9HCD8	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.A567T	ENST00000307546.9	37	c.1699	CCDS44196.1	1	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480083	0.44044	.	.	ENSG00000081026	ENST00000369617;ENST00000307546;ENST00000369615;ENST00000369611	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	5.48	5.48	0.80851	.	0.105254	0.64402	D	0.000004	T	0.31071	0.0785	M	0.66378	2.025	0.44908	D	0.997926	B;B;B	0.25955	0.011;0.138;0.002	B;B;B	0.21151	0.023;0.033;0.006	T	0.19745	-1.0296	10	0.62326	D	0.03	-15.9135	15.3369	0.74263	0.0:0.0:0.8597:0.1403	.	567;567;592	Q5TCQ9-4;Q5TCQ9-3;Q5TCQ9-2	.;.;.	T	592;567;567;567	ENSP00000358630:A592T;ENSP00000304604:A567T;ENSP00000358628:A567T;ENSP00000358624:A567T	ENSP00000304604:A567T	A	+	1	0	MAGI3	113986394	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	4.587000	0.60991	2.731000	0.93534	0.650000	0.86243	GCA	MAGI3	-	superfamily_PDZ	ENSG00000081026		0.498	MAGI3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	MAGI3	HGNC	protein_coding	OTTHUMT00000032429.1	-	0.00	39	0	G	NM_152900		114184871	+1	tier1	-	no_errors	ENST00000369611	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	A
MECP2	4204	genome.wustl.edu	37	X	153295833	153295833	+	Silent	SNP	G	G	A	rs76895094		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:153295833G>A	ENST00000303391.6	-	4	1695	c.1446C>T	c.(1444-1446)acC>acT	p.T482T	MECP2_ENST00000453960.2_Silent_p.T494T|MECP2_ENST00000460227.1_5'Flank	NM_004992.3	NP_004983.1	P51608	MECP2_HUMAN	methyl CpG binding protein 2	482					adult locomotory behavior (GO:0008344)|behavioral fear response (GO:0001662)|cardiolipin metabolic process (GO:0032048)|catecholamine secretion (GO:0050432)|cerebellum development (GO:0021549)|chromatin silencing (GO:0006342)|dendrite development (GO:0016358)|glucocorticoid metabolic process (GO:0008211)|glutamine metabolic process (GO:0006541)|histone acetylation (GO:0016573)|histone methylation (GO:0016571)|inositol metabolic process (GO:0006020)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone methylation (GO:0031061)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron maturation (GO:0042551)|pathogenesis (GO:0009405)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse assembly (GO:0051965)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|proprioception (GO:0019230)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|startle response (GO:0001964)|synapse assembly (GO:0007416)|transcription, DNA-templated (GO:0006351)|ventricular system development (GO:0021591)|visual learning (GO:0008542)	cytosol (GO:0005829)|extracellular space (GO:0005615)|heterochromatin (GO:0000792)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded methylated DNA binding (GO:0010385)|methyl-CpG binding (GO:0008327)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|siRNA binding (GO:0035197)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|prostate(2)|urinary_tract(1)	23	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TAACTCTCTCGGTCACGGGCG	0.522																																																	0													169.0	151.0	157.0					X																	153295833		2203	4300	6503	SO:0001819	synonymous_variant	0			AF158180	CCDS14741.1, CCDS48193.1	Xq28	2014-09-17	2014-06-18		ENSG00000169057	ENSG00000169057			6990	protein-coding gene	gene with protein product		300005	"""mental retardation, X-linked 16"", ""mental retardation, X-linked 79"", ""Rett syndrome"", ""methyl CpG binding protein 2 (Rett syndrome)"""	RTT, MRX16, MRX79		1606614, 10508514	Standard	NM_004992		Approved		uc004fjw.2	P51608	OTTHUMG00000024229	ENST00000303391.6:c.1446C>T	X.37:g.153295833G>A			O15233|Q6QHH9|Q7Z384	Silent	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,superfamily_Ig_E-set,smart_Methyl_CpG_DNA-bd,pirsf_Me_CpG-bd_MeCP2,pfscan_Methyl_CpG_DNA-bd	p.T482	ENST00000303391.6	37	c.1446	CCDS14741.1	X																																																																																			MECP2	-	pirsf_Me_CpG-bd_MeCP2	ENSG00000169057		0.522	MECP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECP2	HGNC	protein_coding	OTTHUMT00000061144.1	-	0.00	53	0	G	NM_004992		153295833	-1	tier1	rs76895094	no_errors	ENST00000303391	ensembl	human	known	74_37	silent	34.21	50	26	SNP	1.000	A
METTL4	64863	genome.wustl.edu	37	18	2563854	2563854	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:2563854C>T	ENST00000574538.1	-	3	1176	c.401G>A	c.(400-402)cGt>cAt	p.R134H	METTL4_ENST00000319888.6_Missense_Mutation_p.R134H|RP11-715F3.2_ENST00000583253.1_RNA	NM_022840.3	NP_073751.3	Q8N3J2	METL4_HUMAN	methyltransferase like 4	134					nucleobase-containing compound metabolic process (GO:0006139)		methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						ACATCTTTTACGCTTCTAAAG	0.294																																																	0													125.0	109.0	114.0					18																	2563854		2201	4299	6500	SO:0001583	missense	0				CCDS11826.1	18p11.31	2008-02-05			ENSG00000101574	ENSG00000101574			24726	protein-coding gene	gene with protein product						12477932	Standard	NM_022840		Approved	FLJ23017, HsT661	uc002klh.4	Q8N3J2	OTTHUMG00000131482	ENST00000574538.1:c.401G>A	18.37:g.2563854C>T	ENSP00000458290:p.Arg134His		B2RNA1|Q2TAA7|Q9H5U9	Missense_Mutation	SNP	pfam_MT-A70-like,pfscan_MT-A70-like	p.R134H	ENST00000574538.1	37	c.401	CCDS11826.1	18	.	.	.	.	.	.	.	.	.	.	C	19.54	3.846623	0.71603	.	.	ENSG00000101574	ENST00000319888	T	0.31769	1.48	5.42	2.65	0.31530	.	0.271361	0.31976	N	0.006771	T	0.46852	0.1414	M	0.67953	2.075	0.33202	D	0.552313	D	0.89917	1.0	P	0.61275	0.886	T	0.61753	-0.6998	10	0.72032	D	0.01	-1.8785	10.7252	0.46064	0.0:0.7906:0.0:0.2094	.	134	Q8N3J2	METL4_HUMAN	H	134	ENSP00000320349:R134H	ENSP00000320349:R134H	R	-	2	0	METTL4	2553854	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	1.760000	0.38430	0.677000	0.31305	0.591000	0.81541	CGT	METTL4	-	NULL	ENSG00000101574		0.294	METTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL4	HGNC	protein_coding	OTTHUMT00000254326.3		0.00	27	0	C	NM_022840		2563854	-1			no_errors	ENST00000574538	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.986	T
MGAM	8972	genome.wustl.edu	37	7	141764224	141764224	+	Silent	SNP	T	T	G	rs538501942	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:141764224T>G	ENST00000549489.2	+	37	4481	c.4386T>G	c.(4384-4386)ctT>ctG	p.L1462L	MGAM_ENST00000475668.2_Silent_p.L1462L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1462	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GCAAGACCCTTTGTATGGAGA	0.562													t|||	8	0.00159744	0.0045	0.0	5008	,	,		18839	0.0		0.0	False		,,,				2504	0.002																0													33.0	35.0	34.0					7																	141764224		1965	4168	6133	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4386T>G	7.37:g.141764224T>G			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.L1462	ENST00000549489.2	37	c.4386	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.562	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	61	0	T			141764224	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	silent	43.75	36	28	SNP	1.000	G
MGAM	8972	genome.wustl.edu	37	7	141764227	141764227	+	Silent	SNP	T	T	C	rs3087317	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:141764227T>C	ENST00000549489.2	+	37	4484	c.4389T>C	c.(4387-4389)tgT>tgC	p.C1463C	MGAM_ENST00000475668.2_Silent_p.C1463C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1463	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACCCTTTGTATGGAGAGTC	0.567													N|||	8	0.00159744	0.0045	0.0	5008	,	,		18881	0.0		0.0	False		,,,				2504	0.002																0													33.0	35.0	35.0					7																	141764227		1968	4170	6138	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4389T>C	7.37:g.141764227T>C			Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.C1463	ENST00000549489.2	37	c.4389	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.567	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	59	0	T			141764227	+1	tier1	rs3087317	no_errors	ENST00000549489	ensembl	human	known	74_37	silent	44.62	36	29	SNP	1.000	C
MLIP	90523	genome.wustl.edu	37	6	54122159	54122159	+	Splice_Site	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:54122159G>T	ENST00000274897.5	+	12	1484	c.1371G>T	c.(1369-1371)gaG>gaT	p.E457D	MLIP_ENST00000509997.1_Intron|MLIP_ENST00000370876.2_Splice_Site_p.E233D|MLIP_ENST00000358276.5_Splice_Site_p.E289D|MLIP_ENST00000502396.1_Splice_Site_p.E992D|MLIP_ENST00000370877.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	457						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						ATTCCAAAGAGGTAAATGTAA	0.338																																																	0													108.0	105.0	106.0					6																	54122159		2203	4300	6503	SO:0001630	splice_region_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1371+1G>T	6.37:g.54122159G>T			B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.E457D	ENST00000274897.5	37	c.1371	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508606	0.64410	.	.	ENSG00000146147	ENST00000274897;ENST00000370876;ENST00000502396;ENST00000358276	T;T;T;T	0.44482	1.8;0.92;1.3;0.96	5.63	5.63	0.86233	.	0.087209	0.40469	N	0.001090	T	0.41880	0.1178	N	0.19112	0.55	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.994;0.994	T	0.46020	-0.9221	10	0.87932	D	0	-0.5277	15.5271	0.75919	0.0:0.0:1.0:0.0	.	992;233;457	Q5VWP3-3;Q5VWP3-2;Q5VWP3	.;.;MLIP_HUMAN	D	457;233;992;289	ENSP00000274897:E457D;ENSP00000359913:E233D;ENSP00000426290:E992D;ENSP00000351019:E289D	ENSP00000274897:E457D	E	+	3	2	MLIP	54230118	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.234000	0.65343	2.818000	0.97014	0.591000	0.81541	GAG	MLIP	-	NULL	ENSG00000146147		0.338	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	-	0.00	67	0	G	NM_138569	Missense_Mutation	54122159	+1	tier1	-	no_errors	ENST00000274897	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
MPP4	58538	genome.wustl.edu	37	2	202552060	202552060	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:202552060G>T	ENST00000409474.3	-	5	521	c.314C>A	c.(313-315)cCt>cAt	p.P105H	MPP4_ENST00000359962.5_Missense_Mutation_p.P105H|MPP4_ENST00000396886.3_Missense_Mutation_p.P105H|MPP4_ENST00000447335.2_Missense_Mutation_p.P105H|MPP4_ENST00000428900.2_Missense_Mutation_p.P105H|MPP4_ENST00000409143.1_Intron|MPP4_ENST00000315506.7_Missense_Mutation_p.P105H	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	105	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						TTGGATCTCAGGGGAAGTAGG	0.408																																																	0													71.0	69.0	70.0					2																	202552060		1833	4086	5919	SO:0001583	missense	0			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.314C>A	2.37:g.202552060G>T	ENSP00000387278:p.Pro105His		C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.P105H	ENST00000409474.3	37	c.314	CCDS46491.1	2	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322301	0.60634	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000428900;ENST00000447335	T;T;T;T;T	0.05199	3.48;3.48;3.48;3.48;3.48	5.97	2.0	0.26442	L27, C-terminal (1);L27 (2);	0.430705	0.22190	N	0.063384	T	0.14227	0.0344	M	0.76328	2.33	0.24118	N	0.995817	B;P;P;P;P;P;D;P;P	0.57571	0.153;0.537;0.808;0.771;0.808;0.654;0.98;0.808;0.508	B;P;P;B;P;P;P;P;P	0.56700	0.195;0.54;0.549;0.413;0.549;0.605;0.804;0.549;0.669	T	0.07481	-1.0770	10	0.59425	D	0.04	.	4.0493	0.09788	0.1214:0.1163:0.5469:0.2154	.	105;105;105;105;105;105;118;105;105	B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;F8WC25;F8WBH8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;.;MPP4_HUMAN;.	H	105	ENSP00000387278:P105H;ENSP00000319363:P105H;ENSP00000353047:P105H;ENSP00000416781:P105H;ENSP00000406160:P105H	ENSP00000319363:P105H	P	-	2	0	MPP4	202260305	0.993000	0.37304	0.971000	0.41717	0.789000	0.44602	1.623000	0.37008	0.425000	0.26087	0.655000	0.94253	CCT	MPP4	-	pfam_L27_C,smart_L27,pfscan_L27	ENSG00000082126		0.408	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	HGNC	protein_coding	OTTHUMT00000335748.2	-	0.00	53	0	G			202552060	-1	tier1	-	no_errors	ENST00000359962	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.518	T
MT-ND2	4536	genome.wustl.edu	37	M	2701	2701	+	5'Flank	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrM:2701G>A	ENST00000361453.3	+	0	0				MT-TW_ENST00000387382.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TV_ENST00000387342.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						cgtgaagaggcgggcatgaca	0.443																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2701G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	RNA	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.443	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	716	0	G	YP_003024027		2701	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	12.33	1315	185	SNP	NULL	A
MTF1	4520	genome.wustl.edu	37	1	38280975	38280975	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:38280975G>T	ENST00000373036.4	-	11	2235	c.2095C>A	c.(2095-2097)Cga>Aga	p.R699R		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	699					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TCTGCTTGTCGGCTTTGCTCA	0.562																																																	0													131.0	136.0	134.0					1																	38280975		2203	4300	6503	SO:0001819	synonymous_variant	0			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.2095C>A	1.37:g.38280975G>T			B2RAK6|Q96CB1	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R699	ENST00000373036.4	37	c.2095	CCDS30676.1	1																																																																																			MTF1	-	NULL	ENSG00000188786		0.562	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF1	HGNC	protein_coding	OTTHUMT00000012984.2		0.00	28	0	G	NM_005955		38280975	-1			no_errors	ENST00000373036	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.982	T
MUC17	140453	genome.wustl.edu	37	7	100676006	100676006	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:100676006G>T	ENST00000306151.4	+	3	1373	c.1309G>T	c.(1309-1311)Gct>Tct	p.A437S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	437	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TCCCACAACTGCTGAAGATAC	0.493																																																	0													224.0	230.0	228.0					7																	100676006		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1309G>T	7.37:g.100676006G>T	ENSP00000302716:p.Ala437Ser		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.A437S	ENST00000306151.4	37	c.1309	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.069	-1.206748	0.01568	.	.	ENSG00000169876	ENST00000306151	T	0.02579	4.24	1.22	-2.44	0.06502	.	.	.	.	.	T	0.01454	0.0047	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.47222	-0.9134	9	0.07813	T	0.8	.	4.1516	0.10240	0.0:0.1966:0.2561:0.5473	.	437	Q685J3	MUC17_HUMAN	S	437	ENSP00000302716:A437S	ENSP00000302716:A437S	A	+	1	0	MUC17	100462726	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.164000	0.00576	-2.204000	0.00743	-0.711000	0.03637	GCT	MUC17	-	NULL	ENSG00000169876		0.493	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	49	0	G	NM_001040105		100676006	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	16.00	84	16	SNP	0.000	T
MUC2	4583	genome.wustl.edu	37	11	1096386	1096386	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:1096386C>T	ENST00000441003.2	+	34	6438	c.6411C>T	c.(6409-6411)taC>taT	p.Y2137Y	MUC2_ENST00000361558.6_Silent_p.Y275Y	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4499					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ACTACAGCTACCAGGGCAACT	0.612																																																	0													83.0	92.0	89.0					11																	1096386		2170	4271	6441	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.6411C>T	11.37:g.1096386C>T			Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Y2137	ENST00000441003.2	37	c.6411		11																																																																																			MUC2	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000198788		0.612	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2		0.00	37	0	C	NM_002457		1096386	+1			no_errors	ENST00000441003	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.997	T
MYSM1	114803	genome.wustl.edu	37	1	59131214	59131214	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:59131214G>T	ENST00000472487.1	-	17	2160	c.2121C>A	c.(2119-2121)acC>acA	p.T707T	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	707					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					TAACCAGGCAGGTAATCTGAG	0.363																																																	0													126.0	119.0	121.0					1																	59131214		1827	4084	5911	SO:0001819	synonymous_variant	0			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2121C>A	1.37:g.59131214G>T			A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Silent	SNP	pfam_SWIRM,pfam_JAB_MPN_dom,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,smart_JAB_MPN_dom,pfscan_SWIRM,pfscan_Myb-like_dom	p.T707	ENST00000472487.1	37	c.2121	CCDS41343.1	1																																																																																			MYSM1	-	smart_JAB_MPN_dom	ENSG00000162601		0.363	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYSM1	HGNC	protein_coding	OTTHUMT00000026343.2	-	0.00	68	0	G	XM_055481		59131214	-1	tier1	-	no_errors	ENST00000472487	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
NBN	4683	genome.wustl.edu	37	8	90949256	90949256	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:90949256delA	ENST00000265433.3	-	15	2386	c.2232delT	c.(2230-2232)tttfs	p.F744fs	NBN_ENST00000409330.1_Frame_Shift_Del_p.F662fs	NM_002485.4	NP_002476.2	O60934	NBN_HUMAN	nibrin	744					blastocyst growth (GO:0001832)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|DNA damage checkpoint (GO:0000077)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intrinsic apoptotic signaling pathway (GO:0097193)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G2 DNA damage checkpoint (GO:0007095)|neuromuscular process controlling balance (GO:0050885)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|telomere maintenance (GO:0000723)	Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nuclear inclusion body (GO:0042405)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|replication fork (GO:0005657)|site of double-strand break (GO:0035861)	damaged DNA binding (GO:0003684)|protein N-terminus binding (GO:0047485)|transcription factor binding (GO:0008134)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(11;0.0344)			AACTTTACCTAAAAAGATCAT	0.294								Homologous recombination																																									0													100.0	98.0	98.0					8																	90949256		2203	4300	6503	SO:0001589	frameshift_variant	0			AF058696	CCDS6249.1	8q21-q24	2014-09-17	2005-06-02	2005-06-02	ENSG00000104320	ENSG00000104320			7652	protein-coding gene	gene with protein product		602667	"""Nijmegen breakage syndrome 1 (nibrin)"""	NBS, NBS1		9590181, 9590180	Standard	XM_005250923		Approved	ATV, AT-V2, AT-V1	uc003yej.1	O60934	OTTHUMG00000153546	ENST00000265433.3:c.2232delT	8.37:g.90949256delA	ENSP00000265433:p.Phe744fs		B2R626|B2RNC5|O60672|Q32NF7|Q53FM6|Q63HR6|Q7LDM2	Frame_Shift_Del	DEL	pfam_DNA-repair_Nbs1_C,pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_BRCT_dom,smart_FHA_dom,pirsf_Nibrin_met,pfscan_FHA_dom	p.F744fs	ENST00000265433.3	37	c.2232	CCDS6249.1	8																																																																																			NBN	-	pfam_DNA-repair_Nbs1_C,pirsf_Nibrin_met	ENSG00000104320		0.294	NBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBN	HGNC	protein_coding	OTTHUMT00000331583.3		0.00	39	0	A	NM_001024688		90949256	-1	tier1		no_errors	ENST00000265433	ensembl	human	known	74_37	frame_shift_del	15.52	49	9	DEL	1.000	-
NCAM2	4685	genome.wustl.edu	37	21	22658646	22658646	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr21:22658646C>A	ENST00000400546.1	+	4	644	c.395C>A	c.(394-396)gCa>gAa	p.A132E	NCAM2_ENST00000284894.7_Intron|NCAM2_ENST00000535285.1_Missense_Mutation_p.A157E|NCAM2_ENST00000486367.1_3'UTR	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	132	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		GGAGAAGATGCAGAAGTGGTT	0.393																																																	0													120.0	113.0	115.0					21																	22658646		2000	4183	6183	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.395C>A	21.37:g.22658646C>A	ENSP00000383392:p.Ala132Glu		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.A132E	ENST00000400546.1	37	c.395	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998088	0.93227	.	.	ENSG00000154654	ENST00000400546;ENST00000535285	T;T	0.32988	1.43;1.43	5.28	5.28	0.74379	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70798	0.3265	H	0.97611	4.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.987	T	0.82376	-0.0488	10	0.72032	D	0.01	-11.4161	17.4781	0.87666	0.0:1.0:0.0:0.0	.	157;132	B7Z841;O15394	.;NCAM2_HUMAN	E	132;157	ENSP00000383392:A132E;ENSP00000441887:A157E	ENSP00000383392:A132E	A	+	2	0	NCAM2	21580517	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.545000	0.67237	2.466000	0.83321	0.561000	0.74099	GCA	NCAM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_Neural_cell_adh	ENSG00000154654		0.393	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1		0.00	29	0	C	NM_004540		22658646	+1			no_errors	ENST00000400546	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	A
NFKBIZ	64332	genome.wustl.edu	37	3	101574724	101574724	+	Missense_Mutation	SNP	T	T	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:101574724T>A	ENST00000326172.5	+	9	1917	c.1802T>A	c.(1801-1803)aTg>aAg	p.M601K	NFKBIZ_ENST00000394054.2_Missense_Mutation_p.M501K|NFKBIZ_ENST00000326151.5_Missense_Mutation_p.M479K	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	601	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						CTAATTCAAATGGGAGCAGCG	0.423																																																	0													75.0	73.0	74.0					3																	101574724		2203	4300	6503	SO:0001583	missense	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1802T>A	3.37:g.101574724T>A	ENSP00000325663:p.Met601Lys		B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M601K	ENST00000326172.5	37	c.1802	CCDS2946.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.44|19.44	3.827906|3.827906	0.71143|0.71143	.|.	.|.	ENSG00000144802|ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172|ENST00000477601	T;T;T;T|.	0.62788|.	-0.0;-0.0;0.09;0.09|.	5.92|5.92	5.92|5.92	0.95590|0.95590	Ankyrin repeat-containing domain (4);|.	0.088337|.	0.85682|.	D|.	0.000000|.	T|T	0.28830|0.28830	0.0715|0.0715	N|N	0.01250|0.01250	-0.93|-0.93	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.994;0.999|.	D;D|.	0.87578|.	0.981;0.998|.	T|T	0.37103|0.37103	-0.9720|-0.9720	10|5	0.02654|.	T|.	1|.	-10.6099|-10.6099	16.3604|16.3604	0.83263|0.83263	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	479;601|.	Q9BYH8-3;Q9BYH8|.	.;IKBZ_HUMAN|.	K|R	501;501;479;601|50	ENSP00000419800:M501K;ENSP00000377618:M501K;ENSP00000325593:M479K;ENSP00000325663:M601K|.	ENSP00000325593:M479K|.	M|W	+|+	2|1	0|0	NFKBIZ|NFKBIZ	103057414|103057414	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	6.667000|6.667000	0.74451|0.74451	2.260000|2.260000	0.74910|0.74910	0.528000|0.528000	0.53228|0.53228	ATG|TGG	NFKBIZ	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000144802		0.423	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	-	0.00	60	0	T	NM_031419		101574724	+1	tier1	-	no_errors	ENST00000326172	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	A
NHLRC2	374354	genome.wustl.edu	37	10	115668044	115668044	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:115668044G>T	ENST00000369301.3	+	11	2142	c.1930G>T	c.(1930-1932)Gaa>Taa	p.E644*		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	644										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		TTTAGGCAATGAATGGCTACT	0.328																																																	0													72.0	69.0	70.0					10																	115668044		2203	4300	6503	SO:0001587	stop_gained	0			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1930G>T	10.37:g.115668044G>T	ENSP00000358307:p.Glu644*		Q8N1H1|Q8N5A6	Nonsense_Mutation	SNP	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.E644*	ENST00000369301.3	37	c.1930	CCDS7585.1	10	.	.	.	.	.	.	.	.	.	.	G	40	8.049437	0.98629	.	.	ENSG00000196865	ENST00000369301	.	.	.	5.77	5.77	0.91146	.	0.118209	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-31.6857	11.8806	0.52574	0.0861:0.0:0.9139:0.0	.	.	.	.	X	644	.	ENSP00000358307:E644X	E	+	1	0	NHLRC2	115658034	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.716000	0.68437	2.735000	0.93741	0.655000	0.94253	GAA	NHLRC2	-	NULL	ENSG00000196865		0.328	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	HGNC	protein_coding	OTTHUMT00000050446.1		0.00	31	0	G	NM_198514		115668044	+1			no_errors	ENST00000369301	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	1.000	T
NHLRC3	387921	genome.wustl.edu	37	13	39622028	39622028	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr13:39622028C>T	ENST00000379600.3	+	7	1331	c.1009C>T	c.(1009-1011)Cct>Tct	p.P337S	NHLRC3_ENST00000470258.1_Missense_Mutation_p.P140S|NHLRC3_ENST00000379599.2_Missense_Mutation_p.P270S	NM_001012754.3	NP_001012772.1	Q5JS37	NHLC3_HUMAN	NHL repeat containing 3	337						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|skin(2)	11		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;2.37e-08)|Epithelial(112;3.14e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00101)|BRCA - Breast invasive adenocarcinoma(63;0.00335)|GBM - Glioblastoma multiforme(144;0.0128)		AAAATATGTCCCTTTGAATAG	0.368																																																	0													75.0	69.0	71.0					13																	39622028		2203	4300	6503	SO:0001583	missense	0				CCDS31961.1, CCDS31962.1	13q13.3	2007-12-18			ENSG00000188811	ENSG00000188811			33751	protein-coding gene	gene with protein product							Standard	NM_001017370		Approved		uc001uxc.4	Q5JS37	OTTHUMG00000016765	ENST00000379600.3:c.1009C>T	13.37:g.39622028C>T	ENSP00000368920:p.Pro337Ser		B2RTZ2|B4DTL0|Q69YI9	Missense_Mutation	SNP	pfam_NHL_repeat,pfscan_NHL_repeat_subgr	p.P337S	ENST00000379600.3	37	c.1009	CCDS31961.1	13	.	.	.	.	.	.	.	.	.	.	C	12.39	1.923813	0.34002	.	.	ENSG00000188811	ENST00000470258;ENST00000379600;ENST00000379599	D;D;D	0.90444	-2.67;-2.67;-2.67	4.95	4.11	0.48088	.	0.158182	0.64402	N	0.000019	D	0.93236	0.7845	M	0.66939	2.045	0.29927	N	0.822253	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.88970	0.3400	9	.	.	.	-3.8523	7.8564	0.29485	0.1593:0.7589:0.0:0.0817	.	270;337	B4DTL0;Q5JS37	.;NHLC3_HUMAN	S	140;337;270	ENSP00000418127:P140S;ENSP00000368920:P337S;ENSP00000368919:P270S	.	P	+	1	0	NHLRC3	38520028	0.999000	0.42202	0.027000	0.17364	0.029000	0.11900	5.167000	0.64972	1.217000	0.43442	-0.253000	0.11424	CCT	NHLRC3	-	NULL	ENSG00000188811		0.368	NHLRC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC3	HGNC	protein_coding	OTTHUMT00000044616.2	-	0.00	20	0	C	NM_001012754		39622028	+1	tier1	-	no_errors	ENST00000379600	ensembl	human	known	74_37	missense	33.33	14	7	SNP	0.648	T
NLRC3	197358	genome.wustl.edu	37	16	3613041	3613041	+	RNA	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:3613041G>A	ENST00000301749.7	-	0	2302				NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000603507.1_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGCTGGGGCAGCAGGCTCTGA	0.697																																																	0													6.0	8.0	7.0					16																	3613041		1917	4070	5987			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3613041G>A			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Silent	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L680	ENST00000301749.7	37	c.2038		16																																																																																			NLRC3	-	NULL	ENSG00000167984		0.697	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene			0.00	96	0	G	NM_178844		3613041	-1			no_errors	ENST00000448023	ensembl	human	known	74_37	silent	5.33	70	4	SNP	1.000	A
NLRC5	84166	genome.wustl.edu	37	16	57060578	57060581	+	Frame_Shift_Del	DEL	CCCT	CCCT	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	CCCT	CCCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:57060578_57060581delCCCT	ENST00000262510.6	+	6	1948_1951	c.1723_1726delCCCT	c.(1723-1728)cccttcfs	p.PF575fs	NLRC5_ENST00000308149.7_Frame_Shift_Del_p.PF575fs|NLRC5_ENST00000539144.1_Frame_Shift_Del_p.PF575fs|NLRC5_ENST00000436936.1_Frame_Shift_Del_p.PF575fs	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	575					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				CACCTGCCGCCCCTTCCTTAGCCA	0.632																																																	0																																										SO:0001589	frameshift_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1723_1726delCCCT	16.37:g.57060578_57060581delCCCT	ENSP00000262510:p.Pro575fs		B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.P575fs	ENST00000262510.6	37	c.1723_1726	CCDS10773.1	16																																																																																			NLRC5	-	NULL	ENSG00000140853		0.632	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1		0.00	35	0	CCCT	NM_032206		57060581	+1	tier1		no_errors	ENST00000262510	ensembl	human	known	74_37	frame_shift_del	40.00	9	6	DEL	0.001:0.047:0.060:0.978	-
NOLC1	9221	genome.wustl.edu	37	10	103912168	103912168	+	Start_Codon_SNP	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:103912168A>T	ENST00000605788.1	+	1	236	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	NOLC1_ENST00000603742.1_De_novo_Start_OutOfFrame|NOLC1_ENST00000488254.2_Start_Codon_SNP_p.M1L|NOLC1_ENST00000405356.1_Start_Codon_SNP_p.M1L	NM_001284389.1|NM_004741.3	NP_001271318.1|NP_004732.2	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	1					cell cycle (GO:0007049)|mitotic nuclear division (GO:0007067)|nucleolus organization (GO:0007000)|rRNA processing (GO:0006364)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	31		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		TGCCTGGAGGATGGCGGACGC	0.632																																																	0													80.0	79.0	79.0					10																	103912168		2203	4300	6503	SO:0001582	initiator_codon_variant	0			Z34289	CCDS7530.1, CCDS65925.1, CCDS65926.1	10q24.32	2008-08-01			ENSG00000166197	ENSG00000166197			15608	protein-coding gene	gene with protein product		602394				7657714, 10567578	Standard	XM_005270273		Approved	P130, KIAA0035, NOPP140, NOPP130	uc001kuo.2	Q14978	OTTHUMG00000018944	ENST00000605788.1:c.1A>T	10.37:g.103912168A>T	ENSP00000474710:p.Met1Leu		Q15030|Q5VV70|Q9BUV3	Missense_Mutation	SNP	pfam_SRP40_C,pfscan_LisH_dimerisation	p.M1L	ENST00000605788.1	37	c.1	CCDS7530.1	10	.	.	.	.	.	.	.	.	.	.	A	17.94	3.511600	0.64522	.	.	ENSG00000166197	ENST00000405356;ENST00000370007	T	0.31510	1.49	5.4	5.4	0.78164	.	0.064023	0.64402	D	0.000003	T	0.54398	0.1856	.	.	.	0.80722	D	1	P;P;P	0.51147	0.942;0.942;0.904	D;D;P	0.67231	0.95;0.95;0.892	T	0.58142	-0.7688	9	0.87932	D	0	-20.3857	13.2901	0.60267	1.0:0.0:0.0:0.0	.	1;1;1	Q14978-3;Q14978-2;Q14978	.;.;NOLC1_HUMAN	L	1	ENSP00000385410:M1L	ENSP00000359024:M1L	M	+	1	0	NOLC1	103902158	1.000000	0.71417	0.948000	0.38648	0.216000	0.24613	4.910000	0.63321	2.270000	0.75569	0.459000	0.35465	ATG	NOLC1	-	NULL	ENSG00000166197		0.632	NOLC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NOLC1	HGNC	protein_coding	OTTHUMT00000050012.2	-	0.00	62	0	A	NM_004741	Missense_Mutation	103912168	+1	tier1	-	no_errors	ENST00000405356	ensembl	human	known	74_37	missense	24.14	44	14	SNP	0.982	T
NOTCH3	4854	genome.wustl.edu	37	19	15281251	15281251	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:15281251G>A	ENST00000263388.2	-	27	5080	c.5005C>T	c.(5005-5007)Cgc>Tgc	p.R1669C		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1669					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CTGTGCTCGCGCTTGCGCCGG	0.677																																																	0													39.0	45.0	43.0					19																	15281251		2203	4299	6502	SO:0001583	missense	0			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5005C>T	19.37:g.15281251G>A	ENSP00000263388:p.Arg1669Cys		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1669C	ENST00000263388.2	37	c.5005	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955492	0.73902	.	.	ENSG00000074181	ENST00000263388	D	0.85556	-2.0	3.69	3.69	0.42338	.	.	.	.	.	D	0.91818	0.7411	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.71184	0.972	D	0.92102	0.5689	9	0.87932	D	0	.	8.6299	0.33913	0.0:0.0:0.6333:0.3666	.	1669	Q9UM47	NOTC3_HUMAN	C	1669	ENSP00000263388:R1669C	ENSP00000263388:R1669C	R	-	1	0	NOTCH3	15142251	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	1.978000	0.40598	1.906000	0.55180	0.491000	0.48974	CGC	NOTCH3	-	pirsf_Notch	ENSG00000074181		0.677	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	-	0.00	23	0	G	NM_000435		15281251	-1	tier1	-	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	40.62	19	13	SNP	1.000	A
NOVA1	4857	genome.wustl.edu	37	14	27064755	27064755	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs141059341		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr14:27064755G>A	ENST00000267422.7	-	0	140				NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000465357.2_Silent_p.D47D|NOVA1_ENST00000344429.5_Silent_p.D47D|NOVA1_ENST00000539517.2_Silent_p.D47D|NOVA1_ENST00000547619.1_Silent_p.D47D|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1_ENST00000574031.1_Silent_p.D47D|NOVA1_ENST00000551754.1_5'Flank			P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1						locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		AATACTGGCCGTCTTCTGAAA	0.393																																																	0								G	,,	0,4406		0,0,2203	69.0	65.0	66.0		141,141,141	4.9	1.0	14	dbSNP_134	66	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous	NOVA1	NM_002515.2,NM_006489.2,NM_006491.2	,,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,,	47/508,47/484,47/182	27064755	2,13004	2203	4300	6503			0			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000267422.7:c.-328C>T	14.37:g.27064755G>A			A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Silent	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.D47	ENST00000267422.7	37	c.141		14																																																																																			NOVA1	-	NULL	ENSG00000139910		0.393	NOVA1-201	KNOWN	basic	protein_coding	NOVA1	HGNC	protein_coding			0.00	31	0	G	NM_006491		27064755	-1			no_errors	ENST00000539517	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	A
NRG1	3084	genome.wustl.edu	37	8	32621513	32621513	+	Missense_Mutation	SNP	G	G	A	rs376858256	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:32621513G>A	ENST00000405005.3	+	12	1516	c.1516G>A	c.(1516-1518)Gcg>Acg	p.A506T	NRG1_ENST00000341377.5_3'UTR|NRG1_ENST00000519301.1_Missense_Mutation_p.A456T|NRG1_ENST00000356819.4_Missense_Mutation_p.A511T|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000521670.1_3'UTR|NRG1_ENST00000287842.3_Missense_Mutation_p.A503T|NRG1_ENST00000287845.5_Missense_Mutation_p.A477T|NRG1_ENST00000539990.1_Missense_Mutation_p.A349T|NRG1_ENST00000338921.4_Missense_Mutation_p.A514T			Q02297	NRG1_HUMAN	neuregulin 1	506					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCACAACCCCGCGCATGACAG	0.547													G|||	2	0.000399361	0.0008	0.0	5008	,	,		17909	0.0		0.0	False		,,,				2504	0.001																0								G	,,,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	104.0	82.0	89.0		,,,1516,1507,1531,1366,1468,1417	5.8	0.9	8		89	0,8600		0,0,4300	no	utr-3,utr-3,utr-3,missense,missense,missense,missense,missense,missense	NRG1	NM_001159996.1,NM_001160004.1,NM_013960.3,NM_013964.3,NM_013957.3,NM_013956.3,NM_001160001.1,NM_001159999.1,NM_001159995.1	,,,58,58,58,58,58,58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,benign,benign,benign,benign,benign,benign	,,,506/641,503/638,511/646,456/591,490/625,473/608	32621513	1,13005	2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1516G>A	8.37:g.32621513G>A	ENSP00000384620:p.Ala506Thr		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.A514T	ENST00000405005.3	37	c.1540	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	4.025	0.002079	0.07819	2.27E-4	0.0	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.75	5.75	0.90469	Neuregulin 1-related, C-terminal (1);	0.245097	0.39210	N	0.001424	T	0.36608	0.0973	N	0.12182	0.205	0.09310	N	1	B;B;B;B;B;B;B	0.24426	0.056;0.01;0.03;0.001;0.103;0.073;0.024	B;B;B;B;B;B;B	0.19666	0.016;0.015;0.026;0.001;0.015;0.026;0.015	T	0.33111	-0.9881	10	0.49607	T	0.09	-11.3637	15.12	0.72434	0.0696:0.0:0.9304:0.0	.	349;477;511;514;503;506;511	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	T	473;456;579;514;511;506;477;503;506;349	ENSP00000430053:A473T;ENSP00000429582:A456T;ENSP00000429067:A579T;ENSP00000343395:A514T;ENSP00000349275:A511T;ENSP00000287840:A506T;ENSP00000287845:A477T;ENSP00000287842:A503T;ENSP00000384620:A506T;ENSP00000439276:A349T	ENSP00000287840:A506T	A	+	1	0	NRG1	32741055	0.570000	0.26651	0.924000	0.36721	0.016000	0.09150	2.157000	0.42320	2.724000	0.93272	0.455000	0.32223	GCG	NRG1	-	pfam_Neuregulin_1_C	ENSG00000157168		0.547	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	45	0	G			32621513	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	24.44	68	22	SNP	0.039	A
NSD1	64324	genome.wustl.edu	37	5	176694593	176694593	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:176694593C>T	ENST00000439151.2	+	15	5222	c.5177C>T	c.(5176-5178)cCt>cTt	p.P1726L	NSD1_ENST00000354179.4_Missense_Mutation_p.P1457L|NSD1_ENST00000361032.4_Missense_Mutation_p.P1623L|NSD1_ENST00000347982.4_Missense_Mutation_p.P1457L	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1726					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.P1726L(1)|p.P1726H(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GATTCTTGCCCTGCTGCTTTT	0.438			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CM033420	NSD1	M							233.0	216.0	222.0					5																	176694593		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5177C>T	5.37:g.176694593C>T	ENSP00000395929:p.Pro1726Leu		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.P1726L	ENST00000439151.2	37	c.5177	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.312496	0.95655	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33	5.51	5.51	0.81932	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.56097	D	0.000024	D	0.94414	0.8203	M	0.84773	2.715	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94844	0.8007	10	0.87932	D	0	.	19.4078	0.94655	0.0:1.0:0.0:0.0	.	1457;1623;1726	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	L	1457;1726;1457;1623	ENSP00000346111:P1457L;ENSP00000395929:P1726L;ENSP00000343209:P1457L;ENSP00000354310:P1623L	ENSP00000343209:P1457L	P	+	2	0	NSD1	176627199	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.600000	0.87896	0.655000	0.94253	CCT	NSD1	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000165671		0.438	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	25	0	C	NM_172349		176694593	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	missense	53.85	18	21	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176709465	176709465	+	Splice_Site	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:176709465G>A	ENST00000439151.2	+	19	5937		c.e19-1		NSD1_ENST00000354179.4_Splice_Site|NSD1_ENST00000361032.4_Splice_Site|NSD1_ENST00000347982.4_Splice_Site	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1						gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		TCTTGTTCTAGGGTGAATTTG	0.328			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													202.0	203.0	203.0					5																	176709465		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.5893-1G>A	5.37:g.176709465G>A			Q96PD8|Q96RN7	Splice_Site	SNP	-	e18-1	ENST00000439151.2	37	c.5893-1	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.227339	0.95173	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2543	0.98414	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NSD1	176642071	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.860000	0.99555	2.884000	0.98904	0.655000	0.94253	.	NSD1	-	-	ENSG00000165671		0.328	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	44	0	G	NM_172349	Intron	176709465	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	splice_site	33.80	47	24	SNP	1.000	A
NUB1	51667	genome.wustl.edu	37	7	151065005	151065005	+	Missense_Mutation	SNP	G	G	A	rs373576077		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:151065005G>A	ENST00000355851.4	+	10	1123	c.1046G>A	c.(1045-1047)cGa>cAa	p.R349Q	NUB1_ENST00000568733.1_Missense_Mutation_p.R373Q|NUB1_ENST00000566856.1_Missense_Mutation_p.R349Q|NUB1_ENST00000413040.2_Missense_Mutation_p.R373Q	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	349					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)		p.R349Q(2)		endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		CAAGGGATCCGAAACTATCAC	0.323											OREG0018452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Substitution - Missense(2)	large_intestine(2)						G	GLN/ARG	1,3659		0,1,1829	64.0	59.0	61.0		1046	3.8	0.8	7		61	0,8182		0,0,4091	no	missense	NUB1	NM_016118.4	43	0,1,5920	AA,AG,GG		0.0,0.0273,0.0084	benign	349/602	151065005	1,11841	1830	4091	5921	SO:0001583	missense	0			AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.1046G>A	7.37:g.151065005G>A	ENSP00000348110:p.Arg349Gln	1737	O95422|Q75MR9|Q8IX22|Q9BXR2	Missense_Mutation	SNP	pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.R373Q	ENST00000355851.4	37	c.1118		7	.	.	.	.	.	.	.	.	.	.	G	7.323	0.617344	0.14129	2.73E-4	0.0	ENSG00000013374	ENST00000413040;ENST00000355851	T	0.62788	0.0	5.63	3.77	0.43336	UBA-like (1);	0.252750	0.34156	N	0.004213	T	0.46151	0.1378	L	0.36672	1.1	0.21445	N	0.99968	B;B	0.20988	0.03;0.05	B;B	0.09377	0.002;0.004	T	0.30592	-0.9973	10	0.33940	T	0.23	-9.2092	5.9963	0.19495	0.0727:0.1347:0.6531:0.1395	.	349;349	Q9Y5A7;Q9Y5A7-2	NUB1_HUMAN;.	Q	349	ENSP00000348110:R349Q	ENSP00000348110:R349Q	R	+	2	0	NUB1	150695938	1.000000	0.71417	0.776000	0.31678	0.247000	0.25773	4.126000	0.57937	0.684000	0.31448	0.655000	0.94253	CGA	NUB1	-	superfamily_UBA-like	ENSG00000013374		0.323	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding		-	0.00	31	0	G	NM_016118		151065005	+1	tier1	-	no_errors	ENST00000568733	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.909	A
NUP160	23279	genome.wustl.edu	37	11	47801978	47801978	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:47801978G>A	ENST00000378460.2	-	35	4184	c.4138C>T	c.(4138-4140)Cca>Tca	p.P1380S	NUP160_ENST00000530326.1_Intron	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa	1380					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						CACACCATTGGGGCTGTTGCG	0.448																																																	0													86.0	83.0	84.0					11																	47801978		2201	4298	6499	SO:0001583	missense	0			D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.4138C>T	11.37:g.47801978G>A	ENSP00000367721:p.Pro1380Ser		B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Missense_Mutation	SNP	pfam_Nucleoporin_Nup160	p.P1380S	ENST00000378460.2	37	c.4138	CCDS31484.1	11	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733938	0.48939	.	.	ENSG00000030066	ENST00000378460	T	0.30448	1.53	5.79	5.79	0.91817	.	0.380280	0.33290	N	0.005073	T	0.25680	0.0625	L	0.40543	1.245	0.80722	D	1	B	0.25719	0.132	B	0.22152	0.038	T	0.11446	-1.0587	10	0.02654	T	1	.	19.6761	0.95934	0.0:0.0:1.0:0.0	.	1380	Q12769	NU160_HUMAN	S	1380	ENSP00000367721:P1380S	ENSP00000367721:P1380S	P	-	1	0	NUP160	47758554	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.444000	0.60001	2.744000	0.94065	0.585000	0.79938	CCA	NUP160	-	NULL	ENSG00000030066		0.448	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP160	HGNC	protein_coding	OTTHUMT00000390239.2		0.00	46	0	G	NM_015231		47801978	-1			no_errors	ENST00000378460	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.953	A
OGFR	11054	genome.wustl.edu	37	20	61444312	61444312	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr20:61444312G>T	ENST00000290291.6	+	7	1370	c.1345G>T	c.(1345-1347)Gcc>Tcc	p.A449S	OGFR_ENST00000370461.1_Missense_Mutation_p.A397S	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	449					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					ACCCCTGGGAGCCAGGGTGGC	0.701																																																	0													27.0	31.0	30.0					20																	61444312		2196	4296	6492	SO:0001583	missense	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1345G>T	20.37:g.61444312G>T	ENSP00000290291:p.Ala449Ser		O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.A449S	ENST00000290291.6	37	c.1345	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	G	17.25	3.340748	0.60963	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.35236	1.78;1.32	4.99	-1.68	0.08212	.	0.606011	0.14663	N	0.305846	T	0.21103	0.0508	L	0.51422	1.61	0.09310	N	1	B;B;B	0.30824	0.296;0.296;0.296	B;B;B	0.19946	0.027;0.027;0.027	T	0.10590	-1.0623	10	0.30078	T	0.28	-19.3112	1.9705	0.03405	0.1372:0.3641:0.17:0.3287	.	449;432;449	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	S	449;449;304;397	ENSP00000290291:A449S;ENSP00000359491:A397S	ENSP00000290291:A449S	A	+	1	0	OGFR	60914757	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.207000	0.17395	0.086000	0.17137	0.561000	0.74099	GCC	OGFR	-	NULL	ENSG00000060491		0.701	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	-	0.00	31	0	G			61444312	+1	tier1	-	no_errors	ENST00000290291	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.000	T
OR1D4	653166	genome.wustl.edu	37	17	3144529	3144529	+	RNA	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:3144529T>C	ENST00000531680.1	+	0	560					NR_033795.1		P47884	OR1D4_HUMAN	olfactory receptor, family 1, subfamily D, member 4 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CTGCTGTGGCTGGCATGTTCC	0.527																																																	0																																												0			U04681		17p13.3	2014-03-20	2010-07-19		ENSG00000255095	ENSG00000255095		"""GPCR / Class A : Olfactory receptors"""	8185	protein-coding gene	gene with protein product			"""olfactory receptor, family 1, subfamily D, member 4"""			8004088, 10673334	Standard	NR_033795		Approved	OR17-30	uc002fvf.3	P47884	OTTHUMG00000166844		17.37:g.3144529T>C			Q96RA5|Q9UM75	RNA	SNP	-	NULL	ENST00000531680.1	37	NULL		17																																																																																			OR1D4	-	-	ENSG00000255095		0.527	OR1D4-002	KNOWN	basic	processed_transcript	OR1D4	HGNC	pseudogene	OTTHUMT00000391569.1	-	0.00	23	0	T	NM_003552		3144529	+1	tier1	-	no_errors	ENST00000531680	ensembl	human	known	74_37	rna	55.17	13	16	SNP	0.148	C
OR2T11	127077	genome.wustl.edu	37	1	248790145	248790145	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:248790145G>T	ENST00000330803.2	-	1	346	c.285C>A	c.(283-285)ggC>ggA	p.G95G		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	95						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGATCTGGATGCCACAGGCCA	0.493																																																	0													71.0	67.0	69.0					1																	248790145		2053	4231	6284	SO:0001819	synonymous_variant	0			BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.285C>A	1.37:g.248790145G>T			Q6IEY6	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G95	ENST00000330803.2	37	c.285	CCDS31122.1	1																																																																																			OR2T11	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000183130		0.493	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T11	HGNC	protein_coding	OTTHUMT00000097134.1		0.00	52	0	G	NM_001001964		248790145	-1			no_errors	ENST00000330803	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.828	T
OR6A2	8590	genome.wustl.edu	37	11	6816277	6816277	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:6816277G>T	ENST00000332601.3	-	1	851	c.663C>A	c.(661-663)gcC>gcA	p.A221A		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	221					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CCACATAGGAGGCCCCAGTGA	0.493																																																	0													98.0	104.0	102.0					11																	6816277		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.663C>A	11.37:g.6816277G>T			Q3MJC7|Q6IF35|Q9H206	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A221	ENST00000332601.3	37	c.663	CCDS7772.1	11																																																																																			OR6A2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000184933		0.493	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	HGNC	protein_coding	OTTHUMT00000385981.1	-	0.00	20	0	G	NM_003696		6816277	-1	tier1	-	no_errors	ENST00000332601	ensembl	human	known	74_37	silent	34.78	15	8	SNP	0.050	T
OR4S1	256148	genome.wustl.edu	37	11	48328641	48328641	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:48328641C>T	ENST00000319988.1	+	1	867	c.867C>T	c.(865-867)aaC>aaT	p.N289N		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						CACTAAGGAACAACGATGTGA	0.453																																																	0													95.0	87.0	90.0					11																	48328641		2201	4298	6499	SO:0001819	synonymous_variant	0			AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.867C>T	11.37:g.48328641C>T			Q6IFB4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N289	ENST00000319988.1	37	c.867	CCDS31488.1	11																																																																																			OR4S1	-	prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000176555		0.453	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	HGNC	protein_coding	OTTHUMT00000390556.1	-	0.00	26	0	C	NM_001004725		48328641	+1	tier1	-	no_errors	ENST00000319988	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.010	T
PCDH20	64881	genome.wustl.edu	37	13	61987736	61987736	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr13:61987736C>T	ENST00000409186.1	-	5	2601	c.496G>A	c.(496-498)Gtt>Att	p.V166I	PCDH20_ENST00000409204.4_Missense_Mutation_p.V166I			Q8N6Y1	PCD20_HUMAN	protocadherin 20	166	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		GAGATGGAAACGCTGCCGCTC	0.562																																																	0													82.0	64.0	70.0					13																	61987736		2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.496G>A	13.37:g.61987736C>T	ENSP00000386653:p.Val166Ile		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V166I	ENST00000409186.1	37	c.496	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	c	11.08	1.532957	0.27387	.	.	ENSG00000197991	ENST00000409204;ENST00000409186	T;T	0.54279	0.58;0.58	5.65	-0.753	0.11068	.	0.749161	0.12219	N	0.488539	T	0.32224	0.0822	N	0.14661	0.345	0.18873	N	0.999987	B	0.02656	0.0	B	0.04013	0.001	T	0.18429	-1.0337	10	0.35671	T	0.21	.	10.5448	0.45054	0.0:0.513:0.0:0.487	.	166	A8K1K9	.	I	166	ENSP00000387250:V166I;ENSP00000386653:V166I	ENSP00000386653:V166I	V	-	1	0	PCDH20	60885737	0.993000	0.37304	0.995000	0.50966	0.950000	0.60333	0.427000	0.21379	-0.114000	0.11936	-0.310000	0.09108	GTT	PCDH20	-	pfscan_Cadherin	ENSG00000197991		0.562	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	-	0.00	47	0	C	NM_022843		61987736	-1	tier1	-	no_errors	ENST00000409186	ensembl	human	known	74_37	missense	36.84	36	21	SNP	0.997	T
PCDHGA6	56109	genome.wustl.edu	37	5	140755131	140755131	+	Missense_Mutation	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:140755131A>G	ENST00000517434.1	+	1	1481	c.1481A>G	c.(1480-1482)gAc>gGc	p.D494G	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	494	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCAGAAGACACCCTCCAG	0.582																																																	0													110.0	126.0	121.0					5																	140755131		2088	4235	6323	SO:0001583	missense	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1481A>G	5.37:g.140755131A>G	ENSP00000429601:p.Asp494Gly		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D494G	ENST00000517434.1	37	c.1481	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	1.816	-0.473532	0.04445	.	.	ENSG00000253731	ENST00000517434	T	0.44083	0.93	5.13	0.151	0.14888	Cadherin (4);Cadherin-like (1);	1.888080	0.04317	U	0.350075	T	0.23611	0.0571	N	0.03917	-0.325	0.09310	N	1	B;B	0.16802	0.008;0.019	B;B	0.26693	0.012;0.072	T	0.27872	-1.0061	10	0.25751	T	0.34	.	9.6505	0.39895	0.5175:0.0:0.4825:0.0	.	494;494	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	G	494	ENSP00000429601:D494G	ENSP00000429601:D494G	D	+	2	0	PCDHGA6	140735315	0.006000	0.16342	0.009000	0.14445	0.055000	0.15305	1.237000	0.32695	0.150000	0.19136	0.533000	0.62120	GAC	PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253731		0.582	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1		0.00	56	0	A	NM_018919		140755131	+1			no_errors	ENST00000517434	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	G
PDZD7	79955	genome.wustl.edu	37	10	102789899	102789899	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:102789899G>A	ENST00000370215.3	-	2	303	c.78C>T	c.(76-78)tcC>tcT	p.S26S	PDZD7_ENST00000470414.1_Silent_p.S26S|SFXN3_ENST00000224807.5_5'Flank|SFXN3_ENST00000393459.1_5'Flank	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	26						cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		GGCCTCGGGAGGAGAGGGAGC	0.677																																																	0													41.0	44.0	43.0					10																	102789899		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.78C>T	10.37:g.102789899G>A			D5FJ77|Q8N321	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S26	ENST00000370215.3	37	c.78	CCDS31269.1	10																																																																																			PDZD7	-	NULL	ENSG00000186862		0.677	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	-	0.00	111	0	G	NM_024895		102789899	-1	tier1	-	no_errors	ENST00000370215	ensembl	human	known	74_37	silent	37.04	68	40	SNP	1.000	A
PGD	5226	genome.wustl.edu	37	1	10468184	10468184	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:10468184C>A	ENST00000270776.8	+	6	544	c.506C>A	c.(505-507)cCc>cAc	p.P169H	PGD_ENST00000538557.1_Missense_Mutation_p.P156H|PGD_ENST00000541529.1_Missense_Mutation_p.P147H	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	169					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	ACTGGAGAACCCTGCTGTGAC	0.507																																																	0													168.0	166.0	167.0					1																	10468184		2203	4300	6503	SO:0001583	missense	0			BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.506C>A	1.37:g.10468184C>A	ENSP00000270776:p.Pro169His		A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	pfam_6PGDH_C,pfam_6PGDH_NADP-bd,superfamily_6-PGluconate_DH_C-like,tigrfam_6PGDH_decarbox	p.P169H	ENST00000270776.8	37	c.506	CCDS113.1	1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693924	0.88735	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.52754	0.69;0.66;0.65	5.06	5.06	0.68205	6-phosphogluconate dehydrogenase, NADP-binding (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.79387	0.4437	H	0.96048	3.76	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.74023	0.906;0.982	D	0.86515	0.1812	10	0.87932	D	0	-18.7386	18.8281	0.92127	0.0:1.0:0.0:0.0	.	147;169	F5H7U0;P52209	.;6PGD_HUMAN	H	147;115;169;156	ENSP00000442285:P147H;ENSP00000270776:P169H;ENSP00000437822:P156H	ENSP00000270776:P169H	P	+	2	0	PGD	10390771	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.559000	0.82265	2.514000	0.84764	0.462000	0.41574	CCC	PGD	-	pfam_6PGDH_NADP-bd,tigrfam_6PGDH_decarbox	ENSG00000142657		0.507	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGD	HGNC	protein_coding	OTTHUMT00000005398.1		0.00	26	0	C	NM_002631		10468184	+1			no_errors	ENST00000270776	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	A
PHKA2	5256	genome.wustl.edu	37	X	18915365	18915365	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:18915365C>T	ENST00000379942.4	-	30	3863	c.3198G>A	c.(3196-3198)caG>caA	p.Q1066Q	PHKA2-AS1_ENST00000452900.1_RNA|PHKA2-AS1_ENST00000439295.1_RNA|PHKA2_ENST00000481718.1_5'Flank	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1066	Calmodulin-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGCGCAGCCACTGGCCCTGCC	0.627																																																	0													51.0	43.0	46.0					X																	18915365		2203	4298	6501	SO:0001819	synonymous_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3198G>A	X.37:g.18915365C>T			A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.Q1066	ENST00000379942.4	37	c.3198	CCDS14190.1	X																																																																																			PHKA2	-	NULL	ENSG00000044446		0.627	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1		0.00	54	0	C	NM_000292		18915365	-1			no_errors	ENST00000379942	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110493751	110493751	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:110493751G>T	ENST00000378402.5	+	56	9521	c.9417G>T	c.(9415-9417)tgG>tgT	p.W3139C		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3139	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CACAAGACTGGGCTCTTCCAG	0.388										HNSCC(38;0.096)																																							0													69.0	68.0	68.0					8																	110493751		1829	4083	5912	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9417G>T	8.37:g.110493751G>T	ENSP00000367655:p.Trp3139Cys		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.W3139C	ENST00000378402.5	37	c.9417	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037766	0.75617	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.89123	-2.47;-2.47	5.77	5.77	0.91146	G8 domain (2);	0.000000	0.85682	D	0.000000	D	0.93828	0.8026	M	0.72118	2.19	0.58432	D	0.999999	D	0.62365	0.991	D	0.69142	0.962	D	0.93990	0.7266	10	0.72032	D	0.01	.	17.4723	0.87649	0.0:0.0:1.0:0.0	.	3139	Q86WI1	PKHL1_HUMAN	C	3139;67	ENSP00000367655:W3139C;ENSP00000437376:W67C	ENSP00000367655:W3139C	W	+	3	0	PKHD1L1	110562927	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.166000	0.77553	2.724000	0.93272	0.650000	0.86243	TGG	PKHD1L1	-	pfam_G8_domain	ENSG00000205038		0.388	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	61	0	G	NM_177531		110493751	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
PKP4	8502	genome.wustl.edu	37	2	159488428	159488428	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:159488428G>A	ENST00000389759.3	+	8	1429	c.1317G>A	c.(1315-1317)caG>caA	p.Q439Q	PKP4_ENST00000389757.3_Silent_p.Q439Q	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	439					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						AAGGATCGCAGACGGCGTTGT	0.498										HNSCC(62;0.18)																																							0													113.0	103.0	106.0					2																	159488428		2203	4300	6503	SO:0001819	synonymous_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1317G>A	2.37:g.159488428G>A			Q86W91	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q439	ENST00000389759.3	37	c.1317	CCDS33305.1	2																																																																																			PKP4	-	NULL	ENSG00000144283		0.498	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	-	0.00	35	0	G			159488428	+1	tier1	-	no_errors	ENST00000389759	ensembl	human	known	74_37	silent	32.35	46	22	SNP	1.000	A
PMP2	5375	genome.wustl.edu	37	8	82359617	82359617	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:82359617C>T	ENST00000256103.2	-	1	141	c.5G>A	c.(4-6)aGc>aAc	p.S2N	PMP2_ENST00000519260.1_Missense_Mutation_p.S2N|RP11-157I4.4_ENST00000524085.2_RNA	NM_002677.3	NP_002668.1	P02689	MYP2_HUMAN	peripheral myelin protein 2	2					membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	cholesterol binding (GO:0015485)|fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			Epithelial(68;0.186)			GAATTTGTTGCTCATCGTGAT	0.423																																																	0													105.0	101.0	102.0					8																	82359617		2203	4300	6503	SO:0001583	missense	0			X62167	CCDS6229.1	8q21.3-q22.1	2013-03-01			ENSG00000147588	ENSG00000147588		"""Fatty acid binding protein family"""	9117	protein-coding gene	gene with protein product		170715				1720307, 8288226	Standard	NM_002677		Approved	MP2, FABP8, M-FABP	uc003ycb.1	P02689	OTTHUMG00000164600	ENST00000256103.2:c.5G>A	8.37:g.82359617C>T	ENSP00000256103:p.Ser2Asn		Q6FHL4	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.S2N	ENST00000256103.2	37	c.5	CCDS6229.1	8	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710718	0.30322	.	.	ENSG00000147588	ENST00000256103;ENST00000519260	T;T	0.42513	2.74;0.97	5.98	3.95	0.45737	.	0.275476	0.40554	N	0.001077	T	0.28134	0.0694	N	0.24115	0.695	0.21147	N	0.999772	B	0.15473	0.013	B	0.15870	0.014	T	0.23904	-1.0175	10	0.87932	D	0	.	8.4025	0.32594	0.0:0.757:0.146:0.097	.	2	P02689	MYP2_HUMAN	N	2	ENSP00000256103:S2N;ENSP00000429917:S2N	ENSP00000256103:S2N	S	-	2	0	PMP2	82522172	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	2.390000	0.44416	0.662000	0.31006	0.650000	0.86243	AGC	PMP2	-	NULL	ENSG00000147588		0.423	PMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP2	HGNC	protein_coding	OTTHUMT00000379365.1	-	0.00	47	0	C	NM_002677		82359617	-1	tier1	-	no_errors	ENST00000256103	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
POSTN	10631	genome.wustl.edu	37	13	38137315	38137316	+	3'UTR	INS	-	-	A	rs540445013	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr13:38137315_38137316insA	ENST00000379747.4	-	0	2782_2783				POSTN_ENST00000541179.1_3'UTR|POSTN_ENST00000379742.4_3'UTR|POSTN_ENST00000379743.4_3'UTR|POSTN_ENST00000379749.4_3'UTR	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTCTCATTCAGAAAAAAAAATA	0.327																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.*155->T	13.37:g.38137324_38137324dupA			B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	RNA	INS	-	NULL	ENST00000379747.4	37	NULL	CCDS9364.1	13																																																																																			POSTN	-	-	ENSG00000133110		0.327	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2		0.00	15	0	-	NM_006475		38137316	-1	tier1		no_errors	ENST00000478947	ensembl	human	known	74_37	rna	8.70	21	2	INS	0.014:0.028	A
PPFIA2	8499	genome.wustl.edu	37	12	81839369	81839369	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:81839369G>T	ENST00000549396.1	-	6	696	c.536C>A	c.(535-537)tCt>tAt	p.S179Y	PPFIA2_ENST00000550359.2_Missense_Mutation_p.S26Y|PPFIA2_ENST00000407050.4_Missense_Mutation_p.S105Y|PPFIA2_ENST00000552948.1_Missense_Mutation_p.S179Y|PPFIA2_ENST00000548586.1_Missense_Mutation_p.S179Y|PPFIA2_ENST00000549325.1_Missense_Mutation_p.S161Y|PPFIA2_ENST00000550584.2_Missense_Mutation_p.S179Y|PPFIA2_ENST00000333447.7_Missense_Mutation_p.S161Y|PPFIA2_ENST00000545296.2_5'UTR|RP11-315E17.1_ENST00000550272.1_RNA|PPFIA2_ENST00000443686.3_Missense_Mutation_p.S105Y	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	179	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CTCAAACAAAGATTTCAGTGC	0.428																																																	0													144.0	137.0	139.0					12																	81839369		1922	4142	6064	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.536C>A	12.37:g.81839369G>T	ENSP00000450337:p.Ser179Tyr		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S179Y	ENST00000549396.1	37	c.536	CCDS55857.1	12	.	.	.	.	.	.	.	.	.	.	G	30	5.051264	0.93740	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.61413	0.2345	L	0.32530	0.975	0.80722	D	1	D;D	0.69078	0.997;0.99	D;D	0.80764	0.994;0.974	T	0.63492	-0.6625	10	0.87932	D	0	-10.2236	19.7763	0.96395	0.0:0.0:1.0:0.0	.	79;179	B7Z4H8;O75334	.;LIPA2_HUMAN	Y	179;161;105;190;161;179;105;179	ENSP00000450337:S179Y;ENSP00000450298:S161Y;ENSP00000385093:S105Y;ENSP00000327416:S161Y;ENSP00000449338:S179Y;ENSP00000388373:S105Y;ENSP00000447868:S179Y	ENSP00000327416:S161Y	S	-	2	0	PPFIA2	80363500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.684000	0.91462	0.650000	0.86243	TCT	PPFIA2	-	NULL	ENSG00000139220		0.428	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	-	0.00	79	0	G			81839369	-1	tier1	-	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	21.33	59	16	SNP	1.000	T
PPP1R18	170954	genome.wustl.edu	37	6	30653411	30653411	+	Missense_Mutation	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:30653411T>C	ENST00000274853.3	-	1	2261	c.385A>G	c.(385-387)Atg>Gtg	p.M129V	PPP1R18_ENST00000488324.1_Intron|NRM_ENST00000470733.1_5'Flank|PPP1R18_ENST00000399199.3_Missense_Mutation_p.M129V	NM_133471.3	NP_597728.1	Q6NYC8	PPR18_HUMAN	protein phosphatase 1, regulatory subunit 18	129						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											TGATCCCGCATCTCCCCAGGG	0.612																																																	0													97.0	110.0	106.0					6																	30653411		1178	2508	3686	SO:0001583	missense	0			AK097089	CCDS43444.1	6p21.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000146112	ENSG00000146112		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29413	protein-coding gene	gene with protein product	"""protein phosphatase 1 F-actin cytoskeleton targeting subunit"""	610990	"""KIAA1949"""	KIAA1949		11853319	Standard	NM_001134870		Approved	phostensin	uc003nra.3	Q6NYC8	OTTHUMG00000031237	ENST00000274853.3:c.385A>G	6.37:g.30653411T>C	ENSP00000274853:p.Met129Val		A2AB01|A2AIB8|A4UBI6|A6NCB7|A8MSS7|B7ZCV7|Q68CK8|Q6ZTV1|Q6ZUJ6|Q8NDQ4|Q8TF52|Q9BRL9	Missense_Mutation	SNP	NULL	p.M129V	ENST00000274853.3	37	c.385	CCDS43444.1	6	.	.	.	.	.	.	.	.	.	.	T	3.231	-0.157464	0.06544	.	.	ENSG00000146112	ENST00000274853;ENST00000399199;ENST00000376424	T;T	0.21361	2.01;2.01	5.09	1.29	0.21616	.	1.536680	0.03795	N	0.263415	T	0.02727	0.0082	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35251	-0.9796	10	0.20046	T	0.44	6.963	3.6295	0.08126	0.1992:0.2763:0.0:0.5245	.	129	Q6NYC8	PPR18_HUMAN	V	129	ENSP00000274853:M129V;ENSP00000382150:M129V	ENSP00000274853:M129V	M	-	1	0	KIAA1949	30761390	0.001000	0.12720	0.039000	0.18376	0.970000	0.65996	0.215000	0.17562	0.379000	0.24794	-0.290000	0.09829	ATG	PPP1R18	-	NULL	ENSG00000146112		0.612	PPP1R18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R18	HGNC	protein_coding	OTTHUMT00000076498.2	-	0.00	48	0	T	NM_133471		30653411	-1	tier1	-	no_errors	ENST00000274853	ensembl	human	known	74_37	missense	42.59	31	23	SNP	0.023	C
PPP5C	5536	genome.wustl.edu	37	19	46857022	46857022	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:46857022G>A	ENST00000012443.4	+	2	242	c.139G>A	c.(139-141)Gcc>Acc	p.A47T	PPP5C_ENST00000391919.1_5'UTR	NM_006247.3	NP_006238.1	P53041	PPP5_HUMAN	protein phosphatase 5, catalytic subunit	47					cell death (GO:0008219)|DNA repair (GO:0006281)|mitotic nuclear division (GO:0007067)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein dephosphorylation (GO:0006470)|protein heterooligomerization (GO:0051291)|response to morphine (GO:0043278)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|RNA binding (GO:0003723)|signal transducer activity (GO:0004871)			endometrium(4)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|pancreas(1)	18		Ovarian(192;0.0731)|all_neural(266;0.196)		OV - Ovarian serous cystadenocarcinoma(262;0.000196)|all cancers(93;0.00192)|GBM - Glioblastoma multiforme(486;0.0499)|Epithelial(262;0.0504)		CTACGAGAACGCCATCAAGTT	0.602																																																	0													80.0	61.0	68.0					19																	46857022		2203	4300	6503	SO:0001583	missense	0				CCDS12684.1	19q13.3	2013-01-10			ENSG00000011485	ENSG00000011485	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	9322	protein-coding gene	gene with protein product		600658		PPP5		8666404	Standard	NM_006247		Approved	PP5	uc002pem.3	P53041	OTTHUMG00000134287	ENST00000012443.4:c.139G>A	19.37:g.46857022G>A	ENSP00000012443:p.Ala47Thr		Q16722|Q53XV2	Missense_Mutation	SNP	pfam_PEstase_dom,pfam_PPP_dom,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ser/Thr-sp_prot-phosphatase,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ser/Thr-sp_prot-phosphatase	p.A47T	ENST00000012443.4	37	c.139	CCDS12684.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.158354	0.94686	.	.	ENSG00000011485	ENST00000012443;ENST00000451918	D	0.89270	-2.49	5.09	5.09	0.68999	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.96679	0.8916	H	0.97962	4.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77004	0.951;0.989	D	0.98104	1.0416	10	0.87932	D	0	-17.1767	16.366	0.83321	0.0:0.0:1.0:0.0	.	47;47	B2R6R6;P53041	.;PPP5_HUMAN	T	47	ENSP00000012443:A47T	ENSP00000012443:A47T	A	+	1	0	PPP5C	51548862	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	8.977000	0.93446	2.531000	0.85337	0.563000	0.77884	GCC	PPP5C	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pirsf_Ser/Thr_PPase_5,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000011485		0.602	PPP5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP5C	HGNC	protein_coding	OTTHUMT00000258969.2		0.00	27	0	G	NM_006247		46857022	+1			no_errors	ENST00000012443	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
PRKD2	25865	genome.wustl.edu	37	19	47178336	47178336	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:47178336C>T	ENST00000291281.4	-	17	2603	c.2378G>A	c.(2377-2379)cGc>cAc	p.R793H	DACT3-AS1_ENST00000525008.1_RNA|PRKD2_ENST00000433867.1_Missense_Mutation_p.R793H|PRKD2_ENST00000595515.1_Missense_Mutation_p.R803H|PRKD2_ENST00000601806.1_Missense_Mutation_p.R636H|DACT3-AS1_ENST00000525352.1_RNA|PRKD2_ENST00000600194.1_Missense_Mutation_p.R636H			Q9BZL6	KPCD2_HUMAN	protein kinase D2	793	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GTAGCGTTTGCGCATCTTCAC	0.567																																																	0													96.0	64.0	75.0					19																	47178336		2203	4300	6503	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.2378G>A	19.37:g.47178336C>T	ENSP00000291281:p.Arg793His		Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.R793H	ENST00000291281.4	37	c.2378	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.566053	0.96540	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.65732	-0.17;-0.17	5.39	5.39	0.77823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.74344	0.3704	L	0.41961	1.31	0.58432	D	0.999999	D;D;D	0.89917	0.989;0.997;1.0	P;D;D	0.83275	0.768;0.96;0.996	T	0.75869	-0.3165	10	0.72032	D	0.01	-45.1278	18.2924	0.90135	0.0:1.0:0.0:0.0	.	803;278;793	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	H	793	ENSP00000291281:R793H;ENSP00000393978:R793H	ENSP00000291281:R793H	R	-	2	0	PRKD2	51870176	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.762000	0.85270	2.686000	0.91538	0.655000	0.94253	CGC	PRKD2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105287		0.567	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1		0.00	22	0	C	NM_016457		47178336	-1			no_errors	ENST00000291281	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
PRKDC	5591	genome.wustl.edu	37	8	48773474	48773474	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:48773474G>T	ENST00000314191.2	-	46	6097	c.6041C>A	c.(6040-6042)gCa>gAa	p.A2014E	PRKDC_ENST00000338368.3_Missense_Mutation_p.A2014E|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2015					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	ATCCCCATTTGCTGCTTCTCT	0.313								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													111.0	105.0	107.0					8																	48773474		1814	4072	5886	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.6041C>A	8.37:g.48773474G>T	ENSP00000313420:p.Ala2014Glu		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A2014E	ENST00000314191.2	37	c.6041		8	.	.	.	.	.	.	.	.	.	.	G	1.518	-0.547691	0.04024	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.32753	1.44;1.44	6.02	3.27	0.37495	NUC194 (1);Armadillo-type fold (1);	0.672121	0.15885	N	0.239849	T	0.21962	0.0529	L	0.35414	1.06	0.09310	N	1	B;B	0.17038	0.02;0.005	B;B	0.17433	0.018;0.018	T	0.17715	-1.0360	10	0.54805	T	0.06	.	6.6744	0.23085	0.1964:0.271:0.5326:0.0	.	2014;2015	E7EUY0;P78527	.;PRKDC_HUMAN	E	2014	ENSP00000313420:A2014E;ENSP00000345182:A2014E	ENSP00000313420:A2014E	A	-	2	0	PRKDC	48936027	0.018000	0.18449	0.334000	0.25495	0.456000	0.32438	0.780000	0.26760	0.878000	0.35920	0.650000	0.86243	GCA	PRKDC	-	pfam_NUC194,superfamily_ARM-type_fold	ENSG00000253729		0.313	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		-	0.00	43	0	G	NM_001081640		48773474	-1	tier1	-	no_errors	ENST00000314191	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.187	T
PROB1	389333	genome.wustl.edu	37	5	138729895	138729895	+	Silent	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:138729895C>A	ENST00000434752.2	-	1	990	c.876G>T	c.(874-876)ctG>ctT	p.L292L		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	292																	TAGCCTTCTCCAGGACCACGT	0.726																																																	0													49.0	61.0	57.0					5																	138729895		692	1591	2283	SO:0001819	synonymous_variant	0			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.876G>T	5.37:g.138729895C>A			B4E007	Silent	SNP	NULL	p.L292	ENST00000434752.2	37	c.876	CCDS54909.1	5																																																																																			PROB1	-	NULL	ENSG00000228672		0.726	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROB1	HGNC	protein_coding	OTTHUMT00000470735.1	-	0.00	163	0	C	NM_001161546		138729895	-1	tier1	-	no_errors	ENST00000434752	ensembl	human	known	74_37	silent	37.19	125	74	SNP	0.019	A
PRPF3	9129	genome.wustl.edu	37	1	150318310	150318310	+	Intron	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:150318310T>C	ENST00000324862.6	+	13	1805				PRPF3_ENST00000467329.1_Intron|PRPF3_ENST00000543398.1_Intron|PRPF3_ENST00000414970.2_Intron	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3						mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		TGAAGAAATGTAAGAGTGTGG	0.328																																					Ovarian(168;1070 2670 5178 20729)												0																																										SO:0001627	intron_variant	0			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.1641-184T>C	1.37:g.150318310T>C			B4DSY9|O43446|Q5VT54	RNA	SNP	-	NULL	ENST00000324862.6	37	NULL	CCDS951.1	1																																																																																			PRPF3	-	-	ENSG00000117360		0.328	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	-	0.00	9	0	T	NM_004698		150318310	+1	tier1	-	no_errors	ENST00000476970	ensembl	human	known	74_37	rna	50.00	7	7	SNP	0.000	C
PTEN	5728	genome.wustl.edu	37	10	89717619	89717619	+	Missense_Mutation	SNP	T	T	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:89717619T>G	ENST00000371953.3	+	7	2001	c.644T>G	c.(643-645)tTt>tGt	p.F215C	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	215	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.N212fs*1(2)|p.Y27fs*1(2)|p.F215S(1)|p.G165_*404del(1)|p.Q214fs*1(1)|p.?(1)|p.Q214fs*22(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GATCCTCAGTTTGTGGTCTGC	0.398		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	51	Whole gene deletion(37)|Deletion - Frameshift(10)|Deletion - In frame(1)|Complex - frameshift(1)|Unknown(1)|Substitution - Missense(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|breast(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|endometrium(2)|urinary_tract(2)|soft_tissue(1)											115.0	102.0	106.0					10																	89717619		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.644T>G	10.37:g.89717619T>G	ENSP00000361021:p.Phe215Cys		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F215C	ENST00000371953.3	37	c.644	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	T	18.63	3.665163	0.67700	.	.	ENSG00000171862	ENST00000371953	D	0.85861	-2.04	5.67	5.67	0.87782	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.092454	0.85682	D	0.000000	D	0.90270	0.6957	L	0.60845	1.875	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	D	0.89864	0.4018	9	.	.	.	-7.8627	15.9118	0.79477	0.0:0.0:0.0:1.0	.	215	P60484	PTEN_HUMAN	C	215	ENSP00000361021:F215C	.	F	+	2	0	PTEN	89707599	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.661000	0.83786	2.162000	0.67917	0.477000	0.44152	TTT	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.398	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	-	0.00	71	0	T	NM_000314		89717619	+1	tier1	-	no_errors	ENST00000371953	ensembl	human	known	74_37	missense	36.14	53	30	SNP	1.000	G
PTPN3	5774	genome.wustl.edu	37	9	112225697	112225697	+	Silent	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:112225697A>T	ENST00000374541.2	-	2	122	c.18T>A	c.(16-18)cgT>cgA	p.R6R	PTPN3_ENST00000262539.3_5'UTR	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	6					negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						CACCCAACGCACGTAACCGGG	0.408																																																	0													112.0	111.0	111.0					9																	112225697		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.18T>A	9.37:g.112225697A>T			A0AUW9|E7EN99|E9PGU7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_PDZ,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R6	ENST00000374541.2	37	c.18	CCDS6776.1	9																																																																																			PTPN3	-	pirsf_Tyr_Pase_non-rcpt_typ-3/4	ENSG00000070159		0.408	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN3	HGNC	protein_coding	OTTHUMT00000053598.4	-	0.00	58	0	A			112225697	-1	tier1	-	no_errors	ENST00000374541	ensembl	human	known	74_37	silent	7.27	51	4	SNP	1.000	T
RBM10	8241	genome.wustl.edu	37	X	47040705	47040705	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chrX:47040705G>A	ENST00000377604.3	+	13	2082	c.1340G>A	c.(1339-1341)aGc>aAc	p.S447N	RBM10_ENST00000478410.1_3'UTR|RBM10_ENST00000329236.7_Missense_Mutation_p.S369N|RBM10_ENST00000345781.6_Missense_Mutation_p.S370N	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	447					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						TATGGCAACAGCCAGGGCACA	0.627																																					Melanoma(171;120 2705 19495 39241)												0													50.0	36.0	41.0					X																	47040705		2191	4288	6479	SO:0001583	missense	0			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.1340G>A	X.37:g.47040705G>A	ENSP00000366829:p.Ser447Asn		C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.S447N	ENST00000377604.3	37	c.1340	CCDS14274.1	X	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517915	0.27211	.	.	ENSG00000182872	ENST00000377604;ENST00000329236;ENST00000345781	T;T;T	0.18810	2.86;2.19;2.45	4.79	3.92	0.45320	.	0.609700	0.16680	N	0.203992	T	0.13457	0.0326	N	0.22421	0.69	0.29295	N	0.86909	B;B;B;B;B	0.30542	0.015;0.013;0.284;0.13;0.004	B;B;B;B;B	0.29598	0.008;0.008;0.104;0.055;0.008	T	0.14254	-1.0479	10	0.23891	T	0.37	-18.9917	10.0261	0.42072	0.0:0.1996:0.8004:0.0	.	370;512;446;369;447	P98175-3;Q7Z3D7;P98175-2;P98175-4;P98175	.;.;.;.;RBM10_HUMAN	N	447;369;370	ENSP00000366829:S447N;ENSP00000328848:S369N;ENSP00000329659:S370N	ENSP00000328848:S369N	S	+	2	0	RBM10	46925649	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.596000	0.46205	1.136000	0.42199	0.597000	0.82753	AGC	RBM10	-	NULL	ENSG00000182872		0.627	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	HGNC	protein_coding	OTTHUMT00000056381.1	-	0.00	48	0	G	NM_005676		47040705	+1	tier1	-	no_errors	ENST00000377604	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	A
RHD	6007	genome.wustl.edu	37	1	25611165	25611165	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:25611165C>T	ENST00000328664.4	+	2	405	c.250C>T	c.(250-252)Ctg>Ttg	p.L84L	RHD_ENST00000357542.4_Silent_p.L84L|RHD_ENST00000454452.2_Silent_p.L84L|RHD_ENST00000423810.2_Silent_p.L84L|RHD_ENST00000417538.2_Silent_p.L84L|RHD_ENST00000568195.1_Silent_p.L84L|RHD_ENST00000423253.1_3'UTR|RHD_ENST00000342055.5_Silent_p.L84L	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	84						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCTCTTCATGCTGGCGCTTGG	0.582																																																	0													74.0	67.0	69.0					1																	25611165		2131	3717	5848	SO:0001819	synonymous_variant	0			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.250C>T	1.37:g.25611165C>T			Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Silent	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.L84	ENST00000328664.4	37	c.250	CCDS262.1	1																																																																																			RHD	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	ENSG00000187010		0.582	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHD	HGNC	protein_coding	OTTHUMT00000009660.5	-	0.00	35	0	C	NM_016124		25611165	+1	tier1	-	no_errors	ENST00000328664	ensembl	human	known	74_37	silent	9.30	39	4	SNP	0.877	T
RC3H1	149041	genome.wustl.edu	37	1	173931047	173931047	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:173931047C>T	ENST00000367696.2	-	12	2369	c.2018G>A	c.(2017-2019)cGt>cAt	p.R673H	RC3H1_ENST00000258349.4_Missense_Mutation_p.R673H|RC3H1_ENST00000367694.2_Missense_Mutation_p.R673H			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	673	Pro-rich.				B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.R673H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						GTACACTCGACGGCCATCATA	0.483																																																	1	Substitution - Missense(1)	pancreas(1)											264.0	255.0	258.0					1																	173931047		2203	4300	6503	SO:0001583	missense	0			AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.2018G>A	1.37:g.173931047C>T	ENSP00000356669:p.Arg673His		B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.R673H	ENST00000367696.2	37	c.2018	CCDS30940.1	1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.439224	0.83885	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.55052	0.54;0.54;0.54	5.92	5.01	0.66863	.	0.202250	0.53938	D	0.000053	T	0.55417	0.1919	L	0.55481	1.735	0.44611	D	0.99758	P;D;P;P	0.76494	0.539;0.999;0.669;0.539	B;P;B;B	0.60117	0.065;0.869;0.138;0.065	T	0.60796	-0.7192	10	0.56958	D	0.05	-12.9212	15.1054	0.72319	0.0:0.9323:0.0:0.0677	.	673;673;673;673	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	H	673	ENSP00000356669:R673H;ENSP00000258349:R673H;ENSP00000356667:R673H	ENSP00000258349:R673H	R	-	2	0	RC3H1	172197670	1.000000	0.71417	0.931000	0.37212	0.989000	0.77384	5.989000	0.70587	1.506000	0.48736	0.650000	0.86243	CGT	RC3H1	-	NULL	ENSG00000135870		0.483	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H1	HGNC	protein_coding	OTTHUMT00000090733.2		0.00	49	0	C	NM_172071		173931047	-1			no_errors	ENST00000258349	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.991	T
RHOBTB1	9886	genome.wustl.edu	37	10	62631234	62631234	+	3'UTR	SNP	T	T	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr10:62631234T>G	ENST00000337910.5	-	0	2434				RHOBTB1_ENST00000490827.1_5'UTR|RHOBTB1_ENST00000357917.4_3'UTR	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					TTTTTTCTCTTCCTCTTCAGG	0.393																																																	0													170.0	138.0	149.0					10																	62631234		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.*6A>C	10.37:g.62631234T>G				RNA	SNP	-	NULL	ENST00000337910.5	37	NULL	CCDS7261.1	10																																																																																			RHOBTB1	-	-	ENSG00000072422		0.393	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	HGNC	protein_coding	OTTHUMT00000048220.1	-	0.00	24	0	T			62631234	-1	tier1	-	no_errors	ENST00000461910	ensembl	human	known	74_37	rna	24.32	28	9	SNP	0.047	G
RNPEPL1	57140	genome.wustl.edu	37	2	241515026	241515026	+	Splice_Site	SNP	A	A	G			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:241515026A>G	ENST00000270357.4	+	8	1409	c.816A>G	c.(814-816)gcA>gcG	p.A272A	RNPEPL1_ENST00000464550.1_3'UTR	NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	272					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		ACTGCCGGGCAGGTGAGGCTG	0.652																																																	0													57.0	53.0	54.0					2																	241515026		2203	4300	6503	SO:0001630	splice_region_variant	0					2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.817+1A>G	2.37:g.241515026A>G			Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Silent	SNP	pfam_Peptidase_M1_C,pfam_Peptidase_M1_N,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.A272	ENST00000270357.4	37	c.816		2																																																																																			RNPEPL1	-	NULL	ENSG00000142327		0.652	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	RNPEPL1	HGNC	protein_coding	OTTHUMT00000257190.4	-	0.00	41	0	A	NM_018226	Silent	241515026	+1	tier1	-	no_errors	ENST00000270357	ensembl	human	known	74_37	silent	7.69	48	4	SNP	1.000	G
RTTN	25914	genome.wustl.edu	37	18	67869157	67869157	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr18:67869157G>T	ENST00000255674.6	-	4	746	c.460C>A	c.(460-462)Cag>Aag	p.Q154K	RTTN_ENST00000454359.1_Missense_Mutation_p.Q154K|RTTN_ENST00000437017.1_Missense_Mutation_p.Q154K	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	154					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				ACTTCCATCTGCTGGAAATTA	0.373																																																	0													102.0	96.0	98.0					18																	67869157		1836	4099	5935	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.460C>A	18.37:g.67869157G>T	ENSP00000255674:p.Gln154Lys		Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q154K	ENST00000255674.6	37	c.460	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262397	0.23051	.	.	ENSG00000176225	ENST00000255674;ENST00000454359;ENST00000437017	T;T;T	0.63417	0.7;0.54;-0.04	5.53	4.6	0.57074	Armadillo-type fold (2);	0.252714	0.32357	N	0.006212	T	0.54095	0.1837	L	0.48362	1.52	0.28789	N	0.899431	B;P	0.48694	0.372;0.914	B;B	0.43536	0.121;0.423	T	0.51553	-0.8691	10	0.19590	T	0.45	.	11.9714	0.53065	0.0:0.2672:0.7328:0.0	.	154;154	Q86VV8-2;Q86VV8	.;RTTN_HUMAN	K	154	ENSP00000255674:Q154K;ENSP00000402352:Q154K;ENSP00000399520:Q154K	ENSP00000255674:Q154K	Q	-	1	0	RTTN	66020137	0.456000	0.25744	0.844000	0.33320	0.439000	0.31926	2.935000	0.48963	2.596000	0.87737	0.655000	0.94253	CAG	RTTN	-	superfamily_ARM-type_fold	ENSG00000176225		0.373	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	-	0.00	72	0	G	NM_173630		67869157	-1	tier1	-	no_errors	ENST00000255674	ensembl	human	known	74_37	missense	41.67	42	30	SNP	0.963	T
RYR1	6261	genome.wustl.edu	37	19	39028578	39028578	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:39028578G>T	ENST00000359596.3	+	84	11667	c.11667G>T	c.(11665-11667)ttG>ttT	p.L3889F	AC067969.2_ENST00000595853.1_RNA|RYR1_ENST00000355481.4_Missense_Mutation_p.L3884F|RYR1_ENST00000360985.3_Missense_Mutation_p.L3884F			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3889					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	TCCTACAATTGCTCTGTGAGG	0.562																																																	0													140.0	114.0	122.0					19																	39028578		2203	4300	6503	SO:0001583	missense	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11667G>T	19.37:g.39028578G>T	ENSP00000352608:p.Leu3889Phe		Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.L3889F	ENST00000359596.3	37	c.11667	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	g	9.434	1.086193	0.20390	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.97620	-4.46;-4.46;-4.46	4.85	3.8	0.43715	RyR/IP3R Homology associated domain (1);	0.000000	0.52532	U	0.000076	D	0.98385	0.9463	M	0.90542	3.125	0.44523	D	0.997479	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.997;0.998	D	0.98797	1.0738	10	0.87932	D	0	.	10.0944	0.42466	0.0:0.1491:0.6968:0.1541	.	3884;3884;3889	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	F	3889;3884;3884	ENSP00000352608:L3889F;ENSP00000347667:L3884F;ENSP00000354254:L3884F	ENSP00000347667:L3884F	L	+	3	2	RYR1	43720418	0.997000	0.39634	0.980000	0.43619	0.979000	0.70002	0.158000	0.16422	1.395000	0.46643	0.546000	0.68486	TTG	RYR1	-	pfam_RIH_assoc-dom	ENSG00000196218		0.562	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	-	0.00	43	0	G			39028578	+1	tier1	-	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	37.70	37	23	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23906661	23906661	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr13:23906661C>T	ENST00000382292.3	-	9	11627	c.11354G>A	c.(11353-11355)aGg>aAg	p.R3785K	SACS_ENST00000402364.1_Missense_Mutation_p.R3035K|SACS_ENST00000382298.3_Missense_Mutation_p.R3785K			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3785					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ACGAAATTCCCTTTTTTCTGC	0.388																																																	0													100.0	88.0	92.0					13																	23906661		2203	4299	6502	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11354G>A	13.37:g.23906661C>T	ENSP00000371729:p.Arg3785Lys		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.R3785K	ENST00000382292.3	37	c.11354	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214053	0.01555	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.86297	-1.97;-2.1;-1.97	5.61	4.58	0.56647	.	0.047266	0.85682	D	0.000000	T	0.76513	0.3998	N	0.22421	0.69	0.28101	N	0.931396	B	0.02656	0.0	B	0.01281	0.0	T	0.55598	-0.8116	10	0.06099	T	0.92	.	15.3941	0.74778	0.0:0.9218:0.0:0.0782	.	3785	Q9NZJ4	SACS_HUMAN	K	3785;3035;3785	ENSP00000371729:R3785K;ENSP00000385844:R3035K;ENSP00000371735:R3785K	ENSP00000371729:R3785K	R	-	2	0	SACS	22804661	0.986000	0.35501	0.965000	0.40720	0.136000	0.21042	2.579000	0.46059	2.638000	0.89438	0.467000	0.42956	AGG	SACS	-	NULL	ENSG00000151835		0.388	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3		0.00	48	0	C	NM_014363		23906661	-1			no_errors	ENST00000382292	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.980	T
SEMA6A	57556	genome.wustl.edu	37	5	115827448	115827448	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:115827448C>T	ENST00000343348.6	-	7	1310	c.523G>A	c.(523-525)Gca>Aca	p.A175T	SEMA6A_ENST00000510263.1_Missense_Mutation_p.A175T|SEMA6A_ENST00000503962.1_5'UTR|CTB-118N6.3_ENST00000514214.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.A175T|CTB-118N6.3_ENST00000510682.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	175	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)	p.A175T(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GCAAACAGTGCAACGTTGGCA	0.448																																																	1	Substitution - Missense(1)	ovary(1)											130.0	132.0	132.0					5																	115827448		2004	4171	6175	SO:0001583	missense	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.523G>A	5.37:g.115827448C>T	ENSP00000345512:p.Ala175Thr		Q9P2H9	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.A175T	ENST00000343348.6	37	c.523	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.295220	0.95574	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	T;T;T	0.11277	2.79;2.79;2.79	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.41696	0.1170	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.25984	-1.0116	10	0.87932	D	0	.	20.2672	0.98462	0.0:1.0:0.0:0.0	.	175;175	Q9H2E6;Q9H2E6-2	SEM6A_HUMAN;.	T	175	ENSP00000345512:A175T;ENSP00000257414:A175T;ENSP00000424388:A175T	ENSP00000257414:A175T	A	-	1	0	SEMA6A	115855347	1.000000	0.71417	0.936000	0.37596	0.645000	0.38454	7.487000	0.81328	2.894000	0.99253	0.591000	0.81541	GCA	SEMA6A	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000092421		0.448	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1		0.00	27	0	C	NM_020796		115827448	-1			no_errors	ENST00000257414	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
SH3GL3	6457	genome.wustl.edu	37	15	84237334	84237334	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:84237334G>A	ENST00000427482.2	+	4	547	c.241G>A	c.(241-243)Gtg>Atg	p.V81M	SH3GL3_ENST00000535412.1_Missense_Mutation_p.V81M|SH3GL3_ENST00000324537.5_Missense_Mutation_p.V89M|SH3GL3_ENST00000434347.1_Missense_Mutation_p.V89M	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	81	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.|Required for dimerization upon membrane association. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						CCGAGGGCAGGTGAAGACCAC	0.473																																																	0													87.0	87.0	87.0					15																	84237334		2203	4300	6503	SO:0001583	missense	0			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.241G>A	15.37:g.84237334G>A	ENSP00000391372:p.Val81Met		O43553|O43554	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain	p.V89M	ENST00000427482.2	37	c.265	CCDS10325.2	15	.	.	.	.	.	.	.	.	.	.	G	20.9	4.071015	0.76301	.	.	ENSG00000140600	ENST00000427482;ENST00000535412;ENST00000324537;ENST00000434347	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	4.86	3.89	0.44902	BAR (3);	0.197195	0.42821	D	0.000649	T	0.46073	0.1374	M	0.79805	2.47	0.58432	D	0.999998	P;P;P	0.52577	0.954;0.62;0.566	P;P;B	0.50590	0.645;0.516;0.295	T	0.52563	-0.8559	10	0.48119	T	0.1	-17.2023	14.1543	0.65407	0.0:0.0:0.8505:0.1495	.	81;81;89	Q8IVP1;Q99963;Q99963-3	.;SH3G3_HUMAN;.	M	81;81;89;89	ENSP00000391372:V81M;ENSP00000439239:V81M;ENSP00000320092:V89M;ENSP00000397871:V89M	ENSP00000320092:V89M	V	+	1	0	SH3GL3	82028338	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.248000	0.72418	2.402000	0.81655	0.544000	0.68410	GTG	SH3GL3	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000140600		0.473	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL3	HGNC	protein_coding	OTTHUMT00000347797.1	-	0.00	36	0	G	NM_003027		84237334	+1	tier1	-	no_errors	ENST00000324537	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	A
SLC25A32	81034	genome.wustl.edu	37	8	104427088	104427088	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:104427088C>T	ENST00000297578.4	-	1	244	c.78G>A	c.(76-78)ctG>ctA	p.L26L	DCAF13_ENST00000297579.5_5'UTR|DCAF13_ENST00000519682.1_5'Flank|DCAF13_ENST00000521971.1_5'Flank|DCAF13_ENST00000521716.1_5'Flank|SLC25A32_ENST00000543107.1_5'UTR	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	26					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	CGCCCGCTATCAGGTTCTCAT	0.677																																																	0													24.0	27.0	26.0					8																	104427088		2203	4300	6503	SO:0001819	synonymous_variant	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.78G>A	8.37:g.104427088C>T			Q96JZ6|Q96SU7	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.L26	ENST00000297578.4	37	c.78	CCDS6300.1	8																																																																																			SLC25A32	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000164933		0.677	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	-	0.00	59	0	C	NM_030780		104427088	-1	tier1	-	no_errors	ENST00000297578	ensembl	human	known	74_37	silent	22.09	67	19	SNP	1.000	T
SLCO1B1	10599	genome.wustl.edu	37	12	21370110	21370110	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr12:21370110G>T	ENST00000256958.2	+	12	1651	c.1555G>T	c.(1555-1557)Gcc>Tcc	p.A519S		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	519					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AAATTACTCAGCCCATTTGGG	0.358																																																	0													130.0	130.0	130.0					12																	21370110		2203	4300	6503	SO:0001583	missense	0				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1555G>T	12.37:g.21370110G>T	ENSP00000256958:p.Ala519Ser		B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.A519S	ENST00000256958.2	37	c.1555	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540508	0.65085	.	.	ENSG00000134538	ENST00000256958	T	0.39056	1.1	3.84	2.86	0.33363	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.359243	0.30492	N	0.009505	T	0.65657	0.2712	M	0.90759	3.145	0.18873	N	0.999985	D	0.71674	0.998	D	0.74674	0.984	T	0.58132	-0.7690	10	0.66056	D	0.02	.	8.4824	0.33052	0.126:0.0:0.874:0.0	.	519	Q9Y6L6	SO1B1_HUMAN	S	519	ENSP00000256958:A519S	ENSP00000256958:A519S	A	+	1	0	SLCO1B1	21261377	0.684000	0.27642	0.003000	0.11579	0.640000	0.38277	4.921000	0.63397	0.594000	0.29761	0.491000	0.48974	GCC	SLCO1B1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000134538		0.358	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	HGNC	protein_coding	OTTHUMT00000402070.1	-	0.00	71	0	G	NM_006446		21370110	+1	tier1	-	no_errors	ENST00000256958	ensembl	human	known	74_37	missense	22.89	64	19	SNP	0.316	T
SMAD3	4088	genome.wustl.edu	37	15	67482843	67482843	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:67482843C>T	ENST00000327367.4	+	9	1557	c.1247C>T	c.(1246-1248)tCc>tTc	p.S416F	SMAD3_ENST00000439724.3_Missense_Mutation_p.S372F|SMAD3_ENST00000537194.2_Missense_Mutation_p.S221F|SMAD3_ENST00000540846.2_Missense_Mutation_p.S311F	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	416	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		CAGATGGGCTCCCCAAGCATC	0.547																																																	0													60.0	52.0	55.0					15																	67482843		2201	4299	6500	SO:0001583	missense	0			BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.1247C>T	15.37:g.67482843C>T	ENSP00000332973:p.Ser416Phe		A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.S416F	ENST00000327367.4	37	c.1247	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020704	0.93462	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.97529	-4.42;-4.42;-4.42;-4.42	4.97	4.97	0.65823	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (1);	0.000000	0.85682	D	0.000000	D	0.98327	0.9445	M	0.88377	2.95	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.57502	0.822;0.822	D	0.99529	1.0960	10	0.87932	D	0	.	18.2521	0.90007	0.0:1.0:0.0:0.0	.	372;416	B7Z4Z5;P84022	.;SMAD3_HUMAN	F	416;416;311;372;221	ENSP00000332973:S416F;ENSP00000437757:S311F;ENSP00000401133:S372F;ENSP00000445348:S221F	ENSP00000332973:S416F	S	+	2	0	SMAD3	65269897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.723000	0.84788	2.318000	0.78349	0.561000	0.74099	TCC	SMAD3	-	superfamily_SMAD_FHA_domain,pfscan_SMAD_dom_Dwarfin-type	ENSG00000166949		0.547	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	HGNC	protein_coding	OTTHUMT00000256967.2	-	0.00	40	0	C	NM_005902		67482843	+1	tier1	-	no_errors	ENST00000327367	ensembl	human	known	74_37	missense	26.53	35	13	SNP	1.000	T
SMARCA4	6597	genome.wustl.edu	37	19	11132513	11132513	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:11132513C>T	ENST00000429416.3	+	20	3010	c.2729C>T	c.(2728-2730)aCg>aTg	p.T910M	SMARCA4_ENST00000344626.4_Missense_Mutation_p.T910M|SMARCA4_ENST00000444061.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000590574.1_Missense_Mutation_p.T910M|SMARCA4_ENST00000450717.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000413806.3_Missense_Mutation_p.T910M|SMARCA4_ENST00000358026.2_Missense_Mutation_p.T910M|SMARCA4_ENST00000541122.2_Missense_Mutation_p.T910M|SMARCA4_ENST00000589677.1_Missense_Mutation_p.T910M	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	910	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.T910M(6)|p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				CTGCTGCTGACGGGCACACCG	0.592			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	7	Substitution - Missense(6)|Unknown(1)	central_nervous_system(6)|lung(1)											88.0	68.0	75.0					19																	11132513		2203	4300	6503	SO:0001583	missense	0			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.2729C>T	19.37:g.11132513C>T	ENSP00000395654:p.Thr910Met		B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.T910M	ENST00000429416.3	37	c.2729	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061387	0.55432	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.97303	-4.33;-4.33;-4.33;-4.33;-4.33;-4.33;-4.33	4.51	4.51	0.55191	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	H	0.98507	4.25	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.998;0.998;0.996;0.994;1.0;0.998;0.998	D	0.98869	1.0765	10	0.87932	D	0	-34.7546	16.1519	0.81629	0.0:1.0:0.0:0.0	.	910;910;910;910;910;130;910;910	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;B4E0F1;A7E2E1;P51532	.;.;.;.;.;.;.;SMCA4_HUMAN	M	910;910;974;910;910;910;910;910	ENSP00000395654:T910M;ENSP00000350720:T910M;ENSP00000343896:T910M;ENSP00000445036:T910M;ENSP00000392837:T910M;ENSP00000397783:T910M;ENSP00000414727:T910M	ENSP00000343896:T910M	T	+	2	0	SMARCA4	10993513	1.000000	0.71417	0.968000	0.41197	0.009000	0.06853	7.651000	0.83577	2.348000	0.79779	0.655000	0.94253	ACG	SMARCA4	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000127616		0.592	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	-	0.00	29	0	C	NM_003072		11132513	+1	tier1	-	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.999	T
SNAI2	6591	genome.wustl.edu	37	8	49831433	49831433	+	Missense_Mutation	SNP	G	G	A	rs376627182		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:49831433G>A	ENST00000396822.1	-	4	1097	c.740C>T	c.(739-741)tCc>tTc	p.S247F	SNAI2_ENST00000020945.1_Missense_Mutation_p.S247F			O43623	SNAI2_HUMAN	snail family zinc finger 2	247					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				GAAGGTTTTGGAGCAGTTTTT	0.463																																																	0													174.0	158.0	163.0					8																	49831433		2203	4300	6503	SO:0001583	missense	0			U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.740C>T	8.37:g.49831433G>A	ENSP00000380034:p.Ser247Phe		B2R6P6|Q53FC1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S247F	ENST00000396822.1	37	c.740	CCDS6146.1	8	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113656	0.77210	.	.	ENSG00000019549	ENST00000020945;ENST00000396822	T;T	0.71103	-0.54;-0.54	5.22	5.22	0.72569	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.70736	0.3258	L	0.58428	1.81	0.80722	D	1	B	0.25206	0.12	B	0.27608	0.081	T	0.70128	-0.4957	10	0.62326	D	0.03	-16.1642	18.7761	0.91912	0.0:0.0:1.0:0.0	.	247	O43623	SNAI2_HUMAN	F	247	ENSP00000020945:S247F;ENSP00000380034:S247F	ENSP00000020945:S247F	S	-	2	0	SNAI2	49993986	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.430000	0.82344	0.650000	0.86243	TCC	SNAI2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000019549		0.463	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	HGNC	protein_coding	OTTHUMT00000313873.2	-	0.00	85	0	G	NM_003068		49831433	-1	tier1	-	no_errors	ENST00000020945	ensembl	human	known	74_37	missense	27.87	88	34	SNP	1.000	A
SNAI3	333929	genome.wustl.edu	37	16	88752673	88752674	+	Intron	DEL	CT	CT	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:88752673_88752674delCT	ENST00000332281.5	-	1	163				SNAI3-AS1_ENST00000567997.1_RNA|SNAI3-AS1_ENST00000563261.1_RNA|SNAI3-AS1_ENST00000596908.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		TCCCAGGGGCCTCTCTCTCTCT	0.718																																					Colon(27;366 710 19748 23199 27567)												0																																										SO:0001627	intron_variant	0			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.76+64AG>-	16.37:g.88752683_88752684delCT			Q86SU5	RNA	DEL	-	NULL	ENST00000332281.5	37	NULL	CCDS32505.1	16																																																																																			SNAI3-AS1	-	-	ENSG00000260630		0.718	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3-AS1	HGNC	protein_coding	OTTHUMT00000422582.1		0.00	17	0	CT			88752674	+1	tier1		no_errors	ENST00000567997	ensembl	human	known	74_37	rna	17.65	14	3	DEL	0.001:0.012	-
SNCAIP	9627	genome.wustl.edu	37	5	121786488	121786488	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:121786488C>T	ENST00000261368.8	+	10	2208	c.1946C>T	c.(1945-1947)tCt>tTt	p.S649F	SNCAIP_ENST00000414317.2_Missense_Mutation_p.S251F|SNCAIP_ENST00000379533.2_Missense_Mutation_p.S696F|SNCAIP_ENST00000261367.7_Missense_Mutation_p.S696F|CTC-210G5.1_ENST00000506053.1_RNA|CTC-210G5.1_ENST00000510972.1_RNA|SNCAIP_ENST00000504884.2_3'UTR|CTC-210G5.1_ENST00000509993.1_RNA|SNCAIP_ENST00000503116.2_3'UTR|SNCAIP_ENST00000379536.2_Missense_Mutation_p.S589F|SNCAIP_ENST00000542191.1_Missense_Mutation_p.S207F|CTC-210G5.1_ENST00000505546.1_RNA|SNCAIP_ENST00000379538.3_Missense_Mutation_p.S283F|CTC-210G5.1_ENST00000503529.1_RNA	NM_005460.2	NP_005451.2	Q9Y6H5	SNCAP_HUMAN	synuclein, alpha interacting protein	649					cell death (GO:0008219)|dopamine metabolic process (GO:0042417)|regulation of inclusion body assembly (GO:0090083)|regulation of neurotransmitter secretion (GO:0046928)	cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	identical protein binding (GO:0042802)|ubiquitin protein ligase binding (GO:0031625)			NS(3)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	39		all_cancers(142;0.00787)|Prostate(80;0.0327)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	OV - Ovarian serous cystadenocarcinoma(64;0.000625)|Epithelial(69;0.00216)|all cancers(49;0.0232)		CAGGCTTCCTCTAGAAATTCT	0.458																																																	0													37.0	41.0	40.0					5																	121786488		2203	4300	6503	SO:0001583	missense	0			AF167306	CCDS4131.1, CCDS58964.1	5q23.2	2013-01-10	2008-07-31		ENSG00000064692	ENSG00000064692		"""Ankyrin repeat domain containing"""	11139	protein-coding gene	gene with protein product	"""synphilin"""	603779				10319874	Standard	NM_001242935		Approved	SYPH1	uc003ksw.1	Q9Y6H5	OTTHUMG00000128915	ENST00000261368.8:c.1946C>T	5.37:g.121786488C>T	ENSP00000261368:p.Ser649Phe		D3DSZ1|Q05BS1|Q1PSC2|Q49AC6|Q504U9|Q6L984|Q6L985|Q6L986|Q9HC59	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S696F	ENST00000261368.8	37	c.2087	CCDS4131.1	5	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456144	0.63401	.	.	ENSG00000064692	ENST00000542191;ENST00000509154;ENST00000261368;ENST00000379533;ENST00000379536;ENST00000379538;ENST00000261367;ENST00000414317;ENST00000447854	T;T;T;T;T;T;T;T	0.14144	4.35;4.88;2.58;2.53;4.88;4.85;2.53;4.57	6.06	5.19	0.71726	.	0.131690	0.53938	D	0.000058	T	0.34279	0.0892	M	0.73217	2.22	0.39499	D	0.968162	B;B;B;P;B;P;D;P	0.65815	0.103;0.23;0.141;0.696;0.22;0.946;0.995;0.911	B;B;B;B;B;P;P;P	0.61201	0.094;0.186;0.108;0.421;0.193;0.598;0.885;0.521	T	0.22138	-1.0225	10	0.72032	D	0.01	-6.3086	15.1649	0.72814	0.1412:0.8588:0.0:0.0	.	589;277;251;589;283;283;696;649	D6R9G8;Q9NVG1;B7Z995;Q9Y6H5-4;Q9Y6H5-5;Q9Y6H5-2;Q9Y6H5-3;Q9Y6H5	.;.;.;.;.;.;.;SNCAP_HUMAN	F	207;589;649;696;589;283;696;251;289	ENSP00000441681:S207F;ENSP00000422106:S589F;ENSP00000261368:S649F;ENSP00000368848:S696F;ENSP00000368851:S589F;ENSP00000368854:S283F;ENSP00000261367:S696F;ENSP00000394392:S251F	ENSP00000261367:S696F	S	+	2	0	SNCAIP	121814387	0.965000	0.33210	0.750000	0.31169	0.885000	0.51271	4.572000	0.60886	1.551000	0.49450	0.655000	0.94253	TCT	SNCAIP	-	NULL	ENSG00000064692		0.458	SNCAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCAIP	HGNC	protein_coding	OTTHUMT00000250888.1	-	0.00	38	0	C			121786488	+1	tier1	-	no_errors	ENST00000379533	ensembl	human	known	74_37	missense	36.00	32	18	SNP	1.000	T
SPECC1	92521	genome.wustl.edu	37	17	20108050	20108050	+	Nonsense_Mutation	SNP	G	G	T	rs149577639	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:20108050G>T	ENST00000261503.5	+	4	739	c.688G>T	c.(688-690)Gag>Tag	p.E230*	SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000395522.2_Nonsense_Mutation_p.E149*|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000395525.3_Nonsense_Mutation_p.E149*|SPECC1_ENST00000395527.4_Nonsense_Mutation_p.E230*|SPECC1_ENST00000395530.2_Nonsense_Mutation_p.E149*|SPECC1_ENST00000395529.3_Nonsense_Mutation_p.E230*	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	230					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AAGAGCTCTTGAGGAGAAGAA	0.478																																																	0													133.0	147.0	143.0					17																	20108050		2203	4300	6503	SO:0001587	stop_gained	0			AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.688G>T	17.37:g.20108050G>T	ENSP00000261503:p.Glu230*		B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Nonsense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E230*	ENST00000261503.5	37	c.688	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956963	0.73902	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	.	.	.	5.28	3.05	0.35203	.	0.140929	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-24.8555	12.8269	0.57725	0.0:0.488:0.512:0.0	.	.	.	.	X	230;230;230;149;149;149	.	ENSP00000261503:E230X	E	+	1	0	SPECC1	20048642	1.000000	0.71417	0.942000	0.38095	0.960000	0.62799	3.402000	0.52608	1.340000	0.45581	0.655000	0.94253	GAG	SPECC1	-	NULL	ENSG00000128487		0.478	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1	HGNC	protein_coding	OTTHUMT00000441206.1		0.00	18	0	G	NM_152904		20108050	+1			no_errors	ENST00000261503	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.962	T
SPEF2	79925	genome.wustl.edu	37	5	35814614	35814614	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:35814614G>A	ENST00000356031.3	+	37	5582	c.5428G>A	c.(5428-5430)Gga>Aga	p.G1810R	SPEF2_ENST00000303129.4_Missense_Mutation_p.G607R|CTD-2113L7.1_ENST00000510433.1_RNA	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1810					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AGGAAGTGATGGAGAGAGATC	0.303																																																	0													71.0	65.0	67.0					5																	35814614		1822	4077	5899	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.5428G>A	5.37:g.35814614G>A	ENSP00000348314:p.Gly1810Arg		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.G1810R	ENST00000356031.3	37	c.5428	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	18.18	3.566854	0.65651	.	.	ENSG00000152582	ENST00000356031;ENST00000303129	T;T	0.54279	3.04;0.58	5.25	4.37	0.52481	.	0.516257	0.17947	N	0.156651	T	0.47764	0.1463	L	0.29908	0.895	0.30078	N	0.809457	D;P	0.55172	0.97;0.845	P;B	0.49708	0.62;0.311	T	0.45512	-0.9256	10	0.40728	T	0.16	.	11.7982	0.52112	0.0883:0.0:0.9116:0.0	.	607;1810	Q9C093-4;Q9C093	.;SPEF2_HUMAN	R	1810;607	ENSP00000348314:G1810R;ENSP00000303843:G607R	ENSP00000303843:G607R	G	+	1	0	SPEF2	35850371	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	5.203000	0.65174	2.624000	0.88883	0.467000	0.42956	GGA	SPEF2	-	NULL	ENSG00000152582		0.303	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	44	0	G	NM_144722		35814614	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	39.53	26	17	SNP	0.998	A
SPSB3	90864	genome.wustl.edu	37	16	1827862	1827862	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:1827862G>A	ENST00000566339.1	-	6	937	c.607C>T	c.(607-609)Cac>Tac	p.H203Y	SPSB3_ENST00000301717.4_Missense_Mutation_p.H203Y	NM_080861.3	NP_543137.2	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box containing 3	203	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(1)|kidney(4)|lung(3)|prostate(2)	10						TCGCCCTTGTGGTGGAGGAGG	0.672																																																	0													44.0	44.0	44.0					16																	1827862		2197	4299	6496	SO:0001583	missense	0				CCDS32365.1	16p13.3	2008-02-05				ENSG00000162032			30629	protein-coding gene	gene with protein product		611659	"""chromosome 16 open reading frame 31"""	C16orf31		12076535	Standard	NM_080861		Approved	SSB-3	uc002cmu.3	Q6PJ21		ENST00000566339.1:c.607C>T	16.37:g.1827862G>A	ENSP00000457206:p.His203Tyr		D3DU78|Q49A96|Q86X18|Q8WXK5|Q96IE6|Q96RY2	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,smart_SOCS_C,pfscan_B30.2/SPRY,pfscan_SOCS_C	p.H203Y	ENST00000566339.1	37	c.607	CCDS32365.1	16	.	.	.	.	.	.	.	.	.	.	G	22.7	4.318557	0.81469	.	.	ENSG00000162032	ENST00000301717	T	0.62105	0.05	4.33	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.82190	0.4983	M	0.90309	3.105	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86833	0.2012	10	0.87932	D	0	-19.3483	15.3934	0.74767	0.0:0.0:1.0:0.0	.	203	Q6PJ21	SPSB3_HUMAN	Y	203	ENSP00000301717:H203Y	ENSP00000301717:H203Y	H	-	1	0	SPSB3	1767863	1.000000	0.71417	0.984000	0.44739	0.675000	0.39556	9.239000	0.95389	1.941000	0.56285	0.561000	0.74099	CAC	SPSB3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000162032		0.672	SPSB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPSB3	HGNC	protein_coding	OTTHUMT00000433512.1	-	0.00	60	0	G	NM_080861		1827862	-1	tier1	-	no_errors	ENST00000301717	ensembl	human	known	74_37	missense	32.81	43	21	SNP	1.000	A
SRL	6345	genome.wustl.edu	37	16	4242709	4242709	+	Nonsense_Mutation	SNP	G	G	T	rs59226311	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:4242709G>T	ENST00000399609.3	-	6	879	c.867C>A	c.(865-867)taC>taA	p.Y289*	SRL_ENST00000537996.1_Nonsense_Mutation_p.Y247*	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	748	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						AGGAGCTGACGTAAACCCTTG	0.547																																																	0													82.0	87.0	85.0					16																	4242709		1932	4137	6069	SO:0001587	stop_gained	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.867C>A	16.37:g.4242709G>T	ENSP00000382518:p.Tyr289*			Nonsense_Mutation	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain,superfamily_P-loop_NTPase	p.Y289*	ENST00000399609.3	37	c.867	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969248	0.53614	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	.	.	.	4.9	-7.55	0.01327	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.813	17.4637	0.87626	0.3047:0.0:0.6953:0.0	.	.	.	.	X	289;747;247	.	ENSP00000333285:Y747X	Y	-	3	2	SRL	4182710	0.001000	0.12720	0.606000	0.28943	0.989000	0.77384	-1.478000	0.02329	-1.976000	0.00996	-0.140000	0.14226	TAC	SRL	-	superfamily_P-loop_NTPase	ENSG00000185739		0.547	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	-	0.00	80	0	G	XM_064152		4242709	-1	tier1	-	no_errors	ENST00000399609	ensembl	human	known	74_37	nonsense	44.57	51	41	SNP	0.716	T
SSC5D	284297	genome.wustl.edu	37	19	56012123	56012123	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:56012123G>T	ENST00000389623.6	+	11	2592	c.2569G>T	c.(2569-2571)Ggg>Tgg	p.G857W	SSC5D_ENST00000587166.1_Missense_Mutation_p.G857W	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	857	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						GGGGGCTTGGGGGAAGCACAA	0.647																																																	0													39.0	41.0	40.0					19																	56012123		692	1591	2283	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2569G>T	19.37:g.56012123G>T	ENSP00000374274:p.Gly857Trp		B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.G857W	ENST00000389623.6	37	c.2569	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876491	0.51801	.	.	ENSG00000179954	ENST00000389623;ENST00000541230	T	0.37752	1.18	4.7	2.5	0.30297	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.963397	0.08403	U	0.951176	T	0.69735	0.3144	H	0.96430	3.82	0.29892	N	0.825164	D	0.89917	1.0	D	0.85130	0.997	T	0.58222	-0.7674	10	0.72032	D	0.01	.	7.6607	0.28402	0.0944:0.1699:0.7357:0.0	.	857	A1L4H1	SRCRL_HUMAN	W	857	ENSP00000374274:G857W	ENSP00000374274:G857W	G	+	1	0	SSC5D	60703935	1.000000	0.71417	0.302000	0.25058	0.732000	0.41865	1.513000	0.35823	1.082000	0.41137	0.549000	0.68633	GGG	SSC5D	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000179954		0.647	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	-	0.00	35	0	G	XM_001718392		56012123	+1	tier1	-	no_errors	ENST00000389623	ensembl	human	known	74_37	missense	52.63	18	20	SNP	0.989	T
SSFA2	6744	genome.wustl.edu	37	2	182783599	182783599	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:182783599G>T	ENST00000431877.2	+	13	3162	c.2983G>T	c.(2983-2985)Gag>Tag	p.E995*	SSFA2_ENST00000409001.1_Nonsense_Mutation_p.E995*|SSFA2_ENST00000409136.1_Nonsense_Mutation_p.E504*|SSFA2_ENST00000428267.2_Nonsense_Mutation_p.E842*|SSFA2_ENST00000320370.7_Nonsense_Mutation_p.E995*|SSFA2_ENST00000467172.2_3'UTR	NM_001130445.1	NP_001123917.1	P28290	SSFA2_HUMAN	sperm specific antigen 2	995						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(18)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	38			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TCATATGACTGAGGAGGAGAG	0.358																																																	0													63.0	63.0	63.0					2																	182783599		2203	4300	6503	SO:0001587	stop_gained	0			M61199	CCDS2284.1, CCDS46467.1, CCDS74611.1	2q32.1	2012-02-01			ENSG00000138434	ENSG00000138434			11319	protein-coding gene	gene with protein product	"""cleavage signal-1 protein"", ""KRAS-induced actin-interacting protein"", ""sperm associated antigen 13"""	118990				1555770	Standard	XM_005246812		Approved	CS-1, SPAG13, KRAP, KIAA1927	uc002uoh.3	P28290	OTTHUMG00000132584	ENST00000431877.2:c.2983G>T	2.37:g.182783599G>T	ENSP00000388731:p.Glu995*		A8K6T0|Q68DA6|Q7Z7L2|Q8N1L3|Q8N263|Q8N7H2|Q8NEN5|Q96E36|Q96PW1	Nonsense_Mutation	SNP	NULL	p.E995*	ENST00000431877.2	37	c.2983	CCDS46467.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	9.962537|9.962537	0.99305|0.99305	.|.	.|.	ENSG00000138434|ENSG00000138434	ENST00000431877;ENST00000320370;ENST00000409001;ENST00000428267;ENST00000409136|ENST00000457421	.|.	.|.	.|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.152664|.	0.64402|.	D|.	0.000018|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.72032|.	D|.	0.01|.	-10.4679|-10.4679	20.2936|20.2936	0.98544|0.98544	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	995;995;995;842;504|33	.|.	ENSP00000314669:E995X|.	E|X	+|+	1|2	0|2	SSFA2|SSFA2	182491844|182491844	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.988000|0.988000	0.76386|0.76386	7.820000|7.820000	0.86633|0.86633	2.801000|2.801000	0.96364|0.96364	0.655000|0.655000	0.94253|0.94253	GAG|TGA	SSFA2	-	NULL	ENSG00000138434		0.358	SSFA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSFA2	HGNC	protein_coding	OTTHUMT00000255793.2		0.00	21	0	G	NM_006751		182783599	+1			no_errors	ENST00000431877	ensembl	human	known	74_37	nonsense	8.70	21	2	SNP	0.999	T
SSPO	23145	genome.wustl.edu	37	7	149474801	149474801	+	RNA	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:149474801C>A	ENST00000378016.2	+	0	600							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CCTGGTCGGGCTTCCACTACC	0.677																																																	0													18.0	23.0	21.0					7																	149474801		2059	4179	6238			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149474801C>A			Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.677	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		-	0.00	72	0	C			149474801	+1	tier1	-	no_errors	ENST00000262089	ensembl	human	known	74_37	rna	36.49	45	27	SNP	0.998	A
STAU2	27067	genome.wustl.edu	37	8	74581291	74581291	+	Missense_Mutation	SNP	C	C	T	rs201379762|rs66718293		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:74581291C>T	ENST00000521419.1	-	6	657	c.351G>A	c.(349-351)atG>atA	p.M117I	STAU2_ENST00000524300.1_Intron|STAU2_ENST00000517542.1_Intron|RP11-463D19.1_ENST00000533978.1_lincRNA|STAU2_ENST00000355780.5_Intron|STAU2_ENST00000523558.1_Intron|STAU2_ENST00000521727.1_Intron|STAU2_ENST00000522509.1_Intron|STAU2_ENST00000522962.1_Intron|STAU2_ENST00000522695.1_Intron|STAU2_ENST00000519961.1_Intron|STAU2_ENST00000521210.1_Intron|STAU2_ENST00000524104.1_Intron|STAU2_ENST00000521451.1_Intron			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	0	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			aaggaaaagacatctccttgg	0.373																																																	0																																										SO:0001583	missense	0			Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521419.1:c.351G>A	8.37:g.74581291C>T	ENSP00000428681:p.Met117Ile		B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Missense_Mutation	SNP	NULL	p.M117I	ENST00000521419.1	37	c.351		8	.	.	.	.	.	.	.	.	.	.	C	3.627	-0.076252	0.07184	.	.	ENSG00000040341	ENST00000521419	.	.	.	3.1	-6.2	0.02072	.	.	.	.	.	T	0.26484	0.0647	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30357	-0.9981	7	0.87932	D	0	.	6.8259	0.23883	0.1921:0.5648:0.0:0.2431	.	117	E5RGT3	.	I	117	.	ENSP00000428681:M117I	M	-	3	0	STAU2	74743845	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.169000	0.01269	-1.535000	0.01740	-1.099000	0.02127	ATG	STAU2	-	NULL	ENSG00000040341		0.373	STAU2-013	PUTATIVE	basic|exp_conf	protein_coding	STAU2	HGNC	protein_coding	OTTHUMT00000379012.2	-	0.00	236	0	C	NM_001164380		74581291	-1	tier1	-	no_errors	ENST00000521419	ensembl	human	putative	74_37	missense	24.94	292	100	SNP	0.000	T
STOML1	9399	genome.wustl.edu	37	15	74276440	74276440	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr15:74276440A>T	ENST00000316900.5	-	7	1159	c.1035T>A	c.(1033-1035)gaT>gaA	p.D345E	STOML1_ENST00000359750.4_Missense_Mutation_p.D274E|STOML1_ENST00000316911.6_Missense_Mutation_p.D295E|STOML1_ENST00000561656.1_Missense_Mutation_p.D257E|STOML1_ENST00000541638.1_Missense_Mutation_p.D302E|STOML1_ENST00000564777.1_Missense_Mutation_p.D294E	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	345	SCP2.					integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CAGGGATGCCATCAGGCACCC	0.617																																																	0													36.0	36.0	36.0					15																	74276440		2198	4297	6495	SO:0001583	missense	0			Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.1035T>A	15.37:g.74276440A>T	ENSP00000319323:p.Asp345Glu		B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	pfam_Band_7,pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom,smart_Band_7,prints_Stomatin	p.D345E	ENST00000316900.5	37	c.1035	CCDS10254.1	15	.	.	.	.	.	.	.	.	.	.	A	2.853	-0.237920	0.05944	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	4.41	-8.81	0.00813	SCP2 sterol-binding domain (2);	0.937244	0.09064	N	0.853857	T	0.06962	0.0177	N	0.16266	0.395	0.09310	N	1	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.0;0.0;0.001;0.001	T	0.33879	-0.9851	10	0.10902	T	0.67	-4.7396	2.1305	0.03749	0.2007:0.1594:0.4185:0.2214	.	302;274;295;274;344;345	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	E	345;295;302;274	ENSP00000319323:D345E;ENSP00000319384:D295E;ENSP00000442478:D302E;ENSP00000352788:D274E	ENSP00000319323:D345E	D	-	3	2	STOML1	72063493	0.000000	0.05858	0.001000	0.08648	0.131000	0.20780	-3.132000	0.00590	-1.534000	0.01743	-0.376000	0.06991	GAT	STOML1	-	pfam_SCP2_sterol-bd_dom,superfamily_SCP2_sterol-bd_dom	ENSG00000067221		0.617	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOML1	HGNC	protein_coding	OTTHUMT00000269022.1		0.00	19	0	A	NM_004809		74276440	-1			no_errors	ENST00000316900	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.000	T
STXBP5L	9515	genome.wustl.edu	37	3	121126164	121126164	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:121126164C>T	ENST00000273666.6	+	24	3005	c.2734C>T	c.(2734-2736)Cca>Tca	p.P912S	STXBP5L_ENST00000471454.1_Missense_Mutation_p.P888S|STXBP5L_ENST00000497029.1_Missense_Mutation_p.P886S|STXBP5L_ENST00000492541.1_Missense_Mutation_p.P912S|STXBP5L_ENST00000472879.1_Missense_Mutation_p.P888S	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	912					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AATGCAACCGCCATATGAAGT	0.398																																																	0													71.0	68.0	69.0					3																	121126164		1835	4088	5923	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2734C>T	3.37:g.121126164C>T	ENSP00000273666:p.Pro912Ser		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.P912S	ENST00000273666.6	37	c.2734	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	C	10.21	1.288667	0.23478	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.19938	2.11;2.11;2.11;2.11;2.11;2.11	5.1	5.1	0.69264	Lethal giant larvae (Lgl)-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43010	0.1228	L	0.53617	1.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.05869	-1.0859	10	0.33141	T	0.24	-12.4296	18.7084	0.91646	0.0:1.0:0.0:0.0	.	888;912	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	S	912;888;888;886;912;855	ENSP00000273666:P912S;ENSP00000420019:P888S;ENSP00000419627:P888S;ENSP00000420287:P886S;ENSP00000420666:P912S;ENSP00000420167:P855S	ENSP00000273666:P912S	P	+	1	0	STXBP5L	122608854	1.000000	0.71417	0.635000	0.29338	0.944000	0.59088	5.560000	0.67332	2.660000	0.90430	0.650000	0.86243	CCA	STXBP5L	-	pfam_Lgl_C_dom	ENSG00000145087		0.398	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	21	0	C			121126164	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	25.71	26	9	SNP	0.998	T
TBX2	6909	genome.wustl.edu	37	17	59486690	59486690	+	3'UTR	SNP	A	A	G	rs539363382	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:59486690A>G	ENST00000240328.3	+	0	3243				C17orf82_ENST00000335108.2_5'Flank|TBX2_ENST00000586986.1_3'UTR|RP11-332H18.4_ENST00000592009.1_RNA	NM_005994.3	NP_005985.3	Q13207	TBX2_HUMAN	T-box 2						aorta morphogenesis (GO:0035909)|atrioventricular canal development (GO:0036302)|cardiac muscle tissue development (GO:0048738)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|developmental growth involved in morphogenesis (GO:0060560)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|endocardial cushion morphogenesis (GO:0003203)|mammary placode formation (GO:0060596)|muscle cell fate determination (GO:0007521)|negative regulation of cardiac chamber formation (GO:1901211)|negative regulation of heart looping (GO:1901208)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|palate development (GO:0060021)|pharynx development (GO:0060465)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(7)|ovary(1)	9						cggcccctcgacccctcggcc	0.682													A|||	2	0.000399361	0.0	0.0	5008	,	,		7271	0.002		0.0	False		,,,				2504	0.0				GBM(3;187 253 11467 14965 23079)												0																																										SO:0001624	3_prime_UTR_variant	0			AB209378	CCDS11627.2	17q23.2	2012-01-23			ENSG00000121068	ENSG00000121068		"""T-boxes"""	11597	protein-coding gene	gene with protein product		600747				8530034	Standard	NM_005994		Approved		uc010wox.2	Q13207	OTTHUMG00000156986	ENST00000240328.3:c.*823A>G	17.37:g.59486690A>G			Q16424|Q7Z647	RNA	SNP	-	NULL	ENST00000240328.3	37	NULL	CCDS11627.2	17																																																																																			TBX2	-	-	ENSG00000121068		0.682	TBX2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TBX2	HGNC	protein_coding	OTTHUMT00000346977.2	-	0.00	26	0	A	NM_005994		59486690	+1	tier1	-	no_errors	ENST00000586986	ensembl	human	known	74_37	rna	25.00	21	7	SNP	0.546	G
SYNGR2	9144	genome.wustl.edu	37	17	76168023	76168023	+	3'UTR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr17:76168023G>A	ENST00000225777.3	+	0	740				SYNGR2_ENST00000585591.1_3'UTR|SYNGR2_ENST00000589711.1_3'UTR|SYNGR2_ENST00000590201.1_3'UTR|SYNGR2_ENST00000592456.1_3'UTR|SYNGR2_ENST00000588282.1_Missense_Mutation_p.R257Q			O43760	SNG2_HUMAN	synaptogyrin 2						protein targeting (GO:0006605)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)				endometrium(2)|large_intestine(1)|liver(1)|lung(1)|skin(1)|urinary_tract(1)	7			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.0994)			ACTGAGCGGCGGTTAGCGTGG	0.632																																																	0													51.0	49.0	50.0					17																	76168023		2203	4298	6501	SO:0001624	3_prime_UTR_variant	0			AJ002308	CCDS11753.1	17q25.3	2014-09-11			ENSG00000108639	ENSG00000108639			11499	protein-coding gene	gene with protein product	"""cellugyrin"""	603926				9760194	Standard	NM_004710		Approved		uc002juu.1	O43760	OTTHUMG00000177457	ENST00000225777.3:c.*6G>A	17.37:g.76168023G>A			O43762|Q3KQZ2|Q658S7	Missense_Mutation	SNP	pfam_Marvel	p.R257Q	ENST00000225777.3	37	c.770	CCDS11753.1	17																																																																																			SYNGR2	-	NULL	ENSG00000108639		0.632	SYNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR2	HGNC	protein_coding	OTTHUMT00000437009.2	-	0.00	36	0	G			76168023	+1	tier1	-	no_errors	ENST00000588282	ensembl	human	putative	74_37	missense	36.36	28	16	SNP	0.000	A
TDRKH	11022	genome.wustl.edu	37	1	151748932	151748932	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:151748932G>T	ENST00000368822.1	-	7	1660	c.1027C>A	c.(1027-1029)Cac>Aac	p.H343N	TDRKH_ENST00000458431.2_Missense_Mutation_p.H343N|TDRKH_ENST00000368827.6_Missense_Mutation_p.H343N|TDRKH_ENST00000440583.2_Missense_Mutation_p.H119N|TDRKH_ENST00000368824.3_Missense_Mutation_p.H343N|TDRKH_ENST00000368825.3_Missense_Mutation_p.H298N|TDRKH_ENST00000484421.1_5'Flank|TDRKH_ENST00000368823.1_Missense_Mutation_p.H339N			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	343					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCTCATAGTGCTGGGTCATC	0.478																																																	0													180.0	172.0	174.0					1																	151748932		1923	4140	6063	SO:0001583	missense	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1027C>A	1.37:g.151748932G>T	ENSP00000357812:p.His343Asn		D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.H343N	ENST00000368822.1	37	c.1027	CCDS41394.1	1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.242113	0.39598	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.09538	2.97;2.97;2.97;2.97;2.97;2.97;2.97	5.38	2.18	0.27775	Maternal tudor protein (1);	0.358812	0.35805	N	0.002965	T	0.06690	0.0171	L	0.53729	1.69	0.37287	D	0.908092	P;P;P	0.40302	0.662;0.712;0.523	B;P;B	0.45998	0.396;0.5;0.303	T	0.23332	-1.0191	10	0.30078	T	0.28	-6.4865	9.5353	0.39218	0.288:0.0:0.712:0.0	.	298;339;343	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	N	343;298;343;339;343;343;119	ENSP00000357819:H343N;ENSP00000357817:H298N;ENSP00000357815:H343N;ENSP00000357813:H339N;ENSP00000357812:H343N;ENSP00000395718:H343N;ENSP00000416645:H119N	ENSP00000357812:H343N	H	-	1	0	TDRKH	150015556	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.026000	0.49689	0.771000	0.33359	0.655000	0.94253	CAC	TDRKH	-	pfam_Tudor	ENSG00000182134		0.478	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	-	0.00	39	0	G	NM_006862		151748932	-1	tier1	-	no_errors	ENST00000368822	ensembl	human	known	74_37	missense	35.29	33	18	SNP	0.984	T
TGFBR2	7048	genome.wustl.edu	37	3	30732976	30732976	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:30732976C>T	ENST00000295754.5	+	7	1971	c.1589C>T	c.(1588-1590)aCa>aTa	p.T530I	TGFBR2_ENST00000359013.4_Missense_Mutation_p.T555I	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	530	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						GCCCGTCTCACAGCCCAGTGT	0.592																																																	0													73.0	70.0	71.0					3																	30732976		2203	4300	6503	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1589C>T	3.37:g.30732976C>T	ENSP00000295754:p.Thr530Ile		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.T555I	ENST00000295754.5	37	c.1664	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.236087	0.95240	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.94828	-3.53;-3.53	5.91	5.91	0.95273	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98175	0.9397	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98548	1.0635	10	0.87932	D	0	.	20.2857	0.98533	0.0:1.0:0.0:0.0	.	530;555	P37173;D2JYI1	TGFR2_HUMAN;.	I	530;555;360	ENSP00000295754:T530I;ENSP00000351905:T555I	ENSP00000295754:T530I	T	+	2	0	TGFBR2	30707980	1.000000	0.71417	0.984000	0.44739	0.992000	0.81027	7.818000	0.86416	2.803000	0.96430	0.650000	0.86243	ACA	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000163513		0.592	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	-	0.00	50	0	C			30732976	+1	tier1	-	no_errors	ENST00000359013	ensembl	human	known	74_37	missense	43.14	29	22	SNP	1.000	T
TMEM150C	441027	genome.wustl.edu	37	4	83406788	83406788	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:83406788C>T	ENST00000515780.2	-	8	830	c.626G>A	c.(625-627)gGc>gAc	p.G209D	TMEM150C_ENST00000449862.2_Missense_Mutation_p.G209D			B9EJG8	T150C_HUMAN	transmembrane protein 150C	209						integral component of membrane (GO:0016021)				ovary(1)	1						GGCAAAGGTGCCAAAATAAGA	0.512																																																	0													44.0	43.0	43.0					4																	83406788		1958	4155	6113	SO:0001583	missense	0			BC147027	CCDS47087.1	4q21.22	2010-06-25			ENSG00000249242	ENSG00000249242			37263	protein-coding gene	gene with protein product							Standard	NM_001080506		Approved	FLJ12993	uc003hmy.1	B9EJG8	OTTHUMG00000161083	ENST00000515780.2:c.626G>A	4.37:g.83406788C>T	ENSP00000420919:p.Gly209Asp		B7Z4J5|B7Z4L3|B7Z692|B7Z6X6	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.G209D	ENST00000515780.2	37	c.626	CCDS47087.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184489	0.78677	.	.	ENSG00000249242	ENST00000449862;ENST00000515780	T;T	0.47177	0.85;0.85	5.41	5.41	0.78517	.	.	.	.	.	T	0.69504	0.3118	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.67688	-0.5606	9	0.36615	T	0.2	-6.1462	19.1891	0.93656	0.0:1.0:0.0:0.0	.	209	B9EJG8	T150C_HUMAN	D	209	ENSP00000403438:G209D;ENSP00000420919:G209D	ENSP00000403438:G209D	G	-	2	0	TMEM150C	83625812	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	5.135000	0.64777	2.515000	0.84797	0.561000	0.74099	GGC	TMEM150C	-	pfam_Frag1/DRAM/Sfk1	ENSG00000249242		0.512	TMEM150C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM150C	HGNC	protein_coding	OTTHUMT00000363685.2	-	0.00	40	0	C	NM_001080506		83406788	-1	tier1	-	no_errors	ENST00000449862	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TMEM252	169693	genome.wustl.edu	37	9	71155464	71155464	+	Silent	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr9:71155464G>A	ENST00000377311.3	-	1	319	c.267C>T	c.(265-267)gcC>gcT	p.A89A	RP11-274B18.2_ENST00000432148.1_lincRNA|RP11-274B18.4_ENST00000413269.3_lincRNA	NM_153237.1	NP_694969.1	Q8N6L7	TM252_HUMAN	transmembrane protein 252	89						integral component of membrane (GO:0016021)											TGTCTACTGTGGCCACGGGCA	0.532																																																	0													66.0	60.0	62.0					9																	71155464		2203	4300	6503	SO:0001819	synonymous_variant	0			BC029780	CCDS35040.1	9q21.13	2012-07-19	2012-07-19	2012-07-19	ENSG00000181778	ENSG00000181778			28537	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 71"""	C9orf71		12477932	Standard	NM_153237		Approved	MGC34760	uc004agt.3	Q8N6L7	OTTHUMG00000019967	ENST00000377311.3:c.267C>T	9.37:g.71155464G>A				Silent	SNP	NULL	p.A89	ENST00000377311.3	37	c.267	CCDS35040.1	9																																																																																			TMEM252	-	NULL	ENSG00000181778		0.532	TMEM252-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM252	HGNC	protein_coding	OTTHUMT00000052551.1	-	0.00	21	0	G	NM_153237		71155464	-1	tier1	-	no_errors	ENST00000377311	ensembl	human	known	74_37	silent	33.33	14	7	SNP	0.150	A
TMEM63B	55362	genome.wustl.edu	37	6	44102778	44102778	+	Missense_Mutation	SNP	C	C	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:44102778C>A	ENST00000259746.9	+	3	367	c.184C>A	c.(184-186)Ctc>Atc	p.L62I	TMEM63B_ENST00000323267.6_Missense_Mutation_p.L62I			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	62					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			ATTCTCTATCCTCCGGAAGGT	0.592																																																	0													87.0	75.0	79.0					6																	44102778		2203	4300	6503	SO:0001583	missense	0			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.184C>A	6.37:g.44102778C>A	ENSP00000259746:p.Leu62Ile		B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.L62I	ENST00000259746.9	37	c.184	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	C	12.32	1.902348	0.33628	.	.	ENSG00000137216	ENST00000259746;ENST00000532634;ENST00000323267	T;T;T	0.41400	1.0;1.0;1.0	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000002	T	0.40839	0.1133	L	0.42487	1.325	0.36866	D	0.888678	B;D	0.71674	0.036;0.998	B;D	0.77557	0.07;0.99	T	0.22208	-1.0223	10	0.30854	T	0.27	.	10.0545	0.42237	0.0:0.9006:0.0:0.0994	.	62;62	Q5T3F8;Q5T3F8-2	TM63B_HUMAN;.	I	62	ENSP00000259746:L62I;ENSP00000437163:L62I;ENSP00000327154:L62I	ENSP00000259746:L62I	L	+	1	0	TMEM63B	44210756	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.377000	0.34317	2.221000	0.72209	0.462000	0.41574	CTC	TMEM63B	-	NULL	ENSG00000137216		0.592	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	-	0.00	29	0	C	XM_166410		44102778	+1	tier1	-	no_errors	ENST00000259746	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
DCHS1	8642	genome.wustl.edu	37	11	6640117	6640117	+	IGR	SNP	C	C	T	rs549309216		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:6640117C>T	ENST00000299441.3	-	0	10763				TPP1_ENST00000534644.1_Intron|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000299427.6_Missense_Mutation_p.R40H|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000528657.1_3'UTR|TPP1_ENST00000533371.1_De_novo_Start_OutOfFrame	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1						branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGGTCCGCACGGCCCAGGGA	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20661	0.001		0.0	False		,,,				2504	0.0																0													60.0	60.0	60.0					11																	6640117		2201	4296	6497	SO:0001628	intergenic_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398		11.37:g.6640117C>T			O15098	Missense_Mutation	SNP	pfam_Peptidase_S53_propep,pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.R40H	ENST00000299441.3	37	c.119	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178886	0.78564	.	.	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.72167	-0.63;-0.63	5.64	4.72	0.59763	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.057570	0.64402	D	0.000001	T	0.74741	0.3756	M	0.77712	2.385	0.80722	D	1	D;P	0.58970	0.984;0.649	P;B	0.46758	0.526;0.043	T	0.77659	-0.2505	10	0.49607	T	0.09	-18.6436	13.6352	0.62219	0.0:0.8447:0.1553:0.0	.	40;40	B4DEQ3;O14773	.;TPP1_HUMAN	H	40	ENSP00000299427:R40H;ENSP00000398136:R40H	ENSP00000299427:R40H	R	-	2	0	TPP1	6596693	0.402000	0.25311	0.984000	0.44739	0.991000	0.79684	0.912000	0.28597	1.360000	0.45960	0.462000	0.41574	CGT	TPP1	-	pfam_Peptidase_S53_propep,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	ENSG00000166340		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	26	0	C	NM_003737		6640117	-1			no_errors	ENST00000299427	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
TRIM66	9866	genome.wustl.edu	37	11	8662484	8662484	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:8662484G>T	ENST00000299550.6	-	9	1197	c.1003C>A	c.(1003-1005)Cag>Aag	p.Q335K	TRIM66_ENST00000402157.2_Missense_Mutation_p.Q333K	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	335						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						GGGGGGACCTGGCCTTTGAGG	0.642																																																	0													29.0	31.0	31.0					11																	8662484		692	1591	2283	SO:0001583	missense	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.1003C>A	11.37:g.8662484G>T	ENSP00000299550:p.Gln335Lys		Q9BQQ4	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.Q335K	ENST00000299550.6	37	c.1003		11	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262829	0.80358	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.17528	2.27;2.27	5.02	5.02	0.67125	.	0.153416	0.30686	N	0.009089	T	0.41994	0.1183	M	0.69823	2.125	0.29912	N	0.823451	D	0.69078	0.997	D	0.73380	0.98	T	0.33675	-0.9859	10	0.37606	T	0.19	-3.4827	18.3148	0.90217	0.0:0.0:1.0:0.0	.	335	O15016	TRI66_HUMAN	K	335;333	ENSP00000299550:Q335K;ENSP00000384876:Q333K	ENSP00000299550:Q335K	Q	-	1	0	TRIM66	8619060	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	6.717000	0.74707	2.323000	0.78572	0.484000	0.47621	CAG	TRIM66	-	NULL	ENSG00000166436		0.642	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		-	0.00	22	0	G	XM_084529		8662484	-1	tier1	-	no_errors	ENST00000299550	ensembl	human	known	74_37	missense	36.36	21	12	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179504469	179504469	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:179504469G>T	ENST00000591111.1	-	173	36134	c.35910C>A	c.(35908-35910)ccC>ccA	p.P11970P	TTN_ENST00000342175.6_Silent_p.P4738P|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Silent_p.P4671P|TTN_ENST00000460472.2_Silent_p.P4546P|TTN_ENST00000589042.1_Silent_p.P13611P|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Silent_p.P11043P|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000431752.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11970	Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGGCAGCGATGGGGGTTGGTT	0.403																																																	0													114.0	111.0	112.0					2																	179504469		1854	4097	5951	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35910C>A	2.37:g.179504469G>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P11043	ENST00000591111.1	37	c.33129		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	51	0	G	NM_133378		179504469	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.015	T
UNC5A	90249	genome.wustl.edu	37	5	176289624	176289624	+	Splice_Site	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:176289624G>T	ENST00000329542.4	+	2	344		c.e2-1		UNC5A_ENST00000261961.3_5'Flank	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCCTGCCGCAGGTGCCCAGCA	0.657																																																	0													37.0	35.0	35.0					5																	176289624		2203	4299	6502	SO:0001630	splice_region_variant	0			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.71-1G>T	5.37:g.176289624G>T			B2RXE6|Q8TF26|Q96GP4	Splice_Site	SNP	-	e2-1	ENST00000329542.4	37	c.71-1	CCDS34299.1	5	.	.	.	.	.	.	.	.	.	.	G	16.48	3.133820	0.56828	.	.	ENSG00000113763	ENST00000329542	.	.	.	3.92	3.92	0.45320	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4942	0.84223	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC5A	176222230	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	9.387000	0.97232	2.206000	0.71126	0.561000	0.74099	.	UNC5A	-	-	ENSG00000113763		0.657	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5A	HGNC	protein_coding	OTTHUMT00000372166.1		0.00	40	0	G	XM_030300	Intron	176289624	+1			no_errors	ENST00000329542	ensembl	human	known	74_37	splice_site	6.67	42	3	SNP	1.000	T
VAX2	25806	genome.wustl.edu	37	2	71160034	71160034	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:71160034G>T	ENST00000234392.2	+	3	605	c.573G>T	c.(571-573)ctG>ctT	p.L191L	ATP6V1B1_ENST00000234396.4_5'Flank|snoU13_ENST00000459218.1_RNA	NM_012476.2	NP_036608.1	Q9UIW0	VAX2_HUMAN	ventral anterior homeobox 2	191					axonogenesis (GO:0007409)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic eye morphogenesis (GO:0048048)|forebrain development (GO:0030900)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	7						AGGGCCGGCTGCTCTCTGTGC	0.662																																																	0													33.0	38.0	37.0					2																	71160034		2203	4300	6503	SO:0001819	synonymous_variant	0			Y17791	CCDS1911.1	2p13.3	2011-06-20			ENSG00000116035	ENSG00000116035		"""Homeoboxes / ANTP class : NKL subclass"""	12661	protein-coding gene	gene with protein product		604295				10485894	Standard	NM_012476		Approved	DRES93	uc002shh.3	Q9UIW0	OTTHUMG00000129714	ENST00000234392.2:c.573G>T	2.37:g.71160034G>T			Q53Y33	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.L191	ENST00000234392.2	37	c.573	CCDS1911.1	2																																																																																			VAX2	-	NULL	ENSG00000116035		0.662	VAX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAX2	HGNC	protein_coding	OTTHUMT00000251923.1	-	0.00	70	0	G			71160034	+1	tier1	-	no_errors	ENST00000234392	ensembl	human	known	74_37	silent	36.62	45	26	SNP	1.000	T
VGLL3	389136	genome.wustl.edu	37	3	87027857	87027859	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr3:87027857_87027859delCTC	ENST00000398399.2	-	2	583_585	c.220_222delGAG	c.(220-222)gagdel	p.E74del	VGLL3_ENST00000383698.3_In_Frame_Del_p.E74del	NM_016206.2	NP_057290.2			vestigial-like family member 3											NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(11)	19	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		GCTGGtctttctcctcctcctcc	0.502																																																	0										1,38,3879		0,0,1,6,26,1926						5.1	1.0			64	3,85,7944		0,0,3,22,41,3950	no	codingComplex	VGLL3	NM_016206.2		0,0,4,28,67,5876	A1A1,A1A2,A1R,A2A2,A2R,RR		1.0956,0.9954,1.0628				4,123,11823				SO:0001651	inframe_deletion	0			AF099505	CCDS43110.1	3p12.1	2014-03-03	2014-03-03		ENSG00000206538	ENSG00000206538			24327	protein-coding gene	gene with protein product		609980	"""vestigial like 3 (Drosophila)"""			12376544	Standard	NM_016206		Approved	VGL-3	uc003dqn.3	A8MV65	OTTHUMG00000158984	ENST00000398399.2:c.220_222delGAG	3.37:g.87027866_87027868delCTC	ENSP00000381436:p.Glu74del			In_Frame_Del	DEL	pfam_Vg_Tdu,smart_TDU_repeat	p.E74in_frame_del	ENST00000398399.2	37	c.222_220	CCDS43110.1	3																																																																																			VGLL3	-	NULL	ENSG00000206538		0.502	VGLL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VGLL3	HGNC	protein_coding	OTTHUMT00000352805.1		0.00	36	0	CTC	NM_016206		87027859	-1	tier1		no_errors	ENST00000398399	ensembl	human	known	74_37	in_frame_del	14.71	29	5	DEL	1.000:1.000:1.000	-
VPS13D	55187	genome.wustl.edu	37	1	12401921	12401921	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:12401921C>T	ENST00000358136.3	+	41	8841	c.8711C>T	c.(8710-8712)aCc>aTc	p.T2904I	VPS13D_ENST00000356315.4_Missense_Mutation_p.T2879I	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGGTTTGCCACCCTGACCACC	0.557																																																	0													91.0	89.0	90.0					1																	12401921		2203	4300	6503	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8711C>T	1.37:g.12401921C>T	ENSP00000350854:p.Thr2904Ile			Missense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.T2904I	ENST00000358136.3	37	c.8711	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.353267|5.353267	0.95830|0.95830	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.51071	.|0.72;0.72	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51534|0.51534	0.1680|0.1680	L|L	0.31371|0.31371	0.925|0.925	0.80722|0.80722	D|D	1|1	.|P;P	.|0.47034	.|0.889;0.822	.|P;P	.|0.55011	.|0.766;0.588	T|T	0.26985|0.26985	-1.0087|-1.0087	5|10	.|0.13108	.|T	.|0.6	.|.	19.9079|19.9079	0.97014|0.97014	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2879;2903	.|Q5THJ4-2;Q5THJ4	.|.;VP13D_HUMAN	S|I	1726|2879;2904	.|ENSP00000348666:T2879I;ENSP00000350854:T2904I	.|ENSP00000348666:T2879I	P|T	+|+	1|2	0|0	VPS13D|VPS13D	12324508|12324508	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.487000|7.487000	0.81328|0.81328	2.703000|2.703000	0.92315|0.92315	0.591000|0.591000	0.81541|0.81541	CCC|ACC	VPS13D	-	NULL	ENSG00000048707		0.557	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	-	0.00	56	0	C	NM_015378		12401921	+1	tier1	-	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	7.94	58	5	SNP	1.000	T
VWA5A	4013	genome.wustl.edu	37	11	123989240	123989240	+	Splice_Site	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:123989240G>T	ENST00000456829.2	+	6	721	c.470G>T	c.(469-471)gGg>gTg	p.G157V	VWA5A_ENST00000360334.4_Splice_Site_p.G157V|VWA5A_ENST00000392744.4_Splice_Site_p.G173V|VWA5A_ENST00000392748.1_Splice_Site_p.G157V|VWA5A_ENST00000449321.1_Splice_Site_p.G157V|VWA5A_ENST00000361352.5_Splice_Site_p.G157V	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	157										autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TCTTTTATAGGGTCGTCTAAG	0.443																																																	0													150.0	151.0	151.0					11																	123989240		2201	4299	6500	SO:0001630	splice_region_variant	0			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.470-1G>T	11.37:g.123989240G>T			Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.G157V	ENST00000456829.2	37	c.470	CCDS8444.1	11	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634887	0.29068	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.25085	3.63;1.82;3.63;2.16;2.16;2.15	5.52	1.17	0.20885	.	0.424262	0.26948	N	0.021700	T	0.25306	0.0615	L	0.59436	1.845	0.33215	D	0.553921	P;P	0.49090	0.749;0.919	B;P	0.47075	0.339;0.536	T	0.31024	-0.9958	9	.	.	.	.	4.3517	0.11158	0.2845:0.0:0.548:0.1675	.	173;157	B4DHS6;O00534	.;VMA5A_HUMAN	V	157;157;157;157;157;157;157;173	ENSP00000407726:G157V;ENSP00000353485:G157V;ENSP00000376504:G157V;ENSP00000355070:G157V;ENSP00000404683:G157V;ENSP00000376501:G173V	.	G	+	2	0	VWA5A	123494450	0.419000	0.25449	0.018000	0.16275	0.001000	0.01503	0.701000	0.25616	0.356000	0.24157	-0.188000	0.12872	GGG	VWA5A	-	NULL	ENSG00000110002		0.443	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	HGNC	protein_coding	OTTHUMT00000387273.1		0.00	21	0	G	NM_014622	Missense_Mutation	123989240	+1			no_errors	ENST00000392748	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.029	T
VWDE	221806	genome.wustl.edu	37	7	12410039	12410039	+	Silent	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr7:12410039C>T	ENST00000275358.3	-	12	2081	c.1893G>A	c.(1891-1893)gcG>gcA	p.A631A		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	631	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						AAGACGGATACGCTGCAGTGT	0.443																																																	0													23.0	19.0	20.0					7																	12410039		692	1590	2282	SO:0001819	synonymous_variant	0				CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1893G>A	7.37:g.12410039C>T			B7ZM77|Q96SQ3	Silent	SNP	pfam_VWF_type-D,superfamily_Cadherin-like,smart_VWF_type-D,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A631	ENST00000275358.3	37	c.1893	CCDS47544.1	7																																																																																			VWDE	-	NULL	ENSG00000146530		0.443	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VWDE	HGNC	protein_coding	OTTHUMT00000325870.3		0.00	21	0	C	XM_371878		12410039	-1			no_errors	ENST00000452576	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.000	T
WARS2	10352	genome.wustl.edu	37	1	119683180	119683180	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:119683180G>T	ENST00000235521.4	-	1	114	c.88C>A	c.(88-90)Cag>Aag	p.Q30K	RP11-418J17.1_ENST00000440150.1_RNA|WARS2_ENST00000369426.5_Missense_Mutation_p.Q30K|RP11-418J17.1_ENST00000457043.1_RNA|RP11-418J17.1_ENST00000425884.1_RNA|RP11-418J17.1_ENST00000413531.1_RNA|RP11-418J17.1_ENST00000418015.1_RNA|WARS2_ENST00000537870.1_5'Flank|WARS2_ENST00000497761.1_5'UTR	NM_015836.3|NM_201263.2	NP_056651.1|NP_957715.1	Q9UGM6	SYWM_HUMAN	tryptophanyl tRNA synthetase 2, mitochondrial	30					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)|vasculogenesis (GO:0001570)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(2)	15	all_neural(166;0.187)	all_lung(203;2.48e-06)|Lung NSC(69;1.74e-05)|all_epithelial(167;0.000564)		Lung(183;0.0629)	L-Tryptophan(DB00150)	TTGGTTACCTGGAGAGCGGGA	0.597																																																	0													43.0	44.0	43.0					1																	119683180		2203	4300	6503	SO:0001583	missense	0			BC021722	CCDS900.1, CCDS30817.1	1p12	2011-07-01	2007-02-23		ENSG00000116874	ENSG00000116874	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12730	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 2, mitochondrial"""	604733				10072595, 10828066	Standard	NM_201263		Approved	TrpRS	uc001ehn.3	Q9UGM6	OTTHUMG00000012335	ENST00000235521.4:c.88C>A	1.37:g.119683180G>T	ENSP00000235521:p.Gln30Lys		B1ALR1|B2R9D4|Q53FT4|Q5VUD2|Q86TQ0	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ic,prints_Trp-tRNA-ligase,tigrfam_Trp-tRNA-ligase	p.Q30K	ENST00000235521.4	37	c.88	CCDS900.1	1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.952536	0.34471	.	.	ENSG00000116874	ENST00000369426;ENST00000235521	T;T	0.39787	1.06;2.06	6.04	5.11	0.69529	.	0.335947	0.31772	N	0.007100	T	0.11623	0.0283	N	0.08118	0	0.80722	D	1	P;B;B;P	0.35192	0.489;0.349;0.019;0.454	B;B;B;B	0.39379	0.298;0.205;0.02;0.192	T	0.09729	-1.0661	10	0.09843	T	0.71	-19.3092	13.1357	0.59407	0.0:0.1603:0.8397:0.0	.	30;30;30;30	B7Z448;B7Z6G7;Q9UGM6;B1ALR1	.;.;SYWM_HUMAN;.	K	30	ENSP00000358434:Q30K;ENSP00000235521:Q30K	ENSP00000235521:Q30K	Q	-	1	0	WARS2	119484703	0.989000	0.36119	0.902000	0.35471	0.016000	0.09150	1.448000	0.35112	1.527000	0.49086	0.561000	0.74099	CAG	WARS2	-	NULL	ENSG00000116874		0.597	WARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WARS2	HGNC	protein_coding	OTTHUMT00000034362.1	-	0.00	25	0	G	NM_015836		119683180	-1	tier1	-	no_errors	ENST00000235521	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.962	T
WDR17	116966	genome.wustl.edu	37	4	177052812	177052812	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:177052812G>A	ENST00000280190.4	+	8	1249	c.1093G>A	c.(1093-1095)Gca>Aca	p.A365T	WDR17_ENST00000508596.1_Missense_Mutation_p.A341T|WDR17_ENST00000393643.2_Missense_Mutation_p.A341T|WDR17_ENST00000507824.2_Missense_Mutation_p.A348T			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	365										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCCTGGTCATGCAGTGTGTTG	0.408																																																	0													294.0	284.0	287.0					4																	177052812		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1093G>A	4.37:g.177052812G>A	ENSP00000280190:p.Ala365Thr		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A365T	ENST00000280190.4	37	c.1093	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.58|15.58	2.876184|2.876184	0.51801|0.51801	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824|ENST00000505894	T;T;T|.	0.57595|.	0.4;0.43;0.39|.	5.45|5.45	5.45|5.45	0.79879|0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);|.	0.311450|.	0.33591|.	N|.	0.004757|.	T|T	0.29028|0.29028	0.0721|0.0721	N|N	0.08118|0.08118	0|0	0.31276|0.31276	N|N	0.691145|0.691145	B;B|.	0.09022|.	0.002;0.002|.	B;B|.	0.09377|.	0.004;0.004|.	T|T	0.21690|0.21690	-1.0238|-1.0238	10|5	0.37606|.	T|.	0.19|.	-7.4256|-7.4256	14.8403|14.8403	0.70217|0.70217	0.071:0.0:0.929:0.0|0.071:0.0:0.929:0.0	.|.	341;365|.	E7EQX0;Q8IZU2|.	.;WDR17_HUMAN|.	T|I	341;341;365;348|113	ENSP00000422763:A341T;ENSP00000377258:A341T;ENSP00000280190:A365T|.	ENSP00000280190:A365T|.	A|M	+|+	1|3	0|0	WDR17|WDR17	177289806|177289806	1.000000|1.000000	0.71417|0.71417	0.793000|0.793000	0.32043|0.32043	0.657000|0.657000	0.38888|0.38888	6.114000|6.114000	0.71560|0.71560	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	GCA|ATG	WDR17	-	superfamily_WD40_repeat_dom	ENSG00000150627		0.408	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2		0.00	55	0	G			177052812	+1			no_errors	ENST00000280190	ensembl	human	known	74_37	missense	5.00	57	3	SNP	0.994	A
PDE8B	8622	genome.wustl.edu	37	5	76721825	76721825	+	Intron	SNP	A	A	T	rs557850223	byFrequency	TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:76721825A>T	ENST00000264917.5	+	21	2593				PDE8B_ENST00000333194.4_Intron|PDE8B_ENST00000340978.3_Intron|PDE8B_ENST00000342343.4_Intron|WDR41_ENST00000512033.1_5'Flank|PDE8B_ENST00000346042.3_Intron|PDE8B_ENST00000505283.1_Intron	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B						cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	ATATATTTTTAAAAATGTGGC	0.408													A|||	3	0.000599042	0.0	0.0	5008	,	,		18696	0.0		0.0	False		,,,				2504	0.0031																0																																										SO:0001627	intron_variant	0			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.2548+104A>T	5.37:g.76721825A>T			Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	RNA	SNP	-	NULL	ENST00000264917.5	37	NULL	CCDS4037.1	5																																																																																			WDR41	-	-	ENSG00000164253		0.408	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR41	HGNC	protein_coding	OTTHUMT00000220015.3	-	0.00	26	0	A	NM_003719		76721825	-1	tier1	-	no_errors	ENST00000514878	ensembl	human	putative	74_37	rna	44.19	24	19	SNP	0.007	T
WHSC1	7468	genome.wustl.edu	37	4	1954887	1954887	+	Intron	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr4:1954887C>T	ENST00000382895.3	+	14	2568				WHSC1_ENST00000382888.3_Silent_p.C6C|WHSC1_ENST00000482415.2_Intron|WHSC1_ENST00000508803.1_Intron|WHSC1_ENST00000382891.5_Intron|WHSC1_ENST00000382892.2_Intron	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1						anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GATCTTTTTGCTGGAGAATGC	0.517			T	IGH@	MM																																			Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0																																										SO:0001627	intron_variant	0			AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.2138-164C>T	4.37:g.1954887C>T			A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	pfam_SET_dom,pfam_PWWP_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_PWWP_dom,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.C6	ENST00000382895.3	37	c.18	CCDS33940.1	4																																																																																			WHSC1	-	NULL	ENSG00000109685		0.517	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	-	0.00	48	0	C	NM_133330		1954887	+1	tier1	-	no_errors	ENST00000382888	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.042	T
WWP2	11060	genome.wustl.edu	37	16	69974083	69974083	+	3'UTR	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:69974083G>A	ENST00000359154.2	+	0	2954				WWP2_ENST00000568684.1_3'UTR|WWP2_ENST00000448661.1_3'UTR|WWP2_ENST00000356003.2_3'UTR	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2						cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CCTTTGCAAAGTTCCAGAGGG	0.597																																																	0													31.0	36.0	35.0					16																	69974083		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.*240G>A	16.37:g.69974083G>A			A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	RNA	SNP	-	NULL	ENST00000359154.2	37	NULL	CCDS10885.1	16																																																																																			WWP2	-	-	ENSG00000198373		0.597	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	-	0.00	30	0	G	NM_007014		69974083	+1	tier1	-	no_errors	ENST00000569297	ensembl	human	known	74_37	rna	22.86	27	8	SNP	0.178	A
XRRA1	143570	genome.wustl.edu	37	11	74559456	74559456	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr11:74559456G>A	ENST00000340360.6	-	15	1739	c.1408C>T	c.(1408-1410)Ccg>Tcg	p.P470S	RN7SL239P_ENST00000490061.2_RNA|XRRA1_ENST00000321448.8_Missense_Mutation_p.P195S|XRRA1_ENST00000527087.1_Missense_Mutation_p.P383S	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GTCATGCGCGGGTGATGGAGC	0.517																																																	0													52.0	55.0	54.0					11																	74559456		2040	4172	6212	SO:0001583	missense	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.1408C>T	11.37:g.74559456G>A	ENSP00000339918:p.Pro470Ser			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P470S	ENST00000340360.6	37	c.1408	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858938	0.51376	.	.	ENSG00000166435	ENST00000340360;ENST00000321448;ENST00000344880;ENST00000398418;ENST00000527087	T;T;T	0.54866	0.57;1.39;0.55	4.75	2.88	0.33553	.	0.685306	0.14270	N	0.330232	T	0.61689	0.2367	L	0.59436	1.845	0.09310	N	1	D;D;D;D;D;D;P	0.76494	0.993;0.999;0.989;0.999;0.989;0.989;0.867	P;D;P;D;P;P;B	0.71414	0.834;0.961;0.836;0.973;0.773;0.773;0.445	T	0.47275	-0.9130	10	0.27082	T	0.32	0.1239	6.5764	0.22569	0.21:0.0:0.79:0.0	.	470;72;26;383;414;80;456	Q6P2D8;B3KRF2;E9PP69;Q6P2D8-2;Q6P2D8-4;Q8TEH2;Q6P2D8-3	XRRA1_HUMAN;.;.;.;.;.;.	S	470;195;456;414;383	ENSP00000339918:P470S;ENSP00000319303:P195S;ENSP00000435838:P383S	ENSP00000319303:P195S	P	-	1	0	XRRA1	74237104	0.023000	0.18921	0.002000	0.10522	0.019000	0.09904	2.405000	0.44548	1.353000	0.45828	-0.218000	0.12543	CCG	XRRA1	-	NULL	ENSG00000166435		0.517	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	-	0.00	29	0	G	NM_182969		74559456	-1	tier1	-	no_errors	ENST00000340360	ensembl	human	known	74_37	missense	33.33	24	12	SNP	0.001	A
ZBTB9	221504	genome.wustl.edu	37	6	33423364	33423364	+	Missense_Mutation	SNP	A	A	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:33423364A>T	ENST00000395064.2	+	2	755	c.487A>T	c.(487-489)Aca>Tca	p.T163S		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	163					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TCTTTCCACTACATCCTCTAC	0.502																																																	0													85.0	93.0	91.0					6																	33423364		2203	4300	6503	SO:0001583	missense	0			AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.487A>T	6.37:g.33423364A>T	ENSP00000378503:p.Thr163Ser		A2AB19	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.T163S	ENST00000395064.2	37	c.487	CCDS4780.1	6	.	.	.	.	.	.	.	.	.	.	A	0.098	-1.157206	0.01686	.	.	ENSG00000213588	ENST00000395064	T	0.05786	3.39	4.72	-1.39	0.08997	.	0.265833	0.22248	U	0.062596	T	0.00754	0.0025	N	0.17082	0.46	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.45131	-0.9282	10	0.09084	T	0.74	.	4.122	0.10109	0.3807:0.0:0.0991:0.5202	.	163	Q96C00	ZBTB9_HUMAN	S	163	ENSP00000378503:T163S	ENSP00000378503:T163S	T	+	1	0	ZBTB9	33531342	0.000000	0.05858	0.003000	0.11579	0.303000	0.27691	-0.188000	0.09642	-0.032000	0.13758	-0.410000	0.06199	ACA	ZBTB9	-	NULL	ENSG00000213588		0.502	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB9	HGNC	protein_coding	OTTHUMT00000276533.1		0.00	36	0	A	NM_152735		33423364	+1			no_errors	ENST00000395064	ensembl	human	known	74_37	missense	6.76	69	5	SNP	0.001	T
ZC3H12A	80149	genome.wustl.edu	37	1	37947279	37947279	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr1:37947279G>T	ENST00000373087.6	+	4	777	c.661G>T	c.(661-663)Gtg>Ttg	p.V221L		NM_025079.2	NP_079355.2			zinc finger CCCH-type containing 12A											NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGGCAAGCGGGTGGTGTGCTA	0.577																																																	0													280.0	244.0	256.0					1																	37947279		2203	4300	6503	SO:0001583	missense	0				CCDS417.1	1p34.3	2012-07-05			ENSG00000163874	ENSG00000163874		"""Zinc fingers, CCCH-type domain containing"""	26259	protein-coding gene	gene with protein product	"""MCP induced protein 1"""	610562				18178554, 22055188	Standard	NM_025079		Approved	FLJ23231, MCPIP1	uc001cbb.4	Q5D1E8	OTTHUMG00000004221	ENST00000373087.6:c.661G>T	1.37:g.37947279G>T	ENSP00000362179:p.Val221Leu			Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.V221L	ENST00000373087.6	37	c.661	CCDS417.1	1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740454	0.89573	.	.	ENSG00000163874	ENST00000373087;ENST00000373082	T	0.41758	0.99	5.8	5.8	0.92144	Ribonuclease Zc3h12a-like (1);	0.056779	0.64402	D	0.000001	T	0.52338	0.1728	L	0.46614	1.455	0.80722	D	1	P	0.43701	0.815	P	0.54706	0.759	T	0.43065	-0.9414	10	0.42905	T	0.14	-28.9726	14.8523	0.70306	0.0:0.0:0.8564:0.1436	.	221	Q5D1E8	ZC12A_HUMAN	L	221	ENSP00000362179:V221L	ENSP00000362174:V221L	V	+	1	0	ZC3H12A	37719866	1.000000	0.71417	0.990000	0.47175	0.977000	0.68977	6.593000	0.74100	2.735000	0.93741	0.655000	0.94253	GTG	ZC3H12A	-	pfam_RNase_Zc3h12	ENSG00000163874		0.577	ZC3H12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12A	HGNC	protein_coding	OTTHUMT00000012154.2	-	0.00	50	0	G	NM_025079		37947279	+1	tier1	-	no_errors	ENST00000373087	ensembl	human	known	74_37	missense	45.65	25	21	SNP	0.998	T
ZC3H6	376940	genome.wustl.edu	37	2	113074098	113074098	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr2:113074098C>T	ENST00000409871.1	+	6	1200	c.799C>T	c.(799-801)Cag>Tag	p.Q267*	ZC3H6_ENST00000343936.4_Nonsense_Mutation_p.Q267*	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	267							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						ATTTATTAATCAGCACACAGT	0.313																																																	0													56.0	54.0	54.0					2																	113074098		1814	4058	5872	SO:0001587	stop_gained	0			AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.799C>T	2.37:g.113074098C>T	ENSP00000386764:p.Gln267*		A9JR71|Q6ZW96	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.Q267*	ENST00000409871.1	37	c.799	CCDS46393.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.618313	0.98888	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	.	.	.	5.52	5.52	0.82312	.	0.116921	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-11.3939	19.7971	0.96490	0.0:1.0:0.0:0.0	.	.	.	.	X	267;267;244	.	ENSP00000340298:Q267X	Q	+	1	0	ZC3H6	112790569	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.632000	0.67819	2.757000	0.94681	0.585000	0.79938	CAG	ZC3H6	-	NULL	ENSG00000188177		0.313	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H6	HGNC	protein_coding	OTTHUMT00000330551.1	-	0.00	42	0	C	NM_198581		113074098	+1	tier1	-	no_errors	ENST00000343936	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	1.000	T
ZFP41	286128	genome.wustl.edu	37	8	144332542	144332542	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr8:144332542G>T	ENST00000330701.4	+	2	898	c.529G>T	c.(529-531)Ggg>Tgg	p.G177W	ZFP41_ENST00000522452.1_Missense_Mutation_p.G177W|ZFP41_ENST00000520584.1_Missense_Mutation_p.G177W	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	177					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CACGCACTGTGGGAAAGCCTT	0.607																																																	0													75.0	84.0	81.0					8																	144332542		2203	4300	6503	SO:0001583	missense	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.529G>T	8.37:g.144332542G>T	ENSP00000327427:p.Gly177Trp		D3DWJ5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G177W	ENST00000330701.4	37	c.529	CCDS6397.1	8	.	.	.	.	.	.	.	.	.	.	G	14.32	2.500688	0.44455	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.01051	5.4;5.4;5.4	3.38	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09335	0.0230	H	0.95114	3.625	0.36373	D	0.861403	D	0.89917	1.0	D	0.91635	0.999	T	0.02519	-1.1147	9	0.87932	D	0	-16.3403	8.9369	0.35706	0.116:0.0:0.884:0.0	.	177	Q8N8Y5	ZFP41_HUMAN	W	177	ENSP00000430465:G177W;ENSP00000327427:G177W;ENSP00000428966:G177W	ENSP00000327427:G177W	G	+	1	0	ZFP41	144403917	0.982000	0.34865	0.311000	0.25182	0.380000	0.30137	2.125000	0.42016	0.741000	0.32674	0.467000	0.42956	GGG	ZFP41	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181638		0.607	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZFP41	HGNC	protein_coding	OTTHUMT00000381114.2		0.00	44	0	G	NM_173832		144332542	+1			no_errors	ENST00000330701	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
ZKSCAN2	342357	genome.wustl.edu	37	16	25251911	25251911	+	Silent	SNP	T	T	C			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr16:25251911T>C	ENST00000328086.7	-	7	2933	c.2130A>G	c.(2128-2130)tcA>tcG	p.S710S	CTD-2547G23.2_ENST00000569456.1_RNA	NM_001012981.4	NP_001012999.3	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	710					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	36				GBM - Glioblastoma multiforme(48;0.0378)		ATTGTCTTCCTGAGATGCATT	0.443																																																	0													116.0	106.0	109.0					16																	25251911		2197	4300	6497	SO:0001819	synonymous_variant	0			AK026852	CCDS32410.1	16p12.1	2013-01-09	2007-02-20	2007-02-20		ENSG00000155592		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	25677	protein-coding gene	gene with protein product			"""zinc finger protein 694"""	ZNF694			Standard	NM_001012981		Approved	FLJ23199, ZSCAN34	uc002dod.4	Q63HK3		ENST00000328086.7:c.2130A>G	16.37:g.25251911T>C			A1L3B4|Q6ZN77	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.S710	ENST00000328086.7	37	c.2130	CCDS32410.1	16																																																																																			ZKSCAN2	-	NULL	ENSG00000155592		0.443	ZKSCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN2	HGNC	protein_coding	OTTHUMT00000435739.1	-	0.00	39	0	T	NM_001012981		25251911	-1	tier1	-	no_errors	ENST00000328086	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.890	C
ZNF333	84449	genome.wustl.edu	37	19	14817559	14817559	+	Missense_Mutation	SNP	G	G	A	rs571042009		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:14817559G>A	ENST00000292530.6	+	7	576	c.485G>A	c.(484-486)cGc>cAc	p.R162H	ZNF333_ENST00000540689.2_Missense_Mutation_p.R162H|ZNF333_ENST00000601134.1_Silent_p.P102P|ZNF333_ENST00000536363.1_Missense_Mutation_p.R53H	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R162H(1)		central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						CTGGGCCACCGCAACCCATGG	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		18225	0.0		0.001	False		,,,				2504	0.0				NSCLC(60;75 1281 16985 25154 29885)												1	Substitution - Missense(1)	large_intestine(1)											85.0	79.0	81.0					19																	14817559		2203	4300	6503	SO:0001583	missense	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.485G>A	19.37:g.14817559G>A	ENSP00000292530:p.Arg162His		Q6P2E6|Q86WS6|Q8TDL0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R162H	ENST00000292530.6	37	c.485	CCDS12316.1	19	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126210	0.20959	.	.	ENSG00000160961	ENST00000536363;ENST00000540689;ENST00000292530	T;T;T	0.06933	3.24;5.82;3.31	2.29	-4.58	0.03410	.	.	.	.	.	T	0.02688	0.0081	N	0.08118	0	0.09310	N	1	P	0.43287	0.802	B	0.32090	0.14	T	0.39961	-0.9588	9	0.41790	T	0.15	.	5.4512	0.16566	0.0:0.2483:0.506:0.2457	.	162	Q96JL9	ZN333_HUMAN	H	53;162;162	ENSP00000439749:R53H;ENSP00000438130:R162H;ENSP00000292530:R162H	ENSP00000292530:R162H	R	+	2	0	ZNF333	14678559	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.496000	0.06436	-1.048000	0.03238	-1.437000	0.01076	CGC	ZNF333	-	NULL	ENSG00000160961		0.572	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1	-	0.00	31	0	G	NM_032433		14817559	+1	tier1	-	no_errors	ENST00000292530	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.000	A
ZNF30	90075	genome.wustl.edu	37	19	35434868	35434868	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:35434868G>A	ENST00000601142.1	+	5	1235	c.998G>A	c.(997-999)cGa>cAa	p.R333Q	ZNF30_ENST00000439785.1_Missense_Mutation_p.R334Q|ZNF30_ENST00000426813.2_Missense_Mutation_p.R252Q|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000303586.7_Missense_Mutation_p.R334Q			P17039	ZNF30_HUMAN	zinc finger protein 30	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		CAGCTTACTCGACATCAGAGT	0.433																																																	0													94.0	100.0	98.0					19																	35434868		2203	4300	6503	SO:0001583	missense	0			X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.998G>A	19.37:g.35434868G>A	ENSP00000469954:p.Arg333Gln		A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R334Q	ENST00000601142.1	37	c.1001	CCDS46045.1	19	.	.	.	.	.	.	.	.	.	.	g	0.013	-1.611831	0.00835	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813;ENST00000342559	T;T	0.36157	1.27;1.27	2.23	-4.45	0.03546	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19685	0.0473	L	0.47190	1.495	0.09310	N	1	B;B	0.24132	0.08;0.098	B;B	0.12156	0.004;0.007	T	0.35325	-0.9793	9	0.10636	T	0.68	.	1.5443	0.02562	0.5063:0.1563:0.1799:0.1575	.	334;333	P17039-2;P17039	.;ZNF30_HUMAN	Q	334;333;252;70	ENSP00000403441:R334Q;ENSP00000416457:R252Q	ENSP00000303889:R333Q	R	+	2	0	ZNF30	40126708	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-6.750000	0.00055	-1.129000	0.02918	-0.490000	0.04691	CGA	ZNF30	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000168661		0.433	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	ZNF30	HGNC	protein_coding	OTTHUMT00000464432.1	-	0.00	48	0	G	NM_194325		35434868	+1	tier1	-	no_errors	ENST00000303586	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	A
ZNF134	7693	genome.wustl.edu	37	19	58132263	58132263	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:58132263C>T	ENST00000396161.5	+	3	1086	c.776C>T	c.(775-777)cCt>cTt	p.P259L		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		GGAGAAATGCCTTATAAGTGC	0.413																																																	0													71.0	77.0	75.0					19																	58132263		2201	4297	6498	SO:0001583	missense	0			U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.776C>T	19.37:g.58132263C>T	ENSP00000379464:p.Pro259Leu		Q9Y4B2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P259L	ENST00000396161.5	37	c.776	CCDS42638.1	19	.	.	.	.	.	.	.	.	.	.	C	23.6	4.433803	0.83776	.	.	ENSG00000213762	ENST00000418193;ENST00000541849;ENST00000396161	T	0.56444	0.46	4.29	4.29	0.51040	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67097	0.2857	L	0.52266	1.64	0.54753	D	0.999989	D	0.89917	1.0	D	0.91635	0.999	T	0.70360	-0.4893	9	0.66056	D	0.02	.	15.975	0.80057	0.0:1.0:0.0:0.0	.	259	P52741	ZN134_HUMAN	L	326;179;259	ENSP00000379464:P259L	ENSP00000379464:P259L	P	+	2	0	ZNF134	62824075	0.107000	0.21998	1.000000	0.80357	0.993000	0.82548	1.451000	0.35145	2.370000	0.80446	0.561000	0.74099	CCT	ZNF134	-	pfscan_Znf_C2H2	ENSG00000213762		0.413	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF134	HGNC	protein_coding	OTTHUMT00000466808.1	-	0.00	29	0	C	NM_003435		58132263	+1	tier1	-	no_errors	ENST00000396161	ensembl	human	known	74_37	missense	34.88	28	15	SNP	1.000	T
ZNF335	63925	genome.wustl.edu	37	20	44578137	44578137	+	Missense_Mutation	SNP	C	C	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr20:44578137C>T	ENST00000322927.2	-	25	3840	c.3740G>A	c.(3739-3741)gGc>gAc	p.G1247D	ZNF335_ENST00000426788.1_Missense_Mutation_p.G1092D	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	1247	Gln-rich.				brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GATGTGATGGCCTTCAGGGAC	0.602																																																	0													65.0	47.0	53.0					20																	44578137		2203	4300	6503	SO:0001583	missense	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.3740G>A	20.37:g.44578137C>T	ENSP00000325326:p.Gly1247Asp		B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G1247D	ENST00000322927.2	37	c.3740	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	C	20.6	4.022947	0.75275	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.38401	1.14;1.14	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.52056	-0.8626	10	0.72032	D	0.01	-27.5442	17.5268	0.87802	0.0:1.0:0.0:0.0	.	1092;1247	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	D	1247;1024;1092	ENSP00000325326:G1247D;ENSP00000397098:G1092D	ENSP00000243961:G1024D	G	-	2	0	ZNF335	44011544	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	7.204000	0.77872	2.630000	0.89119	0.561000	0.74099	GGC	ZNF335	-	NULL	ENSG00000198026		0.602	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	-	0.00	38	0	C	NM_022095		44578137	-1	tier1	-	no_errors	ENST00000322927	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
ZNF581	51545	genome.wustl.edu	37	19	56156448	56156448	+	Missense_Mutation	SNP	C	C	T	rs201594382		TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:56156448C>T	ENST00000587252.1	+	2	784	c.511C>T	c.(511-513)Cgc>Tgc	p.R171C	ZNF581_ENST00000588537.1_Missense_Mutation_p.R171C|CCDC106_ENST00000308964.3_5'Flank|ZNF581_ENST00000270451.5_Missense_Mutation_p.R171C			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	171					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CTCTGGGGAACGCCCGTTTCA	0.692																																																	0													54.0	58.0	57.0					19																	56156448		2203	4300	6503	SO:0001583	missense	0			AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.511C>T	19.37:g.56156448C>T	ENSP00000466047:p.Arg171Cys		B2RDM6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R171C	ENST00000587252.1	37	c.511	CCDS12932.1	19	.	.	.	.	.	.	.	.	.	.	C	17.23	3.337786	0.60963	.	.	ENSG00000171425	ENST00000270451	T	0.20463	2.07	3.28	2.18	0.27775	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46833	0.1413	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.44034	-0.9354	9	0.87932	D	0	.	5.6613	0.17670	0.1912:0.6985:0.0:0.1103	.	171	Q9P0T4	ZN581_HUMAN	C	171	ENSP00000270451:R171C	ENSP00000270451:R171C	R	+	1	0	ZNF581	60848260	0.648000	0.27313	0.714000	0.30535	0.873000	0.50193	0.909000	0.28558	0.700000	0.31782	0.407000	0.27541	CGC	ZNF581	-	pfscan_Znf_C2H2	ENSG00000171425		0.692	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF581	HGNC	protein_coding	OTTHUMT00000453430.1	-	0.00	80	0	C	NM_016535		56156448	+1	tier1	-	no_errors	ENST00000270451	ensembl	human	known	74_37	missense	27.52	79	30	SNP	0.993	T
ZNF608	57507	genome.wustl.edu	37	5	124080411	124080411	+	Missense_Mutation	SNP	G	G	A			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr5:124080411G>A	ENST00000306315.5	-	1	707	c.272C>T	c.(271-273)tCt>tTt	p.S91F	ZNF608_ENST00000504926.1_5'Flank	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	91							metal ion binding (GO:0046872)	p.S91F(1)		breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		CTGGGGAGCAGAGGCCTGAAC	0.498																																																	1	Substitution - Missense(1)	breast(1)											86.0	81.0	83.0					5																	124080411		2203	4300	6503	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.272C>T	5.37:g.124080411G>A	ENSP00000307746:p.Ser91Phe		A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.S91F	ENST00000306315.5	37	c.272	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134983	0.56828	.	.	ENSG00000168916	ENST00000306315;ENST00000509799;ENST00000513986	T	0.54279	0.58	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000011	T	0.62502	0.2433	L	0.59436	1.845	0.45129	D	0.998141	P	0.52692	0.955	P	0.51135	0.66	T	0.63808	-0.6553	10	0.54805	T	0.06	-13.3114	19.2512	0.93926	0.0:0.0:1.0:0.0	.	91	Q9ULD9	ZN608_HUMAN	F	91	ENSP00000307746:S91F	ENSP00000307746:S91F	S	-	2	0	ZNF608	124108310	1.000000	0.71417	0.993000	0.49108	0.947000	0.59692	2.799000	0.47892	2.719000	0.93026	0.655000	0.94253	TCT	ZNF608	-	NULL	ENSG00000168916		0.498	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	-	0.00	52	0	G	XM_114432		124080411	-1	tier1	-	no_errors	ENST00000306315	ensembl	human	known	74_37	missense	34.43	40	21	SNP	1.000	A
ZNF667	63934	genome.wustl.edu	37	19	56952917	56952917	+	Silent	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr19:56952917G>T	ENST00000504904.3	-	7	2166	c.1447C>A	c.(1447-1449)Cga>Aga	p.R483R	ZNF667_ENST00000342634.3_Silent_p.R611R|ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000292069.6_Silent_p.R483R			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		AGAGATATTCGGTGGCTGAAG	0.443																																																	0													80.0	76.0	78.0					19																	56952917		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1447C>A	19.37:g.56952917G>T			B2RMS6|B9EK36|Q6B093|Q9H807	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R611	ENST00000504904.3	37	c.1831	CCDS12944.1	19																																																																																			ZNF667	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198046		0.443	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	36	0	G	NM_022103		56952917	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	silent	28.79	46	19	SNP	0.000	T
ZSCAN31	64288	genome.wustl.edu	37	6	28294059	28294059	+	Missense_Mutation	SNP	G	G	T			TCGA-JY-A93F-01A-21D-A37C-09	TCGA-JY-A93F-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	def53512-fa87-4775-8ed4-9c1ceaea2a3d	09ac5fc9-0dc3-4174-87ac-5207067025d0	g.chr6:28294059G>T	ENST00000414429.1	-	8	2008	c.1105C>A	c.(1105-1107)Cat>Aat	p.H369N	ZSCAN31_ENST00000481934.1_5'UTR|ZSCAN31_ENST00000344279.6_Missense_Mutation_p.H369N|ZSCAN31_ENST00000439158.1_Missense_Mutation_p.H369N|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.H369N|ZSCAN31_ENST00000446474.1_Missense_Mutation_p.H210N			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	369					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACTCGGAGATGCTGGAAAAGC	0.473																																																	0													208.0	201.0	203.0					6																	28294059		2203	4300	6503	SO:0001583	missense	0				CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.1105C>A	6.37:g.28294059G>T	ENSP00000390076:p.His369Asn		Q6P178|Q8WWS5	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.H369N	ENST00000414429.1	37	c.1105	CCDS4649.1	6	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994960	0.74703	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000446474;ENST00000344279	D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18	5.06	3.18	0.36537	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.92821	0.7717	H	0.95043	3.615	0.26365	N	0.976985	D	0.89917	1.0	D	0.97110	1.0	D	0.86378	0.1727	9	0.87932	D	0	.	9.1778	0.37123	0.0793:0.0:0.7753:0.1454	.	369	Q96LW9	ZN323_HUMAN	N	369;369;369;210;369	ENSP00000380050:H369N;ENSP00000413705:H369N;ENSP00000390076:H369N;ENSP00000402937:H210N;ENSP00000345339:H369N	ENSP00000345339:H369N	H	-	1	0	ZNF323	28402038	0.999000	0.42202	0.008000	0.14137	0.978000	0.69477	3.593000	0.54001	0.547000	0.28938	0.650000	0.86243	CAT	ZSCAN31	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000235109		0.473	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZSCAN31	HGNC	protein_coding	OTTHUMT00000346804.1		0.00	24	0	G	NM_030899		28294059	-1			no_errors	ENST00000344279	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.847	T
