#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAAS	8086	genome.wustl.edu	37	12	53702239	53702239	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr12:53702239C>A	ENST00000209873.4	-	12	1326	c.1161G>T	c.(1159-1161)caG>caT	p.Q387H	AAAS_ENST00000549983.1_5'Flank|AAAS_ENST00000394384.3_Missense_Mutation_p.Q354H|AAAS_ENST00000550286.1_Missense_Mutation_p.Q263H	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	387					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						CATCTGGTGTCTGTATTGTTG	0.522																																																	0													281.0	209.0	233.0					12																	53702239		2203	4300	6503	SO:0001583	missense	0			AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.1161G>T	12.37:g.53702239C>A	ENSP00000209873:p.Gln387His		Q5JB47|Q9NWI6|Q9UG19	Missense_Mutation	SNP	pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q387H	ENST00000209873.4	37	c.1161	CCDS8856.1	12	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124635	0.56613	.	.	ENSG00000094914	ENST00000209873;ENST00000394384;ENST00000550286	T;T;T	0.78246	-1.16;-1.16;-1.16	4.43	2.56	0.30785	WD40/YVTN repeat-like-containing domain (1);	0.620854	0.17346	N	0.177568	T	0.52224	0.1721	N	0.08118	0	0.24037	N	0.996091	P;B	0.48294	0.908;0.0	B;B	0.39027	0.288;0.0	T	0.47142	-0.9140	10	0.42905	T	0.14	-7.1273	4.6584	0.12630	0.0:0.6207:0.1829:0.1963	.	354;387	Q5JB47;Q9NRG9	.;AAAS_HUMAN	H	387;354;263	ENSP00000209873:Q387H;ENSP00000377908:Q354H;ENSP00000446885:Q263H	ENSP00000209873:Q387H	Q	-	3	2	AAAS	51988506	0.980000	0.34600	0.971000	0.41717	0.982000	0.71751	0.493000	0.22451	0.608000	0.30000	0.456000	0.33151	CAG	AAAS	-	NULL	ENSG00000094914		0.522	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAAS	HGNC	protein_coding	OTTHUMT00000405632.1	-	0.00	32	0	C			53702239	-1	tier1	-	no_errors	ENST00000209873	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.570	A
ABCA12	26154	genome.wustl.edu	37	2	215865633	215865633	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:215865633G>T	ENST00000272895.7	-	22	3194	c.2975C>A	c.(2974-2976)gCa>gAa	p.A992E	ABCA12_ENST00000389661.4_Missense_Mutation_p.A674E	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	992					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGTGGTCTGTGCGGTCTTGAG	0.453																																					Ovarian(66;664 1488 5121 34295)												0													142.0	149.0	147.0					2																	215865633		2203	4300	6503	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2975C>A	2.37:g.215865633G>T	ENSP00000272895:p.Ala992Glu		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.A992E	ENST00000272895.7	37	c.2975	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062268	0.55432	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95885	-3.84;-3.84	5.73	5.73	0.89815	.	0.350884	0.28021	N	0.016901	D	0.94712	0.8294	L	0.50333	1.59	0.80722	D	1	B;B	0.28971	0.229;0.068	B;B	0.35182	0.122;0.197	D	0.92652	0.6134	10	0.52906	T	0.07	.	19.9082	0.97015	0.0:0.0:1.0:0.0	.	992;674	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	E	992;674	ENSP00000272895:A992E;ENSP00000374312:A674E	ENSP00000272895:A992E	A	-	2	0	ABCA12	215573878	0.937000	0.31787	0.700000	0.30305	0.987000	0.75469	5.458000	0.66679	2.705000	0.92388	0.555000	0.69702	GCA	ABCA12	-	NULL	ENSG00000144452		0.453	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	71	0	G	NM_173076		215865633	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.777	T
ABCA2	20	genome.wustl.edu	37	9	139906593	139906593	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:139906593G>T	ENST00000371605.3	-	33	5465	c.5318C>A	c.(5317-5319)cCc>cAc	p.P1773H	ABCA2_ENST00000265662.5_Missense_Mutation_p.P1774H|ABCA2_ENST00000341511.6_Missense_Mutation_p.P1774H			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1773					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CTTATTCATGGGGTGGTTGGT	0.716																																																	0													88.0	91.0	90.0					9																	139906593		2014	4160	6174	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.5318C>A	9.37:g.139906593G>T	ENSP00000360666:p.Pro1773His		A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P1774H	ENST00000371605.3	37	c.5321		9	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192657	0.58017	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.88509	-2.39;-2.39;-2.39	4.31	4.31	0.51392	.	0.124423	0.56097	D	0.000037	D	0.95341	0.8488	M	0.89658	3.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96428	0.9317	10	0.87932	D	0	.	16.5498	0.84470	0.0:0.0:1.0:0.0	.	1773;1804	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	H	1774;1773;1804;1774	ENSP00000265662:P1774H;ENSP00000360666:P1773H;ENSP00000344155:P1774H	ENSP00000265662:P1774H	P	-	2	0	ABCA2	139026414	1.000000	0.71417	1.000000	0.80357	0.147000	0.21601	8.717000	0.91425	2.229000	0.72834	0.305000	0.20034	CCC	ABCA2	-	NULL	ENSG00000107331		0.716	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		-	0.00	51	0	G	NM_001606		139906593	-1	tier1	-	no_errors	ENST00000265662	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
ABI3BP	25890	genome.wustl.edu	37	3	100530638	100530638	+	Intron	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:100530638C>T	ENST00000284322.5	-	19	1707				ABI3BP_ENST00000383691.4_Missense_Mutation_p.A427T|ABI3BP_ENST00000471714.1_Missense_Mutation_p.A1150T	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TCTGTTTTGGCTGGTGCTAGG	0.423																																																	0																																										SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1598-3559G>A	3.37:g.100530638C>T			B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.A427T	ENST00000284322.5	37	c.1279	CCDS46880.1	3	.	.	.	.	.	.	.	.	.	.	C	10.09	1.255547	0.22965	.	.	ENSG00000154175	ENST00000471714;ENST00000383691;ENST00000482765	T;T;T	0.23552	1.9;1.9;1.9	4.2	-1.56	0.08532	.	.	.	.	.	T	0.10208	0.0250	.	.	.	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.002	T	0.37009	-0.9724	8	0.13108	T	0.6	.	3.7609	0.08603	0.1856:0.3527:0.0:0.4616	.	427;1150	B4DSV9;D3YTG3	.;.	T	1150;427;22	ENSP00000420524:A1150T;ENSP00000373189:A427T;ENSP00000418800:A22T	ENSP00000373189:A427T	A	-	1	0	ABI3BP	102013328	0.002000	0.14202	0.004000	0.12327	0.714000	0.41099	-0.412000	0.07132	-0.304000	0.08843	0.585000	0.79938	GCC	ABI3BP	-	NULL	ENSG00000154175		0.423	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	-	0.00	58	0	C			100530638	-1	tier1	-	no_errors	ENST00000383691	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.007	T
ABI3BP	25890	genome.wustl.edu	37	3	100551140	100551140	+	Intron	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:100551140G>T	ENST00000284322.5	-	18	1707				ABI3BP_ENST00000383691.4_Missense_Mutation_p.T102K|ABI3BP_ENST00000495063.1_Missense_Mutation_p.T797K|ABI3BP_ENST00000471714.1_Missense_Mutation_p.T797K	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TGGATGGGGCGTGGTTTTAGG	0.418																																																	0																																										SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1597+14075C>A	3.37:g.100551140G>T			B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.T102K	ENST00000284322.5	37	c.305	CCDS46880.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.14|19.14|19.14	3.770592|3.770592|3.770592	0.69992|0.69992|0.69992	.|.|.	.|.|.	ENSG00000154175|ENSG00000154175|ENSG00000154175	ENST00000466947|ENST00000495591;ENST00000471901;ENST00000478235;ENST00000528490;ENST00000534413|ENST00000471714;ENST00000383692;ENST00000383691;ENST00000533795;ENST00000495063	.|.|T;T	.|.|0.59083	.|.|0.29;0.29	5.03|5.03|5.03	4.16|4.16|4.16	0.48862|0.48862|0.48862	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	0.54046|0.54046|0.54046	0.1834|0.1834|0.1834	.|.|.	.|.|.	.|.|.	0.22317|0.22317|0.22317	N|N|N	0.999206|0.999206|0.999206	.|.|D;D;D;D	.|.|0.61080	.|.|0.986;0.989;0.986;0.961	.|.|P;P;P;P	.|.|0.59889	.|.|0.78;0.865;0.78;0.67	T|T|T	0.39333|0.39333|0.39333	-0.9619|-0.9619|-0.9619	4|4|8	.|.|0.06365	.|.|T	.|.|0.9	.|.|.	9.487|9.487|9.487	0.38935|0.38935|0.38935	0.0957:0.0:0.9043:0.0|0.0957:0.0:0.9043:0.0|0.0957:0.0:0.9043:0.0	.|.|.	.|.|102;797;797;83	.|.|B4DSV9;Q5JPC9;D3YTG3;D3YTD6	.|.|.;.;.;.	Q|S|K	79|204;7;4;129;140|797;83;102;163;797	.|.|ENSP00000420524:T797K;ENSP00000373189:T102K	.|.|ENSP00000373189:T102K	H|R|T	-|-|-	3|1|2	2|0|0	ABI3BP|ABI3BP|ABI3BP	102033830|102033830|102033830	0.939000|0.939000|0.939000	0.31865|0.31865|0.31865	0.979000|0.979000|0.979000	0.43373|0.43373|0.43373	0.949000|0.949000|0.949000	0.60115|0.60115|0.60115	1.277000|1.277000|1.277000	0.33167|0.33167|0.33167	1.494000|1.494000|1.494000	0.48533|0.48533|0.48533	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAC|CGC|ACG	ABI3BP	-	NULL	ENSG00000154175		0.418	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	-	0.00	139	0	G			100551140	-1	tier1	-	no_errors	ENST00000383691	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.994	T
ADAMTS12	81792	genome.wustl.edu	37	5	33642025	33642025	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:33642025C>A	ENST00000504830.1	-	11	1943	c.1608G>T	c.(1606-1608)aaG>aaT	p.K536N	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Missense_Mutation_p.K536N	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	536	Disintegrin.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TCTCTGGTTTCTTCCCCACTG	0.597										HNSCC(64;0.19)																																							0													61.0	52.0	55.0					5																	33642025		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1608G>T	5.37:g.33642025C>A	ENSP00000422554:p.Lys536Asn		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K536N	ENST00000504830.1	37	c.1608	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	C	12.58	1.979908	0.34942	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60040	0.22;0.25	5.93	5.07	0.68467	.	0.091919	0.64402	D	0.000001	T	0.64080	0.2566	L	0.41961	1.31	0.80722	D	1	D;P	0.76494	0.999;0.885	D;P	0.69479	0.964;0.449	T	0.60234	-0.7303	10	0.23302	T	0.38	.	10.338	0.43860	0.0:0.7957:0.0:0.2043	.	536;536	P58397-3;P58397	.;ATS12_HUMAN	N	536	ENSP00000422554:K536N;ENSP00000344847:K536N	ENSP00000344847:K536N	K	-	3	2	ADAMTS12	33677782	0.993000	0.37304	1.000000	0.80357	0.950000	0.60333	0.666000	0.25097	1.531000	0.49152	0.555000	0.69702	AAG	ADAMTS12	-	NULL	ENSG00000151388		0.597	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2		0.00	36	0	C	NM_030955		33642025	-1			no_errors	ENST00000504830	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
ADH7	131	genome.wustl.edu	37	4	100341790	100341790	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:100341790C>A	ENST00000209665.4	-	6	1001	c.761G>T	c.(760-762)aGt>aTt	p.S254I	ADH7_ENST00000482593.1_Missense_Mutation_p.S185I|ADH7_ENST00000476959.1_Missense_Mutation_p.S262I|ADH7_ENST00000437033.2_Missense_Mutation_p.S242I	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	254					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		GTCCTTGGGACTGATACACTC	0.473																																																	0													173.0	143.0	153.0					4																	100341790		2203	4300	6503	SO:0001583	missense	0			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.761G>T	4.37:g.100341790C>A	ENSP00000209665:p.Ser254Ile		A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.S254I	ENST00000209665.4	37	c.761	CCDS34034.1	4	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317471	0.40996	.	.	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000482593;ENST00000476959	T;T;T;T	0.04454	3.62;3.62;3.62;3.62	3.8	-0.597	0.11653	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.212220	0.46758	N	0.000265	T	0.07999	0.0200	L	0.29908	0.895	0.35353	D	0.787572	D	0.71674	0.998	D	0.80764	0.994	T	0.37934	-0.9684	10	0.87932	D	0	-17.8822	3.2647	0.06860	0.2003:0.2485:0.0:0.5512	.	254	P40394	ADH7_HUMAN	I	242;254;185;262	ENSP00000414254:S242I;ENSP00000209665:S254I;ENSP00000420613:S185I;ENSP00000420269:S262I	ENSP00000209665:S254I	S	-	2	0	ADH7	100560813	0.946000	0.32159	0.583000	0.28640	0.288000	0.27193	0.187000	0.16998	-0.044000	0.13491	0.563000	0.77884	AGT	ADH7	-	pfam_ADH_C	ENSG00000196344		0.473	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding			0.00	60	0	C	NM_000673		100341790	-1			no_errors	ENST00000209665	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
AGO4	192670	genome.wustl.edu	37	1	36297117	36297117	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:36297117C>A	ENST00000373210.3	+	8	1183	c.938C>A	c.(937-939)cCc>cAc	p.P313H		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	313	PAZ. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										CTGAAATACCCCCATCTTCCC	0.388																																																	0													108.0	109.0	108.0					1																	36297117		2203	4300	6503	SO:0001583	missense	0			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.938C>A	1.37:g.36297117C>A	ENSP00000362306:p.Pro313His		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.P313H	ENST00000373210.3	37	c.938	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510430	0.85389	.	.	ENSG00000134698	ENST00000373210	T	0.36157	1.27	5.55	5.55	0.83447	Argonaute/Dicer protein, PAZ (4);	0.048111	0.85682	D	0.000000	T	0.75140	0.3809	H	0.97340	3.985	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.84571	0.0655	10	0.87932	D	0	-4.7179	19.5182	0.95174	0.0:1.0:0.0:0.0	.	313	Q9HCK5	AGO4_HUMAN	H	313	ENSP00000362306:P313H	ENSP00000362306:P313H	P	+	2	0	EIF2C4	36069704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.603000	0.88011	0.655000	0.94253	CCC	AGO4	-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom	ENSG00000134698		0.388	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO4	HGNC	protein_coding	OTTHUMT00000012213.3		0.00	87	0	C	NM_017629		36297117	+1			no_errors	ENST00000373210	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
ADPRHL2	54936	genome.wustl.edu	37	1	36558863	36558863	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:36558863G>T	ENST00000373178.4	+	6	998	c.968G>T	c.(967-969)gGg>gTg	p.G323V		NM_017825.2	NP_060295.1	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	323						mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(ADP-ribose) glycohydrolase activity (GO:0004649)			cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|pancreas(1)	8		Myeloproliferative disorder(586;0.0393)				ACCATGGCTGGGGCCATTGCT	0.552																																																	0													121.0	123.0	122.0					1																	36558863		2203	4300	6503	SO:0001583	missense	0			AJ427295	CCDS402.1	1p34.3	2008-02-05			ENSG00000116863	ENSG00000116863			21304	protein-coding gene	gene with protein product		610624				12070318, 16278211	Standard	NM_017825		Approved	ARH3, FLJ20446	uc001bzt.3	Q9NX46	OTTHUMG00000007628	ENST00000373178.4:c.968G>T	1.37:g.36558863G>T	ENSP00000362273:p.Gly323Val		Q53G94|Q6IAB8|Q9BY47	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	p.G323V	ENST00000373178.4	37	c.968	CCDS402.1	1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424413	0.83667	.	.	ENSG00000116863	ENST00000373178;ENST00000540867;ENST00000543954	T	0.74209	-0.82	5.48	5.48	0.80851	.	0.052078	0.85682	D	0.000000	D	0.90027	0.6886	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92487	0.5997	10	0.72032	D	0.01	-15.0065	14.9046	0.70709	0.0:0.1428:0.8571:0.0	.	323	Q9NX46	ARHL2_HUMAN	V	323;243;169	ENSP00000362273:G323V	ENSP00000362273:G323V	G	+	2	0	ADPRHL2	36331450	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.840000	0.86819	2.563000	0.86464	0.563000	0.77884	GGG	ADPRHL2	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	ENSG00000116863		0.552	ADPRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL2	HGNC	protein_coding	OTTHUMT00000020199.1	-	0.00	40	0	G	NM_017825		36558863	+1	tier1	-	no_errors	ENST00000373178	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
AK9	221264	genome.wustl.edu	37	6	109850198	109850201	+	Intron	DEL	AAAC	AAAC	-	rs577355457|rs201441562|rs560850105|rs72613250|rs72331392	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	AAAC	AAAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:109850198_109850201delAAAC	ENST00000424296.2	-	29	3710				AK9_ENST00000355283.1_Frame_Shift_Del_p.VF295fs|AK9_ENST00000341338.6_Intron	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9						ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										ttgaaaaaaaaaacaaaaCTACTT	0.417																																																	0																																										SO:0001627	intron_variant	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3633+12GTTT>-	6.37:g.109850198_109850201delAAAC			A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Frame_Shift_Del	DEL	pfam_Adenylate_kin,pfam_YHS_dom,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase	p.V295fs	ENST00000424296.2	37	c.886_883	CCDS55048.1	6																																																																																			AK9	-	NULL	ENSG00000155085		0.417	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	HGNC	protein_coding			0.00	114	0	AAAC	NM_001145128		109850201	-1	tier1		no_errors	ENST00000355283	ensembl	human	novel	74_37	frame_shift_del	7.14	26	2	DEL	0.003:0.003:0.000:0.000	-
ALDH1B1	219	genome.wustl.edu	37	9	38396346	38396346	+	Missense_Mutation	SNP	G	G	A	rs199527495		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:38396346G>A	ENST00000377698.3	+	2	754	c.601G>A	c.(601-603)Gcc>Acc	p.A201T		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	201					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)	p.A201T(1)		NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		CCCGGCACTCGCCACAGGCAA	0.597																																																	1	Substitution - Missense(1)	lung(1)						G	THR/ALA	3,4403	6.2+/-15.9	0,3,2200	77.0	76.0	77.0		601	4.6	0.2	9		77	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ALDH1B1	NM_000692.4	58	0,4,6499	AA,AG,GG		0.0116,0.0681,0.0308	probably-damaging	201/518	38396346	4,13002	2203	4300	6503	SO:0001583	missense	0			M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.601G>A	9.37:g.38396346G>A	ENSP00000366927:p.Ala201Thr		B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.A201T	ENST00000377698.3	37	c.601	CCDS6615.1	9	.	.	.	.	.	.	.	.	.	.	G	16.07	3.017270	0.54576	6.81E-4	1.16E-4	ENSG00000137124	ENST00000377698	T	0.81078	-1.45	5.51	4.61	0.57282	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.64402	D	0.000010	D	0.91338	0.7268	H	0.95114	3.625	0.54753	D	0.999983	D	0.71674	0.998	P	0.62740	0.906	D	0.93032	0.6449	10	0.72032	D	0.01	.	12.306	0.54902	0.0827:0.0:0.9173:0.0	.	201	P30837	AL1B1_HUMAN	T	201	ENSP00000366927:A201T	ENSP00000366927:A201T	A	+	1	0	ALDH1B1	38386346	1.000000	0.71417	0.182000	0.23118	0.407000	0.30961	5.253000	0.65452	1.329000	0.45376	0.655000	0.94253	GCC	ALDH1B1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000137124		0.597	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1B1	HGNC	protein_coding	OTTHUMT00000052492.1		0.00	25	0	G			38396346	+1			no_errors	ENST00000377698	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.998	A
ALDOC	230	genome.wustl.edu	37	17	26901148	26901148	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:26901148G>T	ENST00000226253.4	-	7	1211	c.736C>A	c.(736-738)Cca>Aca	p.P246T	ALDOC_ENST00000395321.2_Missense_Mutation_p.P246T|PIGS_ENST00000308360.7_5'Flank|RP11-192H23.5_ENST00000585189.1_RNA|ALDOC_ENST00000395319.3_Missense_Mutation_p.P218T|PIGS_ENST00000543734.1_5'Flank|PIGS_ENST00000395346.2_5'Flank	NM_005165.2	NP_005156.1	P09972	ALDOC_HUMAN	aldolase C, fructose-bisphosphate	246					aging (GO:0007568)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|organ regeneration (GO:0031100)|protein heterotetramerization (GO:0051290)|protein homotetramerization (GO:0051289)|response to hypoxia (GO:0001666)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	cytoskeletal protein binding (GO:0008092)|fructose-bisphosphate aldolase activity (GO:0004332)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Lung NSC(42;0.00431)					ATCTCCTCTGGGGTATACTTG	0.587																																																	0													155.0	158.0	157.0					17																	26901148		2203	4300	6503	SO:0001583	missense	0			AF054987	CCDS11236.1	17q11.2	2013-09-20			ENSG00000109107	ENSG00000109107	4.1.2.13		418	protein-coding gene	gene with protein product		103870					Standard	XM_005257947		Approved		uc002hbp.3	P09972	OTTHUMG00000132605	ENST00000226253.4:c.736C>A	17.37:g.26901148G>T	ENSP00000226253:p.Pro246Thr		B2R5R3|Q3SYL3|Q6FH94|Q6P0L5	Missense_Mutation	SNP	pfam_Aldolase_I	p.P246T	ENST00000226253.4	37	c.736	CCDS11236.1	17	.	.	.	.	.	.	.	.	.	.	G	13.30	2.196373	0.38806	.	.	ENSG00000109107	ENST00000395319;ENST00000226253;ENST00000395321	D;D;D	0.86627	-2.15;-2.15;-2.15	5.58	3.48	0.39840	Aldolase-type TIM barrel (1);	0.288128	0.40064	N	0.001195	D	0.84428	0.5470	M	0.62723	1.935	0.52501	D	0.999952	B;B	0.25390	0.066;0.125	B;B	0.29353	0.099;0.101	T	0.83200	-0.0079	10	0.72032	D	0.01	-2.8769	9.3949	0.38397	0.0742:0.2602:0.6657:0.0	.	218;246	A8MVZ9;P09972	.;ALDOC_HUMAN	T	218;246;246	ENSP00000378729:P218T;ENSP00000226253:P246T;ENSP00000378731:P246T	ENSP00000226253:P246T	P	-	1	0	ALDOC	23925275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.475000	0.45162	1.367000	0.46095	0.555000	0.69702	CCA	ALDOC	-	pfam_Aldolase_I	ENSG00000109107		0.587	ALDOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDOC	HGNC	protein_coding	OTTHUMT00000255839.4	-	0.00	51	0	G			26901148	-1	tier1	-	no_errors	ENST00000226253	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.999	T
ANKFN1	162282	genome.wustl.edu	37	17	54450138	54450138	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:54450138C>A	ENST00000318698.2	+	6	777	c.742C>A	c.(742-744)Ctg>Atg	p.L248M	ANKFN1_ENST00000566473.2_Missense_Mutation_p.L248M	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	248										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AGAGAAGCAGCTGAAAGCTTG	0.493																																																	0													175.0	155.0	162.0					17																	54450138		2203	4300	6503	SO:0001583	missense	0			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.742C>A	17.37:g.54450138C>A	ENSP00000321627:p.Leu248Met			Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.L248M	ENST00000318698.2	37	c.742	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457977	0.43634	.	.	ENSG00000153930	ENST00000318698	T	0.27720	1.65	5.78	3.43	0.39272	.	0.064517	0.64402	D	0.000006	T	0.53626	0.1808	M	0.77103	2.36	0.46678	D	0.999151	D	0.89917	1.0	D	0.76575	0.988	T	0.58781	-0.7576	10	0.62326	D	0.03	-7.143	11.8209	0.52238	0.1255:0.8018:0.0:0.0727	.	248	Q8N957	ANKF1_HUMAN	M	248	ENSP00000321627:L248M	ENSP00000321627:L248M	L	+	1	2	ANKFN1	51805137	1.000000	0.71417	1.000000	0.80357	0.513000	0.34164	4.070000	0.57548	1.422000	0.47177	-0.311000	0.09066	CTG	ANKFN1	-	NULL	ENSG00000153930		0.493	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	-	0.00	35	0	C	NM_153228		54450138	+1	tier1	-	no_errors	ENST00000318698	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619761	+	IGR	DEL	TGTG	TGTG	-	rs563268698	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	TGTG	TGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:201619758_201619761delTGTG								AC007163.3 (19858 upstream) : AOX2P (7269 downstream)																							CCTTTCAAATtgtgtgtgtgtgtg	0.407																																																	0																																										SO:0001628	intergenic_variant	0																															2.37:g.201619766_201619769delTGTG				RNA	DEL	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	ENSG00000243478	0	0.407					AOX2P	HGNC				0.00	18	0	TGTG			201619761	+1	tier1		no_errors	ENST00000472376	ensembl	human	known	74_37	rna	21.05	15	4	DEL	0.000:0.000:0.002:0.002	-
ATAD1	84896	genome.wustl.edu	37	10	89544289	89544289	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:89544289G>T	ENST00000308448.7	-	5	899	c.521C>A	c.(520-522)gCt>gAt	p.A174D	ATAD1_ENST00000400215.3_Missense_Mutation_p.A116D|ATAD1_ENST00000541004.1_Missense_Mutation_p.A174D|ATAD1_ENST00000328142.3_Missense_Mutation_p.A174D|ATAD1_ENST00000495903.1_5'Flank	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	174					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		GACAGCAGCAGCCAATTTCTG	0.413																																																	0													144.0	133.0	136.0					10																	89544289		2203	4300	6503	SO:0001583	missense	0			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.521C>A	10.37:g.89544289G>T	ENSP00000339017:p.Ala174Asp		D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A174D	ENST00000308448.7	37	c.521	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	G	29.0	4.967867	0.92855	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.93076	-3.16;-3.16;-3.16;-3.16	5.35	5.35	0.76521	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.046660	0.85682	D	0.000000	D	0.96012	0.8701	M	0.64630	1.985	0.80722	D	1	D;D	0.59767	0.961;0.986	D;D	0.70227	0.949;0.968	D	0.95190	0.8307	9	.	.	.	-12.6682	19.439	0.94809	0.0:0.0:1.0:0.0	.	116;174	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	D	174;174;116;174	ENSP00000339017:A174D;ENSP00000339016:A174D;ENSP00000412968:A116D;ENSP00000445500:A174D	.	A	-	2	0	ATAD1	89534269	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.662000	0.90505	0.563000	0.77884	GCT	ATAD1	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000138138		0.413	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	HGNC	protein_coding	OTTHUMT00000049235.1	-	0.00	61	0	G	NM_032810		89544289	-1	tier1	-	no_errors	ENST00000308448	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
ATM	472	genome.wustl.edu	37	11	108186796	108186796	+	Nonsense_Mutation	SNP	G	G	T	rs202206540		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:108186796G>T	ENST00000452508.2	+	43	6343	c.6154G>T	c.(6154-6156)Gaa>Taa	p.E2052*	C11orf65_ENST00000525729.1_Intron|ATM_ENST00000278616.4_Nonsense_Mutation_p.E2052*			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2052	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)	p.E2052*(1)		NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	ATATGACCTCGAAACAGCAAT	0.413			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	1	Substitution - Nonsense(1)	lung(1)	GRCh37	CS991309	ATM	S							118.0	103.0	108.0					11																	108186796		2201	4298	6499	SO:0001587	stop_gained	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.6154G>T	11.37:g.108186796G>T	ENSP00000388058:p.Glu2052*		B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Nonsense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2052*	ENST00000452508.2	37	c.6154	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	46	12.924845	0.99706	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	.	.	.	5.29	5.29	0.74685	.	0.151444	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.1094	0.86671	0.0:0.0:1.0:0.0	.	.	.	.	X	2052	.	ENSP00000278616:E2052X	E	+	1	0	ATM	107692006	1.000000	0.71417	0.999000	0.59377	0.360000	0.29518	6.712000	0.74681	2.473000	0.83533	0.484000	0.47621	GAA	ATM	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000149311		0.413	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1		0.00	48	0	G	NM_000051		108186796	+1			no_errors	ENST00000278616	ensembl	human	known	74_37	nonsense	5.88	48	3	SNP	1.000	T
ATP1A2	477	genome.wustl.edu	37	1	160106084	160106084	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:160106084G>T	ENST00000361216.3	+	18	2576	c.2487G>T	c.(2485-2487)atG>atT	p.M829I	ATP1A2_ENST00000392233.3_Missense_Mutation_p.M829I	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	829					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GTGATATCATGAAGCGGCAGC	0.597																																																	0													71.0	70.0	71.0					1																	160106084		2203	4300	6503	SO:0001583	missense	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.2487G>T	1.37:g.160106084G>T	ENSP00000354490:p.Met829Ile		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.M829I	ENST00000361216.3	37	c.2487	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.1|27.1	4.801767|4.801767	0.90538|0.90538	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	D;D|.	0.97553|.	-4.43;-4.43|.	4.71|4.71	4.71|4.71	0.59529|0.59529	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.90304|.	0.6967|.	H|H	0.99357|0.99357	4.53|4.53	0.80722|0.80722	D|D	1|1	B;B|.	0.22414|.	0.056;0.069|.	B;B|.	0.33620|.	0.104;0.167|.	D|.	0.94037|.	0.7306|.	10|.	0.72032|.	D|.	0.01|.	.|.	16.9397|16.9397	0.86213|0.86213	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	729;829|.	F5GXJ7;P50993|.	.;AT1A2_HUMAN|.	I|L	829;829;532|540	ENSP00000354490:M829I;ENSP00000376066:M829I|.	ENSP00000354490:M829I|.	M|X	+|+	3|2	0|2	ATP1A2|ATP1A2	158372708|158372708	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	9.601000|9.601000	0.98297|0.98297	2.590000|2.590000	0.87494|0.87494	0.561000|0.561000	0.74099|0.74099	ATG|TGA	ATP1A2	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000018625		0.597	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2		0.00	44	0	G	NM_000702		160106084	+1			no_errors	ENST00000361216	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
UNC13B	10497	genome.wustl.edu	37	9	35406762	35406762	+	IGR	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:35406762G>T	ENST00000378495.3	+	0	6303				ATP8B5P_ENST00000430846.1_RNA	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)						apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GGGTCTCTAGGGCGTCTGCGC	0.662																																																	0																																										SO:0001628	intergenic_variant	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856		9.37:g.35406762G>T			Q5VYM8	RNA	SNP	-	NULL	ENST00000378495.3	37	NULL	CCDS6579.1	9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.662	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP8B5P	HGNC	protein_coding	OTTHUMT00000052296.1	-	0.00	42	0	G	NM_006377		35406762	+1	tier1	-	no_errors	ENST00000329395	ensembl	human	known	74_37	rna	7.94	58	5	SNP	0.000	T
BCAT2	587	genome.wustl.edu	37	19	49300259	49300259	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:49300259G>T	ENST00000316273.6	-	8	871	c.859C>A	c.(859-861)Ccg>Acg	p.P287T	BCAT2_ENST00000545387.2_Missense_Mutation_p.P195T|BCAT2_ENST00000598162.1_Missense_Mutation_p.P287T|BCAT2_ENST00000597011.1_Missense_Mutation_p.P247T|BCAT2_ENST00000402551.1_Missense_Mutation_p.P247T|BCAT2_ENST00000599246.1_Missense_Mutation_p.P195T	NM_001190.3	NP_001181.2	O15382	BCAT2_HUMAN	branched chain amino-acid transaminase 2, mitochondrial	287					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|isoleucine catabolic process (GO:0006550)|leucine metabolic process (GO:0006551)|regulation of hormone levels (GO:0010817)|small molecule metabolic process (GO:0044281)|valine metabolic process (GO:0006573)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	12		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.000366)|Epithelial(262;0.0195)|GBM - Glioblastoma multiforme(486;0.0224)	L-Isoleucine(DB00167)|L-Leucine(DB00149)	CCATTCAGCGGGGGCGTCACC	0.592																																																	0													83.0	65.0	71.0					19																	49300259		2203	4300	6503	SO:0001583	missense	0			U68418	CCDS12735.1, CCDS54290.1, CCDS74416.1	19q13.33	2013-09-20	2010-05-07		ENSG00000105552	ENSG00000105552	2.6.1.42		977	protein-coding gene	gene with protein product		113530	"""branched chain aminotransferase 2, mitochondrial"""	BCT2		9165094	Standard	NM_001190		Approved	BCAM	uc002pkr.3	O15382	OTTHUMG00000183327	ENST00000316273.6:c.859C>A	19.37:g.49300259G>T	ENSP00000322991:p.Pro287Thr		B2RB87|O00269|Q96KG1|Q9BTB6|Q9BUU6	Missense_Mutation	SNP	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	p.P287T	ENST00000316273.6	37	c.859	CCDS12735.1	19	.	.	.	.	.	.	.	.	.	.	G	14.91	2.676924	0.47886	.	.	ENSG00000105552	ENST00000316273;ENST00000545387;ENST00000402551	T;T;T	0.25912	1.77;1.77;1.77	4.72	3.66	0.41972	Aminotransferase, class IV, conserved site (1);	0.183985	0.47455	D	0.000226	T	0.55305	0.1912	M	0.91717	3.235	0.58432	D	0.999998	D;D;P;D	0.67145	0.996;0.982;0.953;0.982	D;D;P;D	0.72338	0.977;0.937;0.862;0.937	T	0.63607	-0.6599	10	0.87932	D	0	-0.8254	10.2072	0.43120	0.1022:0.0:0.8978:0.0	.	247;287;195;287	B3KSI3;Q53EW7;O15382-2;O15382	.;.;.;BCAT2_HUMAN	T	287;195;247	ENSP00000322991:P287T;ENSP00000440973:P195T;ENSP00000385161:P247T	ENSP00000322991:P287T	P	-	1	0	BCAT2	53992071	1.000000	0.71417	0.984000	0.44739	0.282000	0.26991	2.923000	0.48868	1.286000	0.44565	0.561000	0.74099	CCG	BCAT2	-	pfam_Aminotrans_IV,superfamily_Aminotrans_IV,pirsf_B_amino_transII,tigrfam_B_amino_transII	ENSG00000105552		0.592	BCAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAT2	HGNC	protein_coding	OTTHUMT00000466202.1	-	0.00	45	0	G			49300259	-1	tier1	-	no_errors	ENST00000316273	ensembl	human	known	74_37	missense	6.17	76	5	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32754752	32754752	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:32754752G>T	ENST00000421745.2	+	60	12089	c.11955G>T	c.(11953-11955)caG>caT	p.Q3985H	MIR558_ENST00000384920.1_RNA	NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3985					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CACTTGCCCAGCTTTTAACTC	0.378																																					Pancreas(94;175 1509 16028 18060 45422)												0													103.0	104.0	104.0					2																	32754752		2203	4300	6503	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.11955G>T	2.37:g.32754752G>T	ENSP00000393596:p.Gln3985His		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.Q3985H	ENST00000421745.2	37	c.11955	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	G	19.30	3.801789	0.70682	.	.	ENSG00000115760	ENST00000421745	D	0.83914	-1.78	5.21	2.2	0.27929	.	0.000000	0.85682	D	0.000000	D	0.83562	0.5281	L	0.29908	0.895	0.80722	D	1	D	0.57571	0.98	D	0.66979	0.948	T	0.82192	-0.0579	10	0.87932	D	0	.	10.5165	0.44892	0.1989:0.0:0.8011:0.0	.	3985	Q9NR09	BIRC6_HUMAN	H	3985	ENSP00000393596:Q3985H	ENSP00000393596:Q3985H	Q	+	3	2	BIRC6	32608256	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.120000	0.50430	0.126000	0.18424	0.585000	0.79938	CAG	BIRC6	-	NULL	ENSG00000115760		0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	-	0.00	75	0	G	NM_016252		32754752	+1	tier1	-	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	9.09	59	6	SNP	1.000	T
BOC	91653	genome.wustl.edu	37	3	112997068	112997068	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:112997068G>T	ENST00000495514.1	+	10	2370	c.1666G>T	c.(1666-1668)Gga>Tga	p.G556*	BOC_ENST00000273395.4_Nonsense_Mutation_p.G557*|BOC_ENST00000355385.3_Nonsense_Mutation_p.G556*|BOC_ENST00000497495.1_3'UTR			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	556	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			CAACTGTGCGGGAGAGGGCCA	0.572																																																	0													115.0	99.0	104.0					3																	112997068		2203	4300	6503	SO:0001587	stop_gained	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1666G>T	3.37:g.112997068G>T	ENSP00000418663:p.Gly556*		A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G557*	ENST00000495514.1	37	c.1669	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.893672	0.98994	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	.	.	.	5.8	5.8	0.92144	.	0.111451	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.0466	0.97609	0.0:0.0:1.0:0.0	.	.	.	.	X	556;557;556	.	ENSP00000273395:G557X	G	+	1	0	BOC	114479758	1.000000	0.71417	0.951000	0.38953	0.687000	0.40016	9.467000	0.97671	2.729000	0.93468	0.563000	0.77884	GGA	BOC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000144857		0.572	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3		0.00	32	0	G	NM_033254		112997068	+1			no_errors	ENST00000273395	ensembl	human	known	74_37	nonsense	5.97	63	4	SNP	1.000	T
BRCA1	672	genome.wustl.edu	37	17	41234517	41234517	+	Missense_Mutation	SNP	G	G	T	rs80357013		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:41234517G>T	ENST00000357654.3	-	12	4379	c.4261C>A	c.(4261-4263)Cat>Aat	p.H1421N	BRCA1_ENST00000351666.3_Missense_Mutation_p.H238N|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000354071.3_Missense_Mutation_p.H1421N|BRCA1_ENST00000309486.4_Missense_Mutation_p.H1125N|BRCA1_ENST00000352993.3_Missense_Mutation_p.H279N|BRCA1_ENST00000346315.3_Missense_Mutation_p.H1421N|BRCA1_ENST00000471181.2_Missense_Mutation_p.H1421N|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.H1374N|BRCA1_ENST00000468300.1_Missense_Mutation_p.H318N|BRCA1_ENST00000491747.2_Missense_Mutation_p.H318N|BRCA1_ENST00000591534.1_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1421	Interaction with PALB2.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TGGCTCCCATGCTGTTCTAAC	0.458			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													187.0	160.0	169.0					17																	41234517		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4261C>A	17.37:g.41234517G>T	ENSP00000350283:p.His1421Asn		O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,prints_BRCA1,pfscan_BRCT_dom,pfscan_Znf_RING	p.H1421N	ENST00000357654.3	37	c.4261	CCDS11453.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.60|13.60	2.284952|2.284952	0.40394|0.40394	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825|ENST00000461574	T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.55052|.	0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54;0.54|.	5.5|5.5	4.52|4.52	0.55395|0.55395	.|.	0.355639|.	0.24109|.	N|.	0.041480|.	T|T	0.44030|0.44030	0.1274|0.1274	L|L	0.34521|0.34521	1.04|1.04	0.30157|0.30157	N|N	0.802559|0.802559	B;B;B;B;B;B;B;B|.	0.33413|.	0.028;0.002;0.028;0.411;0.028;0.012;0.167;0.021|.	B;B;B;B;B;B;B;B|.	0.25987|.	0.018;0.002;0.01;0.065;0.014;0.012;0.045;0.027|.	T|T	0.43442|0.43442	-0.9391|-0.9391	10|5	0.87932|.	D|.	0|.	-0.1004|-0.1004	12.712|12.712	0.57094|0.57094	0.0:0.0:0.7043:0.2957|0.0:0.0:0.7043:0.2957	.|.	317;271;317;318;318;1421;1421;1421|.	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;BRCA1_HUMAN;.|.	N|R	1421;1421;1421;279;1421;238;1125;318;271;1421;1374;317;317;192;271;193|185	ENSP00000350283:H1421N;ENSP00000326002:H1421N;ENSP00000312236:H279N;ENSP00000246907:H1421N;ENSP00000338007:H238N;ENSP00000310938:H1125N;ENSP00000417148:H318N;ENSP00000377294:H271N;ENSP00000418960:H1421N;ENSP00000418775:H1374N;ENSP00000420412:H317N;ENSP00000419481:H192N;ENSP00000418819:H271N;ENSP00000418212:H193N|.	ENSP00000310938:H1125N|.	H|S	-|-	1|3	0|2	BRCA1|BRCA1	38488043|38488043	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.822000|0.822000	0.46500|0.46500	3.231000|3.231000	0.51294|0.51294	1.526000|1.526000	0.49068|0.49068	0.655000|0.655000	0.94253|0.94253	CAT|AGC	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.458	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	-	0.00	83	0	G	NM_007294		41234517	-1	tier1	-	no_errors	ENST00000471181	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.982	T
BRINP3	339479	genome.wustl.edu	37	1	190067408	190067408	+	Silent	SNP	G	G	T	rs199983605		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:190067408G>T	ENST00000367462.3	-	8	2272	c.2041C>A	c.(2041-2043)Cgg>Agg	p.R681R	BRINP3_ENST00000534846.1_Silent_p.R579R	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	681					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ATCAGGTCCCGAATTGCTTCA	0.453																																																	0													108.0	108.0	108.0					1																	190067408		2203	4300	6503	SO:0001819	synonymous_variant	0			AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2041C>A	1.37:g.190067408G>T			B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	pfam_MACPF,smart_MACPF	p.R681	ENST00000367462.3	37	c.2041	CCDS1373.1	1																																																																																			BRINP3	-	NULL	ENSG00000162670		0.453	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1		0.00	49	0	G	NM_199051		190067408	-1			no_errors	ENST00000367462	ensembl	human	known	74_37	silent	9.09	20	2	SNP	1.000	T
C16orf72	29035	genome.wustl.edu	37	16	9210601	9210601	+	Silent	SNP	G	G	T	rs372524467		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:9210601G>T	ENST00000327827.7	+	4	1057	c.660G>T	c.(658-660)tcG>tcT	p.S220S		NM_014117.2	NP_054836.2	Q14CZ0	CP072_HUMAN	chromosome 16 open reading frame 72	220										endometrium(4)|large_intestine(2)|lung(2)	8						GCAGTGGATCGAATGCTAGTC	0.443																																																	0													188.0	170.0	176.0					16																	9210601		2197	4300	6497	SO:0001819	synonymous_variant	0			AK123266	CCDS10538.1	16p13.2	2012-11-19			ENSG00000182831	ENSG00000182831			30103	protein-coding gene	gene with protein product						8889548	Standard	NM_014117		Approved	FLJ41272, PRO0149	uc002czm.3	Q14CZ0	OTTHUMG00000178147	ENST00000327827.7:c.660G>T	16.37:g.9210601G>T				Silent	SNP	NULL	p.S220	ENST00000327827.7	37	c.660	CCDS10538.1	16																																																																																			C16orf72	-	NULL	ENSG00000182831		0.443	C16orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf72	HGNC	protein_coding	OTTHUMT00000440760.2	-	0.00	71	0	G	NM_014117		9210601	+1	tier1	-	no_errors	ENST00000327827	ensembl	human	known	74_37	silent	6.33	74	5	SNP	1.000	T
C17orf85	55421	genome.wustl.edu	37	17	3721643	3721643	+	Silent	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:3721643C>A	ENST00000389005.4	-	10	1251	c.1224G>T	c.(1222-1224)ctG>ctT	p.L408L	C17orf85_ENST00000158149.3_Silent_p.L128L	NM_001114118.2	NP_001107590.1	Q53F19	CQ085_HUMAN	chromosome 17 open reading frame 85	408							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L128L(1)|p.L408L(1)		endometrium(2)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (3;0.0725)		AAATCATTTTCAGTTCTAGAT	0.453																																																	2	Substitution - coding silent(2)	endometrium(2)											95.0	93.0	93.0					17																	3721643		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS45578.1	17p13.2	2012-10-23			ENSG00000074356	ENSG00000074356			24612	protein-coding gene	gene with protein product	"""ELG protein"""					11412301	Standard	NM_001114118		Approved	HSA277841, ELG	uc010ckl.2	Q53F19	OTTHUMG00000177672	ENST00000389005.4:c.1224G>T	17.37:g.3721643C>A			B3KWG7|Q7L406|Q96FK1|Q9NXZ4	Silent	SNP	pfam_DUF2414	p.L408	ENST00000389005.4	37	c.1224	CCDS45578.1	17																																																																																			C17orf85	-	NULL	ENSG00000074356		0.453	C17orf85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf85	HGNC	protein_coding	OTTHUMT00000438385.1		0.00	46	0	C	NM_018553		3721643	-1			no_errors	ENST00000389005	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	A
C20orf194	25943	genome.wustl.edu	37	20	3268358	3268358	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:3268358G>T	ENST00000252032.9	-	27	2473	c.2406C>A	c.(2404-2406)gcC>gcA	p.A802A	C20orf194_ENST00000453730.2_3'UTR	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	802										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						GGGCCTCTAGGGCACTGGAAA	0.517																																																	0													139.0	135.0	137.0					20																	3268358		2002	4187	6189	SO:0001819	synonymous_variant	0			AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.2406C>A	20.37:g.3268358G>T			Q66K86|Q6P2R9|Q9UFX9	Silent	SNP	NULL	p.A802	ENST00000252032.9	37	c.2406	CCDS42851.1	20																																																																																			C20orf194	-	NULL	ENSG00000088854		0.517	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf194	HGNC	protein_coding	OTTHUMT00000077734.1	-	0.00	44	0	G	NM_001009984		3268358	-1	tier1	-	no_errors	ENST00000252032	ensembl	human	known	74_37	silent	6.90	54	4	SNP	1.000	T
C2orf71	388939	genome.wustl.edu	37	2	29295900	29295900	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:29295900G>T	ENST00000331664.5	-	1	1227	c.1228C>A	c.(1228-1230)Cag>Aag	p.Q410K		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	410					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						AGGCAGTCCTGGGGTCTGCCT	0.577																																																	0													80.0	82.0	81.0					2																	29295900		1981	4164	6145	SO:0001583	missense	0				CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1228C>A	2.37:g.29295900G>T	ENSP00000332809:p.Gln410Lys			Missense_Mutation	SNP	NULL	p.Q410K	ENST00000331664.5	37	c.1228	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	G	16.75	3.209294	0.58343	.	.	ENSG00000179270	ENST00000331664	T	0.20598	2.06	5.3	4.43	0.53597	.	0.298586	0.29956	N	0.010778	T	0.19208	0.0461	L	0.50333	1.59	0.30357	N	0.784218	P	0.38597	0.639	B	0.36959	0.237	T	0.11665	-1.0578	10	0.46703	T	0.11	-6.2624	8.7885	0.34837	0.0754:0.0:0.7753:0.1492	.	410	A6NGG8	CB071_HUMAN	K	410	ENSP00000332809:Q410K	ENSP00000332809:Q410K	Q	-	1	0	C2orf71	29149404	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	3.948000	0.56660	1.241000	0.43820	0.561000	0.74099	CAG	C2orf71	-	NULL	ENSG00000179270		0.577	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	-	0.00	45	0	G	NM_001029883		29295900	-1	tier1	-	no_errors	ENST00000331664	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
C9orf156	51531	genome.wustl.edu	37	9	100672785	100672785	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:100672785C>A	ENST00000375119.3	-	4	599	c.523G>T	c.(523-525)Gac>Tac	p.D175Y	C9orf156_ENST00000478126.1_5'UTR	NM_016481.3	NP_057565.3	Q9BU70	NAP1_HUMAN	chromosome 9 open reading frame 156	175					viral process (GO:0016032)		hydrolase activity (GO:0016787)	p.D175Y(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)	13		Acute lymphoblastic leukemia(62;0.158)				AAATTAAAGTCTGCTAAAGGC	0.463																																																	1	Substitution - Missense(1)	large_intestine(1)											146.0	139.0	141.0					9																	100672785		2203	4300	6503	SO:0001583	missense	0			AK023069	CCDS6730.1	9q31.1	2011-03-02			ENSG00000136932	ENSG00000136932			30967	protein-coding gene	gene with protein product	"""Nef (lentivirus myristoylated factor) associated protein 1"""						Standard	NM_016481		Approved	HSPC219, NAP1	uc004axv.1	Q9BU70	OTTHUMG00000021007	ENST00000375119.3:c.523G>T	9.37:g.100672785C>A	ENSP00000364260:p.Asp175Tyr		Q5T113|Q86SK0|Q9NXJ7|Q9P0Q7	Missense_Mutation	SNP	pfam_UPF0066,superfamily_UPF0066_YaeB,tigrfam_UPF0066	p.D175Y	ENST00000375119.3	37	c.523	CCDS6730.1	9	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082000	0.55861	.	.	ENSG00000136932	ENST00000375119;ENST00000375118;ENST00000325350	T;T	0.42513	0.97;0.97	5.09	3.22	0.36961	Uncharacterised domain UPF0066, YaeB-like domain (2);	0.586022	0.16274	N	0.221630	T	0.41534	0.1163	N	0.14661	0.345	0.09310	N	1	D;D;P	0.71674	0.998;0.997;0.761	P;D;B	0.63192	0.888;0.912;0.202	T	0.20306	-1.0279	10	0.87932	D	0	-6.5324	8.8748	0.35339	0.0:0.8115:0.0:0.1885	.	72;29;175	Q6Y2L2;Q5T114;Q9BU70	.;.;NAP1_HUMAN	Y	175;29;72	ENSP00000364260:D175Y;ENSP00000364259:D29Y	ENSP00000324426:D72Y	D	-	1	0	C9orf156	99712606	0.038000	0.19896	0.001000	0.08648	0.208000	0.24298	1.132000	0.31418	0.633000	0.30452	0.563000	0.77884	GAC	C9orf156	-	superfamily_UPF0066_YaeB	ENSG00000136932		0.463	C9orf156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf156	HGNC	protein_coding	OTTHUMT00000055401.1		0.00	24	0	C	NM_016481		100672785	-1			no_errors	ENST00000375119	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.022	A
CACNA1A	773	genome.wustl.edu	37	19	13441098	13441098	+	Silent	SNP	G	G	T	rs376451601		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:13441098G>T	ENST00000360228.5	-	10	1304	c.1305C>A	c.(1303-1305)ccC>ccA	p.P435P	CACNA1A_ENST00000573710.2_Silent_p.P436P	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	436					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CAGCCTCTTCGGGGTTGAGCA	0.488																																																	0													81.0	81.0	81.0					19																	13441098		1895	4121	6016	SO:0001819	synonymous_variant	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.1305C>A	19.37:g.13441098G>T			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.P435	ENST00000360228.5	37	c.1305	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.488	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	48	0	G	NM_000068		13441098	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	silent	5.88	48	3	SNP	0.963	T
CAPN13	92291	genome.wustl.edu	37	2	30993193	30993193	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:30993193C>A	ENST00000295055.8	-	5	686	c.510G>T	c.(508-510)gaG>gaT	p.E170D	CAPN13_ENST00000534090.2_Missense_Mutation_p.E170D|CAPN13_ENST00000465960.2_5'UTR	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	170	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					CATAGGCCTTCTCCAGCAGGC	0.552																																																	0													161.0	169.0	167.0					2																	30993193		2138	4258	6396	SO:0001583	missense	0				CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.510G>T	2.37:g.30993193C>A	ENSP00000295055:p.Glu170Asp		Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.E170D	ENST00000295055.8	37	c.510	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177896	0.78564	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.32753	1.44;1.44	5.46	5.46	0.80206	Peptidase C2, calpain, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81726	-0.0801	10	0.87932	D	0	.	12.2317	0.54492	0.0:0.9175:0.0:0.0824	.	170	Q6MZZ7	CAN13_HUMAN	D	170	ENSP00000295055:E170D;ENSP00000431298:E170D	ENSP00000295055:E170D	E	-	3	2	CAPN13	30846697	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.859000	0.39418	2.575000	0.86900	0.561000	0.74099	GAG	CAPN13	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	ENSG00000162949		0.552	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	HGNC	protein_coding	OTTHUMT00000325101.2	-	0.00	51	0	C	NM_144575		30993193	-1	tier1	-	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	A
CASP14	23581	genome.wustl.edu	37	19	15164352	15164352	+	Silent	SNP	G	G	T	rs112772421	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:15164352G>T	ENST00000427043.3	+	3	395	c.87G>T	c.(85-87)cgG>cgT	p.R29R	CASP14_ENST00000221740.1_Silent_p.R29R|AC004699.1_ENST00000411269.1_RNA	NM_012114.2	NP_036246.1	P31944	CASPE_HUMAN	caspase 14, apoptosis-related cysteine peptidase	29					cornification (GO:0070268)|epidermis development (GO:0008544)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinization (GO:0031424)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(3)	26						CCAAAGCCCGGGAAGGTTCCG	0.522																																																	0													98.0	94.0	96.0					19																	15164352		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12323.1	19p13.1	2008-07-16	2005-08-17			ENSG00000105141			1502	protein-coding gene	gene with protein product	"""apoptosis-related cysteine protease"""	605848	"""caspase 14, apoptosis-related cysteine protease"""			10203698, 9792675	Standard	NM_012114		Approved	MICE, MGC119078, MGC119079	uc010dzv.2	P31944		ENST00000427043.3:c.87G>T	19.37:g.15164352G>T			O95823|Q3SYC9	Silent	SNP	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R29	ENST00000427043.3	37	c.87	CCDS12323.1	19																																																																																			CASP14	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000105141		0.522	CASP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP14	HGNC	protein_coding	OTTHUMT00000465663.1	-	0.00	52	0	G	NM_012114		15164352	+1	tier1	-	no_errors	ENST00000221740	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.912	T
CCDC113	29070	genome.wustl.edu	37	16	58286746	58286746	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:58286746G>T	ENST00000219299.4	+	2	296	c.217G>T	c.(217-219)Gat>Tat	p.D73Y	CCDC113_ENST00000443128.2_Missense_Mutation_p.D73Y	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	73						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						ATCAGCAGCAGATTATGCACA	0.403																																																	0													138.0	126.0	130.0					16																	58286746		2198	4300	6498	SO:0001583	missense	0			AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.217G>T	16.37:g.58286746G>T	ENSP00000219299:p.Asp73Tyr		B2RAQ7|B4DR20|Q9NZX2	Missense_Mutation	SNP	NULL	p.D73Y	ENST00000219299.4	37	c.217	CCDS10795.1	16	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558765	0.65538	.	.	ENSG00000103021	ENST00000443128;ENST00000219299	T;T	0.37058	1.22;1.39	5.01	5.01	0.66863	.	0.696070	0.12830	N	0.435675	T	0.44932	0.1317	L	0.34521	1.04	0.09310	N	0.999995	D;D	0.69078	0.979;0.997	P;P	0.57371	0.819;0.819	T	0.34403	-0.9830	10	0.66056	D	0.02	-6.2625	13.8237	0.63338	0.0:0.0:1.0:0.0	.	73;73	B4DR20;Q9H0I3	.;CC113_HUMAN	Y	73	ENSP00000402588:D73Y;ENSP00000219299:D73Y	ENSP00000219299:D73Y	D	+	1	0	CCDC113	56844247	0.992000	0.36948	0.118000	0.21660	0.184000	0.23303	4.604000	0.61112	2.318000	0.78349	0.563000	0.77884	GAT	CCDC113	-	NULL	ENSG00000103021		0.403	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC113	HGNC	protein_coding	OTTHUMT00000257387.2	-	0.00	42	0	G	NM_014157		58286746	+1	tier1	-	no_errors	ENST00000219299	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.218	T
CCDC138	165055	genome.wustl.edu	37	2	109411085	109411085	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:109411085C>A	ENST00000295124.4	+	5	544	c.484C>A	c.(484-486)Cca>Aca	p.P162T	CCDC138_ENST00000470608.1_3'UTR|CCDC138_ENST00000412964.2_Missense_Mutation_p.P162T	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	162										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						TGTCAGCTGTCCAAAATCTAA	0.423																																																	0													82.0	82.0	82.0					2																	109411085		2203	4300	6503	SO:0001583	missense	0			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.484C>A	2.37:g.109411085C>A	ENSP00000295124:p.Pro162Thr		Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.P162T	ENST00000295124.4	37	c.484	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932076	0.34096	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	D;D	0.90261	-2.64;-2.64	5.85	3.02	0.34903	.	0.512246	0.18563	N	0.137557	D	0.83450	0.5257	L	0.57536	1.79	0.09310	N	1	P;P	0.38078	0.465;0.617	B;B	0.34242	0.124;0.178	T	0.71237	-0.4652	10	0.05833	T	0.94	-3.1462	7.2178	0.25969	0.0:0.6662:0.1273:0.2065	.	162;162	Q96M89-2;Q96M89	.;CC138_HUMAN	T	162	ENSP00000411800:P162T;ENSP00000295124:P162T	ENSP00000295124:P162T	P	+	1	0	CCDC138	108777517	0.000000	0.05858	0.005000	0.12908	0.099000	0.18886	-0.089000	0.11180	0.791000	0.33826	0.561000	0.74099	CCA	CCDC138	-	NULL	ENSG00000163006		0.423	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	-	0.00	73	0	C	NM_144978		109411085	+1	tier1	-	no_errors	ENST00000295124	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.001	A
CCDC150	284992	genome.wustl.edu	37	2	197594039	197594039	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:197594039G>T	ENST00000389175.4	+	23	2814	c.2679G>T	c.(2677-2679)aaG>aaT	p.K893N	CCDC150_ENST00000409270.1_Missense_Mutation_p.K380N|CCDC150_ENST00000487663.1_3'UTR|CCDC150_ENST00000272831.7_Missense_Mutation_p.K540N	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	893										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AGAAAATAAAGAATCAAAAGA	0.413																																																	0													105.0	101.0	102.0					2																	197594039		1850	4084	5934	SO:0001583	missense	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.2679G>T	2.37:g.197594039G>T	ENSP00000373827:p.Lys893Asn		Q6P5U6|Q6P663|Q8N8V5	Missense_Mutation	SNP	NULL	p.K893N	ENST00000389175.4	37	c.2679	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365092	0.82463	.	.	ENSG00000144395	ENST00000272831;ENST00000389175;ENST00000409270	T	0.51071	0.72	5.67	5.67	0.87782	.	0.406531	0.25535	N	0.030018	T	0.61022	0.2314	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.67145	0.996;0.979;0.979;0.977	P;P;P;P	0.59357	0.856;0.846;0.801;0.711	T	0.54788	-0.8241	10	0.30078	T	0.28	-19.6913	16.6874	0.85312	0.0:0.0:1.0:0.0	.	310;540;380;893	B4DWS7;B4DZ03;Q8NCX0-2;Q8NCX0	.;.;.;CC150_HUMAN	N	540;893;380	ENSP00000373827:K893N	ENSP00000272831:K540N	K	+	3	2	CCDC150	197302284	1.000000	0.71417	0.996000	0.52242	0.980000	0.70556	1.713000	0.37951	2.697000	0.92050	0.655000	0.94253	AAG	CCDC150	-	NULL	ENSG00000144395		0.413	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2		0.00	60	0	G	NM_001080539		197594039	+1			no_errors	ENST00000389175	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
CCDC158	339965	genome.wustl.edu	37	4	77303786	77303786	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:77303786G>T	ENST00000388914.3	-	7	1043	c.891C>A	c.(889-891)atC>atA	p.I297I	CCDC158_ENST00000434846.2_Silent_p.I297I	NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	297			I -> V (in dbSNP:rs17001885).							breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TTTGACTCTGGATACTATTGG	0.323																																																	0													125.0	122.0	123.0					4																	77303786		1865	4103	5968	SO:0001819	synonymous_variant	0			BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.891C>A	4.37:g.77303786G>T			Q8IYQ1|Q8N7D4|Q8N7E3	Silent	SNP	superfamily_Prefoldin	p.I297	ENST00000388914.3	37	c.891	CCDS43242.1	4																																																																																			CCDC158	-	NULL	ENSG00000163749		0.323	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	HGNC	protein_coding	OTTHUMT00000362694.2	-	0.00	58	0	G	NM_001042784		77303786	-1	tier1	-	no_errors	ENST00000388914	ensembl	human	known	74_37	silent	11.43	31	4	SNP	1.000	T
CCDC30	728621	genome.wustl.edu	37	1	42948562	42948563	+	Intron	INS	-	-	A	rs202122677	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:42948562_42948563insA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TGGAACATGAGAAAAAAAAAAA	0.366																																																	0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+75->A	1.37:g.42948573_42948573dupA			Q14F06|Q5VVM5	RNA	INS	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.366	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	35	0	-	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	14.29	12	2	INS	0.001:0.003	A
CCND1	595	genome.wustl.edu	37	11	69465988	69465990	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:69465988_69465990delGAG	ENST00000227507.2	+	5	1053_1055	c.826_828delGAG	c.(826-828)gagdel	p.E280del	ORAOV1_ENST00000542515.1_5'Flank	NM_053056.2	NP_444284.1	P24385	CCND1_HUMAN	cyclin D1	280	Poly-Glu.				canonical Wnt signaling pathway (GO:0060070)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|lactation (GO:0007595)|Leydig cell differentiation (GO:0033327)|liver development (GO:0001889)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|mitotic G1 DNA damage checkpoint (GO:0031571)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ regeneration (GO:0031100)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|positive regulation of protein phosphorylation (GO:0001934)|re-entry into mitotic cell cycle (GO:0000320)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to organonitrogen compound (GO:0010243)|response to UV-A (GO:0070141)|response to vitamin E (GO:0033197)|response to X-ray (GO:0010165)|transcription, DNA-templated (GO:0006351)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|tight junction (GO:0005923)|transcriptional repressor complex (GO:0017053)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|proline-rich region binding (GO:0070064)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			NS(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|lung(7)|ovary(1)|urinary_tract(1)	23	all_cancers(3;2.01e-114)|all_epithelial(3;3.59e-122)|Breast(3;5.4e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;8.22e-16)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;7.2e-57)|all cancers(3;7.75e-51)|BRCA - Breast invasive adenocarcinoma(2;4.9e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)		Arsenic trioxide(DB01169)	ggaggaggaagaggaggaggagg	0.704			T	"""IGH@, FSTL3"""	"""CLL, B-ALL, breast"""					Multiple Myeloma(6;0.086)																											Pancreas(65;393 884 2788 21700 24360 27795 36895)			Dom	yes		11	11q13	595	cyclin D1		"""L, E"""	0																																										SO:0001651	inframe_deletion	0			Z23022	CCDS8191.1	11q13	2008-07-18	2005-09-12		ENSG00000110092	ENSG00000110092			1582	protein-coding gene	gene with protein product	"""parathyroid adenomatosis 1"", ""B-cell CLL/lymphoma 1"", ""G1/S-specific cyclin D1"""	168461	"""cyclin D1 (PRAD1: parathyroid adenomatosis 1)"""	BCL1, D11S287E, PRAD1		1826542, 1833066	Standard	XM_006718653		Approved	U21B31	uc001opa.3	P24385	OTTHUMG00000167877	ENST00000227507.2:c.826_828delGAG	11.37:g.69465997_69465999delGAG	ENSP00000227507:p.Glu280del		Q6LEF0	In_Frame_Del	DEL	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.E279in_frame_del	ENST00000227507.2	37	c.826_828	CCDS8191.1	11																																																																																			CCND1	-	NULL	ENSG00000110092		0.704	CCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCND1	HGNC	protein_coding	OTTHUMT00000396775.2		0.00	32	0	GAG	NM_053056		69465990	+1	tier1		no_errors	ENST00000227507	ensembl	human	known	74_37	in_frame_del	6.00	47	3	DEL	0.006:0.008:0.008	-
CDC6	990	genome.wustl.edu	37	17	38447798	38447798	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:38447798G>T	ENST00000209728.4	+	4	1009	c.538G>T	c.(538-540)Gat>Tat	p.D180Y		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	180					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AAGGGAGATGGATGTCATCAG	0.502																																																	0													97.0	103.0	101.0					17																	38447798		2203	4300	6503	SO:0001583	missense	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.538G>T	17.37:g.38447798G>T	ENSP00000209728:p.Asp180Tyr		Q8TB30	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6/18	p.D180Y	ENST00000209728.4	37	c.538	CCDS11365.1	17	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200785	0.58234	.	.	ENSG00000094804	ENST00000209728	T	0.58210	0.35	5.86	2.51	0.30379	.	0.461178	0.25078	N	0.033304	T	0.47377	0.1442	L	0.54323	1.7	0.29186	N	0.876179	P	0.38767	0.646	B	0.39876	0.312	T	0.45512	-0.9256	10	0.52906	T	0.07	-0.5563	9.872	0.41180	0.2492:0.0:0.7508:0.0	.	180	Q99741	CDC6_HUMAN	Y	180	ENSP00000209728:D180Y	ENSP00000209728:D180Y	D	+	1	0	CDC6	35701324	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.745000	0.47459	0.334000	0.23590	-0.781000	0.03364	GAT	CDC6	-	superfamily_P-loop_NTPase,pirsf_Cell_div_Cdc6/18	ENSG00000094804		0.502	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	-	0.00	38	0	G			38447798	+1	tier1	-	no_errors	ENST00000209728	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
CDH6	1004	genome.wustl.edu	37	5	31323323	31323323	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:31323323G>T	ENST00000265071.2	+	12	2546	c.2281G>T	c.(2281-2283)Gat>Tat	p.D761Y		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	761					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CACGGATGCAGATCAAGACTA	0.527																																																	0													71.0	63.0	66.0					5																	31323323		2203	4300	6503	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2281G>T	5.37:g.31323323G>T	ENSP00000265071:p.Asp761Tyr		A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D761Y	ENST00000265071.2	37	c.2281	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646234	0.87958	.	.	ENSG00000113361	ENST00000265071	T	0.79554	-1.28	5.55	5.55	0.83447	Cadherin, cytoplasmic domain (1);	0.041259	0.85682	D	0.000000	D	0.92916	0.7746	M	0.94142	3.5	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.94234	0.7479	10	0.87932	D	0	.	19.8741	0.96863	0.0:0.0:1.0:0.0	.	761	P55285	CADH6_HUMAN	Y	761	ENSP00000265071:D761Y	ENSP00000265071:D761Y	D	+	1	0	CDH6	31359080	1.000000	0.71417	0.908000	0.35775	0.917000	0.54804	9.809000	0.99208	2.761000	0.94854	0.655000	0.94253	GAT	CDH6	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000113361		0.527	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	54	0	G	NM_004932		31323323	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
CDK8	1024	genome.wustl.edu	37	13	26967644	26967644	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr13:26967644G>T	ENST00000381527.3	+	7	1290	c.787G>T	c.(787-789)Gca>Tca	p.A263S	CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		GGGATTTCCTGCAGGTACACA	0.358																																																	0													177.0	170.0	172.0					13																	26967644		2203	4300	6503	SO:0001583	missense	0			X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.787G>T	13.37:g.26967644G>T	ENSP00000370938:p.Ala263Ser		Q5VUF3|Q6ISB5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A263S	ENST00000381527.3	37	c.787	CCDS9317.1	13	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590279	0.46214	.	.	ENSG00000132964	ENST00000381527	T	0.39787	1.06	5.56	5.56	0.83823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.21145	0.0509	N	0.01624	-0.795	0.80722	D	1	B;B	0.21520	0.046;0.057	B;B	0.22880	0.025;0.042	T	0.15665	-1.0429	10	0.18710	T	0.47	-12.1841	19.8807	0.96899	0.0:0.0:1.0:0.0	.	263;263	P49336-2;P49336	.;CDK8_HUMAN	S	263	ENSP00000370938:A263S	ENSP00000370938:A263S	A	+	1	0	CDK8	25865644	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.420000	0.97426	2.771000	0.95319	0.650000	0.86243	GCA	CDK8	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000132964		0.358	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK8	HGNC	protein_coding	OTTHUMT00000044250.1	-	0.00	56	0	G			26967644	+1	tier1	-	no_errors	ENST00000381527	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
CEACAM5	1048	genome.wustl.edu	37	19	42221408	42221408	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:42221408C>A	ENST00000221992.6	+	5	1107	c.993C>A	c.(991-993)aaC>aaA	p.N331K	CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000405816.1_Missense_Mutation_p.N331K|CEACAM5_ENST00000398599.4_Missense_Mutation_p.N330K	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	331	Ig-like 4.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCAGCAACAACTCCAACCCCG	0.522																																																	0													146.0	148.0	147.0					19																	42221408		2203	4300	6503	SO:0001583	missense	0			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.993C>A	19.37:g.42221408C>A	ENSP00000221992:p.Asn331Lys		H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N331K	ENST00000221992.6	37	c.993	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.91|11.91	1.780405|1.780405	0.31502|0.31502	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816	.|T;T	.|0.63255	.|-0.03;-0.03	2.77|2.77	1.63|1.63	0.23807|0.23807	.|Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.74306|0.74306	0.3699|0.3699	M|M	0.80982|0.80982	2.52|2.52	0.09310|0.09310	N|N	0.999994|0.999994	.|P;B	.|0.45240	.|0.854;0.053	.|P;B	.|0.61070	.|0.883;0.113	T|T	0.60944|0.60944	-0.7162|-0.7162	5|9	.|0.37606	.|T	.|0.19	.|.	7.8537|7.8537	0.29470|0.29470	0.0:0.7397:0.2603:0.0|0.0:0.7397:0.2603:0.0	.|.	.|331;331	.|P06731;Q53G30	.|CEAM5_HUMAN;.	I|K	327|331	.|ENSP00000221992:N331K;ENSP00000385072:N331K	.|ENSP00000221992:N331K	L|N	+|+	1|3	0|2	CEACAM5|CEACAM5	46913248|46913248	0.002000|0.002000	0.14202|0.14202	0.040000|0.040000	0.18447|0.18447	0.203000|0.203000	0.24098|0.24098	0.373000|0.373000	0.20484|0.20484	0.393000|0.393000	0.25203|0.25203	0.479000|0.479000	0.44913|0.44913	CTC|AAC	CEACAM5	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105388		0.522	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	-	0.00	98	0	C	NM_004363		42221408	+1	tier1	-	no_errors	ENST00000221992	ensembl	human	known	74_37	missense	8.14	79	7	SNP	0.538	A
CIITA	4261	genome.wustl.edu	37	16	11004059	11004059	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:11004059C>A	ENST00000324288.8	+	13	2964	c.2831C>A	c.(2830-2832)tCg>tAg	p.S944*	CIITA_ENST00000381835.5_Nonsense_Mutation_p.S360*|CIITA_ENST00000537380.1_3'UTR	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	944			Missing (in BLS2). {ECO:0000269|PubMed:8402893}.		aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.S944W(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						AGAAGTTCCTCGGAAGACACA	0.567			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """																																			Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	1	Substitution - Missense(1)	lung(1)											74.0	57.0	63.0					16																	11004059		2197	4300	6497	SO:0001587	stop_gained	0			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2831C>A	16.37:g.11004059C>A	ENSP00000316328:p.Ser944*		A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,prints_MHC_II_transact	p.S944*	ENST00000324288.8	37	c.2831	CCDS10544.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.682195	0.96774	.	.	ENSG00000179583	ENST00000324288;ENST00000381835	.	.	.	4.83	3.8	0.43715	.	0.708561	0.12244	N	0.486271	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	9.8368	0.40973	0.2044:0.7956:0.0:0.0	.	.	.	.	X	944;360	.	ENSP00000316328:S944X	S	+	2	0	CIITA	10911560	0.028000	0.19301	0.093000	0.20910	0.831000	0.47069	1.382000	0.34374	2.391000	0.81399	0.561000	0.74099	TCG	CIITA	-	NULL	ENSG00000179583		0.567	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2		0.00	43	0	C	NM_000246		11004059	+1			no_errors	ENST00000324288	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	0.004	A
CNOT10	25904	genome.wustl.edu	37	3	32806207	32806207	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:32806207C>A	ENST00000328834.5	+	17	2226	c.1910C>A	c.(1909-1911)tCc>tAc	p.S637Y	CNOT10_ENST00000454516.2_Missense_Mutation_p.S697Y|CNOT10_ENST00000331889.6_Missense_Mutation_p.S610Y	NM_015442.2	NP_056257.1	Q9H9A5	CNO10_HUMAN	CCR4-NOT transcription complex, subunit 10	637					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(3)	23						TACCCCAGTTCCGTCAACTCT	0.547																																																	0													140.0	139.0	139.0					3																	32806207		2203	4300	6503	SO:0001583	missense	0			BC002928	CCDS2655.1, CCDS58821.1, CCDS58822.1	3p23	2013-01-10			ENSG00000182973	ENSG00000182973		"""Tetratricopeptide (TTC) repeat domain containing"""	23817	protein-coding gene	gene with protein product							Standard	NR_046352		Approved	FLJ12890, FLJ13165	uc011axj.2	Q9H9A5	OTTHUMG00000130748	ENST00000328834.5:c.1910C>A	3.37:g.32806207C>A	ENSP00000330060:p.Ser637Tyr		B7Z7L1|F8WAF2|Q9BU30|Q9H5J7|Q9H8X1|Q9H9W0|Q9HAH3|Q9UFJ2	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat	p.S697Y	ENST00000328834.5	37	c.2090	CCDS2655.1	3	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644074	0.87859	.	.	ENSG00000182973	ENST00000331889;ENST00000328834;ENST00000454516;ENST00000430408	T;T;T	0.36157	1.32;1.3;1.27	6.17	6.17	0.99709	Tetratricopeptide-like helical (1);	0.094163	0.85682	D	0.000000	T	0.61739	0.2371	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.87578	0.979;0.971;0.998;0.956	T	0.59579	-0.7428	10	0.87932	D	0	-16.8887	20.8794	0.99867	0.0:1.0:0.0:0.0	.	697;610;636;637	F8WAF2;Q9H9A5-3;Q9H9A5-2;Q9H9A5	.;.;.;CNOTA_HUMAN	Y	610;637;697;172	ENSP00000329376:S610Y;ENSP00000330060:S637Y;ENSP00000399862:S697Y	ENSP00000330060:S637Y	S	+	2	0	CNOT10	32781211	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	6.240000	0.72363	2.941000	0.99782	0.655000	0.94253	TCC	CNOT10	-	NULL	ENSG00000182973		0.547	CNOT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT10	HGNC	protein_coding	OTTHUMT00000253248.2		0.00	38	0	C	NM_015442		32806207	+1			no_errors	ENST00000454516	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	A
CNTN2	6900	genome.wustl.edu	37	1	205033529	205033529	+	Silent	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:205033529C>T	ENST00000331830.4	+	11	1604	c.1320C>T	c.(1318-1320)tgC>tgT	p.C440C	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	440	Ig-like C2-type 5.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TTATCCCCTGCCAGCCCCGGG	0.637																																					Melanoma(183;2548 2817 37099 41192)												0													88.0	104.0	99.0					1																	205033529		2203	4300	6503	SO:0001819	synonymous_variant	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1320C>T	1.37:g.205033529C>T			P78432|Q5T054	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C440	ENST00000331830.4	37	c.1320	CCDS1449.1	1																																																																																			CNTN2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000184144		0.637	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	-	0.00	38	0	C	NM_005076		205033529	+1	tier1	-	no_errors	ENST00000331830	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.991	T
COL10A1	1300	genome.wustl.edu	37	6	116441237	116441237	+	Nonstop_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:116441237C>A	ENST00000327673.4	-	2	2449	c.2042G>T	c.(2041-2043)tGa>tTa	p.*681L	COL10A1_ENST00000243222.4_Nonstop_Mutation_p.*681L|AL121963.1_ENST00000430695.1_5'Flank|NT5DC1_ENST00000319550.4_Intron			Q03692	COAA1_HUMAN	collagen, type X, alpha 1	0					cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	cell cortex (GO:0005938)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|lung(6)|skin(3)|upper_aerodigestive_tract(1)	13		all_cancers(87;0.0176)|all_epithelial(87;0.0263)|Colorectal(196;0.234)		all cancers(137;0.0157)|OV - Ovarian serous cystadenocarcinoma(136;0.0325)|GBM - Glioblastoma multiforme(226;0.0446)|Epithelial(106;0.0711)		TGTGTGTACTCACATTGGAGC	0.458																																																	0													90.0	99.0	96.0					6																	116441237		2203	4300	6503	SO:0001578	stop_lost	0				CCDS5105.1	6q21-q22	2013-01-16	2008-07-29		ENSG00000123500	ENSG00000123500		"""Collagens"""	2185	protein-coding gene	gene with protein product	"""Schmid metaphyseal chondrodysplasia"""	120110				2037056	Standard	XM_006715332		Approved		uc003pwm.3	Q03692	OTTHUMG00000015426	ENST00000327673.4:c.2042G>T	6.37:g.116441237C>A			A1L4P2	Nonstop_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.*681L	ENST00000327673.4	37	c.2042	CCDS5105.1	6	.	.	.	.	.	.	.	.	.	.	C	11.73	1.726800	0.30593	.	.	ENSG00000123500	ENST00000243222;ENST00000327673	.	.	.	5.08	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.6699	0.23062	0.0:0.7855:0.0:0.2145	.	.	.	.	L	681	.	.	X	-	2	2	COL10A1	116547930	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	1.703000	0.37846	2.539000	0.85634	0.455000	0.32223	TGA	COL10A1	-	NULL	ENSG00000123500		0.458	COL10A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL10A1	HGNC	protein_coding	OTTHUMT00000041926.1		0.00	47	0	C			116441237	-1			no_errors	ENST00000243222	ensembl	human	known	74_37	nonstop	9.26	49	5	SNP	1.000	A
COL14A1	7373	genome.wustl.edu	37	8	121243717	121243717	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:121243717G>T	ENST00000297848.3	+	19	2479	c.2209G>T	c.(2209-2211)Gga>Tga	p.G737*	COL14A1_ENST00000247781.3_Nonsense_Mutation_p.G642*|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Nonsense_Mutation_p.G737*|COL14A1_ENST00000537875.1_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTTCCAGACGGGAATCAGAAA	0.418																																																	0													101.0	95.0	97.0					8																	121243717		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.2209G>T	8.37:g.121243717G>T	ENSP00000297848:p.Gly737*			Nonsense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G737*	ENST00000297848.3	37	c.2209	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.277901	0.97435	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	.	.	.	5.55	5.55	0.83447	.	0.114076	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	18.2636	0.90044	0.0:0.0:1.0:0.0	.	.	.	.	X	737;737;642;550	.	ENSP00000247781:G642X	G	+	1	0	COL14A1	121312898	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.344000	0.79328	2.624000	0.88883	0.561000	0.74099	GGA	COL14A1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187955		0.418	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2		0.00	57	0	G	NM_021110		121243717	+1			no_errors	ENST00000297848	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	1.000	T
COL17A1	1308	genome.wustl.edu	37	10	105819953	105819953	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:105819953C>A	ENST00000353479.5	-	14	1355	c.1065G>T	c.(1063-1065)aaG>aaT	p.K355N	COL17A1_ENST00000369733.3_Missense_Mutation_p.K355N|COL17A1_ENST00000393211.3_Missense_Mutation_p.K355N	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	355	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCATCTCCTTCTTGGCAGGTG	0.537																																																	0													219.0	150.0	174.0					10																	105819953		2203	4300	6503	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1065G>T	10.37:g.105819953C>A	ENSP00000340937:p.Lys355Asn		Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.K355N	ENST00000353479.5	37	c.1065	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316496	0.60524	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	T;T;T	0.62788	0.0;0.0;0.0	5.73	5.73	0.89815	.	0.000000	0.47852	D	0.000207	T	0.76983	0.4064	M	0.71581	2.175	0.52501	D	0.999952	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.963	T	0.78804	-0.2060	10	0.87932	D	0	-14.8398	12.8023	0.57593	0.0:0.9248:0.0:0.0752	.	355;355	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	N	355;355;339;355	ENSP00000340937:K355N;ENSP00000358748:K355N;ENSP00000376905:K355N	ENSP00000340937:K355N	K	-	3	2	COL17A1	105809943	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	1.750000	0.38329	2.713000	0.92767	0.655000	0.94253	AAG	COL17A1	-	NULL	ENSG00000065618		0.537	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	-	0.00	29	0	C	NM_130778, NM_000494		105819953	-1	tier1	-	no_errors	ENST00000353479	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	A
CSF1	1435	genome.wustl.edu	37	1	110466455	110466455	+	Missense_Mutation	SNP	G	G	T	rs149423163	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:110466455G>T	ENST00000329608.6	+	6	1603	c.1212G>T	c.(1210-1212)agG>agT	p.R404S	CSF1_ENST00000369801.1_Intron|CSF1_ENST00000369802.3_Missense_Mutation_p.R404S|CSF1_ENST00000420111.2_Intron|CSF1_ENST00000344188.5_Intron	NM_000757.5|NM_172211.3	NP_000748|NP_757350.1	P09603	CSF1_HUMAN	colony stimulating factor 1 (macrophage)	404					branching involved in mammary gland duct morphogenesis (GO:0060444)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|developmental process involved in reproduction (GO:0003006)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary duct terminal end bud growth (GO:0060763)|mammary gland fat development (GO:0060611)|monocyte activation (GO:0042117)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoclast differentiation (GO:0030316)|osteoclast proliferation (GO:0002158)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of monocyte differentiation (GO:0045657)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of macrophage derived foam cell differentiation (GO:0010743)|regulation of ossification (GO:0030278)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|macrophage colony-stimulating factor receptor binding (GO:0005157)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Acute lymphoblastic leukemia(138;0.204)		Lung(183;0.0238)|Colorectal(144;0.112)|all cancers(265;0.117)|Epithelial(280;0.127)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTCTCCCAGGATCTCATCAC	0.662																																																	0													43.0	52.0	49.0					1																	110466455		2203	4300	6503	SO:0001583	missense	0			BC021117	CCDS816.1, CCDS817.1, CCDS30797.1	1p13.3	2012-09-20			ENSG00000184371	ENSG00000184371			2432	protein-coding gene	gene with protein product		120420				1540160	Standard	NM_172210		Approved	M-CSF, MCSF, MGC31930	uc001dyw.4	P09603	OTTHUMG00000011646	ENST00000329608.6:c.1212G>T	1.37:g.110466455G>T	ENSP00000327513:p.Arg404Ser		A8K6J5|Q13130|Q14086|Q14806|Q5VVF3|Q5VVF4|Q9UQR8	Missense_Mutation	SNP	pfam_MCSF-1,superfamily_4_helix_cytokine-like_core,pirsf_MCSF-1	p.R404S	ENST00000329608.6	37	c.1212	CCDS816.1	1	.	.	.	.	.	.	.	.	.	.	G	3.984	-0.005773	0.07773	.	.	ENSG00000184371	ENST00000329608;ENST00000369802	T;T	0.11604	2.76;2.76	4.98	-0.784	0.10954	.	2.113090	0.02201	N	0.062295	T	0.02083	0.0065	L	0.51422	1.61	0.09310	N	0.999999	B	0.33777	0.425	B	0.31812	0.136	T	0.31916	-0.9926	10	0.07482	T	0.82	.	0.2984	0.00269	0.2746:0.1386:0.2853:0.3015	.	404	P09603	CSF1_HUMAN	S	404	ENSP00000327513:R404S;ENSP00000358817:R404S	ENSP00000327513:R404S	R	+	3	2	CSF1	110267978	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.026000	0.13599	0.197000	0.20387	-0.373000	0.07131	AGG	CSF1	-	pfam_MCSF-1,pirsf_MCSF-1	ENSG00000184371		0.662	CSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1	HGNC	protein_coding	OTTHUMT00000032208.1		0.00	53	0	G	NM_000757		110466455	+1			no_errors	ENST00000329608	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	T
CSMD3	114788	genome.wustl.edu	37	8	113318394	113318394	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:113318394G>T	ENST00000297405.5	-	51	8157	c.7913C>A	c.(7912-7914)cCa>cAa	p.P2638Q	CSMD3_ENST00000455883.2_Missense_Mutation_p.P2534Q|CSMD3_ENST00000352409.3_Missense_Mutation_p.P2568Q|CSMD3_ENST00000343508.3_Missense_Mutation_p.P2598Q	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2638	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P2638L(1)|p.P2598L(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TCCATTTGTTGGAGCTTTAGG	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							2	Substitution - Missense(2)	lung(2)											98.0	91.0	93.0					8																	113318394		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.7913C>A	8.37:g.113318394G>T	ENSP00000297405:p.Pro2638Gln		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P2638Q	ENST00000297405.5	37	c.7913	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856509	0.91355	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.53	5.53	0.82687	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000002	D	0.85418	0.5692	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86149	0.1586	10	0.29301	T	0.29	.	19.4468	0.94851	0.0:0.0:1.0:0.0	.	2534;2638;2598	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Q	2598;2638;1908;2534;2568	ENSP00000345799:P2598Q;ENSP00000297405:P2638Q;ENSP00000341558:P1908Q;ENSP00000412263:P2534Q;ENSP00000343124:P2568Q	ENSP00000297405:P2638Q	P	-	2	0	CSMD3	113387570	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.835000	0.99442	2.591000	0.87537	0.557000	0.71058	CCA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1		0.00	55	0	G	NM_052900		113318394	-1			no_errors	ENST00000297405	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
CYP11A1	1583	genome.wustl.edu	37	15	74635355	74635355	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:74635355G>T	ENST00000268053.6	-	5	1107	c.953C>A	c.(952-954)gCc>gAc	p.A318D	CYP11A1_ENST00000358632.4_Missense_Mutation_p.A160D|CYP11A1_ENST00000419019.2_Missense_Mutation_p.A160D|CYP11A1_ENST00000541301.1_3'UTR	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	318					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	TGTGACGTTGGCCTTGATGTC	0.587																																					Esophageal Squamous(87;818 1337 4093 9268 37314)												0													147.0	114.0	125.0					15																	74635355		2197	4296	6493	SO:0001583	missense	0			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.953C>A	15.37:g.74635355G>T	ENSP00000268053:p.Ala318Asp		A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_mitochondrial,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.A318D	ENST00000268053.6	37	c.953	CCDS32291.1	15	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571802	0.65765	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000452422	T;T;T	0.72167	-0.63;-0.63;-0.63	4.46	3.49	0.39957	.	0.052912	0.85682	D	0.000000	T	0.79907	0.4527	L	0.52823	1.66	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.991;1.0	T	0.82500	-0.0426	10	0.87932	D	0	-15.1298	13.9683	0.64223	0.0:0.1527:0.8473:0.0	.	288;318	B4DTE5;P05108	.;CP11A_HUMAN	D	318;160;160;83	ENSP00000268053:A318D;ENSP00000351455:A160D;ENSP00000405488:A160D	ENSP00000268053:A318D	A	-	2	0	CYP11A1	72422408	1.000000	0.71417	0.997000	0.53966	0.355000	0.29361	6.060000	0.71141	2.035000	0.60131	0.442000	0.29010	GCC	CYP11A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000140459		0.587	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1		0.00	42	0	G			74635355	-1			no_errors	ENST00000268053	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
D2HGDH	728294	genome.wustl.edu	37	2	242690702	242690702	+	Missense_Mutation	SNP	G	G	T	rs142624021	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:242690702G>T	ENST00000321264.4	+	8	1248	c.1039G>T	c.(1039-1041)Gca>Tca	p.A347S	D2HGDH_ENST00000403782.1_Missense_Mutation_p.A213S|D2HGDH_ENST00000486953.1_Intron	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	347					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		AGGCTCCAACGCAGGCCATGA	0.602																																																	0													68.0	65.0	66.0					2																	242690702		2203	4296	6499	SO:0001583	missense	0			AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.1039G>T	2.37:g.242690702G>T	ENSP00000315351:p.Ala347Ser		B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.A347S	ENST00000321264.4	37	c.1039	CCDS33426.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.394|1.394	-0.580092|-0.580092	0.03854|0.03854	.|.	.|.	ENSG00000180902|ENSG00000180902	ENST00000321264;ENST00000403782;ENST00000454048|ENST00000432449	D;D;T|.	0.83591|.	-1.74;-1.74;-1.08|.	5.1|5.1	3.29|3.29	0.37713|0.37713	FAD-linked oxidase-like, C-terminal (1);FAD-linked oxidase, C-terminal (1);|.	0.531049|.	0.19064|.	N|.	0.123687|.	T|T	0.22085|0.22085	0.0532|0.0532	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	B|.	0.18013|.	0.025|.	B|.	0.19666|.	0.026|.	T|T	0.20405|0.20405	-1.0276|-1.0276	10|5	0.09084|.	T|.	0.74|.	0.7091|0.7091	3.028|3.028	0.06097|0.06097	0.1476:0.1203:0.5253:0.2068|0.1476:0.1203:0.5253:0.2068	.|.	347|.	Q8N465|.	D2HDH_HUMAN|.	S|L	347;213;48|100	ENSP00000315351:A347S;ENSP00000384723:A213S;ENSP00000404596:A48S|.	ENSP00000315351:A347S|.	A|R	+|+	1|2	0|0	D2HGDH|D2HGDH	242339375|242339375	0.010000|0.010000	0.17322|0.17322	0.000000|0.000000	0.03702|0.03702	0.031000|0.031000	0.12232|0.12232	0.475000|0.475000	0.22164|0.22164	0.541000|0.541000	0.28827|0.28827	0.561000|0.561000	0.74099|0.74099	GCA|CGC	D2HGDH	-	pfam_FAD-linked_oxidase_C,superfamily_FAD-linked_Oxase-like_C	ENSG00000180902		0.602	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	D2HGDH	HGNC	protein_coding	OTTHUMT00000322794.2		0.00	28	0	G	NM_152783		242690702	+1			no_errors	ENST00000321264	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.000	T
DAPK1	1612	genome.wustl.edu	37	9	90254606	90254606	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:90254606G>T	ENST00000408954.3	+	6	930	c.595G>T	c.(595-597)Gat>Tat	p.D199Y	DAPK1_ENST00000469640.2_Missense_Mutation_p.D199Y|DAPK1_ENST00000358077.5_Missense_Mutation_p.D199Y|DAPK1_ENST00000491893.1_Missense_Mutation_p.D199Y|DAPK1_ENST00000472284.1_Missense_Mutation_p.D199Y	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	199	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						TCTTGAGGCAGATATGTGGTA	0.373									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													390.0	345.0	359.0					9																	90254606		1926	4133	6059	SO:0001583	missense	0	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.595G>T	9.37:g.90254606G>T	ENSP00000386135:p.Asp199Tyr		B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.D199Y	ENST00000408954.3	37	c.595	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571323	0.86542	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.35	5.35	0.76521	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000054	D	0.95837	0.8645	H	0.99732	4.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97400	0.9995	10	0.87932	D	0	.	19.6142	0.95626	0.0:0.0:1.0:0.0	.	199;199;199	B7ZLE7;B7Z454;P53355	.;.;DAPK1_HUMAN	Y	199	ENSP00000350785:D199Y;ENSP00000417076:D199Y;ENSP00000418885:D199Y;ENSP00000386135:D199Y;ENSP00000419026:D199Y	ENSP00000350785:D199Y	D	+	1	0	DAPK1	89444426	1.000000	0.71417	0.987000	0.45799	0.994000	0.84299	9.601000	0.98297	2.941000	0.99782	0.655000	0.94253	GAT	DAPK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000196730		0.373	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1		0.00	89	0	G	NM_004938		90254606	+1			no_errors	ENST00000469640	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
DHX32	55760	genome.wustl.edu	37	10	127540925	127540925	+	Missense_Mutation	SNP	C	C	T	rs17153669		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:127540925C>T	ENST00000284690.3	-	6	1778	c.1288G>A	c.(1288-1290)Gtg>Atg	p.V430M	DHX32_ENST00000284688.6_Missense_Mutation_p.V349M|BCCIP_ENST00000368759.5_Intron|DHX32_ENST00000368721.1_Missense_Mutation_p.V54M	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32	430			V -> L (in dbSNP:rs17153669).			mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				ATAAAAAGCACCATGCTTGTT	0.473																																																	0													181.0	166.0	171.0					10																	127540925		2203	4300	6503	SO:0001583	missense	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1288G>A	10.37:g.127540925C>T	ENSP00000284690:p.Val430Met		A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,superfamily_P-loop_NTPase,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.V430M	ENST00000284690.3	37	c.1288	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	C	29.4	5.005625	0.93287	.	.	ENSG00000089876	ENST00000368721;ENST00000284690;ENST00000284688	T;T;T	0.03272	3.99;3.99;3.99	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.21103	0.0508	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	0.961;1.0	P;D	0.73380	0.85;0.98	T	0.00078	-1.2114	10	0.87932	D	0	-30.4062	18.885	0.92372	0.0:1.0:0.0:0.0	.	349;430	Q7L7V1-2;Q7L7V1	.;DHX32_HUMAN	M	54;430;349	ENSP00000357710:V54M;ENSP00000284690:V430M;ENSP00000284688:V349M	ENSP00000284688:V349M	V	-	1	0	DHX32	127530915	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.399000	0.79935	2.691000	0.91804	0.655000	0.94253	GTG	DHX32	-	superfamily_P-loop_NTPase	ENSG00000089876		0.473	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX32	HGNC	protein_coding	OTTHUMT00000050945.2		0.00	45	0	C	NM_018180		127540925	-1			no_errors	ENST00000284690	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13839571	13839571	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:13839571C>A	ENST00000265104.4	-	35	5880	c.5776G>T	c.(5776-5778)Gaa>Taa	p.E1926*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1926	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TCAGAATCTTCGTTAAAGTAA	0.383									Kartagener syndrome																																								0													117.0	113.0	115.0					5																	13839571		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5776G>T	5.37:g.13839571C>A	ENSP00000265104:p.Glu1926*		Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E1926*	ENST00000265104.4	37	c.5776	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	C	48	14.129725	0.99781	.	.	ENSG00000039139	ENST00000265104	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	17.1545	0.86787	0.0:1.0:0.0:0.0	.	.	.	.	X	1926	.	ENSP00000265104:E1926X	E	-	1	0	DNAH5	13892571	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	7.792000	0.85828	2.300000	0.77407	0.650000	0.86243	GAA	DNAH5	-	NULL	ENSG00000039139		0.383	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	36	0	C	NM_001369		13839571	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	1.000	A
DIMT1	27292	genome.wustl.edu	37	5	61689848	61689848	+	Silent	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:61689848C>T	ENST00000199320.4	-	8	757	c.597G>A	c.(595-597)ccG>ccA	p.P199P	KIF2A_ENST00000509663.2_Intron|DIMT1_ENST00000506390.1_Silent_p.P199P	NM_014473.2	NP_055288.1	Q9UNQ2	DIM1_HUMAN	DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)	199						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase activity (GO:0052909)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)										CCACCTTGGGCGGTGGTCTGA	0.383																																																	0													119.0	118.0	118.0					5																	61689848		2203	4300	6503	SO:0001819	synonymous_variant	0			AF102147	CCDS3981.1	5q12.1	2011-08-11	2011-08-11	2011-08-11	ENSG00000086189	ENSG00000086189			30217	protein-coding gene	gene with protein product		612499	"""DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)"""	DIMT1L		11124703	Standard	NM_014473		Approved	HSA9761	uc003jta.3	Q9UNQ2	OTTHUMG00000131223	ENST00000199320.4:c.597G>A	5.37:g.61689848C>T			O76025|Q9BU77|Q9UES1	Silent	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,tigrfam_rRNA_adenine_dimethylase	p.P199	ENST00000199320.4	37	c.597	CCDS3981.1	5																																																																																			DIMT1	-	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,tigrfam_rRNA_adenine_dimethylase	ENSG00000086189		0.383	DIMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIMT1	HGNC	protein_coding	OTTHUMT00000253967.1	-	0.00	46	0	C	NM_014473		61689848	-1	tier1	-	no_errors	ENST00000199320	ensembl	human	known	74_37	silent	13.33	26	4	SNP	0.996	T
DOCK5	80005	genome.wustl.edu	37	8	25237874	25237874	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:25237874C>A	ENST00000276440.7	+	39	4034	c.3990C>A	c.(3988-3990)agC>agA	p.S1330R		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1330	DHR-2.				positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		CTTACGAAAGCAAAGTATTTG	0.443																																					Pancreas(145;34 1887 3271 10937 30165)												0													86.0	77.0	80.0					8																	25237874		2203	4300	6503	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.3990C>A	8.37:g.25237874C>A	ENSP00000276440:p.Ser1330Arg		B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.S1330R	ENST00000276440.7	37	c.3990	CCDS6047.1	8	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853835	0.32791	.	.	ENSG00000147459	ENST00000276440	T	0.01838	4.61	5.82	3.03	0.35002	.	0.128929	0.64402	D	0.000001	T	0.03959	0.0111	L	0.28400	0.85	0.39359	D	0.96589	P;B;B	0.50443	0.935;0.053;0.053	P;B;B	0.55391	0.775;0.067;0.067	T	0.57957	-0.7721	10	0.34782	T	0.22	.	8.7882	0.34835	0.0:0.7398:0.1253:0.1349	.	119;1320;1330	Q6ZP32;D3DSS6;Q9H7D0	.;.;DOCK5_HUMAN	R	1330	ENSP00000276440:S1330R	ENSP00000276440:S1330R	S	+	3	2	DOCK5	25293791	1.000000	0.71417	0.992000	0.48379	0.948000	0.59901	1.246000	0.32803	0.365000	0.24400	0.561000	0.74099	AGC	DOCK5	-	superfamily_ARM-type_fold	ENSG00000147459		0.443	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2		0.00	55	0	C	NM_024940		25237874	+1			no_errors	ENST00000276440	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	A
DPH7	92715	genome.wustl.edu	37	9	140473264	140473264	+	5'UTR	SNP	G	G	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:140473264G>C	ENST00000277540.2	-	0	123				DPH7_ENST00000479650.1_5'UTR	NM_138778.2	NP_620133.1	Q9BTV6	DPH7_HUMAN	diphthamide biosynthesis 7						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)												GCCGGCAGTAGAGGCGGGTCG	0.761																																																	0													5.0	5.0	5.0					9																	140473264		2037	4036	6073	SO:0001623	5_prime_UTR_variant	0			AK075115	CCDS7047.1	9q34.3	2013-06-20	2013-06-20	2013-06-20	ENSG00000148399	ENSG00000148399		"""WD repeat domain containing"""	25199	protein-coding gene	gene with protein product		613210	"""chromosome 9 open reading frame 112"", ""WD repeat domain 85"""	C9orf112, WDR85		23486472	Standard	NM_138778		Approved	FLJ90634, RRT2	uc004cnk.1	Q9BTV6	OTTHUMG00000020991	ENST00000277540.2:c.-35C>G	9.37:g.140473264G>C			Q96AB7	RNA	SNP	-	NULL	ENST00000277540.2	37	NULL	CCDS7047.1	9																																																																																			DPH7	-	-	ENSG00000148399		0.761	DPH7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH7	HGNC	protein_coding	OTTHUMT00000055350.1	-	0.00	47	0	G	NM_138778		140473264	-1	tier1	-	no_errors	ENST00000467768	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.000	C
DSG1	1828	genome.wustl.edu	37	18	28916515	28916515	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:28916515G>T	ENST00000257192.4	+	9	1416	c.1204G>T	c.(1204-1206)Gat>Tat	p.D402Y		NM_001942.2	NP_001933.2	Q02413	DSG1_HUMAN	desmoglein 1	402	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell-cell junction assembly (GO:0007043)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|protein stabilization (GO:0050821)|response to progesterone (GO:0032570)|single organismal cell-cell adhesion (GO:0016337)	apical plasma membrane (GO:0016324)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)|toxic substance binding (GO:0015643)			NS(2)|central_nervous_system(2)|endometrium(5)|kidney(7)|large_intestine(11)|lung(36)|ovary(3)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	76			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GGGATCAAATGATAAAGTGGG	0.383																																																	0													89.0	82.0	84.0					18																	28916515		2203	4300	6503	SO:0001583	missense	0			X56654	CCDS11896.1	18q12.1	2014-05-13			ENSG00000134760	ENSG00000134760		"""Cadherins / Major cadherins"""	3048	protein-coding gene	gene with protein product		125670		DSG		1889810	Standard	NM_001942		Approved	CDHF4	uc002kwp.3	Q02413	OTTHUMG00000131983	ENST00000257192.4:c.1204G>T	18.37:g.28916515G>T	ENSP00000257192:p.Asp402Tyr		B7Z845	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Desmoglein,prints_Cadherin,prints_Desmosomal_cadherin	p.D402Y	ENST00000257192.4	37	c.1204	CCDS11896.1	18	.	.	.	.	.	.	.	.	.	.	G	0.050	-1.253770	0.01457	.	.	ENSG00000134760	ENST00000257192	T	0.60424	0.19	5.57	-3.29	0.05017	Cadherin (2);Cadherin-like (1);	0.966394	0.08523	N	0.933061	T	0.14743	0.0356	N	0.00289	-1.7	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34304	-0.9834	10	0.05620	T	0.96	.	5.8605	0.18745	0.0:0.2269:0.2337:0.5393	.	402	Q02413	DSG1_HUMAN	Y	402	ENSP00000257192:D402Y	ENSP00000257192:D402Y	D	+	1	0	DSG1	27170513	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.325000	0.07976	-0.426000	0.07360	-1.219000	0.01604	GAT	DSG1	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000134760		0.383	DSG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG1	HGNC	protein_coding	OTTHUMT00000254947.1		0.00	67	0	G	NM_001942		28916515	+1			no_errors	ENST00000257192	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.001	T
DYSF	8291	genome.wustl.edu	37	2	71797024	71797024	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:71797024G>T	ENST00000258104.3	+	27	3162	c.2885G>T	c.(2884-2886)gGa>gTa	p.G962V	DYSF_ENST00000413539.2_Missense_Mutation_p.G993V|DYSF_ENST00000409744.1_Missense_Mutation_p.G949V|DYSF_ENST00000409582.3_Missense_Mutation_p.G979V|DYSF_ENST00000409762.1_Missense_Mutation_p.G979V|DYSF_ENST00000410020.3_Missense_Mutation_p.G980V|DYSF_ENST00000429174.2_Missense_Mutation_p.G962V|DYSF_ENST00000409366.1_Missense_Mutation_p.G963V|DYSF_ENST00000409651.1_Missense_Mutation_p.G994V|DYSF_ENST00000410041.1_Missense_Mutation_p.G980V|DYSF_ENST00000394120.2_Missense_Mutation_p.G963V	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	962					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CGGCTTCCCGGAGGCCAGTGG	0.577																																																	0													53.0	55.0	54.0					2																	71797024		2203	4300	6503	SO:0001583	missense	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2885G>T	2.37:g.71797024G>T	ENSP00000258104:p.Gly962Val		A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.G993V	ENST00000258104.3	37	c.2978	CCDS1918.1	2	.	.	.	.	.	.	.	.	.	.	g	29.6	5.021435	0.93462	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59	5.21	5.21	0.72293	Ferlin/Peroxisome membrane (1);	0.121022	0.56097	D	0.000040	D	0.95130	0.8422	L	0.39147	1.195	0.80722	D	1	D;D;D;D;D;P;D;B;D;P;P;D;D;D	0.59357	0.981;0.981;0.981;0.981;0.984;0.837;0.984;0.175;0.981;0.904;0.851;0.966;0.981;0.985	P;P;P;P;P;P;P;B;P;P;P;P;P;P	0.61003	0.812;0.812;0.812;0.812;0.812;0.649;0.812;0.213;0.812;0.534;0.649;0.812;0.812;0.882	D	0.95323	0.8422	10	0.59425	D	0.04	-16.154	16.623	0.84934	0.0:0.0:1.0:0.0	.	994;980;963;949;980;949;979;948;993;979;962;948;963;962	O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	V	993;979;979;962;962;994;963;949;963;980;980	ENSP00000407046:G993V;ENSP00000387137:G979V;ENSP00000386547:G979V;ENSP00000398305:G962V;ENSP00000258104:G962V;ENSP00000386683:G994V;ENSP00000377678:G963V;ENSP00000386285:G949V;ENSP00000386512:G963V;ENSP00000386881:G980V;ENSP00000386617:G980V	ENSP00000258104:G962V	G	+	2	0	DYSF	71650532	1.000000	0.71417	0.980000	0.43619	0.989000	0.77384	9.628000	0.98415	2.597000	0.87782	0.546000	0.68486	GGA	DYSF	-	smart_Peroxin/Ferlin	ENSG00000135636		0.577	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3		0.00	43	0	G	NM_003494		71797024	+1			no_errors	ENST00000413539	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
ECHDC1	55862	genome.wustl.edu	37	6	127637118	127637118	+	Intron	DEL	A	A	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:127637118delA	ENST00000531967.1	-	4	938				ECHDC1_ENST00000528402.1_Intron|ECHDC1_ENST00000454591.2_Intron|ECHDC1_ENST00000368291.2_Intron|ECHDC1_ENST00000309620.9_Intron|ECHDC1_ENST00000368289.2_Intron|RNA5SP217_ENST00000515959.1_RNA|ECHDC1_ENST00000454859.3_Intron|ECHDC1_ENST00000474289.2_Intron|ECHDC1_ENST00000430841.2_Intron	NM_001139510.1	NP_001132982.1	Q9NTX5	ECHD1_HUMAN	enoyl CoA hydratase domain containing 1							cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxy-lyase activity (GO:0016831)|methylmalonyl-CoA decarboxylase activity (GO:0004492)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				GBM - Glioblastoma multiforme(226;0.0423)|all cancers(137;0.156)		TTGCTTCTTTACCTAGGTGCA	0.378																																																	0																																										SO:0001627	intron_variant	0			AK025796	CCDS34530.1, CCDS43504.1, CCDS47471.1, CCDS47472.1, CCDS55054.1	6q22.33	2011-12-12	2010-04-30		ENSG00000093144	ENSG00000093144			21489	protein-coding gene	gene with protein product		612136	"""enoyl Coenzyme A hydratase domain containing 1"""			22016388	Standard	NM_001002030		Approved	dJ351K20.2	uc003qax.3	Q9NTX5	OTTHUMG00000015523	ENST00000531967.1:c.434+476T>-	6.37:g.127637118delA			A6NFJ5|B7Z8S0|E9PEN7|E9PR31|F8W851|Q5TEF6|Q5TEF7|Q5TEG0|Q5TEG4|Q9NZ30|V9HW18	Frame_Shift_Del	DEL	pfam_Crotonase_core_superfam	p.*140fs	ENST00000531967.1	37	c.418	CCDS47471.1	6																																																																																			ECHDC1	-	NULL	ENSG00000093144		0.378	ECHDC1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECHDC1	HGNC	protein_coding	OTTHUMT00000042131.2		0.00	68	0	A			127637118	-1	tier1		no_errors	ENST00000368292	ensembl	human	known	74_37	frame_shift_del	10.00	18	2	DEL	0.001	-
EIF2AK2	5610	genome.wustl.edu	37	2	37368815	37368815	+	Silent	SNP	C	C	T	rs376000248		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:37368815C>T	ENST00000233057.4	-	5	592	c.270G>A	c.(268-270)acG>acA	p.T90T	EIF2AK2_ENST00000405334.1_Silent_p.T90T|EIF2AK2_ENST00000395127.2_Silent_p.T90T	NM_001135651.2	NP_001129123.1	P19525	E2AK2_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 2	90					activation of MAPKK activity (GO:0000186)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|evasion or tolerance by virus of host immune response (GO:0030683)|innate immune response (GO:0045087)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production (GO:0001819)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of hematopoietic progenitor cell differentiation (GO:1901532)|regulation of hematopoietic stem cell differentiation (GO:1902036)|regulation of hematopoietic stem cell proliferation (GO:1902033)|regulation of NLRP3 inflammasome complex assembly (GO:1900225)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)	22		all_hematologic(82;0.248)				CTGAAGAATTCGTTGTTGTCA	0.313																																																	0								C	,,	0,4406		0,0,2203	78.0	75.0	76.0		270,270,270	-2.5	0.0	2		76	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	EIF2AK2	NM_001135651.1,NM_001135652.1,NM_002759.2	,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,	90/552,90/511,90/552	37368815	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC057805	CCDS1786.1, CCDS46259.1	2p22-p21	2014-06-12	2005-01-19	2005-01-19	ENSG00000055332	ENSG00000055332			9437	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 83"""	176871	"""protein kinase, interferon-inducible double stranded RNA dependent"""	PRKR		1351683	Standard	NM_001135651		Approved	PKR, EIF2AK1, PPP1R83	uc010fac.3	P19525	OTTHUMG00000100962	ENST00000233057.4:c.270G>A	2.37:g.37368815C>T			A8K3P0|D6W584|E9PC80|Q52M43|Q7Z6F6|Q9UIR4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_dsRNA-bd_dom,superfamily_Kinase-like_dom,smart_dsRNA-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_dsRNA-bd_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T90	ENST00000233057.4	37	c.270	CCDS1786.1	2																																																																																			EIF2AK2	-	NULL	ENSG00000055332		0.313	EIF2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK2	HGNC	protein_coding	OTTHUMT00000218571.2		0.00	47	0	C	NM_002759		37368815	-1			no_errors	ENST00000233057	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.000	T
EIF4G1	1981	genome.wustl.edu	37	3	184042019	184042019	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:184042019G>T	ENST00000346169.2	+	17	2774	c.2503G>T	c.(2503-2505)Gtg>Ttg	p.V835L	EIF4G1_ENST00000319274.6_Missense_Mutation_p.V835L|EIF4G1_ENST00000434061.2_Missense_Mutation_p.V640L|EIF4G1_ENST00000424196.1_Missense_Mutation_p.V842L|EIF4G1_ENST00000435046.2_Missense_Mutation_p.V639L|EIF4G1_ENST00000441154.1_Missense_Mutation_p.V672L|EIF4G1_ENST00000414031.1_Missense_Mutation_p.V795L|EIF4G1_ENST00000352767.3_Missense_Mutation_p.V842L|EIF4G1_ENST00000350481.5_Missense_Mutation_p.V671L|EIF4G1_ENST00000427845.1_Missense_Mutation_p.V749L|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Missense_Mutation_p.V748L|EIF4G1_ENST00000411531.1_Missense_Mutation_p.V796L|EIF4G1_ENST00000382330.3_Missense_Mutation_p.V842L|EIF4G1_ENST00000342981.4_Missense_Mutation_p.V836L|SNORD66_ENST00000390856.1_RNA	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	835	eIF3/EIF4A-binding.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AAAGCCAACAGTGACTGTGAA	0.453																																																	0													158.0	147.0	150.0					3																	184042019		2203	4300	6503	SO:0001583	missense	0			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.2503G>T	3.37:g.184042019G>T	ENSP00000316879:p.Val835Leu		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.V842L	ENST00000346169.2	37	c.2524	CCDS3259.1	3	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637397	0.87760	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97	5.71	5.71	0.89125	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.367792	0.29403	N	0.012241	T	0.40694	0.1127	M	0.68952	2.095	0.51012	D	0.999901	P;P;P;P	0.46064	0.872;0.8;0.8;0.8	P;P;P;P	0.53988	0.739;0.636;0.636;0.636	T	0.01218	-1.1415	10	0.28530	T	0.3	-16.3314	20.2469	0.98398	0.0:0.0:1.0:0.0	.	842;836;835;842	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	L	835;795;748;843;842;776;671;842;749;836;835;842;796;671;672;640;639	ENSP00000316879:V835L;ENSP00000391935:V795L;ENSP00000376320:V748L;ENSP00000413159:V843L;ENSP00000371767:V842L;ENSP00000403269:V776L;ENSP00000317600:V671L;ENSP00000338020:V842L;ENSP00000407682:V749L;ENSP00000343450:V836L;ENSP00000323737:V835L;ENSP00000416255:V842L;ENSP00000395974:V796L;ENSP00000398145:V671L;ENSP00000399858:V672L;ENSP00000411826:V640L;ENSP00000404754:V639L	ENSP00000323737:V835L	V	+	1	0	EIF4G1	185524713	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	6.787000	0.75099	2.873000	0.98535	0.561000	0.74099	GTG	EIF4G1	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	ENSG00000114867		0.453	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	HGNC	protein_coding	OTTHUMT00000345733.1	-	0.00	51	0	G	NM_182917		184042019	+1	tier1	-	no_errors	ENST00000352767	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
EIF4G1	1981	genome.wustl.edu	37	3	184049760	184049760	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:184049760G>T	ENST00000346169.2	+	32	4775	c.4504G>T	c.(4504-4506)Gca>Tca	p.A1502S	EIF4G1_ENST00000319274.6_Missense_Mutation_p.A1502S|EIF4G1_ENST00000434061.2_Missense_Mutation_p.A1307S|EIF4G1_ENST00000424196.1_Missense_Mutation_p.A1509S|EIF4G1_ENST00000435046.2_Missense_Mutation_p.A1306S|EIF4G1_ENST00000441154.1_Missense_Mutation_p.A1339S|EIF4G1_ENST00000414031.1_Missense_Mutation_p.A1462S|EIF4G1_ENST00000352767.3_Missense_Mutation_p.A1509S|EIF4G1_ENST00000350481.5_Missense_Mutation_p.A1338S|EIF4G1_ENST00000427845.1_Missense_Mutation_p.A1416S|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Missense_Mutation_p.A1415S|EIF4G1_ENST00000411531.1_Missense_Mutation_p.A1463S|EIF4G1_ENST00000382330.3_Missense_Mutation_p.A1509S|EIF4G1_ENST00000342981.4_Missense_Mutation_p.A1503S	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	1502	EIF4A-binding.|W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGTGGACGTTGCAGTGCTGAA	0.567																																																	0													66.0	65.0	65.0					3																	184049760		2203	4300	6503	SO:0001583	missense	0			D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.4504G>T	3.37:g.184049760G>T	ENSP00000316879:p.Ala1502Ser		D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,pfam_W2_domain,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI,smart_W2_domain	p.A1509S	ENST00000346169.2	37	c.4525	CCDS3259.1	3	.	.	.	.	.	.	.	.	.	.	G	12.46	1.943613	0.34283	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000382330;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.04049	3.93;3.92;3.84;3.92;3.73;3.92;3.84;3.92;3.93;3.92;3.92;3.73;3.72;3.72	4.78	1.69	0.24217	eIF4-gamma/eIF5/eIF2-epsilon (1);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.887861	0.09954	N	0.734250	T	0.04003	0.0112	L	0.42686	1.345	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.11329	0.006;0.006;0.006	T	0.50154	-0.8861	10	0.12103	T	0.63	-0.5328	2.4098	0.04421	0.1576:0.2964:0.403:0.1431	.	1509;1503;1502	E9PFM1;D3DNT2;Q04637	.;.;IF4G1_HUMAN	S	1502;1462;1415;1509;1338;1509;1416;1503;1502;1509;1463;1339;1307;1306	ENSP00000316879:A1502S;ENSP00000391935:A1462S;ENSP00000376320:A1415S;ENSP00000371767:A1509S;ENSP00000317600:A1338S;ENSP00000338020:A1509S;ENSP00000407682:A1416S;ENSP00000343450:A1503S;ENSP00000323737:A1502S;ENSP00000416255:A1509S;ENSP00000395974:A1463S;ENSP00000399858:A1339S;ENSP00000411826:A1307S;ENSP00000404754:A1306S	ENSP00000323737:A1502S	A	+	1	0	EIF4G1	185532454	0.000000	0.05858	0.171000	0.22900	0.940000	0.58332	-0.314000	0.08092	0.021000	0.15133	0.449000	0.29647	GCA	EIF4G1	-	superfamily_ARM-type_fold	ENSG00000114867		0.567	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	EIF4G1	HGNC	protein_coding	OTTHUMT00000345733.1		0.00	17	0	G	NM_182917		184049760	+1			no_errors	ENST00000352767	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.057	T
ENOSF1	55556	genome.wustl.edu	37	18	690729	690730	+	Intron	INS	-	-	T	rs201690054		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:690729_690730insT	ENST00000251101.7	-	8	624				ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000340116.7_Intron|ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GAGTCCAGCTGTTCTCCTGATC	0.545																																																	0																																										SO:0001627	intron_variant	0			X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.536-98->A	18.37:g.690731_690731dupT			A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Frame_Shift_Ins	INS	pfam_Mandelate_racemase_N	p.T147fs	ENST00000251101.7	37	c.440_439	CCDS11822.1	18																																																																																			ENOSF1	-	NULL	ENSG00000132199		0.545	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	HGNC	protein_coding	OTTHUMT00000254312.2		0.00	19	0	-	NM_017512		690730	-1	tier1		no_errors	ENST00000581475	ensembl	human	known	74_37	frame_shift_ins	23.81	16	5	INS	0.009:0.019	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400455	68400455	+	lincRNA	SNP	C	C	T	rs200320813		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:68400455C>T	ENST00000417843.2	-	0	1364																											CTCAGGTGGGCGATGCACCTC	0.498																																																	0																																												0																															9.37:g.68400455C>T				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.498	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	17	0	C			68400455	-1	tier1	rs200320813	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	33.33	10	5	SNP	0.022	T
LOC100131635	100131635	genome.wustl.edu	37	3	187433420	187433420	+	Silent	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:187433420G>A	ENST00000449623.1	+	2	238	c.21G>A	c.(19-21)tcG>tcA	p.S7S	RP11-211G3.3_ENST00000437407.1_Silent_p.S7S																							AGTTGGATTCGATCAGAATTC	0.428																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000449623.1:c.21G>A	3.37:g.187433420G>A				Silent	SNP	NULL	p.S7	ENST00000449623.1	37	c.21		3																																																																																			RP11-211G3.3	-	NULL	ENSG00000228804		0.428	RP11-211G3.3-001	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	ENSG00000228804	Clone_based_vega_gene	protein_coding	OTTHUMT00000344200.2	-	0.00	50	0	G			187433420	+1	tier1	-	no_errors	ENST00000449623	ensembl	human	putative	74_37	silent	8.70	42	4	SNP	0.000	A
RP11-757O6.1	0	genome.wustl.edu	37	18	14250402	14250402	+	lincRNA	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:14250402C>A	ENST00000580200.1	+	0	387																											GCCGCATCCACTGAGGTACCA	0.552																																																	0																																												0																															18.37:g.14250402C>A				RNA	SNP	-	NULL	ENST00000580200.1	37	NULL		18																																																																																			RP11-757O6.1	-	-	ENSG00000264222		0.552	RP11-757O6.1-001	KNOWN	basic	lincRNA	ENSG00000264222	Clone_based_vega_gene	lincRNA	OTTHUMT00000442841.1	-	0.00	19	0	C			14250402	+1	tier1	-	no_errors	ENST00000580200	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.107	A
PARD6G	84552	genome.wustl.edu	37	18	77920429	77920429	+	Intron	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:77920429G>T	ENST00000353265.3	-	3	493				AC139100.2_ENST00000589574.1_Intron|AC139100.2_ENST00000587254.1_Missense_Mutation_p.G43C|AC139100.2_ENST00000586421.1_Missense_Mutation_p.G43C|AC139100.2_ENST00000585422.1_Intron	NM_032510.3	NP_115899.1	Q9BYG4	PAR6G_HUMAN	par-6 family cell polarity regulator gamma						cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	8		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GCCAGCACCCGGCCTCTCTGC	0.498																																																	0																																										SO:0001627	intron_variant	0				CCDS12022.1	18q23	2013-08-28	2013-08-28		ENSG00000178184	ENSG00000178184			16076	protein-coding gene	gene with protein product		608976	"""par-6 (partitioning defective 6, C.elegans) homolog gamma"", ""par-6 partitioning defective 6 homolog gamma (C. elegans)"""			11260256	Standard	NM_032510		Approved	PAR-6G, PAR6gamma	uc002lny.3	Q9BYG4	OTTHUMG00000132922	ENST00000353265.3:c.296-1940C>A	18.37:g.77920429G>T			A8QM57	Missense_Mutation	SNP	NULL	p.G43C	ENST00000353265.3	37	c.127	CCDS12022.1	18																																																																																			AC139100.2	-	NULL	ENSG00000267270		0.498	PARD6G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267270	Clone_based_vega_gene	protein_coding	OTTHUMT00000256435.2	-	0.00	35	0	G	NM_032510		77920429	+1	tier1	-	no_errors	ENST00000586421	ensembl	human	putative	74_37	missense	13.79	25	4	SNP	0.001	T
ETAA1	54465	genome.wustl.edu	37	2	67632308	67632308	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:67632308C>A	ENST00000272342.5	+	5	2624	c.2494C>A	c.(2494-2496)Ctt>Att	p.L832I	ETAA1_ENST00000462772.1_3'UTR	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	832						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TTCTCAGATTCTTTCTCAGTT	0.363																																																	0													48.0	49.0	49.0					2																	67632308		2202	4295	6497	SO:0001583	missense	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2494C>A	2.37:g.67632308C>A	ENSP00000272342:p.Leu832Ile		Q05BT7|Q53SC4	Missense_Mutation	SNP	NULL	p.L832I	ENST00000272342.5	37	c.2494	CCDS1882.1	2	.	.	.	.	.	.	.	.	.	.	C	7.238	0.600643	0.13939	.	.	ENSG00000143971	ENST00000272342	T	0.20598	2.06	4.78	0.666	0.17901	.	1.012260	0.07917	N	0.975318	T	0.19565	0.0470	L	0.56769	1.78	0.09310	N	1	B	0.20261	0.043	B	0.19666	0.026	T	0.35748	-0.9776	10	0.48119	T	0.1	2.1978	3.1113	0.06359	0.2749:0.3407:0.3004:0.084	.	832	Q9NY74	ETAA1_HUMAN	I	832	ENSP00000272342:L832I	ENSP00000272342:L832I	L	+	1	0	ETAA1	67485812	0.000000	0.05858	0.004000	0.12327	0.289000	0.27227	-0.021000	0.12504	0.003000	0.14656	-0.165000	0.13383	CTT	ETAA1	-	NULL	ENSG00000143971		0.363	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1		0.00	74	0	C	NM_019002		67632308	+1			no_errors	ENST00000272342	ensembl	human	known	74_37	missense	8.70	21	2	SNP	0.002	A
EXOC5	10640	genome.wustl.edu	37	14	57710888	57710888	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr14:57710888C>A	ENST00000413566.2	-	4	819	c.460G>T	c.(460-462)Gaa>Taa	p.E154*	EXOC5_ENST00000556911.1_5'UTR|EXOC5_ENST00000340918.7_Intron	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	154					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E154K(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						CTTACCTTTTCAGAATTTGTA	0.363																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											75.0	68.0	70.0					14																	57710888		1834	4080	5914	SO:0001587	stop_gained	0			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.460G>T	14.37:g.57710888C>A	ENSP00000389934:p.Glu154*		B2R6C5	Nonsense_Mutation	SNP	pfam_Sec10-like	p.E154*	ENST00000413566.2	37	c.460	CCDS45111.1	14	.	.	.	.	.	.	.	.	.	.	C	38	7.143326	0.98092	.	.	ENSG00000070367	ENST00000413566	.	.	.	5.52	5.52	0.82312	.	0.044471	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-17.0043	19.4226	0.94727	0.0:1.0:0.0:0.0	.	.	.	.	X	154	.	ENSP00000389934:E154X	E	-	1	0	EXOC5	56780641	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.089000	0.71384	2.591000	0.87537	0.591000	0.81541	GAA	EXOC5	-	pfam_Sec10-like	ENSG00000070367		0.363	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EXOC5	HGNC	protein_coding	OTTHUMT00000412905.1		0.00	50	0	C	NM_006544		57710888	-1			no_errors	ENST00000413566	ensembl	human	known	74_37	nonsense	6.98	40	3	SNP	1.000	A
F13A1	2162	genome.wustl.edu	37	6	6174842	6174842	+	Missense_Mutation	SNP	G	G	A	rs113599940		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:6174842G>A	ENST00000264870.3	-	12	1983	c.1718C>T	c.(1717-1719)aCg>aTg	p.T573M		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	573					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CACGTCGAACGTCTCCTTCTT	0.527																																																	0													283.0	247.0	259.0					6																	6174842		2203	4300	6503	SO:0001583	missense	0			M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.1718C>T	6.37:g.6174842G>A	ENSP00000264870:p.Thr573Met		Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.T573M	ENST00000264870.3	37	c.1718	CCDS4496.1	6	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934696	0.34189	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	T	0.69306	-0.39	5.78	5.78	0.91487	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.563919	0.18787	N	0.131169	T	0.67915	0.2944	M	0.66939	2.045	0.23542	N	0.997459	D;D	0.76494	0.992;0.999	P;P	0.56278	0.795;0.628	T	0.64449	-0.6405	10	0.52906	T	0.07	.	13.9156	0.63895	0.0:0.0:0.8481:0.1519	.	510;573	F5H080;P00488	.;F13A_HUMAN	M	573;510	ENSP00000264870:T573M	ENSP00000264870:T573M	T	-	2	0	F13A1	6119841	0.877000	0.30153	0.418000	0.26571	0.084000	0.17831	2.734000	0.47368	2.726000	0.93360	0.643000	0.83706	ACG	F13A1	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000124491		0.527	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13A1	HGNC	protein_coding	OTTHUMT00000039756.3	-	0.00	89	0	G	NM_000129		6174842	-1	tier1	rs113599940	no_errors	ENST00000264870	ensembl	human	known	74_37	missense	14.04	98	16	SNP	0.422	A
FAM13B	51306	genome.wustl.edu	37	5	137289028	137289028	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:137289028G>T	ENST00000033079.3	-	15	2230	c.1779C>A	c.(1777-1779)agC>agA	p.S593R	FAM13B_ENST00000420893.2_Missense_Mutation_p.S593R|FAM13B_ENST00000425075.2_Missense_Mutation_p.S497R	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	593					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AACCTACCTTGCTATTTCTTT	0.368																																																	0													206.0	198.0	201.0					5																	137289028		2203	4300	6503	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1779C>A	5.37:g.137289028G>T	ENSP00000033079:p.Ser593Arg		D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S593R	ENST00000033079.3	37	c.1779	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202511	0.38905	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95447	-3.71;1.94;-3.71	5.33	3.29	0.37713	.	0.212916	0.49916	D	0.000122	D	0.92678	0.7673	L	0.51422	1.61	0.31393	N	0.677592	P;B;B	0.43519	0.809;0.32;0.215	B;B;B	0.41332	0.354;0.192;0.061	D	0.91706	0.5377	10	0.48119	T	0.1	-0.0799	11.1655	0.48541	0.2482:0.0:0.7518:0.0	.	497;593;593	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	R	593;497;593	ENSP00000033079:S593R;ENSP00000394669:S497R;ENSP00000388521:S593R	ENSP00000033079:S593R	S	-	3	2	FAM13B	137316927	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	0.680000	0.25306	1.235000	0.43724	-0.224000	0.12420	AGC	FAM13B	-	NULL	ENSG00000031003		0.368	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	-	0.00	52	0	G			137289028	-1	tier1	-	no_errors	ENST00000033079	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
FAM198B	51313	genome.wustl.edu	37	4	159092463	159092463	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:159092463C>A	ENST00000296530.8	-	2	686	c.65G>T	c.(64-66)cGg>cTg	p.R22L	RP11-597D13.9_ENST00000509463.1_RNA|RP11-597D13.9_ENST00000514381.1_RNA|RP11-597D13.9_ENST00000505532.1_RNA|FAM198B_ENST00000585682.1_Missense_Mutation_p.R22L|FAM198B_ENST00000592057.1_Missense_Mutation_p.R22L|FAM198B_ENST00000393807.5_Missense_Mutation_p.R22L|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000503611.1_RNA	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	22						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.R22P(3)|p.R22L(2)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						CTTACGCACCCGCGGGACGCA	0.587																																																	5	Substitution - Missense(5)	urinary_tract(3)|skin(2)																																								SO:0001583	missense	0				CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.65G>T	4.37:g.159092463C>A	ENSP00000296530:p.Arg22Leu		Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	NULL	p.R22L	ENST00000296530.8	37	c.65	CCDS3798.1	4	.	.	.	.	.	.	.	.	.	.	C	14.46	2.540794	0.45280	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.28895	1.59;1.59	5.31	5.31	0.75309	.	0.462866	0.22223	N	0.062921	T	0.50222	0.1603	L	0.54323	1.7	0.21762	N	0.99955	D;B;B	0.69078	0.997;0.015;0.015	D;B;B	0.63703	0.917;0.013;0.008	T	0.37641	-0.9697	10	0.37606	T	0.19	0.2039	19.1738	0.93594	0.0:1.0:0.0:0.0	.	22;22;22	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	L	22	ENSP00000296530:R22L;ENSP00000377396:R22L	ENSP00000296530:R22L	R	-	2	0	FAM198B	159311913	0.005000	0.15991	0.089000	0.20774	0.784000	0.44337	1.677000	0.37576	2.764000	0.94973	0.655000	0.94253	CGG	FAM198B	-	NULL	ENSG00000164125		0.587	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM198B	HGNC	protein_coding	OTTHUMT00000365230.1		0.00	42	0	C	NM_001031700, NM_016613		159092463	-1			no_errors	ENST00000393807	ensembl	human	known	74_37	missense	5.56	51	3	SNP	0.267	A
FASN	2194	genome.wustl.edu	37	17	80039884	80039884	+	Splice_Site	SNP	C	C	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:80039884C>G	ENST00000306749.2	-	36	6382		c.e36+1		FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase						acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	gtggggCCCACCTGGGAGGCC	0.687																																					Colon(59;314 1043 11189 28578 32273)												0													42.0	44.0	43.0					17																	80039884		2202	4298	6500	SO:0001630	splice_region_variant	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6163+1G>C	17.37:g.80039884C>G			Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Splice_Site	SNP	-	e35+1	ENST00000306749.2	37	c.6163+1	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	C	15.83	2.948467	0.53186	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7764	0.78224	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FASN	77633173	0.998000	0.40836	0.998000	0.56505	0.630000	0.37929	5.078000	0.64425	2.148000	0.66965	0.197000	0.17608	.	FASN	-	-	ENSG00000169710		0.687	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1		0.00	61	0	C	NM_004104	Intron	80039884	-1			no_errors	ENST00000306749	ensembl	human	known	74_37	splice_site	5.66	49	3	SNP	1.000	G
FBP2	8789	genome.wustl.edu	37	9	97321223	97321223	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:97321223G>T	ENST00000375337.3	-	7	1083	c.1017C>A	c.(1015-1017)agC>agA	p.S339R	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	339					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				AAACTCGCTAGCTGCCTGCCT	0.493																																																	0													96.0	73.0	81.0					9																	97321223		2203	4300	6503	SO:0001583	missense	0			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.1017C>A	9.37:g.97321223G>T	ENSP00000364486:p.Ser339Arg		Q17R39|Q6FI53	Missense_Mutation	SNP	pfam_FBPase_class-1/SBPase,pfam_Inositol_monophosphatase,prints_FBPtase,prints_SBPase	p.S339R	ENST00000375337.3	37	c.1017	CCDS6711.1	9	.	.	.	.	.	.	.	.	.	.	.	8.101	0.776680	0.16120	.	.	ENSG00000130957	ENST00000375337	T	0.72167	-0.63	5.27	1.02	0.19986	.	0.657037	0.15269	N	0.271372	T	0.44685	0.1305	N	0.08118	0	0.27140	N	0.961688	B	0.02656	0.0	B	0.01281	0.0	T	0.38090	-0.9677	10	0.87932	D	0	-10.5586	3.8757	0.09056	0.231:0.2272:0.455:0.0868	.	339	O00757	F16P2_HUMAN	R	339	ENSP00000364486:S339R	ENSP00000364486:S339R	S	-	3	2	FBP2	96361044	0.997000	0.39634	0.998000	0.56505	0.032000	0.12392	0.337000	0.19841	0.700000	0.31782	-0.211000	0.12701	AGC	FBP2	-	NULL	ENSG00000130957		0.493	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBP2	HGNC	protein_coding	OTTHUMT00000053189.1	-	0.00	68	0	G	NM_003837		97321223	-1	tier1	-	no_errors	ENST00000375337	ensembl	human	known	74_37	missense	5.05	94	5	SNP	0.963	T
FCHO2	115548	genome.wustl.edu	37	5	72337134	72337134	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:72337134G>T	ENST00000430046.2	+	11	1047	c.931G>T	c.(931-933)Gat>Tat	p.D311Y	FCHO2_ENST00000341845.6_Missense_Mutation_p.D311Y|FCHO2_ENST00000512348.1_Missense_Mutation_p.D278Y	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	311					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		TCCTGATGCAGATTCATTGGT	0.269																																																	0													55.0	55.0	55.0					5																	72337134		1796	4030	5826	SO:0001583	missense	0			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.931G>T	5.37:g.72337134G>T	ENSP00000393776:p.Asp311Tyr		A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,smart_FCH_dom,pfscan_FCH_dom	p.D311Y	ENST00000430046.2	37	c.931	CCDS47230.1	5	.	.	.	.	.	.	.	.	.	.	G	16.53	3.150274	0.57151	.	.	ENSG00000157107	ENST00000430046;ENST00000341845;ENST00000512348	T;T;T	0.15487	2.42;2.42;2.42	4.97	4.97	0.65823	.	0.439902	0.23137	N	0.051517	T	0.30916	0.0780	L	0.58810	1.83	0.45852	D	0.998719	P;P	0.50943	0.939;0.94	P;P	0.52554	0.702;0.564	T	0.03103	-1.1072	10	0.66056	D	0.02	-9.0004	16.0212	0.80493	0.0:0.0:1.0:0.0	.	278;311	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	Y	311;311;278	ENSP00000393776:D311Y;ENSP00000344034:D311Y;ENSP00000427296:D278Y	ENSP00000344034:D311Y	D	+	1	0	FCHO2	72372890	1.000000	0.71417	1.000000	0.80357	0.492000	0.33523	4.546000	0.60705	2.289000	0.77006	0.585000	0.79938	GAT	FCHO2	-	NULL	ENSG00000157107		0.269	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	-	0.00	78	0	G	XM_291142		72337134	+1	tier1	-	no_errors	ENST00000341845	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
FDPS	2224	genome.wustl.edu	37	1	155279838	155279838	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:155279838C>A	ENST00000356657.6	+	3	343	c.181C>A	c.(181-183)Ctt>Att	p.L61I	FDPS_ENST00000368356.4_Missense_Mutation_p.L61I|FDPS_ENST00000447866.1_Intron|FDPS_ENST00000487002.1_3'UTR	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	61					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.L61I(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	ACTTAGAGCCCTTTGCTCCTC	0.517																																																	1	Substitution - Missense(1)	endometrium(1)											77.0	81.0	80.0					1																	155279838		2203	4300	6503	SO:0001583	missense	0			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.181C>A	1.37:g.155279838C>A	ENSP00000349078:p.Leu61Ile		D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.L61I	ENST00000356657.6	37	c.181	CCDS1110.1	1	.	.	.	.	.	.	.	.	.	.	C	12.73	2.026409	0.35701	.	.	ENSG00000160752	ENST00000368356;ENST00000356657	T;T	0.32988	1.43;1.43	4.13	-0.955	0.10356	.	1.237840	0.06392	N	0.717334	T	0.09730	0.0239	L	0.38175	1.15	0.34556	D	0.711835	B	0.09022	0.002	B	0.04013	0.001	T	0.25779	-1.0122	10	0.45353	T	0.12	.	7.1457	0.25581	0.0:0.3799:0.0:0.6201	.	61	P14324	FPPS_HUMAN	I	61	ENSP00000357340:L61I;ENSP00000349078:L61I	ENSP00000349078:L61I	L	+	1	0	FDPS	153546462	0.898000	0.30612	0.966000	0.40874	0.967000	0.64934	-0.112000	0.10791	-0.283000	0.09115	0.543000	0.68304	CTT	FDPS	-	NULL	ENSG00000160752		0.517	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1		0.00	29	0	C	NM_002004		155279838	+1			no_errors	ENST00000356657	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.621	A
FCRL2	79368	genome.wustl.edu	37	1	157719458	157719458	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:157719458G>T	ENST00000361516.3	-	8	1337	c.1289C>A	c.(1288-1290)tCt>tAt	p.S430Y	FCRL2_ENST00000368181.4_Missense_Mutation_p.S146Y|FCRL2_ENST00000392274.3_Missense_Mutation_p.S430Y	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	430					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATTAGTGGCAGAACTTTCTCC	0.333																																																	0													48.0	53.0	52.0					1																	157719458		2203	4300	6503	SO:0001583	missense	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.1289C>A	1.37:g.157719458G>T	ENSP00000355157:p.Ser430Tyr		A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S430Y	ENST00000361516.3	37	c.1289	CCDS1168.1	1	.	.	.	.	.	.	.	.	.	.	G	8.841	0.942227	0.18281	.	.	ENSG00000132704	ENST00000292389;ENST00000361516;ENST00000368181;ENST00000392274	T;T;T	0.23147	2.0;3.45;1.92	3.31	-2.05	0.07321	.	2.780480	0.01927	U	0.040956	T	0.07413	0.0187	M	0.61703	1.905	0.09310	N	1	B;B;B;P	0.49090	0.015;0.073;0.02;0.919	B;B;B;B	0.43445	0.007;0.03;0.011;0.42	T	0.26087	-1.0113	10	0.02654	T	1	.	3.284	0.06925	0.4473:0.0:0.3654:0.1872	.	430;146;430;177	B4DVJ9;Q96LA5-5;Q96LA5;Q96LA5-2	.;.;FCRL2_HUMAN;.	Y	146;430;146;430	ENSP00000355157:S430Y;ENSP00000357163:S146Y;ENSP00000376100:S430Y	ENSP00000292389:S146Y	S	-	2	0	FCRL2	155986082	0.004000	0.15560	0.000000	0.03702	0.103000	0.19146	-0.053000	0.11846	-0.619000	0.05648	-0.158000	0.13435	TCT	FCRL2	-	NULL	ENSG00000132704		0.333	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	-	0.00	146	0	G	NM_030764		157719458	-1	tier1	-	no_errors	ENST00000361516	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
PRR36	80164	genome.wustl.edu	37	19	7935863	7935863	+	Missense_Mutation	SNP	G	G	T	rs5027409		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:7935863G>T	ENST00000539422.1	-	5	2429	c.2267C>A	c.(2266-2268)cCt>cAt	p.P756H	CTD-3193O13.11_ENST00000597156.1_lincRNA|CTD-3193O13.9_ENST00000593356.1_Intron	NM_001190467.1	NP_001177396.1																					GTTCTCCAGAGGGGGTGTGGT	0.622																																																	0																																										SO:0001583	missense	0																														ENST00000539422.1:c.2267C>A	19.37:g.7935863G>T	ENSP00000438970:p.Pro756His			Missense_Mutation	SNP	NULL	p.P756H	ENST00000539422.1	37	c.2267		19	.	.	.	.	.	.	.	.	.	.	G	5.221	0.226334	0.09916	.	.	ENSG00000183248	ENST00000539422	.	.	.	2.35	-0.76	0.11041	.	.	.	.	.	T	0.23532	0.0569	N	0.11560	0.145	0.58432	P	6.999999999979245E-6	.	.	.	.	.	.	T	0.32268	-0.9913	5	0.56958	D	0.05	.	5.5853	0.17272	0.4446:0.0:0.5554:0.0	rs5027409	.	.	.	H	756	.	ENSP00000438970:P756H	P	-	2	0	AC010336.1	7841863	0.804000	0.28969	0.003000	0.11579	0.318000	0.28184	0.000000	0.12993	0.137000	0.18759	0.074000	0.15403	CCT	CTD-3193O13.9	-	NULL	ENSG00000183248		0.622	CTD-3193O13.9-201	KNOWN	basic|appris_principal	protein_coding	FLJ22184	Clone_based_vega_gene	protein_coding		-	0.00	25	0	G			7935863	-1	tier1	rs5027409	no_errors	ENST00000539422	ensembl	human	known	74_37	missense	13.21	46	7	SNP	0.136	T
FLJ40288	286023	genome.wustl.edu	37	7	132412309	132412309	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:132412309T>C	ENST00000332558.4	+	5	779	c.161T>C	c.(160-162)cTg>cCg	p.L54P																								CAGGGCAGGCTGCTGCCAAGA	0.567																																																	0													50.0	50.0	50.0					7																	132412309		692	1591	2283	SO:0001583	missense	0																														ENST00000332558.4:c.161T>C	7.37:g.132412309T>C	ENSP00000331939:p.Leu54Pro			Missense_Mutation	SNP	NULL	p.L54P	ENST00000332558.4	37	c.161		7	.	.	.	.	.	.	.	.	.	.	T	5.852	0.341450	0.11069	.	.	ENSG00000183470	ENST00000332558	.	.	.	6.17	0.953	0.19590	.	0.312667	0.17719	N	0.164307	T	0.45538	0.1347	.	.	.	.	.	.	.	.	.	.	.	.	T	0.54330	-0.8310	5	0.87932	D	0	-0.7219	4.6044	0.12371	0.0:0.1682:0.3186:0.5132	.	.	.	.	P	54	.	ENSP00000331939:L54P	L	+	2	0	AC009365.3	132062849	0.967000	0.33354	0.996000	0.52242	0.170000	0.22686	-0.076000	0.11412	0.203000	0.20529	0.533000	0.62120	CTG	AC009365.3	-	NULL	ENSG00000183470		0.567	AC009365.3-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	FLJ40288	Clone_based_vega_gene	protein_coding	OTTHUMT00000318676.5	-	0.00	28	0	T			132412309	+1	tier1	-	no_errors	ENST00000332558	ensembl	human	putative	74_37	missense	9.30	39	4	SNP	0.995	C
FLOT2	2319	genome.wustl.edu	37	17	27208318	27208318	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:27208318G>T	ENST00000394908.4	-	9	1094	c.990C>A	c.(988-990)atC>atA	p.I330I	FLOT2_ENST00000394906.2_Silent_p.I385I|FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000585169.1_Silent_p.I330I	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2	330					cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			CCATCGCCTCGATGACTGCCG	0.612																																																	0													71.0	75.0	74.0					17																	27208318		2095	4217	6312	SO:0001819	synonymous_variant	0			M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.990C>A	17.37:g.27208318G>T				Silent	SNP	pfam_Band_7,smart_Band_7	p.I330	ENST00000394908.4	37	c.990	CCDS11245.2	17																																																																																			FLOT2	-	NULL	ENSG00000132589		0.612	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	HGNC	protein_coding	OTTHUMT00000255935.3		0.00	25	0	G	NM_004475		27208318	-1			no_errors	ENST00000394908	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.927	T
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74715180	74715180	+	Missense_Mutation	SNP	C	C	T	rs79045456		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:74715180C>T	ENST00000370899.3	+	5	527	c.490C>T	c.(490-492)Cgc>Tgc	p.R164C	FPGT-TNNI3K_ENST00000370895.1_Missense_Mutation_p.R164C|FPGT-TNNI3K_ENST00000533006.1_3'UTR|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.R177C|TNNI3K_ENST00000326637.3_Missense_Mutation_p.R63C|TNNI3K_ENST00000370891.2_Missense_Mutation_p.R164C	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		TTTAAATTACCGCACTGAAAA	0.333																																																	0													148.0	152.0	150.0					1																	74715180		2202	4300	6502	SO:0001583	missense	0					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.490C>T	1.37:g.74715180C>T	ENSP00000359936:p.Arg164Cys			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R177C	ENST00000370899.3	37	c.529		1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976370	0.92982	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.054702	0.64402	D	0.000001	T	0.25791	0.0628	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.74674	0.925;0.984;0.931;0.967	T	0.01639	-1.1306	10	0.66056	D	0.02	.	19.7289	0.96175	0.0:1.0:0.0:0.0	.	63;164;164;164	Q59H18;Q59H18-1;Q59H18-4;Q59H18-3	TNI3K_HUMAN;.;.;.	C	164;164;164;164;63	ENSP00000359936:R164C;ENSP00000359932:R164C;ENSP00000450895:R164C;ENSP00000359928:R164C;ENSP00000322251:R63C	ENSP00000322251:R63C	R	+	1	0	RP11-653A5.2;AC093158.1	74487768	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.811000	0.55620	2.770000	0.95276	0.655000	0.94253	CGC	FPGT-TNNI3K	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000259030		0.333	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3	-	0.00	40	0	C			74715180	+1	tier1	-	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	T
FRY	10129	genome.wustl.edu	37	13	32709077	32709077	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr13:32709077G>T	ENST00000380250.3	+	9	1418	c.922G>T	c.(922-924)Gat>Tat	p.D308Y		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	308						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CAAAGACAAAGATATCAAGCA	0.383																																																	0													158.0	150.0	153.0					13																	32709077		1892	4102	5994	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.922G>T	13.37:g.32709077G>T	ENSP00000369600:p.Asp308Tyr		Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D308Y	ENST00000380250.3	37	c.922	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820123	0.90873	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	T	0.25912	1.77	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.58595	0.2133	M	0.83692	2.655	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.59669	-0.7411	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	308	Q5TBA9	FRY_HUMAN	Y	308;236	ENSP00000369600:D308Y	ENSP00000267067:D236Y	D	+	1	0	FRY	31607077	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.718000	0.98758	2.941000	0.99782	0.655000	0.94253	GAT	FRY	-	NULL	ENSG00000073910		0.383	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1		0.00	48	0	G	NM_023037		32709077	+1			no_errors	ENST00000380250	ensembl	human	known	74_37	missense	6.82	41	3	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48525101	48525101	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:48525101G>T	ENST00000503238.1	-	51	7337	c.7338C>A	c.(7336-7338)ttC>ttA	p.F2446L	FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.F2446L|FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000358350.4_Missense_Mutation_p.F2446L			O94915	FRYL_HUMAN	FRY-like	2446					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CTCCCCAGTTGAAATTGTCCA	0.448																																																	0													82.0	82.0	82.0					4																	48525101		1868	4114	5982	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.7338C>A	4.37:g.48525101G>T	ENSP00000426064:p.Phe2446Leu		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.F2446L	ENST00000503238.1	37	c.7338	CCDS43227.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.2|24.2	4.510096|4.510096	0.85282|0.85282	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810|ENST00000514617	T;T;T|.	0.52983|.	0.64;0.64;0.64|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	0.051297|.	0.85682|.	D|.	0.000000|.	T|T	0.75613|0.75613	0.3873|0.3873	M|M	0.70595|0.70595	2.14|2.14	0.80722|0.80722	D|D	1|1	B;P;P|.	0.48230|.	0.172;0.752;0.907|.	B;B;P|.	0.49332|.	0.058;0.403;0.607|.	T|T	0.74740|0.74740	-0.3563|-0.3563	10|5	0.72032|.	D|.	0.01|.	.|.	18.6932|18.6932	0.91590|0.91590	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1276;2446;2446|.	Q6ZR29;O94915;F5GX82|.	.;FRYL_HUMAN;.|.	L|K	2446|1316	ENSP00000426064:F2446L;ENSP00000351113:F2446L;ENSP00000441114:F2446L|.	ENSP00000351113:F2446L|.	F|Q	-|-	3|1	2|0	FRYL|FRYL	48219858|48219858	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.898000|0.898000	0.52572|0.52572	3.930000|3.930000	0.56522|0.56522	2.645000|2.645000	0.89757|0.89757	0.460000|0.460000	0.39030|0.39030	TTC|CAA	FRYL	-	NULL	ENSG00000075539		0.448	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	21	0	G			48525101	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	T
FZD2	2535	genome.wustl.edu	37	17	42636367	42636367	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:42636367G>T	ENST00000315323.3	+	1	1443	c.1311G>T	c.(1309-1311)tcG>tcT	p.S437S		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	437					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCTTCGTGTCGCTCTTCCGCA	0.627																																																	0													106.0	96.0	99.0					17																	42636367		2203	4300	6503	SO:0001819	synonymous_variant	0			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.1311G>T	17.37:g.42636367G>T			Q0VG82	Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S437	ENST00000315323.3	37	c.1311	CCDS11484.1	17																																																																																			FZD2	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000180340		0.627	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	HGNC	protein_coding	OTTHUMT00000457806.1		0.00	12	0	G	NM_001466		42636367	+1			no_errors	ENST00000315323	ensembl	human	known	74_37	silent	16.00	20	4	SNP	0.802	T
DDX42	11325	genome.wustl.edu	37	17	61899155	61899155	+	IGR	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:61899155C>A	ENST00000578681.1	+	0	4337				FTSJ3_ENST00000427159.2_Missense_Mutation_p.E508D	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42						protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						GCAGTGGATTCTCCTCCTCCT	0.537																																																	0													231.0	177.0	195.0					17																	61899155		2203	4300	6503	SO:0001628	intergenic_variant	0			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3			17.37:g.61899155C>A			A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_rRNA_MeTfrase_Spb1_C,pfam_rRNA_MeTrfase_FtsJ_dom,pfam_rRNA_MeTfrase_Spb1_DUF3381	p.E508D	ENST00000578681.1	37	c.1524	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	C	6.197	0.404559	0.11754	.	.	ENSG00000108592	ENST00000427159	T	0.32753	1.44	3.52	-1.16	0.09678	.	0.123358	0.53938	D	0.000059	T	0.18087	0.0434	L	0.42245	1.32	0.36279	D	0.855689	B	0.06786	0.001	B	0.06405	0.002	T	0.09574	-1.0668	10	0.21540	T	0.41	-19.5406	4.2055	0.10486	0.0:0.3476:0.3284:0.324	.	508	Q8IY81	RRMJ3_HUMAN	D	508	ENSP00000396673:E508D	ENSP00000396673:E508D	E	-	3	2	FTSJ3	59252887	0.665000	0.27466	0.935000	0.37517	0.269000	0.26545	-0.371000	0.07513	-0.077000	0.12752	0.174000	0.16983	GAG	FTSJ3	-	NULL	ENSG00000108592		0.537	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ3	HGNC	protein_coding	OTTHUMT00000444368.1		0.00	33	0	C	NM_007372		61899155	-1			no_errors	ENST00000427159	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.886	A
GARNL3	84253	genome.wustl.edu	37	9	130117629	130117629	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:130117629G>T	ENST00000373387.4	+	20	2165	c.1813G>T	c.(1813-1815)Gtt>Ttt	p.V605F	GARNL3_ENST00000435213.2_Missense_Mutation_p.V583F|GARNL3_ENST00000314904.5_Missense_Mutation_p.V605F	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	605	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						GAGGATTGTGGTTGCAATTCG	0.493																																																	0													230.0	226.0	227.0					9																	130117629		2203	4300	6503	SO:0001583	missense	0			BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.1813G>T	9.37:g.130117629G>T	ENSP00000362485:p.Val605Phe		B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Missense_Mutation	SNP	pfam_Citron,pfam_Rap_GAP_dom,smart_Citron,pfscan_Rap_GAP_dom	p.V605F	ENST00000373387.4	37	c.1813	CCDS6869.2	9	.	.	.	.	.	.	.	.	.	.	G	29.1	4.973256	0.92919	.	.	ENSG00000136895	ENST00000435213;ENST00000314904;ENST00000373387	T;T;T	0.06608	3.28;3.28;3.28	5.48	5.48	0.80851	Citron-like (2);	0.062767	0.64402	D	0.000004	T	0.13415	0.0325	L	0.60455	1.87	0.51012	D	0.999907	P;P	0.48998	0.918;0.693	P;B	0.47673	0.554;0.34	T	0.01074	-1.1460	9	.	.	.	.	17.9175	0.88955	0.0:0.0:1.0:0.0	.	605;583	Q5VVW2;B7Z3Q6	GARL3_HUMAN;.	F	583;605;605	ENSP00000396205:V583F;ENSP00000313970:V605F;ENSP00000362485:V605F	.	V	+	1	0	GARNL3	129157450	1.000000	0.71417	0.550000	0.28217	0.935000	0.57460	9.174000	0.94824	2.563000	0.86464	0.563000	0.77884	GTT	GARNL3	-	pfam_Citron,smart_Citron	ENSG00000136895		0.493	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	HGNC	protein_coding	OTTHUMT00000054151.3		0.00	45	0	G	NM_032293		130117629	+1			no_errors	ENST00000373387	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.988	T
GK5	256356	genome.wustl.edu	37	3	141923492	141923492	+	Intron	DEL	A	A	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:141923492delA	ENST00000392993.2	-	4	563				GK5_ENST00000466685.3_Intron|GK5_ENST00000544571.1_Intron	NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)						glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						ACATTTACAGAAAAAAAAAAC	0.303																																																	0													52.0	56.0	55.0					3																	141923492		2200	4293	6493	SO:0001627	intron_variant	0			BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.411+44T>-	3.37:g.141923492delA			B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	Frame_Shift_Del	DEL	pfam_Carb_kinase_FGGY_N	p.L153fs	ENST00000392993.2	37	c.456	CCDS33871.1	3																																																																																			GK5	-	NULL	ENSG00000175066		0.303	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK5	HGNC	protein_coding	OTTHUMT00000353999.1		0.00	48	0	A	NM_001039547		141923492	-1	tier1		no_errors	ENST00000487672	ensembl	human	known	74_37	frame_shift_del	14.71	29	5	DEL	0.000	-
GNAI2	2771	genome.wustl.edu	37	3	50296406	50296406	+	3'UTR	DEL	C	C	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:50296406delC	ENST00000313601.6	+	0	2083				GNAI2_ENST00000266027.5_3'UTR|GNAI2_ENST00000491100.1_3'UTR|U73166.2_ENST00000439898.1_lincRNA|GNAI2_ENST00000536647.1_3'UTR	NM_002070.2	NP_002061.1	P04899	GNAI2_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2						activation of MAPKK activity (GO:0000186)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of synaptic transmission (GO:0050805)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|regulation of calcium ion transport (GO:0051924)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|membrane raft (GO:0045121)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|liver(2)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00571)|Kidney(197;0.00651)		GACCAGCAAGCCCCCCCCCAG	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X04828	CCDS2813.1, CCDS54587.1, CCDS63642.1, CCDS63644.1	3p21.31	2010-08-27			ENSG00000114353	ENSG00000114353			4385	protein-coding gene	gene with protein product	"""GTP-binding regulatory protein Gi alpha-2 chain"""	139360		GNAI2B		3100330, 1733849	Standard	NM_001166425		Approved	GIP	uc003cyq.1	P04899	OTTHUMG00000156940	ENST00000313601.6:c.*631C>-	3.37:g.50296406delC			B3KTZ0|B4DYA0|B4E2X5|Q6B6N3|Q8IZ71	RNA	DEL	-	NULL	ENST00000313601.6	37	NULL	CCDS2813.1	3																																																																																			GNAI2	-	-	ENSG00000114353		0.483	GNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNAI2	HGNC	protein_coding	OTTHUMT00000346688.1		0.00	22	0	C	NM_002070		50296406	+1	tier1		no_errors	ENST00000491100	ensembl	human	known	74_37	rna	11.54	23	3	DEL	0.001	-
GK5	256356	genome.wustl.edu	37	3	141944334	141944334	+	5'UTR	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:141944334C>T	ENST00000392993.2	-	0	115				GK5_ENST00000466685.3_5'UTR|GK5_ENST00000544571.1_5'UTR	NM_001039547.2	NP_001034636.1	Q6ZS86	GLPK5_HUMAN	glycerol kinase 5 (putative)						glycerol catabolic process (GO:0019563)		ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			kidney(1)|large_intestine(1)|lung(7)|urinary_tract(1)	10						AGCCGCCTACCCAGAGGGCGC	0.716																																																	0													9.0	11.0	10.0					3																	141944334		2153	4242	6395	SO:0001623	5_prime_UTR_variant	0			BX648681	CCDS33871.1	3q23	2014-02-12	2006-09-21		ENSG00000175066	ENSG00000175066		"""Glycerol kinases"""	28635	protein-coding gene	gene with protein product						12477932	Standard	NM_001039547		Approved	MGC40579	uc003euq.2	Q6ZS86	OTTHUMG00000133572	ENST00000392993.2:c.-37G>A	3.37:g.141944334C>T			B2R9I2|D3DNG2|Q8N2A7|Q8N5E6	RNA	SNP	-	NULL	ENST00000392993.2	37	NULL	CCDS33871.1	3																																																																																			GK5	-	-	ENSG00000175066		0.716	GK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK5	HGNC	protein_coding	OTTHUMT00000353999.1	-	0.00	40	0	C	NM_001039547		141944334	-1	tier1	-	no_errors	ENST00000466685	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.000	T
KISS1	3814	genome.wustl.edu	37	1	204167617	204167617	+	5'Flank	SNP	C	C	A	rs149291000		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:204167617C>A	ENST00000367194.4	-	0	0				GOLT1A_ENST00000475517.1_5'Flank|GOLT1A_ENST00000308302.3_Missense_Mutation_p.R123L	NM_002256.3	NP_002247.3	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor						cytoskeleton organization (GO:0007010)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of synaptic transmission (GO:0050806)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				large_intestine(1)|lung(1)|ovary(1)	3	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		TTGAAGTCTCCGGAACAGCTG	0.502																																																	0													143.0	129.0	134.0					1																	204167617		2203	4300	6503	SO:0001631	upstream_gene_variant	0			U43527	CCDS41454.1	1q32	2014-01-30			ENSG00000170498	ENSG00000170498		"""Endogenous ligands"""	6341	protein-coding gene	gene with protein product	"""prepro-kisspeptin"", ""kisspeptin"""	603286				9192814, 9806840	Standard	NM_002256		Approved		uc001har.3	Q15726	OTTHUMG00000036060		1.37:g.204167617C>A	Exception_encountered		A8K6N0|Q9HBP1	Missense_Mutation	SNP	pfam_Vesicle_transpt_Got1/SFT2	p.R123L	ENST00000367194.4	37	c.368	CCDS41454.1	1	.	.	.	.	.	.	.	.	.	.	C	14.97	2.695558	0.48202	.	.	ENSG00000174567	ENST00000308302	.	.	.	5.03	-7.04	0.01578	.	2.185110	0.02083	N	0.052501	T	0.42494	0.1205	L	0.38838	1.175	0.24444	N	0.994511	B	0.28470	0.213	B	0.34093	0.175	T	0.49447	-0.8939	9	0.66056	D	0.02	0.2205	14.3944	0.67001	0.0:0.2814:0.0:0.7186	.	123	Q6ZVE7	GOT1A_HUMAN	L	123	.	ENSP00000308535:R123L	R	-	2	0	GOLT1A	202434240	0.046000	0.20272	0.846000	0.33378	0.969000	0.65631	-1.911000	0.01583	-1.423000	0.02002	-0.350000	0.07774	CGG	GOLT1A	-	NULL	ENSG00000174567		0.502	KISS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLT1A	HGNC	protein_coding	OTTHUMT00000087892.1	-	0.00	34	0	C	NM_002256		204167617	-1	tier1	-	no_errors	ENST00000308302	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.529	A
GPR158	57512	genome.wustl.edu	37	10	25883266	25883266	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:25883266G>T	ENST00000376351.3	+	9	2297	c.1938G>T	c.(1936-1938)ctG>ctT	p.L646L	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	646					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TGTTGATGCTGTATTTTGCAC	0.323																																																	0													207.0	189.0	195.0					10																	25883266		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1938G>T	10.37:g.25883266G>T			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.L646	ENST00000376351.3	37	c.1938	CCDS31166.1	10																																																																																			GPR158	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000151025		0.323	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2		0.00	26	0	G	XM_166110		25883266	+1			no_errors	ENST00000376351	ensembl	human	known	74_37	silent	14.29	12	2	SNP	1.000	T
GPSM2	29899	genome.wustl.edu	37	1	109465146	109465146	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:109465146C>A	ENST00000406462.2	+	14	2321	c.1548C>A	c.(1546-1548)tgC>tgA	p.C516*	AKNAD1_ENST00000357393.4_Intron|GPSM2_ENST00000264126.3_Nonsense_Mutation_p.C516*			P81274	GPSM2_HUMAN	G-protein signaling modulator 2	516					establishment of mitotic spindle orientation (GO:0000132)|G-protein coupled receptor signaling pathway (GO:0007186)|lung epithelial cell differentiation (GO:0060487)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase regulator activity (GO:0030695)|identical protein binding (GO:0042802)	p.C509C(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)	14		all_epithelial(167;7.64e-05)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0353)|Lung(183;0.0984)|COAD - Colon adenocarcinoma(174;0.129)|Epithelial(280;0.175)|all cancers(265;0.209)		AAAAGAACTGCCATACAGCTT	0.378																																																	1	Substitution - coding silent(1)	large_intestine(1)											162.0	161.0	161.0					1																	109465146		2203	4300	6503	SO:0001587	stop_gained	0			AY136740	CCDS792.2	1p13.3	2013-10-11	2010-06-24		ENSG00000121957	ENSG00000121957		"""Tetratricopeptide (TTC) repeat domain containing"""	29501	protein-coding gene	gene with protein product		609245	"""G-protein signalling modulator 2 (AGS3-like, C. elegans)"", ""deafness, autosomal recessive 82"""	DFNB82		11832491, 8973305, 19888295, 20602914, 21348867	Standard	NM_013296		Approved	LGN, Pins	uc010ovc.2	P81274	OTTHUMG00000011730	ENST00000406462.2:c.1548C>A	1.37:g.109465146C>A	ENSP00000385510:p.Cys516*		Q5T1N8|Q6IBL7|Q8N0Z5	Nonsense_Mutation	SNP	pfam_GoLoco_motif,pfam_TPR_1,pfam_TPR-4,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C516*	ENST00000406462.2	37	c.1548	CCDS792.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	38|38	7.105962|7.105962	0.98066|0.98066	.|.	.|.	ENSG00000121957|ENSG00000121957	ENST00000441735|ENST00000406462;ENST00000264126	.|.	.|.	.|.	6.08|6.08	-2.98|-2.98	0.05513|0.05513	.|.	.|0.512115	.|0.23642	.|N	.|0.046013	T|.	0.13927|.	0.0337|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.12218|.	-1.0556|.	3|.	.|0.40728	.|T	.|0.16	-25.0317|-25.0317	2.661|2.661	0.05027|0.05027	0.1576:0.2643:0.0977:0.4804|0.1576:0.2643:0.0977:0.4804	.|.	.|.	.|.	.|.	D|X	106|516	.|.	.|ENSP00000264126:C516X	A|C	+|+	2|3	0|2	GPSM2|GPSM2	109266669|109266669	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-0.393000|-0.393000	0.07305|0.07305	-0.514000|-0.514000	0.06488|0.06488	0.655000|0.655000	0.94253|0.94253	GCC|TGC	GPSM2	-	NULL	ENSG00000121957		0.378	GPSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM2	HGNC	protein_coding	OTTHUMT00000032400.3	-	0.00	92	0	C	NM_013296		109465146	+1	tier1	-	no_errors	ENST00000264126	ensembl	human	known	74_37	nonsense	5.80	65	4	SNP	0.000	A
GREB1L	80000	genome.wustl.edu	37	18	18964192	18964192	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:18964192G>T	ENST00000580732.2	+	4	564	c.183G>T	c.(181-183)ctG>ctT	p.L61L	GREB1L_ENST00000400483.4_Silent_p.L61L|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000431264.1_Silent_p.L61L|GREB1L_ENST00000269218.6_Silent_p.L61L|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000424526.1_Silent_p.L61L			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	61						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						TGGAGGATCTGGACAAAGATT	0.353																																																	0													86.0	69.0	74.0					18																	18964192		692	1591	2283	SO:0001819	synonymous_variant	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.183G>T	18.37:g.18964192G>T			A4QN17|Q9H8F1	Silent	SNP	superfamily_P-loop_NTPase	p.L61	ENST00000580732.2	37	c.183	CCDS45836.1	18																																																																																			GREB1L	-	NULL	ENSG00000141449		0.353	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	82	0	G	NM_024935		18964192	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	silent	9.26	49	5	SNP	1.000	T
GRID1	2894	genome.wustl.edu	37	10	87489302	87489302	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:87489302G>T	ENST00000327946.7	-	9	1388	c.1303C>A	c.(1303-1305)Caa>Aaa	p.Q435K	GRID1_ENST00000536331.1_Missense_Mutation_p.Q6K	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	435					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GTCAATCCTTGGAGGCGGCTG	0.512										Multiple Myeloma(13;0.14)																																							0													90.0	87.0	88.0					10																	87489302		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1303C>A	10.37:g.87489302G>T	ENSP00000330148:p.Gln435Lys		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q435K	ENST00000327946.7	37	c.1303	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	G	17.06	3.291430	0.59976	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.14144	2.78;2.53	5.45	5.45	0.79879	.	0.050023	0.85682	D	0.000000	T	0.11922	0.0290	L	0.29908	0.895	0.80722	D	1	B	0.29037	0.231	B	0.24541	0.054	T	0.13255	-1.0516	10	0.23891	T	0.37	.	18.2408	0.89967	0.0:0.0:1.0:0.0	.	435	Q9ULK0	GRID1_HUMAN	K	435;6	ENSP00000330148:Q435K;ENSP00000444455:Q6K	ENSP00000330148:Q435K	Q	-	1	0	GRID1	87479282	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.568000	0.82369	2.545000	0.85829	0.591000	0.81541	CAA	GRID1	-	NULL	ENSG00000182771		0.512	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	39	0	G	XM_043613		87489302	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
GSK3A	2931	genome.wustl.edu	37	19	42738787	42738787	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:42738787G>T	ENST00000222330.3	-	5	837	c.710C>A	c.(709-711)tCc>tAc	p.S237Y	GSK3A_ENST00000398249.4_Missense_Mutation_p.S155Y|AC006486.9_ENST00000594664.1_Missense_Mutation_p.S150Y	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	237	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				CACGCCCTGGGAGTGGATGTA	0.602																																																	0													69.0	58.0	62.0					19																	42738787		2203	4299	6502	SO:0001583	missense	0				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.710C>A	19.37:g.42738787G>T	ENSP00000222330:p.Ser237Tyr		O14959	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S237Y	ENST00000222330.3	37	c.710	CCDS12599.1	19	.	.	.	.	.	.	.	.	.	.	G	21.8	4.209091	0.79240	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.51325	0.71;0.71	4.97	4.97	0.65823	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72285	0.3441	M	0.85777	2.775	0.80722	D	1	D;D	0.69078	0.997;0.975	D;D	0.74023	0.982;0.925	T	0.77885	-0.2421	10	0.87932	D	0	-10.6933	17.4117	0.87487	0.0:0.0:1.0:0.0	.	237;155	P49840;A8MT37	GSK3A_HUMAN;.	Y	237;155;182	ENSP00000222330:S237Y;ENSP00000381301:S155Y	ENSP00000222330:S237Y	S	-	2	0	GSK3A	47430627	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.407000	0.80029	2.470000	0.83445	0.591000	0.81541	TCC	GSK3A	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000105723		0.602	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3A	HGNC	protein_coding	OTTHUMT00000319782.1		0.00	60	0	G			42738787	-1			no_errors	ENST00000222330	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
GUCA1B	2979	genome.wustl.edu	37	6	42162358	42162358	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:42162358C>A	ENST00000230361.3	-	1	296	c.201G>T	c.(199-201)aaG>aaT	p.K67N		NM_002098.5	NP_002089.4	Q9UMX6	GUC1B_HUMAN	guanylate cyclase activator 1B (retina)	67	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				body fluid secretion (GO:0007589)|cell-cell signaling (GO:0007267)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)	p.K67N(1)		large_intestine(3)|lung(3)|skin(2)	8	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|Epithelial(12;0.00154)|STAD - Stomach adenocarcinoma(11;0.00177)			TTACCCCATTCTTGTCGAAGG	0.572																																																	1	Substitution - Missense(1)	lung(1)											104.0	86.0	92.0					6																	42162358		2203	4300	6503	SO:0001583	missense	0			AF173227	CCDS4865.1	6p21.1	2013-02-14			ENSG00000112599	ENSG00000112599		"""EF-hand domain containing"""	4679	protein-coding gene	gene with protein product		602275				9119368	Standard	NM_002098		Approved	GCAP2, RP48	uc003orz.3	Q9UMX6	OTTHUMG00000014697	ENST00000230361.3:c.201G>T	6.37:g.42162358C>A	ENSP00000230361:p.Lys67Asn		Q9NU15	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.K67N	ENST00000230361.3	37	c.201	CCDS4865.1	6	.	.	.	.	.	.	.	.	.	.	C	15.86	2.957373	0.53400	.	.	ENSG00000112599	ENST00000230361;ENST00000372949	T	0.41758	0.99	4.6	2.78	0.32641	EF-hand-like domain (1);	0.045975	0.85682	D	0.000000	T	0.33731	0.0873	M	0.72479	2.2	0.58432	D	0.999999	P	0.50369	0.934	P	0.49387	0.609	T	0.18935	-1.0321	10	0.51188	T	0.08	.	7.3112	0.26475	0.0:0.7129:0.0:0.2871	.	67	Q9UMX6	GUC1B_HUMAN	N	67	ENSP00000230361:K67N	ENSP00000230361:K67N	K	-	3	2	GUCA1B	42270336	0.989000	0.36119	1.000000	0.80357	0.948000	0.59901	0.322000	0.19576	1.068000	0.40764	-0.264000	0.10439	AAG	GUCA1B	-	smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	ENSG00000112599		0.572	GUCA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1B	HGNC	protein_coding	OTTHUMT00000040550.1		0.00	33	0	C	NM_002098		42162358	-1			no_errors	ENST00000230361	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	A
HEG1	57493	genome.wustl.edu	37	3	124729390	124729390	+	Missense_Mutation	SNP	C	C	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:124729390C>G	ENST00000311127.4	-	7	3033	c.2966G>C	c.(2965-2967)tGt>tCt	p.C989S	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	989	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						GTTCACAGCACAGCTGTTGAC	0.478																																																	0													37.0	37.0	37.0					3																	124729390		1928	4130	6058	SO:0001583	missense	0			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.2966G>C	3.37:g.124729390C>G	ENSP00000311502:p.Cys989Ser		Q6NX66|Q8NC40|Q9BSV0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.C989S	ENST00000311127.4	37	c.2966	CCDS46898.1	3	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339209	0.41398	.	.	ENSG00000173706	ENST00000311127	D	0.99992	-12.4	4.99	4.99	0.66335	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.438282	0.16563	U	0.208979	D	0.99994	0.9999	H	0.94925	3.6	0.51767	D	0.999934	D	0.89917	1.0	D	0.91635	0.999	D	0.99974	1.2119	10	0.87932	D	0	.	13.9703	0.64235	0.0:1.0:0.0:0.0	.	989	Q9ULI3	HEG1_HUMAN	S	989	ENSP00000311502:C989S	ENSP00000311502:C989S	C	-	2	0	HEG1	126212080	0.991000	0.36638	0.949000	0.38748	0.030000	0.12068	3.610000	0.54125	2.752000	0.94435	0.655000	0.94253	TGT	HEG1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000173706		0.478	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	-	0.00	29	0	C	XM_087386		124729390	-1	tier1	-	no_errors	ENST00000311127	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.971	G
HNRNPLL	92906	genome.wustl.edu	37	2	38809033	38809033	+	Intron	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:38809033C>A	ENST00000449105.3	-	6	1142				HNRNPLL_ENST00000410076.1_Missense_Mutation_p.R270I|HNRNPLL_ENST00000409636.1_Intron|HNRNPLL_ENST00000608859.1_Intron|HNRNPLL_ENST00000409328.1_Intron|HNRNPLL_ENST00000358367.4_Intron|HNRNPLL_ENST00000378915.3_Intron			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like						mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CAAGTACATTCTAAAATGTAT	0.328																																																	0													89.0	86.0	87.0					2																	38809033		2203	4300	6503	SO:0001627	intron_variant	0			BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.802+21G>T	2.37:g.38809033C>A			Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.R270I	ENST00000449105.3	37	c.809		2	.	.	.	.	.	.	.	.	.	.	C	5.106	0.205236	0.09704	.	.	ENSG00000143889	ENST00000410076	.	.	.	6.05	3.92	0.45320	.	.	.	.	.	T	0.72020	0.3409	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.75280	-0.3373	5	0.59425	D	0.04	.	12.9415	0.58348	0.0:0.8108:0.1187:0.0705	.	.	.	.	I	270	.	ENSP00000386695:R270I	R	-	2	0	HNRPLL	38662537	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	1.615000	0.36922	1.549000	0.49425	0.650000	0.86243	AGA	HNRNPLL	-	NULL	ENSG00000143889		0.328	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	HNRNPLL	HGNC	protein_coding	OTTHUMT00000219887.2	-	0.00	92	0	C	NM_138394		38809033	-1	tier1	-	no_errors	ENST00000410076	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	A
HNMT	3176	genome.wustl.edu	37	2	138758583	138758583	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:138758583G>T	ENST00000280097.3	+	3	468	c.286G>T	c.(286-288)Gcc>Tcc	p.A96S	HNMT_ENST00000485653.1_3'UTR|HNMT_ENST00000410115.1_Missense_Mutation_p.A96S	NM_006895.2	NP_008826.1	P50135	HNMT_HUMAN	histamine N-methyltransferase	96					brain development (GO:0007420)|hyperosmotic response (GO:0006972)|respiratory gaseous exchange (GO:0007585)|response to amine (GO:0014075)|response to cocaine (GO:0042220)|response to glucocorticoid (GO:0051384)|response to interleukin-1 (GO:0070555)|response to tumor cell (GO:0002347)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nucleus (GO:0005634)	histamine N-methyltransferase activity (GO:0046539)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Chlorhexidine(DB00878)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)	TGAACAAATTGCCAAATACAA	0.373																																																	0													81.0	73.0	76.0					2																	138758583		2203	4300	6503	SO:0001583	missense	0				CCDS2181.1, CCDS33296.1, CCDS33297.1	2q22.1	2008-02-05			ENSG00000150540	ENSG00000150540	2.1.1.8		5028	protein-coding gene	gene with protein product		605238					Standard	NM_001024074		Approved		uc002tvf.3	P50135	OTTHUMG00000131751	ENST00000280097.3:c.286G>T	2.37:g.138758583G>T	ENSP00000280097:p.Ala96Ser		B2R9J3|Q546Z6|Q7Z7I2|Q8IU56|Q8WW98|Q9BRW6	Missense_Mutation	SNP	pfam_Methyltransf_12,pirsf_Histamine_N-methyltransferase	p.A96S	ENST00000280097.3	37	c.286	CCDS2181.1	2	.	.	.	.	.	.	.	.	.	.	G	5.421	0.262783	0.10294	.	.	ENSG00000150540	ENST00000410115;ENST00000280097	T;T	0.44083	0.93;0.93	5.48	-5.65	0.02459	Methyltransferase type 12 (1);	1.033270	0.07534	N	0.912675	T	0.18923	0.0454	N	0.17474	0.49	0.09310	N	1	B	0.09022	0.002	B	0.17433	0.018	T	0.30179	-0.9987	10	0.09338	T	0.73	-11.5935	4.9486	0.14002	0.5695:0.0819:0.183:0.1656	.	96	P50135	HNMT_HUMAN	S	96	ENSP00000386940:A96S;ENSP00000280097:A96S	ENSP00000280097:A96S	A	+	1	0	HNMT	138475053	0.000000	0.05858	0.004000	0.12327	0.561000	0.35649	-1.050000	0.03510	-1.198000	0.02669	0.655000	0.94253	GCC	HNMT	-	pfam_Methyltransf_12,pirsf_Histamine_N-methyltransferase	ENSG00000150540		0.373	HNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNMT	HGNC	protein_coding	OTTHUMT00000254673.1	-	0.00	41	0	G			138758583	+1	tier1	-	no_errors	ENST00000280097	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.000	T
HYOU1	10525	genome.wustl.edu	37	11	118925720	118925720	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:118925720G>T	ENST00000404233.3	-	6	596	c.472C>A	c.(472-474)Cgt>Agt	p.R158S	HYOU1_ENST00000529972.1_Missense_Mutation_p.R158S|HYOU1_ENST00000543287.1_Missense_Mutation_p.R71S|HYOU1_ENST00000525859.1_Missense_Mutation_p.R158S	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	158					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)	p.R158C(2)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		GCTAGAGAACGAGAATAATTG	0.537																																																	2	Substitution - Missense(2)	large_intestine(2)											117.0	98.0	105.0					11																	118925720		2200	4295	6495	SO:0001583	missense	0			U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.472C>A	11.37:g.118925720G>T	ENSP00000384144:p.Arg158Ser		A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.R158S	ENST00000404233.3	37	c.472	CCDS8408.1	11	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646326	0.87958	.	.	ENSG00000149428	ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000535579;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	T;T;T;T;T	0.01051	5.4;5.4;5.4;5.4;5.4	4.96	4.96	0.65561	.	0.049673	0.85682	D	0.000000	T	0.06917	0.0176	M	0.75615	2.305	0.58432	D	0.999997	D;D;D;D	0.89917	0.999;0.997;1.0;1.0	D;D;D;D	0.78314	0.986;0.951;0.991;0.991	T	0.02313	-1.1178	10	0.87932	D	0	-8.7309	16.5649	0.84576	0.0:0.0:1.0:0.0	.	149;202;158;158	B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.;.;HYOU1_HUMAN;.	S	158;149;158;158;7;158;201;71;158	ENSP00000384144:R158S;ENSP00000437313:R158S;ENSP00000433397:R158S;ENSP00000442727:R71S;ENSP00000431874:R158S	ENSP00000278752:R149S	R	-	1	0	HYOU1	118430930	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	3.777000	0.55364	2.564000	0.86499	0.561000	0.74099	CGT	HYOU1	-	pfam_Hsp_70_fam	ENSG00000149428		0.537	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1		0.00	38	0	G	NM_006389		118925720	-1			no_errors	ENST00000404233	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.996	T
IGFL3	388555	genome.wustl.edu	37	19	46627241	46627241	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:46627241G>T	ENST00000341415.2	-	3	276	c.252C>A	c.(250-252)ccC>ccA	p.P84P	AC007193.6_ENST00000597989.1_lincRNA	NM_207393.1	NP_997276.1	Q6UXB1	IGFL3_HUMAN	IGF-like family member 3	84						extracellular region (GO:0005576)		p.P84P(1)		endometrium(1)|large_intestine(1)|lung(5)	7		Ovarian(192;0.0175)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00473)|GBM - Glioblastoma multiforme(486;0.0149)|Epithelial(262;0.239)		CAAAAGACTCGGGACAGCAGA	0.537																																																	1	Substitution - coding silent(1)	lung(1)											92.0	114.0	107.0					19																	46627241		2186	4300	6486	SO:0001819	synonymous_variant	0			AY358434	CCDS33058.1	19q13.32	2006-07-14				ENSG00000188624			32930	protein-coding gene	gene with protein product		610546				14702039	Standard	NM_207393		Approved	UNQ483	uc002pea.1	Q6UXB1		ENST00000341415.2:c.252C>A	19.37:g.46627241G>T				Silent	SNP	NULL	p.P84	ENST00000341415.2	37	c.252	CCDS33058.1	19																																																																																			IGFL3	-	NULL	ENSG00000188624		0.537	IGFL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFL3	HGNC	protein_coding	OTTHUMT00000421323.1		0.00	26	0	G	NM_207393		46627241	-1			no_errors	ENST00000341415	ensembl	human	known	74_37	silent	6.45	29	2	SNP	0.142	T
IPP	3652	genome.wustl.edu	37	1	46179999	46179999	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:46179999G>T	ENST00000396478.3	-	8	1551	c.1449C>A	c.(1447-1449)ctC>ctA	p.L483L	IPP_ENST00000495072.1_5'Flank	NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	483						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TGCAGTCATTGAGTGCAGCCA	0.428																																																	0													121.0	105.0	110.0					1																	46179999		2203	4300	6503	SO:0001819	synonymous_variant	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.1449C>A	1.37:g.46179999G>T			A2A6V4|D3DQ11|Q8N5C3	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L483	ENST00000396478.3	37	c.1449	CCDS30702.1	1																																																																																			IPP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.428	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3		0.00	54	0	G	NM_005897		46179999	-1			no_errors	ENST00000396478	ensembl	human	known	74_37	silent	6.15	61	4	SNP	1.000	T
ITGA10	8515	genome.wustl.edu	37	1	145527655	145527655	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:145527655T>C	ENST00000369304.3	+	2	270	c.95T>C	c.(94-96)cTa>cCa	p.L32P	ITGA10_ENST00000538811.1_Missense_Mutation_p.Y7H|ITGA10_ENST00000539363.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	32					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CACCCACGCCTATTCCCAGGG	0.527																																																	0													133.0	130.0	131.0					1																	145527655		2203	4300	6503	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.95T>C	1.37:g.145527655T>C	ENSP00000358310:p.Leu32Pro		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L32P	ENST00000369304.3	37	c.95	CCDS918.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.00|14.00	2.403815|2.403815	0.42613|0.42613	.|.	.|.	ENSG00000143127|ENSG00000143127	ENST00000369304|ENST00000543043;ENST00000538811	T|T	0.72835|0.57107	-0.69|0.42	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	0.193193|.	0.34906|.	N|.	0.003591|.	T|T	0.35653|0.35653	0.0939|0.0939	L|L	0.60455|0.60455	1.87|1.87	0.22656|0.22656	N|N	0.998883|0.998883	P;P|B	0.51537|0.31351	0.773;0.946|0.32	P;P|B	0.51777|0.34138	0.594;0.679|0.176	T|T	0.39702|0.39702	-0.9601|-0.9601	10|9	0.62326|0.87932	D|D	0.03|0	.|.	11.0549|11.0549	0.47911|0.47911	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	32;32|7	O75578;O75578-2|F5GY13	ITA10_HUMAN;.|.	P|H	32|7	ENSP00000358310:L32P|ENSP00000440011:Y7H	ENSP00000358310:L32P|ENSP00000440011:Y7H	L|Y	+|+	2|1	0|0	ITGA10|ITGA10	144239012|144239012	0.999000|0.999000	0.42202|0.42202	0.871000|0.871000	0.34182|0.34182	0.917000|0.917000	0.54804|0.54804	5.444000|5.444000	0.66587|0.66587	2.110000|2.110000	0.64415|0.64415	0.533000|0.533000	0.62120|0.62120	CTA|TAT	ITGA10	-	NULL	ENSG00000143127		0.527	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	-	0.00	43	0	T	NM_003637		145527655	+1	tier1	-	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	6.67	70	5	SNP	0.879	C
ITPR3	3710	genome.wustl.edu	37	6	33662731	33662731	+	Silent	SNP	C	C	A	rs376639833		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:33662731C>A	ENST00000374316.5	+	58	8876	c.7816C>A	c.(7816-7818)Cgg>Agg	p.R2606R	ITPR3_ENST00000605930.1_Silent_p.R2606R			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2606					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCCCCGGATGCGGGCCATGTC	0.547																																																	0													66.0	60.0	62.0					6																	33662731		2203	4300	6503	SO:0001819	synonymous_variant	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.7816C>A	6.37:g.33662731C>A			Q14649|Q5TAQ2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.R2606	ENST00000374316.5	37	c.7816	CCDS4783.1	6																																																																																			ITPR3	-	NULL	ENSG00000096433		0.547	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	-	0.00	28	0	C	NM_002224		33662731	+1	tier1	-	no_errors	ENST00000374316	ensembl	human	known	74_37	silent	9.52	38	4	SNP	1.000	A
JMJD1C	221037	genome.wustl.edu	37	10	64946091	64946091	+	Missense_Mutation	SNP	G	G	T	rs201993291		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:64946091G>T	ENST00000399262.2	-	19	6841	c.6623C>A	c.(6622-6624)gCg>gAg	p.A2208E	JMJD1C_ENST00000402544.1_Missense_Mutation_p.A1971E|JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000542921.1_Missense_Mutation_p.A2026E	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2208					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					AATTGATTCCGCCTTCCATAG	0.358																																																	0													103.0	95.0	98.0					10																	64946091		1844	4092	5936	SO:0001583	missense	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.6623C>A	10.37:g.64946091G>T	ENSP00000382204:p.Ala2208Glu		A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.A2208E	ENST00000399262.2	37	c.6623	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288315	0.80803	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	T;T;T	0.71103	-0.54;-0.54;-0.54	5.54	5.54	0.83059	.	0.114155	0.64402	D	0.000014	T	0.75729	0.3889	M	0.76727	2.345	0.80722	D	1	P;D;B	0.54772	0.854;0.968;0.164	P;P;B	0.49140	0.478;0.601;0.166	T	0.79327	-0.1849	10	0.87932	D	0	-9.6587	12.767	0.57396	0.076:0.0:0.924:0.0	.	2026;2208;2026	B7ZLC8;Q15652;A0T124	.;JHD2C_HUMAN;.	E	2208;1971;2026	ENSP00000382204:A2208E;ENSP00000384990:A1971E;ENSP00000444682:A2026E	ENSP00000382204:A2208E	A	-	2	0	JMJD1C	64616097	1.000000	0.71417	0.965000	0.40720	0.949000	0.60115	7.604000	0.82830	2.763000	0.94921	0.557000	0.71058	GCG	JMJD1C	-	NULL	ENSG00000171988		0.358	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2		0.00	31	0	G	NM_004241		64946091	-1			no_errors	ENST00000399262	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.998	T
PLA2G4B	100137049	genome.wustl.edu	37	15	42133048	42133048	+	Missense_Mutation	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:42133048C>T	ENST00000452633.1	+	5	648	c.296C>T	c.(295-297)gCg>gTg	p.A99V	PLA2G4B_ENST00000458483.1_Missense_Mutation_p.A99V|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.A330V|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.A330V|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.A330V			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	99					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		CTGTTTGATGCGGGGACTCTG	0.582																																																	0													98.0	87.0	91.0					15																	42133048		2203	4300	6503	SO:0001583	missense	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.296C>T	15.37:g.42133048C>T	ENSP00000396045:p.Ala99Val		B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.A330V	ENST00000452633.1	37	c.989	CCDS45241.1	15	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.395806	0.01175	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.08370	3.1;3.1;3.1;3.1	5.04	-1.63	0.08345	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.902315	0.09383	N	0.809594	T	0.01421	0.0046	N	0.00104	-2.125	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.45818	-0.9235	10	0.02654	T	1	-3.8655	9.7902	0.40702	0.0:0.3747:0.0:0.6253	.	99;330;330	P0C869;P0C869-7;P0C869-6	PA24B_HUMAN;.;.	V	330;330;99;99	ENSP00000371886:A330V;ENSP00000342785:A330V;ENSP00000416610:A99V;ENSP00000396045:A99V	ENSP00000342785:A330V	A	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39920340	0.005000	0.15991	0.036000	0.18154	0.038000	0.13279	0.008000	0.13197	-0.308000	0.08792	-1.202000	0.01658	GCG	JMJD7-PLA2G4B	-	superfamily_C2_dom,smart_C2_dom	ENSG00000168970		0.582	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1		0.00	24	0	C	NM_001114633		42133048	+1			no_errors	ENST00000382448	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.403	T
KCNG3	170850	genome.wustl.edu	37	2	42671718	42671718	+	Splice_Site	SNP	T	T	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:42671718T>G	ENST00000306078.1	-	2	1262	c.667A>C	c.(667-669)Ata>Cta	p.I223L	KCNG3_ENST00000394973.4_Splice_Site_p.I212L	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	223					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						GCTTCAATTATCCTGTCAAGA	0.363																																																	0													77.0	75.0	75.0					2																	42671718		2203	4300	6503	SO:0001630	splice_region_variant	0			AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.666-1A>C	2.37:g.42671718T>G			Q53SC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.I223L	ENST00000306078.1	37	c.667	CCDS1809.1	2	.	.	.	.	.	.	.	.	.	.	T	15.01	2.707152	0.48412	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	D;D	0.98701	-5.08;-5.08	5.16	4.0	0.46444	Ion transport (1);	0.212522	0.39759	N	0.001271	D	0.98385	0.9463	M	0.62266	1.93	0.42650	D	0.993443	B;P	0.51147	0.031;0.942	B;D	0.64595	0.038;0.927	D	0.97114	0.9806	10	0.25106	T	0.35	.	9.6684	0.39998	0.0:0.0868:0.0:0.9132	.	223;212	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	L	223;212	ENSP00000304127:I223L;ENSP00000378424:I212L	ENSP00000304127:I223L	I	-	1	0	KCNG3	42525222	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.052000	0.57420	0.800000	0.34041	0.460000	0.39030	ATA	KCNG3	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000171126		0.363	KCNG3-001	KNOWN	basic|CCDS	protein_coding	KCNG3	HGNC	protein_coding	OTTHUMT00000250464.2		0.00	48	0	T	NM_172344	Missense_Mutation	42671718	-1			no_errors	ENST00000306078	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	G
KIAA2018	205717	genome.wustl.edu	37	3	113378995	113378995	+	Missense_Mutation	SNP	G	G	T	rs377114570		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:113378995G>T	ENST00000478658.1	-	5	1551	c.1534C>A	c.(1534-1536)Cag>Aag	p.Q512K	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.Q512K			Q68DE3	K2018_HUMAN	KIAA2018	512						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ACTTGTGGCTGGGCAATTAGT	0.443																																																	0													72.0	73.0	73.0					3																	113378995		1938	4156	6094	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.1534C>A	3.37:g.113378995G>T	ENSP00000420721:p.Gln512Lys		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.Q512K	ENST00000478658.1	37	c.1534	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941984	0.34283	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.16597	2.33;2.33	5.2	5.2	0.72013	.	0.224327	0.37809	N	0.001923	T	0.13543	0.0328	L	0.34521	1.04	0.52099	D	0.999944	B	0.06786	0.001	B	0.08055	0.003	T	0.09122	-1.0689	10	0.15066	T	0.55	-1.3347	14.4641	0.67472	0.0:0.0:0.8523:0.1477	.	512	Q68DE3	K2018_HUMAN	K	512	ENSP00000320794:Q512K;ENSP00000420721:Q512K	ENSP00000320794:Q512K	Q	-	1	0	KIAA2018	114861685	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	5.697000	0.68295	2.415000	0.81967	0.557000	0.71058	CAG	KIAA2018	-	NULL	ENSG00000176542		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	-	0.00	53	0	G	NM_001009899		113378995	-1	tier1	-	no_errors	ENST00000316407	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
KIF20B	9585	genome.wustl.edu	37	10	91498738	91498738	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:91498738G>T	ENST00000371728.3	+	21	3865	c.3800G>T	c.(3799-3801)aGc>aTc	p.S1267I	KIF20B_ENST00000416354.1_Missense_Mutation_p.S1297I|KIF20B_ENST00000260753.4_Missense_Mutation_p.S1227I|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Missense_Mutation_p.S1267I	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1267					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						CTCTCTGCAAGCTCTGCTCGT	0.388																																																	0													94.0	95.0	95.0					10																	91498738		2202	4300	6502	SO:0001583	missense	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3800G>T	10.37:g.91498738G>T	ENSP00000360793:p.Ser1267Ile		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1297I	ENST00000371728.3	37	c.3890		10	.	.	.	.	.	.	.	.	.	.	G	9.945	1.218529	0.22373	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.70631	-0.44;-0.44;-0.5;-0.43	5.07	0.998	0.19857	.	0.404702	0.23973	N	0.042748	T	0.70894	0.3276	L	0.59436	1.845	0.30163	N	0.802007	P;P	0.48589	0.771;0.912	B;P	0.50934	0.305;0.654	T	0.69555	-0.5114	10	0.52906	T	0.07	-2.5869	10.0963	0.42478	0.2972:0.0:0.7028:0.0	.	1267;1227	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	I	1227;1297;1267;1267	ENSP00000260753:S1227I;ENSP00000411545:S1297I;ENSP00000377830:S1267I;ENSP00000360793:S1267I	ENSP00000260753:S1227I	S	+	2	0	KIF20B	91488718	0.950000	0.32346	0.835000	0.33067	0.190000	0.23558	1.618000	0.36954	0.241000	0.21283	-0.363000	0.07495	AGC	KIF20B	-	NULL	ENSG00000138182		0.388	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	-	0.00	59	0	G	NM_016195		91498738	+1	tier1	-	no_errors	ENST00000416354	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.986	T
KIF25	3834	genome.wustl.edu	37	6	168439399	168439399	+	Silent	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:168439399C>T	ENST00000443060.2	+	6	875	c.484C>T	c.(484-486)Ctg>Ttg	p.L162L	KIF25_ENST00000351261.3_Silent_p.L162L|KIF25_ENST00000354419.2_Silent_p.L162L			Q9UIL4	KIF25_HUMAN	kinesin family member 25	162	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of autophagy (GO:0010507)|organelle organization (GO:0006996)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	29		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGTTGCGCTGCTGGCCTCTGA	0.592																																																	0													96.0	86.0	89.0					6																	168439399		2203	4300	6503	SO:0001819	synonymous_variant	0			AB012722	CCDS5305.1, CCDS43530.1	6q27	2008-02-05	2003-01-09	2003-01-10	ENSG00000125337	ENSG00000125337		"""Kinesins"""	6390	protein-coding gene	gene with protein product		603815	"""kinesin-like 3"""	KNSL3		9925910	Standard	NM_030615		Approved		uc003qwk.1	Q9UIL4	OTTHUMG00000016035	ENST00000443060.2:c.484C>T	6.37:g.168439399C>T			O94775|Q5SZU9	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L162	ENST00000443060.2	37	c.484	CCDS5305.1	6																																																																																			KIF25	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000125337		0.592	KIF25-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KIF25	HGNC	protein_coding	OTTHUMT00000362509.1		0.00	49	0	C			168439399	+1			no_errors	ENST00000354419	ensembl	human	known	74_37	silent	6.67	56	4	SNP	0.503	T
KMT2D	8085	genome.wustl.edu	37	12	49427264	49427264	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr12:49427264G>A	ENST00000301067.7	-	39	11223	c.11224C>T	c.(11224-11226)Cag>Tag	p.Q3742*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3742	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										tgctgctgctgttgctgctgc	0.587																																																	0													15.0	18.0	17.0					12																	49427264		2196	4294	6490	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11224C>T	12.37:g.49427264G>A	ENSP00000301067:p.Gln3742*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3742*	ENST00000301067.7	37	c.11224	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	50	16.224109	0.99857	.	.	ENSG00000167548	ENST00000301067	.	.	.	5.11	5.11	0.69529	.	0.000000	0.33180	N	0.005189	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6784	0.88236	0.0:0.0:1.0:0.0	.	.	.	.	X	3742	.	ENSP00000301067:Q3742X	Q	-	1	0	MLL2	47713531	0.916000	0.31088	0.998000	0.56505	0.192000	0.23643	3.000000	0.49481	2.547000	0.85894	0.462000	0.41574	CAG	KMT2D	-	NULL	ENSG00000167548		0.587	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	50	0	G			49427264	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense	16.67	45	9	SNP	0.998	A
KRIT1	889	genome.wustl.edu	37	7	91865794	91865794	+	Nonsense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:91865794G>A	ENST00000340022.2	-	7	1436	c.418C>T	c.(418-420)Cga>Tga	p.R140*	KRIT1_ENST00000412043.2_Nonsense_Mutation_p.R140*|KRIT1_ENST00000394507.1_Nonsense_Mutation_p.R140*|KRIT1_ENST00000394503.2_Nonsense_Mutation_p.R140*|KRIT1_ENST00000394505.2_Nonsense_Mutation_p.R140*	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	140	N-terminal domain similar to Nudix hydrolase domain.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)	p.R140*(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CTACAGACTCGCATAATATCT	0.318																																																	1	Substitution - Nonsense(1)	large_intestine(1)											99.0	104.0	102.0					7																	91865794		2203	4299	6502	SO:0001587	stop_gained	0			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.418C>T	7.37:g.91865794G>A	ENSP00000344668:p.Arg140*		A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Nonsense_Mutation	SNP	pfam_FERM_central,superfamily_Ankyrin_rpt-contain_dom,superfamily_FERM_central,smart_Ankyrin_rpt,smart_Band_41_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_FERM_domain	p.R140*	ENST00000340022.2	37	c.418	CCDS5624.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.271354	0.98179	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227;ENST00000458177;ENST00000433016;ENST00000454017	.	.	.	5.17	0.483	0.16820	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.7004	15.7344	0.77831	0.0:0.0:0.2068:0.7932	.	.	.	.	X	140	.	ENSP00000344668:R140X	R	-	1	2	KRIT1	91703730	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	1.282000	0.33226	0.065000	0.16485	-0.238000	0.12139	CGA	KRIT1	-	NULL	ENSG00000001631		0.318	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRIT1	HGNC	protein_coding	OTTHUMT00000253910.1		0.00	86	0	G			91865794	-1			no_errors	ENST00000340022	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	A
L3MBTL1	26013	genome.wustl.edu	37	20	42144758	42144758	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:42144758C>A	ENST00000427442.2	+	7	896	c.737C>A	c.(736-738)cCa>cAa	p.P246Q	L3MBTL1_ENST00000457824.1_3'UTR|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.P178Q|L3MBTL1_ENST00000444063.1_Missense_Mutation_p.P178Q|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.P246Q|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.P178Q			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	178					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						GGAAAGGACCCAGAGGGACAA	0.547																																																	0													79.0	69.0	72.0					20																	42144758		2203	4300	6503	SO:0001583	missense	0			U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.737C>A	20.37:g.42144758C>A	ENSP00000402107:p.Pro246Gln		B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	pfam_Mbt,pfam_Znf_C2HC,superfamily_SAM/pointed,smart_Mbt,pfscan_Mbt	p.P246Q	ENST00000427442.2	37	c.737	CCDS46602.2	20	.	.	.	.	.	.	.	.	.	.	C	11.49	1.652931	0.29336	.	.	ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134	T;T;T;T;T	0.17370	2.29;2.29;2.28;2.28;2.28	5.38	4.23	0.50019	.	0.474638	0.20143	N	0.098322	T	0.14313	0.0346	L	0.47716	1.5	0.09310	N	1	P;B;P;P	0.42203	0.744;0.229;0.773;0.589	B;B;B;B	0.38616	0.243;0.064;0.277;0.142	T	0.13872	-1.0493	10	0.13108	T	0.6	.	11.9262	0.52820	0.0:0.9021:0.0:0.0979	.	246;178;178;178	Q9Y468-5;Q9Y468;Q9Y468-2;Q9Y468-1	.;LMBL1_HUMAN;.;.	Q	246;246;178;178;178	ENSP00000402107:P246Q;ENSP00000398516:P246Q;ENSP00000362227:P178Q;ENSP00000403316:P178Q;ENSP00000362226:P178Q	ENSP00000362226:P178Q	P	+	2	0	L3MBTL1	41578172	0.828000	0.29307	0.995000	0.50966	0.645000	0.38454	0.971000	0.29396	2.530000	0.85305	0.655000	0.94253	CCA	L3MBTL1	-	NULL	ENSG00000185513		0.547	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL1	HGNC	protein_coding	OTTHUMT00000079300.3	-	0.00	39	0	C	NM_032107		42144758	+1	tier1	-	no_errors	ENST00000418998	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.348	A
FAM91A3P	729182	genome.wustl.edu	37	1	149262995	149262995	+	lincRNA	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:149262995C>A	ENST00000325963.8	+	0	2542																											TTGAATGATGCTTTAACACAT	0.398																																																	0																																												0																															1.37:g.149262995C>A				RNA	SNP	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			RP11-403I13.4	-	-	ENSG00000223779		0.398	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC100293748	Clone_based_vega_gene	lincRNA	OTTHUMT00000099551.1	-	0.00	117	0	C			149262995	+1	tier1	-	no_errors	ENST00000325963	ensembl	human	known	74_37	rna	11.76	75	10	SNP	1.000	A
FAR2P1	440905	genome.wustl.edu	37	2	130807905	130807905	+	RNA	SNP	G	G	T	rs201541587	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:130807905G>T	ENST00000325390.3	-	0	799					NR_026758.1																						ATGGAAGAGTGCTCAGTGAGA	0.562													.|||	2719	0.542931	0.4523	0.6671	5008	,	,		21515	0.5208		0.5845	False		,,,				2504	0.5573																0																																												0																															2.37:g.130807905G>T				RNA	SNP	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			AC018865.8	-	-	ENSG00000180178		0.562	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	Clone_based_vega_gene	pseudogene	OTTHUMT00000331630.3	-	0.00	26	0	G			130807905	-1	tier1	rs201541587	no_errors	ENST00000325390	ensembl	human	known	74_37	rna	16.13	26	5	SNP	0.233	T
LRRK2	120892	genome.wustl.edu	37	12	40645141	40645141	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr12:40645141G>T	ENST00000298910.7	+	9	1124	c.1066G>T	c.(1066-1068)Gca>Tca	p.A356S	LRRK2_ENST00000343742.2_Missense_Mutation_p.A356S	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	356					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTGTTACAAAGCATTAACGTG	0.333											OREG0003829	type=REGULATORY REGION|Gene=LRRK2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													72.0	78.0	76.0					12																	40645141		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1066G>T	12.37:g.40645141G>T	ENSP00000298910:p.Ala356Ser	895	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.A356S	ENST00000298910.7	37	c.1066	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686123	0.47991	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.35236	1.32;1.32	5.51	5.51	0.81932	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.47655	0.1457	L	0.31926	0.97	0.40767	D	0.983055	D	0.71674	0.998	D	0.63488	0.915	T	0.42189	-0.9466	10	0.48119	T	0.1	.	16.3317	0.83023	0.0:0.0:1.0:0.0	.	356	Q5S007	LRRK2_HUMAN	S	356	ENSP00000341930:A356S;ENSP00000298910:A356S	ENSP00000298910:A356S	A	+	1	0	LRRK2	38931408	1.000000	0.71417	0.836000	0.33094	0.614000	0.37383	6.607000	0.74163	2.599000	0.87857	0.655000	0.94253	GCA	LRRK2	-	superfamily_ARM-type_fold	ENSG00000188906		0.333	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	106	0	G	XM_058513		40645141	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.988	T
MAGEL2	54551	genome.wustl.edu	37	15	23890704	23890704	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:23890704C>A	ENST00000532292.1	-	1	471	c.377G>T	c.(376-378)aGg>aTg	p.R126M		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	9					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		AGAGGAGCCCCTGCGGTCTAT	0.587																																																	0													24.0	25.0	25.0					15																	23890704		1881	4109	5990	SO:0001583	missense	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.377G>T	15.37:g.23890704C>A	ENSP00000433433:p.Arg126Met			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R126M	ENST00000532292.1	37	c.377		15	.	.	.	.	.	.	.	.	.	.	c	14.74	2.626299	0.46840	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.07	3.15	0.36227	.	.	.	.	.	T	0.16685	0.0401	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.17776	-1.0358	5	.	.	.	.	5.0188	0.14350	0.2074:0.6864:0.0:0.1061	.	.	.	.	W	158	.	.	G	-	1	0	MAGEL2	21441797	0.000000	0.05858	0.017000	0.16124	0.004000	0.04260	0.360000	0.20250	1.288000	0.44600	0.651000	0.88453	GGG	MAGEL2	-	NULL	ENSG00000254585		0.587	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	47	0	C	NM_019066		23890704	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.021	A
LYSMD4	145748	genome.wustl.edu	37	15	100272100	100272100	+	Silent	SNP	C	C	T	rs370472215		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:100272100C>T	ENST00000409796.1	-	2	167	c.105G>A	c.(103-105)tcG>tcA	p.S35S	LYSMD4_ENST00000604213.1_Intron|LYSMD4_ENST00000545021.1_5'UTR|LYSMD4_ENST00000332728.4_Silent_p.S35S|LYSMD4_ENST00000344791.2_Missense_Mutation_p.R6Q	NM_001284417.1|NM_001284418.1|NM_001284420.1	NP_001271346.1|NP_001271347.1|NP_001271349.1	Q5XG99	LYSM4_HUMAN	LysM, putative peptidoglycan-binding, domain containing 4	35						integral component of membrane (GO:0016021)				breast(1)|cervix(1)|kidney(2)|large_intestine(2)|lung(3)|stomach(1)	10	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00162)|LUSC - Lung squamous cell carcinoma(107;0.17)|Lung(145;0.208)			AAGAGTCCCCCGAGTCCCCAC	0.597																																																	0								C	GLN/ARG	0,4406		0,0,2203	24.0	26.0	25.0		17	-9.8	0.1	15		25	1,8599		0,1,4299	no	missense	LYSMD4	NM_152449.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	6/298	100272100	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC041097	CCDS10381.1, CCDS66876.1, CCDS66877.1, CCDS73788.1	15q26.3	2005-10-24			ENSG00000183060	ENSG00000183060			26571	protein-coding gene	gene with protein product						12477932	Standard	NM_001284418		Approved	FLJ33008	uc002bvl.3	Q5XG99	OTTHUMG00000149853	ENST00000409796.1:c.105G>A	15.37:g.100272100C>T			A6NII6|A8K2N1|Q96LY7	Missense_Mutation	SNP	NULL	p.R6Q	ENST00000409796.1	37	c.17		15	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071277	0.76301	0.0	1.16E-4	ENSG00000183060	ENST00000344791;ENST00000450512	T	0.35048	1.33	4.92	-9.84	0.00479	.	2.923490	0.01690	N	0.026622	T	0.14227	0.0344	N	0.08118	0	0.37458	D	0.915106	B	0.20261	0.043	B	0.14578	0.011	T	0.22347	-1.0219	10	0.87932	D	0	-5.7169	0.0925	0.00041	0.3169:0.2026:0.2203:0.2602	.	6	Q5XG99-2	.	Q	6	ENSP00000342840:R6Q	ENSP00000342840:R6Q	R	-	2	0	LYSMD4	98089623	0.000000	0.05858	0.051000	0.19133	0.881000	0.50899	-7.229000	0.00041	-2.979000	0.00283	-0.176000	0.13171	CGG	LYSMD4	-	NULL	ENSG00000183060		0.597	LYSMD4-005	KNOWN	basic|appris_principal	protein_coding	LYSMD4	HGNC	protein_coding	OTTHUMT00000335634.1	-	0.00	81	0	C	NM_152449		100272100	-1	tier1	-	no_errors	ENST00000344791	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.017	T
MAMDC2	256691	genome.wustl.edu	37	9	72840711	72840711	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:72840711G>T	ENST00000377182.4	+	13	2574	c.1957G>T	c.(1957-1959)Gcc>Tcc	p.A653S	SMC5-AS1_ENST00000594708.1_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	653	MAM 4. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)	p.A653T(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						AAGTGATATTGCCATTGATGA	0.338																																																	1	Substitution - Missense(1)	central_nervous_system(1)											81.0	82.0	82.0					9																	72840711		2202	4299	6501	SO:0001583	missense	0			BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.1957G>T	9.37:g.72840711G>T	ENSP00000366387:p.Ala653Ser		Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	p.A653S	ENST00000377182.4	37	c.1957	CCDS6631.1	9	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612595	0.66672	.	.	ENSG00000165072	ENST00000377182	T	0.03212	4.01	6.08	5.18	0.71444	Concanavalin A-like lectin/glucanase (1);MAM domain (4);	0.046059	0.85682	D	0.000000	T	0.22360	0.0539	M	0.87827	2.91	0.58432	D	0.99999	D	0.89917	1.0	D	0.75020	0.985	T	0.03576	-1.1023	10	0.56958	D	0.05	-17.1594	16.9481	0.86235	0.0:0.0:0.8711:0.1289	.	653	Q7Z304	MAMC2_HUMAN	S	653	ENSP00000366387:A653S	ENSP00000366387:A653S	A	+	1	0	MAMDC2	72030531	1.000000	0.71417	0.999000	0.59377	0.624000	0.37722	6.133000	0.71682	1.583000	0.49898	-0.152000	0.13540	GCC	MAMDC2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom	ENSG00000165072		0.338	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC2	HGNC	protein_coding	OTTHUMT00000052600.1		0.00	72	0	G	NM_153267		72840711	+1			no_errors	ENST00000377182	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
MAP1B	4131	genome.wustl.edu	37	5	71490959	71490959	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:71490959C>A	ENST00000296755.7	+	5	2075	c.1777C>A	c.(1777-1779)Cca>Aca	p.P593T		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	593	Lys-rich (highly basic, contains many KKEE and KKEI/V repeats).				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AAAAGACAAGCCAATAAAAAC	0.453																																					Melanoma(17;367 822 11631 31730 47712)												0													56.0	59.0	58.0					5																	71490959		2203	4300	6503	SO:0001583	missense	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.1777C>A	5.37:g.71490959C>A	ENSP00000296755:p.Pro593Thr		A2BDK5	Missense_Mutation	SNP	pfam_MAP1B_neuraxin	p.P593T	ENST00000296755.7	37	c.1777	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	12.58	1.979346	0.34942	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.03607	3.87;3.87;3.87	5.81	5.81	0.92471	.	0.186146	0.38720	N	0.001597	T	0.04363	0.0120	L	0.40543	1.245	0.32864	D	0.508323	B;B	0.29716	0.255;0.255	B;B	0.27262	0.078;0.078	T	0.10109	-1.0644	10	0.46703	T	0.11	-10.8736	11.4249	0.50004	0.1383:0.7281:0.1336:0.0	.	467;593	A2BDK6;P46821	.;MAP1B_HUMAN	T	593;610;467	ENSP00000296755:P593T;ENSP00000423444:P610T;ENSP00000423416:P467T	ENSP00000296755:P593T	P	+	1	0	MAP1B	71526715	0.998000	0.40836	0.999000	0.59377	0.980000	0.70556	1.847000	0.39299	2.746000	0.94184	0.655000	0.94253	CCA	MAP1B	-	NULL	ENSG00000131711		0.453	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	-	0.00	66	0	C	NM_005909		71490959	+1	tier1	-	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
MAP3K13	9175	genome.wustl.edu	37	3	185165697	185165697	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:185165697G>T	ENST00000265026.3	+	5	1306	c.972G>T	c.(970-972)gtG>gtT	p.V324V	MAP3K13_ENST00000446828.1_Silent_p.V117V|MAP3K13_ENST00000424227.1_Silent_p.V324V|MAP3K13_ENST00000443863.1_Silent_p.V180V|MAP3K13_ENST00000535426.1_Silent_p.V180V	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CGCCAGAGGTGATACGGAATG	0.453																																																	0													70.0	66.0	68.0					3																	185165697		2203	4300	6503	SO:0001819	synonymous_variant	0			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.972G>T	3.37:g.185165697G>T				Silent	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V324	ENST00000265026.3	37	c.972	CCDS3270.1	3																																																																																			MAP3K13	-	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000073803		0.453	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1		0.00	51	0	G	NM_004721		185165697	+1			no_errors	ENST00000265026	ensembl	human	known	74_37	silent	5.13	37	2	SNP	1.000	T
MARCH6	10299	genome.wustl.edu	37	5	10410323	10410323	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:10410323G>T	ENST00000274140.5	+	18	1758	c.1626G>T	c.(1624-1626)caG>caT	p.Q542H	MARCH6_ENST00000510792.1_Missense_Mutation_p.Q240H|MARCH6_ENST00000449913.2_Missense_Mutation_p.Q494H|MARCH6_ENST00000503788.1_Missense_Mutation_p.Q437H	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	542					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TACTCGAACAGGGACACACGA	0.542																																																	0													140.0	122.0	128.0					5																	10410323		2203	4300	6503	SO:0001583	missense	0			AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1626G>T	5.37:g.10410323G>T	ENSP00000274140:p.Gln542His		A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.Q542H	ENST00000274140.5	37	c.1626	CCDS34135.1	5	.	.	.	.	.	.	.	.	.	.	G	14.78	2.636646	0.47049	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.35789	1.29;1.29;1.29;1.29	5.7	1.42	0.22433	.	0.000000	0.85682	D	0.000000	T	0.46580	0.1400	L	0.58428	1.81	0.80722	D	1	D;D;D;D	0.89917	0.965;1.0;0.999;1.0	P;D;D;D	0.91635	0.69;0.999;0.997;0.99	T	0.43766	-0.9371	10	0.12766	T	0.61	-20.3005	8.0412	0.30523	0.5224:0.0:0.4776:0.0	.	437;494;122;542	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	H	494;437;542;240	ENSP00000414643:Q494H;ENSP00000425930:Q437H;ENSP00000274140:Q542H;ENSP00000424512:Q240H	ENSP00000274140:Q542H	Q	+	3	2	MARCH6	10463323	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	1.339000	0.33885	0.349000	0.23975	-0.140000	0.14226	CAG	MARCH6	-	NULL	ENSG00000145495		0.542	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH6	HGNC	protein_coding	OTTHUMT00000366919.2	-	0.00	38	0	G	NM_005885		10410323	+1	tier1	-	no_errors	ENST00000274140	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47613427	47613427	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr14:47613427C>A	ENST00000399232.2	-	4	803	c.439G>T	c.(439-441)Gaa>Taa	p.E147*	MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000439988.3_Nonsense_Mutation_p.E216*|MDGA2_ENST00000426342.1_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	147	Ig-like 2.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TAAAATTGTTCTTTAGCTTCA	0.408																																																	0													145.0	130.0	134.0					14																	47613427		692	1591	2283	SO:0001587	stop_gained	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.439G>T	14.37:g.47613427C>A	ENSP00000382178:p.Glu147*		F6W3S7|J3KPX6	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.E216*	ENST00000399232.2	37	c.646		14	.	.	.	.	.	.	.	.	.	.	C	37	6.023335	0.97211	.	.	ENSG00000139915	ENST00000439988;ENST00000399232	.	.	.	5.52	5.52	0.82312	.	0.000000	0.52532	U	0.000071	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	.	18.0133	0.89231	0.0:1.0:0.0:0.0	.	.	.	.	X	147;216	.	ENSP00000382178:E216X	E	-	1	0	MDGA2	46683177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.412000	0.80091	2.608000	0.88229	0.585000	0.79938	GAA	MDGA2	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000272781		0.408	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	87	0	C	NM_182830		47613427	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	nonsense	23.08	10	3	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90422466	90422466	+	Silent	SNP	G	G	T	rs187636155	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:90422466G>T	ENST00000369393.3	-	48	7373	c.7258C>A	c.(7258-7260)Cga>Aga	p.R2420R	MDN1_ENST00000428876.1_Silent_p.R2420R			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2420					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)	p.R2420*(1)		NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCATGTGCTCGCAAAGAAGAA	0.453													G|||	3	0.000599042	0.0008	0.0	5008	,	,		18669	0.002		0.0	False		,,,				2504	0.0																1	Substitution - Nonsense(1)	large_intestine(1)						G		2,4404	4.2+/-10.8	0,2,2201	67.0	64.0	65.0		7258	-1.6	0.0	6		65	0,8600		0,0,4300	no	coding-synonymous	MDN1	NM_014611.1		0,2,6501	TT,TG,GG		0.0,0.0454,0.0154		2420/5597	90422466	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.7258C>A	6.37:g.90422466G>T			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R2420	ENST00000369393.3	37	c.7258	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.453	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2		0.00	27	0	G			90422466	-1			no_errors	ENST00000369393	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.065	T
MEIS3	56917	genome.wustl.edu	37	19	47920526	47920526	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:47920526G>T	ENST00000558555.1	-	2	281	c.94C>A	c.(94-96)Cca>Aca	p.P32T	MEIS3_ENST00000441740.2_Missense_Mutation_p.P32T|MEIS3_ENST00000331559.5_Missense_Mutation_p.P32T|MEIS3_ENST00000561293.1_Missense_Mutation_p.P32T|MEIS3_ENST00000561096.1_Missense_Mutation_p.P120T|MEIS3_ENST00000559524.1_Missense_Mutation_p.P32T			Q99687	MEIS3_HUMAN	Meis homeobox 3	32					negative regulation of apoptotic signaling pathway (GO:2001234)|positive regulation of protein kinase B signaling (GO:0051897)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(5)|lung(11)|prostate(1)|skin(2)	20		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000198)|OV - Ovarian serous cystadenocarcinoma(262;0.000439)|Epithelial(262;0.0113)|GBM - Glioblastoma multiforme(486;0.0223)		TAGGGCCCTGGTACTGCGGGC	0.652																																																	0													42.0	51.0	48.0					19																	47920526		2202	4300	6502	SO:0001583	missense	0			BC025404	CCDS33064.1, CCDS46132.1, CCDS74406.1	19q13.32	2012-10-02	2007-02-15		ENSG00000105419	ENSG00000105419		"""Homeoboxes / TALE class"""	29537	protein-coding gene	gene with protein product			"""Meis1, myeloid ecotropic viral integration site 1 homolog 3 (mouse)"""			8950991	Standard	NM_020160		Approved	MRG2, DKFZp547H236	uc002pgt.4	Q99687	OTTHUMG00000172280	ENST00000558555.1:c.94C>A	19.37:g.47920526G>T	ENSP00000454073:p.Pro32Thr		A8K1N5|Q6NT73|Q8TC66|Q9NPW2	Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P32T	ENST00000558555.1	37	c.94		19	.	.	.	.	.	.	.	.	.	.	G	10.36	1.328016	0.24080	.	.	ENSG00000105419	ENST00000331559;ENST00000441740	T;T	0.36520	1.25;1.25	2.95	0.611	0.17586	.	0.111985	0.32970	N	0.005425	T	0.51398	0.1672	M	0.70275	2.135	0.24069	N	0.995981	B;P;D	0.89917	0.0;0.764;1.0	B;B;D	0.87578	0.002;0.306;0.998	T	0.32824	-0.9892	10	0.54805	T	0.06	-6.3849	7.0027	0.24820	0.0:0.1903:0.614:0.1957	.	32;32;32	Q99687;Q99687-3;Q99687-2	MEIS3_HUMAN;.;.	T	32	ENSP00000333552:P32T;ENSP00000388667:P32T	ENSP00000333552:P32T	P	-	1	0	MEIS3	52612338	0.361000	0.24972	0.181000	0.23098	0.024000	0.10985	1.072000	0.30678	0.257000	0.21650	-0.314000	0.08810	CCA	MEIS3	-	NULL	ENSG00000105419		0.652	MEIS3-005	NOVEL	basic|appris_candidate_longest	protein_coding	MEIS3	HGNC	protein_coding	OTTHUMT00000417642.1	-	0.00	74	0	G	XM_085929		47920526	-1	tier1	-	no_errors	ENST00000559524	ensembl	human	known	74_37	missense	5.83	97	6	SNP	0.641	T
MFN2	9927	genome.wustl.edu	37	1	12061834	12061834	+	Missense_Mutation	SNP	C	C	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:12061834C>G	ENST00000235329.5	+	10	1301	c.979C>G	c.(979-981)Ctc>Gtc	p.L327V	MFN2_ENST00000444836.1_Missense_Mutation_p.L327V	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	327	Dynamin-type G.				apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		AGGGGGCGCTCTCGCAGAAGG	0.483											OREG0013107	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													218.0	230.0	226.0					1																	12061834		2203	4300	6503	SO:0001583	missense	0			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.979C>G	1.37:g.12061834C>G	ENSP00000235329:p.Leu327Val	677	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.L327V	ENST00000235329.5	37	c.979	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302572	0.60195	.	.	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.98120	-4.73;-4.73	5.34	4.41	0.53225	.	0.000000	0.64402	D	0.000001	D	0.96491	0.8855	L	0.55103	1.725	0.58432	D	0.999997	P	0.51933	0.949	P	0.52189	0.692	D	0.94034	0.7303	10	0.32370	T	0.25	-17.096	7.3927	0.26919	0.0:0.7753:0.0:0.2247	.	327	O95140	MFN2_HUMAN	V	327;327;25	ENSP00000416338:L327V;ENSP00000235329:L327V	ENSP00000235329:L327V	L	+	1	0	MFN2	11984421	0.996000	0.38824	1.000000	0.80357	0.973000	0.67179	1.456000	0.35201	2.653000	0.90120	0.655000	0.94253	CTC	MFN2	-	superfamily_P-loop_NTPase	ENSG00000116688		0.483	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	HGNC	protein_coding	OTTHUMT00000006859.2		0.00	24	0	C	NM_014874		12061834	+1			no_errors	ENST00000235329	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.997	G
MFRP	83552	genome.wustl.edu	37	11	119215692	119215692	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:119215692G>T	ENST00000530681.1	-	6	808	c.664C>A	c.(664-666)Ccc>Acc	p.P222T	MFRP_ENST00000555262.1_Missense_Mutation_p.P222T|MFRP_ENST00000360167.4_Missense_Mutation_p.P222T|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000449574.2_Missense_Mutation_p.P222T|MFRP_ENST00000529147.1_5'UTR	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	222	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		TTGAGCGTGGGGGGAGGCACC	0.612																																																	0			GRCh37	CM090350	MFRP	M							28.0	23.0	25.0					11																	119215692		2198	4292	6490	SO:0001583	missense	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.664C>A	11.37:g.119215692G>T	ENSP00000456533:p.Pro222Thr		B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB_dom,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.P222T	ENST00000530681.1	37	c.664	CCDS8421.1	11	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852858	0.51270	.	.	ENSG00000235718	ENST00000555262;ENST00000449574;ENST00000360167	T;T;T	0.17370	2.28;2.28;2.28	5.1	2.99	0.34606	CUB (5);	0.187403	0.47852	D	0.000215	T	0.22044	0.0531	L	0.45051	1.395	0.42933	D	0.99432	P;P	0.48998	0.644;0.918	B;P	0.52454	0.326;0.699	T	0.01800	-1.1271	10	0.31617	T	0.26	-17.4791	10.8927	0.47004	0.0:0.3691:0.5195:0.1115	.	222;222	B4DHN8;Q9BY79	.;MFRP_HUMAN	T	222	ENSP00000450509:P222T;ENSP00000391664:P222T;ENSP00000353291:P222T	ENSP00000353291:P222T	P	-	1	0	MFRP	118720902	1.000000	0.71417	0.975000	0.42487	0.930000	0.56654	2.463000	0.45058	1.237000	0.43756	0.561000	0.74099	CCC	MFRP	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000235718		0.612	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	MFRP	HGNC	protein_coding	OTTHUMT00000415179.1	-	0.00	49	0	G	NM_031433		119215692	-1	tier1	-	no_errors	ENST00000449574	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.860	T
MMD2	221938	genome.wustl.edu	37	7	4965122	4965122	+	Missense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:4965122G>A	ENST00000404774.3	-	2	283	c.89C>T	c.(88-90)cCc>cTc	p.P30L	MMD2_ENST00000406755.1_Missense_Mutation_p.P30L|MMD2_ENST00000401401.3_Missense_Mutation_p.P30L	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	30						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.P30H(2)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		ATACTCTGTGGGCTGGTACCT	0.597																																																	2	Substitution - Missense(2)	endometrium(2)											167.0	166.0	166.0					7																	4965122		1956	4136	6092	SO:0001583	missense	0			BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.89C>T	7.37:g.4965122G>A	ENSP00000384690:p.Pro30Leu		B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	pfam_HlyIII-related	p.P30L	ENST00000404774.3	37	c.89	CCDS47529.1	7	.	.	.	.	.	.	.	.	.	.	g	23.5	4.425263	0.83667	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	.	.	.	3.82	3.82	0.43975	.	0.000000	0.85682	D	0.000000	D	0.84009	0.5378	M	0.90082	3.085	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.999	D	0.87448	0.2399	9	0.56958	D	0.05	-30.6215	14.8881	0.70584	0.0:0.0:1.0:0.0	.	30;30;30	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	L	30	.	ENSP00000384141:P30L	P	-	2	0	MMD2	4931648	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.976000	0.76135	1.965000	0.57142	0.561000	0.74099	CCC	MMD2	-	NULL	ENSG00000136297		0.597	MMD2-001	KNOWN	basic|CCDS	protein_coding	MMD2	HGNC	protein_coding	OTTHUMT00000324136.1		0.00	23	0	G	NM_198403		4965122	-1			no_errors	ENST00000404774	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
MMP16	4325	genome.wustl.edu	37	8	89068411	89068411	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:89068411C>A	ENST00000286614.6	-	8	1599	c.1318G>T	c.(1318-1320)Gat>Tat	p.D440Y		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	440					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ATGGCTGAATCAATACCATGA	0.418																																																	0													114.0	108.0	110.0					8																	89068411		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1318G>T	8.37:g.89068411C>A	ENSP00000286614:p.Asp440Tyr		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.D440Y	ENST00000286614.6	37	c.1318	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.126191	0.94429	.	.	ENSG00000156103	ENST00000286614	T	0.08984	3.03	5.91	5.91	0.95273	Hemopexin/matrixin (2);	0.044326	0.85682	D	0.000000	T	0.51007	0.1649	H	0.98883	4.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71520	-0.4568	10	0.87932	D	0	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	440	P51512	MMP16_HUMAN	Y	440	ENSP00000286614:D440Y	ENSP00000286614:D440Y	D	-	1	0	MMP16	89137527	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.794000	0.85869	2.793000	0.96121	0.655000	0.94253	GAT	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000156103		0.418	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	104	0	C	NM_005941		89068411	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
MPZL2	10205	genome.wustl.edu	37	11	118133240	118133240	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:118133240C>A	ENST00000278937.2	-	3	477	c.349G>T	c.(349-351)Gac>Tac	p.D117Y	MPZL2_ENST00000438295.2_Missense_Mutation_p.D117Y|MPZL2_ENST00000525647.1_5'Flank	NM_005797.3	NP_005788.1	O60487	MPZL2_HUMAN	myelin protein zero-like 2	117	Ig-like V-type.				anatomical structure morphogenesis (GO:0009653)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)|T cell differentiation in thymus (GO:0033077)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D117N(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|skin(1)	11	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		GTCCCATTGTCGTCGAACTGC	0.557																																																	1	Substitution - Missense(1)	endometrium(1)											157.0	114.0	129.0					11																	118133240		2200	4296	6496	SO:0001583	missense	0			AF275945	CCDS8393.1	11q24	2013-01-11	2007-08-01	2007-08-01		ENSG00000149573		"""Immunoglobulin superfamily / V-set domain containing"""	3496	protein-coding gene	gene with protein product		604873	"""epithelial V-like antigen 1"""	EVA1		9585423	Standard	NM_005797		Approved	EVA	uc001psn.3	O60487		ENST00000278937.2:c.349G>T	11.37:g.118133240C>A	ENSP00000278937:p.Asp117Tyr		A8K2R1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_Myelin_P0	p.D117Y	ENST00000278937.2	37	c.349	CCDS8393.1	11	.	.	.	.	.	.	.	.	.	.	C	19.60	3.858027	0.71834	.	.	ENSG00000149573	ENST00000278937;ENST00000438295	D;D	0.88124	-2.34;-2.34	5.98	5.98	0.97165	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.138020	0.64402	D	0.000003	D	0.88358	0.6415	L	0.58428	1.81	0.58432	D	0.999996	P	0.50156	0.932	P	0.45558	0.485	D	0.88727	0.3234	10	0.62326	D	0.03	.	20.4581	0.99154	0.0:1.0:0.0:0.0	.	117	O60487	MPZL2_HUMAN	Y	117	ENSP00000278937:D117Y;ENSP00000408362:D117Y	ENSP00000278937:D117Y	D	-	1	0	MPZL2	117638450	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	5.864000	0.69575	2.835000	0.97688	0.650000	0.86243	GAC	MPZL2	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom,prints_Myelin_P0	ENSG00000149573		0.557	MPZL2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	MPZL2	HGNC	protein_coding	OTTHUMT00000392113.1		0.00	60	0	C	NM_005797		118133240	-1			no_errors	ENST00000438295	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
MRPS11	64963	genome.wustl.edu	37	15	89018469	89018469	+	Splice_Site	SNP	C	C	A	rs561515348		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:89018469C>A	ENST00000325844.4	+	4	675	c.410C>A	c.(409-411)gCg>gAg	p.A137E	MRPS11_ENST00000557974.1_3'UTR|MRPS11_ENST00000353598.6_Splice_Site_p.A104E	NM_022839.3	NP_073750.2	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11	137					DNA damage response, detection of DNA damage (GO:0042769)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(3)	3	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			GCCGCAGCGGCGGTAAGTGTG	0.522																																																	0													124.0	103.0	110.0					15																	89018469		2201	4299	6500	SO:0001630	splice_region_variant	0			AB051349	CCDS10342.1, CCDS10343.1	15q25	2012-09-13			ENSG00000181991	ENSG00000181991		"""Mitochondrial ribosomal proteins / small subunits"""	14050	protein-coding gene	gene with protein product	"""cervical cancer proto-oncogene 2"""	611977				11402041	Standard	NM_022839		Approved	FLJ23406, HCC-2, FLJ22512	uc002bml.3	P82912	OTTHUMG00000148678	ENST00000325844.4:c.411+1C>A	15.37:g.89018469C>A			B2RD52|Q969D7|Q96GI3|Q9BYC3	Missense_Mutation	SNP	pfam_Ribosomal_S11	p.A137E	ENST00000325844.4	37	c.410	CCDS10342.1	15	.	.	.	.	.	.	.	.	.	.	C	12.74	2.029095	0.35797	.	.	ENSG00000181991	ENST00000325844;ENST00000353598	T;T	0.30182	1.54;1.6	5.31	-0.0101	0.13998	.	0.168173	0.50627	D	0.000103	T	0.26268	0.0641	N	0.25245	0.725	0.09310	N	0.999999	D;D;D	0.71674	0.997;0.997;0.998	P;D;P	0.63597	0.842;0.916;0.902	T	0.16808	-1.0390	10	0.19590	T	0.45	-2.8803	2.3602	0.04305	0.1214:0.4751:0.1187:0.2848	.	136;104;137	P82912-2;P82912-3;P82912	.;.;RT11_HUMAN	E	137;104	ENSP00000317376:A137E;ENSP00000318054:A104E	ENSP00000317376:A137E	A	+	2	0	MRPS11	86819473	0.960000	0.32886	0.000000	0.03702	0.047000	0.14425	0.659000	0.24994	-0.021000	0.14009	0.655000	0.94253	GCG	MRPS11	-	pfam_Ribosomal_S11	ENSG00000181991		0.522	MRPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS11	HGNC	protein_coding	OTTHUMT00000309067.2	-	0.00	44	0	C	NM_022839	Missense_Mutation	89018469	+1	tier1	-	no_errors	ENST00000325844	ensembl	human	known	74_37	missense	6.85	68	5	SNP	0.005	A
MYH3	4621	genome.wustl.edu	37	17	10543029	10543029	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:10543029C>A	ENST00000583535.1	-	23	2860	c.2773G>T	c.(2773-2775)Gag>Tag	p.E925*	MYH3_ENST00000226209.7_Nonsense_Mutation_p.E925*	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	925					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TCAGCTCTCTCTGTCACCTCC	0.458																																																	0													255.0	240.0	245.0					17																	10543029		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.2773G>T	17.37:g.10543029C>A	ENSP00000464317:p.Glu925*		Q15492	Nonsense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E925*	ENST00000583535.1	37	c.2773	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.495534	0.98319	.	.	ENSG00000109063	ENST00000226209	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1617	0.93535	0.0:1.0:0.0:0.0	.	.	.	.	X	925	.	ENSP00000226209:E925X	E	-	1	0	MYH3	10483754	1.000000	0.71417	0.953000	0.39169	0.533000	0.34776	7.814000	0.86154	2.581000	0.87130	0.655000	0.94253	GAG	MYH3	-	NULL	ENSG00000109063		0.458	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	-	0.00	63	0	C	NM_002470		10543029	-1	tier1	-	no_errors	ENST00000226209	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	A
NAGS	162417	genome.wustl.edu	37	17	42084768	42084768	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:42084768G>T	ENST00000293404.3	+	5	1292	c.1174G>T	c.(1174-1176)Gtg>Ttg	p.V392L	PYY_ENST00000360085.2_5'Flank	NM_153006.2	NP_694551.1	Q8N159	NAGS_HUMAN	N-acetylglutamate synthase	392	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				arginine biosynthetic process (GO:0006526)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate metabolic process (GO:0006536)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	mitochondrial matrix (GO:0005759)	acetyl-CoA:L-glutamate N-acetyltransferase activity (GO:0004042)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8		Breast(137;0.00536)|Prostate(33;0.0724)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGGCCGTCTAGTGGACCTGGT	0.657											OREG0024449	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													37.0	40.0	39.0					17																	42084768		2199	4297	6496	SO:0001583	missense	0			AY116537	CCDS11473.1	17q21.31	2008-02-05				ENSG00000161653			17996	protein-coding gene	gene with protein product		608300				15050968, 12459178	Standard	NM_153006		Approved	AGAS, ARGA, NAT7	uc002ies.3	Q8N159		ENST00000293404.3:c.1174G>T	17.37:g.42084768G>T	ENSP00000293404:p.Val392Leu	906	B2RAZ9|Q8IWR4	Missense_Mutation	SNP	pfam_DUF619,superfamily_Asp/Glu/Uridylate_kinase,superfamily_Acyl_CoA_acyltransferase,pirsf_GlcNAc_Synth_met,pfscan_GNAT_dom	p.V392L	ENST00000293404.3	37	c.1174	CCDS11473.1	17	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193061	0.38707	.	.	ENSG00000161653	ENST00000541745;ENST00000293404	D	0.94046	-3.34	5.56	4.59	0.56863	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);Domain of unknown function DUF619 (1);	0.080661	0.50627	D	0.000114	D	0.86548	0.5959	L	0.27975	0.815	0.34343	D	0.688998	B;B	0.28667	0.219;0.219	B;B	0.31946	0.138;0.138	T	0.83078	-0.0139	10	0.07644	T	0.81	-32.1052	11.4464	0.50125	0.0869:0.0:0.9131:0.0	.	226;392	Q2NKP2;Q8N159	.;NAGS_HUMAN	L	226;392	ENSP00000293404:V392L	ENSP00000293404:V392L	V	+	1	0	NAGS	39440294	1.000000	0.71417	0.978000	0.43139	0.732000	0.41865	2.979000	0.49313	2.623000	0.88846	0.561000	0.74099	GTG	NAGS	-	pfam_DUF619,superfamily_Acyl_CoA_acyltransferase,pirsf_GlcNAc_Synth_met,pfscan_GNAT_dom	ENSG00000161653		0.657	NAGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGS	HGNC	protein_coding	OTTHUMT00000457660.1		0.00	76	0	G	NM_153006		42084768	+1			no_errors	ENST00000293404	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.995	T
NDC80	10403	genome.wustl.edu	37	18	2616470	2616470	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:2616470G>T	ENST00000261597.4	+	17	2008	c.1826G>T	c.(1825-1827)aGa>aTa	p.R609I		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	609	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AAAGTTGATAGAGAATATGAA	0.274																																																	0													44.0	47.0	46.0					18																	2616470		2200	4285	6485	SO:0001583	missense	0			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1826G>T	18.37:g.2616470G>T	ENSP00000261597:p.Arg609Ile		Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.R609I	ENST00000261597.4	37	c.1826	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187211	0.57909	.	.	ENSG00000080986	ENST00000261597	T	0.47177	0.85	5.32	4.43	0.53597	.	0.204155	0.47455	D	0.000239	T	0.52709	0.1751	L	0.56769	1.78	0.50467	D	0.999875	D	0.54397	0.966	P	0.52159	0.691	T	0.52837	-0.8522	10	0.49607	T	0.09	-6.9503	11.0	0.47600	0.1427:0.0:0.8573:0.0	.	609	O14777	NDC80_HUMAN	I	609	ENSP00000261597:R609I	ENSP00000261597:R609I	R	+	2	0	NDC80	2606470	1.000000	0.71417	0.958000	0.39756	0.435000	0.31806	2.277000	0.43417	2.641000	0.89580	0.555000	0.69702	AGA	NDC80	-	NULL	ENSG00000080986		0.274	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	-	0.00	65	0	G	NM_006101		2616470	+1	tier1	-	no_errors	ENST00000261597	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.982	T
NDN	4692	genome.wustl.edu	37	15	23932244	23932244	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:23932244G>T	ENST00000331837.4	-	1	206	c.121C>A	c.(121-123)Ccg>Acg	p.P41T		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	41					axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P41S(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GGGCTCTGCGGCTCTGCCAGG	0.726									Prader-Willi syndrome																																								1	Substitution - Missense(1)	ovary(1)											8.0	9.0	9.0					15																	23932244		1689	3312	5001	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.121C>A	15.37:g.23932244G>T	ENSP00000332643:p.Pro41Thr		B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.P41T	ENST00000331837.4	37	c.121	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	G	11.03	1.518671	0.27211	.	.	ENSG00000182636	ENST00000331837	T	0.02197	4.4	3.09	0.0374	0.14196	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.11329	0.006	T	0.47535	-0.9110	9	0.48119	T	0.1	.	2.6315	0.04946	0.261:0.0:0.5115:0.2275	.	41	Q99608	NECD_HUMAN	T	41	ENSP00000332643:P41T	ENSP00000332643:P41T	P	-	1	0	NDN	21483337	0.037000	0.19845	0.008000	0.14137	0.023000	0.10783	0.980000	0.29513	0.012000	0.14892	0.561000	0.74099	CCG	NDN	-	NULL	ENSG00000182636		0.726	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2		0.00	10	0	G	NM_002487		23932244	-1			no_errors	ENST00000331837	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.008	T
NLGN3	54413	genome.wustl.edu	37	X	70386937	70386937	+	Silent	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:70386937C>T	ENST00000358741.3	+	7	1293	c.990C>T	c.(988-990)taC>taT	p.Y330Y	NLGN3_ENST00000374051.3_Silent_p.Y310Y|NLGN3_ENST00000536169.1_Silent_p.Y290Y|NLGN3_ENST00000476589.1_3'UTR	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	330					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CAGTGAAGTACACCAGCCTGC	0.542																																					Esophageal Squamous(103;760 1488 16849 22250 40351)												0													89.0	70.0	76.0					X																	70386937		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.990C>T	X.37:g.70386937C>T			B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.Y330	ENST00000358741.3	37	c.990	CCDS55441.1	X																																																																																			NLGN3	-	pfam_CarbesteraseB	ENSG00000196338		0.542	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1		0.00	10	0	C	NM_018977		70386937	+1			no_errors	ENST00000358741	ensembl	human	known	74_37	silent	15.38	22	4	SNP	1.000	T
NLRC3	197358	genome.wustl.edu	37	16	3613868	3613868	+	RNA	DEL	G	G	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:3613868delG	ENST00000301749.7	-	0	1475				NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000359128.5_RNA|NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000448023.2_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAGGGTCCTCGGGGGCCACAG	0.672																																																	0													33.0	37.0	36.0					16																	3613868		1976	4144	6120			0			BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3613868delG			Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Frame_Shift_Del	DEL	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.P404fs	ENST00000301749.7	37	c.1211		16																																																																																			NLRC3	-	NULL	ENSG00000167984		0.672	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	HGNC	polymorphic_pseudogene			0.00	24	0	G	NM_178844		3613868	-1	tier1		no_errors	ENST00000448023	ensembl	human	known	74_37	frame_shift_del	5.13	37	2	DEL	0.989	-
NOTCH1	4851	genome.wustl.edu	37	9	139397632	139397632	+	Splice_Site	SNP	A	A	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:139397632A>G	ENST00000277541.6	-	27	5243		c.e27+1			NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1						anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGCCACACTTACTCTGCACGG	0.662			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													40.0	49.0	46.0					9																	139397632		2096	4211	6307	SO:0001630	splice_region_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5167+1T>C	9.37:g.139397632A>G			Q59ED8|Q5SXM3	Splice_Site	SNP	-	e27+2	ENST00000277541.6	37	c.5167+2	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	A	15.69	2.908808	0.52439	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.81	0.63256	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH1	138517453	1.000000	0.71417	1.000000	0.80357	0.456000	0.32438	8.690000	0.91272	1.923000	0.55706	0.459000	0.35465	.	NOTCH1	-	-	ENSG00000148400		0.662	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	80	0	A	NM_017617	Intron	139397632	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	splice_site	12.59	117	17	SNP	1.000	G
NOTCH4	4855	genome.wustl.edu	37	6	32181562	32181562	+	Silent	SNP	G	G	T	rs201608659		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:32181562G>T	ENST00000375023.3	-	14	2361	c.2223C>A	c.(2221-2223)ggC>ggA	p.G741G	NOTCH4_ENST00000465528.1_5'UTR	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	741	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGCAGGAGCCGCCATTGAGAC	0.592																																																	0													81.0	65.0	70.0					6																	32181562		1509	2709	4218	SO:0001819	synonymous_variant	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.2223C>A	6.37:g.32181562G>T			B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.G741	ENST00000375023.3	37	c.2223	CCDS34420.1	6																																																																																			NOTCH4	-	pirsf_Notch,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	ENSG00000204301		0.592	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2		0.00	35	0	G			32181562	-1			no_errors	ENST00000375023	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.988	T
NSD1	64324	genome.wustl.edu	37	5	176721258	176721258	+	Missense_Mutation	SNP	A	A	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:176721258A>G	ENST00000439151.2	+	23	6934	c.6889A>G	c.(6889-6891)Aga>Gga	p.R2297G	NSD1_ENST00000361032.4_Missense_Mutation_p.R2194G|NSD1_ENST00000354179.4_Missense_Mutation_p.R2028G|NSD1_ENST00000347982.4_Missense_Mutation_p.R2028G	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2297	Pro-rich.				gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AGATAAGGTCAGAGACCTCGC	0.562			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													64.0	68.0	67.0					5																	176721258		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.6889A>G	5.37:g.176721258A>G	ENSP00000395929:p.Arg2297Gly		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R2297G	ENST00000439151.2	37	c.6889	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	A	13.38	2.221176	0.39201	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93859	-3.2;-3.2;-3.2;-3.3	4.55	2.01	0.26516	.	0.097154	0.43579	D	0.000553	D	0.89501	0.6733	N	0.19112	0.55	0.33079	D	0.53634	P;P	0.50528	0.936;0.651	P;B	0.50934	0.654;0.15	D	0.89543	0.3794	10	0.39692	T	0.17	.	11.5853	0.50914	0.5378:0.4622:0.0:0.0	.	2028;2297	Q96L73-2;Q96L73	.;NSD1_HUMAN	G	2028;2297;2028;2194	ENSP00000346111:R2028G;ENSP00000395929:R2297G;ENSP00000343209:R2028G;ENSP00000354310:R2194G	ENSP00000343209:R2028G	R	+	1	2	NSD1	176653864	0.978000	0.34361	1.000000	0.80357	0.876000	0.50452	1.366000	0.34193	0.442000	0.26555	0.533000	0.62120	AGA	NSD1	-	NULL	ENSG00000165671		0.562	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	47	0	A	NM_172349		176721258	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.999	G
NSRP1	84081	genome.wustl.edu	37	17	28511766	28511766	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:28511766G>T	ENST00000247026.5	+	7	814	c.751G>T	c.(751-753)Gat>Tat	p.D251Y	NSRP1_ENST00000540900.3_3'UTR	NM_001261467.1|NM_032141.3	NP_001248396.1|NP_115517.1	Q9H0G5	NSRP1_HUMAN	nuclear speckle splicing regulatory protein 1	251					developmental process (GO:0032502)|mRNA processing (GO:0006397)|nucleocytoplasmic transport (GO:0006913)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	14						CAGTGACTTCGATGCTAAGAG	0.418																																																	0													76.0	71.0	73.0					17																	28511766		2203	4300	6503	SO:0001583	missense	0			AL136806	CCDS11255.1, CCDS74025.1	17q11.2	2011-05-24	2011-05-24	2011-05-24	ENSG00000126653	ENSG00000126653			25305	protein-coding gene	gene with protein product			"""coiled-coil domain containing 55"""	CCDC55		11230166	Standard	NM_032141		Approved	DKFZP434K1421, NSrp70	uc002heu.4	Q9H0G5	OTTHUMG00000132754	ENST00000247026.5:c.751G>T	17.37:g.28511766G>T	ENSP00000247026:p.Asp251Tyr		Q6FI71	Missense_Mutation	SNP	pfam_DUF2040	p.D251Y	ENST00000247026.5	37	c.751	CCDS11255.1	17	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020811	0.54576	.	.	ENSG00000126653	ENST00000247026;ENST00000540900;ENST00000394826	T	0.51071	0.72	5.97	5.97	0.96955	.	0.399046	0.29280	N	0.012608	T	0.50684	0.1630	L	0.56769	1.78	0.80722	D	1	P	0.43169	0.8	B	0.41946	0.371	T	0.54063	-0.8349	10	0.66056	D	0.02	-7.5625	17.5657	0.87919	0.0:0.0:1.0:0.0	.	251	Q9H0G5	NSRP1_HUMAN	Y	251;182;197	ENSP00000247026:D251Y	ENSP00000247026:D251Y	D	+	1	0	NSRP1	25535892	1.000000	0.71417	0.998000	0.56505	0.958000	0.62258	3.131000	0.50515	2.828000	0.97474	0.650000	0.86243	GAT	NSRP1	-	NULL	ENSG00000126653		0.418	NSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSRP1	HGNC	protein_coding	OTTHUMT00000256121.2		0.00	54	0	G	NM_032141		28511766	+1			no_errors	ENST00000247026	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.994	T
ODF2	4957	genome.wustl.edu	37	9	131260845	131260845	+	Silent	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:131260845G>A	ENST00000434106.3	+	19	2529	c.2166G>A	c.(2164-2166)gcG>gcA	p.A722A	ODF2_ENST00000372807.5_Silent_p.A717A|ODF2_ENST00000444119.2_Silent_p.A698A|ODF2_ENST00000604420.1_Silent_p.A722A|ODF2_ENST00000393527.3_Silent_p.A698A|ODF2_ENST00000351030.3_Silent_p.A717A	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2	722					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						ttgaagatgcgaggaggcagg	0.527																																																	0													64.0	53.0	56.0					9																	131260845		2203	4300	6503	SO:0001819	synonymous_variant	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.2166G>A	9.37:g.131260845G>A			B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	Silent	SNP	NULL	p.A722	ENST00000434106.3	37	c.2166	CCDS56588.1	9																																																																																			ODF2	-	NULL	ENSG00000136811		0.527	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3		0.00	55	0	G			131260845	+1			no_errors	ENST00000434106	ensembl	human	known	74_37	silent	6.06	62	4	SNP	0.989	A
OSR2	116039	genome.wustl.edu	37	8	99962900	99962900	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:99962900G>T	ENST00000297565.4	+	3	1169	c.673G>T	c.(673-675)Gaa>Taa	p.E225*	OSR2_ENST00000522510.1_Nonsense_Mutation_p.E225*|OSR2_ENST00000457907.2_Nonsense_Mutation_p.E346*|OSR2_ENST00000523368.1_Nonsense_Mutation_p.E225*|OSR2_ENST00000435298.2_Nonsense_Mutation_p.E225*	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	225					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			CCATTCCAAAGAAAAACCCTT	0.353																																																	0													67.0	64.0	65.0					8																	99962900		1847	4089	5936	SO:0001587	stop_gained	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.673G>T	8.37:g.99962900G>T	ENSP00000297565:p.Glu225*		A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E346*	ENST00000297565.4	37	c.1036	CCDS47901.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.158967	0.98103	.	.	ENSG00000164920	ENST00000523368;ENST00000297565;ENST00000435298;ENST00000522510;ENST00000457907	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.886	19.1074	0.93301	0.0:0.0:1.0:0.0	.	.	.	.	X	225;225;225;225;346	.	.	E	+	1	0	OSR2	100032076	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.738000	0.93877	0.655000	0.94253	GAA	OSR2	-	pfscan_Znf_C2H2	ENSG00000164920		0.353	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	-	0.00	63	0	G	NM_053001		99962900	+1	tier1	-	no_errors	ENST00000457907	ensembl	human	known	74_37	nonsense	5.48	69	4	SNP	1.000	T
PAGE1	8712	genome.wustl.edu	37	X	49458733	49458733	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:49458733C>A	ENST00000376150.3	-	3	267	c.135G>T	c.(133-135)gaG>gaT	p.E45D		NM_003785.3	NP_003776.2	O75459	PAGE1_HUMAN	P antigen family, member 1 (prostate associated)	45					cellular defense response (GO:0006968)					endometrium(1)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	7	Ovarian(276;0.236)					CATCCTCTCTCTCTTCAGCAG	0.498																																																	0													168.0	120.0	137.0					X																	49458733		2202	4298	6500	SO:0001583	missense	0			AF058989	CCDS14327.1	Xp11.23	2009-06-17	2005-01-26	2005-01-27	ENSG00000068985	ENSG00000068985			4107	protein-coding gene	gene with protein product		300288	"""G antigen, family B, 1 (prostate associated)"""	GAGEB1		9651357, 9724777	Standard	NM_003785		Approved	PAGE-1, GAGE-9, CT16.3	uc004dom.3	O75459	OTTHUMG00000033224	ENST00000376150.3:c.135G>T	X.37:g.49458733C>A	ENSP00000365320:p.Glu45Asp		Q6FGM3|Q9BSS7	Missense_Mutation	SNP	pfam_GAGE	p.E45D	ENST00000376150.3	37	c.135	CCDS14327.1	X	.	.	.	.	.	.	.	.	.	.	C	11.65	1.702850	0.30232	.	.	ENSG00000068985	ENST00000376150	T	0.14144	2.53	1.42	1.42	0.22433	.	.	.	.	.	T	0.26557	0.0649	L	0.60067	1.865	0.09310	N	1	D	0.71674	0.998	D	0.69479	0.964	T	0.04900	-1.0919	9	0.54805	T	0.06	.	5.7394	0.18085	0.0:1.0:0.0:0.0	.	45	O75459	GAGB1_HUMAN	D	45	ENSP00000365320:E45D	ENSP00000365320:E45D	E	-	3	2	PAGE1	49345444	0.020000	0.18652	0.002000	0.10522	0.002000	0.02628	1.963000	0.40452	0.987000	0.38709	0.436000	0.28706	GAG	PAGE1	-	pfam_GAGE	ENSG00000068985		0.498	PAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE1	HGNC	protein_coding	OTTHUMT00000081210.1	-	0.00	59	0	C			49458733	-1	tier1	-	no_errors	ENST00000376150	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.002	A
PATL2	197135	genome.wustl.edu	37	15	44960587	44960587	+	Missense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:44960587G>A	ENST00000560775.1	-	12	1377	c.1318C>T	c.(1318-1320)Cca>Tca	p.P440S	PATL2_ENST00000560780.1_Missense_Mutation_p.P251S|PATL2_ENST00000434130.1_Missense_Mutation_p.P440S			C9JE40	PATL2_HUMAN	protein associated with topoisomerase II homolog 2 (yeast)	440					negative regulation of cytoplasmic mRNA processing body assembly (GO:0010607)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|nucleus (GO:0005634)	RNA binding (GO:0003723)			kidney(2)|stomach(1)	3						GAGCCAGGTGGCAACAGCGTT	0.493																																																	0													133.0	120.0	124.0					15																	44960587		687	1589	2276	SO:0001583	missense	0			BC036924	CCDS45253.1	15q21.1	2010-06-04			ENSG00000229474	ENSG00000229474			33630	protein-coding gene	gene with protein product		614661				17936923	Standard	NM_001145112		Approved		uc010uej.2	C9JE40		ENST00000560775.1:c.1318C>T	15.37:g.44960587G>A	ENSP00000453915:p.Pro440Ser			Missense_Mutation	SNP	pfam_Topo_II-assoc_PAT1	p.P440S	ENST00000560775.1	37	c.1318	CCDS45253.1	15	.	.	.	.	.	.	.	.	.	.	G	0.027	-1.366153	0.01235	.	.	ENSG00000229474	ENST00000434130	T	0.41065	1.01	6.06	4.16	0.48862	.	.	.	.	.	T	0.27900	0.0687	L	0.41824	1.3	0.09310	N	1	B	0.13145	0.007	B	0.16289	0.015	T	0.34229	-0.9837	9	0.06891	T	0.86	-14.5885	6.0036	0.19535	0.1659:0.1581:0.676:0.0	.	440	C9JE40	PATL2_HUMAN	S	440	ENSP00000416673:P440S	ENSP00000416673:P440S	P	-	1	0	PATL2	42747879	0.909000	0.30893	0.037000	0.18230	0.297000	0.27493	1.609000	0.36858	0.868000	0.35678	0.655000	0.94253	CCA	PATL2	-	pfam_Topo_II-assoc_PAT1	ENSG00000229474		0.493	PATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL2	HGNC	protein_coding	OTTHUMT00000415947.1		0.00	30	0	G	NM_001145112		44960587	-1			no_errors	ENST00000434130	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.058	A
PCDHA6	56142	genome.wustl.edu	37	5	140209088	140209088	+	Missense_Mutation	SNP	G	G	A	rs542651929		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:140209088G>A	ENST00000529310.1	+	1	1526	c.1412G>A	c.(1411-1413)gGc>gAc	p.G471D	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000527624.1_Missense_Mutation_p.G471D	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	471	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACCCGCCGGGCTGCCACATC	0.657													.|||	1	0.000199681	0.0	0.0	5008	,	,		18697	0.0		0.001	False		,,,				2504	0.0																0													38.0	46.0	44.0					5																	140209088		2203	4291	6494	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.1412G>A	5.37:g.140209088G>A	ENSP00000433378:p.Gly471Asp		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G471D	ENST00000529310.1	37	c.1412	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	G	14.31	2.498472	0.44455	.	.	ENSG00000081842	ENST00000529310;ENST00000527624	T;T	0.68624	-0.34;-0.34	3.72	3.72	0.42706	Cadherin (3);Cadherin-like (1);	0.000000	0.36703	U	0.002452	T	0.81123	0.4757	M	0.78916	2.43	0.39950	D	0.974522	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.87578	0.994;0.998;0.99	D	0.85294	0.1069	10	0.87932	D	0	.	14.7456	0.69488	0.0:0.0:1.0:0.0	.	471;471;471	Q9UN73-3;Q9UN73;Q9UN73-2	.;PCDA6_HUMAN;.	D	471	ENSP00000433378:G471D;ENSP00000434113:G471D	ENSP00000434113:G471D	G	+	2	0	PCDHA6	140189272	1.000000	0.71417	0.900000	0.35374	0.297000	0.27493	4.303000	0.59098	2.061000	0.61500	0.313000	0.20887	GGC	PCDHA6	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000081842		0.657	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	-	0.00	124	0	G	NM_018909		140209088	+1	tier1	-	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	10.18	150	17	SNP	0.969	A
PCDHB11	56125	genome.wustl.edu	37	5	140580114	140580114	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:140580114T>C	ENST00000354757.3	+	1	767	c.767T>C	c.(766-768)aTc>aCc	p.I256T	PCDHB11_ENST00000536699.1_5'UTR	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	256	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAATAGCATCCTTGGCTCG	0.448																																																	0													192.0	196.0	194.0					5																	140580114		2203	4300	6503	SO:0001583	missense	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.767T>C	5.37:g.140580114T>C	ENSP00000346802:p.Ile256Thr		B4DSF7|Q2M223	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I256T	ENST00000354757.3	37	c.767	CCDS4253.1	5	.	.	.	.	.	.	.	.	.	.	T	7.866	0.727041	0.15439	.	.	ENSG00000197479	ENST00000354757	T	0.49139	0.79	2.7	-4.63	0.03359	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.20820	0.0501	N	0.03029	-0.43	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.23013	-1.0200	9	0.72032	D	0.01	.	9.0261	0.36230	0.0:0.6978:0.1491:0.1531	.	256	Q9Y5F2	PCDBB_HUMAN	T	256	ENSP00000346802:I256T	ENSP00000346802:I256T	I	+	2	0	PCDHB11	140560298	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.290000	0.02777	-1.010000	0.03396	-0.644000	0.03951	ATC	PCDHB11	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000197479		0.448	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	-	0.00	59	0	T	NM_018931		140580114	+1	tier1	-	no_errors	ENST00000354757	ensembl	human	known	74_37	missense	7.81	59	5	SNP	0.000	C
PCDHGB2	56103	genome.wustl.edu	37	5	140741884	140741884	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:140741884C>A	ENST00000522605.1	+	1	2182	c.2182C>A	c.(2182-2184)Cag>Aag	p.Q728K	PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	728					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q728*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACTGTTTTCAGCCTGGTCT	0.552																																																	1	Substitution - Nonsense(1)	cervix(1)											106.0	111.0	110.0					5																	140741884		1989	4166	6155	SO:0001583	missense	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2182C>A	5.37:g.140741884C>A	ENSP00000429018:p.Gln728Lys		Q3MIJ3|Q9UN65	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q728K	ENST00000522605.1	37	c.2182	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.749502	0.00669	.	.	ENSG00000253910	ENST00000522605	T	0.14516	2.5	5.18	-0.183	0.13284	.	.	.	.	.	T	0.09158	0.0226	L	0.51853	1.615	0.09310	N	1	B;B	0.14012	0.002;0.009	B;B	0.12837	0.008;0.008	T	0.44544	-0.9321	9	0.05721	T	0.95	.	4.3499	0.11150	0.3824:0.3478:0.1999:0.0699	.	728;728	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	K	728	ENSP00000429018:Q728K	ENSP00000429018:Q728K	Q	+	1	0	PCDHGB2	140722068	0.015000	0.18098	0.801000	0.32222	0.070000	0.16714	0.053000	0.14184	0.261000	0.21753	0.461000	0.40582	CAG	PCDHGB2	-	NULL	ENSG00000253910		0.552	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1		0.00	56	0	C	NM_018923		140741884	+1			no_errors	ENST00000522605	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.000	A
PCDHGB7	56099	genome.wustl.edu	37	5	140799687	140799687	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:140799687T>C	ENST00000398594.2	+	1	2261	c.2261T>C	c.(2260-2262)tTt>tCt	p.F754S	PCDHGA7_ENST00000518325.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	754					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTATAATTTTTGTGTGCCT	0.458																																																	0													58.0	57.0	57.0					5																	140799687		1863	4113	5976	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.2261T>C	5.37:g.140799687T>C	ENSP00000381594:p.Phe754Ser		Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F754S	ENST00000398594.2	37	c.2261	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	t	12.10	1.836503	0.32421	.	.	ENSG00000254122	ENST00000398594	T	0.44482	0.92	5.49	5.49	0.81192	.	0.476007	0.11798	U	0.528467	T	0.36635	0.0974	N	0.19112	0.55	0.09310	N	1	B;B	0.19200	0.034;0.033	B;B	0.30316	0.053;0.114	T	0.41698	-0.9494	10	0.87932	D	0	.	15.2975	0.73922	0.0:0.0:0.0:1.0	.	754;754	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	S	754	ENSP00000381594:F754S	ENSP00000381594:F754S	F	+	2	0	PCDHGB7	140779871	0.356000	0.24930	0.783000	0.31826	0.749000	0.42624	3.297000	0.51810	2.090000	0.63153	0.459000	0.35465	TTT	PCDHGB7	-	NULL	ENSG00000254122		0.458	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	-	0.00	50	0	T	NM_018927		140799687	+1	tier1	-	no_errors	ENST00000398594	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.177	C
PDE1A	5136	genome.wustl.edu	37	2	183106660	183106660	+	Intron	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:183106660G>T	ENST00000410103.1	-	4	299				PDE1A_ENST00000358139.2_Intron|PDE1A_ENST00000409365.1_Intron|PDE1A_ENST00000346717.4_5'Flank|PDE1A_ENST00000435564.1_Intron|PDE1A_ENST00000536095.1_Intron|PDE1A_ENST00000482538.1_5'UTR|PDE1A_ENST00000331935.6_Intron|PDE1A_ENST00000456212.1_Intron|PDE1A_ENST00000351439.5_Intron	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	AGATTCCCTAGCCCATTTCAG	0.328																																																	0													5.0	5.0	5.0					2																	183106660		838	1922	2760	SO:0001627	intron_variant	0				CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.216-1641C>A	2.37:g.183106660G>T			D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	RNA	SNP	-	NULL	ENST00000410103.1	37	NULL	CCDS33344.1	2																																																																																			PDE1A	-	-	ENSG00000115252		0.328	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PDE1A	HGNC	protein_coding	OTTHUMT00000334356.1	-	0.00	65	0	G			183106660	-1	tier1	-	no_errors	ENST00000482538	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.022	T
PGBD3	267004	genome.wustl.edu	37	10	50724704	50724704	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:50724704C>A	ENST00000374127.3	-	2	658	c.457G>T	c.(457-459)Gag>Tag	p.E153*	ERCC6_ENST00000355832.5_Intron|ERCC6-PGBD3_ENST00000447839.2_Nonsense_Mutation_p.E621*|PGBD3_ENST00000508005.2_Nonsense_Mutation_p.E153*|PGBD3_ENST00000603152.1_Nonsense_Mutation_p.E621*|ERCC6-PGBD3_ENST00000515869.1_Nonsense_Mutation_p.E621*	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	153										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						TCAATGACCTCGTCATCAAGA	0.403																																																	0													123.0	119.0	120.0					10																	50724704		2203	4300	6503	SO:0001587	stop_gained	0			AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.457G>T	10.37:g.50724704C>A	ENSP00000363242:p.Glu153*		B3KQC4|Q5W0M0|Q6PIH0	Nonsense_Mutation	SNP	NULL	p.E621*	ENST00000374127.3	37	c.1861	CCDS7230.1	10	.	.	.	.	.	.	.	.	.	.	C	36	5.611244	0.96637	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	.	.	.	0.468	-0.558	0.11796	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-9.3338	.	.	.	.	.	.	.	X	153;153;621;621	.	ENSP00000387966:E621X	E	-	1	0	PGBD3;RP11-123B3.6	50394710	0.061000	0.20836	0.790000	0.31976	0.767000	0.43475	0.305000	0.19254	-0.344000	0.08338	-0.339000	0.08088	GAG	PGBD3	-	NULL	ENSG00000243251		0.403	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	HGNC	protein_coding	OTTHUMT00000047988.1		0.00	50	0	C			50724704	-1			no_errors	ENST00000603152	ensembl	human	known	74_37	nonsense	6.98	40	3	SNP	0.096	A
PHAX	51808	genome.wustl.edu	37	5	125939613	125939613	+	Nonsense_Mutation	SNP	G	G	T	rs370070252		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:125939613G>T	ENST00000297540.4	+	2	1143	c.448G>T	c.(448-450)Gag>Tag	p.E150*	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	150	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						CAGACAATCCGAGACCTACAA	0.438																																																	0													94.0	87.0	90.0					5																	125939613		2203	4300	6503	SO:0001587	stop_gained	0			AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.448G>T	5.37:g.125939613G>T	ENSP00000297540:p.Glu150*		Q9H8W1	Nonsense_Mutation	SNP	pfam_PHAX_RNA-binding_domain	p.E150*	ENST00000297540.4	37	c.448	CCDS4138.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.823678	0.99272	.	.	ENSG00000164902	ENST00000297540	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-35.6189	19.9279	0.97110	0.0:0.0:1.0:0.0	.	.	.	.	X	150	.	ENSP00000297540:E150X	E	+	1	0	PHAX	125967512	1.000000	0.71417	0.949000	0.38748	0.650000	0.38633	9.748000	0.98867	2.715000	0.92844	0.655000	0.94253	GAG	PHAX	-	NULL	ENSG00000164902		0.438	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHAX	HGNC	protein_coding	OTTHUMT00000250924.1	-	0.00	40	0	G	NM_032177		125939613	+1	tier1	-	no_errors	ENST00000297540	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	1.000	T
PHF3	23469	genome.wustl.edu	37	6	64404642	64404642	+	Missense_Mutation	SNP	G	G	T	rs35547668		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:64404642G>T	ENST00000262043.3	+	6	3008	c.2668G>T	c.(2668-2670)Gct>Tct	p.A890S	PHF3_ENST00000393387.1_Missense_Mutation_p.A890S			Q92576	PHF3_HUMAN	PHD finger protein 3	890					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AGGAGAAAAAGCTTCAAAACC	0.308																																					GBM(135;136 1820 29512 34071 46235)												0													46.0	49.0	48.0					6																	64404642		2193	4297	6490	SO:0001583	missense	0			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.2668G>T	6.37:g.64404642G>T	ENSP00000262043:p.Ala890Ser		A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.A890S	ENST00000262043.3	37	c.2668	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	G	9.237	1.037375	0.19669	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000515594;ENST00000262043;ENST00000393387	T;T;T;T;T	0.44482	2.22;1.79;0.92;2.25;2.25	5.07	-5.14	0.02875	.	1.589140	0.04263	N	0.340770	T	0.05044	0.0135	N	0.16478	0.41	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.08680	-1.0710	10	0.06757	T	0.87	0.1052	1.1116	0.01705	0.3296:0.1021:0.1553:0.413	.	890	Q92576	PHF3_HUMAN	S	704;802;159;890;890	ENSP00000424694:A704S;ENSP00000425227:A802S;ENSP00000425338:A159S;ENSP00000262043:A890S;ENSP00000377048:A890S	ENSP00000262043:A890S	A	+	1	0	PHF3	64462601	0.201000	0.23410	0.786000	0.31890	0.772000	0.43724	-0.558000	0.05978	-0.621000	0.05633	-0.334000	0.08254	GCT	PHF3	-	NULL	ENSG00000118482		0.308	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	-	0.00	112	0	G			64404642	+1	tier1	-	no_errors	ENST00000262043	ensembl	human	known	74_37	missense	5.88	80	5	SNP	0.488	T
PI4KA	5297	genome.wustl.edu	37	22	21083684	21083684	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr22:21083684G>T	ENST00000572273.1	-	39	4655	c.4425C>A	c.(4423-4425)atC>atA	p.I1475I	PI4KA_ENST00000414196.3_Silent_p.I285I|PI4KA_ENST00000255882.6_Silent_p.I1533I			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1475	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CACTCAGGCTGATGTACTTAG	0.607																																					GBM(136;1332 1831 3115 23601 50806)												0													158.0	118.0	131.0					22																	21083684		2203	4300	6503	SO:0001819	synonymous_variant	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.4425C>A	22.37:g.21083684G>T			Q7Z625|Q9UPG2	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.I1533	ENST00000572273.1	37	c.4599		22																																																																																			PI4KA	-	superfamily_ARM-type_fold	ENSG00000241973		0.607	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		-	0.00	70	0	G	NM_058004		21083684	-1	tier1	-	no_errors	ENST00000255882	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
PLA2G15	23659	genome.wustl.edu	37	16	68289243	68289243	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:68289243G>T	ENST00000219345.5	+	4	545	c.462G>T	c.(460-462)gaG>gaT	p.E154D	PLA2G15_ENST00000413021.2_Missense_Mutation_p.R102M|RP11-96D1.7_ENST00000569843.1_RNA|RP11-96D1.7_ENST00000563175.1_RNA|PLA2G15_ENST00000444212.2_Intron|PLA2G15_ENST00000566188.1_Missense_Mutation_p.E154D	NM_012320.3	NP_036452.1	Q8NCC3	PAG15_HUMAN	phospholipase A2, group XV	154					ceramide metabolic process (GO:0006672)|fatty acid catabolic process (GO:0009062)|phosphatidylcholine metabolic process (GO:0046470)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)	calcium-independent phospholipase A2 activity (GO:0047499)|lysophospholipase activity (GO:0004622)|O-acyltransferase activity (GO:0008374)|phospholipid binding (GO:0005543)			kidney(2)|large_intestine(2)|lung(2)|ovary(2)|prostate(3)|skin(1)	12						CACGGGGTGAGGATGTCCGAG	0.557																																																	0													59.0	59.0	59.0					16																	68289243		2198	4300	6498	SO:0001583	missense	0			AB017494	CCDS10864.1	16q22.1	2008-09-19	2008-09-19	2008-09-19	ENSG00000103066	ENSG00000103066			17163	protein-coding gene	gene with protein product		609362	"""lysophospholipase 3 (lysosomal phospholipase A2)"""	LYPLA3		10092508, 16973413	Standard	XM_005255886		Approved	LLPL, GXVPLA2	uc002evr.3	Q8NCC3	OTTHUMG00000137554	ENST00000219345.5:c.462G>T	16.37:g.68289243G>T	ENSP00000219345:p.Glu154Asp		B3KMF3|B4DUD1|Q53GZ1|Q9NPQ6|Q9UG04|Q9Y2B3	Missense_Mutation	SNP	pfam_LACT/PDAT_acylTrfase	p.E154D	ENST00000219345.5	37	c.462	CCDS10864.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.89|12.89	2.072786|2.072786	0.36566|0.36566	.|.	.|.	ENSG00000103066|ENSG00000103066	ENST00000219345|ENST00000413021	D|D	0.95724|0.96491	-3.79|-4.03	5.2|5.2	1.76|1.76	0.24704|0.24704	.|.	0.283649|.	0.43747|.	D|.	0.000527|.	D|D	0.90930|0.90930	0.7149|0.7149	N|N	0.25332|0.25332	0.735|0.735	0.80722|0.80722	D|D	1|1	B;B|B	0.16802|0.14438	0.019;0.001|0.01	B;B|B	0.17433|0.14023	0.018;0.007|0.01	D|D	0.85355|0.85355	0.1104|0.1104	10|9	0.16420|0.56958	T|D	0.52|0.05	-32.2876|-32.2876	6.1409|6.1409	0.20259|0.20259	0.652:0.0:0.348:0.0|0.652:0.0:0.348:0.0	.|.	154;154|102	B4DJW4;Q8NCC3|B4DUD1	.;PAG15_HUMAN|.	D|M	154|102	ENSP00000219345:E154D|ENSP00000394197:R102M	ENSP00000219345:E154D|ENSP00000394197:R102M	E|R	+|+	3|2	2|0	PLA2G15|PLA2G15	66846744|66846744	0.988000|0.988000	0.35896|0.35896	0.981000|0.981000	0.43875|0.43875	0.995000|0.995000	0.86356|0.86356	0.294000|0.294000	0.19047|0.19047	0.631000|0.631000	0.30412|0.30412	0.655000|0.655000	0.94253|0.94253	GAG|AGG	PLA2G15	-	pfam_LACT/PDAT_acylTrfase	ENSG00000103066		0.557	PLA2G15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G15	HGNC	protein_coding	OTTHUMT00000268888.2	-	0.00	69	0	G	NM_012320		68289243	+1	tier1	-	no_errors	ENST00000219345	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.997	T
PLEKHD1	400224	genome.wustl.edu	37	14	69968464	69968464	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr14:69968464G>T	ENST00000322564.7	+	5	636	c.424G>T	c.(424-426)Gcc>Tcc	p.A142S		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	142										breast(1)|endometrium(1)|kidney(2)	4						CTGGAAGAATGCCCAGCTGGG	0.537																																																	0													114.0	112.0	112.0					14																	69968464		692	1591	2283	SO:0001583	missense	0			AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.424G>T	14.37:g.69968464G>T	ENSP00000317175:p.Ala142Ser		B9EJC2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A142S	ENST00000322564.7	37	c.424	CCDS53903.1	14	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064109	0.76187	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	T	0.74344	0.3704	L	0.47716	1.5	0.50313	D	0.999863	D	0.63880	0.993	D	0.72625	0.978	T	0.70802	-0.4773	7	.	.	.	.	18.7676	0.91879	0.0:0.0:1.0:0.0	.	142	B9EJC2	.	S	142	.	.	A	+	1	0	PLEKHD1	69038217	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.697000	0.74603	2.744000	0.94065	0.561000	0.74099	GCC	PLEKHD1	-	NULL	ENSG00000175985		0.537	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHD1	HGNC	protein_coding	OTTHUMT00000412451.2	-	0.00	57	0	G	NM_001161498		69968464	+1	tier1	-	no_errors	ENST00000322564	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
PLVAP	83483	genome.wustl.edu	37	19	17487777	17487777	+	Silent	SNP	G	G	A	rs181770634	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:17487777G>A	ENST00000252590.4	-	1	382	c.321C>T	c.(319-321)cgC>cgT	p.R107R		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	107					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R107R(1)		cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGTCCAGGTCGCGGCGAGCAT	0.637													G|||	3	0.000599042	0.0	0.0	5008	,	,		18373	0.002		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	ovary(1)											99.0	86.0	90.0					19																	17487777		2203	4300	6503	SO:0001819	synonymous_variant	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.321C>T	19.37:g.17487777G>A			Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Silent	SNP	pfam_PV-1	p.R107	ENST00000252590.4	37	c.321	CCDS32952.1	19																																																																																			PLVAP	-	pfam_PV-1	ENSG00000130300		0.637	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1		0.00	20	0	G	NM_031310		17487777	-1			no_errors	ENST00000252590	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.039	A
PLXNB2	23654	genome.wustl.edu	37	22	50728337	50728337	+	Missense_Mutation	SNP	G	G	T	rs375502604		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr22:50728337G>T	ENST00000449103.1	-	3	817	c.677C>A	c.(676-678)cCc>cAc	p.P226H	PLXNB2_ENST00000359337.4_Missense_Mutation_p.P226H			O15031	PLXB2_HUMAN	plexin B2	226	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GAAGACGTAGGGGCCGTCCTC	0.612																																																	0													56.0	63.0	61.0					22																	50728337		2107	4229	6336	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.677C>A	22.37:g.50728337G>T	ENSP00000409171:p.Pro226His		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P226H	ENST00000449103.1	37	c.677	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	12.05	1.822203	0.32237	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000414275;ENST00000432455	T;T;T	0.04454	3.62;3.62;3.62	4.62	-9.24	0.00669	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	2.853150	0.00970	N	0.003222	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.38134	-0.9675	10	0.41790	T	0.15	.	2.0469	0.03562	0.1738:0.3445:0.1127:0.369	.	226	O15031	PLXB2_HUMAN	H	226	ENSP00000409171:P226H;ENSP00000352288:P226H;ENSP00000392620:P226H	ENSP00000352288:P226H	P	-	2	0	PLXNB2	49070464	0.000000	0.05858	0.002000	0.10522	0.905000	0.53344	-2.076000	0.01373	-2.763000	0.00369	0.462000	0.41574	CCC	PLXNB2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000196576		0.612	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	-	0.00	35	0	G	NM_012401		50728337	-1	tier1	-	no_errors	ENST00000359337	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.000	T
RSPH10B2	728194	genome.wustl.edu	37	7	6791040	6791040	+	5'Flank	SNP	G	G	C	rs199677566	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:6791040G>C	ENST00000403107.1	+	0	0				RSPH10B2_ENST00000404077.1_5'Flank|PMS2CL_ENST00000486256.1_RNA			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)											breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						TCACTGTATGGAATAATTGGT	0.403													G|||	302	0.0603035	0.0325	0.0389	5008	,	,		18370	0.0843		0.0567	False		,,,				2504	0.092																0																																										SO:0001631	upstream_gene_variant	0				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856		7.37:g.6791040G>C	Exception_encountered		A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	RNA	SNP	-	NULL	ENST00000403107.1	37	NULL	CCDS43552.1	7																																																																																			PMS2CL	-	-	ENSG00000187953		0.403	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2CL	HGNC	protein_coding	OTTHUMT00000324184.4	-	0.00	28	0	G	NM_001099697		6791040	+1	tier1	rs199677566	no_errors	ENST00000486256	ensembl	human	known	74_37	rna	33.33	34	17	SNP	0.001	C
POC5	134359	genome.wustl.edu	37	5	74988260	74988260	+	Missense_Mutation	SNP	G	G	T	rs146386463		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:74988260G>T	ENST00000428202.2	-	7	945	c.756C>A	c.(754-756)ttC>ttA	p.F252L	POC5_ENST00000446329.2_Missense_Mutation_p.F227L|POC5_ENST00000510798.1_Missense_Mutation_p.F135L|POC5_ENST00000504862.1_5'Flank|POC5_ENST00000380475.2_Missense_Mutation_p.F135L|POC5_ENST00000514838.2_Missense_Mutation_p.F224L	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	252					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCCAGTGGAAGAATGTTCTCA	0.418																																																	0													205.0	192.0	196.0					5																	74988260		1907	4143	6050	SO:0001583	missense	0			AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.756C>A	5.37:g.74988260G>T	ENSP00000410216:p.Phe252Leu		B4DJG7|Q494X7|Q494X9|Q6P085	Missense_Mutation	SNP	NULL	p.F252L	ENST00000428202.2	37	c.756	CCDS47236.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.540475	0.85917	.	.	ENSG00000152359	ENST00000428202;ENST00000514838;ENST00000380475;ENST00000510798;ENST00000446329;ENST00000503835	T;T;T;T;T	0.53640	1.63;1.23;0.61;0.61;1.6	5.71	5.71	0.89125	.	0.089887	0.85682	D	0.000000	T	0.63873	0.2548	M	0.71206	2.165	0.53688	D	0.999971	D;P;P	0.71674	0.998;0.845;0.938	D;P;P	0.76071	0.987;0.645;0.689	T	0.67138	-0.5746	10	0.87932	D	0	-17.3146	7.8713	0.29567	0.1948:0.0:0.8052:0.0	.	135;252;227	Q8NA72-2;Q8NA72;Q8NA72-3	.;POC5_HUMAN;.	L	252;224;135;135;227;135	ENSP00000410216:F252L;ENSP00000420971:F224L;ENSP00000369842:F135L;ENSP00000426796:F135L;ENSP00000399481:F227L	ENSP00000369842:F135L	F	-	3	2	POC5	75024016	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.799000	0.62517	2.681000	0.91329	0.655000	0.94253	TTC	POC5	-	NULL	ENSG00000152359		0.418	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC5	HGNC	protein_coding	OTTHUMT00000369124.1		0.00	30	0	G	NM_152408		74988260	-1			no_errors	ENST00000428202	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
POTEH	23784	genome.wustl.edu	37	22	16277775	16277775	+	Missense_Mutation	SNP	T	T	C	rs201571982		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr22:16277775T>C	ENST00000343518.6	-	5	1190	c.1139A>G	c.(1138-1140)gAg>gGg	p.E380G	POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	380										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						AACAGCATACTCTCTGGCCGT	0.353																																																	0																																										SO:0001583	missense	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.1139A>G	22.37:g.16277775T>C	ENSP00000340610:p.Glu380Gly		A2CEK4|A6NCI1|A9Z1W0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E380G	ENST00000343518.6	37	c.1139	CCDS46658.1	22	.	.	.	.	.	.	.	.	.	.	.	7.521	0.656590	0.14580	.	.	ENSG00000198062	ENST00000359587;ENST00000343518	T	0.64260	-0.09	0.887	0.887	0.19200	Ankyrin repeat-containing domain (4);	0.961112	0.08438	U	0.945886	T	0.57636	0.2067	L	0.45352	1.415	0.09310	N	1	P;P	0.50066	0.931;0.768	P;B	0.49477	0.612;0.418	T	0.49466	-0.8937	10	0.54805	T	0.06	.	4.0851	0.09943	0.0:0.0:0.0:1.0	.	380;343	Q6S545;A6NKF6	POTEH_HUMAN;.	G	343;380	ENSP00000340610:E380G	ENSP00000340610:E380G	E	-	2	0	POTEH	14657775	0.003000	0.15002	0.019000	0.16419	0.034000	0.12701	1.157000	0.31724	0.658000	0.30925	0.147000	0.16070	GAG	POTEH	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000198062		0.353	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	-	0.00	22	0	T	NM_001136213		16277775	-1	tier1	rs201571982	no_errors	ENST00000343518	ensembl	human	known	74_37	missense	40.00	6	4	SNP	0.027	C
POU3F3	5455	genome.wustl.edu	37	2	105473304	105473304	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:105473304G>T	ENST00000361360.2	+	1	1336	c.1336G>T	c.(1336-1338)Gag>Tag	p.E446*	RP11-13J10.1_ENST00000598623.1_RNA	NM_006236.1	NP_006227.1	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	446					central nervous system development (GO:0007417)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain ventricular zone progenitor cell division (GO:0021869)|metanephric ascending thin limb development (GO:0072218)|metanephric DCT cell differentiation (GO:0072240)|metanephric loop of Henle development (GO:0072236)|metanephric macula densa development (GO:0072227)|metanephric thick ascending limb development (GO:0072233)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						CCTGCAGCTCGAGAAGGAGGT	0.642																																																	0													38.0	40.0	39.0					2																	105473304		2203	4300	6503	SO:0001587	stop_gained	0				CCDS33265.1	2q12.1	2011-06-20	2007-07-13		ENSG00000198914	ENSG00000198914		"""Homeoboxes / POU class"""	9216	protein-coding gene	gene with protein product		602480	"""POU domain class 3, transcription factor 3"""				Standard	NM_006236		Approved	BRN1, OTF8	uc010ywg.2	P20264	OTTHUMG00000153067	ENST00000361360.2:c.1336G>T	2.37:g.105473304G>T	ENSP00000355001:p.Glu446*		P78379|Q4ZG25	Nonsense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pirsf_Transcription_factor_POU,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.E446*	ENST00000361360.2	37	c.1336	CCDS33265.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.253902	0.97417	.	.	ENSG00000198914	ENST00000361360	.	.	.	4.31	4.31	0.51392	.	0.000000	0.64402	U	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5529	0.76167	0.0:0.0:1.0:0.0	.	.	.	.	X	446	.	ENSP00000355001:E446X	E	+	1	0	POU3F3	104839736	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	7.514000	0.81750	1.943000	0.56356	0.462000	0.41574	GAG	POU3F3	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pirsf_Transcription_factor_POU,pfscan_Homeobox_dom,prints_POU	ENSG00000198914		0.642	POU3F3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	POU3F3	HGNC	protein_coding	OTTHUMT00000329335.2	-	0.00	50	0	G			105473304	+1	tier1	-	no_errors	ENST00000361360	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	1.000	T
PPIL4	85313	genome.wustl.edu	37	6	149847910	149847910	+	Silent	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:149847910C>A	ENST00000253329.2	-	8	713	c.681G>T	c.(679-681)gtG>gtT	p.V227V		NM_139126.3	NP_624311.1	Q8WUA2	PPIL4_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 4	227					protein folding (GO:0006457)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	13		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.11e-11)|GBM - Glioblastoma multiforme(68;0.0885)		GTAGGTCTCCCACCTAAATTA	0.338																																																	0													76.0	71.0	72.0					6																	149847910		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34550.1	6q25.1	2013-02-12			ENSG00000131013	ENSG00000131013		"""RNA binding motif (RRM) containing"""	15702	protein-coding gene	gene with protein product		607609					Standard	NM_139126		Approved		uc003qmo.2	Q8WUA2	OTTHUMG00000015788	ENST00000253329.2:c.681G>T	6.37:g.149847910C>A			B2RD34|Q7Z3Q5	Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_RRM_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.V227	ENST00000253329.2	37	c.681	CCDS34550.1	6																																																																																			PPIL4	-	NULL	ENSG00000131013		0.338	PPIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL4	HGNC	protein_coding	OTTHUMT00000042642.1		0.00	38	0	C			149847910	-1			no_errors	ENST00000253329	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.997	A
PPL	5493	genome.wustl.edu	37	16	4935090	4935090	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:4935090G>T	ENST00000345988.2	-	22	3655	c.3566C>A	c.(3565-3567)gCg>gAg	p.A1189E	PPL_ENST00000590782.2_Missense_Mutation_p.A1187E	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1189					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.A1189V(1)		breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						GCGGAGGTTCGCCACTTCACT	0.632																																																	1	Substitution - Missense(1)	endometrium(1)											84.0	77.0	79.0					16																	4935090		2197	4300	6497	SO:0001583	missense	0			AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.3566C>A	16.37:g.4935090G>T	ENSP00000340510:p.Ala1189Glu		O60314|O60454|Q14C98	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.A1189E	ENST00000345988.2	37	c.3566	CCDS10526.1	16	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582875	0.65992	.	.	ENSG00000118898	ENST00000345988	T	0.54479	0.57	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.71281	0.3321	M	0.65975	2.015	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.64968	-0.6282	10	0.23891	T	0.37	.	19.7311	0.96182	0.0:0.0:1.0:0.0	.	1189	O60437	PEPL_HUMAN	E	1189	ENSP00000340510:A1189E	ENSP00000340510:A1189E	A	-	2	0	PPL	4875091	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	9.827000	0.99397	2.677000	0.91161	0.561000	0.74099	GCG	PPL	-	NULL	ENSG00000118898		0.632	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPL	HGNC	protein_coding	OTTHUMT00000251715.1		0.00	18	0	G	NM_002705		4935090	-1			no_errors	ENST00000345988	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
PQLC2	54896	genome.wustl.edu	37	1	19653743	19653743	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:19653743G>T	ENST00000375153.3	+	7	1281	c.641G>T	c.(640-642)gGg>gTg	p.G214V	PQLC2_ENST00000400548.2_Missense_Mutation_p.G149V|PQLC2_ENST00000375155.3_Missense_Mutation_p.G214V	NM_001040125.1	NP_001035214.1	Q6ZP29	LAAT1_HUMAN	PQ loop repeat containing 2	214	PQ-loop 2.				amino acid homeostasis (GO:0080144)|arginine transport (GO:0015809)|lysine transport (GO:0015819)	integral component of organelle membrane (GO:0031301)|lysosomal membrane (GO:0005765)	arginine transmembrane transporter activity (GO:0015181)|basic amino acid transmembrane transporter activity (GO:0015174)|L-lysine transmembrane transporter activity (GO:0015189)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(1)	10		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00049)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;1.89e-05)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00124)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		TCCACCCAGGGGATCTCCTAC	0.602																																																	0													70.0	69.0	69.0					1																	19653743		2203	4300	6503	SO:0001583	missense	0			BC015324	CCDS195.2, CCDS30618.1	1p36.13	2013-10-11			ENSG00000040487	ENSG00000040487			26001	protein-coding gene	gene with protein product		614760				23169667	Standard	XM_005245915		Approved	FLJ20320	uc001bby.3	Q6ZP29	OTTHUMG00000002521	ENST00000375153.3:c.641G>T	1.37:g.19653743G>T	ENSP00000364295:p.Gly214Val		B3KWQ5|Q6ZMJ3|Q6ZP27|Q9NXC7	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt,smart_CTNS	p.G214V	ENST00000375153.3	37	c.641	CCDS195.2	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021281	0.75275	.	.	ENSG00000040487	ENST00000375155;ENST00000375153;ENST00000400548	D;D;D	0.99511	-6.05;-6.05;-6.05	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.99718	0.9891	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97241	0.9891	10	0.87932	D	0	-13.6572	17.2096	0.86927	0.0:0.0:1.0:0.0	.	214	Q6ZP29	PQLC2_HUMAN	V	214;214;149	ENSP00000364297:G214V;ENSP00000364295:G214V;ENSP00000383395:G149V	ENSP00000364295:G214V	G	+	2	0	PQLC2	19526330	1.000000	0.71417	0.971000	0.41717	0.457000	0.32468	9.558000	0.98132	2.414000	0.81942	0.484000	0.47621	GGG	PQLC2	-	smart_CTNS	ENSG00000040487		0.602	PQLC2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PQLC2	HGNC	protein_coding	OTTHUMT00000007255.1		0.00	47	0	G	NM_017765		19653743	+1			no_errors	ENST00000375153	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
PRDM6	93166	genome.wustl.edu	37	5	122435621	122435621	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:122435621G>T	ENST00000407847.4	+	3	1279	c.865G>T	c.(865-867)Gca>Tca	p.A289S	PRDM6_ENST00000464424.1_3'UTR	NM_001136239.1	NP_001129711.1	Q9NQX0	PRDM6_HUMAN	PR domain containing 6	289	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				negative regulation of smooth muscle cell differentiation (GO:0051151)|negative regulation of transcription, DNA-templated (GO:0045892)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	7						GAAGGTGCAGGCAGGCGCCGT	0.677																																																	0													18.0	20.0	20.0					5																	122435621		691	1591	2282	SO:0001583	missense	0			AF272898	CCDS47259.1	5q21-q23	2013-01-08			ENSG00000061455	ENSG00000061455		"""Zinc fingers, C2H2-type"""	9350	protein-coding gene	gene with protein product							Standard	NM_001136239		Approved		uc003kti.3	Q9NQX0	OTTHUMG00000150469	ENST00000407847.4:c.865G>T	5.37:g.122435621G>T	ENSP00000384725:p.Ala289Ser		B5MCJ4|Q9NQW9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A289S	ENST00000407847.4	37	c.865	CCDS47259.1	5	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491911	0.44352	.	.	ENSG00000061455	ENST00000407847	T	0.72505	-0.66	5.91	3.12	0.35913	SET domain (3);	0.422973	0.25839	N	0.027967	T	0.50854	0.1640	N	0.14661	0.345	0.31300	N	0.688367	B	0.10296	0.003	B	0.12837	0.008	T	0.52631	-0.8550	10	0.49607	T	0.09	-7.3359	8.6695	0.34140	0.3617:0.0:0.6383:0.0	.	289	Q9NQX0	PRDM6_HUMAN	S	289	ENSP00000384725:A289S	ENSP00000384725:A289S	A	+	1	0	PRDM6	122463520	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.969000	0.29370	0.819000	0.34492	0.655000	0.94253	GCA	PRDM6	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000061455		0.677	PRDM6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM6	HGNC	protein_coding	OTTHUMT00000318226.2		0.00	23	0	G	XM_049619		122435621	+1			no_errors	ENST00000407847	ensembl	human	known	74_37	missense	11.90	37	5	SNP	0.988	T
PRKCD	5580	genome.wustl.edu	37	3	53215231	53215231	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:53215231G>T	ENST00000394729.2	+	4	652	c.324G>T	c.(322-324)ctG>ctT	p.L108L	PRKCD_ENST00000330452.3_Silent_p.L108L	NM_212539.1	NP_997704.1	Q05655	KPCD_HUMAN	protein kinase C, delta	108					activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular senescence (GO:0090398)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-10 production (GO:0032613)|interleukin-12 production (GO:0032615)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|mRNA metabolic process (GO:0016071)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of filopodium assembly (GO:0051490)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil activation (GO:0042119)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of ceramide biosynthetic process (GO:2000304)|positive regulation of glucosylceramide catabolic process (GO:2000753)|positive regulation of phospholipid scramblase activity (GO:1900163)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sphingomyelin catabolic process (GO:2000755)|positive regulation of superoxide anion generation (GO:0032930)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of receptor activity (GO:0010469)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|termination of signal transduction (GO:0023021)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-independent protein kinase C activity (GO:0004699)|enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)|insulin receptor substrate binding (GO:0043560)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)	Ingenol Mebutate(DB05013)|Tamoxifen(DB00675)	AGCTGGACCTGCAGCCTCAGG	0.632																																																	0													53.0	46.0	48.0					3																	53215231		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2870.1	3p21.31	2009-07-10			ENSG00000163932	ENSG00000163932	2.7.11.1		9399	protein-coding gene	gene with protein product		176977				8188219	Standard	NM_006254		Approved		uc003dgm.3	Q05655	OTTHUMG00000133659	ENST00000394729.2:c.324G>T	3.37:g.53215231G>T			B0KZ81|B2R834|Q15144|Q86XJ6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Prot_kin_PKC_delta,prints_DAG/PE-bd,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.L108	ENST00000394729.2	37	c.324	CCDS2870.1	3																																																																																			PRKCD	-	superfamily_C2_dom,pirsf_Prot_kin_PKC_delta	ENSG00000163932		0.632	PRKCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCD	HGNC	protein_coding	OTTHUMT00000257818.1	-	0.00	30	0	G			53215231	+1	tier1	-	no_errors	ENST00000330452	ensembl	human	known	74_37	silent	8.51	43	4	SNP	0.990	T
PROCR	10544	genome.wustl.edu	37	20	33762569	33762569	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:33762569G>T	ENST00000216968.4	+	2	217	c.135G>T	c.(133-135)caG>caT	p.Q45H	EDEM2_ENST00000540582.1_Intron	NM_006404.3	NP_006395.2	Q9UNN8	EPCR_HUMAN	protein C receptor, endothelial	45					antigen processing and presentation (GO:0019882)|blood coagulation (GO:0007596)|immune response (GO:0006955)|negative regulation of coagulation (GO:0050819)	cell surface (GO:0009986)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10			BRCA - Breast invasive adenocarcinoma(18;0.0152)		Drotrecogin alfa(DB00055)	TGTGGTACCAGGGCAACGCGT	0.622																																																	0													103.0	91.0	95.0					20																	33762569		2203	4300	6503	SO:0001583	missense	0			L35545	CCDS13248.1	20q11.2	2010-05-04	2010-05-04		ENSG00000101000	ENSG00000101000		"""CD molecules"""	9452	protein-coding gene	gene with protein product		600646				7929370, 10518938	Standard	NM_006404		Approved	EPCR, CCD41, CD201	uc002xbt.3	Q9UNN8	OTTHUMG00000032323	ENST00000216968.4:c.135G>T	20.37:g.33762569G>T	ENSP00000216968:p.Gln45His		B2RC04|Q14218|Q6IB56|Q96CB3|Q9ULX1	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.Q45H	ENST00000216968.4	37	c.135	CCDS13248.1	20	.	.	.	.	.	.	.	.	.	.	g	11.81	1.750054	0.30955	.	.	ENSG00000101000	ENST00000374477;ENST00000216968	D	0.82803	-1.65	5.22	0.669	0.17918	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.593539	0.16196	N	0.225145	T	0.76807	0.4039	M	0.70595	2.14	0.29431	N	0.859887	B	0.33904	0.431	B	0.34093	0.175	T	0.65220	-0.6221	10	0.27082	T	0.32	-0.1878	5.1666	0.15088	0.204:0.3398:0.4562:0.0	.	45	Q9UNN8	EPCR_HUMAN	H	45	ENSP00000216968:Q45H	ENSP00000216968:Q45H	Q	+	3	2	PROCR	33226230	0.094000	0.21725	0.836000	0.33094	0.977000	0.68977	0.120000	0.15647	-0.103000	0.12175	-0.265000	0.10407	CAG	PROCR	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000101000		0.622	PROCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROCR	HGNC	protein_coding	OTTHUMT00000078843.3	-	0.00	58	0	G			33762569	+1	tier1	-	no_errors	ENST00000216968	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.916	T
PRRT4	401399	genome.wustl.edu	37	7	127999678	127999678	+	Missense_Mutation	SNP	C	C	T	rs573263452		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:127999678C>T	ENST00000446477.2	-	3	681	c.368G>A	c.(367-369)cGg>cAg	p.R123Q	PRRT4_ENST00000435512.1_Missense_Mutation_p.R123Q|PRRT4_ENST00000535159.1_Missense_Mutation_p.R123Q|PRRT4_ENST00000489835.2_Missense_Mutation_p.R123Q	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	123						integral component of membrane (GO:0016021)		p.R123Q(1)		endometrium(4)|prostate(1)	5						GGAGGAGGCCCGGGGCTTTGA	0.667																																																	1	Substitution - Missense(1)	endometrium(1)											17.0	21.0	20.0					7																	127999678		692	1591	2283	SO:0001583	missense	0			BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.368G>A	7.37:g.127999678C>T	ENSP00000415026:p.Arg123Gln		A4D0Z9|C9JVW7	Missense_Mutation	SNP	NULL	p.R123Q	ENST00000446477.2	37	c.368	CCDS55160.1	7	.	.	.	.	.	.	.	.	.	.	C	6.204	0.405706	0.11754	.	.	ENSG00000224940	ENST00000489835;ENST00000446477;ENST00000535159;ENST00000435512;ENST00000489517;ENST00000464607;ENST00000495931	.	.	.	5.27	2.34	0.29019	.	.	.	.	.	T	0.21227	0.0511	N	0.08118	0	0.09310	N	0.999997	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.0	T	0.20806	-1.0264	8	0.24483	T	0.36	-1.0E-4	8.386	0.32501	0.0:0.7537:0.1523:0.094	.	123;123	C9JH25;C9JH25-2	PRRT4_HUMAN;.	Q	123	.	ENSP00000410779:R123Q	R	-	2	0	PRRT4	127786914	0.015000	0.18098	0.929000	0.37066	0.002000	0.02628	0.155000	0.16362	0.622000	0.30249	-1.247000	0.01520	CGG	PRRT4	-	NULL	ENSG00000224940		0.667	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT4	HGNC	protein_coding		-	0.00	58	0	C	NM_001114726		127999678	-1	tier1	-	no_errors	ENST00000446477	ensembl	human	known	74_37	missense	12.73	48	7	SNP	0.524	T
PRTN3	5657	genome.wustl.edu	37	19	847929	847929	+	Missense_Mutation	SNP	G	G	T	rs369029250		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:847929G>T	ENST00000234347.5	+	5	777	c.731G>T	c.(730-732)cGt>cTt	p.R244L	PRTN3_ENST00000544537.2_Missense_Mutation_p.R203L	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	244	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTGGATCCGTTCCACGCTG	0.657																																																	0													57.0	43.0	48.0					19																	847929		2203	4300	6503	SO:0001583	missense	0				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.731G>T	19.37:g.847929G>T	ENSP00000234347:p.Arg244Leu		P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R244L	ENST00000234347.5	37	c.731	CCDS32860.1	19	.	.	.	.	.	.	.	.	.	.	G	10.91	1.483838	0.26598	.	.	ENSG00000196415	ENST00000234347;ENST00000544537	T	0.58652	0.32	2.58	-3.76	0.04359	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	.	.	.	.	T	0.32406	0.0828	N	0.12611	0.24	0.09310	N	1	B	0.29136	0.234	B	0.20184	0.028	T	0.14643	-1.0465	9	0.56958	D	0.05	.	8.0646	0.30652	0.7643:0.0:0.2357:0.0	.	244	P24158	PRTN3_HUMAN	L	244;203	ENSP00000234347:R244L	ENSP00000234347:R244L	R	+	2	0	PRTN3	798929	0.000000	0.05858	0.002000	0.10522	0.012000	0.07955	-0.198000	0.09505	-0.706000	0.05028	-0.643000	0.03959	CGT	PRTN3	-	superfamily_Trypsin-like_Pept_dom,pfscan_Peptidase_S1	ENSG00000196415		0.657	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	HGNC	protein_coding	OTTHUMT00000457888.2		0.00	15	0	G	NM_002777		847929	+1			no_errors	ENST00000234347	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.001	T
PSMC4	5704	genome.wustl.edu	37	19	40486575	40486575	+	Missense_Mutation	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:40486575C>T	ENST00000157812.2	+	10	1292	c.1094C>T	c.(1093-1095)gCc>gTc	p.A365V	PSMC4_ENST00000455878.2_Missense_Mutation_p.A334V	NM_006503.3|NM_153001.2	NP_006494.1|NP_694546.1	P43686	PRS6B_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 4	365					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|blastocyst development (GO:0001824)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|inclusion body (GO:0016234)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					GCAGATGTGGCCCGGCCAGAT	0.532																																					Colon(105;1478 1543 4034 6132 38638)												0													149.0	145.0	146.0					19																	40486575		2203	4300	6503	SO:0001583	missense	0			U27515	CCDS12547.1, CCDS46076.1	19q13.11-q13.13	2010-04-21			ENSG00000013275	ENSG00000013275		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9551	protein-coding gene	gene with protein product	"""protease 26S subunit 6"", ""Tat-binding protein 7"", ""MB67 interacting protein"""	602707		MIP224		9473509, 8603043	Standard	NM_006503		Approved	TBP7, S6, MGC8570, MGC13687, MGC23214, TBP-7	uc002omq.4	P43686		ENST00000157812.2:c.1094C>T	19.37:g.40486575C>T	ENSP00000157812:p.Ala365Val		Q96FV5|Q9UBM3|Q9UEX3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.A365V	ENST00000157812.2	37	c.1094	CCDS12547.1	19	.	.	.	.	.	.	.	.	.	.	c	18.30	3.594729	0.66219	.	.	ENSG00000013275	ENST00000157812;ENST00000455878	D;D	0.95001	-3.58;-3.58	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.93651	0.7972	M	0.72479	2.2	0.80722	D	1	P;P	0.45672	0.696;0.864	B;B	0.43867	0.373;0.434	D	0.92037	0.5638	10	0.12430	T	0.62	-14.5693	16.9981	0.86373	0.0:1.0:0.0:0.0	.	334;365	P43686-2;P43686	.;PRS6B_HUMAN	V	365;334	ENSP00000157812:A365V;ENSP00000413869:A334V	ENSP00000157812:A365V	A	+	2	0	PSMC4	45178415	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.728000	0.74769	2.607000	0.88179	0.561000	0.74099	GCC	PSMC4	-	superfamily_P-loop_NTPase,tigrfam_26S_Psome_P45	ENSG00000013275		0.532	PSMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC4	HGNC	protein_coding	OTTHUMT00000462485.1		0.00	53	0	C	NM_006503		40486575	+1			no_errors	ENST00000157812	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
PTPRO	5800	genome.wustl.edu	37	12	15747947	15747947	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr12:15747947T>C	ENST00000281171.4	+	26	3953	c.3623T>C	c.(3622-3624)gTc>gCc	p.V1208A	PTPRO_ENST00000544244.1_Missense_Mutation_p.V369A|PTPRO_ENST00000542557.1_Missense_Mutation_p.V369A|PTPRO_ENST00000348962.2_Missense_Mutation_p.V1180A|PTPRO_ENST00000445537.2_Missense_Mutation_p.V397A|PTPRO_ENST00000442921.2_Missense_Mutation_p.V397A	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	1208					axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				ATCAGTGATGTCATATACGAG	0.438																																																	0													140.0	121.0	127.0					12																	15747947		2203	4300	6503	SO:0001583	missense	0			U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.3623T>C	12.37:g.15747947T>C	ENSP00000281171:p.Val1208Ala		A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V1208A	ENST00000281171.4	37	c.3623	CCDS8675.1	12	.	.	.	.	.	.	.	.	.	.	T	21.6	4.167311	0.78339	.	.	ENSG00000151490	ENST00000281171;ENST00000348962;ENST00000442921;ENST00000542557;ENST00000445537;ENST00000544244	T;T;T;T;T;T	0.04049	3.72;3.88;3.75;3.8;3.75;3.8	4.83	4.83	0.62350	.	0.000000	0.39146	N	0.001444	T	0.07999	0.0200	L	0.41573	1.285	0.50039	D	0.999846	B;D;P	0.57571	0.058;0.98;0.935	B;P;B	0.51229	0.024;0.663;0.315	T	0.47262	-0.9131	10	0.12766	T	0.61	.	14.5704	0.68208	0.0:0.0:0.0:1.0	.	369;1180;1208	Q9UBT5;Q16827-2;Q16827	.;.;PTPRO_HUMAN	A	1208;1180;397;369;397;369	ENSP00000281171:V1208A;ENSP00000343434:V1180A;ENSP00000404188:V397A;ENSP00000437571:V369A;ENSP00000393449:V397A;ENSP00000439234:V369A	ENSP00000281171:V1208A	V	+	2	0	PTPRO	15639214	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.516000	0.81772	2.028000	0.59812	0.533000	0.62120	GTC	PTPRO	-	NULL	ENSG00000151490		0.438	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRO	HGNC	protein_coding	OTTHUMT00000401079.1		0.00	39	0	T			15747947	+1			no_errors	ENST00000281171	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	C
RAB17	64284	genome.wustl.edu	37	2	238486700	238486700	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:238486700G>T	ENST00000264601.3	-	3	885	c.256C>A	c.(256-258)Ctc>Atc	p.L86I	RAB17_ENST00000409822.1_5'UTR|RAB17_ENST00000409576.1_Intron|RAB17_ENST00000538644.1_Intron	NM_022449.3	NP_071894.1	Q9H0T7	RAB17_HUMAN	RAB17, member RAS oncogene family	86					cilium assembly (GO:0042384)|endocytic recycling (GO:0032456)|establishment of melanosome localization (GO:0032401)|filopodium assembly (GO:0046847)|GTP catabolic process (GO:0006184)|immunoglobulin transcytosis in epithelial cells mediated by polymeric immunoglobulin receptor (GO:0002415)|melanosome transport (GO:0032402)|protein transport (GO:0015031)|regulation of dendrite development (GO:0050773)|regulation of filopodium assembly (GO:0051489)|regulation of synapse assembly (GO:0051963)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|melanosome (GO:0042470)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(1)	4		Renal(207;0.00272)|Breast(86;0.00297)|all_hematologic(139;0.182)|Ovarian(221;0.221)		Epithelial(121;9.36e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.26e-10)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000354)|Lung(119;0.011)|LUSC - Lung squamous cell carcinoma(224;0.026)		CTGAAGTAGAGGTGGCAGACG	0.597																																					Colon(56;987 1029 6466 13943 27336)												0													91.0	81.0	84.0					2																	238486700		2203	4300	6503	SO:0001583	missense	0			AK022600	CCDS2520.1	2q37.3	2008-05-23			ENSG00000124839	ENSG00000124839		"""RAB, member RAS oncogene"""	16523	protein-coding gene	gene with protein product		602206				9624171	Standard	NM_022449		Approved		uc002vwz.2	Q9H0T7	OTTHUMG00000133299	ENST00000264601.3:c.256C>A	2.37:g.238486700G>T	ENSP00000264601:p.Leu86Ile		Q53QV6|Q6IA73|Q6PJZ0|Q9BVU1|Q9H9U9	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L86I	ENST00000264601.3	37	c.256	CCDS2520.1	2	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911098	0.72983	.	.	ENSG00000124839	ENST00000264601;ENST00000411462	T;T	0.80480	-1.38;-1.38	4.44	1.39	0.22231	Small GTP-binding protein domain (1);	0.000000	0.48286	D	0.000191	T	0.63522	0.2518	N	0.12569	0.235	0.80722	D	1	B	0.29716	0.255	B	0.35312	0.2	T	0.56001	-0.8051	10	0.52906	T	0.07	3.3445	6.5471	0.22412	0.0859:0.0:0.4649:0.4492	.	86	Q9H0T7	RAB17_HUMAN	I	86;64	ENSP00000264601:L86I;ENSP00000400240:L64I	ENSP00000264601:L86I	L	-	1	0	RAB17	238151439	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	2.556000	0.45862	0.309000	0.22966	0.609000	0.83330	CTC	RAB17	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000124839		0.597	RAB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB17	HGNC	protein_coding	OTTHUMT00000257084.2	-	0.00	46	0	G			238486700	-1	tier1	-	no_errors	ENST00000264601	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
RBM27	54439	genome.wustl.edu	37	5	145647319	145647320	+	Frame_Shift_Ins	INS	-	-	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:145647319_145647320insA	ENST00000265271.5	+	15	2605_2606	c.2439_2440insA	c.(2440-2442)aaafs	p.K814fs	RBM27_ENST00000506502.1_Frame_Shift_Ins_p.K759fs	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	814					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.K816fs*5(1)		NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AAGAAGTGCTTAAAAAAAAACA	0.351																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2448dupA	5.37:g.145647328_145647328dupA	ENSP00000265271:p.Lys814fs		Q8IYW9	Frame_Shift_Ins	INS	pfam_PWI_dom,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.Q816fs	ENST00000265271.5	37	c.2439_2440	CCDS43378.1	5																																																																																			RBM27	-	NULL	ENSG00000091009		0.351	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1		0.00	72	0	-	XM_291128		145647320	+1	tier1		no_errors	ENST00000265271	ensembl	human	known	74_37	frame_shift_ins	12.77	41	6	INS	1.000:1.000	A
RBM47	54502	genome.wustl.edu	37	4	40428047	40428047	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:40428047G>T	ENST00000381793.2	-	6	2052	c.1656C>A	c.(1654-1656)atC>atA	p.I552I	RBM47_ENST00000319592.4_Silent_p.I483I|RBM47_ENST00000514014.1_Silent_p.I514I|RP11-588L15.2_ENST00000514187.1_RNA|RBM47_ENST00000381795.6_Silent_p.I483I|RBM47_ENST00000295971.7_Silent_p.I552I			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	552	Ala-rich.				hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						GTAGTGTGGCGATCGTGGCTG	0.587																																																	0													84.0	74.0	77.0					4																	40428047		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.1656C>A	4.37:g.40428047G>T			A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.I552	ENST00000381793.2	37	c.1656	CCDS43223.1	4																																																																																			RBM47	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000163694		0.587	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM47	HGNC	protein_coding	OTTHUMT00000250456.2		0.00	41	0	G	NM_019027		40428047	-1			no_errors	ENST00000295971	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.993	T
RERE	473	genome.wustl.edu	37	1	8420002	8420002	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:8420002G>T	ENST00000337907.3	-	20	4074	c.3440C>A	c.(3439-3441)aCa>aAa	p.T1147K	RERE_ENST00000400908.2_Missense_Mutation_p.T1147K|RERE_ENST00000400907.2_Intron|RERE_ENST00000377464.1_Missense_Mutation_p.T879K|RERE_ENST00000476556.1_Missense_Mutation_p.T593K	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	1147					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GTACAGGTCTGTCCGGGCACA	0.617																																																	0													59.0	62.0	61.0					1																	8420002		2203	4300	6503	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.3440C>A	1.37:g.8420002G>T	ENSP00000338629:p.Thr1147Lys		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.T1147K	ENST00000337907.3	37	c.3440	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875934	0.91664	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T;T	0.67345	-0.26;-0.25;0.97;-0.26	5.43	5.43	0.79202	.	.	.	.	.	T	0.80417	0.4619	M	0.72894	2.215	0.58432	D	0.999999	D	0.60160	0.987	D	0.63192	0.912	T	0.82478	-0.0437	9	0.87932	D	0	-8.9315	18.2223	0.89905	0.0:0.0:1.0:0.0	.	1147	Q9P2R6	RERE_HUMAN	K	1147;879;593;1147	ENSP00000338629:T1147K;ENSP00000366684:T879K;ENSP00000422246:T593K;ENSP00000383700:T1147K	ENSP00000338629:T1147K	T	-	2	0	RERE	8342589	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	9.782000	0.99034	2.532000	0.85374	0.561000	0.74099	ACA	RERE	-	pfam_Atrophin-like	ENSG00000142599		0.617	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1		0.00	50	0	G			8420002	-1			no_errors	ENST00000337907	ensembl	human	known	74_37	missense	5.08	56	3	SNP	1.000	T
RGAG4	340526	genome.wustl.edu	37	X	71349976	71349976	+	Missense_Mutation	SNP	G	G	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:71349976G>C	ENST00000545866.1	-	1	1782	c.1415C>G	c.(1414-1416)cCg>cGg	p.P472R	NHSL2_ENST00000540800.1_Intron|RGAG4_ENST00000609883.1_Missense_Mutation_p.P472R	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	472										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					AACAAAGGTCGGCTCCATCTC	0.557																																																	0													135.0	137.0	136.0					X																	71349976		2166	4228	6394	SO:0001583	missense	0			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1415C>G	X.37:g.71349976G>C	ENSP00000441366:p.Pro472Arg		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom	p.P472R	ENST00000545866.1	37	c.1415	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	G	11.47	1.648768	0.29336	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.53206	0.63;0.63	3.87	0.912	0.19349	.	.	.	.	.	T	0.27489	0.0675	N	0.19112	0.55	0.09310	N	1	P	0.46621	0.881	B	0.40165	0.321	T	0.09443	-1.0674	8	.	.	.	-0.1933	5.2834	0.15688	0.1108:0.0:0.503:0.3862	.	472	Q5HYW3	RGAG4_HUMAN	R	472	ENSP00000441366:P472R;ENSP00000418667:P472R	.	P	-	2	0	RGAG4	71266701	0.009000	0.17119	0.000000	0.03702	0.196000	0.23810	0.758000	0.26447	0.048000	0.15891	0.500000	0.49745	CCG	RGAG4	-	NULL	ENSG00000242732		0.557	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	-	0.00	31	0	G	NM_001024455		71349976	-1	tier1	-	no_errors	ENST00000479991	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.003	C
RNF217	154214	genome.wustl.edu	37	6	125284478	125284478	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:125284478G>T	ENST00000521654.2	+	1	788	c.788G>T	c.(787-789)tGc>tTc	p.C263F	RP11-510H23.1_ENST00000439075.1_RNA|RNF217_ENST00000560949.1_Missense_Mutation_p.C28F			Q8TC41	RN217_HUMAN	ring finger protein 217	263					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		GTGCTGATGTGCCGGGTGTGC	0.632																																																	0																																										SO:0001583	missense	0			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.788G>T	6.37:g.125284478G>T	ENSP00000428698:p.Cys263Phe		H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_C6HC	p.C28F	ENST00000521654.2	37	c.83		6	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521479	0.64747	.	.	ENSG00000146373	ENST00000521654	.	.	.	4.68	4.68	0.58851	.	.	.	.	.	T	0.75838	0.3904	.	.	.	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.79773	-0.1662	7	0.87932	D	0	.	17.3716	0.87380	0.0:0.0:1.0:0.0	.	28	F2Z2M4	.	F	28	.	ENSP00000428698:C28F	C	+	2	0	RNF217	125326177	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.193000	0.89719	2.401000	0.81631	0.563000	0.77884	TGC	RNF217	-	NULL	ENSG00000146373		0.632	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	HGNC	protein_coding	OTTHUMT00000042063.3	-	0.00	31	0	G	NM_152553		125284478	+1	tier1	-	no_errors	ENST00000560949	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
ROR2	4920	genome.wustl.edu	37	9	94485362	94485362	+	3'UTR	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:94485362C>A	ENST00000375708.3	-	0	3612				ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Intron	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CAGGAACTCCCATTTCAGAAG	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.*582G>T	9.37:g.94485362C>A			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	RNA	SNP	-	NULL	ENST00000375708.3	37	NULL	CCDS6691.1	9																																																																																			ROR2	-	-	ENSG00000169071		0.463	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	-	0.00	32	0	C			94485362	-1	tier1	-	no_errors	ENST00000550066	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.000	A
RREB1	6239	genome.wustl.edu	37	6	7246768	7246768	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:7246768G>T	ENST00000349384.6	+	11	4234	c.3920G>T	c.(3919-3921)gGg>gTg	p.G1307V	RREB1_ENST00000334984.6_Intron|RREB1_ENST00000379933.3_Missense_Mutation_p.G1307V|RREB1_ENST00000379938.2_Missense_Mutation_p.G1362V	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1307					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				CAGGTCGCAGGGGATGCGCCT	0.711																																																	0													21.0	22.0	22.0					6																	7246768		2121	4141	6262	SO:0001583	missense	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.3920G>T	6.37:g.7246768G>T	ENSP00000305560:p.Gly1307Val		A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G1362V	ENST00000349384.6	37	c.4085	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	G	12.10	1.837139	0.32513	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384	T;T;T	0.10192	2.99;2.9;2.99	5.18	-4.19	0.03835	.	1.255130	0.05637	N	0.582707	T	0.01765	0.0056	N	0.22421	0.69	0.09310	N	0.999996	B;B	0.23650	0.089;0.034	B;B	0.24155	0.051;0.023	T	0.45323	-0.9269	10	0.87932	D	0	0.1991	1.1566	0.01797	0.3943:0.2646:0.2118:0.1293	.	1307;1362	Q92766;Q92766-2	RREB1_HUMAN;.	V	1307;1362;1307	ENSP00000369265:G1307V;ENSP00000369270:G1362V;ENSP00000305560:G1307V	ENSP00000305560:G1307V	G	+	2	0	RREB1	7191767	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.209000	0.17435	-1.095000	0.03050	-0.136000	0.14681	GGG	RREB1	-	NULL	ENSG00000124782		0.711	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	-	0.00	27	0	G			7246768	+1	tier1	-	no_errors	ENST00000379938	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.000	T
SACM1L	22908	genome.wustl.edu	37	3	45761072	45761072	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:45761072G>T	ENST00000389061.5	+	8	862	c.658G>T	c.(658-660)Ggt>Tgt	p.G220C	SACM1L_ENST00000541314.1_Missense_Mutation_p.G159C|SACM1L_ENST00000418611.1_Missense_Mutation_p.G117C	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	220	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TTTCAGAGCTGGTGTGCGCTA	0.348																																																	0													136.0	134.0	135.0					3																	45761072		2203	4300	6503	SO:0001583	missense	0			AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.658G>T	3.37:g.45761072G>T	ENSP00000373713:p.Gly220Cys		A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.G220C	ENST00000389061.5	37	c.658	CCDS33745.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.146630	0.94603	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314	T;T;T	0.75821	-0.97;-0.97;-0.97	5.66	5.66	0.87406	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.92351	0.7573	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.94896	0.8052	10	0.87932	D	0	-4.1742	19.7441	0.96245	0.0:0.0:1.0:0.0	.	159;220	B4DK71;Q9NTJ5	.;SAC1_HUMAN	C	117;220;159	ENSP00000396387:G117C;ENSP00000373713:G220C;ENSP00000443373:G159C	ENSP00000373713:G220C	G	+	1	0	SACM1L	45736076	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.209000	0.95087	2.669000	0.90835	0.585000	0.79938	GGT	SACM1L	-	pfam_Syja_N,pfscan_Syja_N	ENSG00000211456		0.348	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACM1L	HGNC	protein_coding	OTTHUMT00000345065.2	-	0.00	63	0	G	NM_014016		45761072	+1	tier1	-	no_errors	ENST00000389061	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
SCD5	79966	genome.wustl.edu	37	4	83557883	83557883	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:83557883G>T	ENST00000319540.4	-	4	982	c.663C>A	c.(661-663)ttC>ttA	p.F221L		NM_001037582.2	NP_001032671.2	Q86SK9	SCD5_HUMAN	stearoyl-CoA desaturase 5	221					fatty acid biosynthetic process (GO:0006633)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	iron ion binding (GO:0005506)|stearoyl-CoA 9-desaturase activity (GO:0004768)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)	13		Colorectal(4;0.0323)|Hepatocellular(203;0.115)				TAGAGGCCAAGAAGTAGGAAT	0.532																																																	0													110.0	97.0	101.0					4																	83557883		2203	4300	6503	SO:0001583	missense	0			AF389338	CCDS3595.1, CCDS34024.1	4q21.3	2013-01-25	2005-06-09	2005-06-09	ENSG00000145284	ENSG00000145284		"""Fatty acid desaturases"""	21088	protein-coding gene	gene with protein product		608370	"""stearoyl-CoA desaturase 4"""	SCD4		12477932	Standard	NM_024906		Approved	ACOD4, FLJ21032, FADS4, HSCD5	uc003hna.2	Q86SK9	OTTHUMG00000130293	ENST00000319540.4:c.663C>A	4.37:g.83557883G>T	ENSP00000316329:p.Phe221Leu		B2RPG0|Q4W5Q5|Q8NDS0|Q9H7D1	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,prints_Fatty_acid_desaturase-1_core	p.F221L	ENST00000319540.4	37	c.663	CCDS34024.1	4	.	.	.	.	.	.	.	.	.	.	G	12.86	2.065543	0.36470	.	.	ENSG00000145284	ENST00000319540	T	0.13420	2.59	4.94	3.19	0.36642	Fatty acid desaturase, type 1 (1);	0.094927	0.85682	N	0.000000	T	0.10723	0.0262	L	0.31752	0.955	0.80722	D	1	B	0.24721	0.11	B	0.31016	0.123	T	0.13548	-1.0505	10	0.39692	T	0.17	-2.2591	8.3584	0.32344	0.3052:0.0:0.6948:0.0	.	221	Q86SK9	SCD5_HUMAN	L	221	ENSP00000316329:F221L	ENSP00000316329:F221L	F	-	3	2	SCD5	83776907	0.997000	0.39634	0.940000	0.37924	0.534000	0.34807	2.299000	0.43611	0.760000	0.33108	0.561000	0.74099	TTC	SCD5	-	pfam_Fatty_acid_desaturase-1	ENSG00000145284		0.532	SCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCD5	HGNC	protein_coding	OTTHUMT00000252635.1	-	0.00	47	0	G	NM_024906		83557883	-1	tier1	-	no_errors	ENST00000319540	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.937	T
SCO2	9997	genome.wustl.edu	37	22	50962417	50962417	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr22:50962417C>A	ENST00000543927.1	-	2	630	c.424G>T	c.(424-426)Gag>Tag	p.E142*	CTA-384D8.36_ENST00000608319.1_RNA|SCO2_ENST00000252785.3_Nonsense_Mutation_p.E142*|SCO2_ENST00000395693.3_Nonsense_Mutation_p.E142*|SCO2_ENST00000535425.1_Nonsense_Mutation_p.E142*	NM_001169109.1	NP_001162580.1	O43819	SCO2_HUMAN	SCO2 cytochrome c oxidase assembly protein	142	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|eye development (GO:0001654)|in utero embryonic development (GO:0001701)|muscle system process (GO:0003012)|oxidation-reduction process (GO:0055114)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|response to activity (GO:0014823)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|nucleus (GO:0005634)	copper ion binding (GO:0005507)			endometrium(1)|lung(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCAGCTTCTCCAGCTCGTCT	0.622																																																	0													56.0	54.0	54.0					22																	50962417		2203	4299	6502	SO:0001587	stop_gained	0			AL021683	CCDS14095.1	22q13.33	2014-01-30	2012-10-15		ENSG00000130489	ENSG00000130489		"""Mitochondrial respiratory chain complex assembly factors"""	10604	protein-coding gene	gene with protein product		604272	"""SCO (cytochrome oxidase deficient, yeast) homolog 2"", ""SCO cytochrome oxidase deficient homolog 2 (yeast)"", ""myopia 6"""	MYP6		10218584, 16091356, 23643385	Standard	NM_005138		Approved	SCO1L	uc003bma.3	O43819	OTTHUMG00000150251	ENST00000543927.1:c.424G>T	22.37:g.50962417C>A	ENSP00000444433:p.Glu142*		Q3T1B5|Q9UK87	Nonsense_Mutation	SNP	pfam_SCO1/SenC,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	p.E142*	ENST00000543927.1	37	c.424	CCDS14095.1	22	.	.	.	.	.	.	.	.	.	.	C	31	5.058683	0.93846	.	.	ENSG00000130489	ENST00000395693;ENST00000543927;ENST00000535425;ENST00000252785	.	.	.	4.86	3.81	0.43845	.	0.071995	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-31.4614	13.0911	0.59167	0.0:0.8372:0.1627:0.0	.	.	.	.	X	142	.	ENSP00000252785:E142X	E	-	1	0	SCO2	49309283	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.691000	0.47010	1.149000	0.42402	0.563000	0.77884	GAG	SCO2	-	pfam_SCO1/SenC,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	ENSG00000130489		0.622	SCO2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SCO2	HGNC	protein_coding	OTTHUMT00000317091.1	-	0.00	46	0	C	NM_005138		50962417	-1	tier1	-	no_errors	ENST00000252785	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	1.000	A
SECISBP2L	9728	genome.wustl.edu	37	15	49319645	49319645	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:49319645C>A	ENST00000559471.1	-	7	1215	c.952G>T	c.(952-954)Gca>Tca	p.A318S	SECISBP2L_ENST00000261847.3_Missense_Mutation_p.A318S	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	318							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						TTCTGAGTTGCCTGGCAAGTT	0.318																																																	0													103.0	101.0	102.0					15																	49319645		2197	4295	6492	SO:0001583	missense	0			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.952G>T	15.37:g.49319645C>A	ENSP00000453854:p.Ala318Ser		Q8N767	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.A318S	ENST00000559471.1	37	c.952	CCDS53942.1	15	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327042	0.81690	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	D	0.89552	-2.53	5.95	5.0	0.66597	.	0.156175	0.56097	D	0.000032	D	0.88273	0.6392	L	0.29908	0.895	0.37666	D	0.922946	P;D	0.55605	0.953;0.972	P;P	0.53912	0.551;0.737	D	0.90627	0.4564	10	0.62326	D	0.03	.	14.1789	0.65562	0.0:0.9245:0.0:0.0755	.	318;318	Q93073;Q93073-2	SBP2L_HUMAN;.	S	318	ENSP00000261847:A318S	ENSP00000261847:A318S	A	-	1	0	SECISBP2L	47106937	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.380000	0.59581	1.433000	0.47394	-0.345000	0.07892	GCA	SECISBP2L	-	NULL	ENSG00000138593		0.318	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	HGNC	protein_coding	OTTHUMT00000417277.1	-	0.00	47	0	C	NM_014701		49319645	-1	tier1	-	no_errors	ENST00000559471	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	A
SETBP1	26040	genome.wustl.edu	37	18	42643239	42643239	+	Missense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:42643239G>A	ENST00000282030.5	+	6	4663	c.4367G>A	c.(4366-4368)cGt>cAt	p.R1456H		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1456						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		AGGCGCGGGCGTCCCAGGAAG	0.557									Schinzel-Giedion syndrome																																								0													35.0	31.0	32.0					18																	42643239		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4367G>A	18.37:g.42643239G>A	ENSP00000282030:p.Arg1456His		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.R1456H	ENST00000282030.5	37	c.4367	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	32	5.116390	0.94385	.	.	ENSG00000152217	ENST00000282030	D	0.85411	-1.98	5.16	5.16	0.70880	AT hook, DNA-binding motif (1);	0.000000	0.64402	D	0.000001	D	0.89058	0.6607	L	0.34521	1.04	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	D	0.90342	0.4360	10	0.87932	D	0	.	18.6082	0.91273	0.0:0.0:1.0:0.0	.	1456	Q9Y6X0	SETBP_HUMAN	H	1456	ENSP00000282030:R1456H	ENSP00000282030:R1456H	R	+	2	0	SETBP1	40897237	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	9.721000	0.98766	2.556000	0.86216	0.563000	0.77884	CGT	SETBP1	-	smart_AT_hook_DNA-bd_motif	ENSG00000152217		0.557	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	12	0	G	NM_001130110		42643239	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	20.83	19	5	SNP	1.000	A
SLC12A1	6557	genome.wustl.edu	37	15	48537005	48537005	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr15:48537005G>T	ENST00000558405.1	+	10	1370	c.1356G>T	c.(1354-1356)ggG>ggT	p.G452G	SLC12A1_ENST00000396577.3_Silent_p.G452G|SLC12A1_ENST00000380993.3_Silent_p.G452G			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	452					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TCATTTCTGGGATGAACTGCA	0.473																																																	0													136.0	114.0	121.0					15																	48537005		2198	4297	6495	SO:0001819	synonymous_variant	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1356G>T	15.37:g.48537005G>T			A8JYA2|E9PDW4	Silent	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.G452	ENST00000558405.1	37	c.1356	CCDS10129.2	15																																																																																			SLC12A1	-	pfam_AA-permease/SLC12A_dom,prints_Na/K/Cl_cotranspt2,tigrfam_Na/K/Cl_cotransptS	ENSG00000074803		0.473	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	-	0.00	43	0	G			48537005	+1	tier1	-	no_errors	ENST00000380993	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.972	T
SLC16A6	9120	genome.wustl.edu	37	17	66267470	66267470	+	Missense_Mutation	SNP	G	G	T	rs370850876		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:66267470G>T	ENST00000327268.4	-	6	995	c.831C>A	c.(829-831)agC>agA	p.S277R	SLC16A6_ENST00000580666.1_Missense_Mutation_p.S277R|ARSG_ENST00000448504.2_Intron	NM_001174166.1	NP_001167637.1	O15403	MOT7_HUMAN	solute carrier family 16, member 6	277					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			large_intestine(3)|lung(8)|prostate(1)|skin(1)|urinary_tract(2)	15	all_cancers(12;1.24e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)		Pyruvic acid(DB00119)	CTTTCTTTTCGCTTGGCCTGG	0.458																																																	0								G	ARG/SER,ARG/SER,	0,4404		0,0,2202	70.0	70.0	70.0		831,831,	-3.5	0.0	17		70	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,intron	SLC16A6,ARSG	NM_001174166.1,NM_004694.4,NM_014960.3	110,110,	0,2,6500	TT,TG,GG		0.0233,0.0,0.0154	benign,benign,	277/524,277/524,	66267470	2,13002	2202	4300	6502	SO:0001583	missense	0			U79745	CCDS11675.1	17q24.2	2013-07-18	2013-07-18		ENSG00000108932	ENSG00000108932		"""Solute carriers"""	10927	protein-coding gene	gene with protein product		603880	"""solute carrier family 16 (monocarboxylic acid transporters), member 6"", ""solute carrier family 16, member 6 (monocarboxylic acid transporter 7)"""			9425115	Standard	NM_004694		Approved	MCT6, MCT7	uc002jgz.2	O15403	OTTHUMG00000179812	ENST00000327268.4:c.831C>A	17.37:g.66267470G>T	ENSP00000319991:p.Ser277Arg		Q6P1X3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S277R	ENST00000327268.4	37	c.831	CCDS11675.1	17	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.406971	0.01155	0.0	2.33E-4	ENSG00000108932	ENST00000327268	T	0.56611	0.45	4.47	-3.55	0.04639	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	3.721230	0.00531	N	0.000210	T	0.45458	0.1343	M	0.61703	1.905	0.09310	N	1	B	0.30605	0.287	B	0.33042	0.157	T	0.10753	-1.0616	10	0.14252	T	0.57	.	3.9137	0.09214	0.162:0.3031:0.4214:0.1135	.	277	O15403	MOT7_HUMAN	R	277	ENSP00000319991:S277R	ENSP00000319991:S277R	S	-	3	2	SLC16A6	63779065	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.149000	0.10204	-0.431000	0.07307	-1.277000	0.01392	AGC	SLC16A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000108932		0.458	SLC16A6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC16A6	HGNC	protein_coding	OTTHUMT00000448323.1	-	0.00	70	0	G	NM_004694		66267470	-1	tier1	-	no_errors	ENST00000327268	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.000	T
SLC17A6	57084	genome.wustl.edu	37	11	22399084	22399084	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:22399084G>T	ENST00000263160.3	+	12	1984	c.1547G>T	c.(1546-1548)tGt>tTt	p.C516F		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	516					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						GAAGAAAAATGTGGATTTATT	0.408																																																	0													69.0	76.0	73.0					11																	22399084		2201	4300	6501	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1547G>T	11.37:g.22399084G>T	ENSP00000263160:p.Cys516Phe		A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.C516F	ENST00000263160.3	37	c.1547	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483315	0.63962	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.61510	0.1	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.71206	2.165	0.80722	D	1	B	0.19935	0.04	B	0.18561	0.022	T	0.58912	-0.7552	10	0.56958	D	0.05	.	20.1588	0.98128	0.0:0.0:1.0:0.0	.	516	Q9P2U8	VGLU2_HUMAN	F	516;404	ENSP00000263160:C516F	ENSP00000263160:C516F	C	+	2	0	SLC17A6	22355660	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.770000	0.95276	0.563000	0.77884	TGT	SLC17A6	-	NULL	ENSG00000091664		0.408	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	-	0.00	41	0	G	NM_020346		22399084	+1	tier1	-	no_errors	ENST00000263160	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	T
SLC23A2	9962	genome.wustl.edu	37	20	4850569	4850569	+	Frame_Shift_Del	DEL	G	G	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:4850569delG	ENST00000379333.1	-	12	1625	c.1233delC	c.(1231-1233)cccfs	p.P411fs	SLC23A2_ENST00000424750.2_Frame_Shift_Del_p.P297fs|SNORA31_ENST00000516287.1_RNA|SLC23A2_ENST00000338244.1_Frame_Shift_Del_p.P411fs|SLC23A2_ENST00000468355.1_5'UTR	NM_203327.1	NP_976072.1	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (ascorbic acid transporter), member 2	411					L-ascorbic acid metabolic process (GO:0019852)|L-ascorbic acid transport (GO:0015882)|molecular hydrogen transport (GO:0015993)|nucleobase transport (GO:0015851)|nucleobase-containing compound metabolic process (GO:0006139)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|transepithelial L-ascorbic acid transport (GO:0070904)|vitamin metabolic process (GO:0006766)|vitamin transmembrane transport (GO:0035461)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	L-ascorbate:sodium symporter activity (GO:0008520)|L-ascorbic acid transporter activity (GO:0015229)|nucleobase transmembrane transporter activity (GO:0015205)|sodium-dependent L-ascorbate transmembrane transporter activity (GO:0070890)|sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.I412fs*4(1)		endometrium(1)|kidney(3)|large_intestine(9)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						TTGCGTGGATGGGGGGGGGTG	0.527																																																	1	Deletion - Frameshift(1)	ovary(1)											65.0	70.0	68.0					20																	4850569		2203	4300	6503	SO:0001589	frameshift_variant	0			AF058319	CCDS13085.1	20p13	2013-07-18	2013-07-18	2003-03-21	ENSG00000089057	ENSG00000089057		"""Solute carriers"""	10973	protein-coding gene	gene with protein product		603791	"""solute carrier family 23 (nucleobase transporters), member 1"""	SLC23A1		9804989, 10331392	Standard	NM_005116		Approved	SVCT2, KIAA0238, YSPL2	uc002wlh.1	Q9UGH3	OTTHUMG00000031793	ENST00000379333.1:c.1233delC	20.37:g.4850569delG	ENSP00000368637:p.Pro411fs		B4DJZ1|Q8WWR4|Q92512|Q96D54|Q9UNU1|Q9UP85	Frame_Shift_Del	DEL	pfam_Xant/urac/vitC	p.I412fs	ENST00000379333.1	37	c.1233	CCDS13085.1	20																																																																																			SLC23A2	-	pfam_Xant/urac/vitC	ENSG00000089057		0.527	SLC23A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC23A2	HGNC	protein_coding	OTTHUMT00000077832.1		0.00	36	0	G			4850569	-1	tier1		no_errors	ENST00000338244	ensembl	human	known	74_37	frame_shift_del	13.79	25	4	DEL	0.974	-
SLC4A3	6508	genome.wustl.edu	37	2	220505562	220505562	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:220505562G>T	ENST00000358055.3	+	22	4011	c.3499G>T	c.(3499-3501)Gca>Tca	p.A1167S	SLC4A3_ENST00000373762.3_Missense_Mutation_p.A1194S|SLC4A3_ENST00000373760.2_Missense_Mutation_p.A1167S|SLC4A3_ENST00000273063.6_Missense_Mutation_p.A1194S|SLC4A3_ENST00000317151.3_Missense_Mutation_p.A1167S			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	1167	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GGGCTGCATCGCACTGCTCTG	0.652																																																	0													72.0	57.0	62.0					2																	220505562		2203	4300	6503	SO:0001583	missense	0				CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.3499G>T	2.37:g.220505562G>T	ENSP00000350756:p.Ala1167Ser		A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.A1194S	ENST00000358055.3	37	c.3580	CCDS2445.1	2	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901879	0.92035	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.70399	-0.48;-0.48;-0.48;-0.48;-0.48	4.83	4.83	0.62350	.	0.203429	0.40908	D	0.000993	T	0.82061	0.4955	M	0.79693	2.465	0.37837	D	0.92891	P;P;P	0.52061	0.564;0.795;0.95	P;P;P	0.54965	0.526;0.587;0.765	D	0.86715	0.1938	10	0.66056	D	0.02	.	18.3098	0.90195	0.0:0.0:1.0:0.0	.	871;1167;1194	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	S	1167;1167;1194;1194;1167	ENSP00000350756:A1167S;ENSP00000362865:A1167S;ENSP00000273063:A1194S;ENSP00000362867:A1194S;ENSP00000314006:A1167S	ENSP00000273063:A1194S	A	+	1	0	SLC4A3	220213806	0.998000	0.40836	0.751000	0.31187	0.990000	0.78478	7.841000	0.86834	2.396000	0.81511	0.563000	0.77884	GCA	SLC4A3	-	tigrfam_HCO3_transpt_euk	ENSG00000114923		0.652	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	HGNC	protein_coding	OTTHUMT00000316472.1		0.00	27	0	G	NM_005070		220505562	+1			no_errors	ENST00000273063	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.940	T
SLIT3	6586	genome.wustl.edu	37	5	168112909	168112909	+	Missense_Mutation	SNP	G	G	T	rs146512576	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:168112909G>T	ENST00000519560.1	-	31	3757	c.3338C>A	c.(3337-3339)cCa>cAa	p.P1113Q	SLIT3_ENST00000332966.8_Missense_Mutation_p.P1120Q|SLIT3_ENST00000404867.3_Missense_Mutation_p.P1113Q	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1113					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACCATGGGTGGGGGGTGTTC	0.602																																					Ovarian(29;311 847 10864 17279 24903)												0													27.0	25.0	26.0					5																	168112909		2203	4300	6503	SO:0001583	missense	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.3338C>A	5.37:g.168112909G>T	ENSP00000430333:p.Pro1113Gln		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.P1113Q	ENST00000519560.1	37	c.3338	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	G	18.80	3.700961	0.68501	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.34275	1.37;1.37;1.37	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.50718	0.1632	L	0.58969	1.84	0.80722	D	1	D	0.56968	0.978	P	0.59825	0.864	T	0.53507	-0.8429	10	0.87932	D	0	.	12.581	0.56390	0.0807:0.0:0.9193:0.0	.	1113	O75094	SLIT3_HUMAN	Q	1113;1120;1113	ENSP00000430333:P1113Q;ENSP00000332164:P1120Q;ENSP00000384890:P1113Q	ENSP00000332164:P1120Q	P	-	2	0	SLIT3	168045487	1.000000	0.71417	0.957000	0.39632	0.670000	0.39368	7.971000	0.88012	2.349000	0.79799	0.561000	0.74099	CCA	SLIT3	-	NULL	ENSG00000184347		0.602	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4		0.00	38	0	G	NM_003062		168112909	-1			no_errors	ENST00000519560	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.999	T
SLX4	84464	genome.wustl.edu	37	16	3647636	3647636	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:3647636G>T	ENST00000294008.3	-	7	2067	c.1427C>A	c.(1426-1428)tCt>tAt	p.S476Y		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	476	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						TGTGGTTTCAGAGTCCTGGAC	0.522								Direct reversal of damage																																									0													72.0	81.0	78.0					16																	3647636		2197	4300	6497	SO:0001583	missense	0			AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1427C>A	16.37:g.3647636G>T	ENSP00000294008:p.Ser476Tyr		Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.S476Y	ENST00000294008.3	37	c.1427	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	G	15.19	2.759037	0.49468	.	.	ENSG00000188827	ENST00000294008	T	0.01240	5.12	5.34	2.25	0.28309	.	0.615347	0.15485	N	0.259849	T	0.03783	0.0107	L	0.48642	1.525	0.09310	N	1	D	0.67145	0.996	P	0.59703	0.862	T	0.37979	-0.9682	10	0.87932	D	0	.	8.4463	0.32843	0.1414:0.1263:0.7323:0.0	.	476	Q8IY92	SLX4_HUMAN	Y	476	ENSP00000294008:S476Y	ENSP00000294008:S476Y	S	-	2	0	SLX4	3587637	0.010000	0.17322	0.078000	0.20375	0.526000	0.34562	1.301000	0.33447	0.223000	0.20920	0.655000	0.94253	TCT	SLX4	-	NULL	ENSG00000188827		0.522	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	HGNC	protein_coding	OTTHUMT00000157301.3	-	0.00	89	0	G	NM_032444		3647636	-1	tier1	-	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	8.97	71	7	SNP	0.202	T
SMCHD1	23347	genome.wustl.edu	37	18	2739474	2739474	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:2739474G>T	ENST00000320876.6	+	27	3808	c.3470G>T	c.(3469-3471)gGa>gTa	p.G1157V	SMCHD1_ENST00000261598.8_Missense_Mutation_p.G1157V|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1157					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GAAATGAAAGGAGGAAAAACA	0.343																																																	0													97.0	87.0	90.0					18																	2739474		1841	4091	5932	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3470G>T	18.37:g.2739474G>T	ENSP00000326603:p.Gly1157Val		O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.G1157V	ENST00000320876.6	37	c.3470	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269103	0.80469	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.27104	1.69;1.7	5.61	5.61	0.85477	.	0.133343	0.52532	D	0.000071	T	0.51109	0.1655	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50259	-0.8849	10	0.87932	D	0	-18.6554	18.627	0.91344	0.0:0.0:1.0:0.0	.	1157	A6NHR9	SMHD1_HUMAN	V	1157	ENSP00000326603:G1157V;ENSP00000261598:G1157V	ENSP00000261598:G1157V	G	+	2	0	SMCHD1	2729474	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	6.796000	0.75145	2.642000	0.89623	0.650000	0.86243	GGA	SMCHD1	-	NULL	ENSG00000101596		0.343	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	-	0.00	67	0	G			2739474	+1	tier1	-	no_errors	ENST00000320876	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
SOS1	6654	genome.wustl.edu	37	2	39213416	39213416	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:39213416G>T	ENST00000426016.1	-	24	3637	c.3551C>A	c.(3550-3552)cCt>cAt	p.P1184H	SOS1_ENST00000395038.2_Missense_Mutation_p.P1169H|SOS1_ENST00000402219.2_Missense_Mutation_p.P1184H			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	1184					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.P1184H(1)		autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				GGGTTGCCTAGGAGGAATGGC	0.393									Noonan syndrome																																								1	Substitution - Missense(1)	ovary(1)											73.0	80.0	77.0					2																	39213416		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.3551C>A	2.37:g.39213416G>T	ENSP00000387784:p.Pro1184His		A8K2G3|B4DXG2	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.P1184H	ENST00000426016.1	37	c.3551	CCDS1802.1	2	.	.	.	.	.	.	.	.	.	.	G	18.07	3.542113	0.65198	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038	D;D;D	0.84516	-1.52;-1.52;-1.86	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.90861	0.7129	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.89481	0.3750	10	0.40728	T	0.16	.	19.559	0.95364	0.0:0.0:1.0:0.0	.	1184	Q07889	SOS1_HUMAN	H	1184;1184;901;1169	ENSP00000387784:P1184H;ENSP00000384675:P1184H;ENSP00000378479:P1169H	ENSP00000378479:P1169H	P	-	2	0	SOS1	39066920	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.554000	0.90689	2.706000	0.92434	0.650000	0.86243	CCT	SOS1	-	NULL	ENSG00000115904		0.393	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SOS1	HGNC	protein_coding	OTTHUMT00000219948.3		0.00	109	0	G	NM_005633		39213416	-1			no_errors	ENST00000402219	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
SNED1	25992	genome.wustl.edu	37	2	242009498	242009498	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:242009498G>T	ENST00000310397.8	+	24	3471	c.3471G>T	c.(3469-3471)gcG>gcT	p.A1157A	MTERFD2_ENST00000464344.2_5'Flank|SNED1_ENST00000342631.6_Silent_p.A1157A|SNED1_ENST00000401884.1_Silent_p.A1157A|SNED1_ENST00000405547.3_Silent_p.A1157A	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	1157	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		GGAAGCTGGCGTCCTACACGG	0.657																																																	0													26.0	32.0	30.0					2																	242009498		2125	4226	6351	SO:0001819	synonymous_variant	0			AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.3471G>T	2.37:g.242009498G>T			B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	pfam_EG-like_dom,pfam_Fibronectin_type3,pfam_Nidogen_extracell_dom,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_Fibronectin_type3,superfamily_Sushi_SCR_CCP,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Sushi_SCR_CCP,smart_Fibronectin_type3,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Sushi_SCR_CCP	p.A1157	ENST00000310397.8	37	c.3471	CCDS46562.1	2																																																																																			SNED1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000162804		0.657	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNED1	HGNC	protein_coding	OTTHUMT00000323935.2	-	0.00	60	0	G	XM_059482		242009498	+1	tier1	-	no_errors	ENST00000310397	ensembl	human	known	74_37	silent	6.06	93	6	SNP	0.000	T
SPATA7	55812	genome.wustl.edu	37	14	88904395	88904395	+	Missense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr14:88904395G>A	ENST00000393545.4	+	12	1718	c.1429G>A	c.(1429-1431)Gca>Aca	p.A477T	SPATA7_ENST00000356583.5_Missense_Mutation_p.A445T|SPATA7_ENST00000045347.7_Intron|SPATA7_ENST00000556553.1_Missense_Mutation_p.A445T	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	477					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						GTTATTGTCGGCACCAAAGGA	0.363																																																	0													70.0	65.0	67.0					14																	88904395		2203	4300	6503	SO:0001583	missense	0			AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.1429G>A	14.37:g.88904395G>A	ENSP00000377176:p.Ala477Thr		Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Missense_Mutation	SNP	NULL	p.A477T	ENST00000393545.4	37	c.1429	CCDS9883.1	14	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443031	0.25987	.	.	ENSG00000042317	ENST00000556553;ENST00000393545;ENST00000356583	T;T;T	0.26373	1.74;1.75;1.74	5.87	1.91	0.25777	.	1.348350	0.04653	N	0.407552	T	0.17492	0.0420	N	0.22421	0.69	0.09310	N	1	B;B;B	0.26258	0.145;0.062;0.145	B;B;B	0.24701	0.053;0.055;0.053	T	0.28235	-1.0050	10	0.23891	T	0.37	0.4096	5.4369	0.16486	0.2409:0.1786:0.5804:0.0	.	445;445;477	A8K3L6;Q9P0W8-2;Q9P0W8	.;.;SPAT7_HUMAN	T	445;477;445	ENSP00000451128:A445T;ENSP00000377176:A477T;ENSP00000348991:A445T	ENSP00000348991:A445T	A	+	1	0	SPATA7	87974148	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.800000	0.04555	0.127000	0.18452	0.655000	0.94253	GCA	SPATA7	-	NULL	ENSG00000042317		0.363	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPATA7	HGNC	protein_coding	OTTHUMT00000410172.1		0.00	56	0	G			88904395	+1			no_errors	ENST00000393545	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	A
SPEF2	79925	genome.wustl.edu	37	5	35705819	35705819	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:35705819G>T	ENST00000356031.3	+	18	2728	c.2574G>T	c.(2572-2574)ttG>ttT	p.L858F	SPEF2_ENST00000509059.1_Missense_Mutation_p.L853F|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.L853F	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	858					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			AAAATATTTTGATAAAAATCA	0.279																																																	0													47.0	42.0	43.0					5																	35705819		1783	4053	5836	SO:0001583	missense	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.2574G>T	5.37:g.35705819G>T	ENSP00000348314:p.Leu858Phe		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.L858F	ENST00000356031.3	37	c.2574	CCDS43309.1	5	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374381	0.61735	.	.	ENSG00000152582	ENST00000356031;ENST00000509059;ENST00000440995;ENST00000504054	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.77	0.98	0.19750	.	0.000000	0.64402	D	0.000002	T	0.50257	0.1605	M	0.78049	2.395	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.49615	-0.8921	10	0.87932	D	0	.	7.9741	0.30145	0.4623:0.0:0.5377:0.0	.	853;853;858	D6REZ4;Q9C093-2;Q9C093	.;.;SPEF2_HUMAN	F	858;853;853;364	ENSP00000348314:L858F;ENSP00000421593:L853F;ENSP00000412125:L853F;ENSP00000421744:L364F	ENSP00000348314:L858F	L	+	3	2	SPEF2	35741576	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	1.824000	0.39072	0.379000	0.24794	-0.781000	0.03364	TTG	SPEF2	-	superfamily_P-loop_NTPase	ENSG00000152582		0.279	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	-	0.00	54	0	G	NM_144722		35705819	+1	tier1	-	no_errors	ENST00000356031	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.998	T
SSH2	85464	genome.wustl.edu	37	17	27963457	27963457	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:27963457G>T	ENST00000269033.3	-	14	1861	c.1710C>A	c.(1708-1710)tgC>tgA	p.C570*	RP11-68I3.2_ENST00000581474.1_RNA|SSH2_ENST00000540801.1_Nonsense_Mutation_p.C597*	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	570					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGATGCATGGCAATTGTCAA	0.408																																																	0													101.0	94.0	96.0					17																	27963457		2203	4300	6503	SO:0001587	stop_gained	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.1710C>A	17.37:g.27963457G>T	ENSP00000269033:p.Cys570*		Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.C570*	ENST00000269033.3	37	c.1710	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.250140	0.97412	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	.	.	.	6.16	6.16	0.99307	.	0.406531	0.27613	N	0.018595	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5001	11.0431	0.47842	0.1367:0.0:0.8633:0.0	.	.	.	.	X	570;597	.	ENSP00000269033:C570X	C	-	3	2	SSH2	24987583	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.043000	0.57354	2.937000	0.99478	0.650000	0.86243	TGC	SSH2	-	NULL	ENSG00000141298		0.408	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1		0.00	59	0	G	NM_033389		27963457	-1			no_errors	ENST00000269033	ensembl	human	known	74_37	nonsense	5.56	51	3	SNP	1.000	T
ST3GAL1	6482	genome.wustl.edu	37	8	134488167	134488167	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:134488167G>T	ENST00000319914.5	-	4	1128	c.101C>A	c.(100-102)gCc>gAc	p.A34D	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.A34D|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.A34D|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.A34D|ST3GAL1_ENST00000519435.1_5'Flank			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	34					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			CCAGGTGGTGGCCACCATGGT	0.577																																																	0													100.0	88.0	92.0					8																	134488167		2203	4300	6503	SO:0001583	missense	0			L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.101C>A	8.37:g.134488167G>T	ENSP00000318445:p.Ala34Asp		O60677|Q9UN51	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.A34D	ENST00000319914.5	37	c.101	CCDS6373.1	8	.	.	.	.	.	.	.	.	.	.	G	13.05	2.120544	0.37436	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652;ENST00000523634;ENST00000519924;ENST00000523855	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.55	4.67	0.58626	.	1.274490	0.04919	N	0.454717	T	0.13286	0.0322	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31641	-0.9936	10	0.18276	T	0.48	-22.6381	10.0292	0.42090	0.0733:0.0:0.788:0.1387	.	34	Q11201	SIA4A_HUMAN	D	34	ENSP00000318445:A34D;ENSP00000414073:A34D;ENSP00000428540:A34D;ENSP00000430515:A34D	ENSP00000318445:A34D	A	-	2	0	ST3GAL1	134557349	0.558000	0.26554	0.071000	0.20095	0.977000	0.68977	2.540000	0.45727	1.325000	0.45301	0.561000	0.74099	GCC	ST3GAL1	-	pirsf_Sialyl_trans	ENSG00000008513		0.577	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL1	HGNC	protein_coding	OTTHUMT00000379132.1	-	0.00	48	0	G	NM_003033		134488167	-1	tier1	-	no_errors	ENST00000319914	ensembl	human	known	74_37	missense	7.14	65	5	SNP	0.088	T
SYCP1	6847	genome.wustl.edu	37	1	115398163	115398163	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:115398163G>T	ENST00000369522.3	+	2	318	c.78G>T	c.(76-78)caG>caT	p.Q26H	SYCP1_ENST00000369518.1_Missense_Mutation_p.Q26H	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	26	Asp/Glu-rich (acidic).				chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGAAACCTCAGACCCTGGGAG	0.418																																																	0													76.0	75.0	76.0					1																	115398163		2203	4300	6503	SO:0001583	missense	0			D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.78G>T	1.37:g.115398163G>T	ENSP00000358535:p.Gln26His		O14963|Q5VXJ6	Missense_Mutation	SNP	pfam_SCP-1	p.Q26H	ENST00000369522.3	37	c.78	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050592	0.55218	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	T;T;T	0.54071	1.17;0.59;1.17	5.16	3.11	0.35812	.	0.138830	0.50627	N	0.000118	T	0.20861	0.0502	L	0.34521	1.04	0.39490	D	0.968036	B;B	0.24618	0.107;0.107	B;B	0.18263	0.021;0.021	T	0.13335	-1.0513	10	0.72032	D	0.01	-1.0436	5.6334	0.17524	0.0778:0.1411:0.6352:0.1459	.	26;26	B7ZLS9;Q15431	.;SYCP1_HUMAN	H	26	ENSP00000358535:Q26H;ENSP00000410011:Q26H;ENSP00000358531:Q26H	ENSP00000358531:Q26H	Q	+	3	2	SYCP1	115199686	0.784000	0.28713	0.984000	0.44739	0.559000	0.35586	0.755000	0.26405	1.129000	0.42072	0.561000	0.74099	CAG	SYCP1	-	NULL	ENSG00000198765		0.418	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	HGNC	protein_coding	OTTHUMT00000033386.1	-	0.00	89	0	G	NM_003176		115398163	+1	tier1	-	no_errors	ENST00000369518	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.996	T
SYNDIG1L	646658	genome.wustl.edu	37	14	74874689	74874689	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr14:74874689C>A	ENST00000554823.1	-	2	482	c.421G>T	c.(421-423)Gat>Tat	p.D141Y	SYNDIG1L_ENST00000331628.3_Missense_Mutation_p.D141Y			A6NDD5	SYN1L_HUMAN	synapse differentiation inducing 1-like	141					response to biotic stimulus (GO:0009607)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)		p.D141N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|lung(8)|pancreas(1)|prostate(1)|skin(1)	14						GAAGTGGCATCGCTCTGCAAA	0.552																																																	1	Substitution - Missense(1)	skin(1)											92.0	96.0	95.0					14																	74874689		2203	4300	6503	SO:0001583	missense	0				CCDS41970.1	14q24.3	2011-06-30	2011-06-30	2011-06-30		ENSG00000183379			32388	protein-coding gene	gene with protein product	"""caudate-and putamen-enriched sequence"", ""interferon induced transmembrane protein domain containing 4"""	609999	"""transmembrane protein 90A"""	TMEM90A		16359841	Standard	NM_001105579		Approved	capucin, IFITMD4	uc001xpx.2	A6NDD5		ENST00000554823.1:c.421G>T	14.37:g.74874689C>A	ENSP00000450439:p.Asp141Tyr			Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.D141Y	ENST00000554823.1	37	c.421	CCDS41970.1	14	.	.	.	.	.	.	.	.	.	.	C	14.84	2.656981	0.47467	.	.	ENSG00000183379	ENST00000331628;ENST00000554823	D;D	0.96300	-3.97;-3.97	5.13	4.24	0.50183	.	0.000000	0.85682	D	0.000000	D	0.96944	0.9002	L	0.46157	1.445	0.58432	D	0.999998	D	0.89917	1.0	D	0.85130	0.997	D	0.97373	0.9977	10	0.72032	D	0.01	-0.2473	13.7637	0.62981	0.0:0.9264:0.0:0.0735	.	141	A6NDD5	SYN1L_HUMAN	Y	141	ENSP00000331474:D141Y;ENSP00000450439:D141Y	ENSP00000331474:D141Y	D	-	1	0	SYNDIG1L	73944442	1.000000	0.71417	0.909000	0.35828	0.079000	0.17450	5.409000	0.66374	1.388000	0.46506	-0.140000	0.14226	GAT	SYNDIG1L	-	NULL	ENSG00000183379		0.552	SYNDIG1L-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SYNDIG1L	HGNC	protein_coding	OTTHUMT00000412341.1	-	0.00	34	0	C	XM_938515		74874689	-1	tier1	-	no_errors	ENST00000331628	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
TADA2B	93624	genome.wustl.edu	37	4	7055887	7055887	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:7055887C>A	ENST00000310074.7	+	2	558	c.369C>A	c.(367-369)tgC>tgA	p.C123*	TADA2B_ENST00000515646.1_Nonsense_Mutation_p.C31*|TADA2B_ENST00000512388.1_Nonsense_Mutation_p.C48*	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	123					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GGAAGGCCTGCATCCCCGACA	0.637																																																	0													28.0	33.0	32.0					4																	7055887		2101	4213	6314	SO:0001587	stop_gained	0			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.369C>A	4.37:g.7055887C>A	ENSP00000308022:p.Cys123*		A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Nonsense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.C123*	ENST00000310074.7	37	c.369	CCDS47007.1	4	.	.	.	.	.	.	.	.	.	.	C	36	5.788127	0.96945	.	.	ENSG00000173011	ENST00000506692;ENST00000310074;ENST00000512388;ENST00000515646;ENST00000510704	.	.	.	5.33	3.56	0.40772	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-53.5566	12.4377	0.55608	0.0:0.8582:0.0:0.1418	.	.	.	.	X	31;123;48;31;31	.	ENSP00000308022:C123X	C	+	3	2	TADA2B	7106788	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.182000	0.42556	1.225000	0.43566	0.561000	0.74099	TGC	TADA2B	-	pirsf_Transcriptional_adaptor_2	ENSG00000173011		0.637	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2		0.00	64	0	C	NM_152293		7055887	+1			no_errors	ENST00000310074	ensembl	human	known	74_37	nonsense	5.56	68	4	SNP	1.000	A
TACR3	6870	genome.wustl.edu	37	4	104640394	104640394	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:104640394G>T	ENST00000304883.2	-	1	579	c.439C>A	c.(439-441)Ctt>Att	p.L147I		NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	147					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		TCGCTATGAAGCGCGTAGATG	0.532																																																	0													105.0	96.0	99.0					4																	104640394		2203	4300	6503	SO:0001583	missense	0			M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.439C>A	4.37:g.104640394G>T	ENSP00000303325:p.Leu147Ile		Q0P510	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NK3_rcpt,prints_Neurokn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK1_rcpt	p.L147I	ENST00000304883.2	37	c.439	CCDS3664.1	4	.	.	.	.	.	.	.	.	.	.	G	13.58	2.280824	0.40394	.	.	ENSG00000169836	ENST00000304883	T	0.27890	1.64	5.26	4.41	0.53225	GPCR, rhodopsin-like superfamily (1);	0.472054	0.22766	N	0.055898	T	0.19208	0.0461	N	0.11023	0.085	0.35183	D	0.772663	B	0.20368	0.044	B	0.25614	0.062	T	0.13548	-1.0505	10	0.23891	T	0.37	.	15.199	0.73120	0.0:0.1408:0.8592:0.0	.	147	P29371	NK3R_HUMAN	I	147	ENSP00000303325:L147I	ENSP00000303325:L147I	L	-	1	0	TACR3	104859843	0.961000	0.32948	0.993000	0.49108	0.924000	0.55760	1.618000	0.36954	1.181000	0.42912	0.591000	0.81541	CTT	TACR3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt	ENSG00000169836		0.532	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR3	HGNC	protein_coding	OTTHUMT00000253804.1	-	0.00	32	0	G	NM_001059		104640394	-1	tier1	-	no_errors	ENST00000304883	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.971	T
TAF1	6872	genome.wustl.edu	37	X	70598241	70598241	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:70598241G>T	ENST00000373790.4	+	7	1138	c.1087G>T	c.(1087-1089)Gac>Tac	p.D363Y	TAF1_ENST00000449580.1_Missense_Mutation_p.D363Y|TAF1_ENST00000276072.3_Missense_Mutation_p.D384Y|TAF1_ENST00000423759.1_Missense_Mutation_p.D384Y	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	363	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				CAGTGGGTTTGACTATGGCTT	0.448																																																	0													182.0	151.0	161.0					X																	70598241		2203	4300	6503	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1087G>T	X.37:g.70598241G>T	ENSP00000362895:p.Asp363Tyr		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D363Y	ENST00000373790.4	37	c.1087	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	15.78	2.933219	0.52866	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.27	5.27	0.74061	.	0.101965	0.64402	D	0.000003	T	0.54695	0.1874	M	0.64404	1.975	0.49051	D	0.999744	P;P	0.48162	0.848;0.906	B;P	0.46362	0.379;0.514	T	0.61387	-0.7073	10	0.72032	D	0.01	.	18.2069	0.89858	0.0:0.0:1.0:0.0	.	363;384	P21675;P21675-2	TAF1_HUMAN;.	Y	363;363;384;384	ENSP00000362895:D363Y;ENSP00000389000:D363Y;ENSP00000406549:D384Y;ENSP00000276072:D384Y	ENSP00000276072:D384Y	D	+	1	0	TAF1	70514966	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.817000	0.69229	2.324000	0.78689	0.513000	0.50165	GAC	TAF1	-	pirsf_TAF1_animal	ENSG00000147133		0.448	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2		0.00	33	0	G	NM_004606		70598241	+1			no_errors	ENST00000449580	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
TAF3	83860	genome.wustl.edu	37	10	8006695	8006695	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:8006695G>T	ENST00000344293.5	+	3	1428	c.1222G>T	c.(1222-1224)Gaa>Taa	p.E408*		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	408					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						AGATCCTTTCGAATTTTCTTC	0.483																																																	0													96.0	92.0	93.0					10																	8006695		1879	4127	6006	SO:0001587	stop_gained	0			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.1222G>T	10.37:g.8006695G>T	ENSP00000340271:p.Glu408*		Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Nonsense_Mutation	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E408*	ENST00000344293.5	37	c.1222	CCDS41487.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.388868	0.97529	.	.	ENSG00000165632	ENST00000344293	.	.	.	5.56	4.65	0.58169	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-30.1827	14.3961	0.67013	0.0712:0.0:0.9288:0.0	.	.	.	.	X	408	.	ENSP00000340271:E408X	E	+	1	0	TAF3	8046701	1.000000	0.71417	0.151000	0.22473	0.657000	0.38888	9.230000	0.95299	1.356000	0.45884	0.650000	0.86243	GAA	TAF3	-	NULL	ENSG00000165632		0.483	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1		0.00	41	0	G	NM_031923		8006695	+1			no_errors	ENST00000344293	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	0.992	T
TARBP1	6894	genome.wustl.edu	37	1	234528170	234528170	+	Silent	SNP	G	G	T	rs377007975		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:234528170G>T	ENST00000040877.1	-	29	4688	c.4689C>A	c.(4687-4689)ctC>ctA	p.L1563L	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1563					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			ACCCCAACAAGAGCAGAGATT	0.403																																																	0													173.0	174.0	174.0					1																	234528170		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4689C>A	1.37:g.234528170G>T			Q9H581	Silent	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.L1563	ENST00000040877.1	37	c.4689	CCDS1601.1	1																																																																																			TARBP1	-	pfam_SpoU_MeTrfase	ENSG00000059588		0.403	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	-	0.00	80	0	G	NM_005646		234528170	-1	tier1	-	no_errors	ENST00000040877	ensembl	human	novel	74_37	silent	5.19	72	4	SNP	0.199	T
TAS2R40	259286	genome.wustl.edu	37	7	142919701	142919701	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:142919701C>A	ENST00000408947.3	+	1	572	c.530C>A	c.(529-531)tCc>tAc	p.S177Y	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	177					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					CCTATCCCCTCCTCCAACTCC	0.448																																																	0													161.0	150.0	154.0					7																	142919701		1924	4132	6056	SO:0001583	missense	0			AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.530C>A	7.37:g.142919701C>A	ENSP00000386210:p.Ser177Tyr		A4D2I2|Q645W6	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.S177Y	ENST00000408947.3	37	c.530	CCDS43662.1	7	.	.	.	.	.	.	.	.	.	.	C	5.891	0.348497	0.11126	.	.	ENSG00000221937	ENST00000408947	T	0.00816	5.66	5.29	4.39	0.52855	.	0.681105	0.13127	U	0.411750	T	0.02418	0.0074	L	0.58101	1.795	0.09310	N	1	P	0.46327	0.876	P	0.51016	0.656	T	0.48906	-0.8993	10	0.36615	T	0.2	.	9.8705	0.41170	0.0:0.824:0.0:0.176	.	177	P59535	T2R40_HUMAN	Y	177	ENSP00000386210:S177Y	ENSP00000386210:S177Y	S	+	2	0	TAS2R40	142629823	0.000000	0.05858	0.254000	0.24359	0.658000	0.38924	-0.143000	0.10296	1.198000	0.43158	0.655000	0.94253	TCC	TAS2R40	-	pfam_TAS2_rcpt	ENSG00000221937		0.448	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R40	HGNC	protein_coding	OTTHUMT00000327097.1	-	0.00	40	0	C			142919701	+1	tier1	-	no_errors	ENST00000408947	ensembl	human	known	74_37	missense	11.54	23	3	SNP	0.003	A
TBC1D8B	54885	genome.wustl.edu	37	X	106109160	106109160	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:106109160G>T	ENST00000357242.5	+	16	2733	c.2559G>T	c.(2557-2559)tgG>tgT	p.W853C	TBC1D8B_ENST00000276175.3_Missense_Mutation_p.W847C	NM_017752.2	NP_060222.2	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	853							calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|liver(4)|lung(15)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGAGTCCCTGGGCTCATTCTG	0.418																																																	0													156.0	137.0	144.0					X																	106109160		2203	4300	6503	SO:0001583	missense	0			AK123957	CCDS14522.1, CCDS14523.1	Xq22.3	2013-01-10			ENSG00000133138	ENSG00000133138		"""EF-hand domain containing"""	24715	protein-coding gene	gene with protein product						8889548	Standard	NM_017752		Approved	FLJ20298, RP11-321G1.1	uc004emo.3	Q0IIM8	OTTHUMG00000022152	ENST00000357242.5:c.2559G>T	X.37:g.106109160G>T	ENSP00000349781:p.Trp853Cys		B9A6K5|B9A6K6|Q5JRB7|Q6ZVX5|Q9NXE3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_EF_hand_dom,pfscan_Rab-GTPase-TBC_dom	p.W853C	ENST00000357242.5	37	c.2559	CCDS14522.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.963931|3.963931	0.74131|0.74131	.|.	.|.	ENSG00000133138|ENSG00000133138	ENST00000431860|ENST00000357242;ENST00000276175;ENST00000394972	.|T;T	.|0.54675	.|0.56;0.56	5.71|5.71	5.71|5.71	0.89125|0.89125	.|EF-hand-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73473|0.73473	0.3591|0.3591	M|M	0.83774|0.83774	2.66|2.66	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|P	.|0.62491	.|0.903	T|T	0.78066|0.78066	-0.2349|-0.2349	5|10	.|0.87932	.|D	.|0	-1.7939|-1.7939	17.2863|17.2863	0.87142|0.87142	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|853	.|Q0IIM8	.|TBC8B_HUMAN	C|C	116|853;847;115	.|ENSP00000349781:W853C;ENSP00000276175:W847C	.|ENSP00000276175:W847C	G|W	+|+	1|3	0|0	TBC1D8B|TBC1D8B	105995816|105995816	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.476000|9.476000	0.97823|0.97823	2.400000|2.400000	0.81607|0.81607	0.594000|0.594000	0.82650|0.82650	GGC|TGG	TBC1D8B	-	NULL	ENSG00000133138		0.418	TBC1D8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D8B	HGNC	protein_coding	OTTHUMT00000057807.2	-	0.00	40	0	G	NM_017752		106109160	+1	tier1	-	no_errors	ENST00000357242	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
TCF4	6925	genome.wustl.edu	37	18	53018130	53018130	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr18:53018130C>A	ENST00000356073.4	-	7	1085	c.474G>T	c.(472-474)agG>agT	p.R158S	TCF4_ENST00000564403.2_Missense_Mutation_p.R158S|TCF4_ENST00000566286.1_Missense_Mutation_p.R156S|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000564228.1_Missense_Mutation_p.R87S|TCF4_ENST00000565018.2_Missense_Mutation_p.R158S|TCF4_ENST00000398339.1_Missense_Mutation_p.R260S|TCF4_ENST00000568740.1_Missense_Mutation_p.R133S|TCF4_ENST00000570177.2_Missense_Mutation_p.R28S|TCF4_ENST00000537856.3_Missense_Mutation_p.R28S|TCF4_ENST00000564999.1_Missense_Mutation_p.R158S|TCF4_ENST00000544241.2_Missense_Mutation_p.R87S|TCF4_ENST00000543082.1_Missense_Mutation_p.R116S|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000537578.1_Missense_Mutation_p.R134S|TCF4_ENST00000354452.3_Missense_Mutation_p.R158S|TCF4_ENST00000568673.1_Missense_Mutation_p.R134S|TCF4_ENST00000540999.1_Missense_Mutation_p.R134S|TCF4_ENST00000561992.1_Missense_Mutation_p.R28S	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	158					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GAAGAGGCCTCCTTCGGGGAT	0.438																																																	0													104.0	102.0	103.0					18																	53018130		2203	4300	6503	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.474G>T	18.37:g.53018130C>A	ENSP00000348374:p.Arg158Ser		B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.R260S	ENST00000356073.4	37	c.780	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162916	0.38217	.	.	ENSG00000196628	ENST00000354452;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09;0.09;0.09;0.09	5.41	1.46	0.22682	.	0.000000	0.85682	D	0.000000	T	0.70150	0.3191	M	0.72479	2.2	0.28636	N	0.907401	D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.997;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.998;0.999;0.989;0.973;0.999;0.999	T	0.64084	-0.6490	10	0.66056	D	0.02	-24.9582	9.0231	0.36213	0.0:0.6736:0.0:0.3264	.	134;158;134;260;158;116;87	B7Z5M6;G0LNT9;B7Z6Y1;E9PH57;P15884;B3KUC0;B3KT62	.;.;.;.;ITF2_HUMAN;.;.	S	158;158;116;134;134;87;28;260	ENSP00000346440:R158S;ENSP00000348374:R158S;ENSP00000439656:R116S;ENSP00000445202:R134S;ENSP00000440731:R134S;ENSP00000441562:R87S;ENSP00000439827:R28S;ENSP00000381382:R260S	ENSP00000346440:R158S	R	-	3	2	TCF4	51169128	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.168000	0.31859	0.041000	0.15688	0.655000	0.94253	AGG	TCF4	-	NULL	ENSG00000196628		0.438	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	-	0.00	66	0	C	NM_003199		53018130	-1	tier1	-	no_errors	ENST00000398339	ensembl	human	known	74_37	missense	25.00	12	4	SNP	1.000	A
TEAD3	7005	genome.wustl.edu	37	6	35454368	35454368	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:35454368G>T	ENST00000402886.3	-	2	173	c.20C>A	c.(19-21)aCa>aAa	p.T7K	TEAD3_ENST00000338863.7_Missense_Mutation_p.D24E			Q99594	TEAD3_HUMAN	TEA domain family member 3	0					female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						CCAGCCCCTTGTCCAGGCCCT	0.697																																																	0													33.0	42.0	39.0					6																	35454368		2170	4278	6448	SO:0001583	missense	0			X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.20C>A	6.37:g.35454368G>T	ENSP00000384577:p.Thr7Lys		O95910|Q5BJG7|Q8N6Y4	Missense_Mutation	SNP	pfam_TEA/ATTS,pirsf_TEF	p.T7K	ENST00000402886.3	37	c.20		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.697|6.697	0.497325|0.497325	0.12762|0.12762	.|.	.|.	ENSG00000007866|ENSG00000007866	ENST00000338863;ENST00000373905|ENST00000402886	T|T	0.28666|0.55930	1.6|0.49	4.93|4.93	3.12|3.12	0.35913|0.35913	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.21347|0.21347	0.0514|0.0514	L|L	0.39633|0.39633	1.23|1.23	0.26322|0.26322	N|N	0.977668|0.977668	B|B	0.13594|0.09022	0.008|0.002	B|B	0.17722|0.06405	0.019|0.002	T|T	0.24368|0.24368	-1.0162|-1.0162	10|9	0.27082|0.59425	T|D	0.32|0.04	-22.1334|-22.1334	5.9568|5.9568	0.19277|0.19277	0.1645:0.0:0.6844:0.1512|0.1645:0.0:0.6844:0.1512	.|.	40|7	Q7Z6V0|B5MCM0	.|.	E|K	24;40|7	ENSP00000345772:D24E|ENSP00000384577:T7K	ENSP00000345772:D24E|ENSP00000384577:T7K	D|T	-|-	3|2	2|0	TEAD3|TEAD3	35562346|35562346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.003000|0.003000	0.03518|0.03518	5.652000|5.652000	0.67959|0.67959	0.600000|0.600000	0.29862|0.29862	-0.400000|-0.400000	0.06385|0.06385	GAC|ACA	TEAD3	-	pirsf_TEF	ENSG00000007866		0.697	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	TEAD3	HGNC	protein_coding	OTTHUMT00000316961.2		0.00	46	0	G			35454368	-1			no_errors	ENST00000402886	ensembl	human	novel	74_37	missense	5.56	68	4	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78381549	78381549	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr11:78381549G>T	ENST00000278550.7	-	32	6303	c.5841C>A	c.(5839-5841)ttC>ttA	p.F1947L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1947					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.F1947F(4)									CATTCTTGTCGAACTCAAAGA	0.532																																																	4	Substitution - coding silent(4)	large_intestine(4)											71.0	74.0	73.0					11																	78381549		2006	4165	6171	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5841C>A	11.37:g.78381549G>T	ENSP00000278550:p.Phe1947Leu		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.F1947L	ENST00000278550.7	37	c.5841	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	17.93	3.508273	0.64410	.	.	ENSG00000149256	ENST00000278550;ENST00000530738	D;T	0.89746	-2.56;0.88	4.93	-7.43	0.01383	.	0.000000	0.85682	D	0.000000	D	0.90116	0.6912	L	0.51422	1.61	0.49687	D	0.999813	D	0.63880	0.993	D	0.71656	0.974	D	0.89295	0.3622	9	.	.	.	.	18.0806	0.89440	0.7965:0.0:0.2035:0.0	.	1947	Q6N022	TEN4_HUMAN	L	1947;411	ENSP00000278550:F1947L;ENSP00000431711:F411L	.	F	-	3	2	ODZ4	78059197	0.565000	0.26610	0.870000	0.34147	0.999000	0.98932	-0.030000	0.12308	-1.382000	0.02109	0.655000	0.94253	TTC	TENM4	-	NULL	ENSG00000149256		0.532	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2		0.00	18	0	G			78381549	-1			no_errors	ENST00000278550	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.901	T
THG1L	54974	genome.wustl.edu	37	5	157158604	157158604	+	Missense_Mutation	SNP	G	G	T	rs372055284		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:157158604G>T	ENST00000231198.7	+	1	400	c.156G>T	c.(154-156)tgG>tgT	p.W52C		NM_017872.3	NP_060342.2	Q9NWX6	THG1_HUMAN	tRNA-histidine guanylyltransferase 1-like (S. cerevisiae)	52					protein homotetramerization (GO:0051289)|tRNA modification (GO:0006400)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|tRNA binding (GO:0000049)|tRNA guanylyltransferase activity (GO:0008193)			NS(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)|skin(1)	13	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CACACTGCTGGGTGGTAGTGC	0.622																																																	0													167.0	158.0	161.0					5																	157158604		2203	4300	6503	SO:0001583	missense	0			AK223119	CCDS4341.1	5q33.3	2008-02-05			ENSG00000113272	ENSG00000113272			26053	protein-coding gene	gene with protein product	"""interphase cytoplasmic foci protein 45"""					11230166	Standard	XM_005265939		Approved	ICF45, FLJ11601, FLJ20546	uc003lxd.3	Q9NWX6	OTTHUMG00000130254	ENST00000231198.7:c.156G>T	5.37:g.157158604G>T	ENSP00000231198:p.Trp52Cys		D3DQJ5|Q53G12|Q7L5R3|Q9H0S2	Missense_Mutation	SNP	pfam_tRNAHis_GuaTrfase_cat,superfamily_Restrct_endonuc-II-like,pirsf_tRNAHis_GuaTrfase_Thg1	p.W52C	ENST00000231198.7	37	c.156	CCDS4341.1	5	.	.	.	.	.	.	.	.	.	.	G	22.1	4.249250	0.80024	.	.	ENSG00000113272	ENST00000231198	T	0.50001	0.76	5.77	5.77	0.91146	.	0.106348	0.64402	D	0.000001	T	0.77785	0.4182	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80605	-0.1308	10	0.52906	T	0.07	-14.431	20.3473	0.98799	0.0:0.0:1.0:0.0	.	52	Q9NWX6	THG1_HUMAN	C	52	ENSP00000231198:W52C	ENSP00000231198:W52C	W	+	3	0	THG1L	157091182	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.562000	0.60816	2.884000	0.98904	0.655000	0.94253	TGG	THG1L	-	pfam_tRNAHis_GuaTrfase_cat,pirsf_tRNAHis_GuaTrfase_Thg1	ENSG00000113272		0.622	THG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THG1L	HGNC	protein_coding	OTTHUMT00000252579.2		0.00	48	0	G	NM_017872		157158604	+1			no_errors	ENST00000231198	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
TM4SF20	79853	genome.wustl.edu	37	2	228228650	228228650	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:228228650G>T	ENST00000304568.3	-	4	517	c.480C>A	c.(478-480)ccC>ccA	p.P160P		NM_024795.3	NP_079071.2	Q53R12	T4S20_HUMAN	transmembrane 4 L six family member 20	160						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|kidney(2)|large_intestine(1)|lung(4)|stomach(2)	10		Renal(207;0.025)|all_lung(227;0.123)|Esophageal squamous(248;0.23)|all_hematologic(139;0.248)		Epithelial(121;3.8e-11)|all cancers(144;2.57e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CGTTACTGGTGGGTTTATTGA	0.398																																																	0													88.0	84.0	85.0					2																	228228650		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026453	CCDS2466.1	2q36.3	2008-02-05			ENSG00000168955	ENSG00000168955			26230	protein-coding gene	gene with protein product		615404				12975309	Standard	NM_024795		Approved	FLJ22800, TCCE518	uc002vpb.2	Q53R12	OTTHUMG00000133187	ENST00000304568.3:c.480C>A	2.37:g.228228650G>T			B2RP42|Q5U609|Q6UWS1|Q9H5X9	Silent	SNP	pfam_L6_membrane	p.P160	ENST00000304568.3	37	c.480	CCDS2466.1	2																																																																																			TM4SF20	-	pfam_L6_membrane	ENSG00000168955		0.398	TM4SF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF20	HGNC	protein_coding	OTTHUMT00000256896.2	-	0.00	61	0	G	NM_024795		228228650	-1	tier1	-	no_errors	ENST00000304568	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.000	T
TMEM132E	124842	genome.wustl.edu	37	17	32964404	32964404	+	Missense_Mutation	SNP	G	G	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:32964404G>A	ENST00000321639.5	+	10	2436	c.2108G>A	c.(2107-2109)tGc>tAc	p.C703Y		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	703						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCTGAGAGCTGCCAGAAAACC	0.647																																																	0													56.0	60.0	59.0					17																	32964404		2203	4300	6503	SO:0001583	missense	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.2108G>A	17.37:g.32964404G>A	ENSP00000316532:p.Cys703Tyr		Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.C703Y	ENST00000321639.5	37	c.2108	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506877	0.64410	.	.	ENSG00000181291	ENST00000321639	T	0.17528	2.27	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.48874	0.1524	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.57573	-0.7788	10	0.87932	D	0	-29.8441	17.2291	0.86979	0.0:0.0:1.0:0.0	.	703	Q6IEE7	T132E_HUMAN	Y	703	ENSP00000316532:C703Y	ENSP00000316532:C703Y	C	+	2	0	TMEM132E	29988517	1.000000	0.71417	1.000000	0.80357	0.247000	0.25773	9.657000	0.98554	2.538000	0.85594	0.643000	0.83706	TGC	TMEM132E	-	NULL	ENSG00000181291		0.647	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	-	0.00	55	0	G	NM_207313		32964404	+1	tier1	-	no_errors	ENST00000321639	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
TMEM106A	113277	genome.wustl.edu	37	17	41365224	41365224	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr17:41365224G>T	ENST00000331615.3	+	3	401	c.164G>T	c.(163-165)aGc>aTc	p.S55I	TMEM106A_ENST00000592564.1_3'UTR|TMEM106A_ENST00000588659.1_Missense_Mutation_p.S55I|TMEM106A_ENST00000536052.1_Missense_Mutation_p.S55I|TMEM106A_ENST00000541594.1_Missense_Mutation_p.S7I	NM_145041.1	NP_659478.1	Q96A25	T106A_HUMAN	transmembrane protein 106A	55						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11		Breast(137;0.0164)		BRCA - Breast invasive adenocarcinoma(366;0.0917)		GCTGATGCCAGCTTCGTGACT	0.542																																																	0													138.0	125.0	129.0					17																	41365224		2203	4296	6499	SO:0001583	missense	0			AK056132	CCDS11462.1, CCDS74073.1	17q21.31	2012-01-23			ENSG00000184988	ENSG00000184988			28288	protein-coding gene	gene with protein product							Standard	XM_006721658		Approved	MGC20235	uc002idn.1	Q96A25		ENST00000331615.3:c.164G>T	17.37:g.41365224G>T	ENSP00000330774:p.Ser55Ile		A8K2X2|B7Z698	Missense_Mutation	SNP	pfam_DUF1356_TMEM106	p.S55I	ENST00000331615.3	37	c.164	CCDS11462.1	17	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106348	0.56291	.	.	ENSG00000184988	ENST00000331615;ENST00000536052;ENST00000541594	T;T;T	0.22945	1.93;1.93;1.93	5.17	3.15	0.36227	.	0.843930	0.10899	N	0.621842	T	0.36496	0.0969	L	0.57536	1.79	0.27406	N	0.954706	P;P;P	0.45396	0.748;0.857;0.857	B;P;P	0.52514	0.351;0.505;0.701	T	0.17745	-1.0359	10	0.87932	D	0	-25.9335	7.429	0.27115	0.2558:0.0:0.7442:0.0	.	55;7;55	B7Z779;B7Z698;Q96A25	.;.;T106A_HUMAN	I	55;55;7	ENSP00000330774:S55I;ENSP00000439835:S55I;ENSP00000439844:S7I	ENSP00000330774:S55I	S	+	2	0	TMEM106A	38720750	0.962000	0.33011	0.840000	0.33206	0.657000	0.38888	1.563000	0.36364	1.414000	0.47017	0.655000	0.94253	AGC	TMEM106A	-	pfam_DUF1356_TMEM106	ENSG00000184988		0.542	TMEM106A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106A	HGNC	protein_coding	OTTHUMT00000453470.2	-	0.00	54	0	G	NM_145041		41365224	+1	tier1	-	no_errors	ENST00000331615	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.607	T
TMEM156	80008	genome.wustl.edu	37	4	39033931	39033931	+	Start_Codon_SNP	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:39033931C>A	ENST00000381938.3	-	1	110	c.3G>T	c.(1-3)atG>atT	p.M1I	TMEM156_ENST00000372489.2_5'UTR	NM_024943.1	NP_079219.1	Q8N614	TM156_HUMAN	transmembrane protein 156	1						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|stomach(1)	10						CTGTTTTTGTCATGTCTCTTC	0.368																																																	0													66.0	57.0	60.0					4																	39033931		2201	4298	6499	SO:0001582	initiator_codon_variant	0			AK026888	CCDS3448.1	4p14	2008-02-05			ENSG00000121895	ENSG00000121895			26260	protein-coding gene	gene with protein product						12477932	Standard	NM_024943		Approved	FLJ23235	uc003gto.3	Q8N614	OTTHUMG00000128582	ENST00000381938.3:c.3G>T	4.37:g.39033931C>A	ENSP00000371364:p.Met1Ile		Q9H5N9	Missense_Mutation	SNP	NULL	p.M1I	ENST00000381938.3	37	c.3	CCDS3448.1	4	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911519	0.72983	.	.	ENSG00000121895	ENST00000381938;ENST00000344606	T;T	0.56103	1.5;0.48	5.39	5.39	0.77823	.	0.230183	0.38663	N	0.001612	T	0.72534	0.3472	.	.	.	0.80722	D	1	D	0.67145	0.996	D	0.78314	0.991	T	0.74996	-0.3473	9	0.62326	D	0.03	-10.1475	14.9943	0.71418	0.0:1.0:0.0:0.0	.	1	Q8N614	TM156_HUMAN	I	1	ENSP00000371364:M1I;ENSP00000343758:M1I	ENSP00000343758:M1I	M	-	3	0	TMEM156	38710326	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	3.863000	0.56016	2.675000	0.91044	0.591000	0.81541	ATG	TMEM156	-	NULL	ENSG00000121895		0.368	TMEM156-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM156	HGNC	protein_coding	OTTHUMT00000250435.3	-	0.00	45	0	C	NM_024943	Missense_Mutation	39033931	-1	tier1	-	no_errors	ENST00000381938	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	A
TMEM176B	28959	genome.wustl.edu	37	7	150490641	150490641	+	Silent	SNP	G	G	T	rs556270613	byFrequency	TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:150490641G>T	ENST00000447204.2	-	4	735	c.363C>A	c.(361-363)ggC>ggA	p.G121G	TMEM176B_ENST00000434545.1_Silent_p.G121G|TMEM176B_ENST00000450753.2_Silent_p.G84G|TMEM176B_ENST00000326442.5_Silent_p.G121G|TMEM176B_ENST00000492607.1_Silent_p.G121G|TMEM176B_ENST00000429904.2_Silent_p.G121G	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	121					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCAAGTTTGCCCGGGTGCT	0.502													G|||	2	0.000399361	0.0	0.0	5008	,	,		19217	0.002		0.0	False		,,,				2504	0.0																0													111.0	104.0	106.0					7																	150490641		2203	4300	6503	SO:0001819	synonymous_variant	0			AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.363C>A	7.37:g.150490641G>T			B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Silent	SNP	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	p.G121	ENST00000447204.2	37	c.363	CCDS5908.1	7																																																																																			TMEM176B	-	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	ENSG00000106565		0.502	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM176B	HGNC	protein_coding	OTTHUMT00000349204.1		0.00	59	0	G	NM_014020		150490641	-1			no_errors	ENST00000326442	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.002	T
TNXB	7148	genome.wustl.edu	37	6	32049952	32049952	+	Silent	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr6:32049952C>A	ENST00000375244.3	-	9	3798	c.3597G>T	c.(3595-3597)cgG>cgT	p.R1199R	TNXB_ENST00000375247.2_Silent_p.R1199R			P22105	TENX_HUMAN	tenascin XB	1286	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCACCTGGGGCCGTCCATCCC	0.562																																																	0													43.0	39.0	40.0					6																	32049952		1269	2542	3811	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3597G>T	6.37:g.32049952C>A			P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R1199	ENST00000375244.3	37	c.3597		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.562	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2		0.00	80	0	C	NM_019105		32049952	-1			no_errors	ENST00000375247	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.701	A
TP53INP2	58476	genome.wustl.edu	37	20	33297097	33297097	+	Missense_Mutation	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:33297097C>T	ENST00000374810.3	+	4	571	c.182C>T	c.(181-183)cCg>cTg	p.P61L	NCOA6_ENST00000593786.1_Intron|TP53INP2_ENST00000374809.2_Missense_Mutation_p.P61L	NM_021202.1	NP_067025.1	Q8IXH6	T53I2_HUMAN	tumor protein p53 inducible nuclear protein 2	61					autophagic vacuole assembly (GO:0000045)|osteoblast differentiation (GO:0001649)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(1)|urinary_tract(1)	2						ggccgccctccgcccgcgccc	0.736																																																	0													7.0	9.0	8.0					20																	33297097		2046	4154	6200	SO:0001583	missense	0			AL109824	CCDS13240.1	20q11.22	2010-01-05	2004-06-18	2004-06-18	ENSG00000078804	ENSG00000078804			16104	protein-coding gene	gene with protein product	"""diabetes and obesity regulated"""		"""chromosome 20 open reading frame 110"""	C20orf110		12477932	Standard	NM_021202		Approved	FLJ21759, FLJ23500, DKFZp434B2411, DKFZp434O0827, dJ1181N3.1, PINH, DOR	uc002xau.1	Q8IXH6	OTTHUMG00000032310	ENST00000374810.3:c.182C>T	20.37:g.33297097C>T	ENSP00000363943:p.Pro61Leu		A8K8S8|E1P5P6|Q5JX64|Q8IYL5|Q9NU00	Missense_Mutation	SNP	NULL	p.P61L	ENST00000374810.3	37	c.182	CCDS13240.1	20	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114130	0.56398	.	.	ENSG00000078804	ENST00000374810;ENST00000374809;ENST00000414082	T;T;T	0.33438	1.41;1.41;1.41	3.73	2.77	0.32553	.	0.160747	0.42053	D	0.000767	T	0.21550	0.0519	L	0.43923	1.385	0.53005	D	0.999961	B	0.10296	0.003	B	0.10450	0.005	T	0.08659	-1.0711	10	0.41790	T	0.15	-8.1197	4.2036	0.10478	0.1649:0.5828:0.1601:0.0922	.	61	Q8IXH6	T53I2_HUMAN	L	61	ENSP00000363943:P61L;ENSP00000363942:P61L;ENSP00000404410:P61L	ENSP00000363942:P61L	P	+	2	0	TP53INP2	32760758	0.887000	0.30362	0.996000	0.52242	0.969000	0.65631	0.639000	0.24690	1.131000	0.42111	0.561000	0.74099	CCG	TP53INP2	-	NULL	ENSG00000078804		0.736	TP53INP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53INP2	HGNC	protein_coding	OTTHUMT00000078807.2		0.00	61	0	C	NM_021202		33297097	+1			no_errors	ENST00000374809	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.993	T
TRIM33	51592	genome.wustl.edu	37	1	114967322	114967322	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:114967322G>T	ENST00000358465.2	-	10	1834	c.1751C>A	c.(1750-1752)gCt>gAt	p.A584D	TRIM33_ENST00000369543.2_Missense_Mutation_p.A584D|TRIM33_ENST00000450349.2_Missense_Mutation_p.A192D	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	584					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCTTGAAAAGCTCCACAGTT	0.433			T	RET	papillary thyroid																																			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	0													128.0	111.0	117.0					1																	114967322		2203	4300	6503	SO:0001583	missense	0			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1751C>A	1.37:g.114967322G>T	ENSP00000351250:p.Ala584Asp		O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.A584D	ENST00000358465.2	37	c.1751	CCDS872.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.21|19.21	3.783872|3.783872	0.70222|0.70222	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349|ENST00000448034	T;T;T|.	0.75821|.	-0.85;-0.73;-0.97|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.417760|.	0.29646|.	N|.	0.011575|.	T|T	0.39835|0.39835	0.1093|0.1093	N|N	0.14661|0.14661	0.345|0.345	0.53688|0.53688	D|D	0.999976|0.999976	P;P;B;B|.	0.35433|.	0.501;0.501;0.403;0.281|.	B;B;B;B|.	0.36289|.	0.154;0.058;0.221;0.11|.	T|T	0.33752|0.33752	-0.9856|-0.9856	10|5	0.44086|.	T|.	0.13|.	-6.529|-6.529	19.6568|19.6568	0.95845|0.95845	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	192;192;584;584|.	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9|.	.;.;.;TRI33_HUMAN|.	D|I	584;584;192|321	ENSP00000351250:A584D;ENSP00000358556:A584D;ENSP00000412077:A192D|.	ENSP00000351250:A584D|.	A|L	-|-	2|1	0|0	TRIM33|TRIM33	114768845|114768845	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	5.105000|5.105000	0.64591|0.64591	2.656000|2.656000	0.90262|0.90262	0.650000|0.650000	0.86243|0.86243	GCT|CTT	TRIM33	-	NULL	ENSG00000197323		0.433	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM33	HGNC	protein_coding	OTTHUMT00000032854.1	-	0.00	39	0	G	NM_015906		114967322	-1	tier1	-	no_errors	ENST00000358465	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
TRIM35	23087	genome.wustl.edu	37	8	27145627	27145627	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr8:27145627G>T	ENST00000305364.4	-	6	1005	c.922C>A	c.(922-924)Ccc>Acc	p.P308T	TRIM35_ENST00000521253.1_3'UTR	NM_171982.3	NP_741983.2	Q9UPQ4	TRI35_HUMAN	tripartite motif containing 35	308	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				apoptotic process (GO:0006915)|innate immune response (GO:0045087)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(6)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	14		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0213)|Epithelial(17;9.34e-10)|Colorectal(74;0.141)		GCGGTGTTGGGGTCAAAGCTG	0.592																																																	0													35.0	39.0	38.0					8																	27145627		2203	4300	6503	SO:0001583	missense	0			AB029021	CCDS6056.2	8p21.2	2013-01-09	2011-01-25		ENSG00000104228	ENSG00000104228		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16285	protein-coding gene	gene with protein product			"""tripartite motif-containing 35"""			11331580, 14662771, 12692137	Standard	XM_005273451		Approved	KIAA1098, MAIR, HLS5	uc003xfl.1	Q9UPQ4	OTTHUMG00000102047	ENST00000305364.4:c.922C>A	8.37:g.27145627G>T	ENSP00000301924:p.Pro308Thr		Q86XQ0|Q8WVA4	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P308T	ENST00000305364.4	37	c.922	CCDS6056.2	8	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992477	0.54041	.	.	ENSG00000104228	ENST00000305364;ENST00000380544	T	0.19806	2.12	5.58	5.58	0.84498	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.000000	0.64402	D	0.000003	T	0.53158	0.1779	M	0.89030	3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59484	-0.7446	10	0.59425	D	0.04	.	15.0751	0.72071	0.0:0.0:1.0:0.0	.	308	Q9UPQ4	TRI35_HUMAN	T	308	ENSP00000301924:P308T	ENSP00000301924:P308T	P	-	1	0	TRIM35	27201544	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	7.032000	0.76498	2.630000	0.89119	0.491000	0.48974	CCC	TRIM35	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000104228		0.592	TRIM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM35	HGNC	protein_coding	OTTHUMT00000219848.2		0.00	25	0	G	NM_171982		27145627	-1			no_errors	ENST00000305364	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
TRIO	7204	genome.wustl.edu	37	5	14336722	14336722	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:14336722G>T	ENST00000344204.4	+	11	1956	c.1932G>T	c.(1930-1932)gaG>gaT	p.E644D	TRIO_ENST00000537187.1_Missense_Mutation_p.E644D|TRIO_ENST00000509967.2_Missense_Mutation_p.E595D	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	644					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ACCCCGAAGAGATTTATCAGG	0.498																																																	0													103.0	92.0	96.0					5																	14336722		2203	4300	6503	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.1932G>T	5.37:g.14336722G>T	ENSP00000339299:p.Glu644Asp		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.E644D	ENST00000344204.4	37	c.1932	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222017	0.58560	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.41758	0.99;0.99;0.99	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.48943	0.1528	L	0.31420	0.93	0.58432	D	0.999992	D;D;D	0.76494	0.997;0.999;0.992	D;D;D	0.85130	0.967;0.997;0.989	T	0.45249	-0.9274	10	0.45353	T	0.12	.	9.3611	0.38197	0.1648:0.0:0.8352:0.0	.	595;644;644	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	D	644;644;595;331	ENSP00000339299:E644D;ENSP00000446348:E644D;ENSP00000445592:E595D	ENSP00000339299:E644D	E	+	3	2	TRIO	14389722	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.036000	0.57304	2.471000	0.83476	0.650000	0.86243	GAG	TRIO	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000038382		0.498	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	-	0.00	62	0	G	NM_007118		14336722	+1	tier1	-	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
TSPAN6	7105	genome.wustl.edu	37	X	99887533	99887533	+	Missense_Mutation	SNP	C	C	G			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:99887533C>G	ENST00000373020.4	-	6	729	c.618G>C	c.(616-618)gaG>gaC	p.E206D	TSPAN6_ENST00000496771.1_5'Flank	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6	206					negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)	p.E206D(1)		endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CCATTTCTGACTCTATAATGG	0.363																																																	1	Substitution - Missense(1)	large_intestine(1)											64.0	59.0	61.0					X																	99887533		2203	4300	6503	SO:0001583	missense	0			AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.618G>C	X.37:g.99887533C>G	ENSP00000362111:p.Glu206Asp		Q54A42|Q6IAN9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.E206D	ENST00000373020.4	37	c.618	CCDS14470.1	X	.	.	.	.	.	.	.	.	.	.	C	15.95	2.982717	0.53827	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	T	0.79749	-1.3	5.5	1.47	0.22746	Tetraspanin, EC2 domain (1);	0.344862	0.36200	N	0.002726	T	0.81950	0.4931	M	0.78344	2.41	0.54753	D	0.999981	B	0.31227	0.314	B	0.42163	0.378	T	0.75611	-0.3258	9	.	.	.	.	9.8988	0.41335	0.0:0.6577:0.0:0.3423	.	206	O43657	TSN6_HUMAN	D	206;188	ENSP00000362111:E206D	.	E	-	3	2	TSPAN6	99774189	0.705000	0.27846	1.000000	0.80357	0.549000	0.35272	-0.159000	0.10056	0.165000	0.19558	0.513000	0.50165	GAG	TSPAN6	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000000003		0.363	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	HGNC	protein_coding	OTTHUMT00000057483.1	-	0.00	97	0	C			99887533	-1	tier1	-	no_errors	ENST00000373020	ensembl	human	known	74_37	missense	7.04	65	5	SNP	1.000	G
UGGT1	56886	genome.wustl.edu	37	2	128922332	128922332	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:128922332G>T	ENST00000259253.6	+	26	2901	c.2854G>T	c.(2854-2856)Gct>Tct	p.A952S	UGGT1_ENST00000375990.3_Missense_Mutation_p.A928S	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	952					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						GAAGGTGGATGCTCTTCTGTC	0.373																																																	0													103.0	101.0	102.0					2																	128922332		2203	4300	6503	SO:0001583	missense	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.2854G>T	2.37:g.128922332G>T	ENSP00000259253:p.Ala952Ser		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans	p.A952S	ENST00000259253.6	37	c.2854	CCDS2154.1	2	.	.	.	.	.	.	.	.	.	.	G	13.46	2.244995	0.39697	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	T;T	0.29142	1.58;1.58	5.35	5.35	0.76521	.	0.111068	0.64402	D	0.000012	T	0.21468	0.0517	N	0.25031	0.7	0.45690	D	0.998608	B;B	0.02656	0.0;0.0	B;B	0.16289	0.002;0.015	T	0.05500	-1.0881	9	.	.	.	.	14.2907	0.66275	0.0:0.0:0.8513:0.1487	.	928;952	Q9NYU2-2;Q9NYU2	.;UGGG1_HUMAN	S	928;952	ENSP00000365158:A928S;ENSP00000259253:A952S	.	A	+	1	0	UGGT1	128638802	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.226000	0.51254	2.634000	0.89283	0.557000	0.71058	GCT	UGGT1	-	pfam_UDP-g_GGtrans	ENSG00000136731		0.373	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	-	0.00	73	0	G	NM_020120		128922332	+1	tier1	-	no_errors	ENST00000259253	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
UBR3	130507	genome.wustl.edu	37	2	170783470	170783470	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:170783470G>T	ENST00000272793.5	+	16	2377	c.2327G>T	c.(2326-2328)cGt>cTt	p.R776L	UBR3_ENST00000418381.1_Missense_Mutation_p.R776L			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	776					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTGAGTCTTCGTTTACATTTA	0.393																																																	0													380.0	323.0	340.0					2																	170783470		692	1591	2283	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.2327G>T	2.37:g.170783470G>T	ENSP00000272793:p.Arg776Leu		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R776L	ENST00000272793.5	37	c.2327		2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418203	0.83449	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.64085	-0.08;-0.08	5.25	5.25	0.73442	.	.	.	.	.	T	0.76828	0.4042	M	0.67397	2.05	0.80722	D	1	D	0.60160	0.987	D	0.67725	0.953	T	0.77653	-0.2507	9	0.51188	T	0.08	.	17.0258	0.86446	0.0:0.0:1.0:0.0	.	776	Q6ZT12	UBR3_HUMAN	L	776	ENSP00000272793:R776L;ENSP00000396068:R776L	ENSP00000272793:R776L	R	+	2	0	UBR3	170491716	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.459000	0.83118	0.557000	0.71058	CGT	UBR3	-	NULL	ENSG00000144357		0.393	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2		0.00	19	0	G	NM_172070		170783470	+1			no_errors	ENST00000272793	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179605299	179605299	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr2:179605299G>T	ENST00000591111.1	-	46	11934	c.11710C>A	c.(11710-11712)Cca>Aca	p.P3904T	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.P3858T|TTN_ENST00000342175.6_Missense_Mutation_p.P4050T|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P4221T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.P3983T			Q8WZ42	TITIN_HUMAN	titin	0					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAATGCATTGGAGGTTCTATT	0.383																																																	0													134.0	122.0	126.0					2																	179605299		1854	4107	5961	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11710C>A	2.37:g.179605299G>T	ENSP00000465570:p.Pro3904Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P4050T	ENST00000591111.1	37	c.12148		2	.	.	.	.	.	.	.	.	.	.	G	2.411	-0.335301	0.05278	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.60171	0.27;0.22;0.21	5.51	1.53	0.23141	.	.	.	.	.	T	0.40719	0.1128	L	0.27053	0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33471	-0.9867	9	0.87932	D	0	.	5.2932	0.15739	0.0652:0.3442:0.3547:0.2359	.	3858;3983;4050	D3DPF9;E7EQE6;E7ET18	.;.;.	T	3858;4050;3983;3858	ENSP00000434586:P3858T;ENSP00000340554:P4050T;ENSP00000352154:P3983T	ENSP00000340554:P4050T	P	-	1	0	TTN	179313544	0.024000	0.19004	0.000000	0.03702	0.300000	0.27592	0.725000	0.25970	0.005000	0.14708	0.655000	0.94253	CCA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	60	0	G	NM_133378		179605299	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.000	T
USP24	23358	genome.wustl.edu	37	1	55599820	55599820	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:55599820G>T	ENST00000294383.6	-	30	3303	c.3304C>A	c.(3304-3306)Cgg>Agg	p.R1102R	USP24_ENST00000407756.1_Silent_p.R942R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1102					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						AGAAGCTTCCGTACTCGTAGA	0.328																																																	0													47.0	45.0	45.0					1																	55599820		1831	4087	5918	SO:0001819	synonymous_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.3304C>A	1.37:g.55599820G>T			Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	pfam_Peptidase_C19/C67,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19/C67	p.R942	ENST00000294383.6	37	c.2824	CCDS44154.2	1																																																																																			USP24	-	NULL	ENSG00000162402		0.328	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2		0.00	55	0	G			55599820	-1			no_errors	ENST00000407756	ensembl	human	known	74_37	silent	6.45	29	2	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216052381	216052381	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:216052381C>A	ENST00000307340.3	-	42	8669	c.8283G>T	c.(8281-8283)atG>atT	p.M2761I	USH2A_ENST00000366943.2_Missense_Mutation_p.M2761I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2761	Fibronectin type-III 14. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAGGGTCAGGCATGTGAATCT	0.403										HNSCC(13;0.011)																																							0													156.0	156.0	156.0					1																	216052381		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8283G>T	1.37:g.216052381C>A	ENSP00000305941:p.Met2761Ile		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.M2761I	ENST00000307340.3	37	c.8283	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099437	0.76983	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.55760	0.5;0.5	6.16	5.23	0.72850	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000041	T	0.60222	0.2252	M	0.82323	2.585	0.38654	D	0.951912	P	0.39535	0.677	B	0.40329	0.326	T	0.65150	-0.6238	10	0.30078	T	0.28	.	16.8855	0.86075	0.0:0.8449:0.1551:0.0	.	2761	O75445	USH2A_HUMAN	I	2761	ENSP00000305941:M2761I;ENSP00000355910:M2761I	ENSP00000305941:M2761I	M	-	3	0	USH2A	214119004	1.000000	0.71417	0.989000	0.46669	0.975000	0.68041	3.630000	0.54273	1.514000	0.48869	0.650000	0.86243	ATG	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	46	0	C	NM_007123		216052381	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
VCP	7415	genome.wustl.edu	37	9	35062127	35062127	+	Silent	SNP	G	G	T	rs377316335		TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:35062127G>T	ENST00000358901.6	-	9	1849	c.954C>A	c.(952-954)ggC>ggA	p.G318G		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	318					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GCTCCACCTCGCCATGAGTCT	0.522																																																	0													185.0	157.0	166.0					9																	35062127		2203	4300	6503	SO:0001819	synonymous_variant	0			AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.954C>A	9.37:g.35062127G>T			B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Silent	SNP	pfam_ATPase_AAA_core,pfam_CDC4_N-term_subdom,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_Cdc48_dom2,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_Vps4_C,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	p.G318	ENST00000358901.6	37	c.954	CCDS6573.1	9																																																																																			VCP	-	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_AAA_ATPase_CDC48	ENSG00000165280		0.522	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCP	HGNC	protein_coding	OTTHUMT00000052290.1	-	0.00	30	0	G	NM_007126		35062127	-1	tier1	-	no_errors	ENST00000358901	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.622	T
VSX1	30813	genome.wustl.edu	37	20	25057116	25057116	+	Silent	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr20:25057116G>T	ENST00000376709.4	-	5	1142	c.879C>A	c.(877-879)ggC>ggA	p.G293G	VSX1_ENST00000424574.1_Intron|VSX1_ENST00000429762.3_Intron|VSX1_ENST00000451258.1_Intron|VSX1_ENST00000444511.2_Intron	NM_014588.5	NP_055403.2	Q9NZR4	VSX1_HUMAN	visual system homeobox 1	293					neuron maturation (GO:0042551)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(3)|lung(2)	6						AGTGGTCAGAGCCCCAGAGTC	0.428																																																	0													101.0	109.0	106.0					20																	25057116		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176797	CCDS13168.1, CCDS13169.1, CCDS58766.1, CCDS58767.1	20p11.21	2014-02-14	2007-07-12		ENSG00000100987	ENSG00000100987		"""Homeoboxes / PRD class"""	12723	protein-coding gene	gene with protein product		605020	"""posterior polymorphous corneal dystrophy"", ""visual system homeobox 1 homolog, CHX10-like (zebrafish)"""	PPCD		10673340	Standard	NM_001256272		Approved	PPD, PPCD1	uc002wuf.4	Q9NZR4	OTTHUMG00000032111	ENST00000376709.4:c.879C>A	20.37:g.25057116G>T			B9EGJ4|D1MF28|Q0GM60|Q0GM61|Q0GM62|Q0GM63|Q0GM64|Q0GM65|Q5TF40|Q5TF41|Q9HCU3|Q9NU27	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G293	ENST00000376709.4	37	c.879	CCDS13168.1	20																																																																																			VSX1	-	NULL	ENSG00000100987		0.428	VSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSX1	HGNC	protein_coding	OTTHUMT00000078384.3	-	0.00	15	0	G			25057116	-1	tier1	-	no_errors	ENST00000376709	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.000	T
WDR17	116966	genome.wustl.edu	37	4	177067295	177067295	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:177067295G>T	ENST00000280190.4	+	13	1907	c.1751G>T	c.(1750-1752)aGt>aTt	p.S584I	WDR17_ENST00000393643.2_Missense_Mutation_p.S560I|WDR17_ENST00000508596.1_Missense_Mutation_p.S560I|WDR17_ENST00000507824.2_Missense_Mutation_p.S567I			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	584										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ATTCTTTGCAGTGGTTCTGAT	0.348																																																	0													131.0	125.0	127.0					4																	177067295		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1751G>T	4.37:g.177067295G>T	ENSP00000280190:p.Ser584Ile		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S584I	ENST00000280190.4	37	c.1751	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785269	0.70337	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.72282	-0.64;-0.64;-0.64	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.114352	0.64402	D	0.000013	D	0.88621	0.6486	M	0.94063	3.49	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91672	0.5351	10	0.87932	D	0	-24.4945	18.6126	0.91291	0.0:0.0:1.0:0.0	.	560;584	E7EQX0;Q8IZU2	.;WDR17_HUMAN	I	560;560;584;567	ENSP00000422763:S560I;ENSP00000377258:S560I;ENSP00000280190:S584I	ENSP00000280190:S584I	S	+	2	0	WDR17	177304289	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.618000	0.74214	2.391000	0.81399	0.563000	0.77884	AGT	WDR17	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000150627		0.348	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2		0.00	109	0	G			177067295	+1			no_errors	ENST00000280190	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
WDR49	151790	genome.wustl.edu	37	3	167320043	167320043	+	Missense_Mutation	SNP	T	T	C			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:167320043T>C	ENST00000308378.3	-	3	429	c.124A>G	c.(124-126)Aaa>Gaa	p.K42E	WDR49_ENST00000479765.1_Missense_Mutation_p.K383E|WDR49_ENST00000453925.2_Missense_Mutation_p.K95E	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	42										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						AGGCAAACTTTATTGTTAATG	0.383																																																	0													56.0	53.0	54.0					3																	167320043		2203	4300	6503	SO:0001583	missense	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.124A>G	3.37:g.167320043T>C	ENSP00000311343:p.Lys42Glu		Q8N297	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K42E	ENST00000308378.3	37	c.124	CCDS3201.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.98|11.98	1.800542|1.800542	0.31869|0.31869	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000479765;ENST00000453925	.|T;T;T	.|0.29655	.|1.62;1.56;2.22	5.4|5.4	4.24|4.24	0.50183|0.50183	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	.|0.385818	.|0.26991	.|N	.|0.021473	T|T	0.23249|0.23249	0.0562|0.0562	L|L	0.50333|0.50333	1.59|1.59	0.26535|0.26535	N|N	0.974182|0.974182	.|P;P;P	.|0.36483	.|0.495;0.495;0.555	.|B;B;B	.|0.31290	.|0.09;0.09;0.127	T|T	0.14504|0.14504	-1.0470|-1.0470	5|10	.|0.37606	.|T	.|0.19	.|.	7.1197|7.1197	0.25437|0.25437	0.0:0.0786:0.1468:0.7746|0.0:0.0786:0.1468:0.7746	.|.	.|95;383;42	.|E7EQK3;E9PDB0;Q8IV35	.|.;.;WDR49_HUMAN	M|E	106|42;383;95	.|ENSP00000311343:K42E;ENSP00000419749:K383E;ENSP00000410863:K95E	.|ENSP00000311343:K42E	I|K	-|-	3|1	3|0	WDR49|WDR49	168802737|168802737	0.978000|0.978000	0.34361|0.34361	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	0.594000|0.594000	0.24014|0.24014	0.875000|0.875000	0.35847|0.35847	0.455000|0.455000	0.32223|0.32223	ATA|AAA	WDR49	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000174776		0.383	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3		0.00	59	0	T	NM_178824		167320043	-1			no_errors	ENST00000308378	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	C
WWC1	23286	genome.wustl.edu	37	5	167882521	167882521	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:167882521G>T	ENST00000265293.4	+	19	3321	c.2819G>T	c.(2818-2820)tGc>tTc	p.C940F	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Missense_Mutation_p.C940F	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	940	Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CAGTACGTGTGCCGGGTAAGT	0.607																																																	0													87.0	85.0	86.0					5																	167882521		2203	4300	6503	SO:0001583	missense	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2819G>T	5.37:g.167882521G>T	ENSP00000265293:p.Cys940Phe		B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.C940F	ENST00000265293.4	37	c.2819	CCDS4366.1	5	.	.	.	.	.	.	.	.	.	.	G	24.4	4.527296	0.85706	.	.	ENSG00000113645	ENST00000265293;ENST00000521089;ENST00000524038	T;T;T	0.69806	-0.43;-0.43;-0.43	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.84056	0.5388	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	1.0;0.991	D;P	0.85130	0.997;0.757	D	0.86119	0.1567	10	0.87932	D	0	.	19.325	0.94258	0.0:0.0:1.0:0.0	.	940;940	Q8IX03-2;Q8IX03	.;KIBRA_HUMAN	F	940;940;266	ENSP00000265293:C940F;ENSP00000427772:C940F;ENSP00000428084:C266F	ENSP00000265293:C940F	C	+	2	0	WWC1	167815099	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	9.772000	0.98984	2.559000	0.86315	0.655000	0.94253	TGC	WWC1	-	NULL	ENSG00000113645		0.607	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2	-	0.00	23	0	G	NM_015238		167882521	+1	tier1	-	no_errors	ENST00000265293	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
ZC3H13	23091	genome.wustl.edu	37	13	46549808	46549809	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr13:46549808_46549809delCT	ENST00000242848.4	-	12	2425_2426	c.2077_2078delAG	c.(2077-2079)aggfs	p.R693fs	ZC3H13_ENST00000282007.3_Frame_Shift_Del_p.R693fs			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	693	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		ttcacgttccctctctctctcc	0.495																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0																																										SO:0001589	frameshift_variant	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2077_2078delAG	13.37:g.46549816_46549817delCT	ENSP00000242848:p.Arg693fs		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Frame_Shift_Del	DEL	pfam_Znf_CCCH,smart_Znf_CCCH	p.R693fs	ENST00000242848.4	37	c.2078_2077		13																																																																																			ZC3H13	-	NULL	ENSG00000123200		0.495	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1		0.00	38	0	CT	NM_015070		46549809	-1	tier1		no_errors	ENST00000242848	ensembl	human	known	74_37	frame_shift_del	18.18	9	2	DEL	0.991:0.444	-
ZFP69	339559	genome.wustl.edu	37	1	40961561	40961561	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:40961561C>A	ENST00000372706.1	+	6	2417	c.1411C>A	c.(1411-1413)Cgc>Agc	p.R471S	RP11-656D10.3_ENST00000450713.1_RNA|ZFP69_ENST00000372705.3_Missense_Mutation_p.R471S			Q49AA0	ZFP69_HUMAN	ZFP69 zinc finger protein	471					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGAATGCAACCGCTGTGGAAA	0.393																																																	0													76.0	74.0	75.0					1																	40961561		2203	4300	6503	SO:0001583	missense	0			AK122618	CCDS30686.1	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187815	ENSG00000187815		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	24708	protein-coding gene	gene with protein product	"""ZFP69 zinc finger protein A"""		"""zinc finger protein 642"""	ZNF642			Standard	XM_005270808		Approved	ZKSCAN23A, FLJ16030, ZFP69A, ZSCAN54A	uc001cfo.3	Q49AA0	OTTHUMG00000007303	ENST00000372706.1:c.1411C>A	1.37:g.40961561C>A	ENSP00000361791:p.Arg471Ser		Q5SWM5|Q6ZWK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R471S	ENST00000372706.1	37	c.1411	CCDS30686.1	1	.	.	.	.	.	.	.	.	.	.	C	15.72	2.915707	0.52546	.	.	ENSG00000187815	ENST00000372706;ENST00000372705	T;T	0.14893	2.47;2.47	4.51	4.51	0.55191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42294	D	0.000732	T	0.15478	0.0373	N	0.10874	0.06	0.09310	N	1	D	0.58268	0.982	P	0.53722	0.733	T	0.06092	-1.0846	10	0.72032	D	0.01	-12.0743	10.9555	0.47356	0.0:0.8111:0.1889:0.0	.	471	Q49AA0	ZN642_HUMAN	S	471	ENSP00000361791:R471S;ENSP00000361790:R471S	ENSP00000361790:R471S	R	+	1	0	ZNF642	40734148	0.000000	0.05858	0.998000	0.56505	0.973000	0.67179	0.329000	0.19698	2.786000	0.95864	0.561000	0.74099	CGC	ZFP69	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187815		0.393	ZFP69-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZFP69	HGNC	protein_coding	OTTHUMT00000019082.1		0.00	48	0	C	NM_198494		40961561	+1			no_errors	ENST00000372705	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.131	A
ZCCHC11	23318	genome.wustl.edu	37	1	52991514	52991514	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:52991514G>T	ENST00000371544.3	-	2	701	c.439C>A	c.(439-441)Cag>Aag	p.Q147K	ZCCHC11_ENST00000355809.4_Missense_Mutation_p.Q147K|ZCCHC11_ENST00000257177.4_Missense_Mutation_p.Q147K|ZCCHC11_ENST00000371541.1_5'UTR	NM_001009881.2|NM_015269.2	NP_001009881.1|NP_056084.1	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11	147					cytokine production (GO:0001816)|miRNA catabolic process (GO:0010587)|miRNA metabolic process (GO:0010586)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|pre-miRNA processing (GO:0031054)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|RNA 3'-end processing (GO:0031123)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(17)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	58						GACTTCATCTGATAACTGGAT	0.393																																																	0													188.0	192.0	191.0					1																	52991514		2203	4300	6503	SO:0001583	missense	0			D83776	CCDS30715.1, CCDS30716.1	1p32.3	2014-03-05			ENSG00000134744	ENSG00000134744		"""Zinc fingers, CCHC domain containing"""	28981	protein-coding gene	gene with protein product	"""TUTase4"""	613692				8724849, 12239557	Standard	NM_015269		Approved	KIAA0191, PAPD3, TUT4	uc001cty.2	Q5TAX3	OTTHUMG00000008200	ENST00000371544.3:c.439C>A	1.37:g.52991514G>T	ENSP00000360599:p.Gln147Lys		A2RRP0|B7Z8J5|D3DQ35|Q12764|Q5TAX2|Q5TAX4|Q86XZ3	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,pfam_Nucleotidyltransferase,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q147K	ENST00000371544.3	37	c.439	CCDS30716.1	1	.	.	.	.	.	.	.	.	.	.	G	8.378	0.836887	0.16891	.	.	ENSG00000134744	ENST00000257177;ENST00000371544;ENST00000528642;ENST00000355809	T;T;T	0.46063	1.04;1.04;0.88	4.82	3.82	0.43975	.	1.674850	0.03007	N	0.148880	T	0.41627	0.1167	L	0.56769	1.78	0.36650	D	0.877321	B;B;P;B	0.42871	0.031;0.372;0.792;0.001	B;B;B;B	0.35039	0.017;0.114;0.194;0.002	T	0.50996	-0.8761	10	0.24483	T	0.36	.	12.9535	0.58413	0.0:0.0:0.8383:0.1617	.	147;147;147;147	E9PKY2;Q5TAX3-2;E9PRG2;Q5TAX3	.;.;.;TUT4_HUMAN	K	147	ENSP00000257177:Q147K;ENSP00000360599:Q147K;ENSP00000433486:Q147K	ENSP00000257177:Q147K	Q	-	1	0	ZCCHC11	52764102	1.000000	0.71417	0.990000	0.47175	0.012000	0.07955	4.088000	0.57678	2.607000	0.88179	0.655000	0.94253	CAG	ZCCHC11	-	NULL	ENSG00000134744		0.393	ZCCHC11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZCCHC11	HGNC	protein_coding	OTTHUMT00000022462.1	-	0.00	41	0	G	XM_038288		52991514	-1	tier1	-	no_errors	ENST00000257177	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.965	T
ZKSCAN1	7586	genome.wustl.edu	37	7	99631789	99631789	+	Missense_Mutation	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:99631789C>T	ENST00000324306.6	+	6	1895	c.1661C>T	c.(1660-1662)gCa>gTa	p.A554V	ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.A518V|ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.A341V	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	554					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			TCCCTTGATGCATTTGGCGCG	0.493																																																	0													98.0	92.0	94.0					7																	99631789		2203	4300	6503	SO:0001583	missense	0			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1661C>T	7.37:g.99631789C>T	ENSP00000323148:p.Ala554Val		A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.A554V	ENST00000324306.6	37	c.1661	CCDS34698.1	7	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742536	0.49151	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.06933	3.34;3.3;3.24	5.53	5.53	0.82687	.	0.225081	0.31612	N	0.007356	T	0.04907	0.0132	N	0.08118	0	0.31774	N	0.631691	B	0.20368	0.044	B	0.21708	0.036	T	0.11591	-1.0581	10	0.36615	T	0.2	.	10.2233	0.43209	0.0:0.9129:0.0:0.0871	.	554	P17029	ZKSC1_HUMAN	V	554;518;341	ENSP00000323148:A554V;ENSP00000409172:A518V;ENSP00000443508:A341V	ENSP00000323148:A554V	A	+	2	0	ZKSCAN1	99469725	0.965000	0.33210	0.973000	0.42090	0.967000	0.64934	2.275000	0.43399	2.882000	0.98803	0.655000	0.94253	GCA	ZKSCAN1	-	NULL	ENSG00000106261		0.493	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN1	HGNC	protein_coding	OTTHUMT00000344550.2	-	0.00	35	0	C	NM_003439		99631789	+1	tier1	-	no_errors	ENST00000324306	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.916	T
ZMYM3	9203	genome.wustl.edu	37	X	70473060	70473060	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:70473060G>T	ENST00000353904.2	-	2	233	c.46C>A	c.(46-48)Cca>Aca	p.P16T	ZMYM3_ENST00000373981.1_Missense_Mutation_p.P16T|ZMYM3_ENST00000373998.1_Missense_Mutation_p.P16T|ZMYM3_ENST00000373984.3_Missense_Mutation_p.P16T|ZMYM3_ENST00000373982.1_Missense_Mutation_p.P16T|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P16T|ZMYM3_ENST00000373978.1_Missense_Mutation_p.P16T|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P16T	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	16					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GGCTTCTCTGGCAGGGTCAAT	0.552											OREG0019858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													28.0	29.0	29.0					X																	70473060		1990	4157	6147	SO:0001583	missense	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.46C>A	X.37:g.70473060G>T	ENSP00000343909:p.Pro16Thr	1122	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.P16T	ENST00000353904.2	37	c.46	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	16.79	3.219566	0.58560	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43;1.43;1.43;1.43	4.64	4.64	0.57946	.	0.000000	0.49916	D	0.000140	T	0.40719	0.1128	N	0.19112	0.55	0.36211	D	0.851342	D;D;D	0.71674	0.998;0.997;0.994	D;D;D	0.78314	0.987;0.991;0.981	T	0.55509	-0.8130	10	0.87932	D	0	-3.7351	15.0413	0.71793	0.0:0.0:1.0:0.0	.	16;16;16	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	T	16	ENSP00000322845:P16T;ENSP00000363110:P16T;ENSP00000343909:P16T;ENSP00000363096:P16T;ENSP00000363100:P16T;ENSP00000363094:P16T;ENSP00000363093:P16T;ENSP00000363090:P16T	ENSP00000322845:P16T	P	-	1	0	ZMYM3	70389785	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.802000	0.69122	1.898000	0.54952	0.287000	0.19450	CCA	ZMYM3	-	NULL	ENSG00000147130		0.552	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	33	0	G	NM_201599		70473060	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	T
ZNF181	339318	genome.wustl.edu	37	19	35232847	35232847	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:35232847G>T	ENST00000492450.1	+	4	1650	c.1561G>T	c.(1561-1563)Gag>Tag	p.E521*	ZNF181_ENST00000459757.2_Nonsense_Mutation_p.E520*|ZNF181_ENST00000392232.3_Nonsense_Mutation_p.E565*			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	521					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			TAAATGTAATGAGTGTGGGAA	0.388																																																	0													64.0	71.0	69.0					19																	35232847		2202	4298	6500	SO:0001587	stop_gained	0			BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.1561G>T	19.37:g.35232847G>T	ENSP00000420727:p.Glu521*		B7ZKX3|Q49A75	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E565*	ENST00000492450.1	37	c.1693	CCDS32990.2	19	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264395	0.80358	.	.	ENSG00000197841	ENST00000392232;ENST00000492450;ENST00000459757	.	.	.	2.74	2.74	0.32292	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	11.6561	0.51320	0.0:0.0:1.0:0.0	.	.	.	.	X	565;521;520	.	ENSP00000376065:E565X	E	+	1	0	ZNF181	39924687	0.002000	0.14202	0.998000	0.56505	0.969000	0.65631	0.861000	0.27885	1.851000	0.53745	0.655000	0.94253	GAG	ZNF181	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197841		0.388	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF181	HGNC	protein_coding	OTTHUMT00000349005.3	-	0.00	135	0	G	NM_001029997		35232847	+1	tier1	-	no_errors	ENST00000392232	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	0.159	T
ZNF205	7755	genome.wustl.edu	37	16	3165551	3165551	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr16:3165551C>A	ENST00000382192.3	+	3	458	c.253C>A	c.(253-255)Ctc>Atc	p.L85I	RP11-473M20.14_ENST00000576490.1_RNA|ZNF205-AS1_ENST00000572691.1_RNA|ZNF205_ENST00000219091.4_Missense_Mutation_p.L85I|RP11-473M20.14_ENST00000575139.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	85					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						GGAGAAAGCTCTCTTCCTGCC	0.667																																																	0													33.0	31.0	31.0					16																	3165551		2197	4300	6497	SO:0001583	missense	0			AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.253C>A	16.37:g.3165551C>A	ENSP00000371627:p.Leu85Ile		A8MZK0|D3DUB4|Q9BU95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L85I	ENST00000382192.3	37	c.253	CCDS10494.2	16	.	.	.	.	.	.	.	.	.	.	C	9.085	1.000199	0.19121	.	.	ENSG00000122386	ENST00000382192;ENST00000219091;ENST00000444510;ENST00000414351	T;T;T;T	0.48201	3.13;3.13;0.82;3.08	4.74	2.74	0.32292	.	1.802300	0.03240	N	0.180324	T	0.45296	0.1335	L	0.56769	1.78	0.09310	N	1	B	0.29432	0.244	B	0.22152	0.038	T	0.24657	-1.0154	10	0.33940	T	0.23	0.5511	7.9422	0.29965	0.0:0.8029:0.0:0.1971	.	85	O95201	ZN205_HUMAN	I	85	ENSP00000371627:L85I;ENSP00000219091:L85I;ENSP00000394360:L85I;ENSP00000403306:L85I	ENSP00000219091:L85I	L	+	1	0	ZNF205	3105552	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	0.314000	0.19432	0.533000	0.28675	0.591000	0.81541	CTC	ZNF205	-	NULL	ENSG00000122386		0.667	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF205	HGNC	protein_coding	OTTHUMT00000309057.1	-	0.00	69	0	C	NM_003456		3165551	+1	tier1	-	no_errors	ENST00000219091	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.001	A
ZNF227	7770	genome.wustl.edu	37	19	44739247	44739247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:44739247G>T	ENST00000313040.7	+	6	869	c.664G>T	c.(664-666)Gaa>Taa	p.E222*	ZNF227_ENST00000589005.1_Nonsense_Mutation_p.E171*|ZNF227_ENST00000391961.2_Nonsense_Mutation_p.E171*	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				AACTGACACAGAACCAAAACC	0.378																																																	0													62.0	62.0	62.0					19																	44739247		2203	4300	6503	SO:0001587	stop_gained	0			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.664G>T	19.37:g.44739247G>T	ENSP00000321049:p.Glu222*		B3KRU7|B7Z5P9	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E222*	ENST00000313040.7	37	c.664	CCDS12636.1	19	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327643	0.81690	.	.	ENSG00000131115	ENST00000313040;ENST00000328297;ENST00000391961;ENST00000418980	.	.	.	4.27	-1.75	0.08031	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	4.1138	0.10072	0.4029:0.1722:0.4248:0.0	.	.	.	.	X	222;179;171;201	.	ENSP00000321049:E222X	E	+	1	0	ZNF227	49431087	.	.	0.000000	0.03702	0.315000	0.28087	.	.	-0.287000	0.09064	-0.251000	0.11542	GAA	ZNF227	-	NULL	ENSG00000131115		0.378	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF227	HGNC	protein_coding	OTTHUMT00000460720.1		0.00	35	0	G	NM_182490		44739247	+1			no_errors	ENST00000313040	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	0.000	T
ZNF273	10793	genome.wustl.edu	37	7	64388284	64388284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:64388284C>A	ENST00000476120.1	+	4	649	c.578C>A	c.(577-579)tCa>tAa	p.S193*	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Nonsense_Mutation_p.S128*	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TTCTCAAATTCAAATATACAT	0.294																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0													43.0	48.0	46.0					7																	64388284		2199	4287	6486	SO:0001587	stop_gained	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.578C>A	7.37:g.64388284C>A	ENSP00000418719:p.Ser193*		B3KQZ5|Q6P3V4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S193*	ENST00000476120.1	37	c.578	CCDS5528.2	7	.	.	.	.	.	.	.	.	.	.	.	10.15	1.272133	0.23221	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	.	.	.	1.16	-0.0966	0.13636	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	.	4.1423	0.10200	0.0:0.4886:0.0:0.5113	.	.	.	.	X	193;128	.	ENSP00000324518:S128X	S	+	2	0	ZNF273	64025719	0.001000	0.12720	0.030000	0.17652	0.030000	0.12068	-0.104000	0.10923	0.202000	0.20498	0.205000	0.17691	TCA	ZNF273	-	NULL	ENSG00000198039		0.294	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	HGNC	protein_coding	OTTHUMT00000313502.1		0.00	85	0	C			64388284	+1			no_errors	ENST00000476120	ensembl	human	known	74_37	nonsense	5.26	36	2	SNP	0.000	A
ZNF273	10793	genome.wustl.edu	37	7	64388525	64388525	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr7:64388525G>T	ENST00000476120.1	+	4	890	c.819G>T	c.(817-819)caG>caT	p.Q273H	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Missense_Mutation_p.Q208H	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	273					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CCTTTAACCAGTCCTTAACTC	0.328																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0													40.0	45.0	43.0					7																	64388525		2199	4299	6498	SO:0001583	missense	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.819G>T	7.37:g.64388525G>T	ENSP00000418719:p.Gln273His		B3KQZ5|Q6P3V4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q273H	ENST00000476120.1	37	c.819	CCDS5528.2	7	.	.	.	.	.	.	.	.	.	.	.	0.020	-1.444940	0.01089	.	.	ENSG00000198039	ENST00000476120;ENST00000319636	T;T	0.05513	3.43;3.43	1.16	1.16	0.20824	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05547	0.0146	L	0.37850	1.14	0.09310	N	1	B	0.10296	0.003	B	0.21151	0.033	T	0.43491	-0.9388	9	0.24483	T	0.36	.	7.3527	0.26700	0.0:0.0:1.0:0.0	.	273	Q14593	ZN273_HUMAN	H	273;208	ENSP00000418719:Q273H;ENSP00000324518:Q208H	ENSP00000324518:Q208H	Q	+	3	2	ZNF273	64025960	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.617000	0.00413	0.202000	0.20498	0.205000	0.17691	CAG	ZNF273	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198039		0.328	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	HGNC	protein_coding	OTTHUMT00000313502.1	-	0.00	39	0	G			64388525	+1	tier1	-	no_errors	ENST00000476120	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.000	T
ZNF300	91975	genome.wustl.edu	37	5	150275819	150275819	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr5:150275819delA	ENST00000274599.5	-	6	1402	c.982delT	c.(982-984)tctfs	p.S328fs	ZNF300_ENST00000446148.2_Frame_Shift_Del_p.S344fs|ZNF300_ENST00000394226.2_Frame_Shift_Del_p.S328fs|ZNF300_ENST00000418587.2_Frame_Shift_Del_p.S292fs|ZNF300_ENST00000427179.1_3'UTR	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	328					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCACATTCAGAACAATCATAA	0.418																																																	0													79.0	84.0	82.0					5																	150275819		2202	4298	6500	SO:0001589	frameshift_variant	0			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.982delT	5.37:g.150275819delA	ENSP00000274599:p.Ser328fs		A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S344fs	ENST00000274599.5	37	c.1030	CCDS4311.2	5																																																																																			ZNF300	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000145908		0.418	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	HGNC	protein_coding			0.00	53	0	A	NM_052860		150275819	-1	tier1		no_errors	ENST00000446148	ensembl	human	known	74_37	frame_shift_del	14.29	12	2	DEL	0.993	-
ZNF41	7592	genome.wustl.edu	37	X	47308821	47308821	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chrX:47308821G>T	ENST00000377065.4	-	5	987	c.348C>A	c.(346-348)ttC>ttA	p.F116L	ZNF41_ENST00000397050.2_Missense_Mutation_p.F126L|ZNF41_ENST00000313116.7_Missense_Mutation_p.F116L|ZNF41_ENST00000465311.1_5'UTR	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	158	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				TCTCACAGTGGAAGAAAATTC	0.383																																																	0													42.0	37.0	39.0					X																	47308821		2203	4300	6503	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.348C>A	X.37:g.47308821G>T	ENSP00000366265:p.Phe116Leu		A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F126L	ENST00000377065.4	37	c.378	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	G	2.720	-0.266871	0.05754	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050;ENST00000432977	T;T;T;T	0.06371	3.31;3.31;3.32;5.96	3.1	1.29	0.21616	.	0.215118	0.23627	N	0.046170	T	0.04679	0.0127	L	0.48642	1.525	0.20975	N	0.999811	B;B;B;B;B	0.15141	0.003;0.003;0.012;0.003;0.001	B;B;B;B;B	0.14578	0.002;0.002;0.011;0.004;0.002	T	0.43540	-0.9385	10	0.13470	T	0.59	.	3.0668	0.06217	0.1513:0.0:0.5817:0.2671	.	116;118;126;150;158	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	L	116;116;126;126	ENSP00000315173:F116L;ENSP00000366265:F116L;ENSP00000380243:F126L;ENSP00000390385:F126L	ENSP00000315173:F116L	F	-	3	2	ZNF41	47193765	0.000000	0.05858	0.453000	0.27007	0.364000	0.29643	-0.044000	0.12023	0.219000	0.20840	0.594000	0.82650	TTC	ZNF41	-	NULL	ENSG00000147124		0.383	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	-	0.00	22	0	G	NM_153380		47308821	-1	tier1	-	no_errors	ENST00000397050	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.622	T
ZNF438	220929	genome.wustl.edu	37	10	31137766	31137766	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:31137766C>A	ENST00000361310.3	-	6	1897	c.1568G>T	c.(1567-1569)cGa>cTa	p.R523L	ZNF438_ENST00000538351.2_Missense_Mutation_p.R474L|ZNF438_ENST00000375311.1_Missense_Mutation_p.R87L|ZNF438_ENST00000413025.1_Missense_Mutation_p.R523L|ZNF438_ENST00000452305.1_Missense_Mutation_p.R513L|ZNF438_ENST00000444692.2_Missense_Mutation_p.R513L|ZNF438_ENST00000436087.2_Missense_Mutation_p.R523L|ZNF438_ENST00000331737.6_Missense_Mutation_p.R513L|ZNF438_ENST00000442986.1_Missense_Mutation_p.R523L			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	523					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R523L(1)		breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				CATGTGGTCTCGAAGGTGCTG	0.498																																																	1	Substitution - Missense(1)	lung(1)											230.0	230.0	230.0					10																	31137766		2203	4300	6503	SO:0001583	missense	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1568G>T	10.37:g.31137766C>A	ENSP00000354663:p.Arg523Leu		A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R523L	ENST00000361310.3	37	c.1568	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190945	0.38707	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.07800	3.16;3.16;3.16;3.16;3.16;3.16;3.16;3.16;3.16	5.5	-2.69	0.06022	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.232649	0.44688	N	0.000430	T	0.04137	0.0115	N	0.17631	0.505	0.33092	D	0.538105	B;B	0.25904	0.137;0.112	B;B	0.28849	0.095;0.057	T	0.38564	-0.9655	10	0.21540	T	0.41	-5.5561	6.1038	0.20061	0.1483:0.2148:0.0:0.637	.	523;513	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	L	513;523;523;523;523;513;513;474;242;87	ENSP00000333571:R513L;ENSP00000354663:R523L;ENSP00000406934:R523L;ENSP00000412363:R523L;ENSP00000387546:R523L;ENSP00000413060:R513L;ENSP00000410898:R513L;ENSP00000445461:R474L;ENSP00000364460:R87L	ENSP00000333571:R513L	R	-	2	0	ZNF438	31177772	0.471000	0.25862	0.128000	0.21923	0.994000	0.84299	0.851000	0.27751	-0.301000	0.08882	-0.194000	0.12790	CGA	ZNF438	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183621		0.498	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1		0.00	51	0	C	NM_182755		31137766	-1			no_errors	ENST00000361310	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.816	A
ZNF445	353274	genome.wustl.edu	37	3	44489119	44489119	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr3:44489119G>T	ENST00000396077.2	-	8	2391	c.2044C>A	c.(2044-2046)Ctg>Atg	p.L682M	ZNF445_ENST00000425708.2_Missense_Mutation_p.L682M	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	682					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L682M(2)		breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TGCTGACACAGAAATGTTTTC	0.468																																																	2	Substitution - Missense(2)	large_intestine(2)											77.0	75.0	75.0					3																	44489119		2203	4300	6503	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.2044C>A	3.37:g.44489119G>T	ENSP00000379387:p.Leu682Met		Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L682M	ENST00000396077.2	37	c.2044	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	G	5.740	0.320970	0.10845	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.61274	0.12;0.12	3.88	-7.76	0.01232	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	2.326550	0.02051	N	0.050067	T	0.33352	0.0860	N	0.16656	0.425	0.09310	N	1	P;P	0.44309	0.728;0.832	B;B	0.39904	0.313;0.313	T	0.46247	-0.9205	10	0.59425	D	0.04	.	0.9001	0.01272	0.2844:0.2456:0.29:0.18	.	670;682	B7ZKX2;P59923	.;ZN445_HUMAN	M	682	ENSP00000413073:L682M;ENSP00000379387:L682M	ENSP00000379387:L682M	L	-	1	2	ZNF445	44464123	0.000000	0.05858	0.000000	0.03702	0.424000	0.31475	-1.878000	0.01630	-1.789000	0.01264	-0.383000	0.06682	CTG	ZNF445	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185219		0.468	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2		0.00	27	0	G	NM_181489		44489119	-1			no_errors	ENST00000396077	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.000	T
ZNF462	58499	genome.wustl.edu	37	9	109686536	109686536	+	Missense_Mutation	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr9:109686536C>T	ENST00000277225.5	+	3	632	c.343C>T	c.(343-345)Cgc>Tgc	p.R115C	ZNF462_ENST00000457913.1_Missense_Mutation_p.R115C			Q96JM2	ZN462_HUMAN	zinc finger protein 462	115					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R115S(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						GTTCTGTGTACGCTACTTCAG	0.473																																																	1	Substitution - Missense(1)	lung(1)											87.0	82.0	84.0					9																	109686536		2203	4300	6503	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.343C>T	9.37:g.109686536C>T	ENSP00000277225:p.Arg115Cys		Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R115C	ENST00000277225.5	37	c.343	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241105	0.58995	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.10288	2.89;3.36	5.56	5.56	0.83823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.30727	0.0774	L	0.53249	1.67	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00254	-1.1874	9	.	.	.	.	19.525	0.95201	0.0:1.0:0.0:0.0	.	115	Q96JM2	ZN462_HUMAN	C	115	ENSP00000277225:R115C;ENSP00000414570:R115C	.	R	+	1	0	ZNF462	108726357	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.411000	0.80078	2.628000	0.89032	0.467000	0.42956	CGC	ZNF462	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000148143		0.473	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2		0.00	39	0	C	NM_021224		109686536	+1			no_errors	ENST00000457913	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
ZNF616	90317	genome.wustl.edu	37	19	52620223	52620223	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:52620223G>T	ENST00000600228.1	-	4	455	c.194C>A	c.(193-195)aCa>aAa	p.T65K	ZNF616_ENST00000330123.5_3'UTR|ZNF616_ENST00000596290.1_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CCTTTCTCCTGTATTACTGTT	0.333																																																	0													105.0	104.0	104.0					19																	52620223		2203	4300	6503	SO:0001583	missense	0			AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.194C>A	19.37:g.52620223G>T	ENSP00000471000:p.Thr65Lys		B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T65K	ENST00000600228.1	37	c.194	CCDS33090.1	19	.	.	.	.	.	.	.	.	.	.	G	2.000	-0.429666	0.04701	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.64	-3.27	0.05048	Krueppel-associated box (2);	.	.	.	.	T	0.14442	0.0349	N	0.17474	0.49	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.29366	-1.0014	8	0.12430	T	0.62	.	0.1812	0.00124	0.3768:0.1775:0.2093:0.2364	.	65	Q08AN1	ZN616_HUMAN	K	65	.	ENSP00000328722:T65K	T	-	2	0	ZNF616	57312035	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-2.500000	0.00967	-1.547000	0.01715	0.305000	0.20034	ACA	ZNF616	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000204611		0.333	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	HGNC	protein_coding	OTTHUMT00000462451.1	-	0.00	51	0	G	XM_030892		52620223	-1	tier1	-	no_errors	ENST00000600228	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.000	T
ZNF497	162968	genome.wustl.edu	37	19	58867836	58867836	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr19:58867836G>T	ENST00000311044.3	-	3	1354	c.1166C>A	c.(1165-1167)gCc>gAc	p.A389D	A1BG_ENST00000263100.3_5'Flank|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000600379.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|CTD-2619J13.9_ENST00000599952.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000593960.1_RNA|ZNF497_ENST00000425453.3_Missense_Mutation_p.A389D	NM_198458.2	NP_940860.2	Q6ZNH5	ZN497_HUMAN	zinc finger protein 497	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.A389V(1)		central_nervous_system(2)|lung(3)|skin(2)	7		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0278)		GCCGCAGTCGGCGCAGGCGAA	0.706																																																	1	Substitution - Missense(1)	lung(1)											5.0	5.0	5.0					19																	58867836		2106	4141	6247	SO:0001583	missense	0			AK126727	CCDS12977.1	19q13.43	2013-01-08			ENSG00000174586	ENSG00000174586		"""Zinc fingers, C2H2-type"""	23714	protein-coding gene	gene with protein product							Standard	NM_198458		Approved	FLJ44773	uc002qsi.2	Q6ZNH5		ENST00000311044.3:c.1166C>A	19.37:g.58867836G>T	ENSP00000311183:p.Ala389Asp		Q05AG8|Q0VF48|Q6ZTD2|Q9UIA8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A389D	ENST00000311044.3	37	c.1166	CCDS12977.1	19	.	.	.	.	.	.	.	.	.	.	G	5.211	0.224484	0.09916	.	.	ENSG00000174586	ENST00000311044;ENST00000425453;ENST00000391697	T;T	0.16073	2.37;2.37	0.658	0.658	0.17855	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05547	0.0146	N	0.01202	-0.96	0.09310	N	1	B	0.15719	0.014	B	0.21708	0.036	T	0.37753	-0.9692	9	0.38643	T	0.18	.	5.6325	0.17518	0.0:0.0:0.6846:0.3154	.	389	Q6ZNH5	ZN497_HUMAN	D	389;389;178	ENSP00000311183:A389D;ENSP00000402815:A389D	ENSP00000311183:A389D	A	-	2	0	ZNF497	63559648	0.000000	0.05858	0.030000	0.17652	0.089000	0.18198	-0.128000	0.10531	0.613000	0.30089	0.205000	0.17691	GCC	ZNF497	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174586		0.706	ZNF497-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF497	HGNC	protein_coding	OTTHUMT00000466942.2		0.00	10	0	G	NM_198458		58867836	-1			no_errors	ENST00000311044	ensembl	human	known	74_37	missense	30.00	7	3	SNP	0.002	T
ZNF732	654254	genome.wustl.edu	37	4	265587	265587	+	Missense_Mutation	SNP	C	C	A			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr4:265587C>A	ENST00000419098.1	-	4	1069	c.1059G>T	c.(1057-1059)aaG>aaT	p.K353N		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TATGAATTCTCTTATGTTCAT	0.393																																																	0													43.0	40.0	41.0					4																	265587		692	1591	2283	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1059G>T	4.37:g.265587C>A	ENSP00000415774:p.Lys353Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K353N	ENST00000419098.1	37	c.1059	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	C	0.577	-0.838694	0.02692	.	.	ENSG00000186777	ENST00000419098	T	0.51817	0.69	0.977	-1.95	0.07548	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.50446	0.1616	L	0.41124	1.26	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.40997	-0.9533	9	0.72032	D	0.01	.	2.8075	0.05431	0.2585:0.5012:0.0:0.2402	.	353	B4DXR9	ZN732_HUMAN	N	353	ENSP00000415774:K353N	ENSP00000415774:K353N	K	-	3	2	ZNF732	255587	0.000000	0.05858	0.063000	0.19743	0.055000	0.15305	0.122000	0.15687	-0.502000	0.06596	-0.497000	0.04613	AAG	ZNF732	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.393	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	-	0.00	40	0	C	NM_001137608		265587	-1	tier1	-	no_errors	ENST00000419098	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.016	A
ZNHIT6	54680	genome.wustl.edu	37	1	86173818	86173818	+	Silent	SNP	C	C	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr1:86173818C>T	ENST00000370574.3	-	1	283	c.150G>A	c.(148-150)ggG>ggA	p.G50G	ZNHIT6_ENST00000431532.2_Silent_p.G50G			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	50	Glu-rich.				box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						TCCCTGTCAGCCCTGTCCCCT	0.582																																																	0													201.0	182.0	188.0					1																	86173818		2203	4300	6503	SO:0001819	synonymous_variant	0			AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.150G>A	1.37:g.86173818C>T			B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Silent	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.G50	ENST00000370574.3	37	c.150	CCDS707.1	1																																																																																			ZNHIT6	-	NULL	ENSG00000117174		0.582	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT6	HGNC	protein_coding	OTTHUMT00000029186.1		0.00	42	0	C	NM_017953		86173818	-1			no_errors	ENST00000370574	ensembl	human	known	74_37	silent	6.25	45	3	SNP	0.008	T
ZSWIM8	23053	genome.wustl.edu	37	10	75551792	75551792	+	Missense_Mutation	SNP	G	G	T			TCGA-KH-A6WC-01A-11D-A33E-09	TCGA-KH-A6WC-10B-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	176fdb52-294f-4b73-90ba-b4f8e709ed7f	e2bf976d-dd39-49a7-b0bd-84ecf7118a5f	g.chr10:75551792G>T	ENST00000605216.1	+	10	1712	c.1495G>T	c.(1495-1497)Ggc>Tgc	p.G499C	ZSWIM8_ENST00000603114.1_Missense_Mutation_p.G499C|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.G499C|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.G499C|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.G499C	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	499							zinc ion binding (GO:0008270)										CACCTACAGCGGCACTGACAG	0.697																																																	0													7.0	8.0	8.0					10																	75551792		1775	3799	5574	SO:0001583	missense	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.1495G>T	10.37:g.75551792G>T	ENSP00000474748:p.Gly499Cys		B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.G499C	ENST00000605216.1	37	c.1495		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.32|18.32	3.598422|3.598422	0.66332|0.66332	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000433366	T|.	0.50001|.	0.76|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.360284|.	0.20455|.	U|.	0.092006|.	T|T	0.27594|0.27594	0.0678|0.0678	N|N	0.08118|0.08118	0|0	0.34035|0.34035	D|D	0.654252|0.654252	D;P;D|.	0.63880|.	0.993;0.737;0.993|.	P;P;P|.	0.55055|.	0.767;0.499;0.767|.	T|T	0.33828|0.33828	-0.9853|-0.9853	10|5	0.62326|.	D|.	0.03|.	-2.3232|-2.3232	6.7079|6.7079	0.23260|0.23260	0.1984:0.0:0.8016:0.0|0.1984:0.0:0.8016:0.0	.|.	499;499;499|.	A7E2V4;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.|.	C|L	499|221	ENSP00000381693:G499C|.	ENSP00000381693:G499C|.	G|R	+|+	1|2	0|0	KIAA0913|KIAA0913	75221798|75221798	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.969000|0.969000	0.65631|0.65631	6.194000|6.194000	0.72082|0.72082	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GGC|CGG	ZSWIM8	-	NULL	ENSG00000214655		0.697	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8	HGNC	protein_coding	OTTHUMT00000468545.1	-	0.00	49	0	G	NM_001242487		75551792	+1	tier1	-	no_errors	ENST00000398706	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
