#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A1CF	29974	genome.wustl.edu	37	10	52573791	52573791	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:52573791C>T	ENST00000373993.1	-	8	1217	c.1173G>A	c.(1171-1173)gcG>gcA	p.A391A	A1CF_ENST00000373997.3_Silent_p.A383A|A1CF_ENST00000395489.2_Silent_p.A384A|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000282641.2_Silent_p.A391A|A1CF_ENST00000395495.1_Silent_p.A336A|A1CF_ENST00000374001.2_Silent_p.A383A|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000373995.3_Silent_p.A391A			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	391	Required for nuclear localization. {ECO:0000269|PubMed:12896982}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						CTCTCACTCCCGCAGCCCCTA	0.468																																																	0													66.0	70.0	69.0					10																	52573791		2203	4300	6503	SO:0001819	synonymous_variant	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1173G>A	10.37:g.52573791C>T			A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A391	ENST00000373993.1	37	c.1173	CCDS7242.1	10																																																																																			A1CF	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.468	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	-	0.00	20	0	C	NM_014576		52573791	-1	tier1	-	no_errors	ENST00000282641	ensembl	human	known	74_37	silent	29.41	12	5	SNP	1.000	T
A1CF	29974	genome.wustl.edu	37	10	52573791	52573791	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:52573791C>T	ENST00000373993.1	-	8	1217	c.1173G>A	c.(1171-1173)gcG>gcA	p.A391A	A1CF_ENST00000373997.3_Silent_p.A383A|A1CF_ENST00000395489.2_Silent_p.A384A|A1CF_ENST00000493415.1_5'UTR|A1CF_ENST00000282641.2_Silent_p.A391A|A1CF_ENST00000395495.1_Silent_p.A336A|A1CF_ENST00000374001.2_Silent_p.A383A|ASAH2B_ENST00000483649.1_Intron|A1CF_ENST00000373995.3_Silent_p.A391A			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	391	Required for nuclear localization. {ECO:0000269|PubMed:12896982}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						CTCTCACTCCCGCAGCCCCTA	0.468																																																	0													66.0	70.0	69.0					10																	52573791		2203	4300	6503	SO:0001819	synonymous_variant	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.1173G>A	10.37:g.52573791C>T			A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A391	ENST00000373993.1	37	c.1173	CCDS7242.1	10																																																																																			A1CF	-	tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.468	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	-	0.00	39	0	C	NM_014576		52573791	-1	tier1	-	no_errors	ENST00000282641	ensembl	human	known	74_37	silent	29.41	12	5	SNP	1.000	T
AATK	9625	genome.wustl.edu	37	17	79098773	79098773	+	Missense_Mutation	SNP	G	G	A	rs202102141		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:79098773G>A	ENST00000326724.4	-	8	821	c.797C>T	c.(796-798)aCg>aTg	p.T266M	AATK_ENST00000572339.1_5'UTR|MIR338_ENST00000390137.2_RNA|MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Missense_Mutation_p.T163M	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AATCTTCACCGTCAGGTCAGC	0.692																																																	0								G	MET/THR,MET/THR	2,4246		0,2,2122	26.0	27.0	27.0		797,488	3.8	1.0	17		27	0,8424		0,0,4212	yes	missense,missense	AATK	NM_001080395.2,NM_004920.2	81,81	0,2,6334	AA,AG,GG		0.0,0.0471,0.0158	probably-damaging,probably-damaging	266/1375,163/1272	79098773	2,12670	2124	4212	6336	SO:0001583	missense	0			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.797C>T	17.37:g.79098773G>A	ENSP00000324196:p.Thr266Met		O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T266M	ENST00000326724.4	37	c.797	CCDS45807.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.92|18.92	3.725620|3.725620	0.68959|0.68959	4.71E-4|4.71E-4	0.0|0.0	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724;ENST00000374792	.|D;D	.|0.89617	.|-2.54;-2.54	3.75|3.75	3.75|3.75	0.43078|0.43078	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.152498	.|0.44097	.|D	.|0.000488	D|D	0.93575|0.93575	0.7949|0.7949	M|M	0.76002|0.76002	2.32|2.32	0.33159|0.33159	D|D	0.546662|0.546662	.|D	.|0.89917	.|1.0	.|D	.|0.76071	.|0.987	D|D	0.95753|0.95753	0.8793|0.8793	5|10	.|0.87932	.|D	.|0	.|.	14.8544|14.8544	0.70326|0.70326	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|266	.|Q6ZMQ8	.|LMTK1_HUMAN	W|M	219|266	.|ENSP00000324196:T266M;ENSP00000363924:T266M	.|ENSP00000324196:T266M	R|T	-|-	1|2	2|0	AATK|AATK	76713368|76713368	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.668000|0.668000	0.39293|0.39293	4.545000|4.545000	0.60698|0.60698	2.089000|2.089000	0.63090|0.63090	0.655000|0.655000	0.94253|0.94253	CGG|ACG	AATK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000181409		0.692	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATK	HGNC	protein_coding	OTTHUMT00000256055.1	-	0.00	66	0	G	NM_004920		79098773	-1	tier1	rs202102141	no_errors	ENST00000326724	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	A
AATK	9625	genome.wustl.edu	37	17	79098773	79098773	+	Missense_Mutation	SNP	G	G	A	rs202102141		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:79098773G>A	ENST00000326724.4	-	8	821	c.797C>T	c.(796-798)aCg>aTg	p.T266M	AATK_ENST00000572339.1_5'UTR|MIR338_ENST00000390137.2_RNA|MIR657_ENST00000385003.1_RNA|AATK_ENST00000417379.1_Missense_Mutation_p.T163M	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AATCTTCACCGTCAGGTCAGC	0.692																																																	0								G	MET/THR,MET/THR	2,4246		0,2,2122	26.0	27.0	27.0		797,488	3.8	1.0	17		27	0,8424		0,0,4212	yes	missense,missense	AATK	NM_001080395.2,NM_004920.2	81,81	0,2,6334	AA,AG,GG		0.0,0.0471,0.0158	probably-damaging,probably-damaging	266/1375,163/1272	79098773	2,12670	2124	4212	6336	SO:0001583	missense	0			AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.797C>T	17.37:g.79098773G>A	ENSP00000324196:p.Thr266Met		O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T266M	ENST00000326724.4	37	c.797	CCDS45807.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.92|18.92	3.725620|3.725620	0.68959|0.68959	4.71E-4|4.71E-4	0.0|0.0	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724;ENST00000374792	.|D;D	.|0.89617	.|-2.54;-2.54	3.75|3.75	3.75|3.75	0.43078|0.43078	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.152498	.|0.44097	.|D	.|0.000488	D|D	0.93575|0.93575	0.7949|0.7949	M|M	0.76002|0.76002	2.32|2.32	0.33159|0.33159	D|D	0.546662|0.546662	.|D	.|0.89917	.|1.0	.|D	.|0.76071	.|0.987	D|D	0.95753|0.95753	0.8793|0.8793	5|10	.|0.87932	.|D	.|0	.|.	14.8544|14.8544	0.70326|0.70326	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|266	.|Q6ZMQ8	.|LMTK1_HUMAN	W|M	219|266	.|ENSP00000324196:T266M;ENSP00000363924:T266M	.|ENSP00000324196:T266M	R|T	-|-	1|2	2|0	AATK|AATK	76713368|76713368	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.668000|0.668000	0.39293|0.39293	4.545000|4.545000	0.60698|0.60698	2.089000|2.089000	0.63090|0.63090	0.655000|0.655000	0.94253|0.94253	CGG|ACG	AATK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000181409		0.692	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATK	HGNC	protein_coding	OTTHUMT00000256055.1	-	0.00	72	0	G	NM_004920		79098773	-1	tier1	rs202102141	no_errors	ENST00000326724	ensembl	human	known	74_37	missense	21.28	37	10	SNP	1.000	A
ABCC8	6833	genome.wustl.edu	37	11	17498306	17498306	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:17498306G>A	ENST00000389817.3	-	1	86	c.18C>T	c.(16-18)tgC>tgT	p.C6C	ABCC8_ENST00000302539.4_Silent_p.C6C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	6					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TCTCGCTGCCGCAGAAGGCCA	0.721																																																	0													18.0	19.0	19.0					11																	17498306		2190	4285	6475	SO:0001819	synonymous_variant	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.18C>T	11.37:g.17498306G>A			A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.C6	ENST00000389817.3	37	c.18	CCDS31437.1	11																																																																																			ABCC8	-	NULL	ENSG00000006071		0.721	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	27	0	G	NM_000352		17498306	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	silent	26.32	14	5	SNP	1.000	A
ABCC8	6833	genome.wustl.edu	37	11	17498306	17498306	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:17498306G>A	ENST00000389817.3	-	1	86	c.18C>T	c.(16-18)tgC>tgT	p.C6C	ABCC8_ENST00000302539.4_Silent_p.C6C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	6					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TCTCGCTGCCGCAGAAGGCCA	0.721																																																	0													18.0	19.0	19.0					11																	17498306		2190	4285	6475	SO:0001819	synonymous_variant	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.18C>T	11.37:g.17498306G>A			A6NMX8|E3UYX6|O75948|Q16583	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.C6	ENST00000389817.3	37	c.18	CCDS31437.1	11																																																																																			ABCC8	-	NULL	ENSG00000006071		0.721	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	39	0	G	NM_000352		17498306	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	silent	26.32	14	5	SNP	1.000	A
ABHD8	79575	genome.wustl.edu	37	19	17412301	17412301	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:17412301C>T	ENST00000247706.3	-	2	364	c.125G>A	c.(124-126)cGc>cAc	p.R42H	MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	42							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						CCGCAGCACGCGGCCGGGCTT	0.677																																					Ovarian(156;1368 2543 15275 41187)												0													16.0	20.0	18.0					19																	17412301		2191	4289	6480	SO:0001583	missense	0			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.125G>A	19.37:g.17412301C>T	ENSP00000247706:p.Arg42His		Q9HAE9	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.R42H	ENST00000247706.3	37	c.125	CCDS12355.1	19	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029282	0.75504	.	.	ENSG00000127220	ENST00000247706	T	0.56611	0.45	5.24	4.21	0.49690	.	0.057779	0.64402	N	0.000004	T	0.60130	0.2245	L	0.34521	1.04	0.49051	D	0.999746	D	0.89917	1.0	D	0.80764	0.994	T	0.63001	-0.6734	10	0.87932	D	0	-26.7344	11.3718	0.49704	0.0:0.9108:0.0:0.0892	.	42	Q96I13	ABHD8_HUMAN	H	42	ENSP00000247706:R42H	ENSP00000247706:R42H	R	-	2	0	ABHD8	17273301	1.000000	0.71417	0.724000	0.30704	0.593000	0.36681	7.296000	0.78790	1.215000	0.43411	0.491000	0.48974	CGC	ABHD8	-	NULL	ENSG00000127220		0.677	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	HGNC	protein_coding	OTTHUMT00000462937.1	-	0.00	35	0	C	NM_024527		17412301	-1	tier1	-	no_errors	ENST00000247706	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.954	T
ABHD8	79575	genome.wustl.edu	37	19	17412301	17412301	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:17412301C>T	ENST00000247706.3	-	2	364	c.125G>A	c.(124-126)cGc>cAc	p.R42H	MRPL34_ENST00000594999.1_5'Flank|MRPL34_ENST00000600434.1_Intron|MRPL34_ENST00000595444.1_Intron	NM_024527.4	NP_078803.4	Q96I13	ABHD8_HUMAN	abhydrolase domain containing 8	42							hydrolase activity (GO:0016787)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	9						CCGCAGCACGCGGCCGGGCTT	0.677																																					Ovarian(156;1368 2543 15275 41187)												0													16.0	20.0	18.0					19																	17412301		2191	4289	6480	SO:0001583	missense	0			AK021805	CCDS12355.1	19p13.12	2010-12-09			ENSG00000127220	ENSG00000127220		"""Abhydrolase domain containing"""	23759	protein-coding gene	gene with protein product						12477932	Standard	NM_024527		Approved	FLJ11743, MGC14280, MGC2512	uc002ngb.4	Q96I13		ENST00000247706.3:c.125G>A	19.37:g.17412301C>T	ENSP00000247706:p.Arg42His		Q9HAE9	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_AB_hydrolase_1,prints_Epox_hydrolase-like	p.R42H	ENST00000247706.3	37	c.125	CCDS12355.1	19	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029282	0.75504	.	.	ENSG00000127220	ENST00000247706	T	0.56611	0.45	5.24	4.21	0.49690	.	0.057779	0.64402	N	0.000004	T	0.60130	0.2245	L	0.34521	1.04	0.49051	D	0.999746	D	0.89917	1.0	D	0.80764	0.994	T	0.63001	-0.6734	10	0.87932	D	0	-26.7344	11.3718	0.49704	0.0:0.9108:0.0:0.0892	.	42	Q96I13	ABHD8_HUMAN	H	42	ENSP00000247706:R42H	ENSP00000247706:R42H	R	-	2	0	ABHD8	17273301	1.000000	0.71417	0.724000	0.30704	0.593000	0.36681	7.296000	0.78790	1.215000	0.43411	0.491000	0.48974	CGC	ABHD8	-	NULL	ENSG00000127220		0.677	ABHD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD8	HGNC	protein_coding	OTTHUMT00000462937.1	-	0.00	44	0	C	NM_024527		17412301	-1	tier1	-	no_errors	ENST00000247706	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.954	T
ACBD3	64746	genome.wustl.edu	37	1	226340281	226340281	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:226340281C>T	ENST00000366812.5	-	7	1184	c.1130G>A	c.(1129-1131)cGa>cAa	p.R377Q	ACBD3_ENST00000464927.1_5'Flank|RP11-275I14.4_ENST00000440540.1_RNA	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	377					steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		GATCTGAGGTCGTGTCCACAT	0.463																																																	0													144.0	150.0	148.0					1																	226340281		2203	4300	6503	SO:0001583	missense	0			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.1130G>A	1.37:g.226340281C>T	ENSP00000355777:p.Arg377Gln		B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_GOLD,superfamily_Acyl-CoA-binding_protein,pfscan_GOLD	p.R377Q	ENST00000366812.5	37	c.1130	CCDS1551.1	1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255864	0.59321	.	.	ENSG00000182827	ENST00000366812	T	0.55930	0.49	5.29	3.41	0.39046	.	0.249234	0.41097	N	0.000957	T	0.65984	0.2744	M	0.73598	2.24	0.80722	D	1	D	0.69078	0.997	P	0.60949	0.881	T	0.67015	-0.5777	10	0.66056	D	0.02	-2.8531	10.0499	0.42210	0.1382:0.7901:0.0:0.0718	.	377	Q9H3P7	GCP60_HUMAN	Q	377	ENSP00000355777:R377Q	ENSP00000355777:R377Q	R	-	2	0	ACBD3	224406904	1.000000	0.71417	0.718000	0.30602	0.003000	0.03518	7.426000	0.80270	0.613000	0.30089	-0.169000	0.13324	CGA	ACBD3	-	NULL	ENSG00000182827		0.463	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD3	HGNC	protein_coding	OTTHUMT00000091528.1	-	0.00	75	0	C	NM_022735		226340281	-1	tier1	-	no_errors	ENST00000366812	ensembl	human	known	74_37	missense	35.85	34	19	SNP	0.923	T
ACBD3	64746	genome.wustl.edu	37	1	226340281	226340281	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:226340281C>T	ENST00000366812.5	-	7	1184	c.1130G>A	c.(1129-1131)cGa>cAa	p.R377Q	ACBD3_ENST00000464927.1_5'Flank|RP11-275I14.4_ENST00000440540.1_RNA	NM_022735.3	NP_073572.2	Q9H3P7	GCP60_HUMAN	acyl-CoA binding domain containing 3	377					steroid biosynthetic process (GO:0006694)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA binding (GO:0000062)			breast(2)|endometrium(3)|large_intestine(5)|lung(7)|skin(1)|urinary_tract(2)	20	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.121)		GATCTGAGGTCGTGTCCACAT	0.463																																																	0													144.0	150.0	148.0					1																	226340281		2203	4300	6503	SO:0001583	missense	0			AB043587	CCDS1551.1	1q41	2013-10-16	2010-04-30	2003-11-12	ENSG00000182827	ENSG00000182827		"""A-kinase anchor proteins"""	15453	protein-coding gene	gene with protein product	"""PBR- and PKA-associated protein 7"""	606809	"""golgi complex associated protein 1, 60kDa"", ""acyl-Coenzyme A binding domain containing 3"""	GOLPH1, GOCAP1		12692076, 20150326	Standard	NM_022735		Approved	GCP60, PAP7	uc001hpy.3	Q9H3P7	OTTHUMG00000037560	ENST00000366812.5:c.1130G>A	1.37:g.226340281C>T	ENSP00000355777:p.Arg377Gln		B2RB29|Q5VTJ0|Q6P9F1|Q8IZC5|Q8N4D6|Q9H6U3	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_GOLD,superfamily_Acyl-CoA-binding_protein,pfscan_GOLD	p.R377Q	ENST00000366812.5	37	c.1130	CCDS1551.1	1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255864	0.59321	.	.	ENSG00000182827	ENST00000366812	T	0.55930	0.49	5.29	3.41	0.39046	.	0.249234	0.41097	N	0.000957	T	0.65984	0.2744	M	0.73598	2.24	0.80722	D	1	D	0.69078	0.997	P	0.60949	0.881	T	0.67015	-0.5777	10	0.66056	D	0.02	-2.8531	10.0499	0.42210	0.1382:0.7901:0.0:0.0718	.	377	Q9H3P7	GCP60_HUMAN	Q	377	ENSP00000355777:R377Q	ENSP00000355777:R377Q	R	-	2	0	ACBD3	224406904	1.000000	0.71417	0.718000	0.30602	0.003000	0.03518	7.426000	0.80270	0.613000	0.30089	-0.169000	0.13324	CGA	ACBD3	-	NULL	ENSG00000182827		0.463	ACBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACBD3	HGNC	protein_coding	OTTHUMT00000091528.1	-	0.00	81	0	C	NM_022735		226340281	-1	tier1	-	no_errors	ENST00000366812	ensembl	human	known	74_37	missense	35.85	34	19	SNP	0.923	T
ACSM5	54988	genome.wustl.edu	37	16	20448478	20448478	+	Silent	SNP	C	C	T	rs557422368		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:20448478C>T	ENST00000331849.4	+	11	1560	c.1413C>T	c.(1411-1413)aaC>aaT	p.N471N		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	471					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGGGAAGAAACGACGATGTGA	0.473																																																	0													192.0	181.0	185.0					16																	20448478		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1413C>T	16.37:g.20448478C>T			Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.N471	ENST00000331849.4	37	c.1413	CCDS10585.1	16																																																																																			ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.473	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	-	0.00	104	0	C	NM_017888		20448478	+1	tier1	-	no_errors	ENST00000331849	ensembl	human	known	74_37	silent	24.14	66	21	SNP	0.677	T
ACSM5	54988	genome.wustl.edu	37	16	20448478	20448478	+	Silent	SNP	C	C	T	rs557422368		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:20448478C>T	ENST00000331849.4	+	11	1560	c.1413C>T	c.(1411-1413)aaC>aaT	p.N471N		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	471					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						TGGGAAGAAACGACGATGTGA	0.473																																																	0													192.0	181.0	185.0					16																	20448478		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1413C>T	16.37:g.20448478C>T			Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.N471	ENST00000331849.4	37	c.1413	CCDS10585.1	16																																																																																			ACSM5	-	pfam_AMP-dep_Synth/Lig	ENSG00000183549		0.473	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	-	0.00	119	0	C	NM_017888		20448478	+1	tier1	-	no_errors	ENST00000331849	ensembl	human	known	74_37	silent	24.14	66	21	SNP	0.677	T
AIFM1	9131	genome.wustl.edu	37	X	129270036	129270036	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:129270036C>T	ENST00000287295.3	-	12	1519	c.1289G>A	c.(1288-1290)cGc>cAc	p.R430H	AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000319908.3_Missense_Mutation_p.R426H|AIFM1_ENST00000440263.1_Missense_Mutation_p.R78H|AIFM1_ENST00000346424.2_Missense_Mutation_p.R143H|AIFM1_ENST00000460436.2_Missense_Mutation_p.R91H	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	430	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.R430H(1)|p.R426H(1)|p.R430L(1)|p.R426L(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	GATGTTAGAGCGTGCTTGTAG	0.522																																																	4	Substitution - Missense(4)	lung(2)|prostate(2)											135.0	106.0	116.0					X																	129270036		2203	4300	6503	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1289G>A	X.37:g.129270036C>T	ENSP00000287295:p.Arg430His		A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.R430H	ENST00000287295.3	37	c.1289	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.462775	0.96257	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;T;T;T	0.48522	0.82;0.83;0.9;0.81;0.9	6.0	6.0	0.97389	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.73410	0.3583	M	0.88181	2.935	0.80722	D	1	P;D;D	0.89917	0.628;1.0;0.999	B;P;P	0.61940	0.224;0.882;0.896	T	0.78069	-0.2348	10	0.66056	D	0.02	-8.016	19.4264	0.94742	0.0:1.0:0.0:0.0	.	143;426;430	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	H	91;143;426;78;430	ENSP00000431222:R91H;ENSP00000316320:R143H;ENSP00000315122:R426H;ENSP00000405879:R78H;ENSP00000287295:R430H	ENSP00000287295:R430H	R	-	2	0	AIFM1	129097717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.542000	0.85734	0.600000	0.82982	CGC	AIFM1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000156709		0.522	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	-	0.00	46	0	C			129270036	-1	tier1	-	no_errors	ENST00000287295	ensembl	human	known	74_37	missense	86.11	5	31	SNP	1.000	T
AIFM1	9131	genome.wustl.edu	37	X	129270036	129270036	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:129270036C>T	ENST00000287295.3	-	12	1519	c.1289G>A	c.(1288-1290)cGc>cAc	p.R430H	AIFM1_ENST00000535724.1_3'UTR|AIFM1_ENST00000319908.3_Missense_Mutation_p.R426H|AIFM1_ENST00000440263.1_Missense_Mutation_p.R78H|AIFM1_ENST00000346424.2_Missense_Mutation_p.R143H|AIFM1_ENST00000460436.2_Missense_Mutation_p.R91H	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	430	FAD-dependent oxidoreductase. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)	p.R430H(1)|p.R426H(1)|p.R430L(1)|p.R426L(1)		central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	GATGTTAGAGCGTGCTTGTAG	0.522																																																	4	Substitution - Missense(4)	lung(2)|prostate(2)											135.0	106.0	116.0					X																	129270036		2203	4300	6503	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.1289G>A	X.37:g.129270036C>T	ENSP00000287295:p.Arg430His		A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.R430H	ENST00000287295.3	37	c.1289	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	C	35	5.462775	0.96257	.	.	ENSG00000156709	ENST00000460436;ENST00000346424;ENST00000319908;ENST00000440263;ENST00000287295	T;T;T;T;T	0.48522	0.82;0.83;0.9;0.81;0.9	6.0	6.0	0.97389	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.73410	0.3583	M	0.88181	2.935	0.80722	D	1	P;D;D	0.89917	0.628;1.0;0.999	B;P;P	0.61940	0.224;0.882;0.896	T	0.78069	-0.2348	10	0.66056	D	0.02	-8.016	19.4264	0.94742	0.0:1.0:0.0:0.0	.	143;426;430	O95831-2;O95831-3;O95831	.;.;AIFM1_HUMAN	H	91;143;426;78;430	ENSP00000431222:R91H;ENSP00000316320:R143H;ENSP00000315122:R426H;ENSP00000405879:R78H;ENSP00000287295:R430H	ENSP00000287295:R430H	R	-	2	0	AIFM1	129097717	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.542000	0.85734	0.600000	0.82982	CGC	AIFM1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000156709		0.522	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	-	0.00	55	0	C			129270036	-1	tier1	-	no_errors	ENST00000287295	ensembl	human	known	74_37	missense	86.11	5	31	SNP	1.000	T
ANKRD30B	374860	genome.wustl.edu	37	18	14851759	14851759	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:14851759A>G	ENST00000358984.4	+	36	3639	c.3459A>G	c.(3457-3459)gcA>gcG	p.A1153A		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1153										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTCTGACGGCAGAGAACACGA	0.383																																																	0													20.0	20.0	20.0					18																	14851759		510	1393	1903	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3459A>G	18.37:g.14851759A>G			B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1153	ENST00000358984.4	37	c.3459	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.383	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	104	0	A	NM_001145029		14851759	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	silent	33.85	43	22	SNP	0.925	G
ANKRD30B	374860	genome.wustl.edu	37	18	14851759	14851759	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:14851759A>G	ENST00000358984.4	+	36	3639	c.3459A>G	c.(3457-3459)gcA>gcG	p.A1153A		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1153										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTCTGACGGCAGAGAACACGA	0.383																																																	0													20.0	20.0	20.0					18																	14851759		510	1393	1903	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3459A>G	18.37:g.14851759A>G			B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1153	ENST00000358984.4	37	c.3459	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.383	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	-	0.00	112	0	A	NM_001145029		14851759	+1	tier1	-	no_errors	ENST00000358984	ensembl	human	known	74_37	silent	33.85	43	22	SNP	0.925	G
ANKRD6	22881	genome.wustl.edu	37	6	90312804	90312804	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:90312804G>A	ENST00000522441.1	+	4	917	c.276G>A	c.(274-276)gcG>gcA	p.A92A	ANKRD6_ENST00000339746.4_Silent_p.A92A|ANKRD6_ENST00000369408.5_Silent_p.A92A|ANKRD6_ENST00000485637.1_Silent_p.A92A|ANKRD6_ENST00000520793.1_Silent_p.A92A|ANKRD6_ENST00000520886.2_3'UTR|ANKRD6_ENST00000447838.2_Silent_p.A92A	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	92					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		AGATCATCGCGGCGCTCATCC	0.617																																																	0													41.0	48.0	45.0					6																	90312804		2100	4207	6307	SO:0001819	synonymous_variant	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.276G>A	6.37:g.90312804G>A			B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A92	ENST00000522441.1	37	c.276	CCDS56441.1	6																																																																																			ANKRD6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000135299		0.617	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1	-	0.00	17	0	G			90312804	+1	tier1	-	no_errors	ENST00000339746	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.003	A
ANKRD6	22881	genome.wustl.edu	37	6	90312804	90312804	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:90312804G>A	ENST00000522441.1	+	4	917	c.276G>A	c.(274-276)gcG>gcA	p.A92A	ANKRD6_ENST00000339746.4_Silent_p.A92A|ANKRD6_ENST00000369408.5_Silent_p.A92A|ANKRD6_ENST00000485637.1_Silent_p.A92A|ANKRD6_ENST00000520793.1_Silent_p.A92A|ANKRD6_ENST00000520886.2_3'UTR|ANKRD6_ENST00000447838.2_Silent_p.A92A	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	92					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		AGATCATCGCGGCGCTCATCC	0.617																																																	0													41.0	48.0	45.0					6																	90312804		2100	4207	6307	SO:0001819	synonymous_variant	0			AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.276G>A	6.37:g.90312804G>A			B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A92	ENST00000522441.1	37	c.276	CCDS56441.1	6																																																																																			ANKRD6	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000135299		0.617	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	HGNC	protein_coding	OTTHUMT00000376594.1	-	0.00	29	0	G			90312804	+1	tier1	-	no_errors	ENST00000339746	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.003	A
AP5Z1	9907	genome.wustl.edu	37	7	4823399	4823399	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:4823399C>T	ENST00000348624.4	+	5	685	c.591C>T	c.(589-591)ggC>ggT	p.G197G	AP5Z1_ENST00000401897.1_Silent_p.G197G	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	197					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CACACTCCGGCGGCTTCTTCT	0.662																																																	0													7.0	9.0	9.0					7																	4823399		1886	3933	5819	SO:0001819	synonymous_variant	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.591C>T	7.37:g.4823399C>T			Q8N3X2|Q96H80	Silent	SNP	NULL	p.G197	ENST00000348624.4	37	c.591	CCDS47528.1	7																																																																																			AP5Z1	-	NULL	ENSG00000242802		0.662	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1	-	0.00	78	0	C			4823399	+1	tier1	-	no_errors	ENST00000348624	ensembl	human	known	74_37	silent	16.98	44	9	SNP	0.854	T
AP5Z1	9907	genome.wustl.edu	37	7	4823399	4823399	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:4823399C>T	ENST00000348624.4	+	5	685	c.591C>T	c.(589-591)ggC>ggT	p.G197G	AP5Z1_ENST00000401897.1_Silent_p.G197G	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	197					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CACACTCCGGCGGCTTCTTCT	0.662																																																	0													7.0	9.0	9.0					7																	4823399		1886	3933	5819	SO:0001819	synonymous_variant	0			AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.591C>T	7.37:g.4823399C>T			Q8N3X2|Q96H80	Silent	SNP	NULL	p.G197	ENST00000348624.4	37	c.591	CCDS47528.1	7																																																																																			AP5Z1	-	NULL	ENSG00000242802		0.662	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5Z1	HGNC	protein_coding	OTTHUMT00000323771.1	-	0.00	80	0	C			4823399	+1	tier1	-	no_errors	ENST00000348624	ensembl	human	known	74_37	silent	16.98	44	9	SNP	0.854	T
LVRN	206338	genome.wustl.edu	37	5	115298820	115298820	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:115298820C>T	ENST00000357872.4	+	1	630	c.506C>T	c.(505-507)gCc>gTc	p.A169V	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		169						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										ACTGGGAACGCCACAGTGGGC	0.667																																																	0													22.0	24.0	23.0					5																	115298820		2201	4298	6499	SO:0001583	missense	0																														ENST00000357872.4:c.506C>T	5.37:g.115298820C>T	ENSP00000350541:p.Ala169Val		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A169V	ENST00000357872.4	37	c.506	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	C	6.171	0.399770	0.11696	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02498	4.27	4.78	1.45	0.22620	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.470270	0.04496	N	0.380433	T	0.03783	0.0107	L	0.38733	1.17	0.09310	N	0.999997	B	0.28470	0.213	B	0.31390	0.129	T	0.47849	-0.9085	10	0.30854	T	0.27	.	7.6976	0.28604	0.3309:0.5241:0.1449:0.0	.	169	Q6Q4G3	AMPQ_HUMAN	V	169;158	ENSP00000350541:A169V	ENSP00000350541:A169V	A	+	2	0	AC010282.1	115326719	0.000000	0.05858	0.005000	0.12908	0.027000	0.11550	-0.199000	0.09491	0.401000	0.25424	0.655000	0.94253	GCC	AQPEP	-	pfam_Peptidase_M1_N	ENSG00000172901		0.667	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1	-	0.00	15	0	C			115298820	+1	tier1	-	no_errors	ENST00000357872	ensembl	human	known	74_37	missense	66.67	2	4	SNP	0.001	T
LVRN	206338	genome.wustl.edu	37	5	115298820	115298820	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:115298820C>T	ENST00000357872.4	+	1	630	c.506C>T	c.(505-507)gCc>gTc	p.A169V	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		169						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										ACTGGGAACGCCACAGTGGGC	0.667																																																	0													22.0	24.0	23.0					5																	115298820		2201	4298	6499	SO:0001583	missense	0																														ENST00000357872.4:c.506C>T	5.37:g.115298820C>T	ENSP00000350541:p.Ala169Val		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.A169V	ENST00000357872.4	37	c.506	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	C	6.171	0.399770	0.11696	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02498	4.27	4.78	1.45	0.22620	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	1.470270	0.04496	N	0.380433	T	0.03783	0.0107	L	0.38733	1.17	0.09310	N	0.999997	B	0.28470	0.213	B	0.31390	0.129	T	0.47849	-0.9085	10	0.30854	T	0.27	.	7.6976	0.28604	0.3309:0.5241:0.1449:0.0	.	169	Q6Q4G3	AMPQ_HUMAN	V	169;158	ENSP00000350541:A169V	ENSP00000350541:A169V	A	+	2	0	AC010282.1	115326719	0.000000	0.05858	0.005000	0.12908	0.027000	0.11550	-0.199000	0.09491	0.401000	0.25424	0.655000	0.94253	GCC	AQPEP	-	pfam_Peptidase_M1_N	ENSG00000172901		0.667	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1	-	0.00	16	0	C			115298820	+1	tier1	-	no_errors	ENST00000357872	ensembl	human	known	74_37	missense	66.67	2	4	SNP	0.001	T
LVRN	206338	genome.wustl.edu	37	5	115336817	115336817	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:115336817G>T	ENST00000357872.4	+	10	1825	c.1701G>T	c.(1699-1701)atG>atT	p.M567I	AQPEP_ENST00000395528.2_Missense_Mutation_p.M84I	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		567						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AAAACATAATGGACAGTTGGA	0.378																																																	0													106.0	106.0	106.0					5																	115336817		2202	4300	6502	SO:0001583	missense	0																														ENST00000357872.4:c.1701G>T	5.37:g.115336817G>T	ENSP00000350541:p.Met567Ile		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.M567I	ENST00000357872.4	37	c.1701	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503891	0.85176	.	.	ENSG00000172901	ENST00000395528;ENST00000357872;ENST00000379578	T;T	0.05199	3.48;3.48	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	M	0.85462	2.755	0.50813	D	0.999891	D	0.76494	0.999	D	0.80764	0.994	T	0.01476	-1.1345	10	0.87932	D	0	.	19.4349	0.94788	0.0:0.0:1.0:0.0	.	567	Q6Q4G3	AMPQ_HUMAN	I	84;567;556	ENSP00000378899:M84I;ENSP00000350541:M567I	ENSP00000350541:M567I	M	+	3	0	AC010282.1	115364716	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.183000	0.77697	2.894000	0.99253	0.655000	0.94253	ATG	AQPEP	-	NULL	ENSG00000172901		0.378	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1		0.00	64	0	G			115336817	+1			no_errors	ENST00000357872	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
ARHGAP21	57584	genome.wustl.edu	37	10	24909458	24909458	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:24909458G>A	ENST00000396432.2	-	9	1852	c.1366C>T	c.(1366-1368)Cgc>Tgc	p.R456C	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.R243C	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	455					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GACACACTGCGTTGCCGTATC	0.498																																																	0													36.0	34.0	35.0					10																	24909458		2202	4278	6480	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1366C>T	10.37:g.24909458G>A	ENSP00000379709:p.Arg456Cys		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R456C	ENST00000396432.2	37	c.1366	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647706	0.67358	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.74315	1.18;0.84;-0.83;-0.83	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.86029	0.5835	M	0.78801	2.425	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.971	D	0.86779	0.1978	10	0.87932	D	0	.	15.8177	0.78615	0.0:0.0:0.8017:0.1983	.	446;455	F8W9U9;Q5T5U3	.;RHG21_HUMAN	C	456;445;243;446;456;291	ENSP00000379709:R456C;ENSP00000365604:R243C;ENSP00000365592:R446C;ENSP00000405018:R456C	ENSP00000365604:R243C	R	-	1	0	ARHGAP21	24949464	1.000000	0.71417	0.846000	0.33378	0.787000	0.44495	5.868000	0.69605	2.937000	0.99478	0.650000	0.86243	CGC	ARHGAP21	-	NULL	ENSG00000107863		0.498	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	-	0.00	65	0	G	NM_020824		24909458	-1	tier1	-	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	12.33	64	9	SNP	0.989	A
ARHGAP21	57584	genome.wustl.edu	37	10	24909458	24909458	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:24909458G>A	ENST00000396432.2	-	9	1852	c.1366C>T	c.(1366-1368)Cgc>Tgc	p.R456C	ARHGAP21_ENST00000320481.6_Missense_Mutation_p.R243C	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	455					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						GACACACTGCGTTGCCGTATC	0.498																																																	0													36.0	34.0	35.0					10																	24909458		2202	4278	6480	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1366C>T	10.37:g.24909458G>A	ENSP00000379709:p.Arg456Cys		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R456C	ENST00000396432.2	37	c.1366	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647706	0.67358	.	.	ENSG00000107863	ENST00000396432;ENST00000447364;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	T;T;T;T	0.74315	1.18;0.84;-0.83;-0.83	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.86029	0.5835	M	0.78801	2.425	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.971	D	0.86779	0.1978	10	0.87932	D	0	.	15.8177	0.78615	0.0:0.0:0.8017:0.1983	.	446;455	F8W9U9;Q5T5U3	.;RHG21_HUMAN	C	456;445;243;446;456;291	ENSP00000379709:R456C;ENSP00000365604:R243C;ENSP00000365592:R446C;ENSP00000405018:R456C	ENSP00000365604:R243C	R	-	1	0	ARHGAP21	24949464	1.000000	0.71417	0.846000	0.33378	0.787000	0.44495	5.868000	0.69605	2.937000	0.99478	0.650000	0.86243	CGC	ARHGAP21	-	NULL	ENSG00000107863		0.498	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	-	0.00	91	0	G	NM_020824		24909458	-1	tier1	-	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	12.33	64	9	SNP	0.989	A
ARL5A	26225	genome.wustl.edu	37	2	152684743	152684743	+	5'UTR	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:152684743C>G	ENST00000295087.8	-	0	259				ARL5A_ENST00000487723.1_5'UTR|ARL5A_ENST00000428992.2_Intron	NM_001037174.1|NM_012097.3	NP_001032251.1|NP_036229.1	Q9Y689	ARL5A_HUMAN	ADP-ribosylation factor-like 5A						small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			breast(1)|large_intestine(2)|liver(1)|lung(2)	6				BRCA - Breast invasive adenocarcinoma(221;0.153)		TGGCTTCCCCCGGCTCAGGCT	0.677																																																	0													12.0	14.0	14.0					2																	152684743		691	1590	2281	SO:0001623	5_prime_UTR_variant	0			AF100740	CCDS2195.1, CCDS46425.1	2q23.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000162980	ENSG00000162980		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	696	protein-coding gene	gene with protein product		608960	"""ADP-ribosylation factor-like 5"""	ARL5			Standard	NM_012097		Approved		uc002txx.1	Q9Y689	OTTHUMG00000131887	ENST00000295087.8:c.-53G>C	2.37:g.152684743C>G			Q580I5	RNA	SNP	-	NULL	ENST00000295087.8	37	NULL	CCDS2195.1	2																																																																																			ARL5A	-	-	ENSG00000162980		0.677	ARL5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL5A	HGNC	protein_coding	OTTHUMT00000254837.1	-	0.00	29	0	C			152684743	-1	tier1	-	no_errors	ENST00000487723	ensembl	human	putative	74_37	rna	24.14	22	7	SNP	0.986	G
ARL5A	26225	genome.wustl.edu	37	2	152684743	152684743	+	5'UTR	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:152684743C>G	ENST00000295087.8	-	0	259				ARL5A_ENST00000487723.1_5'UTR|ARL5A_ENST00000428992.2_Intron	NM_001037174.1|NM_012097.3	NP_001032251.1|NP_036229.1	Q9Y689	ARL5A_HUMAN	ADP-ribosylation factor-like 5A						small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			breast(1)|large_intestine(2)|liver(1)|lung(2)	6				BRCA - Breast invasive adenocarcinoma(221;0.153)		TGGCTTCCCCCGGCTCAGGCT	0.677																																																	0													12.0	14.0	14.0					2																	152684743		691	1590	2281	SO:0001623	5_prime_UTR_variant	0			AF100740	CCDS2195.1, CCDS46425.1	2q23.3	2014-05-09	2005-11-03	2005-11-03	ENSG00000162980	ENSG00000162980		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	696	protein-coding gene	gene with protein product		608960	"""ADP-ribosylation factor-like 5"""	ARL5			Standard	NM_012097		Approved		uc002txx.1	Q9Y689	OTTHUMG00000131887	ENST00000295087.8:c.-53G>C	2.37:g.152684743C>G			Q580I5	RNA	SNP	-	NULL	ENST00000295087.8	37	NULL	CCDS2195.1	2																																																																																			ARL5A	-	-	ENSG00000162980		0.677	ARL5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL5A	HGNC	protein_coding	OTTHUMT00000254837.1	-	0.00	40	0	C			152684743	-1	tier1	-	no_errors	ENST00000487723	ensembl	human	putative	74_37	rna	24.14	22	7	SNP	0.986	G
ASB15	142685	genome.wustl.edu	37	7	123269135	123269135	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:123269135G>A	ENST00000451558.1	+	12	1608	c.1087G>A	c.(1087-1089)Gtt>Att	p.V363I	ASB15_ENST00000451215.1_Missense_Mutation_p.V363I|ASB15_ENST00000540573.1_Missense_Mutation_p.V363I|ASB15_ENST00000275699.3_Missense_Mutation_p.V363I|ASB15_ENST00000434204.1_Missense_Mutation_p.V363I			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	363					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						TAATAATGACGTTCATTGCAC	0.438																																																	0													144.0	129.0	134.0					7																	123269135		2203	4300	6503	SO:0001583	missense	0			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1087G>A	7.37:g.123269135G>A	ENSP00000397655:p.Val363Ile		Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.V363I	ENST00000451558.1	37	c.1087	CCDS34742.1	7	.	.	.	.	.	.	.	.	.	.	G	0.797	-0.756933	0.03019	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000275699	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	6.17	4.96	0.65561	Ankyrin repeat-containing domain (4);	0.142946	0.48767	N	0.000163	T	0.37544	0.1007	N	0.13003	0.285	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.28870	-1.0030	10	0.02654	T	1	-8.4562	8.4844	0.33063	0.8367:0.0:0.1633:0.0	.	363	Q8WXK1	ASB15_HUMAN	I	363;363;363;363;152;363	ENSP00000397655:V363I;ENSP00000390963:V363I;ENSP00000416433:V363I;ENSP00000438643:V363I;ENSP00000275699:V363I	ENSP00000275699:V363I	V	+	1	0	ASB15	123056371	0.653000	0.27358	0.221000	0.23827	0.206000	0.24218	2.010000	0.40913	1.058000	0.40530	-0.345000	0.07892	GTT	ASB15	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000146809		0.438	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB15	HGNC	protein_coding	OTTHUMT00000347493.1	-	0.00	57	0	G			123269135	+1	tier1	-	no_errors	ENST00000275699	ensembl	human	known	74_37	missense	42.70	51	38	SNP	0.235	A
ASB15	142685	genome.wustl.edu	37	7	123269135	123269135	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:123269135G>A	ENST00000451558.1	+	12	1608	c.1087G>A	c.(1087-1089)Gtt>Att	p.V363I	ASB15_ENST00000451215.1_Missense_Mutation_p.V363I|ASB15_ENST00000540573.1_Missense_Mutation_p.V363I|ASB15_ENST00000275699.3_Missense_Mutation_p.V363I|ASB15_ENST00000434204.1_Missense_Mutation_p.V363I			Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box containing 15	363					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|kidney(1)|large_intestine(1)|lung(6)|skin(3)	12						TAATAATGACGTTCATTGCAC	0.438																																																	0													144.0	129.0	134.0					7																	123269135		2203	4300	6503	SO:0001583	missense	0			AF403033	CCDS34742.1	7q31.31	2013-01-10	2011-01-25		ENSG00000146809	ENSG00000146809		"""Ankyrin repeat domain containing"""	19767	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 15"""			12076535	Standard	XM_005250149		Approved	FLJ43370	uc003vkw.1	Q8WXK1	OTTHUMG00000157114	ENST00000451558.1:c.1087G>A	7.37:g.123269135G>A	ENSP00000397655:p.Val363Ile		Q3ZCP3|Q3ZCP5|Q68D37	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.V363I	ENST00000451558.1	37	c.1087	CCDS34742.1	7	.	.	.	.	.	.	.	.	.	.	G	0.797	-0.756933	0.03019	.	.	ENSG00000146809	ENST00000451558;ENST00000434204;ENST00000451215;ENST00000540573;ENST00000542545;ENST00000275699	T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1;-0.1	6.17	4.96	0.65561	Ankyrin repeat-containing domain (4);	0.142946	0.48767	N	0.000163	T	0.37544	0.1007	N	0.13003	0.285	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.28870	-1.0030	10	0.02654	T	1	-8.4562	8.4844	0.33063	0.8367:0.0:0.1633:0.0	.	363	Q8WXK1	ASB15_HUMAN	I	363;363;363;363;152;363	ENSP00000397655:V363I;ENSP00000390963:V363I;ENSP00000416433:V363I;ENSP00000438643:V363I;ENSP00000275699:V363I	ENSP00000275699:V363I	V	+	1	0	ASB15	123056371	0.653000	0.27358	0.221000	0.23827	0.206000	0.24218	2.010000	0.40913	1.058000	0.40530	-0.345000	0.07892	GTT	ASB15	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000146809		0.438	ASB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB15	HGNC	protein_coding	OTTHUMT00000347493.1	-	0.00	67	0	G			123269135	+1	tier1	-	no_errors	ENST00000275699	ensembl	human	known	74_37	missense	42.70	51	38	SNP	0.235	A
ASXL3	80816	genome.wustl.edu	37	18	31318661	31318661	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:31318661A>T	ENST00000269197.5	+	11	1293	c.1293A>T	c.(1291-1293)aaA>aaT	p.K431N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TTCCACCTAAAGATATAATGG	0.433																																																	0													73.0	74.0	73.0					18																	31318661		1866	4100	5966	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1293A>T	18.37:g.31318661A>T	ENSP00000269197:p.Lys431Asn		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.K431N	ENST00000269197.5	37	c.1293	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	A	10.74	1.435077	0.25813	.	.	ENSG00000141431	ENST00000269197	T	0.21734	1.99	5.37	-0.348	0.12613	.	0.938275	0.08986	N	0.865146	T	0.22742	0.0549	M	0.63843	1.955	0.31645	N	0.647582	P	0.41366	0.747	B	0.40375	0.327	T	0.37776	-0.9691	10	0.45353	T	0.12	.	8.7137	0.34399	0.3971:0.0:0.6029:0.0	.	431	Q9C0F0	ASXL3_HUMAN	N	431	ENSP00000269197:K431N	ENSP00000269197:K431N	K	+	3	2	ASXL3	29572659	0.994000	0.37717	0.663000	0.29738	0.492000	0.33523	0.249000	0.18216	0.075000	0.16796	0.482000	0.46254	AAA	ASXL3	-	NULL	ENSG00000141431		0.433	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	46	0	A			31318661	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.994	T
ASXL3	80816	genome.wustl.edu	37	18	31318661	31318661	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:31318661A>T	ENST00000269197.5	+	11	1293	c.1293A>T	c.(1291-1293)aaA>aaT	p.K431N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	431					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TTCCACCTAAAGATATAATGG	0.433																																																	0													73.0	74.0	73.0					18																	31318661		1866	4100	5966	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1293A>T	18.37:g.31318661A>T	ENSP00000269197:p.Lys431Asn		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.K431N	ENST00000269197.5	37	c.1293	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	A	10.74	1.435077	0.25813	.	.	ENSG00000141431	ENST00000269197	T	0.21734	1.99	5.37	-0.348	0.12613	.	0.938275	0.08986	N	0.865146	T	0.22742	0.0549	M	0.63843	1.955	0.31645	N	0.647582	P	0.41366	0.747	B	0.40375	0.327	T	0.37776	-0.9691	10	0.45353	T	0.12	.	8.7137	0.34399	0.3971:0.0:0.6029:0.0	.	431	Q9C0F0	ASXL3_HUMAN	N	431	ENSP00000269197:K431N	ENSP00000269197:K431N	K	+	3	2	ASXL3	29572659	0.994000	0.37717	0.663000	0.29738	0.492000	0.33523	0.249000	0.18216	0.075000	0.16796	0.482000	0.46254	AAA	ASXL3	-	NULL	ENSG00000141431		0.433	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	48	0	A			31318661	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.994	T
ATP13A4	84239	genome.wustl.edu	37	3	193272456	193272456	+	Intron	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:193272456T>C	ENST00000342695.4	-	1	383				ATP13A4_ENST00000295548.3_Intron|ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4_ENST00000392443.3_Intron|ATP13A4-AS1_ENST00000426459.1_RNA	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		tgtgtgtgtgtgtgtgtgtgt	0.448																																																	0																																										SO:0001627	intron_variant	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.60+72A>G	3.37:g.193272456T>C			B7WPC7|Q6UY23|Q8N1Q9|Q9H043	RNA	SNP	-	NULL	ENST00000342695.4	37	NULL	CCDS3304.2	3																																																																																			ATP13A4-AS1	-	-	ENSG00000225473		0.448	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4-AS1	HGNC	protein_coding	OTTHUMT00000157244.4	-	0.00	42	0	T	NM_032279		193272456	+1	tier1	-	no_errors	ENST00000426459	ensembl	human	known	74_37	rna	12.77	41	6	SNP	0.000	C
ATP4A	495	genome.wustl.edu	37	19	36051293	36051293	+	Silent	SNP	G	G	A	rs149356804		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:36051293G>A	ENST00000262623.3	-	6	787	c.759C>T	c.(757-759)atC>atT	p.I253I		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	253					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	AGAAGAAGGCGATGTTGCGGG	0.622																																																	0										1,4405	2.1+/-5.4	0,1,2202	97.0	99.0	98.0		759	2.0	1.0	19	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous	ATP4A	NM_000704.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		253/1036	36051293	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.759C>T	19.37:g.36051293G>A			O00738	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.I253	ENST00000262623.3	37	c.759	CCDS12467.1	19																																																																																			ATP4A	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000105675		0.622	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	-	0.00	57	0	G	NM_000704		36051293	-1	tier1	rs149356804	no_errors	ENST00000262623	ensembl	human	known	74_37	silent	21.88	25	7	SNP	1.000	A
ATP4A	495	genome.wustl.edu	37	19	36051293	36051293	+	Silent	SNP	G	G	A	rs149356804		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:36051293G>A	ENST00000262623.3	-	6	787	c.759C>T	c.(757-759)atC>atT	p.I253I		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	253					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	AGAAGAAGGCGATGTTGCGGG	0.622																																																	0										1,4405	2.1+/-5.4	0,1,2202	97.0	99.0	98.0		759	2.0	1.0	19	dbSNP_134	98	0,8600		0,0,4300	no	coding-synonymous	ATP4A	NM_000704.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		253/1036	36051293	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.759C>T	19.37:g.36051293G>A			O00738	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.I253	ENST00000262623.3	37	c.759	CCDS12467.1	19																																																																																			ATP4A	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000105675		0.622	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	-	0.00	80	0	G	NM_000704		36051293	-1	tier1	rs149356804	no_errors	ENST00000262623	ensembl	human	known	74_37	silent	21.88	25	7	SNP	1.000	A
ATXN7L3	56970	genome.wustl.edu	37	17	42274607	42274607	+	Silent	SNP	G	G	T	rs201010457		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:42274607G>T	ENST00000454077.2	-	3	344	c.345C>A	c.(343-345)atC>atA	p.I115I	ATXN7L3_ENST00000593073.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA|ATXN7L3_ENST00000389384.4_Silent_p.I115I	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGCGGTTGGCGATTCGGCTGC	0.612																																																	0													50.0	60.0	57.0					17																	42274607		2011	4171	6182	SO:0001819	synonymous_variant	0			AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.345C>A	17.37:g.42274607G>T				Silent	SNP	pfam_SAGA_su_Sgf11,pfam_SCA7_dom	p.I115	ENST00000454077.2	37	c.345	CCDS45697.1	17																																																																																			ATXN7L3	-	NULL	ENSG00000087152		0.612	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATXN7L3	HGNC	protein_coding	OTTHUMT00000457724.1	-	0.00	57	0	G			42274607	-1	tier1	-	no_errors	ENST00000454077	ensembl	human	known	74_37	silent	68.89	14	31	SNP	0.995	T
ATXN7L3	56970	genome.wustl.edu	37	17	42274607	42274607	+	Silent	SNP	G	G	T	rs201010457		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:42274607G>T	ENST00000454077.2	-	3	344	c.345C>A	c.(343-345)atC>atA	p.I115I	ATXN7L3_ENST00000593073.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA|ATXN7L3_ENST00000389384.4_Silent_p.I115I	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		GGCGGTTGGCGATTCGGCTGC	0.612																																																	0													50.0	60.0	57.0					17																	42274607		2011	4171	6182	SO:0001819	synonymous_variant	0			AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.345C>A	17.37:g.42274607G>T				Silent	SNP	pfam_SAGA_su_Sgf11,pfam_SCA7_dom	p.I115	ENST00000454077.2	37	c.345	CCDS45697.1	17																																																																																			ATXN7L3	-	NULL	ENSG00000087152		0.612	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATXN7L3	HGNC	protein_coding	OTTHUMT00000457724.1	-	0.00	58	0	G			42274607	-1	tier1	-	no_errors	ENST00000454077	ensembl	human	known	74_37	silent	68.89	14	31	SNP	0.995	T
AUTS2	26053	genome.wustl.edu	37	7	70231114	70231114	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:70231114C>T	ENST00000342771.4	+	9	1804	c.1483C>T	c.(1483-1485)Cga>Tga	p.R495*	AUTS2_ENST00000406775.2_Nonsense_Mutation_p.R495*	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	495										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		AGACATCTTGCGACAGGAACT	0.582																																																	0													131.0	127.0	128.0					7																	70231114		2203	4300	6503	SO:0001587	stop_gained	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.1483C>T	7.37:g.70231114C>T	ENSP00000344087:p.Arg495*		A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Nonsense_Mutation	SNP	prints_AUTS2	p.R495*	ENST00000342771.4	37	c.1483	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.088503	0.97271	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	.	.	.	5.77	4.87	0.63330	.	0.114328	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.7214	13.5519	0.61736	0.2921:0.7079:0.0:0.0	.	.	.	.	X	495	.	.	R	+	1	2	AUTS2	69869050	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.508000	0.53378	1.378000	0.46305	0.561000	0.74099	CGA	AUTS2	-	NULL	ENSG00000158321		0.582	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	-	0.00	61	0	C			70231114	+1	tier1	-	no_errors	ENST00000342771	ensembl	human	known	74_37	nonsense	13.64	57	9	SNP	1.000	T
AZU1	566	genome.wustl.edu	37	19	828364	828364	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:828364G>A	ENST00000233997.2	+	2	214	c.193G>A	c.(193-195)Gcg>Acg	p.A65T		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	65	Hydrophobic.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.|Possesses antibiotic activity.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGATGACCGCGGCCAGCTG	0.657																																																	0													35.0	41.0	39.0					19																	828364		2200	4292	6492	SO:0001583	missense	0			X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.193G>A	19.37:g.828364G>A	ENSP00000233997:p.Ala65Thr		P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A65T	ENST00000233997.2	37	c.193	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511257	0.44660	.	.	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.95238	-3.65	2.4	1.33	0.21861	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.97321	0.9124	H	0.94620	3.56	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90289	0.4321	9	0.87932	D	0	.	5.0783	0.14644	0.1821:0.0:0.8179:0.0	.	65	P20160	CAP7_HUMAN	T	79;65	ENSP00000233997:A65T	ENSP00000233997:A65T	A	+	1	0	AZU1	779364	0.085000	0.21516	0.005000	0.12908	0.027000	0.11550	2.053000	0.41326	0.340000	0.23745	0.511000	0.50034	GCG	AZU1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000172232		0.657	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	HGNC	protein_coding	OTTHUMT00000457472.2	-	0.00	29	0	G	NM_001700		828364	+1	tier1	-	no_errors	ENST00000233997	ensembl	human	known	74_37	missense	45.45	12	10	SNP	0.006	A
AZU1	566	genome.wustl.edu	37	19	828364	828364	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:828364G>A	ENST00000233997.2	+	2	214	c.193G>A	c.(193-195)Gcg>Acg	p.A65T		NM_001700.3	NP_001691.1	P20160	CAP7_HUMAN	azurocidin 1	65	Hydrophobic.|Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.|Possesses antibiotic activity.				cellular extravasation (GO:0045123)|defense response to Gram-negative bacterium (GO:0050829)|glial cell migration (GO:0008347)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|macrophage chemotaxis (GO:0048246)|microglial cell activation (GO:0001774)|monocyte activation (GO:0042117)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fractalkine biosynthetic process (GO:0050754)|positive regulation of interleukin-1 beta biosynthetic process (GO:0050725)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of vascular permeability (GO:0043114)	azurophil granule (GO:0042582)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)|toxic substance binding (GO:0015643)			NS(1)|endometrium(1)|kidney(1)|lung(4)|pancreas(1)|upper_aerodigestive_tract(2)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGATGACCGCGGCCAGCTG	0.657																																																	0													35.0	41.0	39.0					19																	828364		2200	4292	6492	SO:0001583	missense	0			X58794	CCDS12044.1	19p13.3	2012-03-30	2008-08-01		ENSG00000172232	ENSG00000172232			913	protein-coding gene	gene with protein product	"""cationic antimicrobial protein 37"", ""heparin-binding protein"", ""neutrophil azurocidin"""	162815				1919011	Standard	NM_001700		Approved	AZU, CAP37, AZAMP, HBP, NAZC, HUMAZUR	uc002lpz.1	P20160		ENST00000233997.2:c.193G>A	19.37:g.828364G>A	ENSP00000233997:p.Ala65Thr		P80014|Q52LG4|Q9UCM1|Q9UCT5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A65T	ENST00000233997.2	37	c.193	CCDS12044.1	19	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511257	0.44660	.	.	ENSG00000172232	ENST00000334630;ENST00000233997	D	0.95238	-3.65	2.4	1.33	0.21861	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.97321	0.9124	H	0.94620	3.56	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90289	0.4321	9	0.87932	D	0	.	5.0783	0.14644	0.1821:0.0:0.8179:0.0	.	65	P20160	CAP7_HUMAN	T	79;65	ENSP00000233997:A65T	ENSP00000233997:A65T	A	+	1	0	AZU1	779364	0.085000	0.21516	0.005000	0.12908	0.027000	0.11550	2.053000	0.41326	0.340000	0.23745	0.511000	0.50034	GCG	AZU1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000172232		0.657	AZU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZU1	HGNC	protein_coding	OTTHUMT00000457472.2	-	0.00	32	0	G	NM_001700		828364	+1	tier1	-	no_errors	ENST00000233997	ensembl	human	known	74_37	missense	45.45	12	10	SNP	0.006	A
B3GNTL1	146712	genome.wustl.edu	37	17	80923600	80923600	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:80923600G>T	ENST00000320865.3	-	7	540	c.527C>A	c.(526-528)aCg>aAg	p.T176K	B3GNTL1_ENST00000576599.1_Missense_Mutation_p.T65K|B3GNTL1_ENST00000571954.1_5'UTR	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	176							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CATGATCACCGTGGGGCCATT	0.527																																																	0													66.0	58.0	60.0					17																	80923600		2203	4300	6503	SO:0001583	missense	0			AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.527C>A	17.37:g.80923600G>T	ENSP00000319979:p.Thr176Lys		Q6GV30|Q8WUT3	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.T176K	ENST00000320865.3	37	c.527	CCDS32778.1	17	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659398	0.67586	.	.	ENSG00000175711	ENST00000320865	T	0.61627	0.09	4.83	4.83	0.62350	Glycosyl transferase, family 2 (1);	0.000000	0.85682	D	0.000000	T	0.75953	0.3920	M	0.78801	2.425	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.77694	-0.2492	9	.	.	.	-15.4566	15.7877	0.78319	0.0:0.0:1.0:0.0	.	176	Q67FW5	B3GNL_HUMAN	K	176	ENSP00000319979:T176K	.	T	-	2	0	B3GNTL1	78516889	1.000000	0.71417	0.339000	0.25562	0.300000	0.27592	4.680000	0.61656	2.428000	0.82296	0.462000	0.41574	ACG	B3GNTL1	-	pfam_Glyco_trans_2	ENSG00000175711		0.527	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	HGNC	protein_coding	OTTHUMT00000438949.1		0.00	55	0	G	NM_001009905		80923600	-1			no_errors	ENST00000320865	ensembl	human	known	74_37	missense	7.41	49	4	SNP	0.993	T
BAZ2B	29994	genome.wustl.edu	37	2	160194204	160194204	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:160194204T>C	ENST00000392783.2	-	32	6029	c.5534A>G	c.(5533-5535)aAg>aGg	p.K1845R	BAZ2B_ENST00000343439.5_Missense_Mutation_p.K1745R|BAZ2B_ENST00000355831.2_Missense_Mutation_p.K1811R|BAZ2B_ENST00000392782.1_Missense_Mutation_p.K1809R	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1845					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ATCATGCTCCTTGCACAATTT	0.433																																																	0													134.0	131.0	132.0					2																	160194204		1920	4140	6060	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5534A>G	2.37:g.160194204T>C	ENSP00000376534:p.Lys1845Arg		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.K1845R	ENST00000392783.2	37	c.5534	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880735	0.33255	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000426648	T;T;T;T	0.59502	0.33;0.33;0.33;0.26	5.78	5.78	0.91487	.	0.000000	0.38720	U	0.001591	T	0.50103	0.1596	L	0.31926	0.97	0.54753	D	0.999989	P;P	0.37955	0.612;0.555	B;B	0.37692	0.256;0.138	T	0.52373	-0.8584	10	0.48119	T	0.1	-11.7145	16.1021	0.81178	0.0:0.0:0.0:1.0	.	1809;1845	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	R	1809;1845;1811;1745;63	ENSP00000376533:K1809R;ENSP00000376534:K1845R;ENSP00000348087:K1811R;ENSP00000339670:K1745R	ENSP00000339670:K1745R	K	-	2	0	BAZ2B	159902450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.383000	0.52471	2.210000	0.71456	0.533000	0.62120	AAG	BAZ2B	-	NULL	ENSG00000123636		0.433	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	-	0.00	77	0	T			160194204	-1	tier1	-	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	34.48	38	20	SNP	1.000	C
BAZ2B	29994	genome.wustl.edu	37	2	160194204	160194204	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:160194204T>C	ENST00000392783.2	-	32	6029	c.5534A>G	c.(5533-5535)aAg>aGg	p.K1845R	BAZ2B_ENST00000343439.5_Missense_Mutation_p.K1745R|BAZ2B_ENST00000355831.2_Missense_Mutation_p.K1811R|BAZ2B_ENST00000392782.1_Missense_Mutation_p.K1809R	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1845					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ATCATGCTCCTTGCACAATTT	0.433																																																	0													134.0	131.0	132.0					2																	160194204		1920	4140	6060	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.5534A>G	2.37:g.160194204T>C	ENSP00000376534:p.Lys1845Arg		D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.K1845R	ENST00000392783.2	37	c.5534	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	T	12.25	1.880735	0.33255	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439;ENST00000426648	T;T;T;T	0.59502	0.33;0.33;0.33;0.26	5.78	5.78	0.91487	.	0.000000	0.38720	U	0.001591	T	0.50103	0.1596	L	0.31926	0.97	0.54753	D	0.999989	P;P	0.37955	0.612;0.555	B;B	0.37692	0.256;0.138	T	0.52373	-0.8584	10	0.48119	T	0.1	-11.7145	16.1021	0.81178	0.0:0.0:0.0:1.0	.	1809;1845	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	R	1809;1845;1811;1745;63	ENSP00000376533:K1809R;ENSP00000376534:K1845R;ENSP00000348087:K1811R;ENSP00000339670:K1745R	ENSP00000339670:K1745R	K	-	2	0	BAZ2B	159902450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.383000	0.52471	2.210000	0.71456	0.533000	0.62120	AAG	BAZ2B	-	NULL	ENSG00000123636		0.433	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	-	0.00	87	0	T			160194204	-1	tier1	-	no_errors	ENST00000392783	ensembl	human	known	74_37	missense	34.48	38	20	SNP	1.000	C
BCL9L	283149	genome.wustl.edu	37	11	118768467	118768467	+	3'UTR	DEL	T	T	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:118768467delT	ENST00000334801.3	-	0	6121				BCL9L_ENST00000526143.1_5'UTR|CXCR5_ENST00000292174.4_3'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like						canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TCTTTTATCCTTTTTTTTTTG	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.*657A>-	11.37:g.118768467delT			A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	RNA	DEL	-	NULL	ENST00000334801.3	37	NULL	CCDS8403.1	11																																																																																			BCL9L	-	-	ENSG00000186174		0.498	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1		0.00	27	0	T	NM_182557		118768467	-1	tier1		no_errors	ENST00000526143	ensembl	human	known	74_37	rna	18.75	13	3	DEL	0.885	-
C1QTNF9B	387911	genome.wustl.edu	37	13	24465623	24465623	+	Silent	SNP	G	G	A	rs4083570		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:24465623G>A	ENST00000382140.2	-	5	867	c.807C>T	c.(805-807)aaC>aaT	p.N269N	MIPEP_ENST00000469167.1_5'Flank|C1QTNF9B-AS1_ENST00000382133.4_RNA|C1QTNF9B_ENST00000556521.1_5'UTR|C1QTNF9B-AS1_ENST00000435039.2_RNA|C1QTNF9B_ENST00000382145.1_Missense_Mutation_p.T98M|C1QTNF9B_ENST00000382057.3_Missense_Mutation_p.T98M|C1QTNF9B_ENST00000382137.3_Silent_p.N269N|C1QTNF9B-AS1_ENST00000417034.1_RNA|MIPEP_ENST00000382172.3_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	269	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						TTTTTACTCCGTTTTTGACCA	0.507																																																	0													137.0	117.0	124.0					13																	24465623		2203	4300	6503	SO:0001819	synonymous_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.807C>T	13.37:g.24465623G>A			A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	pfam_Collagen	p.T98M	ENST00000382140.2	37	c.293	CCDS31947.1	13	.	.	.	.	.	.	.	.	.	.	g	0.007	-2.002413	0.00431	.	.	ENSG00000205863	ENST00000382145;ENST00000382057	D;D	0.89343	-2.5;-2.5	3.96	-5.77	0.02369	.	.	.	.	.	D	0.88351	0.6413	.	.	.	0.19945	N	0.999942	.	.	.	.	.	.	T	0.82481	-0.0436	6	0.52906	T	0.07	.	15.0983	0.72253	0.4662:0.0:0.5338:0.0	rs4083570	.	.	.	M	98	ENSP00000371580:T98M;ENSP00000371489:T98M	ENSP00000371489:T98M	T	-	2	0	C1QTNF9B	23363623	0.000000	0.05858	0.269000	0.24586	0.053000	0.15095	-1.610000	0.02064	-1.672000	0.01464	-2.013000	0.00436	ACG	C1QTNF9B	-	NULL	ENSG00000205863		0.507	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B	HGNC	protein_coding	OTTHUMT00000044162.3	-	0.00	111	0	G	NM_001007537		24465623	-1	tier1	rs4083570	no_errors	ENST00000382057	ensembl	human	known	74_37	missense	11.76	135	18	SNP	0.289	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24465623	24465623	+	Silent	SNP	G	G	A	rs4083570		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:24465623G>A	ENST00000382140.2	-	5	867	c.807C>T	c.(805-807)aaC>aaT	p.N269N	MIPEP_ENST00000469167.1_5'Flank|C1QTNF9B-AS1_ENST00000382133.4_RNA|C1QTNF9B_ENST00000556521.1_5'UTR|C1QTNF9B-AS1_ENST00000435039.2_RNA|C1QTNF9B_ENST00000382145.1_Missense_Mutation_p.T98M|C1QTNF9B_ENST00000382057.3_Missense_Mutation_p.T98M|C1QTNF9B_ENST00000382137.3_Silent_p.N269N|C1QTNF9B-AS1_ENST00000417034.1_RNA|MIPEP_ENST00000382172.3_5'Flank			B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B	269	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.					collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						TTTTTACTCCGTTTTTGACCA	0.507																																																	0													137.0	117.0	124.0					13																	24465623		2203	4300	6503	SO:0001819	synonymous_variant	0			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382140.2:c.807C>T	13.37:g.24465623G>A			A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	Missense_Mutation	SNP	pfam_Collagen	p.T98M	ENST00000382140.2	37	c.293	CCDS31947.1	13	.	.	.	.	.	.	.	.	.	.	g	0.007	-2.002413	0.00431	.	.	ENSG00000205863	ENST00000382145;ENST00000382057	D;D	0.89343	-2.5;-2.5	3.96	-5.77	0.02369	.	.	.	.	.	D	0.88351	0.6413	.	.	.	0.19945	N	0.999942	.	.	.	.	.	.	T	0.82481	-0.0436	6	0.52906	T	0.07	.	15.0983	0.72253	0.4662:0.0:0.5338:0.0	rs4083570	.	.	.	M	98	ENSP00000371580:T98M;ENSP00000371489:T98M	ENSP00000371489:T98M	T	-	2	0	C1QTNF9B	23363623	0.000000	0.05858	0.269000	0.24586	0.053000	0.15095	-1.610000	0.02064	-1.672000	0.01464	-2.013000	0.00436	ACG	C1QTNF9B	-	NULL	ENSG00000205863		0.507	C1QTNF9B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	C1QTNF9B	HGNC	protein_coding	OTTHUMT00000044162.3	-	0.00	128	0	G	NM_001007537		24465623	-1	tier1	rs4083570	no_errors	ENST00000382057	ensembl	human	known	74_37	missense	11.76	135	18	SNP	0.289	A
MTHFR	4524	genome.wustl.edu	37	1	11848037	11848037	+	3'UTR	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:11848037A>T	ENST00000376592.1	-	0	4799				C1orf167_ENST00000433342.1_Nonsense_Mutation_p.R1285*|MTHFR_ENST00000376583.3_3'UTR|MTHFR_ENST00000376590.3_3'UTR			P42898	MTHR_HUMAN	methylenetetrahydrofolate reductase (NAD(P)H)						blood circulation (GO:0008015)|cellular amino acid metabolic process (GO:0006520)|folic acid metabolic process (GO:0046655)|homocysteine metabolic process (GO:0050667)|methionine biosynthetic process (GO:0009086)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to interleukin-1 (GO:0070555)|response to vitamin B2 (GO:0033274)|S-adenosylmethionine metabolic process (GO:0046500)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|neuron projection (GO:0043005)	flavin adenine dinucleotide binding (GO:0050660)|methylenetetrahydrofolate reductase (NAD(P)H) activity (GO:0004489)|modified amino acid binding (GO:0072341)|NADP binding (GO:0050661)			NS(4)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Fluorouracil(DB00544)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Riboflavin(DB00140)|Tetrahydrofolic acid(DB00116)	CCAGGGACCAAGAGCGCACTC	0.627																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC053509	CCDS137.1	1p36.3	2014-09-17	2010-05-04		ENSG00000177000	ENSG00000177000	1.5.1.20		7436	protein-coding gene	gene with protein product		607093	"""5,10-methylenetetrahydrofolate reductase (NADPH)"""			7920641	Standard	NM_005957		Approved		uc001atc.2	P42898	OTTHUMG00000002277	ENST00000376592.1:c.*2700T>A	1.37:g.11848037A>T			B2R7A6|Q5SNW6|Q5SNW9|Q7Z6M6|Q8IU73|Q9UQR2	Nonsense_Mutation	SNP	NULL	p.R1285*	ENST00000376592.1	37	c.3853	CCDS137.1	1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	18.04|18.04|18.04	3.534619|3.534619|3.534619	0.64972|0.64972|0.64972	.|.|.	.|.|.	ENSG00000215910|ENSG00000215910|ENSG00000215910	ENST00000312793;ENST00000444493|ENST00000449278|ENST00000433342	.|.|.	.|.|.	.|.|.	4.47|4.47|4.47	3.54|3.54|3.54	0.40534|0.40534|0.40534	.|.|.	.|.|2.773450	.|.|0.03176	.|.|U	.|.|0.171473	T|T|.	0.36193|0.36193|.	0.0958|0.0958|.	.|.|.	.|.|.	.|.|.	0.25745|0.25745|0.25745	N|N|N	0.985112|0.985112|0.985112	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|.	0.31943|0.31943|.	-0.9925|-0.9925|.	4|4|.	.|.|.	.|.|.	.|.|.	-0.0447|-0.0447|-0.0447	8.412|8.412|8.412	0.32648|0.32648|0.32648	0.1162:0.0:0.8838:0.0|0.1162:0.0:0.8838:0.0|0.1162:0.0:0.8838:0.0	.|.|.	.|.|.	.|.|.	.|.|.	M|H|X	644;427|370|1285	.|.|.	.|.|.	K|Q|R	+|+|+	2|3|1	0|2|2	C1orf167|C1orf167|C1orf167	11770624|11770624|11770624	0.004000|0.004000|0.004000	0.15560|0.15560|0.15560	0.012000|0.012000|0.012000	0.15200|0.15200|0.15200	0.007000|0.007000|0.007000	0.05969|0.05969|0.05969	1.030000|1.030000|1.030000	0.30153|0.30153|0.30153	1.150000|1.150000|1.150000	0.42419|0.42419|0.42419	-0.255000|-0.255000|-0.255000	0.11280|0.11280|0.11280	AAG|CAA|AGA	C1orf167	-	NULL	ENSG00000215910		0.627	MTHFR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf167	HGNC	protein_coding	OTTHUMT00000006538.1		0.00	25	0	A	NM_005957		11848037	+1			no_errors	ENST00000433342	ensembl	human	known	74_37	nonsense	9.68	28	3	SNP	0.047	T
C9orf40	55071	genome.wustl.edu	37	9	77563083	77563083	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:77563083A>G	ENST00000376854.5	-	2	740	c.466T>C	c.(466-468)Tgg>Cgg	p.W156R		NM_017998.2	NP_060468.2	Q8IXQ3	CI040_HUMAN	chromosome 9 open reading frame 40	156										lung(2)|stomach(1)	3						GGATTCCTCCAGTACTGGAAG	0.388																																																	0													109.0	102.0	105.0					9																	77563083		2203	4300	6503	SO:0001583	missense	0			AK000972	CCDS6648.1	9q21.31	2012-03-15			ENSG00000135045	ENSG00000135045			23433	protein-coding gene	gene with protein product							Standard	NM_017998		Approved	FLJ10110	uc004ajo.4	Q8IXQ3	OTTHUMG00000020031	ENST00000376854.5:c.466T>C	9.37:g.77563083A>G	ENSP00000366050:p.Trp156Arg		Q9NWD3	Missense_Mutation	SNP	NULL	p.W156R	ENST00000376854.5	37	c.466	CCDS6648.1	9	.	.	.	.	.	.	.	.	.	.	A	19.15	3.771443	0.69992	.	.	ENSG00000135045	ENST00000376854	.	.	.	5.98	5.98	0.97165	.	0.000000	0.44902	D	0.000409	T	0.76040	0.3932	M	0.63843	1.955	0.38854	D	0.956347	D	0.89917	1.0	D	0.91635	0.999	T	0.79813	-0.1645	9	0.87932	D	0	-14.784	12.854	0.57873	1.0:0.0:0.0:0.0	.	156	Q8IXQ3	CI040_HUMAN	R	156	.	ENSP00000366050:W156R	W	-	1	0	C9orf40	76752903	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.833000	0.62766	2.289000	0.77006	0.533000	0.62120	TGG	C9orf40	-	NULL	ENSG00000135045		0.388	C9orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf40	HGNC	protein_coding	OTTHUMT00000052702.1	-	0.00	21	0	A	NM_017998		77563083	-1	tier1	-	no_errors	ENST00000376854	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	G
C9orf40	55071	genome.wustl.edu	37	9	77563083	77563083	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:77563083A>G	ENST00000376854.5	-	2	740	c.466T>C	c.(466-468)Tgg>Cgg	p.W156R		NM_017998.2	NP_060468.2	Q8IXQ3	CI040_HUMAN	chromosome 9 open reading frame 40	156										lung(2)|stomach(1)	3						GGATTCCTCCAGTACTGGAAG	0.388																																																	0													109.0	102.0	105.0					9																	77563083		2203	4300	6503	SO:0001583	missense	0			AK000972	CCDS6648.1	9q21.31	2012-03-15			ENSG00000135045	ENSG00000135045			23433	protein-coding gene	gene with protein product							Standard	NM_017998		Approved	FLJ10110	uc004ajo.4	Q8IXQ3	OTTHUMG00000020031	ENST00000376854.5:c.466T>C	9.37:g.77563083A>G	ENSP00000366050:p.Trp156Arg		Q9NWD3	Missense_Mutation	SNP	NULL	p.W156R	ENST00000376854.5	37	c.466	CCDS6648.1	9	.	.	.	.	.	.	.	.	.	.	A	19.15	3.771443	0.69992	.	.	ENSG00000135045	ENST00000376854	.	.	.	5.98	5.98	0.97165	.	0.000000	0.44902	D	0.000409	T	0.76040	0.3932	M	0.63843	1.955	0.38854	D	0.956347	D	0.89917	1.0	D	0.91635	0.999	T	0.79813	-0.1645	9	0.87932	D	0	-14.784	12.854	0.57873	1.0:0.0:0.0:0.0	.	156	Q8IXQ3	CI040_HUMAN	R	156	.	ENSP00000366050:W156R	W	-	1	0	C9orf40	76752903	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.833000	0.62766	2.289000	0.77006	0.533000	0.62120	TGG	C9orf40	-	NULL	ENSG00000135045		0.388	C9orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf40	HGNC	protein_coding	OTTHUMT00000052702.1	-	0.00	30	0	A	NM_017998		77563083	-1	tier1	-	no_errors	ENST00000376854	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	G
CACNA1A	773	genome.wustl.edu	37	19	13319692	13319694	+	In_Frame_Del	DEL	GAT	GAT	-	rs16051	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	GAT	GAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:13319692_13319694delGAT	ENST00000360228.5	-	46	6655_6657	c.6656_6658delATC	c.(6655-6660)catccc>ccc	p.H2219del	CACNA1A_ENST00000573710.2_In_Frame_Del_p.H2220del	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGGCGGGGGAtggtggtggtg	0.734																																																	0																																										SO:0001651	inframe_deletion	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6656_6658delATC	19.37:g.13319692_13319694delGAT	ENSP00000353362:p.His2219del		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.H2219in_frame_del	ENST00000360228.5	37	c.6658_6656	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.734	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	19	0	GAT	NM_000068		13319694	-1	tier1		no_errors	ENST00000360228	ensembl	human	known	74_37	in_frame_del	25.00	9	3	DEL	1.000:1.000:1.000	-
CADM1	23705	genome.wustl.edu	37	11	115080312	115080314	+	In_Frame_Del	DEL	TGG	TGG	-	rs370430583		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	TGG	TGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:115080312_115080314delTGG	ENST00000452722.3	-	8	1078_1080	c.1058_1060delCCA	c.(1057-1062)accatc>atc	p.T353del	CADM1_ENST00000331581.6_In_Frame_Del_p.T353del|CADM1_ENST00000542447.2_Intron|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000537058.1_In_Frame_Del_p.T353del	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		atggtaaggatggtggtggtggt	0.429																																																	0																																										SO:0001651	inframe_deletion	0			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1058_1060delCCA	11.37:g.115080321_115080323delTGG	ENSP00000395359:p.Thr353del			In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.T353in_frame_del	ENST00000452722.3	37	c.1060_1058	CCDS8373.1	11																																																																																			CADM1	-	NULL	ENSG00000182985		0.429	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	HGNC	protein_coding	OTTHUMT00000398753.2		0.00	28	0	TGG	NM_014333		115080314	-1	tier1		no_errors	ENST00000452722	ensembl	human	known	74_37	in_frame_del	8.33	22	2	DEL	1.000:1.000:1.000	-
CAPN14	440854	genome.wustl.edu	37	2	31416160	31416160	+	Splice_Site	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:31416160C>T	ENST00000403897.3	-	10	1092	c.951G>A	c.(949-951)tgG>tgA	p.W317*	CAPN14_ENST00000444918.2_Splice_Site_p.W317*	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	317	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						GCAGCGTCATCCTGTGGAGAG	0.537																																																	0													43.0	39.0	40.0					2																	31416160		692	1591	2283	SO:0001630	splice_region_variant	0			AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.951-1G>A	2.37:g.31416160C>T			B3KRU9	Nonsense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.W317*	ENST00000403897.3	37	c.951	CCDS46254.1	2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692850	0.88735	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	.	.	.	4.14	4.14	0.48551	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4223	0.83771	0.0:1.0:0.0:0.0	.	.	.	.	X	317	.	ENSP00000385247:W317X	W	-	3	0	CAPN14	31269664	1.000000	0.71417	0.250000	0.24296	0.009000	0.06853	5.112000	0.64634	1.857000	0.53885	0.655000	0.94253	TGG	CAPN14	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	ENSG00000214711		0.537	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CAPN14	HGNC	protein_coding	OTTHUMT00000325010.1	-	0.00	47	0	C	NM_001145122	Nonsense_Mutation	31416160	-1	tier1	-	no_errors	ENST00000444918	ensembl	human	known	74_37	nonsense	30.00	28	12	SNP	1.000	T
CAPN14	440854	genome.wustl.edu	37	2	31416160	31416160	+	Splice_Site	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:31416160C>T	ENST00000403897.3	-	10	1092	c.951G>A	c.(949-951)tgG>tgA	p.W317*	CAPN14_ENST00000444918.2_Splice_Site_p.W317*	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	317	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						GCAGCGTCATCCTGTGGAGAG	0.537																																																	0													43.0	39.0	40.0					2																	31416160		692	1591	2283	SO:0001630	splice_region_variant	0			AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.951-1G>A	2.37:g.31416160C>T			B3KRU9	Nonsense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.W317*	ENST00000403897.3	37	c.951	CCDS46254.1	2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.692850	0.88735	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	.	.	.	4.14	4.14	0.48551	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4223	0.83771	0.0:1.0:0.0:0.0	.	.	.	.	X	317	.	ENSP00000385247:W317X	W	-	3	0	CAPN14	31269664	1.000000	0.71417	0.250000	0.24296	0.009000	0.06853	5.112000	0.64634	1.857000	0.53885	0.655000	0.94253	TGG	CAPN14	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	ENSG00000214711		0.537	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CAPN14	HGNC	protein_coding	OTTHUMT00000325010.1	-	0.00	53	0	C	NM_001145122	Nonsense_Mutation	31416160	-1	tier1	-	no_errors	ENST00000444918	ensembl	human	known	74_37	nonsense	30.00	28	12	SNP	1.000	T
CARM1P1	100130873	genome.wustl.edu	37	9	2943517	2943518	+	IGR	INS	-	-	CC	rs34443524|rs200969035|rs199975050	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:2943517_2943518insCC								AL589675.1 (19107 upstream) : CARM1P1 (48543 downstream)																							TAGTTTTAAAAACTGGTTTACT	0.455																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.2943517_2943518insCC				RNA	INS	-	NULL		37	NULL		9																																																																																			CARM1P1	-	-	ENSG00000227835	0	0.455					CARM1P1	HGNC				0.00	24	0	-			2943518	-1	tier1		no_errors	ENST00000492533	ensembl	human	known	74_37	rna	52.63	9	10	INS	0.066:0.065	CC
CARM1P1	100130873	genome.wustl.edu	37	9	2943517	2943518	+	IGR	INS	-	-	CC	rs34443524|rs200969035|rs199975050	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:2943517_2943518insCC								AL589675.1 (19107 upstream) : CARM1P1 (48543 downstream)																							TAGTTTTAAAAACTGGTTTACT	0.455																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.2943517_2943518insCC				RNA	INS	-	NULL		37	NULL		9																																																																																			CARM1P1	-	-	ENSG00000227835	0	0.455					CARM1P1	HGNC				0.00	30	0	-			2943518	-1	tier1		no_errors	ENST00000492533	ensembl	human	known	74_37	rna	52.63	9	10	INS	0.066:0.065	CC
CCDC60	160777	genome.wustl.edu	37	12	119968722	119968722	+	Missense_Mutation	SNP	T	T	C	rs369830128		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:119968722T>C	ENST00000327554.2	+	13	1870	c.1405T>C	c.(1405-1407)Ttc>Ctc	p.F469L	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	469										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TCTAAAGAACTTCCGCCCCGC	0.493																																																	0								T	LEU/PHE	0,4406		0,0,2203	93.0	91.0	91.0		1405	5.8	1.0	12		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC60	NM_178499.3	22	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	469/551	119968722	1,13005	2203	4300	6503	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1405T>C	12.37:g.119968722T>C	ENSP00000333374:p.Phe469Leu			Missense_Mutation	SNP	NULL	p.F469L	ENST00000327554.2	37	c.1405	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297400	0.60086	0.0	1.16E-4	ENSG00000183273	ENST00000327554	T	0.22336	1.96	5.82	5.82	0.92795	.	0.377447	0.24925	N	0.034512	T	0.23451	0.0567	M	0.63428	1.95	0.80722	D	1	P	0.45531	0.86	B	0.41271	0.352	T	0.02391	-1.1166	9	.	.	.	-25.1641	10.2384	0.43297	0.0:0.0:0.1662:0.8338	.	469	Q8IWA6	CCD60_HUMAN	L	469	ENSP00000333374:F469L	.	F	+	1	0	CCDC60	118453105	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.148000	0.42235	2.220000	0.72140	0.533000	0.62120	TTC	CCDC60	-	NULL	ENSG00000183273		0.493	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	-	0.00	48	0	T	NM_178499		119968722	+1	tier1	-	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	58.97	16	23	SNP	0.993	C
CCDC60	160777	genome.wustl.edu	37	12	119968722	119968722	+	Missense_Mutation	SNP	T	T	C	rs369830128		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:119968722T>C	ENST00000327554.2	+	13	1870	c.1405T>C	c.(1405-1407)Ttc>Ctc	p.F469L	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	469										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TCTAAAGAACTTCCGCCCCGC	0.493																																																	0								T	LEU/PHE	0,4406		0,0,2203	93.0	91.0	91.0		1405	5.8	1.0	12		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC60	NM_178499.3	22	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	possibly-damaging	469/551	119968722	1,13005	2203	4300	6503	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1405T>C	12.37:g.119968722T>C	ENSP00000333374:p.Phe469Leu			Missense_Mutation	SNP	NULL	p.F469L	ENST00000327554.2	37	c.1405	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	T	17.08	3.297400	0.60086	0.0	1.16E-4	ENSG00000183273	ENST00000327554	T	0.22336	1.96	5.82	5.82	0.92795	.	0.377447	0.24925	N	0.034512	T	0.23451	0.0567	M	0.63428	1.95	0.80722	D	1	P	0.45531	0.86	B	0.41271	0.352	T	0.02391	-1.1166	9	.	.	.	-25.1641	10.2384	0.43297	0.0:0.0:0.1662:0.8338	.	469	Q8IWA6	CCD60_HUMAN	L	469	ENSP00000333374:F469L	.	F	+	1	0	CCDC60	118453105	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.148000	0.42235	2.220000	0.72140	0.533000	0.62120	TTC	CCDC60	-	NULL	ENSG00000183273		0.493	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	-	0.00	55	0	T	NM_178499		119968722	+1	tier1	-	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	58.97	16	23	SNP	0.993	C
CCKBR	887	genome.wustl.edu	37	11	6291950	6291950	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:6291950G>A	ENST00000334619.2	+	4	921	c.728G>A	c.(727-729)cGc>cAc	p.R243H	CCKBR_ENST00000525462.1_Missense_Mutation_p.R243H|CCKBR_ENST00000532715.1_Missense_Mutation_p.R159H	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	243					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CTTATCTCTCGCGAGCTCTAC	0.592																																																	0													157.0	115.0	129.0					11																	6291950		2201	4296	6497	SO:0001583	missense	0			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.728G>A	11.37:g.6291950G>A	ENSP00000335544:p.Arg243His		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R243H	ENST00000334619.2	37	c.728	CCDS7761.1	11	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742066	0.89573	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.39592	1.07;1.07;1.07	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	M	0.74881	2.28	0.80722	D	1	P;D;D	0.60575	0.632;0.988;0.979	B;B;P	0.52514	0.147;0.445;0.701	T	0.53358	-0.8450	10	0.30078	T	0.28	.	18.5901	0.91208	0.0:0.0:1.0:0.0	.	243;177;243	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	H	243;159;243	ENSP00000335544:R243H;ENSP00000432079:R159H;ENSP00000435534:R243H	ENSP00000335544:R243H	R	+	2	0	CCKBR	6248526	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	6.621000	0.74228	2.735000	0.93741	0.655000	0.94253	CGC	CCKBR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt	ENSG00000110148		0.592	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	HGNC	protein_coding	OTTHUMT00000257230.2	-	0.00	43	0	G	NM_176875		6291950	+1	tier1	-	no_errors	ENST00000525462	ensembl	human	known	74_37	missense	47.50	21	19	SNP	1.000	A
CCKBR	887	genome.wustl.edu	37	11	6291950	6291950	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:6291950G>A	ENST00000334619.2	+	4	921	c.728G>A	c.(727-729)cGc>cAc	p.R243H	CCKBR_ENST00000525462.1_Missense_Mutation_p.R243H|CCKBR_ENST00000532715.1_Missense_Mutation_p.R159H	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor	243					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	CTTATCTCTCGCGAGCTCTAC	0.592																																																	0													157.0	115.0	129.0					11																	6291950		2201	4296	6497	SO:0001583	missense	0			D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.728G>A	11.37:g.6291950G>A	ENSP00000335544:p.Arg243His		A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R243H	ENST00000334619.2	37	c.728	CCDS7761.1	11	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742066	0.89573	.	.	ENSG00000110148	ENST00000334619;ENST00000532715;ENST00000525462	T;T;T	0.39592	1.07;1.07;1.07	5.79	5.79	0.91817	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	M	0.74881	2.28	0.80722	D	1	P;D;D	0.60575	0.632;0.988;0.979	B;B;P	0.52514	0.147;0.445;0.701	T	0.53358	-0.8450	10	0.30078	T	0.28	.	18.5901	0.91208	0.0:0.0:1.0:0.0	.	243;177;243	P32239-2;P32239-3;P32239	.;.;GASR_HUMAN	H	243;159;243	ENSP00000335544:R243H;ENSP00000432079:R159H;ENSP00000435534:R243H	ENSP00000335544:R243H	R	+	2	0	CCKBR	6248526	1.000000	0.71417	0.991000	0.47740	0.993000	0.82548	6.621000	0.74228	2.735000	0.93741	0.655000	0.94253	CGC	CCKBR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt	ENSG00000110148		0.592	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	HGNC	protein_coding	OTTHUMT00000257230.2	-	0.00	52	0	G	NM_176875		6291950	+1	tier1	-	no_errors	ENST00000525462	ensembl	human	known	74_37	missense	47.50	21	19	SNP	1.000	A
CCT8L2	150160	genome.wustl.edu	37	22	17072055	17072055	+	Silent	SNP	G	G	A	rs370876356		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:17072055G>A	ENST00000359963.3	-	1	1645	c.1386C>T	c.(1384-1386)gaC>gaT	p.D462D		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	462					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTGCCATCACGTCTGAGACAG	0.527																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	125.0	128.0	127.0		1386	-4.0	0.0	22		127	0,8600		0,0,4300	no	coding-synonymous	CCT8L2	NM_014406.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		462/558	17072055	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1386C>T	22.37:g.17072055G>A			A4QPH3|Q9UJS3	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.D462	ENST00000359963.3	37	c.1386	CCDS13738.1	22																																																																																			CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000198445		0.527	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	113	0	G			17072055	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	silent	33.66	67	34	SNP	0.009	A
CCT8L2	150160	genome.wustl.edu	37	22	17072055	17072055	+	Silent	SNP	G	G	A	rs370876356		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:17072055G>A	ENST00000359963.3	-	1	1645	c.1386C>T	c.(1384-1386)gaC>gaT	p.D462D		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	462					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				CTGCCATCACGTCTGAGACAG	0.527																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	125.0	128.0	127.0		1386	-4.0	0.0	22		127	0,8600		0,0,4300	no	coding-synonymous	CCT8L2	NM_014406.4		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		462/558	17072055	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1386C>T	22.37:g.17072055G>A			A4QPH3|Q9UJS3	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.D462	ENST00000359963.3	37	c.1386	CCDS13738.1	22																																																																																			CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000198445		0.527	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	-	0.00	96	0	G			17072055	-1	tier1	-	no_errors	ENST00000359963	ensembl	human	known	74_37	silent	33.66	67	34	SNP	0.009	A
CDH12	1010	genome.wustl.edu	37	5	21752212	21752212	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:21752212G>A	ENST00000382254.1	-	15	3105	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F	CDH12_ENST00000521384.1_5'UTR|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Silent_p.F633F|CDH12_ENST00000504376.2_Silent_p.F673F	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	673					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCCCGATGTCGAAAGCCTGGG	0.463										HNSCC(59;0.17)																																							0													122.0	109.0	113.0					5																	21752212		2203	4300	6503	SO:0001819	synonymous_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2019C>T	5.37:g.21752212G>A			B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F673	ENST00000382254.1	37	c.2019	CCDS3890.1	5																																																																																			CDH12	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000154162		0.463	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	121	0	G	NM_004061		21752212	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	silent	13.83	81	13	SNP	0.997	A
CDH12	1010	genome.wustl.edu	37	5	21752212	21752212	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:21752212G>A	ENST00000382254.1	-	15	3105	c.2019C>T	c.(2017-2019)ttC>ttT	p.F673F	CDH12_ENST00000521384.1_5'UTR|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Silent_p.F633F|CDH12_ENST00000504376.2_Silent_p.F673F	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	673					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CCCCGATGTCGAAAGCCTGGG	0.463										HNSCC(59;0.17)																																							0													122.0	109.0	113.0					5																	21752212		2203	4300	6503	SO:0001819	synonymous_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2019C>T	5.37:g.21752212G>A			B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F673	ENST00000382254.1	37	c.2019	CCDS3890.1	5																																																																																			CDH12	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000154162		0.463	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	-	0.00	142	0	G	NM_004061		21752212	-1	tier1	-	no_errors	ENST00000382254	ensembl	human	known	74_37	silent	13.83	81	13	SNP	0.997	A
CDH22	64405	genome.wustl.edu	37	20	44856189	44856189	+	Missense_Mutation	SNP	C	C	T	rs376488565		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:44856189C>T	ENST00000372262.3	-	3	1028	c.628G>A	c.(628-630)Gtg>Atg	p.V210M	CDH22_ENST00000537909.1_Missense_Mutation_p.V210M	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CCGTCCAGCACGCTGTACACC	0.736																																																	0								C	MET/VAL	1,4405		0,1,2202	30.0	25.0	27.0		628	2.1	1.0	20		27	0,8598		0,0,4299	no	missense	CDH22	NM_021248.1	21	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	benign	210/829	44856189	1,13003	2203	4299	6502	SO:0001583	missense	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.628G>A	20.37:g.44856189C>T	ENSP00000361336:p.Val210Met		B9EGK7|O43205	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V210M	ENST00000372262.3	37	c.628	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	C	14.12	2.439398	0.43326	2.27E-4	0.0	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.52295	0.67;0.67	5.14	2.13	0.27403	Cadherin (4);Cadherin-like (1);	0.137362	0.48286	N	0.000185	T	0.33789	0.0875	L	0.33485	1.01	0.34088	D	0.660408	B	0.32350	0.366	B	0.29862	0.108	T	0.45264	-0.9273	10	0.66056	D	0.02	.	9.9393	0.41570	0.0:0.668:0.2607:0.0712	.	210	Q9UJ99	CAD22_HUMAN	M	210	ENSP00000361336:V210M;ENSP00000437790:V210M	ENSP00000361336:V210M	V	-	1	0	CDH22	44289596	0.032000	0.19561	1.000000	0.80357	0.945000	0.59286	0.351000	0.20096	0.325000	0.23359	-1.126000	0.01995	GTG	CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.736	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1		0.00	61	0	C	NM_021248		44856189	-1			no_errors	ENST00000372262	ensembl	human	known	74_37	missense	12.96	47	7	SNP	0.999	T
CFHR1	3078	genome.wustl.edu	37	1	196794651	196794651	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:196794651G>A	ENST00000320493.5	+	2	191	c.103G>A	c.(103-105)Gat>Aat	p.D35N	CFHR1_ENST00000367424.4_Missense_Mutation_p.D35N|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	35	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						AATTCTATATGATGAAGAAAA	0.294																																																	0													36.0	44.0	42.0					1																	196794651		1835	4111	5946	SO:0001583	missense	0			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.103G>A	1.37:g.196794651G>A	ENSP00000314299:p.Asp35Asn		A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.D35N	ENST00000320493.5	37	c.103	CCDS1386.1	1	.	.	.	.	.	.	.	.	.	.	G	9.553	1.116426	0.20795	.	.	ENSG00000244414	ENST00000367424;ENST00000320493	T;T	0.40756	1.02;1.02	4.02	-0.287	0.12858	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.24392	0.0591	L	0.29908	0.895	0.20403	N	0.99991	B	0.26195	0.144	B	0.28553	0.091	T	0.26018	-1.0115	9	0.16420	T	0.52	.	3.4031	0.07331	0.3558:0.2018:0.4424:0.0	.	35	Q03591	FHR1_HUMAN	N	35	ENSP00000356394:D35N;ENSP00000314299:D35N	ENSP00000314299:D35N	D	+	1	0	CFHR1	195061274	0.045000	0.20229	0.783000	0.31826	0.711000	0.40976	0.416000	0.21198	0.368000	0.24481	0.430000	0.28490	GAT	CFHR1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000244414		0.294	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR1	HGNC	protein_coding	OTTHUMT00000088251.2	-	0.00	54	0	G	NM_002113		196794651	+1	tier1	-	no_errors	ENST00000320493	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.212	A
CFHR1	3078	genome.wustl.edu	37	1	196794651	196794651	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:196794651G>A	ENST00000320493.5	+	2	191	c.103G>A	c.(103-105)Gat>Aat	p.D35N	CFHR1_ENST00000367424.4_Missense_Mutation_p.D35N|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	35	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						AATTCTATATGATGAAGAAAA	0.294																																																	0													36.0	44.0	42.0					1																	196794651		1835	4111	5946	SO:0001583	missense	0			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.103G>A	1.37:g.196794651G>A	ENSP00000314299:p.Asp35Asn		A8K465|Q3B774|Q9UJ17	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.D35N	ENST00000320493.5	37	c.103	CCDS1386.1	1	.	.	.	.	.	.	.	.	.	.	G	9.553	1.116426	0.20795	.	.	ENSG00000244414	ENST00000367424;ENST00000320493	T;T	0.40756	1.02;1.02	4.02	-0.287	0.12858	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.24392	0.0591	L	0.29908	0.895	0.20403	N	0.99991	B	0.26195	0.144	B	0.28553	0.091	T	0.26018	-1.0115	9	0.16420	T	0.52	.	3.4031	0.07331	0.3558:0.2018:0.4424:0.0	.	35	Q03591	FHR1_HUMAN	N	35	ENSP00000356394:D35N;ENSP00000314299:D35N	ENSP00000314299:D35N	D	+	1	0	CFHR1	195061274	0.045000	0.20229	0.783000	0.31826	0.711000	0.40976	0.416000	0.21198	0.368000	0.24481	0.430000	0.28490	GAT	CFHR1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000244414		0.294	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR1	HGNC	protein_coding	OTTHUMT00000088251.2	-	0.00	65	0	G	NM_002113		196794651	+1	tier1	-	no_errors	ENST00000320493	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.212	A
CNTNAP2	26047	genome.wustl.edu	37	7	147675017	147675017	+	Silent	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:147675017A>T	ENST00000361727.3	+	15	2835	c.2319A>T	c.(2317-2319)ggA>ggT	p.G773G		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	773	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGGTGGTTGGAGATACTGACC	0.488										HNSCC(39;0.1)																																							0													143.0	126.0	132.0					7																	147675017		2203	4300	6503	SO:0001819	synonymous_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2319A>T	7.37:g.147675017A>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G773	ENST00000361727.3	37	c.2319	CCDS5889.1	7																																																																																			CNTNAP2	-	NULL	ENSG00000174469		0.488	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	57	0	A			147675017	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	silent	57.69	33	45	SNP	0.999	T
CNTNAP2	26047	genome.wustl.edu	37	7	147675017	147675017	+	Silent	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:147675017A>T	ENST00000361727.3	+	15	2835	c.2319A>T	c.(2317-2319)ggA>ggT	p.G773G		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	773	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGGTGGTTGGAGATACTGACC	0.488										HNSCC(39;0.1)																																							0													143.0	126.0	132.0					7																	147675017		2203	4300	6503	SO:0001819	synonymous_variant	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.2319A>T	7.37:g.147675017A>T			D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G773	ENST00000361727.3	37	c.2319	CCDS5889.1	7																																																																																			CNTNAP2	-	NULL	ENSG00000174469		0.488	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	-	0.00	78	0	A			147675017	+1	tier1	-	no_errors	ENST00000361727	ensembl	human	known	74_37	silent	57.69	33	45	SNP	0.999	T
CNTNAP4	85445	genome.wustl.edu	37	16	76482821	76482821	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:76482821A>G	ENST00000476707.1	+	5	1048	c.909A>G	c.(907-909)gaA>gaG	p.E303E	CNTNAP4_ENST00000377504.4_Silent_p.E299E|CNTNAP4_ENST00000307431.8_Silent_p.E299E|CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Silent_p.E275E			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	300	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CACGGGGAGAATTCAATCTCA	0.393																																																	0													109.0	87.0	95.0					16																	76482821		2198	4300	6498	SO:0001819	synonymous_variant	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.909A>G	16.37:g.76482821A>G			E9PFZ6|Q86YZ7	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E299	ENST00000476707.1	37	c.897		16																																																																																			CNTNAP4	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000152910		0.393	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	-	0.00	71	0	A	NM_033401		76482821	+1	tier1	-	no_errors	ENST00000307431	ensembl	human	known	74_37	silent	22.58	48	14	SNP	0.006	G
CNTNAP5	129684	genome.wustl.edu	37	2	124999867	124999867	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:124999867C>T	ENST00000431078.1	+	3	642	c.278C>T	c.(277-279)aCg>aTg	p.T93M		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	93	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.T93M(1)		NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCAGTGGCCACGCAGGGAAGA	0.527																																																	1	Substitution - Missense(1)	large_intestine(1)											69.0	74.0	73.0					2																	124999867		2050	4199	6249	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.278C>T	2.37:g.124999867C>T	ENSP00000399013:p.Thr93Met		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T93M	ENST00000431078.1	37	c.278	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678496	0.88542	.	.	ENSG00000155052	ENST00000431078	D	0.98585	-5.01	5.83	5.83	0.93111	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.52532	D	0.000072	D	0.99468	0.9811	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98221	1.0478	10	0.87932	D	0	.	19.1032	0.93282	0.0:1.0:0.0:0.0	.	93	Q8WYK1	CNTP5_HUMAN	M	93	ENSP00000399013:T93M	ENSP00000399013:T93M	T	+	2	0	CNTNAP5	124716337	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.705000	0.84606	2.761000	0.94854	0.650000	0.86243	ACG	CNTNAP5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000155052		0.527	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	64	0	C			124999867	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	27.78	39	15	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139601386	139601386	+	3'UTR	DEL	A	A	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:139601386delA	ENST00000303045.6	-	0	5437				COL22A1_ENST00000435777.1_3'UTR|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			taaaagaaagaaaaaaaaaag	0.378										HNSCC(7;0.00092)																																							0																																										SO:0001624	3_prime_UTR_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.*110T>-	8.37:g.139601386delA			B7ZMH0|C9K0G4|Q8IVT9	RNA	DEL	-	NULL	ENST00000303045.6	37	NULL	CCDS6376.1	8																																																																																			COL22A1	-	-	ENSG00000169436		0.378	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2		0.00	28	0	A	XM_291257		139601386	-1	tier1		no_errors	ENST00000341807	ensembl	human	known	74_37	rna	17.65	28	6	DEL	0.000	-
COL6A2	1292	genome.wustl.edu	37	21	47546099	47546099	+	Silent	SNP	C	C	T	rs530866573		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:47546099C>T	ENST00000300527.4	+	26	2474	c.2370C>T	c.(2368-2370)tcC>tcT	p.S790S	COL6A2_ENST00000409416.1_Silent_p.S790S|COL6A2_ENST00000357838.4_Silent_p.S790S|COL6A2_ENST00000397763.1_Silent_p.S790S|COL6A2_ENST00000310645.5_Silent_p.S790S	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	790	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CGCTGTTCTCCGACCTGGTCG	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		19006	0.0		0.0	False		,,,				2504	0.001																0													215.0	212.0	213.0					21																	47546099		2202	4300	6502	SO:0001819	synonymous_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2370C>T	21.37:g.47546099C>T			Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S790	ENST00000300527.4	37	c.2370	CCDS13728.1	21																																																																																			COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142173		0.627	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	-	0.00	34	0	C			47546099	+1	tier1	-	no_errors	ENST00000300527	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.879	T
COL6A2	1292	genome.wustl.edu	37	21	47546099	47546099	+	Silent	SNP	C	C	T	rs530866573		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:47546099C>T	ENST00000300527.4	+	26	2474	c.2370C>T	c.(2368-2370)tcC>tcT	p.S790S	COL6A2_ENST00000409416.1_Silent_p.S790S|COL6A2_ENST00000357838.4_Silent_p.S790S|COL6A2_ENST00000397763.1_Silent_p.S790S|COL6A2_ENST00000310645.5_Silent_p.S790S	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	790	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CGCTGTTCTCCGACCTGGTCG	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		19006	0.0		0.0	False		,,,				2504	0.001																0													215.0	212.0	213.0					21																	47546099		2202	4300	6502	SO:0001819	synonymous_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2370C>T	21.37:g.47546099C>T			Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S790	ENST00000300527.4	37	c.2370	CCDS13728.1	21																																																																																			COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142173		0.627	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	-	0.00	45	0	C			47546099	+1	tier1	-	no_errors	ENST00000300527	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.879	T
CRISPLD1	83690	genome.wustl.edu	37	8	75925214	75925214	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:75925214G>T	ENST00000262207.4	+	4	935	c.467G>T	c.(466-468)tGt>tTt	p.C156F	CRISPLD1_ENST00000523524.1_5'UTR|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.V9F	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	156	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AACCCATATTGTCCATTCAGG	0.388																																																	0													113.0	98.0	103.0					8																	75925214		2203	4300	6503	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.467G>T	8.37:g.75925214G>T	ENSP00000262207:p.Cys156Phe		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.C156F	ENST00000262207.4	37	c.467	CCDS6219.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.753952|4.753952	0.89843|0.89843	.|.	.|.	ENSG00000121005|ENSG00000121005	ENST00000262207|ENST00000517786	T|D	0.07688|0.84370	3.17|-1.84	5.37|5.37	5.37|5.37	0.77165|0.77165	CAP domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87661|0.87661	0.6233|0.6233	M|M	0.82323|0.82323	2.585|2.585	0.28104|0.28104	N|N	0.931295|0.931295	D|B	0.89917|0.21606	1.0|0.058	D|B	0.91635|0.23419	0.999|0.046	T|T	0.78800|0.78800	-0.2062|-0.2062	10|8	0.87932|.	D|.	0|.	.|.	19.2974|19.2974	0.94128|0.94128	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	156|9	Q9H336|B7Z929	CRLD1_HUMAN|.	F|F	156|9	ENSP00000262207:C156F|ENSP00000429746:V9F	ENSP00000262207:C156F|.	C|V	+|+	2|1	0|0	CRISPLD1|CRISPLD1	76087769|76087769	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.969000|0.969000	0.65631|0.65631	9.507000|9.507000	0.97996|0.97996	2.802000|2.802000	0.96397|0.96397	0.650000|0.650000	0.86243|0.86243	TGT|GTC	CRISPLD1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000121005		0.388	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	-	0.00	59	0	G	NM_031461		75925214	+1	tier1	-	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	22.78	60	18	SNP	1.000	T
CRISPLD1	83690	genome.wustl.edu	37	8	75925214	75925214	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:75925214G>T	ENST00000262207.4	+	4	935	c.467G>T	c.(466-468)tGt>tTt	p.C156F	CRISPLD1_ENST00000523524.1_5'UTR|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.V9F	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	156	SCP.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AACCCATATTGTCCATTCAGG	0.388																																																	0													113.0	98.0	103.0					8																	75925214		2203	4300	6503	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.467G>T	8.37:g.75925214G>T	ENSP00000262207:p.Cys156Phe		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.C156F	ENST00000262207.4	37	c.467	CCDS6219.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.753952|4.753952	0.89843|0.89843	.|.	.|.	ENSG00000121005|ENSG00000121005	ENST00000262207|ENST00000517786	T|D	0.07688|0.84370	3.17|-1.84	5.37|5.37	5.37|5.37	0.77165|0.77165	CAP domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87661|0.87661	0.6233|0.6233	M|M	0.82323|0.82323	2.585|2.585	0.28104|0.28104	N|N	0.931295|0.931295	D|B	0.89917|0.21606	1.0|0.058	D|B	0.91635|0.23419	0.999|0.046	T|T	0.78800|0.78800	-0.2062|-0.2062	10|8	0.87932|.	D|.	0|.	.|.	19.2974|19.2974	0.94128|0.94128	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	156|9	Q9H336|B7Z929	CRLD1_HUMAN|.	F|F	156|9	ENSP00000262207:C156F|ENSP00000429746:V9F	ENSP00000262207:C156F|.	C|V	+|+	2|1	0|0	CRISPLD1|CRISPLD1	76087769|76087769	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.969000|0.969000	0.65631|0.65631	9.507000|9.507000	0.97996|0.97996	2.802000|2.802000	0.96397|0.96397	0.650000|0.650000	0.86243|0.86243	TGT|GTC	CRISPLD1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000121005		0.388	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	-	0.00	64	0	G	NM_031461		75925214	+1	tier1	-	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	22.78	60	18	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34401382	34401382	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:34401382A>C	ENST00000373381.4	-	4	867	c.691T>G	c.(691-693)Ttc>Gtc	p.F231V		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	191	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGCAGGGGGAAGTCCCACGTG	0.632																																																	0													58.0	54.0	55.0					1																	34401382		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.691T>G	1.37:g.34401382A>C	ENSP00000362479:p.Phe231Val		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.F231V	ENST00000373381.4	37	c.691		1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.380464	0.61845	.	.	ENSG00000121904	ENST00000373381	T	0.23754	1.89	5.41	5.41	0.78517	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.35828	0.0945	L	0.56396	1.775	0.80722	D	1	B;P	0.52316	0.24;0.952	B;P	0.51945	0.309;0.685	T	0.07654	-1.0761	10	0.17369	T	0.5	.	14.6327	0.68668	1.0:0.0:0.0:0.0	.	191;231	Q7Z408;E7EUA6	CSMD2_HUMAN;.	V	231	ENSP00000362479:F231V	ENSP00000241312:F191V	F	-	1	0	CSMD2	34173969	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.235000	0.95353	2.038000	0.60285	0.460000	0.39030	TTC	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.632	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	38	0	A	NM_052896		34401382	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	50.00	13	13	SNP	1.000	C
CSMD2	114784	genome.wustl.edu	37	1	34401382	34401382	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:34401382A>C	ENST00000373381.4	-	4	867	c.691T>G	c.(691-693)Ttc>Gtc	p.F231V		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	191	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGCAGGGGGAAGTCCCACGTG	0.632																																																	0													58.0	54.0	55.0					1																	34401382		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.691T>G	1.37:g.34401382A>C	ENSP00000362479:p.Phe231Val		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.F231V	ENST00000373381.4	37	c.691		1	.	.	.	.	.	.	.	.	.	.	A	17.40	3.380464	0.61845	.	.	ENSG00000121904	ENST00000373381	T	0.23754	1.89	5.41	5.41	0.78517	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.35828	0.0945	L	0.56396	1.775	0.80722	D	1	B;P	0.52316	0.24;0.952	B;P	0.51945	0.309;0.685	T	0.07654	-1.0761	10	0.17369	T	0.5	.	14.6327	0.68668	1.0:0.0:0.0:0.0	.	191;231	Q7Z408;E7EUA6	CSMD2_HUMAN;.	V	231	ENSP00000362479:F231V	ENSP00000241312:F191V	F	-	1	0	CSMD2	34173969	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.235000	0.95353	2.038000	0.60285	0.460000	0.39030	TTC	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.632	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	44	0	A	NM_052896		34401382	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	50.00	13	13	SNP	1.000	C
CSF3R	1441	genome.wustl.edu	37	1	36932232	36932232	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:36932232G>T	ENST00000373106.1	-	17	2784	c.2237C>A	c.(2236-2238)aCc>aAc	p.T746N	MRPS15_ENST00000373116.5_5'Flank|CSF3R_ENST00000338937.5_Missense_Mutation_p.P715T|CSF3R_ENST00000373103.1_Missense_Mutation_p.T773N|CSF3R_ENST00000440588.2_Missense_Mutation_p.T773N|CSF3R_ENST00000373104.1_Missense_Mutation_p.T746N|CSF3R_ENST00000418048.2_Missense_Mutation_p.T746N|CSF3R_ENST00000361632.4_Missense_Mutation_p.T746N|CSF3R_ENST00000331941.5_Missense_Mutation_p.T746N|CSF3R_ENST00000487540.2_5'UTR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	746					cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CTGATCGCTGGTGCCAGACTG	0.637																																																	0													51.0	54.0	53.0					1																	36932232		2203	4300	6503	SO:0001583	missense	0			M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.2237C>A	1.37:g.36932232G>T	ENSP00000362198:p.Thr746Asn			Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.T773N	ENST00000373106.1	37	c.2318	CCDS413.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.297|3.297	-0.143725|-0.143725	0.06627|0.06627	.|.	.|.	ENSG00000119535|ENSG00000119535	ENST00000464465;ENST00000338937|ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000440588	T|T;T;T;T;T;T;T	0.36699|0.56275	1.24|0.84;0.6;0.47;0.84;0.6;0.84;0.47	5.81|5.81	1.82|1.82	0.25136|0.25136	.|.	.|1.142640	.|0.06449	.|N	.|0.727458	T|T	0.37265|0.37265	0.0997|0.0997	L|L	0.31294|0.31294	0.92|0.92	0.09310|0.09310	N|N	1|1	B|B;B;B;B	0.21381|0.17667	0.055|0.006;0.01;0.006;0.023	B|B;B;B;B	0.19148|0.18871	0.024|0.005;0.01;0.005;0.023	T|T	0.29640|0.29640	-1.0005|-1.0005	9|10	0.36615|0.40728	T|T	0.2|0.16	-11.3124|-11.3124	1.6579|1.6579	0.02785|0.02785	0.1564:0.1425:0.4067:0.2944|0.1564:0.1425:0.4067:0.2944	.|.	715|746;773;746;746	E1B6W6|Q1ZYL6;Q99062-3;Q99062;Q99062-4	.|.;.;CSF3R_HUMAN;.	T|N	298;715|746;746;773;746;746;746;773	ENSP00000345013:P715T|ENSP00000362198:T746N;ENSP00000362196:T746N;ENSP00000362195:T773N;ENSP00000355406:T746N;ENSP00000332180:T746N;ENSP00000401588:T746N;ENSP00000397568:T773N	ENSP00000345013:P715T|ENSP00000332180:T746N	P|T	-|-	1|2	0|0	CSF3R|CSF3R	36704819|36704819	0.446000|0.446000	0.25665|0.25665	0.439000|0.439000	0.26833|0.26833	0.029000|0.029000	0.11900|0.11900	1.104000|1.104000	0.31074|0.31074	0.355000|0.355000	0.24131|0.24131	0.655000|0.655000	0.94253|0.94253	CCA|ACC	CSF3R	-	NULL	ENSG00000119535		0.637	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF3R	HGNC	protein_coding	OTTHUMT00000021997.2		0.00	48	0	G	NM_156039		36932232	-1			no_errors	ENST00000373103	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.139	T
CSRNP1	64651	genome.wustl.edu	37	3	39187974	39187974	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:39187974A>C	ENST00000273153.5	-	2	377	c.200T>G	c.(199-201)tTc>tGc	p.F67C	CSRNP1_ENST00000514182.1_Missense_Mutation_p.F67C	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	67					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CTCACGGGTGAAACTTCTGGG	0.582																																																	0													27.0	29.0	28.0					3																	39187974		2024	3881	5905	SO:0001583	missense	0			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.200T>G	3.37:g.39187974A>C	ENSP00000273153:p.Phe67Cys		Q69YY5	Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.F67C	ENST00000273153.5	37	c.200	CCDS2682.1	3	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374810	0.42105	.	.	ENSG00000144655	ENST00000273153;ENST00000514182	T;T	0.42131	0.98;0.98	3.78	1.29	0.21616	.	0.369881	0.27210	N	0.020416	T	0.52757	0.1754	M	0.71581	2.175	0.44852	D	0.997866	D	0.61697	0.99	P	0.58873	0.847	T	0.51244	-0.8730	10	0.72032	D	0.01	-9.0918	7.4585	0.27280	0.804:0.0:0.196:0.0	.	67	Q96S65	CSRN1_HUMAN	C	67	ENSP00000273153:F67C;ENSP00000422532:F67C	ENSP00000273153:F67C	F	-	2	0	CSRNP1	39162978	0.985000	0.35326	0.154000	0.22540	0.438000	0.31896	2.903000	0.48711	0.132000	0.18615	0.402000	0.26972	TTC	CSRNP1	-	NULL	ENSG00000144655		0.582	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP1	HGNC	protein_coding	OTTHUMT00000254061.1	-	0.00	39	0	A	NM_033027		39187974	-1	tier1	-	no_errors	ENST00000273153	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.748	C
CSRNP1	64651	genome.wustl.edu	37	3	39187974	39187974	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:39187974A>C	ENST00000273153.5	-	2	377	c.200T>G	c.(199-201)tTc>tGc	p.F67C	CSRNP1_ENST00000514182.1_Missense_Mutation_p.F67C	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	67					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CTCACGGGTGAAACTTCTGGG	0.582																																																	0													27.0	29.0	28.0					3																	39187974		2024	3881	5905	SO:0001583	missense	0			AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.200T>G	3.37:g.39187974A>C	ENSP00000273153:p.Phe67Cys		Q69YY5	Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.F67C	ENST00000273153.5	37	c.200	CCDS2682.1	3	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374810	0.42105	.	.	ENSG00000144655	ENST00000273153;ENST00000514182	T;T	0.42131	0.98;0.98	3.78	1.29	0.21616	.	0.369881	0.27210	N	0.020416	T	0.52757	0.1754	M	0.71581	2.175	0.44852	D	0.997866	D	0.61697	0.99	P	0.58873	0.847	T	0.51244	-0.8730	10	0.72032	D	0.01	-9.0918	7.4585	0.27280	0.804:0.0:0.196:0.0	.	67	Q96S65	CSRN1_HUMAN	C	67	ENSP00000273153:F67C;ENSP00000422532:F67C	ENSP00000273153:F67C	F	-	2	0	CSRNP1	39162978	0.985000	0.35326	0.154000	0.22540	0.438000	0.31896	2.903000	0.48711	0.132000	0.18615	0.402000	0.26972	TTC	CSRNP1	-	NULL	ENSG00000144655		0.582	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP1	HGNC	protein_coding	OTTHUMT00000254061.1	-	0.00	44	0	A	NM_033027		39187974	-1	tier1	-	no_errors	ENST00000273153	ensembl	human	known	74_37	missense	45.83	13	11	SNP	0.748	C
CUEDC2	79004	genome.wustl.edu	37	10	104183745	104183745	+	Intron	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:104183745A>G	ENST00000369937.4	-	6	740				PSD_ENST00000492902.2_5'Flank|CUEDC2_ENST00000465409.1_5'UTR	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2							cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGTGCTGGGAAAAGATACCTG	0.587																																																	0													28.0	31.0	30.0					10																	104183745		1909	4124	6033	SO:0001627	intron_variant	0			BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.594+7T>C	10.37:g.104183745A>G			D3DR88|Q9BWG8	RNA	SNP	-	NULL	ENST00000369937.4	37	NULL	CCDS41566.1	10																																																																																			CUEDC2	-	-	ENSG00000107874		0.587	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC2	HGNC	protein_coding	OTTHUMT00000050060.1	-	0.00	100	0	A	NM_024040		104183745	-1	tier1	-	no_errors	ENST00000465409	ensembl	human	known	74_37	rna	41.94	36	26	SNP	0.002	G
CUEDC2	79004	genome.wustl.edu	37	10	104183745	104183745	+	Intron	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:104183745A>G	ENST00000369937.4	-	6	740				PSD_ENST00000492902.2_5'Flank|CUEDC2_ENST00000465409.1_5'UTR	NM_024040.2	NP_076945.2	Q9H467	CUED2_HUMAN	CUE domain containing 2							cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(1)|stomach(1)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.122)		Epithelial(162;9.17e-09)|all cancers(201;2.16e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GGTGCTGGGAAAAGATACCTG	0.587																																																	0													28.0	31.0	30.0					10																	104183745		1909	4124	6033	SO:0001627	intron_variant	0			BC000262	CCDS41566.1	10q24.32	2008-10-23	2004-03-04	2004-03-05	ENSG00000107874	ENSG00000107874			28352	protein-coding gene	gene with protein product		614142	"""chromosome 10 open reading frame 66"""	C10orf66		12477932	Standard	NM_024040		Approved	MGC2491	uc001kvn.2	Q9H467	OTTHUMG00000018958	ENST00000369937.4:c.594+7T>C	10.37:g.104183745A>G			D3DR88|Q9BWG8	RNA	SNP	-	NULL	ENST00000369937.4	37	NULL	CCDS41566.1	10																																																																																			CUEDC2	-	-	ENSG00000107874		0.587	CUEDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC2	HGNC	protein_coding	OTTHUMT00000050060.1	-	0.00	86	0	A	NM_024040		104183745	-1	tier1	-	no_errors	ENST00000465409	ensembl	human	known	74_37	rna	41.94	36	26	SNP	0.002	G
CXCR5	643	genome.wustl.edu	37	11	118764738	118764738	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:118764738G>A	ENST00000292174.4	+	2	661	c.485G>A	c.(484-486)cGc>cAc	p.R162H	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	162					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		CGCCACCGCCGCCTCCTCTCC	0.612																																																	0													59.0	50.0	53.0					11																	118764738		2200	4295	6495	SO:0001583	missense	0			X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.485G>A	11.37:g.118764738G>A	ENSP00000292174:p.Arg162His		Q14811	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR5,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR4,prints_ATII_rcpt	p.R162H	ENST00000292174.4	37	c.485	CCDS8402.1	11	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434624	0.83885	.	.	ENSG00000160683	ENST00000292174	T	0.38240	1.15	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.063724	0.64402	D	0.000006	T	0.61388	0.2343	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.66077	-0.6013	10	0.44086	T	0.13	.	16.1885	0.81971	0.0:0.0:1.0:0.0	.	162	P32302	CXCR5_HUMAN	H	162	ENSP00000292174:R162H	ENSP00000292174:R162H	R	+	2	0	CXCR5	118269948	0.925000	0.31364	1.000000	0.80357	0.822000	0.46500	4.503000	0.60407	2.029000	0.59856	0.313000	0.20887	CGC	CXCR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR5	ENSG00000160683		0.612	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR5	HGNC	protein_coding	OTTHUMT00000389309.1	-	0.00	32	0	G	NM_001716		118764738	+1	tier1	-	no_errors	ENST00000292174	ensembl	human	known	74_37	missense	62.50	9	15	SNP	1.000	A
CXCR5	643	genome.wustl.edu	37	11	118764738	118764738	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:118764738G>A	ENST00000292174.4	+	2	661	c.485G>A	c.(484-486)cGc>cAc	p.R162H	BCL9L_ENST00000334801.3_3'UTR	NM_001716.4|NM_032966.2	NP_001707.1|NP_116743.1	P32302	CXCR5_HUMAN	chemokine (C-X-C motif) receptor 5	162					B cell activation (GO:0042113)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|lymph node development (GO:0048535)|positive regulation of cytokinesis (GO:0032467)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine receptor activity (GO:0016494)|G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.62e-05)		CGCCACCGCCGCCTCCTCTCC	0.612																																																	0													59.0	50.0	53.0					11																	118764738		2200	4295	6495	SO:0001583	missense	0			X68829	CCDS8402.1	11q23.3	2012-08-08	2008-01-22	2008-01-22	ENSG00000160683	ENSG00000160683		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	1060	protein-coding gene	gene with protein product		601613	"""Burkitt lymphoma receptor 1, GTP-binding protein"", ""Burkitt lymphoma receptor 1, GTP binding protein (chemokine (C-X-C motif) receptor 5)"""	BLR1		1425907	Standard	NM_001716		Approved	MDR15, CD185	uc001pue.4	P32302	OTTHUMG00000166345	ENST00000292174.4:c.485G>A	11.37:g.118764738G>A	ENSP00000292174:p.Arg162His		Q14811	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR5,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR4,prints_ATII_rcpt	p.R162H	ENST00000292174.4	37	c.485	CCDS8402.1	11	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434624	0.83885	.	.	ENSG00000160683	ENST00000292174	T	0.38240	1.15	3.96	3.96	0.45880	GPCR, rhodopsin-like superfamily (1);	0.063724	0.64402	D	0.000006	T	0.61388	0.2343	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.66077	-0.6013	10	0.44086	T	0.13	.	16.1885	0.81971	0.0:0.0:1.0:0.0	.	162	P32302	CXCR5_HUMAN	H	162	ENSP00000292174:R162H	ENSP00000292174:R162H	R	+	2	0	CXCR5	118269948	0.925000	0.31364	1.000000	0.80357	0.822000	0.46500	4.503000	0.60407	2.029000	0.59856	0.313000	0.20887	CGC	CXCR5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR5	ENSG00000160683		0.612	CXCR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR5	HGNC	protein_coding	OTTHUMT00000389309.1	-	0.00	48	0	G	NM_001716		118764738	+1	tier1	-	no_errors	ENST00000292174	ensembl	human	known	74_37	missense	62.50	9	15	SNP	1.000	A
CYFIP1	23191	genome.wustl.edu	37	15	22980149	22980149	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:22980149G>T	ENST00000313077.7	+	23	2772	c.2647G>T	c.(2647-2649)Gca>Tca	p.A883S	CYFIP1_ENST00000435939.2_Missense_Mutation_p.A452S|CYFIP1_ENST00000560848.1_Missense_Mutation_p.A883S	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCAGCCTAATGCACAGCCTCA	0.363																																																	0													131.0	113.0	119.0					15																	22980149		2203	4300	6503	SO:0001583	missense	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2647G>T	15.37:g.22980149G>T	ENSP00000324549:p.Ala883Ser			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.A883S	ENST00000313077.7	37	c.2647	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733605	0.69189	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.21932	1.98;1.98	5.07	5.07	0.68467	.	0.096778	0.45361	N	0.000375	T	0.31136	0.0787	L	0.52126	1.63	0.80722	D	1	P;B;B	0.40578	0.722;0.029;0.013	P;B;B	0.47744	0.556;0.216;0.07	T	0.01238	-1.1409	10	0.27082	T	0.32	-7.0588	18.4175	0.90575	0.0:0.0:1.0:0.0	.	911;452;883	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	S	883;911;452	ENSP00000324549:A883S;ENSP00000405956:A452S	ENSP00000324549:A883S	A	+	1	0	CYFIP1	20531590	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	9.245000	0.95431	2.499000	0.84300	0.585000	0.79938	GCA	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.363	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	-	0.00	39	0	G	NM_014608		22980149	+1	tier1	-	no_errors	ENST00000313077	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
CYFIP1	23191	genome.wustl.edu	37	15	22980149	22980149	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:22980149G>T	ENST00000313077.7	+	23	2772	c.2647G>T	c.(2647-2649)Gca>Tca	p.A883S	CYFIP1_ENST00000435939.2_Missense_Mutation_p.A452S|CYFIP1_ENST00000560848.1_Missense_Mutation_p.A883S	NM_014608.2	NP_055423.1			cytoplasmic FMR1 interacting protein 1											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(1)|lung(14)|ovary(4)|pancreas(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	40		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.22e-06)|Epithelial(43;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00101)		GCAGCCTAATGCACAGCCTCA	0.363																																																	0													131.0	113.0	119.0					15																	22980149		2203	4300	6503	SO:0001583	missense	0			D38549	CCDS73695.1, CCDS73696.1	15q11	2008-07-18			ENSG00000068793	ENSG00000273749			13759	protein-coding gene	gene with protein product	"""selective hybridizing clone"", ""cytoplasmic FMRP interacting protein 1"""	606322				11438699	Standard	XM_005272543		Approved	KIAA0068, P140SRA-1, SHYC	uc001yus.3	Q7L576	OTTHUMG00000129100	ENST00000313077.7:c.2647G>T	15.37:g.22980149G>T	ENSP00000324549:p.Ala883Ser			Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.A883S	ENST00000313077.7	37	c.2647	CCDS10009.1	15	.	.	.	.	.	.	.	.	.	.	G	18.96	3.733605	0.69189	.	.	ENSG00000068793	ENST00000313077;ENST00000412127;ENST00000435939	T;T	0.21932	1.98;1.98	5.07	5.07	0.68467	.	0.096778	0.45361	N	0.000375	T	0.31136	0.0787	L	0.52126	1.63	0.80722	D	1	P;B;B	0.40578	0.722;0.029;0.013	P;B;B	0.47744	0.556;0.216;0.07	T	0.01238	-1.1409	10	0.27082	T	0.32	-7.0588	18.4175	0.90575	0.0:0.0:1.0:0.0	.	911;452;883	E7EQ04;Q7L576-2;Q7L576	.;.;CYFP1_HUMAN	S	883;911;452	ENSP00000324549:A883S;ENSP00000405956:A452S	ENSP00000324549:A883S	A	+	1	0	CYFIP1	20531590	1.000000	0.71417	1.000000	0.80357	0.660000	0.38997	9.245000	0.95431	2.499000	0.84300	0.585000	0.79938	GCA	CYFIP1	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000068793		0.363	CYFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYFIP1	HGNC	protein_coding	OTTHUMT00000251136.2	-	0.00	58	0	G	NM_014608		22980149	+1	tier1	-	no_errors	ENST00000313077	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
DACH2	117154	genome.wustl.edu	37	X	85969601	85969601	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:85969601T>G	ENST00000373125.4	+	6	982	c.982T>G	c.(982-984)Tta>Gta	p.L328V	DACH2_ENST00000508860.1_Missense_Mutation_p.L161V|DACH2_ENST00000373131.1_Missense_Mutation_p.L315V|DACH2_ENST00000510272.1_Missense_Mutation_p.L109V	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	328					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TCCAGTCAGCTTACCTCCTGC	0.428																																																	0													194.0	158.0	170.0					X																	85969601		2203	4300	6503	SO:0001583	missense	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.982T>G	X.37:g.85969601T>G	ENSP00000362217:p.Leu328Val		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.L328V	ENST00000373125.4	37	c.982	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436940	0.62955	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.87887	-2.29;-2.31	5.02	2.64	0.31445	.	0.000000	0.48767	D	0.000163	D	0.89483	0.6728	M	0.64404	1.975	0.44104	D	0.996877	D;D;D;D	0.76494	0.989;0.986;0.999;0.998	P;P;D;D	0.87578	0.786;0.795;0.998;0.978	D	0.85249	0.1043	10	0.28530	T	0.3	.	5.4695	0.16662	0.0:0.4834:0.0:0.5166	.	194;328;315;328	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	V	328;315;328;161;109;161	ENSP00000362223:L315V;ENSP00000362217:L328V	ENSP00000345134:L328V	L	+	1	2	DACH2	85856257	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.109000	0.57824	0.592000	0.29728	0.417000	0.27973	TTA	DACH2	-	NULL	ENSG00000126733		0.428	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	17	0	T	NM_053281		85969601	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	71.43	6	15	SNP	1.000	G
DACH2	117154	genome.wustl.edu	37	X	85969601	85969601	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:85969601T>G	ENST00000373125.4	+	6	982	c.982T>G	c.(982-984)Tta>Gta	p.L328V	DACH2_ENST00000508860.1_Missense_Mutation_p.L161V|DACH2_ENST00000373131.1_Missense_Mutation_p.L315V|DACH2_ENST00000510272.1_Missense_Mutation_p.L109V	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	328					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TCCAGTCAGCTTACCTCCTGC	0.428																																																	0													194.0	158.0	170.0					X																	85969601		2203	4300	6503	SO:0001583	missense	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.982T>G	X.37:g.85969601T>G	ENSP00000362217:p.Leu328Val		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.L328V	ENST00000373125.4	37	c.982	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436940	0.62955	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.87887	-2.29;-2.31	5.02	2.64	0.31445	.	0.000000	0.48767	D	0.000163	D	0.89483	0.6728	M	0.64404	1.975	0.44104	D	0.996877	D;D;D;D	0.76494	0.989;0.986;0.999;0.998	P;P;D;D	0.87578	0.786;0.795;0.998;0.978	D	0.85249	0.1043	10	0.28530	T	0.3	.	5.4695	0.16662	0.0:0.4834:0.0:0.5166	.	194;328;315;328	Q1RMF5;A8K3I1;Q96NX9-2;Q96NX9	.;.;.;DACH2_HUMAN	V	328;315;328;161;109;161	ENSP00000362223:L315V;ENSP00000362217:L328V	ENSP00000345134:L328V	L	+	1	2	DACH2	85856257	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.109000	0.57824	0.592000	0.29728	0.417000	0.27973	TTA	DACH2	-	NULL	ENSG00000126733		0.428	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	23	0	T	NM_053281		85969601	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	71.43	6	15	SNP	1.000	G
ACKR1	2532	genome.wustl.edu	37	1	159176205	159176205	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:159176205T>C	ENST00000368122.2	+	2	1655	c.976T>C	c.(976-978)Tct>Cct	p.S326P	DARC_ENST00000368121.2_Missense_Mutation_p.S328P|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Missense_Mutation_p.S326P	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		326			S -> F (in dbSNP:rs17851570). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.6}.		chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					TGAAGGATGGTCTTCTCATCT	0.547																																																	0													215.0	233.0	227.0					1																	159176205		2203	4300	6503	SO:0001583	missense	0																														ENST00000368122.2:c.976T>C	1.37:g.159176205T>C	ENSP00000357104:p.Ser326Pro		A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	prints_Duffy_chemokine_rcpt	p.S328P	ENST00000368122.2	37	c.982	CCDS1183.1	1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652623	0.47362	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.02552	4.26;4.26;4.25	4.89	-4.54	0.03452	.	.	.	.	.	T	0.01189	0.0039	N	0.17474	0.49	0.09310	N	1	D;D	0.65815	0.995;0.995	D;D	0.64687	0.928;0.928	T	0.39418	-0.9615	9	0.38643	T	0.18	-11.1036	0.226	0.00174	0.249:0.1814:0.2681:0.3015	.	328;326	Q5Y7A1;Q16570	.;DUFFY_HUMAN	P	326;326;326;328	ENSP00000357104:S326P;ENSP00000441985:S326P;ENSP00000357103:S328P	ENSP00000352341:S326P	S	+	1	0	DARC	157442829	0.009000	0.17119	0.002000	0.10522	0.759000	0.43091	-0.310000	0.08135	-0.722000	0.04922	0.482000	0.46254	TCT	DARC	-	NULL	ENSG00000213088		0.547	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	HGNC	protein_coding	OTTHUMT00000090338.2	-	0.00	120	0	T			159176205	+1	tier1	-	no_errors	ENST00000368121	ensembl	human	known	74_37	missense	38.98	36	23	SNP	0.000	C
ACKR1	2532	genome.wustl.edu	37	1	159176205	159176205	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:159176205T>C	ENST00000368122.2	+	2	1655	c.976T>C	c.(976-978)Tct>Cct	p.S326P	DARC_ENST00000368121.2_Missense_Mutation_p.S328P|CTA-134P22.2_ENST00000609696.1_RNA|DARC_ENST00000537147.1_Missense_Mutation_p.S326P	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		326			S -> F (in dbSNP:rs17851570). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.6}.		chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					TGAAGGATGGTCTTCTCATCT	0.547																																																	0													215.0	233.0	227.0					1																	159176205		2203	4300	6503	SO:0001583	missense	0																														ENST00000368122.2:c.976T>C	1.37:g.159176205T>C	ENSP00000357104:p.Ser326Pro		A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Missense_Mutation	SNP	prints_Duffy_chemokine_rcpt	p.S328P	ENST00000368122.2	37	c.982	CCDS1183.1	1	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652623	0.47362	.	.	ENSG00000213088	ENST00000368122;ENST00000537147;ENST00000359381;ENST00000368121	T;T;T	0.02552	4.26;4.26;4.25	4.89	-4.54	0.03452	.	.	.	.	.	T	0.01189	0.0039	N	0.17474	0.49	0.09310	N	1	D;D	0.65815	0.995;0.995	D;D	0.64687	0.928;0.928	T	0.39418	-0.9615	9	0.38643	T	0.18	-11.1036	0.226	0.00174	0.249:0.1814:0.2681:0.3015	.	328;326	Q5Y7A1;Q16570	.;DUFFY_HUMAN	P	326;326;326;328	ENSP00000357104:S326P;ENSP00000441985:S326P;ENSP00000357103:S328P	ENSP00000352341:S326P	S	+	1	0	DARC	157442829	0.009000	0.17119	0.002000	0.10522	0.759000	0.43091	-0.310000	0.08135	-0.722000	0.04922	0.482000	0.46254	TCT	DARC	-	NULL	ENSG00000213088		0.547	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	HGNC	protein_coding	OTTHUMT00000090338.2	-	0.00	128	0	T			159176205	+1	tier1	-	no_errors	ENST00000368121	ensembl	human	known	74_37	missense	38.98	36	23	SNP	0.000	C
DCAF12L2	340578	genome.wustl.edu	37	X	125298766	125298766	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:125298766T>G	ENST00000360028.2	-	1	1168	c.1142A>C	c.(1141-1143)aAg>aCg	p.K381T	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.K381T			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	381										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CTCCAGGAACTTCTGGGCGCG	0.632																																																	0													67.0	71.0	69.0					X																	125298766		2197	4298	6495	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1142A>C	X.37:g.125298766T>G	ENSP00000353128:p.Lys381Thr		B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K381T	ENST00000360028.2	37	c.1142	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	T	15.94	2.982111	0.53827	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.64991	-0.13;-0.13	4.14	1.7	0.24286	WD40/YVTN repeat-like-containing domain (1);	0.202238	0.24833	N	0.035222	T	0.61362	0.2341	M	0.75777	2.31	0.34869	D	0.743373	P	0.52577	0.954	P	0.48901	0.594	T	0.65496	-0.6154	10	0.48119	T	0.1	.	3.2351	0.06762	0.0:0.2237:0.2094:0.5669	.	381	Q5VW00	DC122_HUMAN	T	381	ENSP00000441489:K381T;ENSP00000353128:K381T	ENSP00000353128:K381T	K	-	2	0	DCAF12L2	125126447	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.860000	0.48372	0.230000	0.21059	0.486000	0.48141	AAG	DCAF12L2	-	NULL	ENSG00000198354		0.632	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	41	0	T	NM_001013628		125298766	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	missense	63.33	11	19	SNP	1.000	G
DCAF12L2	340578	genome.wustl.edu	37	X	125298766	125298766	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:125298766T>G	ENST00000360028.2	-	1	1168	c.1142A>C	c.(1141-1143)aAg>aCg	p.K381T	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.K381T			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	381										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						CTCCAGGAACTTCTGGGCGCG	0.632																																																	0													67.0	71.0	69.0					X																	125298766		2197	4298	6495	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1142A>C	X.37:g.125298766T>G	ENSP00000353128:p.Lys381Thr		B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K381T	ENST00000360028.2	37	c.1142	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	T	15.94	2.982111	0.53827	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.64991	-0.13;-0.13	4.14	1.7	0.24286	WD40/YVTN repeat-like-containing domain (1);	0.202238	0.24833	N	0.035222	T	0.61362	0.2341	M	0.75777	2.31	0.34869	D	0.743373	P	0.52577	0.954	P	0.48901	0.594	T	0.65496	-0.6154	10	0.48119	T	0.1	.	3.2351	0.06762	0.0:0.2237:0.2094:0.5669	.	381	Q5VW00	DC122_HUMAN	T	381	ENSP00000441489:K381T;ENSP00000353128:K381T	ENSP00000353128:K381T	K	-	2	0	DCAF12L2	125126447	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.860000	0.48372	0.230000	0.21059	0.486000	0.48141	AAG	DCAF12L2	-	NULL	ENSG00000198354		0.632	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	-	0.00	47	0	T	NM_001013628		125298766	-1	tier1	-	no_errors	ENST00000360028	ensembl	human	known	74_37	missense	63.33	11	19	SNP	1.000	G
DCC	1630	genome.wustl.edu	37	18	50451636	50451636	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:50451636A>C	ENST00000442544.2	+	5	1497	c.881A>C	c.(880-882)aAc>aCc	p.N294T	DCC_ENST00000412726.1_Missense_Mutation_p.N142T	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	294	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTGGAAGCAACTTGCTTATC	0.373																																																	0													129.0	128.0	128.0					18																	50451636		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.881A>C	18.37:g.50451636A>C	ENSP00000389140:p.Asn294Thr			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N294T	ENST00000442544.2	37	c.881	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	A	13.44	2.236939	0.39498	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.62232	0.04;0.04	5.76	5.76	0.90799	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	N	0.16098	0.37	0.80722	D	1	B;B	0.31153	0.084;0.31	B;B	0.41619	0.069;0.361	T	0.47861	-0.9084	10	0.11794	T	0.64	.	15.0617	0.71961	1.0:0.0:0.0:0.0	.	142;294	E7EQM8;P43146	.;DCC_HUMAN	T	294;227;142	ENSP00000389140:N294T;ENSP00000397322:N142T	ENSP00000304146:N227T	N	+	2	0	DCC	48705634	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.921000	0.75805	2.200000	0.70718	0.377000	0.23210	AAC	DCC	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000187323		0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	42	0	A	NM_005215		50451636	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	27.78	39	15	SNP	1.000	C
DCC	1630	genome.wustl.edu	37	18	50451636	50451636	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:50451636A>C	ENST00000442544.2	+	5	1497	c.881A>C	c.(880-882)aAc>aCc	p.N294T	DCC_ENST00000412726.1_Missense_Mutation_p.N142T	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	294	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTGGAAGCAACTTGCTTATC	0.373																																																	0													129.0	128.0	128.0					18																	50451636		2203	4300	6503	SO:0001583	missense	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.881A>C	18.37:g.50451636A>C	ENSP00000389140:p.Asn294Thr			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N294T	ENST00000442544.2	37	c.881	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	A	13.44	2.236939	0.39498	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.62232	0.04;0.04	5.76	5.76	0.90799	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	N	0.16098	0.37	0.80722	D	1	B;B	0.31153	0.084;0.31	B;B	0.41619	0.069;0.361	T	0.47861	-0.9084	10	0.11794	T	0.64	.	15.0617	0.71961	1.0:0.0:0.0:0.0	.	142;294	E7EQM8;P43146	.;DCC_HUMAN	T	294;227;142	ENSP00000389140:N294T;ENSP00000397322:N142T	ENSP00000304146:N227T	N	+	2	0	DCC	48705634	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.921000	0.75805	2.200000	0.70718	0.377000	0.23210	AAC	DCC	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000187323		0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	49	0	A	NM_005215		50451636	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	27.78	39	15	SNP	1.000	C
DCHS2	54798	genome.wustl.edu	37	4	155160394	155160394	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:155160394A>C	ENST00000357232.4	-	24	6054	c.6055T>G	c.(6055-6057)Tta>Gta	p.L2019V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2019	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTGCTTTCTAAGTCTGTGGCT	0.378																																																	0													65.0	65.0	65.0					4																	155160394		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6055T>G	4.37:g.155160394A>C	ENSP00000349768:p.Leu2019Val		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L2019V	ENST00000357232.4	37	c.6055	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	A	4.868	0.161256	0.09287	.	.	ENSG00000197410	ENST00000357232	T	0.61627	0.09	5.82	-11.6	0.00059	Cadherin (4);Cadherin-like (1);	1.597620	0.04136	N	0.318827	T	0.36908	0.0984	L	0.41079	1.255	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.10405	-1.0631	10	0.24483	T	0.36	.	3.1431	0.06462	0.0936:0.2843:0.1825:0.4396	.	2019	Q6V1P9	PCD23_HUMAN	V	2019	ENSP00000349768:L2019V	ENSP00000349768:L2019V	L	-	1	2	DCHS2	155379844	0.000000	0.05858	0.001000	0.08648	0.299000	0.27559	-1.053000	0.03500	-3.260000	0.00202	-1.271000	0.01417	TTA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	49	0	A	NM_001142552		155160394	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	40.74	32	22	SNP	0.000	C
DCHS2	54798	genome.wustl.edu	37	4	155160394	155160394	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:155160394A>C	ENST00000357232.4	-	24	6054	c.6055T>G	c.(6055-6057)Tta>Gta	p.L2019V		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2019	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTGCTTTCTAAGTCTGTGGCT	0.378																																																	0													65.0	65.0	65.0					4																	155160394		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6055T>G	4.37:g.155160394A>C	ENSP00000349768:p.Leu2019Val		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L2019V	ENST00000357232.4	37	c.6055	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	A	4.868	0.161256	0.09287	.	.	ENSG00000197410	ENST00000357232	T	0.61627	0.09	5.82	-11.6	0.00059	Cadherin (4);Cadherin-like (1);	1.597620	0.04136	N	0.318827	T	0.36908	0.0984	L	0.41079	1.255	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.10405	-1.0631	10	0.24483	T	0.36	.	3.1431	0.06462	0.0936:0.2843:0.1825:0.4396	.	2019	Q6V1P9	PCD23_HUMAN	V	2019	ENSP00000349768:L2019V	ENSP00000349768:L2019V	L	-	1	2	DCHS2	155379844	0.000000	0.05858	0.001000	0.08648	0.299000	0.27559	-1.053000	0.03500	-3.260000	0.00202	-1.271000	0.01417	TTA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.378	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	76	0	A	NM_001142552		155160394	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	40.74	32	22	SNP	0.000	C
DCHS2	54798	genome.wustl.edu	37	4	155254358	155254358	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:155254358G>T	ENST00000357232.4	-	9	1504	c.1505C>A	c.(1504-1506)gCa>gAa	p.A502E	DCHS2_ENST00000507542.1_5'UTR|DCHS2_ENST00000339452.1_Missense_Mutation_p.A1001E	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	502	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTCCGCACGTGCGAGGTACAA	0.602																																																	0													69.0	64.0	66.0					4																	155254358		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1505C>A	4.37:g.155254358G>T	ENSP00000349768:p.Ala502Glu		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A502E	ENST00000357232.4	37	c.1505	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136260	0.77662	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.52526	0.66;0.66	5.6	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.198922	0.33005	N	0.005383	T	0.66906	0.2837	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69161	-0.5218	10	0.59425	D	0.04	.	12.1397	0.53991	0.1008:0.0:0.8992:0.0	.	1001;502	E9PC11;Q6V1P9	.;PCD23_HUMAN	E	502;1001;1001	ENSP00000349768:A502E;ENSP00000345062:A1001E	ENSP00000345062:A1001E	A	-	2	0	DCHS2	155473808	1.000000	0.71417	0.018000	0.16275	0.618000	0.37518	4.158000	0.58150	1.109000	0.41680	0.563000	0.77884	GCA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.602	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	49	0	G	NM_001142552		155254358	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.998	T
DCHS2	54798	genome.wustl.edu	37	4	155254358	155254358	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:155254358G>T	ENST00000357232.4	-	9	1504	c.1505C>A	c.(1504-1506)gCa>gAa	p.A502E	DCHS2_ENST00000507542.1_5'UTR|DCHS2_ENST00000339452.1_Missense_Mutation_p.A1001E	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	502	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTCCGCACGTGCGAGGTACAA	0.602																																																	0													69.0	64.0	66.0					4																	155254358		2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1505C>A	4.37:g.155254358G>T	ENSP00000349768:p.Ala502Glu		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A502E	ENST00000357232.4	37	c.1505	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136260	0.77662	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.52526	0.66;0.66	5.6	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.198922	0.33005	N	0.005383	T	0.66906	0.2837	M	0.75447	2.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.69161	-0.5218	10	0.59425	D	0.04	.	12.1397	0.53991	0.1008:0.0:0.8992:0.0	.	1001;502	E9PC11;Q6V1P9	.;PCD23_HUMAN	E	502;1001;1001	ENSP00000349768:A502E;ENSP00000345062:A1001E	ENSP00000345062:A1001E	A	-	2	0	DCHS2	155473808	1.000000	0.71417	0.018000	0.16275	0.618000	0.37518	4.158000	0.58150	1.109000	0.41680	0.563000	0.77884	GCA	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.602	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	52	0	G	NM_001142552		155254358	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	9.76	37	4	SNP	0.998	T
DCSTAMP	81501	genome.wustl.edu	37	8	105367289	105367289	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:105367289C>T	ENST00000297581.2	+	3	1263	c.1214C>T	c.(1213-1215)tCa>tTa	p.S405L	DCSTAMP_ENST00000517991.1_Intron|DCSTAMP_ENST00000520080.1_3'UTR|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	405					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											ATCCTGGTGTCAGCATCTTTC	0.443																																																	0													143.0	140.0	141.0					8																	105367289		2203	4300	6503	SO:0001583	missense	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1214C>T	8.37:g.105367289C>T	ENSP00000297581:p.Ser405Leu		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	p.S405L	ENST00000297581.2	37	c.1214	CCDS6301.1	8	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156759	0.38119	.	.	ENSG00000164935	ENST00000297581	T	0.30448	1.53	5.3	3.51	0.40186	Dendritic cell-specific transmembrane protein-like (1);	0.341542	0.32671	N	0.005793	T	0.33904	0.0879	M	0.77820	2.39	0.80722	D	1	P	0.39352	0.669	B	0.38156	0.266	T	0.09840	-1.0656	10	0.34782	T	0.22	-1.7356	10.5324	0.44983	0.0:0.8486:0.0:0.1514	.	405	Q9H295	TM7S4_HUMAN	L	405	ENSP00000297581:S405L	ENSP00000297581:S405L	S	+	2	0	TM7SF4	105436465	0.862000	0.29867	0.484000	0.27391	0.800000	0.45204	1.551000	0.36233	0.730000	0.32425	-0.291000	0.09656	TCA	DCSTAMP	-	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	ENSG00000164935		0.443	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	HGNC	protein_coding	OTTHUMT00000380810.1		0.00	43	0	C	NM_030788		105367289	+1			no_errors	ENST00000297581	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.891	T
DDX4	54514	genome.wustl.edu	37	5	55081694	55081694	+	Missense_Mutation	SNP	A	A	G	rs2305123	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:55081694A>G	ENST00000505374.1	+	13	951	c.859A>G	c.(859-861)Att>Gtt	p.I287V	DDX4_ENST00000354991.5_Missense_Mutation_p.I253V|DDX4_ENST00000353507.5_Missense_Mutation_p.I253V|DDX4_ENST00000511853.1_Missense_Mutation_p.I138V|DDX4_ENST00000514278.2_Missense_Mutation_p.I267V	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	287			I -> V (in dbSNP:rs2305123).		male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				ACCACCAGCAATTCTGGTCAG	0.373													A|||	498	0.0994409	0.0287	0.1167	5008	,	,		19275	0.1617		0.1252	False		,,,				2504	0.092																0								A	VAL/ILE,VAL/ILE,VAL/ILE,VAL/ILE	203,4203	125.3+/-162.5	8,187,2008	82.0	71.0	75.0		757,799,412,859	5.0	1.0	5	dbSNP_100	75	1025,7575	219.7+/-257.6	57,911,3332	yes	missense,missense,missense,missense	DDX4	NM_001142549.1,NM_001166533.1,NM_001166534.1,NM_024415.2	29,29,29,29	65,1098,5340	GG,GA,AA		11.9186,4.6074,9.4418	benign,benign,benign,benign	253/691,267/705,138/576,287/725	55081694	1228,11778	2203	4300	6503	SO:0001583	missense	0			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.859A>G	5.37:g.55081694A>G	ENSP00000424838:p.Ile287Val		A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.I287V	ENST00000505374.1	37	c.859	CCDS3969.1	5	234	0.10714285714285714	20	0.04065040650406504	34	0.09392265193370165	76	0.13286713286713286	104	0.13720316622691292	A	16.14	3.039979	0.55003	0.046074	0.119186	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.03	5.03	0.67393	.	0.060251	0.64402	D	0.000007	T	0.00271	0.0008	L	0.45285	1.41	0.09310	P	0.9999999851068	B;B;B;B	0.32862	0.057;0.116;0.115;0.387	B;B;B;B	0.32624	0.123;0.083;0.149;0.117	T	0.13388	-1.0511	9	0.59425	D	0.04	-14.6095	10.7067	0.45958	0.8486:0.0:0.0:0.1514	rs2305123;rs52819192;rs2305123	267;138;253;287	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	V	253;267;287;267;253;138	ENSP00000334167:I253V;ENSP00000425359:I267V;ENSP00000424838:I287V;ENSP00000427167:I267V;ENSP00000347087:I253V;ENSP00000423123:I138V	ENSP00000334167:I253V	I	+	1	0	DDX4	55117451	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.827000	0.55745	1.905000	0.55150	0.533000	0.62120	ATT	DDX4	-	superfamily_P-loop_NTPase	ENSG00000152670		0.373	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	HGNC	protein_coding	OTTHUMT00000214147.2		0.00	53	0	A	NM_024415		55081694	+1			no_errors	ENST00000505374	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	G
DGKI	9162	genome.wustl.edu	37	7	137255970	137255970	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:137255970C>T	ENST00000288490.5	-	19	1898	c.1898G>A	c.(1897-1899)cGt>cAt	p.R633H	DGKI_ENST00000446122.1_Missense_Mutation_p.R633H|DGKI_ENST00000424189.2_Missense_Mutation_p.R633H|DGKI_ENST00000453654.2_Missense_Mutation_p.R333H	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	633					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ATCATCATGACGCTGAGGTTC	0.388																																																	0													91.0	90.0	90.0					7																	137255970		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1898G>A	7.37:g.137255970C>T	ENSP00000288490:p.Arg633His		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R633H	ENST00000288490.5	37	c.1898	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.420506	0.96111	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.30448	1.53;1.53;1.53	6.08	6.08	0.98989	Diacylglycerol kinase, accessory domain (2);	0.051922	0.85682	D	0.000000	T	0.52677	0.1749	L	0.48218	1.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.44528	-0.9322	10	0.62326	D	0.03	.	20.2738	0.98482	0.0:1.0:0.0:0.0	.	333;633	E9PFX6;O75912	.;DGKI_HUMAN	H	333;581;633;633;633	ENSP00000392161:R333H;ENSP00000288490:R633H;ENSP00000399131:R633H	ENSP00000288490:R633H	R	-	2	0	DGKI	136906510	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.292000	0.78731	2.894000	0.99253	0.655000	0.94253	CGT	DGKI	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000157680		0.388	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	74	0	C	NM_004717		137255970	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	9.72	65	7	SNP	1.000	T
DGKI	9162	genome.wustl.edu	37	7	137255970	137255970	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:137255970C>T	ENST00000288490.5	-	19	1898	c.1898G>A	c.(1897-1899)cGt>cAt	p.R633H	DGKI_ENST00000446122.1_Missense_Mutation_p.R633H|DGKI_ENST00000424189.2_Missense_Mutation_p.R633H|DGKI_ENST00000453654.2_Missense_Mutation_p.R333H	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	633					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ATCATCATGACGCTGAGGTTC	0.388																																																	0													91.0	90.0	90.0					7																	137255970		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.1898G>A	7.37:g.137255970C>T	ENSP00000288490:p.Arg633His		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R633H	ENST00000288490.5	37	c.1898	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.420506	0.96111	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.30448	1.53;1.53;1.53	6.08	6.08	0.98989	Diacylglycerol kinase, accessory domain (2);	0.051922	0.85682	D	0.000000	T	0.52677	0.1749	L	0.48218	1.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.44528	-0.9322	10	0.62326	D	0.03	.	20.2738	0.98482	0.0:1.0:0.0:0.0	.	333;633	E9PFX6;O75912	.;DGKI_HUMAN	H	333;581;633;633;633	ENSP00000392161:R333H;ENSP00000288490:R633H;ENSP00000399131:R633H	ENSP00000288490:R633H	R	-	2	0	DGKI	136906510	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.292000	0.78731	2.894000	0.99253	0.655000	0.94253	CGT	DGKI	-	pfam_Diacylglycerol_kin_accessory,smart_Diacylglycerol_kin_accessory	ENSG00000157680		0.388	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	78	0	C	NM_004717		137255970	-1	tier1	-	no_errors	ENST00000288490	ensembl	human	known	74_37	missense	9.72	65	7	SNP	1.000	T
DENND2A	27147	genome.wustl.edu	37	7	140273781	140273781	+	Nonsense_Mutation	SNP	G	G	A	rs372731585		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:140273781G>A	ENST00000275884.6	-	5	1690	c.1273C>T	c.(1273-1275)Cga>Tga	p.R425*	DENND2A_ENST00000537639.1_Nonsense_Mutation_p.R425*|DENND2A_ENST00000492720.1_Nonsense_Mutation_p.R425*|DENND2A_ENST00000496613.1_Nonsense_Mutation_p.R425*			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	425					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					GAATTTTGTCGGAAAAAAGCA	0.493																																																	0								G	stop/ARG	0,3740		0,0,1870	144.0	144.0	144.0		1273	3.0	1.0	7		144	1,8211		0,1,4105	no	stop-gained	DENND2A	NM_015689.3		0,1,5975	AA,AG,GG		0.0122,0.0,0.0084		425/1010	140273781	1,11951	1870	4106	5976	SO:0001587	stop_gained	0			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1273C>T	7.37:g.140273781G>A	ENSP00000275884:p.Arg425*		C9JUI3|Q1RMD5|Q86XY0	Nonsense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R425*	ENST00000275884.6	37	c.1273	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	G	38	6.882455	0.97908	0.0	1.22E-4	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720;ENST00000475837	.	.	.	4.86	3.0	0.34707	.	0.135828	0.49305	D	0.000155	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.9928	5.6154	0.17428	0.0751:0.1395:0.6409:0.1445	.	.	.	.	X	425;425;425;425;48	.	ENSP00000275884:R425X	R	-	1	2	DENND2A	139920250	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	2.031000	0.41117	0.732000	0.32470	0.313000	0.20887	CGA	DENND2A	-	NULL	ENSG00000146966		0.493	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1		0.00	55	0	G	NM_015689		140273781	-1			no_errors	ENST00000275884	ensembl	human	known	74_37	nonsense	22.78	61	18	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124341688	124341688	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:124341688C>T	ENST00000409039.3	+	36	6195	c.6170C>T	c.(6169-6171)tCg>tTg	p.S2057L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2057					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGTTTGATTTCGGATCTGTTT	0.537																																																	0													172.0	177.0	175.0					12																	124341688		2053	4191	6244	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6170C>T	12.37:g.124341688C>T	ENSP00000386770:p.Ser2057Leu		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.S2057L	ENST00000409039.3	37	c.6170	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962189	0.53400	.	.	ENSG00000197653	ENST00000409039	T	0.42900	0.96	5.75	5.75	0.90469	.	0.000000	0.64402	U	0.000003	T	0.54759	0.1878	M	0.92077	3.27	0.80722	D	1	P	0.52692	0.955	B	0.37198	0.243	T	0.71303	-0.4633	10	0.62326	D	0.03	.	19.9522	0.97203	0.0:1.0:0.0:0.0	.	2057	Q8IVF4	DYH10_HUMAN	L	2057	ENSP00000386770:S2057L	ENSP00000386770:S2057L	S	+	2	0	DNAH10	122907641	1.000000	0.71417	0.489000	0.27452	0.135000	0.20990	4.807000	0.62576	2.725000	0.93324	0.655000	0.94253	TCG	DNAH10	-	superfamily_P-loop_NTPase	ENSG00000197653		0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	121	0	C			124341688	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	74.36	20	58	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124341688	124341688	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:124341688C>T	ENST00000409039.3	+	36	6195	c.6170C>T	c.(6169-6171)tCg>tTg	p.S2057L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2057					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGTTTGATTTCGGATCTGTTT	0.537																																																	0													172.0	177.0	175.0					12																	124341688		2053	4191	6244	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6170C>T	12.37:g.124341688C>T	ENSP00000386770:p.Ser2057Leu		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.S2057L	ENST00000409039.3	37	c.6170	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	15.88	2.962189	0.53400	.	.	ENSG00000197653	ENST00000409039	T	0.42900	0.96	5.75	5.75	0.90469	.	0.000000	0.64402	U	0.000003	T	0.54759	0.1878	M	0.92077	3.27	0.80722	D	1	P	0.52692	0.955	B	0.37198	0.243	T	0.71303	-0.4633	10	0.62326	D	0.03	.	19.9522	0.97203	0.0:1.0:0.0:0.0	.	2057	Q8IVF4	DYH10_HUMAN	L	2057	ENSP00000386770:S2057L	ENSP00000386770:S2057L	S	+	2	0	DNAH10	122907641	1.000000	0.71417	0.489000	0.27452	0.135000	0.20990	4.807000	0.62576	2.725000	0.93324	0.655000	0.94253	TCG	DNAH10	-	superfamily_P-loop_NTPase	ENSG00000197653		0.537	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	123	0	C			124341688	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	74.36	20	58	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196726626	196726626	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:196726626C>A	ENST00000312428.6	-	42	7651	c.7551G>T	c.(7549-7551)ttG>ttT	p.L2517F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2517	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAATTTCTTCCAAGAATCGTG	0.373																																																	0													110.0	103.0	105.0					2																	196726626		1877	4111	5988	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7551G>T	2.37:g.196726626C>A	ENSP00000311273:p.Leu2517Phe		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L2517F	ENST00000312428.6	37	c.7551	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989898	0.35131	.	.	ENSG00000118997	ENST00000312428	T	0.58358	0.34	5.87	0.509	0.16977	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.64402	D	0.000004	T	0.71039	0.3293	M	0.87097	2.86	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.70525	-0.4848	10	0.51188	T	0.08	.	9.9662	0.41725	0.0:0.4397:0.0:0.5603	.	2517	Q8WXX0	DYH7_HUMAN	F	2517	ENSP00000311273:L2517F	ENSP00000311273:L2517F	L	-	3	2	DNAH7	196434871	1.000000	0.71417	0.989000	0.46669	0.015000	0.08874	1.939000	0.40213	0.065000	0.16485	-0.145000	0.13849	TTG	DNAH7	-	superfamily_P-loop_NTPase	ENSG00000118997		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	40	0	C	NM_018897		196726626	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
DNAH7	56171	genome.wustl.edu	37	2	196726626	196726626	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:196726626C>A	ENST00000312428.6	-	42	7651	c.7551G>T	c.(7549-7551)ttG>ttT	p.L2517F		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2517	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAATTTCTTCCAAGAATCGTG	0.373																																																	0													110.0	103.0	105.0					2																	196726626		1877	4111	5988	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.7551G>T	2.37:g.196726626C>A	ENSP00000311273:p.Leu2517Phe		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L2517F	ENST00000312428.6	37	c.7551	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989898	0.35131	.	.	ENSG00000118997	ENST00000312428	T	0.58358	0.34	5.87	0.509	0.16977	Dynein heavy chain, P-loop containing D4 domain (1);	0.000000	0.64402	D	0.000004	T	0.71039	0.3293	M	0.87097	2.86	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.70525	-0.4848	10	0.51188	T	0.08	.	9.9662	0.41725	0.0:0.4397:0.0:0.5603	.	2517	Q8WXX0	DYH7_HUMAN	F	2517	ENSP00000311273:L2517F	ENSP00000311273:L2517F	L	-	3	2	DNAH7	196434871	1.000000	0.71417	0.989000	0.46669	0.015000	0.08874	1.939000	0.40213	0.065000	0.16485	-0.145000	0.13849	TTG	DNAH7	-	superfamily_P-loop_NTPase	ENSG00000118997		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	49	0	C	NM_018897		196726626	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	21.21	26	7	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11593365	11593365	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:11593365T>C	ENST00000262442.4	+	20	4294	c.4226T>C	c.(4225-4227)cTg>cCg	p.L1409P	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1409P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1409	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCGCACCTGCTGCAGCTCCAG	0.577																																																	0													44.0	38.0	40.0					17																	11593365		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4226T>C	17.37:g.11593365T>C	ENSP00000262442:p.Leu1409Pro		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1409P	ENST00000262442.4	37	c.4226	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855212	0.51376	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.67865	-0.29;-0.29	6.08	5.01	0.66863	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000011	D	0.88540	0.6464	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91418	0.5156	10	0.87932	D	0	.	11.9538	0.52970	0.0:0.0671:0.0:0.9329	.	1409	Q9NYC9	DYH9_HUMAN	P	1409	ENSP00000262442:L1409P;ENSP00000414874:L1409P	ENSP00000262442:L1409P	L	+	2	0	DNAH9	11534090	1.000000	0.71417	0.989000	0.46669	0.300000	0.27592	6.302000	0.72788	1.134000	0.42165	0.533000	0.62120	CTG	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.577	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	44	0	T	NM_001372		11593365	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	C
DNAH9	1770	genome.wustl.edu	37	17	11593365	11593365	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:11593365T>C	ENST00000262442.4	+	20	4294	c.4226T>C	c.(4225-4227)cTg>cCg	p.L1409P	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1409P	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1409	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCGCACCTGCTGCAGCTCCAG	0.577																																																	0													44.0	38.0	40.0					17																	11593365		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4226T>C	17.37:g.11593365T>C	ENSP00000262442:p.Leu1409Pro		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1409P	ENST00000262442.4	37	c.4226	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855212	0.51376	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.67865	-0.29;-0.29	6.08	5.01	0.66863	Dynein heavy chain, domain-2 (1);	0.000000	0.64402	D	0.000011	D	0.88540	0.6464	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91418	0.5156	10	0.87932	D	0	.	11.9538	0.52970	0.0:0.0671:0.0:0.9329	.	1409	Q9NYC9	DYH9_HUMAN	P	1409	ENSP00000262442:L1409P;ENSP00000414874:L1409P	ENSP00000262442:L1409P	L	+	2	0	DNAH9	11534090	1.000000	0.71417	0.989000	0.46669	0.300000	0.27592	6.302000	0.72788	1.134000	0.42165	0.533000	0.62120	CTG	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.577	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	48	0	T	NM_001372		11593365	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	28.57	20	8	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102299761	102299761	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:102299761G>A	ENST00000561463.1	+	0	7807									DNM1 pseudogene 47																		TCATGGAGGAGTCGGCAGAGC	0.582																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299761G>A				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	16	0	G	NG_009149		102299761	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	25.00	12	4	SNP	1.000	A
DNM1P47	100216544	genome.wustl.edu	37	15	102299761	102299761	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:102299761G>A	ENST00000561463.1	+	0	7807									DNM1 pseudogene 47																		TCATGGAGGAGTCGGCAGAGC	0.582																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299761G>A				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	19	0	G	NG_009149		102299761	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	25.00	12	4	SNP	1.000	A
DOCK1	1793	genome.wustl.edu	37	10	129213428	129213428	+	Nonsense_Mutation	SNP	G	G	T	rs369679951		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:129213428G>T	ENST00000280333.6	+	44	4487	c.4378G>T	c.(4378-4380)Gag>Tag	p.E1460*		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1460	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TATGTGGATCGAGAGAACCAT	0.438																																																	0													98.0	103.0	102.0					10																	129213428		2005	4202	6207	SO:0001587	stop_gained	0			D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4378G>T	10.37:g.129213428G>T	ENSP00000280333:p.Glu1460*		A9Z1Z5	Nonsense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,superfamily_Cyt_c-like_dom,smart_SH3_domain,pfscan_SH3_domain	p.E1460*	ENST00000280333.6	37	c.4378		10	.	.	.	.	.	.	.	.	.	.	G	45	11.553497	0.99575	.	.	ENSG00000150760	ENST00000280333	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.6123	0.91290	0.0:0.0:1.0:0.0	.	.	.	.	X	1460	.	ENSP00000280333:E1460X	E	+	1	0	DOCK1	129103418	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	9.595000	0.98260	2.634000	0.89283	0.650000	0.86243	GAG	DOCK1	-	pfam_DOCK_C	ENSG00000150760		0.438	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	HGNC	protein_coding	OTTHUMT00000050979.2		0.00	75	0	G	NM_001380		129213428	+1			no_errors	ENST00000280333	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	T
EDNRB	1910	genome.wustl.edu	37	13	78492695	78492695	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:78492695G>A	ENST00000334286.5	-	1	250	c.14C>T	c.(13-15)cCa>cTa	p.P5L	RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Missense_Mutation_p.P5L|EDNRB_ENST00000377211.4_Missense_Mutation_p.P95L|EDNRB_ENST00000475537.1_5'UTR	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	5			P -> T (in dbSNP:rs12720160). {ECO:0000269|Ref.14}.		aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GCACAGACTTGGAGGCGGCTG	0.647											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	26.0	25.0					13																	78492695		2203	4300	6503	SO:0001583	missense	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.14C>T	13.37:g.78492695G>A	ENSP00000335311:p.Pro5Leu	1183	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ETB_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn,prints_Bombsn_rcpt	p.P5L	ENST00000334286.5	37	c.14	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	G	8.457	0.854416	0.17106	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.35605	1.3;1.3;1.3	4.11	2.35	0.29111	.	1.140030	0.06352	N	0.710086	T	0.21307	0.0513	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.0	T	0.18493	-1.0335	10	0.39692	T	0.17	1.3306	5.9371	0.19171	0.2372:0.0:0.7628:0.0	.	5;95;5	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	L	95;5;5	ENSP00000366416:P95L;ENSP00000403401:P5L;ENSP00000335311:P5L	ENSP00000335311:P5L	P	-	2	0	EDNRB	77390696	0.002000	0.14202	0.013000	0.15412	0.322000	0.28314	0.546000	0.23284	1.075000	0.40932	0.591000	0.81541	CCA	EDNRB	-	prints_ETB_rcpt	ENSG00000136160		0.647	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	-	0.00	37	0	G			78492695	-1	tier1	-	no_errors	ENST00000334286	ensembl	human	known	74_37	missense	41.51	31	22	SNP	0.002	A
EDNRB	1910	genome.wustl.edu	37	13	78492695	78492695	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:78492695G>A	ENST00000334286.5	-	1	250	c.14C>T	c.(13-15)cCa>cTa	p.P5L	RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Missense_Mutation_p.P5L|EDNRB_ENST00000377211.4_Missense_Mutation_p.P95L|EDNRB_ENST00000475537.1_5'UTR	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	5			P -> T (in dbSNP:rs12720160). {ECO:0000269|Ref.14}.		aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	GCACAGACTTGGAGGCGGCTG	0.647											OREG0022452	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	26.0	25.0					13																	78492695		2203	4300	6503	SO:0001583	missense	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.14C>T	13.37:g.78492695G>A	ENSP00000335311:p.Pro5Leu	1183	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ETB_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn,prints_Bombsn_rcpt	p.P5L	ENST00000334286.5	37	c.14	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	G	8.457	0.854416	0.17106	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.35605	1.3;1.3;1.3	4.11	2.35	0.29111	.	1.140030	0.06352	N	0.710086	T	0.21307	0.0513	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.0	T	0.18493	-1.0335	10	0.39692	T	0.17	1.3306	5.9371	0.19171	0.2372:0.0:0.7628:0.0	.	5;95;5	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	L	95;5;5	ENSP00000366416:P95L;ENSP00000403401:P5L;ENSP00000335311:P5L	ENSP00000335311:P5L	P	-	2	0	EDNRB	77390696	0.002000	0.14202	0.013000	0.15412	0.322000	0.28314	0.546000	0.23284	1.075000	0.40932	0.591000	0.81541	CCA	EDNRB	-	prints_ETB_rcpt	ENSG00000136160		0.647	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	-	0.00	45	0	G			78492695	-1	tier1	-	no_errors	ENST00000334286	ensembl	human	known	74_37	missense	41.51	31	22	SNP	0.002	A
EFR3A	23167	genome.wustl.edu	37	8	132952792	132952792	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:132952792G>A	ENST00000254624.5	+	2	282	c.57G>A	c.(55-57)ctG>ctA	p.L19L	EFR3A_ENST00000519656.1_De_novo_Start_InFrame|EFR3A_ENST00000334503.4_Silent_p.L19L	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	19						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ACAAACGCCTGGTGGACAACA	0.413																																																	0													86.0	87.0	86.0					8																	132952792		2077	4209	6286	SO:0001819	synonymous_variant	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.57G>A	8.37:g.132952792G>A			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	superfamily_ARM-type_fold	p.L19	ENST00000254624.5	37	c.57	CCDS34942.2	8																																																																																			EFR3A	-	NULL	ENSG00000132294		0.413	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	-	0.00	62	0	G	NM_015137		132952792	+1	tier1	-	no_errors	ENST00000254624	ensembl	human	known	74_37	silent	25.24	77	26	SNP	1.000	A
EFR3A	23167	genome.wustl.edu	37	8	132952792	132952792	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:132952792G>A	ENST00000254624.5	+	2	282	c.57G>A	c.(55-57)ctG>ctA	p.L19L	EFR3A_ENST00000519656.1_De_novo_Start_InFrame|EFR3A_ENST00000334503.4_Silent_p.L19L	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	19						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			ACAAACGCCTGGTGGACAACA	0.413																																																	0													86.0	87.0	86.0					8																	132952792		2077	4209	6286	SO:0001819	synonymous_variant	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.57G>A	8.37:g.132952792G>A			A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Silent	SNP	superfamily_ARM-type_fold	p.L19	ENST00000254624.5	37	c.57	CCDS34942.2	8																																																																																			EFR3A	-	NULL	ENSG00000132294		0.413	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	-	0.00	67	0	G	NM_015137		132952792	+1	tier1	-	no_errors	ENST00000254624	ensembl	human	known	74_37	silent	25.24	77	26	SNP	1.000	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68400476	68400476	+	lincRNA	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:68400476G>C	ENST00000417843.2	-	0	1343																											AGGCCACAGTGTGGACtgttg	0.483																																																	0																																												0																															9.37:g.68400476G>C				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.483	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	25	0	G			68400476	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.009	C
RP11-764K9.1	0	genome.wustl.edu	37	9	68400476	68400476	+	lincRNA	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:68400476G>C	ENST00000417843.2	-	0	1343																											AGGCCACAGTGTGGACtgttg	0.483																																																	0																																												0																															9.37:g.68400476G>C				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.483	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	32	0	G			68400476	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	26.67	11	4	SNP	0.009	C
RP11-526A4.1	0	genome.wustl.edu	37	4	150607571	150607571	+	lincRNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:150607571T>G	ENST00000511993.1	-	0	866				RP11-707F2.1_ENST00000505781.1_lincRNA																							TCTCCATTTTTTTACTCACTG	0.284																																																	0																																												0																															4.37:g.150607571T>G				RNA	SNP	-	NULL	ENST00000511993.1	37	NULL		4																																																																																			RP11-526A4.1	-	-	ENSG00000234828		0.284	RP11-526A4.1-001	KNOWN	basic	lincRNA	ENSG00000234828	Clone_based_vega_gene	lincRNA	OTTHUMT00000364766.1	-	0.00	59	0	T			150607571	-1	tier1	-	no_errors	ENST00000511993	ensembl	human	known	74_37	rna	24.24	50	16	SNP	1.000	G
RP11-526A4.1	0	genome.wustl.edu	37	4	150607571	150607571	+	lincRNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:150607571T>G	ENST00000511993.1	-	0	866				RP11-707F2.1_ENST00000505781.1_lincRNA																							TCTCCATTTTTTTACTCACTG	0.284																																																	0																																												0																															4.37:g.150607571T>G				RNA	SNP	-	NULL	ENST00000511993.1	37	NULL		4																																																																																			RP11-526A4.1	-	-	ENSG00000234828		0.284	RP11-526A4.1-001	KNOWN	basic	lincRNA	ENSG00000234828	Clone_based_vega_gene	lincRNA	OTTHUMT00000364766.1	-	0.00	62	0	T			150607571	-1	tier1	-	no_errors	ENST00000511993	ensembl	human	known	74_37	rna	24.24	50	16	SNP	1.000	G
TOPORSLP1	347281	genome.wustl.edu	37	9	107037824	107037824	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:107037824T>G	ENST00000493279.1	+	0	588																											ATGTGGGGTCTTCTCAAAACA	0.453																																																	0																																												0																															9.37:g.107037824T>G				RNA	SNP	-	NULL	ENST00000493279.1	37	NULL		9																																																																																			RP11-86L19.2	-	-	ENSG00000242111		0.453	RP11-86L19.2-002	KNOWN	basic	processed_transcript	ENSG00000242111	Clone_based_vega_gene	pseudogene	OTTHUMT00000337446.1	-	0.00	36	0	T			107037824	+1	tier1	-	no_errors	ENST00000493279	ensembl	human	known	74_37	rna	37.50	25	15	SNP	0.002	G
TOPORSLP1	347281	genome.wustl.edu	37	9	107037824	107037824	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:107037824T>G	ENST00000493279.1	+	0	588																											ATGTGGGGTCTTCTCAAAACA	0.453																																																	0																																												0																															9.37:g.107037824T>G				RNA	SNP	-	NULL	ENST00000493279.1	37	NULL		9																																																																																			RP11-86L19.2	-	-	ENSG00000242111		0.453	RP11-86L19.2-002	KNOWN	basic	processed_transcript	ENSG00000242111	Clone_based_vega_gene	pseudogene	OTTHUMT00000337446.1	-	0.00	37	0	T			107037824	+1	tier1	-	no_errors	ENST00000493279	ensembl	human	known	74_37	rna	37.50	25	15	SNP	0.002	G
DCDC1	341019	genome.wustl.edu	37	11	31329171	31329171	+	Intron	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:31329171A>T	ENST00000452803.1	-	4	636				DCDC1_ENST00000597505.1_Intron|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					AAGAACAGAGAACAGCTTTGA	0.353																																																	0													111.0	108.0	109.0					11																	31329171		2202	4299	6501	SO:0001627	intron_variant	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.434+14T>A	11.37:g.31329171A>T			A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000452803.1	37	NULL	CCDS7872.1	11																																																																																			RP1-296L11.1	-	-	ENSG00000255525		0.353	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255525	Clone_based_vega_gene	protein_coding	OTTHUMT00000316531.1	-	0.00	44	0	A	NM_181807		31329171	+1	tier1	-	no_errors	ENST00000528872	ensembl	human	known	74_37	rna	42.86	20	15	SNP	0.107	T
DCDC1	341019	genome.wustl.edu	37	11	31329171	31329171	+	Intron	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:31329171A>T	ENST00000452803.1	-	4	636				DCDC1_ENST00000597505.1_Intron|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					AAGAACAGAGAACAGCTTTGA	0.353																																																	0													111.0	108.0	109.0					11																	31329171		2202	4299	6501	SO:0001627	intron_variant	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.434+14T>A	11.37:g.31329171A>T			A6PVL6|B7WNX6|Q6ZU04	RNA	SNP	-	NULL	ENST00000452803.1	37	NULL	CCDS7872.1	11																																																																																			RP1-296L11.1	-	-	ENSG00000255525		0.353	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255525	Clone_based_vega_gene	protein_coding	OTTHUMT00000316531.1	-	0.00	59	0	A	NM_181807		31329171	+1	tier1	-	no_errors	ENST00000528872	ensembl	human	known	74_37	rna	42.86	20	15	SNP	0.107	T
CTC-444N24.8	0	genome.wustl.edu	37	19	57773718	57773719	+	lincRNA	INS	-	-	AAA	rs115948325|rs373660265|rs397717881|rs55937732|rs386389346	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:57773718_57773719insAAA	ENST00000600047.1	+	0	997_998																											TTGTAACCAAGAAAAAAAAAAA	0.322																																																	0																																												0																															19.37:g.57773725_57773727dupAAA				RNA	INS	-	NULL	ENST00000600047.1	37	NULL		19																																																																																			CTC-444N24.8	-	-	ENSG00000268713		0.322	CTC-444N24.8-001	KNOWN	basic	lincRNA	ENSG00000268713	Clone_based_vega_gene	lincRNA	OTTHUMT00000465723.1		0.00	60	0	-			57773719	+1	tier1		no_errors	ENST00000600047	ensembl	human	known	74_37	rna	5.13	37	2	INS	0.000:0.000	AAA
ERBB4	2066	genome.wustl.edu	37	2	212426722	212426722	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:212426722A>C	ENST00000342788.4	-	20	2703	c.2393T>G	c.(2392-2394)cTt>cGt	p.L798R	ERBB4_ENST00000436443.1_Missense_Mutation_p.L798R|ERBB4_ENST00000402597.1_Missense_Mutation_p.L788R	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	798	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ATGGGGCATAAGTTGAGTAAC	0.493										TSP Lung(8;0.080)																																							0													148.0	124.0	132.0					2																	212426722		2203	4300	6503	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.2393T>G	2.37:g.212426722A>C	ENSP00000342235:p.Leu798Arg		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L798R	ENST00000342788.4	37	c.2393	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539997	0.85917	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.65364	-0.15;-0.15;-0.15	5.12	5.12	0.69794	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82563	0.5064	M	0.89658	3.05	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.999;0.999	D	0.86678	0.1915	10	0.87932	D	0	.	15.2321	0.73398	1.0:0.0:0.0:0.0	.	788;788;798;798	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	R	798;798;788	ENSP00000342235:L798R;ENSP00000403204:L798R;ENSP00000385565:L788R	ENSP00000342235:L798R	L	-	2	0	ERBB4	212134967	1.000000	0.71417	0.862000	0.33874	0.961000	0.63080	9.287000	0.95975	2.063000	0.61619	0.533000	0.62120	CTT	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000178568		0.493	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1		0.00	56	0	A	NM_001042599		212426722	-1			no_errors	ENST00000342788	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.999	C
EVC	2121	genome.wustl.edu	37	4	5758076	5758076	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:5758076T>G	ENST00000264956.6	+	11	1734	c.1550T>G	c.(1549-1551)gTt>gGt	p.V517G	EVC_ENST00000509451.1_Missense_Mutation_p.V517G|EVC_ENST00000382674.2_Missense_Mutation_p.V517G	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	517					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GAGGCTGTGGTTGCACTCTGC	0.587																																																	0													78.0	70.0	73.0					4																	5758076		2203	4300	6503	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1550T>G	4.37:g.5758076T>G	ENSP00000264956:p.Val517Gly			Missense_Mutation	SNP	NULL	p.V517G	ENST00000264956.6	37	c.1550	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	T	8.297	0.818992	0.16607	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.54279	0.58;0.58;0.6	5.12	0.228	0.15364	.	0.874123	0.10181	N	0.705879	T	0.35393	0.0930	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	10	0.33940	T	0.23	.	5.3439	0.15998	0.0:0.5205:0.1376:0.3419	.	517	P57679	EVC_HUMAN	G	517	ENSP00000264956:V517G;ENSP00000372120:V517G;ENSP00000426774:V517G	ENSP00000264956:V517G	V	+	2	0	EVC	5808977	0.009000	0.17119	0.000000	0.03702	0.000000	0.00434	0.658000	0.24979	-0.063000	0.13065	-1.090000	0.02178	GTT	EVC	-	NULL	ENSG00000072840		0.587	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	-	0.00	44	0	T			5758076	+1	tier1	-	no_errors	ENST00000264956	ensembl	human	known	74_37	missense	51.28	19	20	SNP	0.000	G
EVC	2121	genome.wustl.edu	37	4	5758076	5758076	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:5758076T>G	ENST00000264956.6	+	11	1734	c.1550T>G	c.(1549-1551)gTt>gGt	p.V517G	EVC_ENST00000509451.1_Missense_Mutation_p.V517G|EVC_ENST00000382674.2_Missense_Mutation_p.V517G	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	517					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GAGGCTGTGGTTGCACTCTGC	0.587																																																	0													78.0	70.0	73.0					4																	5758076		2203	4300	6503	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.1550T>G	4.37:g.5758076T>G	ENSP00000264956:p.Val517Gly			Missense_Mutation	SNP	NULL	p.V517G	ENST00000264956.6	37	c.1550	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	T	8.297	0.818992	0.16607	.	.	ENSG00000072840	ENST00000264956;ENST00000382674;ENST00000509451	T;T;T	0.54279	0.58;0.58;0.6	5.12	0.228	0.15364	.	0.874123	0.10181	N	0.705879	T	0.35393	0.0930	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20907	-1.0261	10	0.33940	T	0.23	.	5.3439	0.15998	0.0:0.5205:0.1376:0.3419	.	517	P57679	EVC_HUMAN	G	517	ENSP00000264956:V517G;ENSP00000372120:V517G;ENSP00000426774:V517G	ENSP00000264956:V517G	V	+	2	0	EVC	5808977	0.009000	0.17119	0.000000	0.03702	0.000000	0.00434	0.658000	0.24979	-0.063000	0.13065	-1.090000	0.02178	GTT	EVC	-	NULL	ENSG00000072840		0.587	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	-	0.00	50	0	T			5758076	+1	tier1	-	no_errors	ENST00000264956	ensembl	human	known	74_37	missense	51.28	19	20	SNP	0.000	G
EYS	346007	genome.wustl.edu	37	6	65523282	65523282	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:65523282A>G	ENST00000370621.3	-	22	3958	c.3432T>C	c.(3430-3432)acT>acC	p.T1144T	EYS_ENST00000370616.2_Silent_p.T1144T|EYS_ENST00000503581.1_Silent_p.T1144T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1144	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGCAGTCAAAAGTATGTCCAG	0.368																																																	0													128.0	106.0	112.0					6																	65523282		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.3432T>C	6.37:g.65523282A>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1144	ENST00000370621.3	37	c.3432		6																																																																																			EYS	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000188107		0.368	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	19	0	A	XM_294050		65523282	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	46.15	7	6	SNP	0.000	G
EYS	346007	genome.wustl.edu	37	6	65523282	65523282	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:65523282A>G	ENST00000370621.3	-	22	3958	c.3432T>C	c.(3430-3432)acT>acC	p.T1144T	EYS_ENST00000370616.2_Silent_p.T1144T|EYS_ENST00000503581.1_Silent_p.T1144T			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1144	EGF-like 19. {ECO:0000255|PROSITE- ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGCAGTCAAAAGTATGTCCAG	0.368																																																	0													128.0	106.0	112.0					6																	65523282		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.3432T>C	6.37:g.65523282A>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.T1144	ENST00000370621.3	37	c.3432		6																																																																																			EYS	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000188107		0.368	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	27	0	A	XM_294050		65523282	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	46.15	7	6	SNP	0.000	G
EYS	346007	genome.wustl.edu	37	6	66115232	66115232	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:66115232A>G	ENST00000370621.3	-	6	1417	c.891T>C	c.(889-891)ccT>ccC	p.P297P	EYS_ENST00000370616.2_Silent_p.P297P|EYS_ENST00000503581.1_Silent_p.P297P|EYS_ENST00000370618.3_Silent_p.P297P|EYS_ENST00000393380.2_Silent_p.P297P|EYS_ENST00000342421.5_Silent_p.P297P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	297					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GAGAAACACAAGGTTTTGCTG	0.363																																																	0													129.0	133.0	132.0					6																	66115232		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.891T>C	6.37:g.66115232A>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P297	ENST00000370621.3	37	c.891		6																																																																																			EYS	-	NULL	ENSG00000188107		0.363	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	38	0	A	XM_294050		66115232	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	34.21	25	13	SNP	0.000	G
EYS	346007	genome.wustl.edu	37	6	66115232	66115232	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:66115232A>G	ENST00000370621.3	-	6	1417	c.891T>C	c.(889-891)ccT>ccC	p.P297P	EYS_ENST00000370616.2_Silent_p.P297P|EYS_ENST00000503581.1_Silent_p.P297P|EYS_ENST00000370618.3_Silent_p.P297P|EYS_ENST00000393380.2_Silent_p.P297P|EYS_ENST00000342421.5_Silent_p.P297P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	297					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GAGAAACACAAGGTTTTGCTG	0.363																																																	0													129.0	133.0	132.0					6																	66115232		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.891T>C	6.37:g.66115232A>G			A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.P297	ENST00000370621.3	37	c.891		6																																																																																			EYS	-	NULL	ENSG00000188107		0.363	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	41	0	A	XM_294050		66115232	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	34.21	25	13	SNP	0.000	G
FAM105A	54491	genome.wustl.edu	37	5	14608906	14608906	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:14608906G>T	ENST00000274217.3	+	7	797	c.677G>T	c.(676-678)tGc>tTc	p.C226F		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	226	OTU.									large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					GGAAGTATGTGCAACACCCTT	0.328																																																	0													78.0	78.0	78.0					5																	14608906		2203	4300	6503	SO:0001583	missense	0				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.677G>T	5.37:g.14608906G>T	ENSP00000274217:p.Cys226Phe		Q53H50|Q9H037	Missense_Mutation	SNP	prints_FAM105,prints_FAM105A	p.C226F	ENST00000274217.3	37	c.677	CCDS3884.1	5	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249652	0.39797	.	.	ENSG00000145569	ENST00000274217	T	0.18016	2.24	4.89	4.01	0.46588	.	0.146987	0.48286	D	0.000190	T	0.38612	0.1047	M	0.66939	2.045	0.44447	D	0.997376	D	0.89917	1.0	D	0.85130	0.997	T	0.13845	-1.0494	10	0.52906	T	0.07	-18.1564	12.8898	0.58066	0.0796:0.0:0.9204:0.0	.	226	Q9NUU6	F105A_HUMAN	F	226	ENSP00000274217:C226F	ENSP00000274217:C226F	C	+	2	0	FAM105A	14661906	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.241000	0.78201	1.037000	0.40024	0.585000	0.79938	TGC	FAM105A	-	prints_FAM105,prints_FAM105A	ENSG00000145569		0.328	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105A	HGNC	protein_coding	OTTHUMT00000253710.1		0.00	36	0	G	NM_019018		14608906	+1			no_errors	ENST00000274217	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
FAM184A	79632	genome.wustl.edu	37	6	119296289	119296292	+	Frame_Shift_Del	DEL	CCTC	CCTC	-	rs369621266		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	CCTC	CCTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:119296289_119296292delCCTC	ENST00000338891.7	-	13	3108_3111	c.2665_2668delGAGG	c.(2665-2670)gaggttfs	p.EV889fs	FAM184A_ENST00000368475.4_Frame_Shift_Del_p.EV769fs|FAM184A_ENST00000352896.5_Frame_Shift_Del_p.EV769fs|FAM184A_ENST00000521531.1_Frame_Shift_Del_p.EV889fs|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	889						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						AGGTGCTGAACCTCCTTATCCAAT	0.363																																																	0																																										SO:0001589	frameshift_variant	0			BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.2665_2668delGAGG	6.37:g.119296289_119296292delCCTC	ENSP00000342604:p.Glu889fs		B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Frame_Shift_Del	DEL	superfamily_Prefoldin	p.E889fs	ENST00000338891.7	37	c.2668_2665	CCDS43499.1	6																																																																																			FAM184A	-	NULL	ENSG00000111879		0.363	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	HGNC	protein_coding	OTTHUMT00000042009.3		0.00	72	0	CCTC	NM_024581		119296292	-1			no_errors	ENST00000338891	ensembl	human	known	74_37	frame_shift_del	8.00	46	4	DEL	0.999:1.000:1.000:1.000	0
FAM198A	729085	genome.wustl.edu	37	3	43074800	43074800	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:43074800C>T	ENST00000430121.2	+	2	1140	c.1045C>T	c.(1045-1047)Cgc>Tgc	p.R349C	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	349						extracellular region (GO:0005576)				endometrium(1)	1						TGCTGTGGCCCGCCGCTTCCA	0.652																																																	0													25.0	30.0	28.0					3																	43074800		692	1591	2283	SO:0001583	missense	0			AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.1045C>T	3.37:g.43074800C>T	ENSP00000407301:p.Arg349Cys		B3KR48	Missense_Mutation	SNP	NULL	p.R349C	ENST00000430121.2	37	c.1045	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	C	20.7	4.028456	0.75390	.	.	ENSG00000144649	ENST00000430121	T	0.52754	0.65	5.1	4.21	0.49690	.	0.127868	0.52532	D	0.000079	T	0.69611	0.3130	M	0.82323	2.585	0.51767	D	0.999936	D	0.89917	1.0	D	0.76575	0.988	T	0.73691	-0.3903	9	.	.	.	-10.5977	14.1191	0.65175	0.1605:0.8395:0.0:0.0	.	349	Q9UFP1	F198A_HUMAN	C	349	ENSP00000407301:R349C	.	R	+	1	0	FAM198A	43049804	1.000000	0.71417	0.994000	0.49952	0.864000	0.49448	3.673000	0.54591	1.257000	0.44085	0.650000	0.86243	CGC	FAM198A	-	NULL	ENSG00000144649		0.652	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	-	0.00	56	0	C	NM_001129908		43074800	+1	tier1	-	no_errors	ENST00000273146	ensembl	human	known	74_37	missense	32.26	20	10	SNP	1.000	T
FAM47A	158724	genome.wustl.edu	37	X	34148882	34148882	+	Missense_Mutation	SNP	C	C	T	rs5973089		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:34148882C>T	ENST00000346193.3	-	1	1565	c.1514G>A	c.(1513-1515)cGc>cAc	p.R505H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	505			Missing. {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.					p.R505H(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGCTCCGAGCGGAGACTGGA	0.647																																																	2	Substitution - Missense(2)	kidney(1)|endometrium(1)											30.0	31.0	31.0					X																	34148882		2183	4272	6455	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1514G>A	X.37:g.34148882C>T	ENSP00000345029:p.Arg505His		A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.R505H	ENST00000346193.3	37	c.1514	CCDS43926.1	X	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	c	0.583	-0.836375	0.02692	.	.	ENSG00000185448	ENST00000346193	T	0.21191	2.02	0.513	-0.53	0.11898	.	.	.	.	.	T	0.11623	0.0283	N	0.21097	0.63	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.28106	-1.0054	8	0.40728	T	0.16	.	.	.	.	rs5973089	505	Q5JRC9	FA47A_HUMAN	H	505	ENSP00000345029:R505H	ENSP00000345029:R505H	R	-	2	0	FAM47A	34058803	0.076000	0.21285	0.002000	0.10522	0.006000	0.05464	-0.425000	0.07017	-0.338000	0.08413	-0.722000	0.03604	CGC	FAM47A	-	NULL	ENSG00000185448		0.647	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1		0.00	22	0	C	NM_203408		34148882	-1			no_errors	ENST00000346193	ensembl	human	known	74_37	missense	20.51	31	8	SNP	0.002	T
FAM65C	140876	genome.wustl.edu	37	20	49225464	49225464	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:49225464G>A	ENST00000327979.2	-	9	1068	c.657C>T	c.(655-657)ccC>ccT	p.P219P	FAM65C_ENST00000535356.1_Silent_p.P223P|FAM65C_ENST00000045083.2_Silent_p.P219P			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	219										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGTGGTCTCCGGGACAGAGGC	0.647																																																	0													43.0	34.0	37.0					20																	49225464		2202	4300	6502	SO:0001819	synonymous_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.657C>T	20.37:g.49225464G>A			Q5QPB6|Q9NQQ2	Silent	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.P223	ENST00000327979.2	37	c.669	CCDS13431.2	20																																																																																			FAM65C	-	NULL	ENSG00000042062		0.647	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	113	0	G			49225464	-1	tier1	-	no_errors	ENST00000535356	ensembl	human	known	74_37	silent	6.82	82	6	SNP	0.037	A
FAM65C	140876	genome.wustl.edu	37	20	49225464	49225464	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:49225464G>A	ENST00000327979.2	-	9	1068	c.657C>T	c.(655-657)ccC>ccT	p.P219P	FAM65C_ENST00000535356.1_Silent_p.P223P|FAM65C_ENST00000045083.2_Silent_p.P219P			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	219										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGTGGTCTCCGGGACAGAGGC	0.647																																																	0													43.0	34.0	37.0					20																	49225464		2202	4300	6502	SO:0001819	synonymous_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.657C>T	20.37:g.49225464G>A			Q5QPB6|Q9NQQ2	Silent	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.P223	ENST00000327979.2	37	c.669	CCDS13431.2	20																																																																																			FAM65C	-	NULL	ENSG00000042062		0.647	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	-	0.00	80	0	G			49225464	-1	tier1	-	no_errors	ENST00000535356	ensembl	human	known	74_37	silent	6.82	82	6	SNP	0.037	A
FANCM	57697	genome.wustl.edu	37	14	45645573	45645573	+	Nonsense_Mutation	SNP	C	C	T	rs377167890		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:45645573C>T	ENST00000267430.5	+	14	3701	c.3616C>T	c.(3616-3618)Cag>Tag	p.Q1206*	FANCM_ENST00000542564.2_Nonsense_Mutation_p.Q1180*	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1206					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATCTCGTGATCAGAGAGGTGT	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													81.0	82.0	81.0					14																	45645573		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3616C>T	14.37:g.45645573C>T	ENSP00000267430:p.Gln1206*		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1206*	ENST00000267430.5	37	c.3616	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.483|9.483	1.098701|1.098701	0.20552|0.20552	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	.|.	.|.	.|.	5.5|5.5	-2.62|-2.62	0.06152|0.06152	.|.	1.475890|.	0.04460|.	N|.	0.374151|.	.|T	.|0.26304	.|0.0642	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.34875	.|-0.9811	.|3	0.05959|.	T|.	0.93|.	.|.	3.8337|3.8337	0.08885|0.08885	0.121:0.0749:0.3948:0.4093|0.121:0.0749:0.3948:0.4093	.|.	.|.	.|.	.|.	X|L	1206;1180;722|138	.|.	ENSP00000267430:Q1206X|.	Q|S	+|+	1|2	0|0	FANCM|FANCM	44715323|44715323	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	-0.656000|-0.656000	0.05342|0.05342	-0.231000|-0.231000	0.09825|0.09825	-0.423000|-0.423000	0.05987|0.05987	CAG|TCA	FANCM	-	NULL	ENSG00000187790		0.353	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	64	0	C	XM_048128		45645573	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	nonsense	30.26	53	23	SNP	0.000	T
FANCM	57697	genome.wustl.edu	37	14	45645573	45645573	+	Nonsense_Mutation	SNP	C	C	T	rs377167890		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:45645573C>T	ENST00000267430.5	+	14	3701	c.3616C>T	c.(3616-3618)Cag>Tag	p.Q1206*	FANCM_ENST00000542564.2_Nonsense_Mutation_p.Q1180*	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1206					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATCTCGTGATCAGAGAGGTGT	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													81.0	82.0	81.0					14																	45645573		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3616C>T	14.37:g.45645573C>T	ENSP00000267430:p.Gln1206*		B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q1206*	ENST00000267430.5	37	c.3616	CCDS32070.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.483|9.483	1.098701|1.098701	0.20552|0.20552	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	.|.	.|.	.|.	5.5|5.5	-2.62|-2.62	0.06152|0.06152	.|.	1.475890|.	0.04460|.	N|.	0.374151|.	.|T	.|0.26304	.|0.0642	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.34875	.|-0.9811	.|3	0.05959|.	T|.	0.93|.	.|.	3.8337|3.8337	0.08885|0.08885	0.121:0.0749:0.3948:0.4093|0.121:0.0749:0.3948:0.4093	.|.	.|.	.|.	.|.	X|L	1206;1180;722|138	.|.	ENSP00000267430:Q1206X|.	Q|S	+|+	1|2	0|0	FANCM|FANCM	44715323|44715323	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.004000|0.004000	0.04260|0.04260	-0.656000|-0.656000	0.05342|0.05342	-0.231000|-0.231000	0.09825|0.09825	-0.423000|-0.423000	0.05987|0.05987	CAG|TCA	FANCM	-	NULL	ENSG00000187790		0.353	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	71	0	C	XM_048128		45645573	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	nonsense	30.26	53	23	SNP	0.000	T
FBXO18	84893	genome.wustl.edu	37	10	5957704	5957704	+	Intron	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:5957704T>A	ENST00000362091.4	+	9	1680				FBXO18_ENST00000379999.5_Intron|FBXO18_ENST00000397269.3_Intron	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						ATTTGTACTTTTATCCTGTAG	0.418																																																	0																																										SO:0001627	intron_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.1565+170T>A	10.37:g.5957704T>A			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	-	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			FBXO18	-	-	ENSG00000134452		0.418	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	-	0.00	10	0	T	NM_032807		5957704	+1	tier1	-	no_errors	ENST00000460453	ensembl	human	known	74_37	rna	40.00	6	4	SNP	0.013	A
GABRA4	2557	genome.wustl.edu	37	4	46994821	46994821	+	Intron	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:46994821T>A	ENST00000264318.3	-	2	1188				GABRA4_ENST00000509316.1_5'UTR	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4						central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	cagGACACACTTGCGCGTTTG	0.473																																					Ovarian(6;283 369 8234 12290 33402)												0													125.0	111.0	115.0					4																	46994821		2203	4300	6503	SO:0001627	intron_variant	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.205+23A>T	4.37:g.46994821T>A			Q8IYR7	RNA	SNP	-	NULL	ENST00000264318.3	37	NULL	CCDS3473.1	4																																																																																			GABRA4	-	-	ENSG00000109158		0.473	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	-	0.00	59	0	T			46994821	-1	tier1	-	no_errors	ENST00000509316	ensembl	human	known	74_37	rna	20.59	54	14	SNP	0.207	A
GABRA4	2557	genome.wustl.edu	37	4	46994821	46994821	+	Intron	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:46994821T>A	ENST00000264318.3	-	2	1188				GABRA4_ENST00000509316.1_5'UTR	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4						central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	cagGACACACTTGCGCGTTTG	0.473																																					Ovarian(6;283 369 8234 12290 33402)												0													125.0	111.0	115.0					4																	46994821		2203	4300	6503	SO:0001627	intron_variant	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.205+23A>T	4.37:g.46994821T>A			Q8IYR7	RNA	SNP	-	NULL	ENST00000264318.3	37	NULL	CCDS3473.1	4																																																																																			GABRA4	-	-	ENSG00000109158		0.473	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	-	0.00	66	0	T			46994821	-1	tier1	-	no_errors	ENST00000509316	ensembl	human	known	74_37	rna	20.59	54	14	SNP	0.207	A
GDF7	151449	genome.wustl.edu	37	2	20870289	20870289	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:20870289G>A	ENST00000272224.3	+	2	1033	c.457G>A	c.(457-459)Gag>Aag	p.E153K		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	153					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGACGCAGACGAGGTGGTGGG	0.662																																																	0													25.0	24.0	24.0					2																	20870289		2200	4299	6499	SO:0001583	missense	0			AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.457G>A	2.37:g.20870289G>A	ENSP00000272224:p.Glu153Lys			Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.E153K	ENST00000272224.3	37	c.457	CCDS1701.1	2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207995	0.79240	.	.	ENSG00000143869	ENST00000272224	T	0.64438	-0.1	3.74	3.74	0.42951	Transforming growth factor-beta, N-terminal (1);	0.238170	0.23943	U	0.043027	T	0.75532	0.3862	M	0.62723	1.935	0.44024	D	0.996744	D	0.89917	1.0	D	0.80764	0.994	T	0.76369	-0.2984	10	0.41790	T	0.15	.	16.0775	0.80979	0.0:0.0:1.0:0.0	.	153	Q7Z4P5	GDF7_HUMAN	K	153	ENSP00000272224:E153K	ENSP00000272224:E153K	E	+	1	0	GDF7	20733770	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	7.433000	0.80362	2.092000	0.63282	0.462000	0.41574	GAG	GDF7	-	pfam_TGF-b_N	ENSG00000143869		0.662	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF7	HGNC	protein_coding	OTTHUMT00000207563.2	-	0.00	63	0	G	NM_182828		20870289	+1	tier1	-	no_errors	ENST00000272224	ensembl	human	known	74_37	missense	33.33	44	22	SNP	1.000	A
GDF7	151449	genome.wustl.edu	37	2	20870289	20870289	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:20870289G>A	ENST00000272224.3	+	2	1033	c.457G>A	c.(457-459)Gag>Aag	p.E153K		NM_182828.2	NP_878248.2	Q7Z4P5	GDF7_HUMAN	growth differentiation factor 7	153					activin receptor signaling pathway (GO:0032924)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching morphogenesis of an epithelial tube (GO:0048754)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|forebrain morphogenesis (GO:0048853)|gland morphogenesis (GO:0022612)|growth (GO:0040007)|midbrain development (GO:0030901)|morphogenesis of an epithelial fold (GO:0060571)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of tendon cell differentiation (GO:2001051)|positive regulation of transcription, DNA-templated (GO:0045893)|reproductive structure development (GO:0048608)|roof plate formation (GO:0021509)|spinal cord association neuron differentiation (GO:0021527)	extracellular space (GO:0005615)				breast(1)|cervix(1)|endometrium(2)|lung(1)|prostate(1)|skin(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CGACGCAGACGAGGTGGTGGG	0.662																																																	0													25.0	24.0	24.0					2																	20870289		2200	4299	6499	SO:0001583	missense	0			AF522369	CCDS1701.1	2p24.1	2008-05-22			ENSG00000143869	ENSG00000143869			4222	protein-coding gene	gene with protein product		604651				10022976, 9808626	Standard	NM_182828		Approved	BMP12	uc002rdz.1	Q7Z4P5	OTTHUMG00000090781	ENST00000272224.3:c.457G>A	2.37:g.20870289G>A	ENSP00000272224:p.Glu153Lys			Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.E153K	ENST00000272224.3	37	c.457	CCDS1701.1	2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.207995	0.79240	.	.	ENSG00000143869	ENST00000272224	T	0.64438	-0.1	3.74	3.74	0.42951	Transforming growth factor-beta, N-terminal (1);	0.238170	0.23943	U	0.043027	T	0.75532	0.3862	M	0.62723	1.935	0.44024	D	0.996744	D	0.89917	1.0	D	0.80764	0.994	T	0.76369	-0.2984	10	0.41790	T	0.15	.	16.0775	0.80979	0.0:0.0:1.0:0.0	.	153	Q7Z4P5	GDF7_HUMAN	K	153	ENSP00000272224:E153K	ENSP00000272224:E153K	E	+	1	0	GDF7	20733770	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	7.433000	0.80362	2.092000	0.63282	0.462000	0.41574	GAG	GDF7	-	pfam_TGF-b_N	ENSG00000143869		0.662	GDF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF7	HGNC	protein_coding	OTTHUMT00000207563.2	-	0.00	72	0	G	NM_182828		20870289	+1	tier1	-	no_errors	ENST00000272224	ensembl	human	known	74_37	missense	33.33	44	22	SNP	1.000	A
GHSR	2693	genome.wustl.edu	37	3	172165868	172165868	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:172165868G>A	ENST00000241256.2	-	1	378	c.336C>T	c.(334-336)ggC>ggT	p.G112G	GHSR_ENST00000427970.1_Silent_p.G112G	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	112					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			AGAGGAGGTCGCCGAAGTTCC	0.597																																					Esophageal Squamous(93;641 1401 20883 29581 34638)												0													67.0	59.0	61.0					3																	172165868		2203	4300	6503	SO:0001819	synonymous_variant	0			AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.336C>T	3.37:g.172165868G>A			Q14D12|Q6ISR8|Q92848|Q96RJ7	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R,prints_GPCR_Rhodpsn	p.G112	ENST00000241256.2	37	c.336	CCDS3218.1	3																																																																																			GHSR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000121853		0.597	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHSR	HGNC	protein_coding	OTTHUMT00000346728.1		0.00	19	0	G	NM_004122		172165868	-1			no_errors	ENST00000241256	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.982	A
GPAM	57678	genome.wustl.edu	37	10	113921486	113921486	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:113921486T>A	ENST00000348367.4	-	15	1630	c.1433A>T	c.(1432-1434)aAg>aTg	p.K478M	GPAM_ENST00000423155.1_Missense_Mutation_p.K478M|GPAM_ENST00000369425.1_Missense_Mutation_p.K478M			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	478					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GGCACAGGACTTGCTAGCAGC	0.413																																					Ovarian(161;1017 2606 18293 52943)												0													126.0	106.0	113.0					10																	113921486		2203	4300	6503	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1433A>T	10.37:g.113921486T>A	ENSP00000265276:p.Lys478Met		Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.K478M	ENST00000348367.4	37	c.1433	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743460	0.69418	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.70869	-0.52;-0.52;-0.5	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.80954	0.4723	L	0.61387	1.9	0.58432	D	0.999998	D;D	0.76494	0.999;0.998	D;P	0.73380	0.98;0.879	T	0.81176	-0.1052	10	0.45353	T	0.12	-21.2927	13.6873	0.62524	0.0:0.0:0.0:1.0	.	478;478	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	M	478	ENSP00000265276:K478M;ENSP00000409242:K478M;ENSP00000358433:K478M	ENSP00000265276:K478M	K	-	2	0	GPAM	113911476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.541000	0.60670	1.985000	0.57927	0.523000	0.50628	AAG	GPAM	-	NULL	ENSG00000119927		0.413	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	-	0.00	34	0	T	NM_020918		113921486	-1	tier1	-	no_errors	ENST00000348367	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	A
GPAM	57678	genome.wustl.edu	37	10	113921486	113921486	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:113921486T>A	ENST00000348367.4	-	15	1630	c.1433A>T	c.(1432-1434)aAg>aTg	p.K478M	GPAM_ENST00000423155.1_Missense_Mutation_p.K478M|GPAM_ENST00000369425.1_Missense_Mutation_p.K478M			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	478					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GGCACAGGACTTGCTAGCAGC	0.413																																					Ovarian(161;1017 2606 18293 52943)												0													126.0	106.0	113.0					10																	113921486		2203	4300	6503	SO:0001583	missense	0			AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1433A>T	10.37:g.113921486T>A	ENSP00000265276:p.Lys478Met		Q5VW51|Q86TA3	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.K478M	ENST00000348367.4	37	c.1433	CCDS7570.1	10	.	.	.	.	.	.	.	.	.	.	T	19.01	3.743460	0.69418	.	.	ENSG00000119927	ENST00000348367;ENST00000423155;ENST00000369425	T;T;T	0.70869	-0.52;-0.52;-0.5	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.80954	0.4723	L	0.61387	1.9	0.58432	D	0.999998	D;D	0.76494	0.999;0.998	D;P	0.73380	0.98;0.879	T	0.81176	-0.1052	10	0.45353	T	0.12	-21.2927	13.6873	0.62524	0.0:0.0:0.0:1.0	.	478;478	Q5VW52;Q9HCL2	.;GPAT1_HUMAN	M	478	ENSP00000265276:K478M;ENSP00000409242:K478M;ENSP00000358433:K478M	ENSP00000265276:K478M	K	-	2	0	GPAM	113911476	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.541000	0.60670	1.985000	0.57927	0.523000	0.50628	AAG	GPAM	-	NULL	ENSG00000119927		0.413	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAM	HGNC	protein_coding	OTTHUMT00000050377.1	-	0.00	44	0	T	NM_020918		113921486	-1	tier1	-	no_errors	ENST00000348367	ensembl	human	known	74_37	missense	31.25	22	10	SNP	1.000	A
GPR110	266977	genome.wustl.edu	37	6	46976809	46976809	+	Missense_Mutation	SNP	G	G	T	rs368956326		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:46976809G>T	ENST00000371253.2	-	11	2577	c.2362C>A	c.(2362-2364)Cgc>Agc	p.R788S	GPR110_ENST00000283297.5_Missense_Mutation_p.R591S|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	788					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TTCCCCACGCGGATGATGGTG	0.552																																																	0													67.0	69.0	68.0					6																	46976809		2203	4300	6503	SO:0001583	missense	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2362C>A	6.37:g.46976809G>T	ENSP00000360299:p.Arg788Ser		Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.R788S	ENST00000371253.2	37	c.2362	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610783	0.66558	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.44881	0.91;0.91	5.9	5.9	0.94986	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000010	T	0.47525	0.1450	L	0.42245	1.32	0.47065	D	0.999306	D	0.89917	1.0	D	0.74674	0.984	T	0.10109	-1.0644	10	0.16420	T	0.52	-21.031	20.2789	0.98501	0.0:0.0:1.0:0.0	.	788	Q5T601	GP110_HUMAN	S	788;591	ENSP00000360299:R788S;ENSP00000283297:R591S	ENSP00000283297:R591S	R	-	1	0	GPR110	47084768	1.000000	0.71417	0.987000	0.45799	0.503000	0.33858	7.013000	0.76373	2.788000	0.95919	0.650000	0.86243	CGC	GPR110	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_Ig-hepta_rcpt	ENSG00000153292		0.552	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	-	0.00	72	0	G	NM_153840		46976809	-1	tier1	-	no_errors	ENST00000371253	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
GPR110	266977	genome.wustl.edu	37	6	46976809	46976809	+	Missense_Mutation	SNP	G	G	T	rs368956326		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:46976809G>T	ENST00000371253.2	-	11	2577	c.2362C>A	c.(2362-2364)Cgc>Agc	p.R788S	GPR110_ENST00000283297.5_Missense_Mutation_p.R591S|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	788					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TTCCCCACGCGGATGATGGTG	0.552																																																	0													67.0	69.0	68.0					6																	46976809		2203	4300	6503	SO:0001583	missense	0			AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2362C>A	6.37:g.46976809G>T	ENSP00000360299:p.Arg788Ser		Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.R788S	ENST00000371253.2	37	c.2362	CCDS34471.1	6	.	.	.	.	.	.	.	.	.	.	G	18.38	3.610783	0.66558	.	.	ENSG00000153292	ENST00000371253;ENST00000283297	T;T	0.44881	0.91;0.91	5.9	5.9	0.94986	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000010	T	0.47525	0.1450	L	0.42245	1.32	0.47065	D	0.999306	D	0.89917	1.0	D	0.74674	0.984	T	0.10109	-1.0644	10	0.16420	T	0.52	-21.031	20.2789	0.98501	0.0:0.0:1.0:0.0	.	788	Q5T601	GP110_HUMAN	S	788;591	ENSP00000360299:R788S;ENSP00000283297:R591S	ENSP00000283297:R591S	R	-	1	0	GPR110	47084768	1.000000	0.71417	0.987000	0.45799	0.503000	0.33858	7.013000	0.76373	2.788000	0.95919	0.650000	0.86243	CGC	GPR110	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_Ig-hepta_rcpt	ENSG00000153292		0.552	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	HGNC	protein_coding	OTTHUMT00000040810.2	-	0.00	90	0	G	NM_153840		46976809	-1	tier1	-	no_errors	ENST00000371253	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
GPR158	57512	genome.wustl.edu	37	10	25888059	25888059	+	Silent	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:25888059A>T	ENST00000376351.3	+	11	3863	c.3504A>T	c.(3502-3504)cgA>cgT	p.R1168R	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1168					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TAACATCACGAGCAGAGGTTT	0.438																																																	0													52.0	55.0	54.0					10																	25888059		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3504A>T	10.37:g.25888059A>T			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.R1168	ENST00000376351.3	37	c.3504	CCDS31166.1	10																																																																																			GPR158	-	NULL	ENSG00000151025		0.438	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	25	0	A	XM_166110		25888059	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	silent	42.86	8	6	SNP	0.991	T
GPR158	57512	genome.wustl.edu	37	10	25888059	25888059	+	Silent	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:25888059A>T	ENST00000376351.3	+	11	3863	c.3504A>T	c.(3502-3504)cgA>cgT	p.R1168R	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1168					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						TAACATCACGAGCAGAGGTTT	0.438																																																	0													52.0	55.0	54.0					10																	25888059		2203	4300	6503	SO:0001819	synonymous_variant	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3504A>T	10.37:g.25888059A>T			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.R1168	ENST00000376351.3	37	c.3504	CCDS31166.1	10																																																																																			GPR158	-	NULL	ENSG00000151025		0.438	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	26	0	A	XM_166110		25888059	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	silent	42.86	8	6	SNP	0.991	T
GPR158	57512	genome.wustl.edu	37	10	25888066	25888066	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:25888066G>A	ENST00000376351.3	+	11	3870	c.3511G>A	c.(3511-3513)Gtt>Att	p.V1171I	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1171					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ACGAGCAGAGGTTTGTCCTTG	0.458																																																	0													50.0	54.0	53.0					10																	25888066		2203	4300	6503	SO:0001583	missense	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3511G>A	10.37:g.25888066G>A	ENSP00000365529:p.Val1171Ile		Q6QR81|Q9ULT3	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.V1171I	ENST00000376351.3	37	c.3511	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	G	5.422	0.263090	0.10294	.	.	ENSG00000151025	ENST00000376351	T	0.68765	-0.35	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000005	T	0.52645	0.1747	L	0.34521	1.04	0.43263	D	0.995204	B	0.33857	0.429	B	0.26202	0.067	T	0.51521	-0.8695	10	0.28530	T	0.3	.	14.1165	0.65156	0.0715:0.0:0.9285:0.0	.	1171	Q5T848	GP158_HUMAN	I	1171	ENSP00000365529:V1171I	ENSP00000365529:V1171I	V	+	1	0	GPR158	25928072	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	4.916000	0.63362	2.702000	0.92279	0.655000	0.94253	GTT	GPR158	-	NULL	ENSG00000151025		0.458	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	20	0	G	XM_166110		25888066	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	missense	42.86	8	6	SNP	1.000	A
GPR158	57512	genome.wustl.edu	37	10	25888066	25888066	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:25888066G>A	ENST00000376351.3	+	11	3870	c.3511G>A	c.(3511-3513)Gtt>Att	p.V1171I	GPR158_ENST00000490549.1_3'UTR	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	1171					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ACGAGCAGAGGTTTGTCCTTG	0.458																																																	0													50.0	54.0	53.0					10																	25888066		2203	4300	6503	SO:0001583	missense	0			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.3511G>A	10.37:g.25888066G>A	ENSP00000365529:p.Val1171Ile		Q6QR81|Q9ULT3	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.V1171I	ENST00000376351.3	37	c.3511	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	G	5.422	0.263090	0.10294	.	.	ENSG00000151025	ENST00000376351	T	0.68765	-0.35	5.74	5.74	0.90152	.	0.000000	0.64402	D	0.000005	T	0.52645	0.1747	L	0.34521	1.04	0.43263	D	0.995204	B	0.33857	0.429	B	0.26202	0.067	T	0.51521	-0.8695	10	0.28530	T	0.3	.	14.1165	0.65156	0.0715:0.0:0.9285:0.0	.	1171	Q5T848	GP158_HUMAN	I	1171	ENSP00000365529:V1171I	ENSP00000365529:V1171I	V	+	1	0	GPR158	25928072	1.000000	0.71417	1.000000	0.80357	0.060000	0.15804	4.916000	0.63362	2.702000	0.92279	0.655000	0.94253	GTT	GPR158	-	NULL	ENSG00000151025		0.458	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	-	0.00	24	0	G	XM_166110		25888066	+1	tier1	-	no_errors	ENST00000376351	ensembl	human	known	74_37	missense	42.86	8	6	SNP	1.000	A
GPR87	53836	genome.wustl.edu	37	3	151012365	151012365	+	Silent	SNP	G	G	A	rs149315251		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:151012365G>A	ENST00000260843.4	-	3	1133	c.669C>T	c.(667-669)atC>atT	p.I223I	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	223					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTAACATCCGATCAGAATCA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		18895	0.0		0.0	False		,,,				2504	0.001																0								G	,	3,4403	6.2+/-15.9	0,3,2200	111.0	100.0	104.0		669,	-5.6	0.4	3	dbSNP_134	104	0,8600		0,0,4300	no	coding-synonymous,intron	GPR87,MED12L	NM_023915.3,NM_053002.4	,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	223/359,	151012365	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.669C>T	3.37:g.151012365G>A			Q5KU35|Q96JZ8|Q9BXC2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.I223	ENST00000260843.4	37	c.669	CCDS3157.1	3																																																																																			GPR87	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000138271		0.463	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR87	HGNC	protein_coding	OTTHUMT00000357788.1	-	0.00	24	0	G			151012365	-1	tier1	rs149315251	no_errors	ENST00000260843	ensembl	human	known	74_37	silent	31.03	20	9	SNP	0.109	A
GPR87	53836	genome.wustl.edu	37	3	151012365	151012365	+	Silent	SNP	G	G	A	rs149315251		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:151012365G>A	ENST00000260843.4	-	3	1133	c.669C>T	c.(667-669)atC>atT	p.I223I	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	223					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGTAACATCCGATCAGAATCA	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		18895	0.0		0.0	False		,,,				2504	0.001																0								G	,	3,4403	6.2+/-15.9	0,3,2200	111.0	100.0	104.0		669,	-5.6	0.4	3	dbSNP_134	104	0,8600		0,0,4300	no	coding-synonymous,intron	GPR87,MED12L	NM_023915.3,NM_053002.4	,	0,3,6500	AA,AG,GG		0.0,0.0681,0.0231	,	223/359,	151012365	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	0			AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.669C>T	3.37:g.151012365G>A			Q5KU35|Q96JZ8|Q9BXC2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2Y13_rcpt,prints_P2Y14_rcpt	p.I223	ENST00000260843.4	37	c.669	CCDS3157.1	3																																																																																			GPR87	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000138271		0.463	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR87	HGNC	protein_coding	OTTHUMT00000357788.1	-	0.00	25	0	G			151012365	-1	tier1	rs149315251	no_errors	ENST00000260843	ensembl	human	known	74_37	silent	31.03	20	9	SNP	0.109	A
GREB1L	80000	genome.wustl.edu	37	18	18981267	18981267	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:18981267G>A	ENST00000580732.2	+	6	1070	c.689G>A	c.(688-690)gGa>gAa	p.G230E	GREB1L_ENST00000400483.4_Missense_Mutation_p.G230E|GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000269218.6_Missense_Mutation_p.G230E|GREB1L_ENST00000431264.1_Missense_Mutation_p.G230E|GREB1L_ENST00000424526.1_Missense_Mutation_p.G230E			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	230						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CTGTCTAAAGGACCTCTTATC	0.443																																																	0													76.0	62.0	66.0					18																	18981267		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.689G>A	18.37:g.18981267G>A	ENSP00000464162:p.Gly230Glu		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.G230E	ENST00000580732.2	37	c.689	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202169	0.79127	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.32023	2.24;2.1;1.47;1.47	5.8	5.8	0.92144	.	.	.	.	.	T	0.59649	0.2209	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60999	-0.7151	9	0.87932	D	0	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	230;230	Q9C091;Q9C091-2	GRB1L_HUMAN;.	E	230	ENSP00000412060:G230E;ENSP00000269218:G230E;ENSP00000383331:G230E;ENSP00000393125:G230E	ENSP00000269218:G230E	G	+	2	0	GREB1L	17235265	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.869000	0.99810	2.744000	0.94065	0.655000	0.94253	GGA	GREB1L	-	NULL	ENSG00000141449		0.443	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	46	0	G	NM_024935		18981267	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	43.14	29	22	SNP	1.000	A
GREB1L	80000	genome.wustl.edu	37	18	18981267	18981267	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:18981267G>A	ENST00000580732.2	+	6	1070	c.689G>A	c.(688-690)gGa>gAa	p.G230E	GREB1L_ENST00000400483.4_Missense_Mutation_p.G230E|GREB1L_ENST00000578368.1_3'UTR|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000269218.6_Missense_Mutation_p.G230E|GREB1L_ENST00000431264.1_Missense_Mutation_p.G230E|GREB1L_ENST00000424526.1_Missense_Mutation_p.G230E			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	230						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CTGTCTAAAGGACCTCTTATC	0.443																																																	0													76.0	62.0	66.0					18																	18981267		692	1591	2283	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.689G>A	18.37:g.18981267G>A	ENSP00000464162:p.Gly230Glu		A4QN17|Q9H8F1	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.G230E	ENST00000580732.2	37	c.689	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202169	0.79127	.	.	ENSG00000141449	ENST00000424526;ENST00000269218;ENST00000400483;ENST00000431264	T;T;T;T	0.32023	2.24;2.1;1.47;1.47	5.8	5.8	0.92144	.	.	.	.	.	T	0.59649	0.2209	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.60999	-0.7151	9	0.87932	D	0	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	230;230	Q9C091;Q9C091-2	GRB1L_HUMAN;.	E	230	ENSP00000412060:G230E;ENSP00000269218:G230E;ENSP00000383331:G230E;ENSP00000393125:G230E	ENSP00000269218:G230E	G	+	2	0	GREB1L	17235265	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.869000	0.99810	2.744000	0.94065	0.655000	0.94253	GGA	GREB1L	-	NULL	ENSG00000141449		0.443	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	-	0.00	56	0	G	NM_024935		18981267	+1	tier1	-	no_errors	ENST00000424526	ensembl	human	known	74_37	missense	43.14	29	22	SNP	1.000	A
GRID1	2894	genome.wustl.edu	37	10	87484373	87484373	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:87484373A>C	ENST00000327946.7	-	11	1679	c.1594T>G	c.(1594-1596)Ttc>Gtc	p.F532V	GRID1_ENST00000536331.1_Missense_Mutation_p.F103V	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	532					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGCTTGCTGAAGTCCACAACG	0.498										Multiple Myeloma(13;0.14)																																							0													77.0	72.0	74.0					10																	87484373		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1594T>G	10.37:g.87484373A>C	ENSP00000330148:p.Phe532Val		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F532V	ENST00000327946.7	37	c.1594	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	A	28.3	4.906726	0.92107	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.54479	0.57;0.57	5.83	5.83	0.93111	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	H	0.97940	4.11	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.89277	0.3609	10	0.87932	D	0	.	15.3578	0.74440	1.0:0.0:0.0:0.0	.	532	Q9ULK0	GRID1_HUMAN	V	532;103	ENSP00000330148:F532V;ENSP00000444455:F103V	ENSP00000330148:F532V	F	-	1	0	GRID1	87474353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.253000	0.95501	2.212000	0.71576	0.528000	0.53228	TTC	GRID1	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.498	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	21	0	A	XM_043613		87484373	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	C
GRID1	2894	genome.wustl.edu	37	10	87484373	87484373	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:87484373A>C	ENST00000327946.7	-	11	1679	c.1594T>G	c.(1594-1596)Ttc>Gtc	p.F532V	GRID1_ENST00000536331.1_Missense_Mutation_p.F103V	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	532					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CGCTTGCTGAAGTCCACAACG	0.498										Multiple Myeloma(13;0.14)																																							0													77.0	72.0	74.0					10																	87484373		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.1594T>G	10.37:g.87484373A>C	ENSP00000330148:p.Phe532Val		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.F532V	ENST00000327946.7	37	c.1594	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	A	28.3	4.906726	0.92107	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.54479	0.57;0.57	5.83	5.83	0.93111	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	H	0.97940	4.11	0.80722	D	1	D	0.71674	0.998	D	0.85130	0.997	D	0.89277	0.3609	10	0.87932	D	0	.	15.3578	0.74440	1.0:0.0:0.0:0.0	.	532	Q9ULK0	GRID1_HUMAN	V	532;103	ENSP00000330148:F532V;ENSP00000444455:F103V	ENSP00000330148:F532V	F	-	1	0	GRID1	87474353	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.253000	0.95501	2.212000	0.71576	0.528000	0.53228	TTC	GRID1	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.498	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	23	0	A	XM_043613		87484373	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	missense	23.81	16	5	SNP	1.000	C
GRIK3	2899	genome.wustl.edu	37	1	37271783	37271783	+	Missense_Mutation	SNP	C	C	T	rs142411639	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:37271783C>T	ENST00000373091.3	-	14	2252	c.2236G>A	c.(2236-2238)Gtc>Atc	p.V746I	GRIK3_ENST00000373093.4_Missense_Mutation_p.V746I	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	746					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CTCTGCGTGACGTACTCGATG	0.642																																																	0								C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	195.0	138.0	157.0		2236	-0.2	1.0	1	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GRIK3	NM_000831.3	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	746/920	37271783	3,13003	2203	4300	6503	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2236G>A	1.37:g.37271783C>T	ENSP00000362183:p.Val746Ile		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V746I	ENST00000373091.3	37	c.2236	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.338160	0.24253	4.54E-4	1.16E-4	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.10763	2.84;2.84	5.31	-0.164	0.13359	Ionotropic glutamate receptor (2);	0.270885	0.34531	N	0.003882	T	0.04003	0.0112	N	0.11341	0.13	0.29126	N	0.879927	B;B	0.15719	0.014;0.014	B;B	0.19946	0.027;0.016	T	0.45556	-0.9253	10	0.02654	T	1	.	8.3483	0.32286	0.0:0.281:0.0:0.719	.	746;746	A9Z1Z8;Q13003	.;GRIK3_HUMAN	I	746	ENSP00000362183:V746I;ENSP00000362185:V746I	ENSP00000362183:V746I	V	-	1	0	GRIK3	37044370	0.992000	0.36948	0.996000	0.52242	0.989000	0.77384	0.782000	0.26788	0.068000	0.16574	0.549000	0.68633	GTC	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000163873		0.642	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	-	0.00	105	0	C	NM_000831		37271783	-1	tier1	rs142411639	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37271783	37271783	+	Missense_Mutation	SNP	C	C	T	rs142411639	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:37271783C>T	ENST00000373091.3	-	14	2252	c.2236G>A	c.(2236-2238)Gtc>Atc	p.V746I	GRIK3_ENST00000373093.4_Missense_Mutation_p.V746I	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	746					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CTCTGCGTGACGTACTCGATG	0.642																																																	0								C	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	195.0	138.0	157.0		2236	-0.2	1.0	1	dbSNP_134	157	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GRIK3	NM_000831.3	29	0,3,6500	TT,TC,CC		0.0116,0.0454,0.0231	benign	746/920	37271783	3,13003	2203	4300	6503	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2236G>A	1.37:g.37271783C>T	ENSP00000362183:p.Val746Ile		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V746I	ENST00000373091.3	37	c.2236	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	10.39	1.338160	0.24253	4.54E-4	1.16E-4	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.10763	2.84;2.84	5.31	-0.164	0.13359	Ionotropic glutamate receptor (2);	0.270885	0.34531	N	0.003882	T	0.04003	0.0112	N	0.11341	0.13	0.29126	N	0.879927	B;B	0.15719	0.014;0.014	B;B	0.19946	0.027;0.016	T	0.45556	-0.9253	10	0.02654	T	1	.	8.3483	0.32286	0.0:0.281:0.0:0.719	.	746;746	A9Z1Z8;Q13003	.;GRIK3_HUMAN	I	746	ENSP00000362183:V746I;ENSP00000362185:V746I	ENSP00000362183:V746I	V	-	1	0	GRIK3	37044370	0.992000	0.36948	0.996000	0.52242	0.989000	0.77384	0.782000	0.26788	0.068000	0.16574	0.549000	0.68633	GTC	GRIK3	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000163873		0.642	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	-	0.00	125	0	C	NM_000831		37271783	-1	tier1	rs142411639	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	9.84	55	6	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37337907	37337907	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:37337907C>T	ENST00000373091.3	-	4	630	c.614G>A	c.(613-615)cGt>cAt	p.R205H	GRIK3_ENST00000373093.4_Missense_Mutation_p.R205H	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	205					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGGGAGCTGACGGATCTTCAG	0.577																																																	0													106.0	89.0	95.0					1																	37337907		2203	4300	6503	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.614G>A	1.37:g.37337907C>T	ENSP00000362183:p.Arg205His		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R205H	ENST00000373091.3	37	c.614	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.372440	0.95923	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.23348	1.91;1.91	5.22	5.22	0.72569	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.70324	-0.4903	10	0.87932	D	0	.	18.7775	0.91916	0.0:1.0:0.0:0.0	.	205;205	A9Z1Z8;Q13003	.;GRIK3_HUMAN	H	205	ENSP00000362183:R205H;ENSP00000362185:R205H	ENSP00000362183:R205H	R	-	2	0	GRIK3	37110494	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.818000	0.86416	2.460000	0.83146	0.561000	0.74099	CGT	GRIK3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000163873		0.577	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	-	0.00	29	0	C	NM_000831		37337907	-1	tier1	-	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37337907	37337907	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:37337907C>T	ENST00000373091.3	-	4	630	c.614G>A	c.(613-615)cGt>cAt	p.R205H	GRIK3_ENST00000373093.4_Missense_Mutation_p.R205H	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	205					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GGGGAGCTGACGGATCTTCAG	0.577																																																	0													106.0	89.0	95.0					1																	37337907		2203	4300	6503	SO:0001583	missense	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.614G>A	1.37:g.37337907C>T	ENSP00000362183:p.Arg205His		A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R205H	ENST00000373091.3	37	c.614	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.372440	0.95923	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.23348	1.91;1.91	5.22	5.22	0.72569	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	T	0.60996	0.2312	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.70324	-0.4903	10	0.87932	D	0	.	18.7775	0.91916	0.0:1.0:0.0:0.0	.	205;205	A9Z1Z8;Q13003	.;GRIK3_HUMAN	H	205	ENSP00000362183:R205H;ENSP00000362185:R205H	ENSP00000362183:R205H	R	-	2	0	GRIK3	37110494	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.818000	0.86416	2.460000	0.83146	0.561000	0.74099	CGT	GRIK3	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000163873		0.577	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1	-	0.00	43	0	C	NM_000831		37337907	-1	tier1	-	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	T
GRIN2B	2904	genome.wustl.edu	37	12	13769499	13769499	+	Silent	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:13769499C>G	ENST00000609686.1	-	5	1427	c.1218G>C	c.(1216-1218)ctG>ctC	p.L406L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	406					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCACAATGCTCAGATGGTCAT	0.527																																																	0													214.0	190.0	198.0					12																	13769499		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1218G>C	12.37:g.13769499C>G			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L406	ENST00000609686.1	37	c.1218	CCDS8662.1	12																																																																																			GRIN2B	-	NULL	ENSG00000273079		0.527	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	-	0.00	85	0	C			13769499	-1	tier1	-	no_errors	ENST00000609686	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	G
GRIN2B	2904	genome.wustl.edu	37	12	13769499	13769499	+	Silent	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:13769499C>G	ENST00000609686.1	-	5	1427	c.1218G>C	c.(1216-1218)ctG>ctC	p.L406L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	406					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCACAATGCTCAGATGGTCAT	0.527																																																	0													214.0	190.0	198.0					12																	13769499		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1218G>C	12.37:g.13769499C>G			Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L406	ENST00000609686.1	37	c.1218	CCDS8662.1	12																																																																																			GRIN2B	-	NULL	ENSG00000273079		0.527	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	-	0.00	95	0	C			13769499	-1	tier1	-	no_errors	ENST00000609686	ensembl	human	known	74_37	silent	5.88	64	4	SNP	1.000	G
GUCY1A2	2977	genome.wustl.edu	37	11	106558367	106558367	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:106558367G>T	ENST00000526355.2	-	8	2575	c.2107C>A	c.(2107-2109)Cca>Aca	p.P703T	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.P734T|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.P724T	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	703					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GGTGGCTTTGGACCAGTCCTT	0.478																																																	0													148.0	148.0	148.0					11																	106558367		2201	4298	6499	SO:0001583	missense	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.2107C>A	11.37:g.106558367G>T	ENSP00000431245:p.Pro703Thr		A1L4C4|B7ZLT5	Missense_Mutation	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.P734T	ENST00000526355.2	37	c.2200	CCDS8335.1	11	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905610	0.33628	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.86497	-1.8;-2.13;-1.79	5.38	5.38	0.77491	.	0.169997	0.28031	U	0.016867	T	0.76485	0.3994	N	0.08118	0	0.44825	D	0.99783	P;B;P	0.39665	0.682;0.241;0.546	B;B;B	0.35550	0.205;0.08;0.205	T	0.80094	-0.1526	10	0.51188	T	0.08	.	18.4699	0.90769	0.0:0.0:1.0:0.0	.	724;734;703	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	T	703;734;724	ENSP00000431245:P703T;ENSP00000282249:P734T;ENSP00000344874:P724T	ENSP00000282249:P734T	P	-	1	0	GUCY1A2	106063577	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.389000	0.79806	2.689000	0.91719	0.305000	0.20034	CCA	GUCY1A2	-	superfamily_A/G_cyclase	ENSG00000152402		0.478	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2		0.00	102	0	G			106558367	-1			no_errors	ENST00000282249	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
GUCY2F	2986	genome.wustl.edu	37	X	108708491	108708491	+	Silent	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:108708491G>T	ENST00000218006.2	-	3	1203	c.912C>A	c.(910-912)ctC>ctA	p.L304L		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	304					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						AGGCTTCCCGGAGCTTTGGGT	0.488																																																	0													140.0	120.0	126.0					X																	108708491		2203	4300	6503	SO:0001819	synonymous_variant	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.912C>A	X.37:g.108708491G>T			Q9UJF1	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.L304	ENST00000218006.2	37	c.912	CCDS14545.1	X																																																																																			GUCY2F	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000101890		0.488	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	-	0.00	51	0	G	NM_001522		108708491	-1	tier1	-	no_errors	ENST00000218006	ensembl	human	known	74_37	silent	80.56	7	29	SNP	0.816	T
GUCY2F	2986	genome.wustl.edu	37	X	108708491	108708491	+	Silent	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:108708491G>T	ENST00000218006.2	-	3	1203	c.912C>A	c.(910-912)ctC>ctA	p.L304L		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	304					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						AGGCTTCCCGGAGCTTTGGGT	0.488																																																	0													140.0	120.0	126.0					X																	108708491		2203	4300	6503	SO:0001819	synonymous_variant	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.912C>A	X.37:g.108708491G>T			Q9UJF1	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Haem_no_assoc-bd,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.L304	ENST00000218006.2	37	c.912	CCDS14545.1	X																																																																																			GUCY2F	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000101890		0.488	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	-	0.00	54	0	G	NM_001522		108708491	-1	tier1	-	no_errors	ENST00000218006	ensembl	human	known	74_37	silent	80.56	7	29	SNP	0.816	T
HCN2	610	genome.wustl.edu	37	19	613434	613434	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:613434G>A	ENST00000251287.2	+	6	1824	c.1771G>A	c.(1771-1773)Gtg>Atg	p.V591M	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	591					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGGTCAGCGTGCTCACTAA	0.617																																					Melanoma(145;1175 2427 8056 36306)												0													91.0	77.0	82.0					19																	613434		2202	4299	6501	SO:0001583	missense	0			AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1771G>A	19.37:g.613434G>A	ENSP00000251287:p.Val591Met		O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.V591M	ENST00000251287.2	37	c.1771	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	16.79	3.221672	0.58560	.	.	ENSG00000099822	ENST00000251287	D	0.94687	-3.49	3.65	3.65	0.41850	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.96266	0.8782	M	0.77486	2.375	0.52099	D	0.999945	D	0.89917	1.0	D	0.70716	0.97	D	0.95912	0.8924	9	0.87932	D	0	.	8.7811	0.34792	0.124:0.0:0.876:0.0	.	591	Q9UL51	HCN2_HUMAN	M	591	ENSP00000251287:V591M	ENSP00000251287:V591M	V	+	1	0	HCN2	564434	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.603000	0.61105	1.764000	0.52075	0.493000	0.49557	GTG	HCN2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000099822		0.617	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1	-	0.00	23	0	G	NM_001194		613434	+1	tier1	-	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	35.71	9	5	SNP	1.000	A
HCN2	610	genome.wustl.edu	37	19	613434	613434	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:613434G>A	ENST00000251287.2	+	6	1824	c.1771G>A	c.(1771-1773)Gtg>Atg	p.V591M	AC005559.2_ENST00000591847.1_RNA	NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	591					cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGGTCAGCGTGCTCACTAA	0.617																																					Melanoma(145;1175 2427 8056 36306)												0													91.0	77.0	82.0					19																	613434		2202	4299	6501	SO:0001583	missense	0			AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.1771G>A	19.37:g.613434G>A	ENSP00000251287:p.Val591Met		O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.V591M	ENST00000251287.2	37	c.1771	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	16.79	3.221672	0.58560	.	.	ENSG00000099822	ENST00000251287	D	0.94687	-3.49	3.65	3.65	0.41850	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	.	.	.	.	D	0.96266	0.8782	M	0.77486	2.375	0.52099	D	0.999945	D	0.89917	1.0	D	0.70716	0.97	D	0.95912	0.8924	9	0.87932	D	0	.	8.7811	0.34792	0.124:0.0:0.876:0.0	.	591	Q9UL51	HCN2_HUMAN	M	591	ENSP00000251287:V591M	ENSP00000251287:V591M	V	+	1	0	HCN2	564434	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.603000	0.61105	1.764000	0.52075	0.493000	0.49557	GTG	HCN2	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000099822		0.617	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1	-	0.00	27	0	G	NM_001194		613434	+1	tier1	-	no_errors	ENST00000251287	ensembl	human	known	74_37	missense	35.71	9	5	SNP	1.000	A
HOOK1	51361	genome.wustl.edu	37	1	60333961	60333961	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:60333961G>T	ENST00000371208.3	+	20	2142	c.1885G>T	c.(1885-1887)Gct>Tct	p.A629S	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.A587S	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	629					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TCCAGCATCAGCTGAAATAAT	0.279																																																	0													53.0	60.0	58.0					1																	60333961		2203	4299	6502	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1885G>T	1.37:g.60333961G>T	ENSP00000360252:p.Ala629Ser		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.A629S	ENST00000371208.3	37	c.1885	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748595	0.89753	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.17691	2.26;2.26	5.99	5.99	0.97316	.	0.094754	0.64402	D	0.000001	T	0.18087	0.0434	L	0.43152	1.355	0.80722	D	1	P	0.42456	0.78	B	0.40782	0.34	T	0.02766	-1.1113	10	0.07482	T	0.82	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	629	Q9UJC3	HOOK1_HUMAN	S	629;587	ENSP00000360252:A629S;ENSP00000378928:A587S	ENSP00000360252:A629S	A	+	1	0	HOOK1	60106549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.772000	0.68889	2.840000	0.97914	0.655000	0.94253	GCT	HOOK1	-	pfam_Hook-related_fam	ENSG00000134709		0.279	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	-	0.00	50	0	G	NM_015888		60333961	+1	tier1	-	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	53.66	19	22	SNP	1.000	T
HOOK1	51361	genome.wustl.edu	37	1	60333961	60333961	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:60333961G>T	ENST00000371208.3	+	20	2142	c.1885G>T	c.(1885-1887)Gct>Tct	p.A629S	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.A587S	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	629					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TCCAGCATCAGCTGAAATAAT	0.279																																																	0													53.0	60.0	58.0					1																	60333961		2203	4299	6502	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1885G>T	1.37:g.60333961G>T	ENSP00000360252:p.Ala629Ser		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.A629S	ENST00000371208.3	37	c.1885	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.748595	0.89753	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.17691	2.26;2.26	5.99	5.99	0.97316	.	0.094754	0.64402	D	0.000001	T	0.18087	0.0434	L	0.43152	1.355	0.80722	D	1	P	0.42456	0.78	B	0.40782	0.34	T	0.02766	-1.1113	10	0.07482	T	0.82	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	629	Q9UJC3	HOOK1_HUMAN	S	629;587	ENSP00000360252:A629S;ENSP00000378928:A587S	ENSP00000360252:A629S	A	+	1	0	HOOK1	60106549	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.772000	0.68889	2.840000	0.97914	0.655000	0.94253	GCT	HOOK1	-	pfam_Hook-related_fam	ENSG00000134709		0.279	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	-	0.00	67	0	G	NM_015888		60333961	+1	tier1	-	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	53.66	19	22	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186099193	186099193	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:186099193G>A	ENST00000271588.4	+	84	13229	c.13000G>A	c.(13000-13002)Gtt>Att	p.V4334I	HMCN1_ENST00000367492.2_Missense_Mutation_p.V4334I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4334	Ig-like C2-type 42.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGAGAACAGCGTTGGCTTTGT	0.388																																																	0													152.0	141.0	145.0					1																	186099193		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13000G>A	1.37:g.186099193G>A	ENSP00000271588:p.Val4334Ile		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V4334I	ENST00000271588.4	37	c.13000	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228763	0.58777	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68181	-0.31;-0.31	5.62	3.76	0.43208	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	0.179434	0.49305	N	0.000156	T	0.49218	0.1544	N	0.20807	0.61	0.46874	D	0.99923	B	0.33512	0.415	B	0.35073	0.195	T	0.33420	-0.9869	10	0.22109	T	0.4	.	10.3958	0.44201	0.1503:0.0:0.8497:0.0	.	4334	Q96RW7	HMCN1_HUMAN	I	4334	ENSP00000271588:V4334I;ENSP00000356462:V4334I	ENSP00000271588:V4334I	V	+	1	0	HMCN1	184365816	1.000000	0.71417	0.685000	0.30070	0.845000	0.48019	4.193000	0.58385	0.739000	0.32628	0.655000	0.94253	GTT	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000143341		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	57	0	G	NM_031935		186099193	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	19.23	42	10	SNP	0.979	A
HMCN1	83872	genome.wustl.edu	37	1	186099193	186099193	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:186099193G>A	ENST00000271588.4	+	84	13229	c.13000G>A	c.(13000-13002)Gtt>Att	p.V4334I	HMCN1_ENST00000367492.2_Missense_Mutation_p.V4334I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4334	Ig-like C2-type 42.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGAGAACAGCGTTGGCTTTGT	0.388																																																	0													152.0	141.0	145.0					1																	186099193		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13000G>A	1.37:g.186099193G>A	ENSP00000271588:p.Val4334Ile		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V4334I	ENST00000271588.4	37	c.13000	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228763	0.58777	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68181	-0.31;-0.31	5.62	3.76	0.43208	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like fold (1);	0.179434	0.49305	N	0.000156	T	0.49218	0.1544	N	0.20807	0.61	0.46874	D	0.99923	B	0.33512	0.415	B	0.35073	0.195	T	0.33420	-0.9869	10	0.22109	T	0.4	.	10.3958	0.44201	0.1503:0.0:0.8497:0.0	.	4334	Q96RW7	HMCN1_HUMAN	I	4334	ENSP00000271588:V4334I;ENSP00000356462:V4334I	ENSP00000271588:V4334I	V	+	1	0	HMCN1	184365816	1.000000	0.71417	0.685000	0.30070	0.845000	0.48019	4.193000	0.58385	0.739000	0.32628	0.655000	0.94253	GTT	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000143341		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	62	0	G	NM_031935		186099193	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	19.23	42	10	SNP	0.979	A
HYKK	123688	genome.wustl.edu	37	15	78825722	78825722	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:78825722A>G	ENST00000569878.1	+	4	832	c.832A>G	c.(832-834)Aag>Gag	p.K278E	HYKK_ENST00000408962.2_Intron|HYKK_ENST00000563233.1_Intron|HYKK_ENST00000388988.4_Missense_Mutation_p.K278E			A2RU49	HYKK_HUMAN	hydroxylysine kinase	278						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										GATTGAGAGCAAGAGTCCTAT	0.428																																																	0													152.0	137.0	142.0					15																	78825722		1984	4167	6151	SO:0001583	missense	0			BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.832A>G	15.37:g.78825722A>G	ENSP00000455459:p.Lys278Glu		B7ZMA5|F8W6X5|Q6ZTN0	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.K278E	ENST00000569878.1	37	c.832	CCDS42063.1	15	.	.	.	.	.	.	.	.	.	.	A	1.242	-0.621103	0.03636	.	.	ENSG00000188266	ENST00000388988	T	0.27557	1.66	5.85	0.741	0.18336	Aminoglycoside phosphotransferase (1);	0.826473	0.11379	N	0.569963	T	0.16214	0.0390	L	0.31526	0.94	0.36797	D	0.885132	B	0.02656	0.0	B	0.09377	0.004	T	0.34104	-0.9842	10	0.02654	T	1	-3.2702	6.3205	0.21215	0.4456:0.3399:0.2145:0.0	.	278	A2RU49	AGPD1_HUMAN	E	278	ENSP00000373640:K278E	ENSP00000373640:K278E	K	+	1	0	AGPHD1	76612777	0.061000	0.20836	0.135000	0.22099	0.318000	0.28184	0.345000	0.19979	0.108000	0.17862	0.533000	0.62120	AAG	HYKK	-	pfam_Aminoglycoside_PTrfase	ENSG00000188266		0.428	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HYKK	HGNC	protein_coding	OTTHUMT00000435834.1	-	0.00	100	0	A	NM_001013619		78825722	+1	tier1	-	no_errors	ENST00000388988	ensembl	human	known	74_37	missense	53.93	41	48	SNP	0.035	G
HYKK	123688	genome.wustl.edu	37	15	78825722	78825722	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:78825722A>G	ENST00000569878.1	+	4	832	c.832A>G	c.(832-834)Aag>Gag	p.K278E	HYKK_ENST00000408962.2_Intron|HYKK_ENST00000563233.1_Intron|HYKK_ENST00000388988.4_Missense_Mutation_p.K278E			A2RU49	HYKK_HUMAN	hydroxylysine kinase	278						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										GATTGAGAGCAAGAGTCCTAT	0.428																																																	0													152.0	137.0	142.0					15																	78825722		1984	4167	6151	SO:0001583	missense	0			BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.832A>G	15.37:g.78825722A>G	ENSP00000455459:p.Lys278Glu		B7ZMA5|F8W6X5|Q6ZTN0	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.K278E	ENST00000569878.1	37	c.832	CCDS42063.1	15	.	.	.	.	.	.	.	.	.	.	A	1.242	-0.621103	0.03636	.	.	ENSG00000188266	ENST00000388988	T	0.27557	1.66	5.85	0.741	0.18336	Aminoglycoside phosphotransferase (1);	0.826473	0.11379	N	0.569963	T	0.16214	0.0390	L	0.31526	0.94	0.36797	D	0.885132	B	0.02656	0.0	B	0.09377	0.004	T	0.34104	-0.9842	10	0.02654	T	1	-3.2702	6.3205	0.21215	0.4456:0.3399:0.2145:0.0	.	278	A2RU49	AGPD1_HUMAN	E	278	ENSP00000373640:K278E	ENSP00000373640:K278E	K	+	1	0	AGPHD1	76612777	0.061000	0.20836	0.135000	0.22099	0.318000	0.28184	0.345000	0.19979	0.108000	0.17862	0.533000	0.62120	AAG	HYKK	-	pfam_Aminoglycoside_PTrfase	ENSG00000188266		0.428	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	HYKK	HGNC	protein_coding	OTTHUMT00000435834.1	-	0.00	106	0	A	NM_001013619		78825722	+1	tier1	-	no_errors	ENST00000388988	ensembl	human	known	74_37	missense	53.93	41	48	SNP	0.035	G
IRAK4	51135	genome.wustl.edu	37	12	44166789	44166790	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:44166789_44166790GG>TT	ENST00000448290.2	+	5	636_637	c.565_566GG>TT	c.(565-567)GGt>TTt	p.G189F	IRAK4_ENST00000440781.2_Missense_Mutation_p.G65F|IRAK4_ENST00000431837.1_Missense_Mutation_p.G65F|IRAK4_ENST00000551736.1_Missense_Mutation_p.G189F	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)					all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		TTCTGTTGGTGGTAATAAAATG	0.342																																																	0																																										SO:0001583	missense	0			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		Exception_encountered	12.37:g.44166789_44166790delinsTT	ENSP00000390651:p.Gly189Phe		Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation|Splice_Site	SNP	pirsf_IL-1_rcpt-assoc_kin4,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom|-	p.G189C|e2+1	ENST00000448290.2	37	c.565|c.183+1	CCDS8744.1	12																																																																																			IRAK4	-	pirsf_IL-1_rcpt-assoc_kin4,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom|-	ENSG00000198001		0.342	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK4	HGNC	protein_coding	OTTHUMT00000403947.1	-	0.00	63	0	G			44166789|44166790	+1	tier1	-	no_errors	ENST00000448290|ENST00000552309	ensembl	human	known	74_37	missense|splice_site	38.46	24	15	SNP	1.000|0.999	T
IRAK4	51135	genome.wustl.edu	37	12	44166789	44166790	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:44166789_44166790GG>TT	ENST00000448290.2	+	5	636_637	c.565_566GG>TT	c.(565-567)GGt>TTt	p.G189F	IRAK4_ENST00000440781.2_Missense_Mutation_p.G65F|IRAK4_ENST00000431837.1_Missense_Mutation_p.G65F|IRAK4_ENST00000551736.1_Missense_Mutation_p.G189F	NM_016123.3	NP_057207.2	Q9NWZ3	IRAK4_HUMAN	interleukin-1 receptor-associated kinase 4	189	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine production (GO:0001816)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)					all_cancers(12;0.00149)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.04)		TTCTGTTGGTGGTAATAAAATG	0.342																																																	0																																										SO:0001583	missense	0			AF155118	CCDS8744.1, CCDS44862.1	12q12	2014-09-17				ENSG00000198001			17967	protein-coding gene	gene with protein product		606883				3772297, 10508479	Standard	NM_001114182		Approved	NY-REN-64	uc001rnt.3	Q9NWZ3		Exception_encountered	12.37:g.44166789_44166790delinsTT	ENSP00000390651:p.Gly189Phe		Q69FE1|Q8TDF7|Q9Y589	Missense_Mutation|Splice_Site	SNP	pirsf_IL-1_rcpt-assoc_kin4,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom|-	p.G189C|e2+1	ENST00000448290.2	37	c.565|c.183+1	CCDS8744.1	12																																																																																			IRAK4	-	pirsf_IL-1_rcpt-assoc_kin4,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom|-	ENSG00000198001		0.342	IRAK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK4	HGNC	protein_coding	OTTHUMT00000403947.1	-	0.00	67|63	0	G			44166789|44166790	+1	tier1	-	no_errors	ENST00000448290|ENST00000552309	ensembl	human	known	74_37	missense|splice_site	38.46	24	15	SNP	1.000|0.999	T
JAKMIP2	9832	genome.wustl.edu	37	5	147040774	147040774	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:147040774G>A	ENST00000265272.5	-	3	831	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R122C|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R80C	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	122						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCCGTCGCGGAGAGCACAG	0.557																																																	0													136.0	133.0	134.0					5																	147040774		2203	4300	6503	SO:0001583	missense	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.364C>T	5.37:g.147040774G>A	ENSP00000265272:p.Arg122Cys		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	NULL	p.R122C	ENST00000265272.5	37	c.364	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420010	0.42918	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.09350	2.99;2.99;2.99	4.67	3.71	0.42584	.	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;0.998	D;P;P;P	0.76575	0.988;0.649;0.649;0.649	T	0.02901	-1.1096	10	0.87932	D	0	.	12.4018	0.55418	0.0:0.0:0.7172:0.2828	.	80;122;122;122	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	C	122;122;80;122	ENSP00000421398:R122C;ENSP00000265272:R122C;ENSP00000328989:R80C	ENSP00000265272:R122C	R	-	1	0	JAKMIP2	147020967	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	4.485000	0.60279	2.529000	0.85273	0.563000	0.77884	CGC	JAKMIP2	-	NULL	ENSG00000176049		0.557	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	59	0	G	NM_014790		147040774	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	missense	61.70	18	29	SNP	1.000	A
JAKMIP2	9832	genome.wustl.edu	37	5	147040774	147040774	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:147040774G>A	ENST00000265272.5	-	3	831	c.364C>T	c.(364-366)Cgc>Tgc	p.R122C	JAKMIP2_ENST00000507386.1_Missense_Mutation_p.R122C|JAKMIP2_ENST00000333010.6_Missense_Mutation_p.R80C	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	122						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGCCGTCGCGGAGAGCACAG	0.557																																																	0													136.0	133.0	134.0					5																	147040774		2203	4300	6503	SO:0001583	missense	0			AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.364C>T	5.37:g.147040774G>A	ENSP00000265272:p.Arg122Cys		A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	NULL	p.R122C	ENST00000265272.5	37	c.364	CCDS4285.1	5	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420010	0.42918	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.09350	2.99;2.99;2.99	4.67	3.71	0.42584	.	0.000000	0.85682	D	0.000000	T	0.30665	0.0772	M	0.76170	2.325	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;0.998	D;P;P;P	0.76575	0.988;0.649;0.649;0.649	T	0.02901	-1.1096	10	0.87932	D	0	.	12.4018	0.55418	0.0:0.0:0.7172:0.2828	.	80;122;122;122	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	C	122;122;80;122	ENSP00000421398:R122C;ENSP00000265272:R122C;ENSP00000328989:R80C	ENSP00000265272:R122C	R	-	1	0	JAKMIP2	147020967	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	4.485000	0.60279	2.529000	0.85273	0.563000	0.77884	CGC	JAKMIP2	-	NULL	ENSG00000176049		0.557	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP2	HGNC	protein_coding	OTTHUMT00000251941.1	-	0.00	76	0	G	NM_014790		147040774	-1	tier1	-	no_errors	ENST00000265272	ensembl	human	known	74_37	missense	61.70	18	29	SNP	1.000	A
JMJD1C	221037	genome.wustl.edu	37	10	64976993	64976993	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:64976993G>T	ENST00000399262.2	-	5	870	c.652C>A	c.(652-654)Cgc>Agc	p.R218S	JMJD1C_ENST00000489372.2_5'UTR|JMJD1C_ENST00000402544.1_5'UTR|JMJD1C_ENST00000399251.1_5'UTR|JMJD1C_ENST00000542921.1_Missense_Mutation_p.R36S	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	218					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATCATGGTGCGGGTGAAGAGA	0.373																																																	0													115.0	111.0	112.0					10																	64976993		1850	4104	5954	SO:0001583	missense	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.652C>A	10.37:g.64976993G>T	ENSP00000382204:p.Arg218Ser		A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.R218S	ENST00000399262.2	37	c.652	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919490	0.73098	.	.	ENSG00000171988	ENST00000399262;ENST00000542921	T;T	0.08896	3.04;3.04	5.74	5.74	0.90152	.	0.255682	0.32578	U	0.005909	T	0.13072	0.0317	L	0.50333	1.59	0.80722	D	1	B	0.21753	0.06	B	0.22601	0.04	T	0.02950	-1.1090	10	0.87932	D	0	-5.1461	19.915	0.97057	0.0:0.0:1.0:0.0	.	218	Q15652	JHD2C_HUMAN	S	218;36	ENSP00000382204:R218S;ENSP00000444682:R36S	ENSP00000382204:R218S	R	-	1	0	JMJD1C	64646999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.150000	0.64869	2.707000	0.92482	0.557000	0.71058	CGC	JMJD1C	-	NULL	ENSG00000171988		0.373	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	-	0.00	49	0	G	NM_004241		64976993	-1	tier1	-	no_errors	ENST00000399262	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
JMJD1C	221037	genome.wustl.edu	37	10	64976993	64976993	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:64976993G>T	ENST00000399262.2	-	5	870	c.652C>A	c.(652-654)Cgc>Agc	p.R218S	JMJD1C_ENST00000489372.2_5'UTR|JMJD1C_ENST00000402544.1_5'UTR|JMJD1C_ENST00000399251.1_5'UTR|JMJD1C_ENST00000542921.1_Missense_Mutation_p.R36S	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	218					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					ATCATGGTGCGGGTGAAGAGA	0.373																																																	0													115.0	111.0	112.0					10																	64976993		1850	4104	5954	SO:0001583	missense	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.652C>A	10.37:g.64976993G>T	ENSP00000382204:p.Arg218Ser		A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.R218S	ENST00000399262.2	37	c.652	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919490	0.73098	.	.	ENSG00000171988	ENST00000399262;ENST00000542921	T;T	0.08896	3.04;3.04	5.74	5.74	0.90152	.	0.255682	0.32578	U	0.005909	T	0.13072	0.0317	L	0.50333	1.59	0.80722	D	1	B	0.21753	0.06	B	0.22601	0.04	T	0.02950	-1.1090	10	0.87932	D	0	-5.1461	19.915	0.97057	0.0:0.0:1.0:0.0	.	218	Q15652	JHD2C_HUMAN	S	218;36	ENSP00000382204:R218S;ENSP00000444682:R36S	ENSP00000382204:R218S	R	-	1	0	JMJD1C	64646999	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.150000	0.64869	2.707000	0.92482	0.557000	0.71058	CGC	JMJD1C	-	NULL	ENSG00000171988		0.373	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	-	0.00	55	0	G	NM_004241		64976993	-1	tier1	-	no_errors	ENST00000399262	ensembl	human	known	74_37	missense	12.50	28	4	SNP	1.000	T
JAKMIP3	282973	genome.wustl.edu	37	10	133954069	133954069	+	Missense_Mutation	SNP	G	G	A	rs374337157		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:133954069G>A	ENST00000298622.4	+	9	1597	c.1459G>A	c.(1459-1461)Gat>Aat	p.D487N		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	487						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CACCCCGGACGATGACTTGGA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12065	0.0		0.0	False		,,,				2504	0.0																0								G	ASN/ASP	0,3922		0,0,1961	40.0	46.0	44.0		1459	4.2	0.1	10		44	1,8287		0,1,4143	no	missense	JAKMIP3	NM_001105521.2	23	0,1,6104	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	487/845	133954069	1,12209	1961	4144	6105	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1459G>A	10.37:g.133954069G>A	ENSP00000298622:p.Asp487Asn		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.D487N	ENST00000298622.4	37	c.1459	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217443	0.39201	0.0	1.21E-4	ENSG00000188385	ENST00000298622	T	0.23754	1.89	4.22	4.22	0.49857	.	0.066811	0.56097	D	0.000024	T	0.26919	0.0659	L	0.48642	1.525	0.43540	D	0.995839	D	0.56521	0.976	B	0.43990	0.438	T	0.04825	-1.0924	10	0.30078	T	0.28	-22.0962	16.7501	0.85483	0.0:0.0:1.0:0.0	.	487	Q5VZ66	JKIP3_HUMAN	N	487	ENSP00000298622:D487N	ENSP00000298622:D487N	D	+	1	0	JAKMIP3	133804059	1.000000	0.71417	0.118000	0.21660	0.010000	0.07245	5.859000	0.69539	2.196000	0.70406	0.655000	0.94253	GAT	JAKMIP3	-	NULL	ENSG00000188385		0.617	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	-	0.00	136	0	G	NM_194303		133954069	+1	tier1	-	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	24.39	62	20	SNP	0.963	A
JAKMIP3	282973	genome.wustl.edu	37	10	133954069	133954069	+	Missense_Mutation	SNP	G	G	A	rs374337157		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:133954069G>A	ENST00000298622.4	+	9	1597	c.1459G>A	c.(1459-1461)Gat>Aat	p.D487N		NM_001105521.2	NP_001098991.1	Q5VZ66	JKIP3_HUMAN	Janus kinase and microtubule interacting protein 3	487						Golgi apparatus (GO:0005794)				breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	31		all_cancers(35;5.63e-09)|all_epithelial(44;9.25e-07)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|Colorectal(31;0.0721)|all_neural(114;0.0726)|Breast(234;0.0949)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;0.000104)|Epithelial(32;0.000142)|all cancers(32;0.000185)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CACCCCGGACGATGACTTGGA	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12065	0.0		0.0	False		,,,				2504	0.0																0								G	ASN/ASP	0,3922		0,0,1961	40.0	46.0	44.0		1459	4.2	0.1	10		44	1,8287		0,1,4143	no	missense	JAKMIP3	NM_001105521.2	23	0,1,6104	AA,AG,GG		0.0121,0.0,0.0082	probably-damaging	487/845	133954069	1,12209	1961	4144	6105	SO:0001583	missense	0			AL832756	CCDS44494.1	10q26.3	2009-04-23	2009-04-23	2008-01-28	ENSG00000188385	ENSG00000188385			23523	protein-coding gene	gene with protein product	"""neuroendocrine long coiled-coil 2"""	611198	"""chromosome 10 open reading frame 39"", ""chromosome 10 open reading frame 14"""	C10orf39, C10orf14		15277531, 17572408	Standard	NM_001105521		Approved	FLJ37857, NECC2, KIAA4091, bA140A10.5	uc001lkx.4	Q5VZ66	OTTHUMG00000150167	ENST00000298622.4:c.1459G>A	10.37:g.133954069G>A	ENSP00000298622:p.Asp487Asn		A6PW00|Q69YM6|Q6ZT29	Missense_Mutation	SNP	NULL	p.D487N	ENST00000298622.4	37	c.1459	CCDS44494.1	10	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217443	0.39201	0.0	1.21E-4	ENSG00000188385	ENST00000298622	T	0.23754	1.89	4.22	4.22	0.49857	.	0.066811	0.56097	D	0.000024	T	0.26919	0.0659	L	0.48642	1.525	0.43540	D	0.995839	D	0.56521	0.976	B	0.43990	0.438	T	0.04825	-1.0924	10	0.30078	T	0.28	-22.0962	16.7501	0.85483	0.0:0.0:1.0:0.0	.	487	Q5VZ66	JKIP3_HUMAN	N	487	ENSP00000298622:D487N	ENSP00000298622:D487N	D	+	1	0	JAKMIP3	133804059	1.000000	0.71417	0.118000	0.21660	0.010000	0.07245	5.859000	0.69539	2.196000	0.70406	0.655000	0.94253	GAT	JAKMIP3	-	NULL	ENSG00000188385		0.617	JAKMIP3-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	JAKMIP3	HGNC	protein_coding	OTTHUMT00000051049.3	-	0.00	141	0	G	NM_194303		133954069	+1	tier1	-	no_errors	ENST00000298622	ensembl	human	known	74_37	missense	24.39	62	20	SNP	0.963	A
KALRN	8997	genome.wustl.edu	37	3	124420960	124420960	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:124420960G>A	ENST00000291478.5	+	24	3144	c.2981G>A	c.(2980-2982)gGa>gAa	p.G994E	KALRN_ENST00000428018.2_Missense_Mutation_p.G962E|KALRN_ENST00000360013.3_Missense_Mutation_p.G2691E	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2690					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AATGAAATTGGAAGGTAATGA	0.363																																																	0													123.0	120.0	121.0					3																	124420960		2203	4300	6503	SO:0001583	missense	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2981G>A	3.37:g.124420960G>A	ENSP00000291478:p.Gly994Glu		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G2691E	ENST00000291478.5	37	c.8072	CCDS3028.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.758209|4.758209	0.89843|0.89843	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000291478;ENST00000428018	.|D;D;D	.|0.82893	.|-1.66;-1.66;-1.66	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94381|0.94381	0.8193|0.8193	H|H	0.96489|0.96489	3.83|3.83	0.47245|0.47245	D|D	0.999369|0.999369	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	D|D	0.95608|0.95608	0.8669|0.8669	5|10	.|0.87932	.|D	.|0	.|.	19.3137|19.3137	0.94202|0.94202	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|994;2690	.|C9JQ37;O60229	.|.;KALRN_HUMAN	K|E	2660|2691;994;962	.|ENSP00000353109:G2691E;ENSP00000291478:G994E;ENSP00000402419:G962E	.|ENSP00000291478:G994E	E|G	+|+	1|2	0|0	KALRN|KALRN	125903650|125903650	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.993000|8.993000	0.93524|0.93524	2.788000|2.788000	0.95919|0.95919	0.650000|0.650000	0.86243|0.86243	GAA|GGA	KALRN	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160145		0.363	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	-	0.00	70	0	G	NM_003947		124420960	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	16.67	45	9	SNP	1.000	A
KALRN	8997	genome.wustl.edu	37	3	124420960	124420960	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:124420960G>A	ENST00000291478.5	+	24	3144	c.2981G>A	c.(2980-2982)gGa>gAa	p.G994E	KALRN_ENST00000428018.2_Missense_Mutation_p.G962E|KALRN_ENST00000360013.3_Missense_Mutation_p.G2691E	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2690					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						AATGAAATTGGAAGGTAATGA	0.363																																																	0													123.0	120.0	121.0					3																	124420960		2203	4300	6503	SO:0001583	missense	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2981G>A	3.37:g.124420960G>A	ENSP00000291478:p.Gly994Glu		A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.G2691E	ENST00000291478.5	37	c.8072	CCDS3028.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.758209|4.758209	0.89843|0.89843	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000291478;ENST00000428018	.|D;D;D	.|0.82893	.|-1.66;-1.66;-1.66	5.37|5.37	5.37|5.37	0.77165|0.77165	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94381|0.94381	0.8193|0.8193	H|H	0.96489|0.96489	3.83|3.83	0.47245|0.47245	D|D	0.999369|0.999369	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.999	D|D	0.95608|0.95608	0.8669|0.8669	5|10	.|0.87932	.|D	.|0	.|.	19.3137|19.3137	0.94202|0.94202	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|994;2690	.|C9JQ37;O60229	.|.;KALRN_HUMAN	K|E	2660|2691;994;962	.|ENSP00000353109:G2691E;ENSP00000291478:G994E;ENSP00000402419:G962E	.|ENSP00000291478:G994E	E|G	+|+	1|2	0|0	KALRN|KALRN	125903650|125903650	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	8.993000|8.993000	0.93524|0.93524	2.788000|2.788000	0.95919|0.95919	0.650000|0.650000	0.86243|0.86243	GAA|GGA	KALRN	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160145		0.363	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	-	0.00	78	0	G	NM_003947		124420960	+1	tier1	-	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	16.67	45	9	SNP	1.000	A
KCNG1	3755	genome.wustl.edu	37	20	49626152	49626152	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:49626152C>T	ENST00000371571.4	-	2	1009	c.724G>A	c.(724-726)Gtc>Atc	p.V242I	RP5-955M13.4_ENST00000424566.1_RNA|KCNG1_ENST00000506387.1_5'Flank|KCNG1_ENST00000396017.3_Missense_Mutation_p.V242I	NM_002237.3	NP_002228.2	Q9UIX4	KCNG1_HUMAN	potassium voltage-gated channel, subfamily G, member 1	242					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						GAGAGGTTGACGGCGGTGACG	0.682																																																	0													40.0	34.0	36.0					20																	49626152		2202	4300	6502	SO:0001583	missense	0			AF033383	CCDS13436.1	20q13	2011-07-05			ENSG00000026559	ENSG00000026559		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6248	protein-coding gene	gene with protein product		603788		KCNG		9434767, 16382104	Standard	NM_002237		Approved	Kv6.1, kH2, K13	uc002xwa.4	Q9UIX4	OTTHUMG00000032745	ENST00000371571.4:c.724G>A	20.37:g.49626152C>T	ENSP00000360626:p.Val242Ile		A8K3S4|O43528|Q5JXL5|Q9BRC1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.V242I	ENST00000371571.4	37	c.724	CCDS13436.1	20	.	.	.	.	.	.	.	.	.	.	C	13.92	2.381567	0.42207	.	.	ENSG00000026559	ENST00000371571;ENST00000396017;ENST00000439216	D;D;D	0.97404	-4.37;-2.71;-3.27	5.65	2.71	0.32032	.	0.245620	0.41097	N	0.000960	D	0.91798	0.7405	N	0.25890	0.77	0.39338	D	0.965533	B;B	0.31655	0.334;0.002	B;B	0.25140	0.058;0.002	D	0.86610	0.1872	9	.	.	.	.	10.5898	0.45304	0.0:0.7934:0.0:0.2066	.	242;242	Q9UIX4-2;Q9UIX4	.;KCNG1_HUMAN	I	242	ENSP00000360626:V242I;ENSP00000379338:V242I;ENSP00000394075:V242I	.	V	-	1	0	KCNG1	49059559	0.398000	0.25279	0.443000	0.26883	0.981000	0.71138	0.997000	0.29731	0.348000	0.23949	0.561000	0.74099	GTC	KCNG1	-	prints_K_chnl	ENSG00000026559		0.682	KCNG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNG1	HGNC	protein_coding	OTTHUMT00000079726.4	-	0.00	18	0	C	NM_002237		49626152	-1	tier1	-	no_errors	ENST00000371571	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.678	T
KCNJ4	3761	genome.wustl.edu	37	22	38823524	38823524	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:38823524C>T	ENST00000303592.3	-	2	872	c.614G>A	c.(613-615)cGc>cAc	p.R205H	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	205					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GTTGCCCACGCGCCACATGAG	0.657																																																	0													44.0	44.0	44.0					22																	38823524		2203	4299	6502	SO:0001583	missense	0			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.614G>A	22.37:g.38823524C>T	ENSP00000306497:p.Arg205His		Q14D44	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.3	p.R205H	ENST00000303592.3	37	c.614	CCDS13971.1	22	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696687	0.88830	.	.	ENSG00000168135	ENST00000303592	D	0.97256	-4.31	4.94	4.94	0.65067	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.99146	0.9705	H	0.97962	4.115	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	D	0.98988	1.0807	10	0.87932	D	0	.	18.5997	0.91244	0.0:1.0:0.0:0.0	.	205	P48050	IRK4_HUMAN	H	205	ENSP00000306497:R205H	ENSP00000306497:R205H	R	-	2	0	KCNJ4	37153470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.787000	0.85759	2.472000	0.83506	0.555000	0.69702	CGC	KCNJ4	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000168135		0.657	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ4	HGNC	protein_coding	OTTHUMT00000321447.1	-	0.00	38	0	C	NM_004981		38823524	-1	tier1	-	no_errors	ENST00000303592	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
KCNJ4	3761	genome.wustl.edu	37	22	38823524	38823524	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:38823524C>T	ENST00000303592.3	-	2	872	c.614G>A	c.(613-615)cGc>cAc	p.R205H	RP3-434P1.6_ENST00000433230.1_RNA	NM_004981.1|NM_152868.2	NP_004972.1|NP_690607.1	P48050	KCNJ4_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 4	205					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|PDZ domain binding (GO:0030165)			endometrium(7)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	23	Melanoma(58;0.0286)					GTTGCCCACGCGCCACATGAG	0.657																																																	0													44.0	44.0	44.0					22																	38823524		2203	4299	6502	SO:0001583	missense	0			U07364	CCDS13971.1	22q13.1	2011-07-05			ENSG00000168135	ENSG00000168135		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6265	protein-coding gene	gene with protein product		600504				8016146, 16382105	Standard	NM_152868		Approved	Kir2.3, HIR, HRK1, hIRK2, IRK3	uc003avs.1	P48050	OTTHUMG00000151131	ENST00000303592.3:c.614G>A	22.37:g.38823524C>T	ENSP00000306497:p.Arg205His		Q14D44	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.3	p.R205H	ENST00000303592.3	37	c.614	CCDS13971.1	22	.	.	.	.	.	.	.	.	.	.	C	26.0	4.696687	0.88830	.	.	ENSG00000168135	ENST00000303592	D	0.97256	-4.31	4.94	4.94	0.65067	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.99146	0.9705	H	0.97962	4.115	0.53688	D	0.999972	D	0.89917	1.0	D	0.97110	1.0	D	0.98988	1.0807	10	0.87932	D	0	.	18.5997	0.91244	0.0:1.0:0.0:0.0	.	205	P48050	IRK4_HUMAN	H	205	ENSP00000306497:R205H	ENSP00000306497:R205H	R	-	2	0	KCNJ4	37153470	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.787000	0.85759	2.472000	0.83506	0.555000	0.69702	CGC	KCNJ4	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000168135		0.657	KCNJ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ4	HGNC	protein_coding	OTTHUMT00000321447.1	-	0.00	57	0	C	NM_004981		38823524	-1	tier1	-	no_errors	ENST00000303592	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
KCNK13	56659	genome.wustl.edu	37	14	90650580	90650580	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:90650580G>A	ENST00000282146.4	+	2	901	c.460G>A	c.(460-462)Gcc>Acc	p.A154T		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	154					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.A154T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CACCATCATCGCCTACATCAT	0.567																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											92.0	95.0	94.0					14																	90650580		2203	4300	6503	SO:0001583	missense	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.460G>A	14.37:g.90650580G>A	ENSP00000282146:p.Ala154Thr		B5TJL8|Q96E79	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.A154T	ENST00000282146.4	37	c.460	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224152	0.58668	.	.	ENSG00000152315	ENST00000282146	T	0.24908	1.83	5.31	4.42	0.53409	.	0.177476	0.27375	N	0.019655	T	0.29223	0.0727	M	0.71206	2.165	0.80722	D	1	B	0.25312	0.123	B	0.21546	0.035	T	0.05068	-1.0908	10	0.30078	T	0.28	.	13.7227	0.62737	0.0747:0.0:0.9253:0.0	.	154	Q9HB14	KCNKD_HUMAN	T	154	ENSP00000282146:A154T	ENSP00000282146:A154T	A	+	1	0	KCNK13	89720333	1.000000	0.71417	0.975000	0.42487	0.735000	0.41995	6.739000	0.74827	1.235000	0.43724	0.655000	0.94253	GCC	KCNK13	-	NULL	ENSG00000152315		0.567	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1	-	0.00	30	0	G	NM_022054		90650580	+1	tier1	-	no_errors	ENST00000282146	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	A
KCNK13	56659	genome.wustl.edu	37	14	90650580	90650580	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:90650580G>A	ENST00000282146.4	+	2	901	c.460G>A	c.(460-462)Gcc>Acc	p.A154T		NM_022054.2	NP_071337.2	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	154					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)	p.A154T(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(12)|prostate(1)|skin(4)	25		all_cancers(154;0.186)				CACCATCATCGCCTACATCAT	0.567																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											92.0	95.0	94.0					14																	90650580		2203	4300	6503	SO:0001583	missense	0			AF287303	CCDS9889.1	14q32.11	2012-03-07				ENSG00000152315		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6275	protein-coding gene	gene with protein product		607367				11060316, 16382106	Standard	NM_022054		Approved	K2p13.1, THIK-1, THIK1	uc001xye.1	Q9HB14		ENST00000282146.4:c.460G>A	14.37:g.90650580G>A	ENSP00000282146:p.Ala154Thr		B5TJL8|Q96E79	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,prints_2pore_dom_K_chnl_THIK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TASK	p.A154T	ENST00000282146.4	37	c.460	CCDS9889.1	14	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224152	0.58668	.	.	ENSG00000152315	ENST00000282146	T	0.24908	1.83	5.31	4.42	0.53409	.	0.177476	0.27375	N	0.019655	T	0.29223	0.0727	M	0.71206	2.165	0.80722	D	1	B	0.25312	0.123	B	0.21546	0.035	T	0.05068	-1.0908	10	0.30078	T	0.28	.	13.7227	0.62737	0.0747:0.0:0.9253:0.0	.	154	Q9HB14	KCNKD_HUMAN	T	154	ENSP00000282146:A154T	ENSP00000282146:A154T	A	+	1	0	KCNK13	89720333	1.000000	0.71417	0.975000	0.42487	0.735000	0.41995	6.739000	0.74827	1.235000	0.43724	0.655000	0.94253	GCC	KCNK13	-	NULL	ENSG00000152315		0.567	KCNK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK13	HGNC	protein_coding	OTTHUMT00000411251.1	-	0.00	44	0	G	NM_022054		90650580	+1	tier1	-	no_errors	ENST00000282146	ensembl	human	known	74_37	missense	37.50	20	12	SNP	1.000	A
RIMS4	140730	genome.wustl.edu	37	20	43379389	43379389	+	IGR	SNP	C	C	T	rs374466555		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:43379389C>T	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Silent_p.R301R	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GGTGCGCCCGCGACAACCTGG	0.736																																																	0													4.0	3.0	3.0					20																	43379389		1749	3299	5048	SO:0001628	intergenic_variant	0				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43379389C>T			A4FU94|E1P613|Q3MI44|Q5JWT7	Silent	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_TASK5,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	p.R301	ENST00000372851.3	37	c.903	CCDS13338.1	20																																																																																			KCNK15	-	pirsf_2pore_dom_K_chnl_TASK	ENSG00000124249		0.736	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNK15	HGNC	protein_coding	OTTHUMT00000101027.2	-	0.00	18	0	C	NM_182970		43379389	+1	tier1	-	no_errors	ENST00000372861	ensembl	human	known	74_37	silent	44.44	5	4	SNP	0.066	T
RIMS4	140730	genome.wustl.edu	37	20	43379389	43379389	+	IGR	SNP	C	C	T	rs374466555		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:43379389C>T	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Silent_p.R301R	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GGTGCGCCCGCGACAACCTGG	0.736																																																	0													4.0	3.0	3.0					20																	43379389		1749	3299	5048	SO:0001628	intergenic_variant	0				CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43379389C>T			A4FU94|E1P613|Q3MI44|Q5JWT7	Silent	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_TASK5,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	p.R301	ENST00000372851.3	37	c.903	CCDS13338.1	20																																																																																			KCNK15	-	pirsf_2pore_dom_K_chnl_TASK	ENSG00000124249		0.736	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNK15	HGNC	protein_coding	OTTHUMT00000101027.2	-	0.00	21	0	C	NM_182970		43379389	+1	tier1	-	no_errors	ENST00000372861	ensembl	human	known	74_37	silent	44.44	5	4	SNP	0.066	T
KCNMA1	3778	genome.wustl.edu	37	10	78880764	78880764	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:78880764T>C	ENST00000286628.8	-	6	850	c.851A>G	c.(850-852)gAa>gGa	p.E284G	KCNMA1_ENST00000372440.1_Missense_Mutation_p.E284G|KCNMA1_ENST00000354353.5_Missense_Mutation_p.E284G|KCNMA1_ENST00000286627.5_Missense_Mutation_p.E284G|KCNMA1_ENST00000404857.1_Missense_Mutation_p.E284G|KCNMA1_ENST00000406533.3_Missense_Mutation_p.E284G|KCNMA1_ENST00000372443.1_Missense_Mutation_p.E284G|KCNMA1_ENST00000404771.3_Missense_Mutation_p.E284G	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	284					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CTGCAAAATTTCTGAAAACTG	0.323																																																	0													43.0	47.0	46.0					10																	78880764		2200	4298	6498	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.851A>G	10.37:g.78880764T>C	ENSP00000286628:p.Glu284Gly		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.E284G	ENST00000286628.8	37	c.851		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.7|27.7	4.859076|4.859076	0.91433|0.91433	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708|ENST00000372403	D;D;D;D;D;D;D;D;D|.	0.97378|.	-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36;-4.36|.	6.04|6.04	6.04|6.04	0.98038|0.98038	Ion transport (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56645|0.56645	0.1999|0.1999	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;P;P;D;D;D|.	0.89917|.	1.0;0.941;0.928;0.993;0.967;0.973|.	D;P;P;D;P;P|.	0.87578|.	0.998;0.739;0.79;0.973;0.79;0.867|.	T|T	0.52601|0.52601	-0.8554|-0.8554	10|5	0.87932|.	D|.	0|.	-13.8482|-13.8482	16.2378|16.2378	0.82389|0.82389	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	284;284;284;284;284;284|.	Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;Q5SVJ7|.	.;.;.;KCMA1_HUMAN;.;.|.	G|E	284;221;219;258;221;284;284;258;284;284;284;66|235	ENSP00000361517:E284G;ENSP00000361485:E221G;ENSP00000361514:E219G;ENSP00000396608:E258G;ENSP00000361520:E284G;ENSP00000286627:E284G;ENSP00000385552:E284G;ENSP00000346321:E284G;ENSP00000385806:E284G|.	ENSP00000286627:E284G|.	E|K	-|-	2|1	0|0	KCNMA1|KCNMA1	78550770|78550770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.934000|7.934000	0.87649|0.87649	2.317000|2.317000	0.78254|0.78254	0.459000|0.459000	0.35465|0.35465	GAA|AAA	KCNMA1	-	pfam_Ion_trans_dom	ENSG00000156113		0.323	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	63	0	T	NM_002247		78880764	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	44.23	29	23	SNP	1.000	C
KCNMB2	10242	genome.wustl.edu	37	3	178538392	178538392	+	Intron	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:178538392T>C	ENST00000432997.1	+	3	408				KCNMB2_ENST00000452583.1_Intron|KCNMB2_ENST00000470361.2_Intron|RP11-385J1.2_ENST00000451742.1_RNA|RP11-385J1.2_ENST00000437488.1_RNA|KCNMB2_ENST00000358316.3_Intron|RP11-385J1.2_ENST00000432385.1_RNA|KCNMB2_ENST00000420517.2_Intron|RP11-385J1.2_ENST00000425330.1_RNA	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2						action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	CATATTTGTATGTGCATGGCC	0.328																																																	0																																										SO:0001627	intron_variant	0			AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.57-4984T>C	3.37:g.178538392T>C			B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	RNA	SNP	-	NULL	ENST00000432997.1	37	NULL	CCDS3223.1	3																																																																																			KCNMB2	-	-	ENSG00000197584		0.328	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNMB2	HGNC	protein_coding	OTTHUMT00000348251.1	-	0.00	66	0	T	NM_181361		178538392	+1	tier1	-	no_errors	ENST00000436247	ensembl	human	putative	74_37	rna	6.56	57	4	SNP	0.000	C
KCNMB2	10242	genome.wustl.edu	37	3	178538392	178538392	+	Intron	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:178538392T>C	ENST00000432997.1	+	3	408				KCNMB2_ENST00000452583.1_Intron|KCNMB2_ENST00000470361.2_Intron|RP11-385J1.2_ENST00000451742.1_RNA|RP11-385J1.2_ENST00000437488.1_RNA|KCNMB2_ENST00000358316.3_Intron|RP11-385J1.2_ENST00000432385.1_RNA|KCNMB2_ENST00000420517.2_Intron|RP11-385J1.2_ENST00000425330.1_RNA	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2						action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	CATATTTGTATGTGCATGGCC	0.328																																																	0																																										SO:0001627	intron_variant	0			AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.57-4984T>C	3.37:g.178538392T>C			B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	RNA	SNP	-	NULL	ENST00000432997.1	37	NULL	CCDS3223.1	3																																																																																			KCNMB2	-	-	ENSG00000197584		0.328	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNMB2	HGNC	protein_coding	OTTHUMT00000348251.1	-	0.00	71	0	T	NM_181361		178538392	+1	tier1	-	no_errors	ENST00000436247	ensembl	human	putative	74_37	rna	6.56	57	4	SNP	0.000	C
KDM2A	22992	genome.wustl.edu	37	11	67023823	67023823	+	3'UTR	DEL	A	A	-	rs112132478		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:67023823delA	ENST00000529006.2	+	0	5232				KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TTTGCACTTTAAAAAAAAAAA	0.443																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1297A>-	11.37:g.67023823delA			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	DEL	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.443	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2		0.00	21	0	A	NM_012308		67023823	+1	tier1		no_errors	ENST00000524657	ensembl	human	known	74_37	rna	18.75	13	3	DEL	1.000	-
KGFLP2	654466	genome.wustl.edu	37	9	41962641	41962641	+	lincRNA	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:41962641G>C	ENST00000454645.1	-	0	863					NR_003670.1																						TTGATTTAAGGCCACAAACAT	0.358																																																	0																																												0																															9.37:g.41962641G>C				RNA	SNP	-	NULL	ENST00000454645.1	37	NULL		9																																																																																			RP11-204M4.2	-	-	ENSG00000204837		0.358	RP11-204M4.2-001	KNOWN	basic	lincRNA	KGFLP2	Clone_based_vega_gene	lincRNA	OTTHUMT00000143738.1	-	0.00	439	0	G			41962641	-1	tier1	-	no_errors	ENST00000454645	ensembl	human	known	74_37	rna	7.51	344	28	SNP	1.000	C
KGFLP2	654466	genome.wustl.edu	37	9	41962641	41962641	+	lincRNA	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:41962641G>C	ENST00000454645.1	-	0	863					NR_003670.1																						TTGATTTAAGGCCACAAACAT	0.358																																																	0																																												0																															9.37:g.41962641G>C				RNA	SNP	-	NULL	ENST00000454645.1	37	NULL		9																																																																																			RP11-204M4.2	-	-	ENSG00000204837		0.358	RP11-204M4.2-001	KNOWN	basic	lincRNA	KGFLP2	Clone_based_vega_gene	lincRNA	OTTHUMT00000143738.1	-	0.00	443	0	G			41962641	-1	tier1	-	no_errors	ENST00000454645	ensembl	human	known	74_37	rna	7.51	344	28	SNP	1.000	C
KIDINS220	57498	genome.wustl.edu	37	2	8890383	8890383	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:8890383C>T	ENST00000256707.3	-	24	3454	c.3273G>A	c.(3271-3273)gcG>gcA	p.A1091A	KIDINS220_ENST00000418530.1_Silent_p.A1049A|KIDINS220_ENST00000473731.1_Silent_p.A1091A|KIDINS220_ENST00000427284.1_Silent_p.A1091A	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1091	Mediates interaction with CRKL. {ECO:0000250}.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACCCTGATGGCGCCCTAGGAG	0.577																																																	0													65.0	69.0	67.0					2																	8890383		1986	4152	6138	SO:0001819	synonymous_variant	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3273G>A	2.37:g.8890383C>T			A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1091	ENST00000256707.3	37	c.3273	CCDS42650.1	2																																																																																			KIDINS220	-	NULL	ENSG00000134313		0.577	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	-	0.00	27	0	C	NM_020738		8890383	-1	tier1	-	no_errors	ENST00000256707	ensembl	human	known	74_37	silent	17.39	19	4	SNP	0.000	T
KIDINS220	57498	genome.wustl.edu	37	2	8890383	8890383	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:8890383C>T	ENST00000256707.3	-	24	3454	c.3273G>A	c.(3271-3273)gcG>gcA	p.A1091A	KIDINS220_ENST00000418530.1_Silent_p.A1049A|KIDINS220_ENST00000473731.1_Silent_p.A1091A|KIDINS220_ENST00000427284.1_Silent_p.A1091A	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1091	Mediates interaction with CRKL. {ECO:0000250}.				activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ACCCTGATGGCGCCCTAGGAG	0.577																																																	0													65.0	69.0	67.0					2																	8890383		1986	4152	6138	SO:0001819	synonymous_variant	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3273G>A	2.37:g.8890383C>T			A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Silent	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1091	ENST00000256707.3	37	c.3273	CCDS42650.1	2																																																																																			KIDINS220	-	NULL	ENSG00000134313		0.577	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	-	0.00	28	0	C	NM_020738		8890383	-1	tier1	-	no_errors	ENST00000256707	ensembl	human	known	74_37	silent	17.39	19	4	SNP	0.000	T
Unknown	0	genome.wustl.edu	37	GL000209.1	73926	73926	+	IGR	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrGL000209.1:73926C>T								None (None upstream) : None (None downstream)																							ACAGATGCTACGGTTCTGTTA	0.537																																																	0																																										SO:0001628	intergenic_variant	0																															GL000209.1.37:g.73926C>T				Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.Y196		37	c.588		GL000209.1																																																																																			KIR2DL2	-	smart_Ig_sub	ENSG00000215764	0	0.537					KIR2DL2	HGNC			-	0.00	111	0	C			73926	+1	tier1	-	no_errors	ENST00000400847	ensembl	human	known	74_37	silent	73.68	15	42	SNP	NULL	T
Unknown	0	genome.wustl.edu	37	GL000209.1	73926	73926	+	IGR	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrGL000209.1:73926C>T								None (None upstream) : None (None downstream)																							ACAGATGCTACGGTTCTGTTA	0.537																																																	0																																										SO:0001628	intergenic_variant	0																															GL000209.1.37:g.73926C>T				Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.Y196		37	c.588		GL000209.1																																																																																			KIR2DL2	-	smart_Ig_sub	ENSG00000215764	0	0.537					KIR2DL2	HGNC			-	0.00	86	0	C			73926	+1	tier1	-	no_errors	ENST00000400847	ensembl	human	known	74_37	silent	73.68	15	42	SNP	NULL	T
KLHL18	23276	genome.wustl.edu	37	3	47371501	47371501	+	Silent	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:47371501G>C	ENST00000232766.5	+	4	482	c.462G>C	c.(460-462)gtG>gtC	p.V154V	KLHL18_ENST00000455924.2_Silent_p.V42V	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	154	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		TGTGTGCTGTGCTGTACGACG	0.498																																																	0													127.0	122.0	124.0					3																	47371501		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.462G>C	3.37:g.47371501G>C			A8K612|Q7Z3E8|Q8N125	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V154	ENST00000232766.5	37	c.462	CCDS33749.1	3																																																																																			KLHL18	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000114648		0.498	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL18	HGNC	protein_coding	OTTHUMT00000344493.1	-	0.00	64	0	G	NM_025010		47371501	+1	tier1	-	no_errors	ENST00000232766	ensembl	human	known	74_37	silent	17.86	23	5	SNP	1.000	C
KLHL18	23276	genome.wustl.edu	37	3	47371501	47371501	+	Silent	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:47371501G>C	ENST00000232766.5	+	4	482	c.462G>C	c.(460-462)gtG>gtC	p.V154V	KLHL18_ENST00000455924.2_Silent_p.V42V	NM_025010.4	NP_079286.2	O94889	KLH18_HUMAN	kelch-like family member 18	154	BACK.									endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	21		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00645)|Kidney(197;0.00741)		TGTGTGCTGTGCTGTACGACG	0.498																																																	0													127.0	122.0	124.0					3																	47371501		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018338	CCDS33749.1	3p21	2013-01-30	2013-01-30		ENSG00000114648	ENSG00000114648		"""Kelch-like"", ""BTB/POZ domain containing"""	29120	protein-coding gene	gene with protein product			"""kelch-like 18 (Drosophila)"""			9872452	Standard	NM_025010		Approved	KIAA0795, FLJ13703	uc003crd.3	O94889	OTTHUMG00000156522	ENST00000232766.5:c.462G>C	3.37:g.47371501G>C			A8K612|Q7Z3E8|Q8N125	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V154	ENST00000232766.5	37	c.462	CCDS33749.1	3																																																																																			KLHL18	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000114648		0.498	KLHL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL18	HGNC	protein_coding	OTTHUMT00000344493.1	-	0.00	71	0	G	NM_025010		47371501	+1	tier1	-	no_errors	ENST00000232766	ensembl	human	known	74_37	silent	17.86	23	5	SNP	1.000	C
KMT2D	8085	genome.wustl.edu	37	12	49426583	49426583	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:49426583G>A	ENST00000301067.7	-	39	11904	c.11905C>T	c.(11905-11907)Cag>Tag	p.Q3969*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3969	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3699*(1)									tgttgctgctgctgttgaaac	0.522																																																	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											57.0	60.0	59.0					12																	49426583		2150	4208	6358	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11905C>T	12.37:g.49426583G>A	ENSP00000301067:p.Gln3969*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3969*	ENST00000301067.7	37	c.11905	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	g	49	15.557270	0.99838	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.63	3.73	0.42828	.	0.302441	0.19000	N	0.125365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.7244	0.28750	0.0909:0.165:0.7441:0.0	.	.	.	.	X	3969	.	ENSP00000301067:Q3969X	Q	-	1	0	MLL2	47712850	0.986000	0.35501	0.035000	0.18076	0.025000	0.11179	1.370000	0.34238	1.083000	0.41159	0.655000	0.94253	CAG	KMT2D	-	NULL	ENSG00000167548		0.522	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	76	0	G			49426583	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense	28.57	35	14	SNP	0.013	A
KMT2D	8085	genome.wustl.edu	37	12	49426583	49426583	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:49426583G>A	ENST00000301067.7	-	39	11904	c.11905C>T	c.(11905-11907)Cag>Tag	p.Q3969*	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3969	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q3699*(1)									tgttgctgctgctgttgaaac	0.522																																																	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											57.0	60.0	59.0					12																	49426583		2150	4208	6358	SO:0001587	stop_gained	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11905C>T	12.37:g.49426583G>A	ENSP00000301067:p.Gln3969*		O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3969*	ENST00000301067.7	37	c.11905	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	g	49	15.557270	0.99838	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.63	3.73	0.42828	.	0.302441	0.19000	N	0.125365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.7244	0.28750	0.0909:0.165:0.7441:0.0	.	.	.	.	X	3969	.	ENSP00000301067:Q3969X	Q	-	1	0	MLL2	47712850	0.986000	0.35501	0.035000	0.18076	0.025000	0.11179	1.370000	0.34238	1.083000	0.41159	0.655000	0.94253	CAG	KMT2D	-	NULL	ENSG00000167548		0.522	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	85	0	G			49426583	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	nonsense	28.57	35	14	SNP	0.013	A
KMT2D	8085	genome.wustl.edu	37	12	49433280	49433280	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:49433280C>T	ENST00000301067.7	-	32	8166	c.8167G>A	c.(8167-8169)Gag>Aag	p.E2723K	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2723					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTGCTGGGCTCAGCACCCCAG	0.627																																																	0													19.0	20.0	20.0					12																	49433280		2017	4179	6196	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8167G>A	12.37:g.49433280C>T	ENSP00000301067:p.Glu2723Lys		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E2723K	ENST00000301067.7	37	c.8167	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066269	0.55539	.	.	ENSG00000167548	ENST00000301067	D	0.86694	-2.16	5.45	5.45	0.79879	.	0.000000	0.38897	N	0.001527	D	0.87783	0.6264	L	0.42245	1.32	0.31300	N	0.688387	D	0.57257	0.979	P	0.49999	0.628	D	0.88380	0.3001	10	0.87932	D	0	.	18.432	0.90628	0.0:1.0:0.0:0.0	.	2723	O14686	MLL2_HUMAN	K	2723	ENSP00000301067:E2723K	ENSP00000301067:E2723K	E	-	1	0	MLL2	47719547	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.808000	0.55598	2.729000	0.93468	0.655000	0.94253	GAG	KMT2D	-	NULL	ENSG00000167548		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	47	0	C			49433280	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	T
KMT2D	8085	genome.wustl.edu	37	12	49433280	49433280	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:49433280C>T	ENST00000301067.7	-	32	8166	c.8167G>A	c.(8167-8169)Gag>Aag	p.E2723K	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	2723					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTGCTGGGCTCAGCACCCCAG	0.627																																																	0													19.0	20.0	20.0					12																	49433280		2017	4179	6196	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.8167G>A	12.37:g.49433280C>T	ENSP00000301067:p.Glu2723Lys		O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E2723K	ENST00000301067.7	37	c.8167	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066269	0.55539	.	.	ENSG00000167548	ENST00000301067	D	0.86694	-2.16	5.45	5.45	0.79879	.	0.000000	0.38897	N	0.001527	D	0.87783	0.6264	L	0.42245	1.32	0.31300	N	0.688387	D	0.57257	0.979	P	0.49999	0.628	D	0.88380	0.3001	10	0.87932	D	0	.	18.432	0.90628	0.0:1.0:0.0:0.0	.	2723	O14686	MLL2_HUMAN	K	2723	ENSP00000301067:E2723K	ENSP00000301067:E2723K	E	-	1	0	MLL2	47719547	0.993000	0.37304	1.000000	0.80357	0.997000	0.91878	3.808000	0.55598	2.729000	0.93468	0.655000	0.94253	GAG	KMT2D	-	NULL	ENSG00000167548		0.627	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	-	0.00	50	0	C			49433280	-1	tier1	-	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	37.50	15	9	SNP	1.000	T
KRTAP1-3	81850	genome.wustl.edu	37	17	39191010	39191010	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:39191010A>T	ENST00000344363.5	-	1	97	c.64T>A	c.(64-66)Tcc>Acc	p.S22T		NM_030966.1	NP_112228.1	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	22						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(6)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCAGCTGGAGCCGCATGTC	0.587																																																	0													41.0	49.0	47.0					17																	39191010		1974	4168	6142	SO:0001583	missense	0			AJ406927	CCDS42323.1	17q21.2	2013-06-20			ENSG00000221880	ENSG00000221880		"""Keratin associated proteins"""	16771	protein-coding gene	gene with protein product		608820				11279113	Standard	NM_030966		Approved	KAP1.3	uc002hvv.3	Q8IUG1	OTTHUMG00000133583	ENST00000344363.5:c.64T>A	17.37:g.39191010A>T	ENSP00000344420:p.Ser22Thr		Q07628|Q8IUG0|Q9BYS2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.S22T	ENST00000344363.5	37	c.64	CCDS42323.1	17	.	.	.	.	.	.	.	.	.	.	A	9.615	1.132314	0.21041	.	.	ENSG00000221880	ENST00000344363	T	0.33216	1.42	4.31	0.846	0.18955	.	.	.	.	.	T	0.15652	0.0377	.	.	.	0.26468	N	0.975321	B	0.09022	0.002	B	0.15484	0.013	T	0.30060	-0.9991	8	0.21014	T	0.42	.	3.8262	0.08855	0.6175:0.1859:0.1966:0.0	.	22	Q8IUG1	KRA13_HUMAN	T	22	ENSP00000344420:S22T	ENSP00000344420:S22T	S	-	1	0	KRTAP1-3	36444536	.	.	0.993000	0.49108	0.724000	0.41520	.	.	0.093000	0.17368	-0.376000	0.06991	TCC	KRTAP1-3	-	pfam_Keratin-assoc	ENSG00000221880		0.587	KRTAP1-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-3	HGNC	protein_coding	OTTHUMT00000257687.1		0.00	100	0	A			39191010	-1			no_errors	ENST00000344363	ensembl	human	known	74_37	missense	8.51	86	8	SNP	0.997	T
LAMA5	3911	genome.wustl.edu	37	20	60902360	60902360	+	Missense_Mutation	SNP	C	C	T	rs147438795		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:60902360C>T	ENST00000252999.3	-	38	5107	c.5041G>A	c.(5041-5043)Gtg>Atg	p.V1681M		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1681	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCTCAGGCACGTGCCGCAGG	0.687																																																	0								C	MET/VAL	3,4383		0,3,2190	27.0	23.0	24.0		5041	0.0	0.0	20	dbSNP_134	24	0,8592		0,0,4296	no	missense	LAMA5	NM_005560.3	21	0,3,6486	TT,TC,CC		0.0,0.0684,0.0231	possibly-damaging	1681/3696	60902360	3,12975	2193	4296	6489	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5041G>A	20.37:g.60902360C>T	ENSP00000252999:p.Val1681Met		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.V1681M	ENST00000252999.3	37	c.5041	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749831	0.30955	6.84E-4	0.0	ENSG00000130702	ENST00000252999	T	0.20598	2.06	4.78	0.0116	0.14088	Laminin B type IV (1);	0.204155	0.39834	U	0.001255	T	0.14313	0.0346	M	0.65975	2.015	0.09310	N	1	P	0.46859	0.885	B	0.31686	0.134	T	0.22312	-1.0220	10	0.38643	T	0.18	.	6.3597	0.21420	0.1224:0.3765:0.4281:0.073	.	1681	O15230	LAMA5_HUMAN	M	1681	ENSP00000252999:V1681M	ENSP00000252999:V1681M	V	-	1	0	LAMA5	60335755	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-1.369000	0.02578	-0.267000	0.09325	0.423000	0.28283	GTG	LAMA5	-	pfscan_Laminin_B_type_IV	ENSG00000130702		0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	61	0	C	NM_005560		60902360	-1	tier1	rs147438795	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	33.33	32	16	SNP	0.000	T
LAMA5	3911	genome.wustl.edu	37	20	60902360	60902360	+	Missense_Mutation	SNP	C	C	T	rs147438795		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:60902360C>T	ENST00000252999.3	-	38	5107	c.5041G>A	c.(5041-5043)Gtg>Atg	p.V1681M		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1681	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCCTCAGGCACGTGCCGCAGG	0.687																																																	0								C	MET/VAL	3,4383		0,3,2190	27.0	23.0	24.0		5041	0.0	0.0	20	dbSNP_134	24	0,8592		0,0,4296	no	missense	LAMA5	NM_005560.3	21	0,3,6486	TT,TC,CC		0.0,0.0684,0.0231	possibly-damaging	1681/3696	60902360	3,12975	2193	4296	6489	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5041G>A	20.37:g.60902360C>T	ENSP00000252999:p.Val1681Met		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.V1681M	ENST00000252999.3	37	c.5041	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	C	11.81	1.749831	0.30955	6.84E-4	0.0	ENSG00000130702	ENST00000252999	T	0.20598	2.06	4.78	0.0116	0.14088	Laminin B type IV (1);	0.204155	0.39834	U	0.001255	T	0.14313	0.0346	M	0.65975	2.015	0.09310	N	1	P	0.46859	0.885	B	0.31686	0.134	T	0.22312	-1.0220	10	0.38643	T	0.18	.	6.3597	0.21420	0.1224:0.3765:0.4281:0.073	.	1681	O15230	LAMA5_HUMAN	M	1681	ENSP00000252999:V1681M	ENSP00000252999:V1681M	V	-	1	0	LAMA5	60335755	0.000000	0.05858	0.000000	0.03702	0.176000	0.22953	-1.369000	0.02578	-0.267000	0.09325	0.423000	0.28283	GTG	LAMA5	-	pfscan_Laminin_B_type_IV	ENSG00000130702		0.687	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	87	0	C	NM_005560		60902360	-1	tier1	rs147438795	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	33.33	32	16	SNP	0.000	T
LHFPL3	375612	genome.wustl.edu	37	7	103969419	103969419	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:103969419C>T	ENST00000401970.2	+	1	272	c.150C>T	c.(148-150)ggC>ggT	p.G50G	LHFPL3_ENST00000543266.1_Silent_p.G64G|LHFPL3_ENST00000424859.1_Silent_p.G50G|LHFPL3_ENST00000535008.1_Silent_p.G64G			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	64						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						TAGGCGACGGCGTGGACACCC	0.622																																																	0													61.0	74.0	69.0					7																	103969419		2178	4292	6470	SO:0001819	synonymous_variant	0			AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.150C>T	7.37:g.103969419C>T			A1L383|A4D0Q5	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.G64	ENST00000401970.2	37	c.192		7																																																																																			LHFPL3	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000187416		0.622	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	LHFPL3	HGNC	protein_coding	OTTHUMT00000348284.1	-	0.00	38	0	C	NM_199000		103969419	+1	tier1	-	no_errors	ENST00000535008	ensembl	human	known	74_37	silent	30.00	28	12	SNP	1.000	T
LHFPL3	375612	genome.wustl.edu	37	7	103969419	103969419	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:103969419C>T	ENST00000401970.2	+	1	272	c.150C>T	c.(148-150)ggC>ggT	p.G50G	LHFPL3_ENST00000543266.1_Silent_p.G64G|LHFPL3_ENST00000424859.1_Silent_p.G50G|LHFPL3_ENST00000535008.1_Silent_p.G64G			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	64						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)	9						TAGGCGACGGCGTGGACACCC	0.622																																																	0													61.0	74.0	69.0					7																	103969419		2178	4292	6470	SO:0001819	synonymous_variant	0			AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000401970.2:c.150C>T	7.37:g.103969419C>T			A1L383|A4D0Q5	Silent	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.G64	ENST00000401970.2	37	c.192		7																																																																																			LHFPL3	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000187416		0.622	LHFPL3-002	PUTATIVE	basic|appris_principal	protein_coding	LHFPL3	HGNC	protein_coding	OTTHUMT00000348284.1	-	0.00	46	0	C	NM_199000		103969419	+1	tier1	-	no_errors	ENST00000535008	ensembl	human	known	74_37	silent	30.00	28	12	SNP	1.000	T
TUNAR	100507043	genome.wustl.edu	37	14	96389361	96389361	+	lincRNA	SNP	C	C	T	rs560724246	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:96389361C>T	ENST00000503525.2	+	0	650					NR_038861.1																						TCCTGCGTGTCGGCGCATCAC	0.502													C|||	4	0.000798722	0.0	0.0	5008	,	,		20946	0.0		0.0	False		,,,				2504	0.0041																0																																												0																															14.37:g.96389361C>T				RNA	SNP	-	NULL	ENST00000503525.2	37	NULL		14																																																																																			LINC00617	-	-	ENSG00000250366		0.502	LINC00617-002	KNOWN	basic	lincRNA	LINC00617	HGNC	lincRNA	OTTHUMT00000413257.1	-	0.00	20	0	C			96389361	+1	tier1	-	no_errors	ENST00000503525	ensembl	human	known	74_37	rna	43.75	9	7	SNP	0.000	T
LMO7	4008	genome.wustl.edu	37	13	76374826	76374826	+	Missense_Mutation	SNP	G	G	A	rs200309758		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:76374826G>A	ENST00000341547.4	+	8	1885	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	LMO7_ENST00000465261.2_5'UTR|LMO7_ENST00000377534.3_Missense_Mutation_p.E209K|LMO7_ENST00000526202.1_Missense_Mutation_p.E118K|LMO7_ENST00000321797.8_5'UTR|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.E209K	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	209					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTAGGCACTCGAAGACTCCAG	0.388																																																	0								G	LYS/GLU,	0,4406		0,0,2203	69.0	70.0	70.0		625,	5.8	1.0	13		70	1,8599	1.2+/-3.3	0,1,4299	yes	missense,utr-5	LMO7	NM_005358.5,NM_015842.2	56,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	209/1350,	76374826	1,13005	2203	4300	6503	SO:0001583	missense	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.625G>A	13.37:g.76374826G>A	ENSP00000342112:p.Glu209Lys		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.E209K	ENST00000341547.4	37	c.625	CCDS9454.1	13	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880803	0.91740	0.0	1.16E-4	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000526202	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.76	5.82	5.82	0.92795	.	0.120045	0.56097	D	0.000025	T	0.75889	0.3911	M	0.71581	2.175	0.44807	D	0.997818	D;D;D	0.89917	0.992;0.999;1.0	P;P;D	0.66084	0.608;0.803;0.941	T	0.76550	-0.2918	10	0.66056	D	0.02	-23.7706	20.089	0.97809	0.0:0.0:1.0:0.0	.	118;209;157	E9PMS6;Q8WWI1-3;F8J2B5	.;.;.	K	209;209;209;157;118	ENSP00000342112:E209K;ENSP00000349571:E209K;ENSP00000366757:E209K;ENSP00000366719:E157K;ENSP00000431129:E118K	ENSP00000342112:E209K	E	+	1	0	LMO7	75272827	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	6.920000	0.75799	2.765000	0.95021	0.591000	0.81541	GAA	LMO7	-	superfamily_CH-domain	ENSG00000136153		0.388	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045297.1	-	0.00	51	0	G	NM_005358		76374826	+1	tier1	rs200309758	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
LMO7	4008	genome.wustl.edu	37	13	76374826	76374826	+	Missense_Mutation	SNP	G	G	A	rs200309758		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:76374826G>A	ENST00000341547.4	+	8	1885	c.625G>A	c.(625-627)Gaa>Aaa	p.E209K	LMO7_ENST00000465261.2_5'UTR|LMO7_ENST00000377534.3_Missense_Mutation_p.E209K|LMO7_ENST00000526202.1_Missense_Mutation_p.E118K|LMO7_ENST00000321797.8_5'UTR|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000357063.3_Missense_Mutation_p.E209K	NM_005358.5	NP_005349.3	Q8WWI1	LMO7_HUMAN	LIM domain 7	209					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TTAGGCACTCGAAGACTCCAG	0.388																																																	0								G	LYS/GLU,	0,4406		0,0,2203	69.0	70.0	70.0		625,	5.8	1.0	13		70	1,8599	1.2+/-3.3	0,1,4299	yes	missense,utr-5	LMO7	NM_005358.5,NM_015842.2	56,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	209/1350,	76374826	1,13005	2203	4300	6503	SO:0001583	missense	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000341547.4:c.625G>A	13.37:g.76374826G>A	ENSP00000342112:p.Glu209Lys		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.E209K	ENST00000341547.4	37	c.625	CCDS9454.1	13	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880803	0.91740	0.0	1.16E-4	ENSG00000136153	ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000526202	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.76	5.82	5.82	0.92795	.	0.120045	0.56097	D	0.000025	T	0.75889	0.3911	M	0.71581	2.175	0.44807	D	0.997818	D;D;D	0.89917	0.992;0.999;1.0	P;P;D	0.66084	0.608;0.803;0.941	T	0.76550	-0.2918	10	0.66056	D	0.02	-23.7706	20.089	0.97809	0.0:0.0:1.0:0.0	.	118;209;157	E9PMS6;Q8WWI1-3;F8J2B5	.;.;.	K	209;209;209;157;118	ENSP00000342112:E209K;ENSP00000349571:E209K;ENSP00000366757:E209K;ENSP00000366719:E157K;ENSP00000431129:E118K	ENSP00000342112:E209K	E	+	1	0	LMO7	75272827	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	6.920000	0.75799	2.765000	0.95021	0.591000	0.81541	GAA	LMO7	-	superfamily_CH-domain	ENSG00000136153		0.388	LMO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045297.1	-	0.00	64	0	G	NM_005358		76374826	+1	tier1	rs200309758	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	A
RP11-435B5.5	0	genome.wustl.edu	37	1	143391669	143391669	+	lincRNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:143391669A>C	ENST00000428624.1	+	0	1885				RP11-435B5.4_ENST00000423249.1_lincRNA																							CTATGAAAAAAGTACAACAGG	0.313																																																	0																																												0																															1.37:g.143391669A>C				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.313	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	310	0	A			143391669	+1	tier1	-	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	23.60	203	63	SNP	0.001	C
RP11-435B5.5	0	genome.wustl.edu	37	1	143391669	143391669	+	lincRNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:143391669A>C	ENST00000428624.1	+	0	1885				RP11-435B5.4_ENST00000423249.1_lincRNA																							CTATGAAAAAAGTACAACAGG	0.313																																																	0																																												0																															1.37:g.143391669A>C				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.313	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	320	0	A			143391669	+1	tier1	-	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	23.60	203	63	SNP	0.001	C
PKD1P1	339044	genome.wustl.edu	37	16	16418925	16418925	+	3'UTR	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:16418925C>T	ENST00000537112.1	+	0	932					NR_036447.1																						CGCTGGTGTACGCCCTGCTGC	0.682																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000537112.1:c.*929C>T	16.37:g.16418925C>T				RNA	SNP	-	NULL	ENST00000537112.1	37	NULL		16																																																																																			AC138969.4	-	-	ENSG00000183889		0.682	AC138969.4-005	KNOWN	non_canonical_other|basic	processed_transcript	LOC101930008	Clone_based_vega_gene	protein_coding	OTTHUMT00000399242.1	-	0.00	24	0	C			16418925	+1	tier1	-	no_errors	ENST00000537112	ensembl	human	known	74_37	rna	33.33	4	2	SNP	1.000	T
PKD1P1	339044	genome.wustl.edu	37	16	16418925	16418925	+	3'UTR	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:16418925C>T	ENST00000537112.1	+	0	932					NR_036447.1																						CGCTGGTGTACGCCCTGCTGC	0.682																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000537112.1:c.*929C>T	16.37:g.16418925C>T				RNA	SNP	-	NULL	ENST00000537112.1	37	NULL		16																																																																																			AC138969.4	-	-	ENSG00000183889		0.682	AC138969.4-005	KNOWN	non_canonical_other|basic	processed_transcript	LOC101930008	Clone_based_vega_gene	protein_coding	OTTHUMT00000399242.1	-	0.00	26	0	C			16418925	+1	tier1	-	no_errors	ENST00000537112	ensembl	human	known	74_37	rna	33.33	4	2	SNP	1.000	T
LOC441666	441666	genome.wustl.edu	37	10	42848290	42848290	+	RNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:42848290A>C	ENST00000609841.1	-	0	159					NR_024380.1																						TTTCCACTGAAGCACAGCTTC	0.448																																																	0																																												0																															10.37:g.42848290A>C				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.448	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	87	0	A			42848290	-1	tier1	-	no_errors	ENST00000609502	ensembl	human	known	74_37	rna	30.34	62	27	SNP	0.014	C
LOC441666	441666	genome.wustl.edu	37	10	42848290	42848290	+	RNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:42848290A>C	ENST00000609841.1	-	0	159					NR_024380.1																						TTTCCACTGAAGCACAGCTTC	0.448																																																	0																																												0																															10.37:g.42848290A>C				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.448	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	89	0	A			42848290	-1	tier1	-	no_errors	ENST00000609502	ensembl	human	known	74_37	rna	30.34	62	27	SNP	0.014	C
LOC644669	644669	genome.wustl.edu	37	18	15323305	15323305	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:15323305T>G	ENST00000455308.2	-	0	543				RNU6-721P_ENST00000410155.1_RNA	NR_027417.1																						TCAGTAAAAATTCCACAATTT	0.299																																																	0																																												0																															18.37:g.15323305T>G				RNA	SNP	-	NULL	ENST00000455308.2	37	NULL		18																																																																																			AP005901.1	-	-	ENSG00000215512		0.299	AP005901.1-001	KNOWN	basic	processed_transcript	LOC644669	Clone_based_vega_gene	pseudogene	OTTHUMT00000373635.1	-	0.00	106	0	T			15323305	-1	tier1	-	no_errors	ENST00000455308	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.040	G
LOC644669	644669	genome.wustl.edu	37	18	15323305	15323305	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:15323305T>G	ENST00000455308.2	-	0	543				RNU6-721P_ENST00000410155.1_RNA	NR_027417.1																						TCAGTAAAAATTCCACAATTT	0.299																																																	0																																												0																															18.37:g.15323305T>G				RNA	SNP	-	NULL	ENST00000455308.2	37	NULL		18																																																																																			AP005901.1	-	-	ENSG00000215512		0.299	AP005901.1-001	KNOWN	basic	processed_transcript	LOC644669	Clone_based_vega_gene	pseudogene	OTTHUMT00000373635.1	-	0.00	92	0	T			15323305	-1	tier1	-	no_errors	ENST00000455308	ensembl	human	known	74_37	rna	13.21	46	7	SNP	0.040	G
LRBA	987	genome.wustl.edu	37	4	151817569	151817569	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:151817569T>A	ENST00000357115.3	-	16	2287	c.2044A>T	c.(2044-2046)Aat>Tat	p.N682Y	LRBA_ENST00000535741.1_Missense_Mutation_p.N682Y|LRBA_ENST00000507224.1_Missense_Mutation_p.N682Y|LRBA_ENST00000510413.1_Missense_Mutation_p.N682Y	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	682						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTAGGTAATTAAGAATGGCC	0.244																																																	0													71.0	70.0	70.0					4																	151817569		2198	4285	6483	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2044A>T	4.37:g.151817569T>A	ENSP00000349629:p.Asn682Tyr		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.N682Y	ENST00000357115.3	37	c.2044	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408016	0.83340	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80439	0.4623	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.83799	0.0235	10	0.72032	D	0.01	.	15.0827	0.72127	0.0:0.0:0.0:1.0	.	682;682	P50851;P50851-2	LRBA_HUMAN;.	Y	682	ENSP00000446299:N682Y;ENSP00000421552:N682Y;ENSP00000349629:N682Y;ENSP00000422180:N682Y	ENSP00000349629:N682Y	N	-	1	0	LRBA	152037019	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.755000	0.85180	2.004000	0.58718	0.482000	0.46254	AAT	LRBA	-	superfamily_ARM-type_fold	ENSG00000198589		0.244	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	68	0	T			151817569	-1	tier1	-	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	24.24	50	16	SNP	1.000	A
LRBA	987	genome.wustl.edu	37	4	151817569	151817569	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:151817569T>A	ENST00000357115.3	-	16	2287	c.2044A>T	c.(2044-2046)Aat>Tat	p.N682Y	LRBA_ENST00000535741.1_Missense_Mutation_p.N682Y|LRBA_ENST00000507224.1_Missense_Mutation_p.N682Y|LRBA_ENST00000510413.1_Missense_Mutation_p.N682Y	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	682						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					AGTAGGTAATTAAGAATGGCC	0.244																																																	0													71.0	70.0	70.0					4																	151817569		2198	4285	6483	SO:0001583	missense	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.2044A>T	4.37:g.151817569T>A	ENSP00000349629:p.Asn682Tyr		Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.N682Y	ENST00000357115.3	37	c.2044	CCDS3773.1	4	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408016	0.83340	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80439	0.4623	M	0.83012	2.62	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.83799	0.0235	10	0.72032	D	0.01	.	15.0827	0.72127	0.0:0.0:0.0:1.0	.	682;682	P50851;P50851-2	LRBA_HUMAN;.	Y	682	ENSP00000446299:N682Y;ENSP00000421552:N682Y;ENSP00000349629:N682Y;ENSP00000422180:N682Y	ENSP00000349629:N682Y	N	-	1	0	LRBA	152037019	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.755000	0.85180	2.004000	0.58718	0.482000	0.46254	AAT	LRBA	-	superfamily_ARM-type_fold	ENSG00000198589		0.244	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	-	0.00	69	0	T			151817569	-1	tier1	-	no_errors	ENST00000357115	ensembl	human	known	74_37	missense	24.24	50	16	SNP	1.000	A
LRP12	29967	genome.wustl.edu	37	8	105507424	105507424	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:105507424G>C	ENST00000276654.5	-	6	1702	c.1594C>G	c.(1594-1596)Cag>Gag	p.Q532E	LRP12_ENST00000424843.2_Missense_Mutation_p.Q513E|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	532					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGACAACTGTGTTTCAAAT	0.358																																																	0													90.0	96.0	94.0					8																	105507424		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1594C>G	8.37:g.105507424G>C	ENSP00000276654:p.Gln532Glu		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.Q513E	ENST00000276654.5	37	c.1537	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429485	0.62844	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523007	D;D;D	0.93763	-1.86;-1.8;-3.28	5.72	5.72	0.89469	.	0.100997	0.64402	D	0.000001	D	0.89719	0.6796	N	0.22421	0.69	0.80722	D	1	B;B	0.24483	0.073;0.104	B;B	0.24701	0.055;0.036	D	0.85097	0.0955	10	0.51188	T	0.08	-7.701	20.244	0.98389	0.0:0.0:1.0:0.0	.	513;532	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	E	513;532;121	ENSP00000399148:Q513E;ENSP00000276654:Q532E;ENSP00000429305:Q121E	ENSP00000276654:Q532E	Q	-	1	0	LRP12	105576600	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.799000	0.99117	2.865000	0.98341	0.655000	0.94253	CAG	LRP12	-	NULL	ENSG00000147650		0.358	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	25	0	G	NM_013437		105507424	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	C
LRP12	29967	genome.wustl.edu	37	8	105507424	105507424	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:105507424G>C	ENST00000276654.5	-	6	1702	c.1594C>G	c.(1594-1596)Cag>Gag	p.Q532E	LRP12_ENST00000424843.2_Missense_Mutation_p.Q513E|LRP12_ENST00000518375.1_5'UTR	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	532					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGACAACTGTGTTTCAAAT	0.358																																																	0													90.0	96.0	94.0					8																	105507424		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1594C>G	8.37:g.105507424G>C	ENSP00000276654:p.Gln532Glu		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.Q513E	ENST00000276654.5	37	c.1537	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429485	0.62844	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523007	D;D;D	0.93763	-1.86;-1.8;-3.28	5.72	5.72	0.89469	.	0.100997	0.64402	D	0.000001	D	0.89719	0.6796	N	0.22421	0.69	0.80722	D	1	B;B	0.24483	0.073;0.104	B;B	0.24701	0.055;0.036	D	0.85097	0.0955	10	0.51188	T	0.08	-7.701	20.244	0.98389	0.0:0.0:1.0:0.0	.	513;532	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	E	513;532;121	ENSP00000399148:Q513E;ENSP00000276654:Q532E;ENSP00000429305:Q121E	ENSP00000276654:Q532E	Q	-	1	0	LRP12	105576600	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.799000	0.99117	2.865000	0.98341	0.655000	0.94253	CAG	LRP12	-	NULL	ENSG00000147650		0.358	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	34	0	G	NM_013437		105507424	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	C
LRP1B	53353	genome.wustl.edu	37	2	141597656	141597656	+	Splice_Site	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:141597656T>G	ENST00000389484.3	-	31	6086		c.e31-2			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAGAGTTTTCTTAATTCAAAA	0.323										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													69.0	64.0	66.0					2																	141597656		2203	4299	6502	SO:0001630	splice_region_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5115-2A>C	2.37:g.141597656T>G			Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	-	e31-2	ENST00000389484.3	37	c.5115-2	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601387	0.87055	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5873	0.76495	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141314126	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.434000	0.80377	2.087000	0.62958	0.377000	0.23210	.	LRP1B	-	-	ENSG00000168702		0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	35	0	T	NM_018557	Intron	141597656	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	splice_site	29.63	19	8	SNP	1.000	G
LRP1B	53353	genome.wustl.edu	37	2	141597656	141597656	+	Splice_Site	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:141597656T>G	ENST00000389484.3	-	31	6086		c.e31-2			NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B						protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TAGAGTTTTCTTAATTCAAAA	0.323										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													69.0	64.0	66.0					2																	141597656		2203	4299	6502	SO:0001630	splice_region_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.5115-2A>C	2.37:g.141597656T>G			Q8WY29|Q8WY30|Q8WY31	Splice_Site	SNP	-	e31-2	ENST00000389484.3	37	c.5115-2	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	25.1	4.601387	0.87055	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5873	0.76495	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP1B	141314126	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.434000	0.80377	2.087000	0.62958	0.377000	0.23210	.	LRP1B	-	-	ENSG00000168702		0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	36	0	T	NM_018557	Intron	141597656	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	splice_site	29.63	19	8	SNP	1.000	G
LRP2	4036	genome.wustl.edu	37	2	170072829	170072829	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:170072829G>T	ENST00000263816.3	-	35	6045	c.5760C>A	c.(5758-5760)caC>caA	p.H1920Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1920					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACACTCCAGGTGTTCGAGGT	0.498																																																	0													146.0	131.0	136.0					2																	170072829		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5760C>A	2.37:g.170072829G>T	ENSP00000263816:p.His1920Gln		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H1920Q	ENST00000263816.3	37	c.5760	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	7.622	0.677113	0.14841	.	.	ENSG00000081479	ENST00000263816	D	0.96396	-4.0	5.49	-4.07	0.03975	Six-bladed beta-propeller, TolB-like (1);	0.147454	0.64402	D	0.000011	D	0.95840	0.8646	L	0.53617	1.68	0.38888	D	0.957059	D	0.60160	0.987	P	0.59357	0.856	D	0.93322	0.6693	10	0.30078	T	0.28	.	15.6567	0.77140	0.7004:0.0:0.2996:0.0	.	1920	P98164	LRP2_HUMAN	Q	1920	ENSP00000263816:H1920Q	ENSP00000263816:H1920Q	H	-	3	2	LRP2	169781075	0.002000	0.14202	0.001000	0.08648	0.210000	0.24377	0.006000	0.13152	-0.730000	0.04869	0.655000	0.94253	CAC	LRP2	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.498	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	59	0	G	NM_004525		170072829	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.024	T
LRP2	4036	genome.wustl.edu	37	2	170072829	170072829	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:170072829G>T	ENST00000263816.3	-	35	6045	c.5760C>A	c.(5758-5760)caC>caA	p.H1920Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1920					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACACTCCAGGTGTTCGAGGT	0.498																																																	0													146.0	131.0	136.0					2																	170072829		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5760C>A	2.37:g.170072829G>T	ENSP00000263816:p.His1920Gln		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.H1920Q	ENST00000263816.3	37	c.5760	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	7.622	0.677113	0.14841	.	.	ENSG00000081479	ENST00000263816	D	0.96396	-4.0	5.49	-4.07	0.03975	Six-bladed beta-propeller, TolB-like (1);	0.147454	0.64402	D	0.000011	D	0.95840	0.8646	L	0.53617	1.68	0.38888	D	0.957059	D	0.60160	0.987	P	0.59357	0.856	D	0.93322	0.6693	10	0.30078	T	0.28	.	15.6567	0.77140	0.7004:0.0:0.2996:0.0	.	1920	P98164	LRP2_HUMAN	Q	1920	ENSP00000263816:H1920Q	ENSP00000263816:H1920Q	H	-	3	2	LRP2	169781075	0.002000	0.14202	0.001000	0.08648	0.210000	0.24377	0.006000	0.13152	-0.730000	0.04869	0.655000	0.94253	CAC	LRP2	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.498	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	65	0	G	NM_004525		170072829	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.024	T
LRRC37A4P	55073	genome.wustl.edu	37	17	43592301	43592301	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:43592301G>A	ENST00000579913.1	-	0	221				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		CTGGACTCCCGAGCCTTTTTT	0.577																																																	0																																												0			AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43592301G>A				RNA	SNP	-	NULL	ENST00000579913.1	37	NULL		17																																																																																			LRRC37A4P	-	-	ENSG00000214425		0.577	LRRC37A4P-002	KNOWN	basic	processed_transcript	LRRC37A4P	HGNC	pseudogene	OTTHUMT00000445300.1	-	0.00	25	0	G	NR_002940		43592301	-1	tier1	-	no_errors	ENST00000579913	ensembl	human	known	74_37	rna	20.90	53	14	SNP	0.000	A
LRRC7	57554	genome.wustl.edu	37	1	70486774	70486774	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:70486774G>C	ENST00000035383.5	+	14	1423	c.1393G>C	c.(1393-1395)Gac>Cac	p.D465H	LRRC7_ENST00000310961.5_Missense_Mutation_p.D470H|RP11-181B18.1_ENST00000425754.1_RNA|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	465						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.D465H(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGAATTTGAAGACAAAAAAGA	0.388																																																	1	Substitution - Missense(1)	lung(1)											90.0	85.0	86.0					1																	70486774		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1393G>C	1.37:g.70486774G>C	ENSP00000035383:p.Asp465His		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.D465H	ENST00000035383.5	37	c.1393	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468610	0.84533	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.43294	0.95;1.02	5.72	5.72	0.89469	.	0.270973	0.41823	D	0.000809	T	0.24005	0.0581	N	0.14661	0.345	0.80722	D	1	P	0.45594	0.862	B	0.44278	0.445	T	0.06625	-1.0816	10	0.52906	T	0.07	.	18.8773	0.92343	0.0:0.0:1.0:0.0	.	465	Q96NW7	LRRC7_HUMAN	H	470;465;288	ENSP00000309245:D470H;ENSP00000035383:D465H	ENSP00000035383:D465H	D	+	1	0	LRRC7	70259362	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.399000	0.97285	2.689000	0.91719	0.655000	0.94253	GAC	LRRC7	-	NULL	ENSG00000033122		0.388	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	108	0	G	NM_020794		70486774	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	25.33	56	19	SNP	1.000	C
LRRC7	57554	genome.wustl.edu	37	1	70486774	70486774	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:70486774G>C	ENST00000035383.5	+	14	1423	c.1393G>C	c.(1393-1395)Gac>Cac	p.D465H	LRRC7_ENST00000310961.5_Missense_Mutation_p.D470H|RP11-181B18.1_ENST00000425754.1_RNA|RP11-181B18.1_ENST00000414132.1_RNA|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	465						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.D465H(1)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGAATTTGAAGACAAAAAAGA	0.388																																																	1	Substitution - Missense(1)	lung(1)											90.0	85.0	86.0					1																	70486774		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.1393G>C	1.37:g.70486774G>C	ENSP00000035383:p.Asp465His		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.D465H	ENST00000035383.5	37	c.1393	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468610	0.84533	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.43294	0.95;1.02	5.72	5.72	0.89469	.	0.270973	0.41823	D	0.000809	T	0.24005	0.0581	N	0.14661	0.345	0.80722	D	1	P	0.45594	0.862	B	0.44278	0.445	T	0.06625	-1.0816	10	0.52906	T	0.07	.	18.8773	0.92343	0.0:0.0:1.0:0.0	.	465	Q96NW7	LRRC7_HUMAN	H	470;465;288	ENSP00000309245:D470H;ENSP00000035383:D465H	ENSP00000035383:D465H	D	+	1	0	LRRC7	70259362	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.399000	0.97285	2.689000	0.91719	0.655000	0.94253	GAC	LRRC7	-	NULL	ENSG00000033122		0.388	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	98	0	G	NM_020794		70486774	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	25.33	56	19	SNP	1.000	C
LRRC8C	84230	genome.wustl.edu	37	1	90180085	90180085	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:90180085C>T	ENST00000370454.4	+	3	2211	c.1956C>T	c.(1954-1956)atC>atT	p.I652I	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	652					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TCACCTACATCCCAGAGCATA	0.418																																																	0													60.0	57.0	58.0					1																	90180085		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1956C>T	1.37:g.90180085C>T			B3KXS9|Q29RV6|Q9H075	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.I652	ENST00000370454.4	37	c.1956	CCDS725.1	1																																																																																			LRRC8C	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000171488		0.418	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	-	0.00	30	0	C	NM_032270		90180085	+1	tier1	-	no_errors	ENST00000370454	ensembl	human	known	74_37	silent	51.72	13	15	SNP	1.000	T
LRRC8C	84230	genome.wustl.edu	37	1	90180085	90180085	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:90180085C>T	ENST00000370454.4	+	3	2211	c.1956C>T	c.(1954-1956)atC>atT	p.I652I	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	652					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TCACCTACATCCCAGAGCATA	0.418																																																	0													60.0	57.0	58.0					1																	90180085		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.1956C>T	1.37:g.90180085C>T			B3KXS9|Q29RV6|Q9H075	Silent	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.I652	ENST00000370454.4	37	c.1956	CCDS725.1	1																																																																																			LRRC8C	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000171488		0.418	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	-	0.00	37	0	C	NM_032270		90180085	+1	tier1	-	no_errors	ENST00000370454	ensembl	human	known	74_37	silent	51.72	13	15	SNP	1.000	T
MAGEE1	57692	genome.wustl.edu	37	X	75649101	75649101	+	Missense_Mutation	SNP	G	G	A	rs374134344		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:75649101G>A	ENST00000361470.2	+	1	1056	c.778G>A	c.(778-780)Gtg>Atg	p.V260M		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	260	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GAGCACCTCCGTGCCGGCCAC	0.687																																																	0								G	MET/VAL	1,3831		0,1,1630,570	27.0	27.0	27.0		778	-2.8	0.0	X		27	0,6724		0,0,2427,1870	no	missense	MAGEE1	NM_020932.2	21	0,1,4057,2440	AA,AG,GG,G		0.0,0.0261,0.0095	benign	260/958	75649101	1,10555	2201	4297	6498	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.778G>A	X.37:g.75649101G>A	ENSP00000354912:p.Val260Met		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.V260M	ENST00000361470.2	37	c.778	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	g	1.396	-0.579340	0.03854	2.61E-4	0.0	ENSG00000198934	ENST00000361470	T	0.09817	2.94	2.28	-2.84	0.05751	.	.	.	.	.	T	0.05777	0.0151	N	0.19112	0.55	0.09310	N	1	B	0.24768	0.111	B	0.06405	0.002	T	0.28618	-1.0038	9	0.46703	T	0.11	.	6.2688	0.20943	0.2249:0.2904:0.4847:0.0	.	260	Q9HCI5	MAGE1_HUMAN	M	260	ENSP00000354912:V260M	ENSP00000354912:V260M	V	+	1	0	MAGEE1	75565505	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.848000	0.04326	-1.557000	0.01692	-0.905000	0.02835	GTG	MAGEE1	-	NULL	ENSG00000198934		0.687	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	15	0	G	NM_020932		75649101	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	missense	87.50	2	14	SNP	0.000	A
MAGEE1	57692	genome.wustl.edu	37	X	75649101	75649101	+	Missense_Mutation	SNP	G	G	A	rs374134344		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:75649101G>A	ENST00000361470.2	+	1	1056	c.778G>A	c.(778-780)Gtg>Atg	p.V260M		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	260	Pro-rich.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GAGCACCTCCGTGCCGGCCAC	0.687																																																	0								G	MET/VAL	1,3831		0,1,1630,570	27.0	27.0	27.0		778	-2.8	0.0	X		27	0,6724		0,0,2427,1870	no	missense	MAGEE1	NM_020932.2	21	0,1,4057,2440	AA,AG,GG,G		0.0,0.0261,0.0095	benign	260/958	75649101	1,10555	2201	4297	6498	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.778G>A	X.37:g.75649101G>A	ENSP00000354912:p.Val260Met		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.V260M	ENST00000361470.2	37	c.778	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	g	1.396	-0.579340	0.03854	2.61E-4	0.0	ENSG00000198934	ENST00000361470	T	0.09817	2.94	2.28	-2.84	0.05751	.	.	.	.	.	T	0.05777	0.0151	N	0.19112	0.55	0.09310	N	1	B	0.24768	0.111	B	0.06405	0.002	T	0.28618	-1.0038	9	0.46703	T	0.11	.	6.2688	0.20943	0.2249:0.2904:0.4847:0.0	.	260	Q9HCI5	MAGE1_HUMAN	M	260	ENSP00000354912:V260M	ENSP00000354912:V260M	V	+	1	0	MAGEE1	75565505	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.848000	0.04326	-1.557000	0.01692	-0.905000	0.02835	GTG	MAGEE1	-	NULL	ENSG00000198934		0.687	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	23	0	G	NM_020932		75649101	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	missense	87.50	2	14	SNP	0.000	A
MAN2B1	4125	genome.wustl.edu	37	19	12775735	12775735	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:12775735G>A	ENST00000456935.2	-	4	541	c.501C>T	c.(499-501)gcC>gcT	p.A167A	CTD-2192J16.24_ENST00000597961.1_Silent_p.A164A|WDR83_ENST00000418543.3_5'Flank|MAN2B1_ENST00000221363.4_Silent_p.A167A	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	167					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGTCCACGATGGCACCGTAGT	0.617																																																	0													103.0	72.0	82.0					19																	12775735		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.501C>T	19.37:g.12775735G>A			G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.A167	ENST00000456935.2	37	c.501	CCDS32919.1	19																																																																																			MAN2B1	-	pfam_Glyco_hydro_38_N,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000104774		0.617	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1	-	0.00	25	0	G			12775735	-1	tier1	-	no_errors	ENST00000456935	ensembl	human	known	74_37	silent	38.10	13	8	SNP	1.000	A
MAN2B1	4125	genome.wustl.edu	37	19	12775735	12775735	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:12775735G>A	ENST00000456935.2	-	4	541	c.501C>T	c.(499-501)gcC>gcT	p.A167A	CTD-2192J16.24_ENST00000597961.1_Silent_p.A164A|WDR83_ENST00000418543.3_5'Flank|MAN2B1_ENST00000221363.4_Silent_p.A167A	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	167					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						GGTCCACGATGGCACCGTAGT	0.617																																																	0													103.0	72.0	82.0					19																	12775735		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.501C>T	19.37:g.12775735G>A			G5E928|O15330|Q16680|Q93094|Q9BW13	Silent	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.A167	ENST00000456935.2	37	c.501	CCDS32919.1	19																																																																																			MAN2B1	-	pfam_Glyco_hydro_38_N,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000104774		0.617	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1	-	0.00	43	0	G			12775735	-1	tier1	-	no_errors	ENST00000456935	ensembl	human	known	74_37	silent	38.10	13	8	SNP	1.000	A
MARCO	8685	genome.wustl.edu	37	2	119731921	119731921	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:119731921A>C	ENST00000327097.4	+	5	608	c.473A>C	c.(472-474)cAc>cCc	p.H158P	MARCO_ENST00000541757.1_Missense_Mutation_p.H80P	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	158	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CTTCAAGGTCACAAGGGGGCC	0.567																																					GBM(8;18 374 7467 11269 32796)												0													63.0	59.0	60.0					2																	119731921		2200	4299	6499	SO:0001583	missense	0			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.473A>C	2.37:g.119731921A>C	ENSP00000318916:p.His158Pro		B4DW79|Q9Y5S3	Missense_Mutation	SNP	pfam_Collagen,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.H158P	ENST00000327097.4	37	c.473	CCDS2124.1	2	.	.	.	.	.	.	.	.	.	.	A	6.739	0.505107	0.12822	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.89681	-2.55;-2.55	4.43	-4.91	0.03085	.	2.258190	0.01471	N	0.016272	T	0.64249	0.2581	N	0.00608	-1.33	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64470	-0.6400	9	.	.	.	.	4.6554	0.12615	0.3329:0.4828:0.0886:0.0956	.	158	Q9UEW3	MARCO_HUMAN	P	158;158;80	ENSP00000318916:H158P;ENSP00000441769:H80P	.	H	+	2	0	MARCO	119448391	0.030000	0.19436	0.000000	0.03702	0.019000	0.09904	-0.511000	0.06321	-0.995000	0.03459	-0.301000	0.09380	CAC	MARCO	-	pfam_Collagen	ENSG00000019169		0.567	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	HGNC	protein_coding	OTTHUMT00000254190.2	-	0.00	56	0	A	NM_006770		119731921	+1	tier1	-	no_errors	ENST00000327097	ensembl	human	known	74_37	missense	55.10	22	27	SNP	0.001	C
MARCO	8685	genome.wustl.edu	37	2	119731921	119731921	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:119731921A>C	ENST00000327097.4	+	5	608	c.473A>C	c.(472-474)cAc>cCc	p.H158P	MARCO_ENST00000541757.1_Missense_Mutation_p.H80P	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	158	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CTTCAAGGTCACAAGGGGGCC	0.567																																					GBM(8;18 374 7467 11269 32796)												0													63.0	59.0	60.0					2																	119731921		2200	4299	6499	SO:0001583	missense	0			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.473A>C	2.37:g.119731921A>C	ENSP00000318916:p.His158Pro		B4DW79|Q9Y5S3	Missense_Mutation	SNP	pfam_Collagen,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.H158P	ENST00000327097.4	37	c.473	CCDS2124.1	2	.	.	.	.	.	.	.	.	.	.	A	6.739	0.505107	0.12822	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.89681	-2.55;-2.55	4.43	-4.91	0.03085	.	2.258190	0.01471	N	0.016272	T	0.64249	0.2581	N	0.00608	-1.33	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64470	-0.6400	9	.	.	.	.	4.6554	0.12615	0.3329:0.4828:0.0886:0.0956	.	158	Q9UEW3	MARCO_HUMAN	P	158;158;80	ENSP00000318916:H158P;ENSP00000441769:H80P	.	H	+	2	0	MARCO	119448391	0.030000	0.19436	0.000000	0.03702	0.019000	0.09904	-0.511000	0.06321	-0.995000	0.03459	-0.301000	0.09380	CAC	MARCO	-	pfam_Collagen	ENSG00000019169		0.567	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	HGNC	protein_coding	OTTHUMT00000254190.2	-	0.00	87	0	A	NM_006770		119731921	+1	tier1	-	no_errors	ENST00000327097	ensembl	human	known	74_37	missense	55.10	22	27	SNP	0.001	C
MATK	4145	genome.wustl.edu	37	19	3784173	3784173	+	Missense_Mutation	SNP	G	G	A	rs373715019		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:3784173G>A	ENST00000310132.6	-	5	709	c.311C>T	c.(310-312)gCg>gTg	p.A104V	MATK_ENST00000395040.2_Missense_Mutation_p.A63V|MATK_ENST00000585778.1_Missense_Mutation_p.A104V|MATK_ENST00000395045.2_Missense_Mutation_p.A105V	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	104	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCCGCAGCGCCCCAGCTGC	0.682																																																	0									VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	42.0	47.0	45.0		314,188,311	3.2	0.0	19		45	0,8600		0,0,4300	no	missense,missense,missense	MATK	NM_002378.3,NM_139354.2,NM_139355.2	64,64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	105/509,63/467,104/508	3784173	1,13005	2203	4300	6503	SO:0001583	missense	0			L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.311C>T	19.37:g.3784173G>A	ENSP00000308734:p.Ala104Val		B3KNZ9|Q9NST8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.A105V	ENST00000310132.6	37	c.314	CCDS12114.1	19	.	.	.	.	.	.	.	.	.	.	g	14.60	2.582527	0.46006	2.27E-4	0.0	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.16457	2.34;2.34;2.34	4.25	3.16	0.36331	Src homology-3 domain (3);	0.534815	0.19061	N	0.123770	T	0.16342	0.0393	L	0.40543	1.245	0.09310	N	1	D;D;D	0.60160	0.987;0.987;0.987	B;B;B	0.43194	0.411;0.411;0.411	T	0.06607	-1.0817	10	0.87932	D	0	-21.872	12.3729	0.55263	0.0:0.0:0.8299:0.17	.	104;105;104	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	V	105;104;63	ENSP00000378485:A105V;ENSP00000308734:A104V;ENSP00000378481:A63V	ENSP00000308734:A104V	A	-	2	0	MATK	3735173	0.399000	0.25287	0.026000	0.17262	0.752000	0.42762	3.599000	0.54045	0.839000	0.34971	0.306000	0.20318	GCG	MATK	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000007264		0.682	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	HGNC	protein_coding	OTTHUMT00000453639.1	-	0.00	64	0	G	NM_139355		3784173	-1	tier1	-	no_errors	ENST00000395045	ensembl	human	known	74_37	missense	41.46	24	17	SNP	0.011	A
MATK	4145	genome.wustl.edu	37	19	3784173	3784173	+	Missense_Mutation	SNP	G	G	A	rs373715019		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:3784173G>A	ENST00000310132.6	-	5	709	c.311C>T	c.(310-312)gCg>gTg	p.A104V	MATK_ENST00000395040.2_Missense_Mutation_p.A63V|MATK_ENST00000585778.1_Missense_Mutation_p.A104V|MATK_ENST00000395045.2_Missense_Mutation_p.A105V	NM_139355.2	NP_647612.1	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase	104	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell proliferation (GO:0008283)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(2)|stomach(2)|urinary_tract(1)	26		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCCGCAGCGCCCCAGCTGC	0.682																																																	0									VAL/ALA,VAL/ALA,VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	42.0	47.0	45.0		314,188,311	3.2	0.0	19		45	0,8600		0,0,4300	no	missense,missense,missense	MATK	NM_002378.3,NM_139354.2,NM_139355.2	64,64,64	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	105/509,63/467,104/508	3784173	1,13005	2203	4300	6503	SO:0001583	missense	0			L18974	CCDS12113.1, CCDS12114.1, CCDS42468.1	19p13.3	2013-02-14						"""SH2 domain containing"""	6906	protein-coding gene	gene with protein product	"""Csk-homologous kinase"", ""tyrosine-protein kinase CTK"", ""protein kinase HYL"", ""hematopoietic consensus tyrosine-lacking kinase"", ""tyrosylprotein kinase"", ""hydroxyaryl-protein kinase"", ""Csk-type protein tyrosine kinase"", ""HYL tyrosine kinase"", ""tyrosine kinase MATK"", ""leukocyte carboxyl-terminal src kinase related"""	600038				8288563, 7530249	Standard	NM_139355		Approved	HYLTK, CTK, HYL, Lsk, CHK, HHYLTK, DKFZp434N1212, MGC1708, MGC2101	uc002lyt.3	P42679		ENST00000310132.6:c.311C>T	19.37:g.3784173G>A	ENSP00000308734:p.Ala104Val		B3KNZ9|Q9NST8	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.A105V	ENST00000310132.6	37	c.314	CCDS12114.1	19	.	.	.	.	.	.	.	.	.	.	g	14.60	2.582527	0.46006	2.27E-4	0.0	ENSG00000007264	ENST00000395045;ENST00000310132;ENST00000395040	T;T;T	0.16457	2.34;2.34;2.34	4.25	3.16	0.36331	Src homology-3 domain (3);	0.534815	0.19061	N	0.123770	T	0.16342	0.0393	L	0.40543	1.245	0.09310	N	1	D;D;D	0.60160	0.987;0.987;0.987	B;B;B	0.43194	0.411;0.411;0.411	T	0.06607	-1.0817	10	0.87932	D	0	-21.872	12.3729	0.55263	0.0:0.0:0.8299:0.17	.	104;105;104	F1T0G6;B3KNZ9;P42679	.;.;MATK_HUMAN	V	105;104;63	ENSP00000378485:A105V;ENSP00000308734:A104V;ENSP00000378481:A63V	ENSP00000308734:A104V	A	-	2	0	MATK	3735173	0.399000	0.25287	0.026000	0.17262	0.752000	0.42762	3.599000	0.54045	0.839000	0.34971	0.306000	0.20318	GCG	MATK	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000007264		0.682	MATK-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	MATK	HGNC	protein_coding	OTTHUMT00000453639.1	-	0.00	77	0	G	NM_139355		3784173	-1	tier1	-	no_errors	ENST00000395045	ensembl	human	known	74_37	missense	41.46	24	17	SNP	0.011	A
MDGA1	266727	genome.wustl.edu	37	6	37626179	37626179	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:37626179G>A	ENST00000434837.3	-	3	1402	c.224C>T	c.(223-225)aCg>aTg	p.T75M	MDGA1_ENST00000505425.1_Missense_Mutation_p.T75M|MDGA1_ENST00000297153.7_Missense_Mutation_p.T75M	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	75	Ig-like 1.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						GCTACCTGCCGTCTTGGTCCA	0.662																																																	0													65.0	73.0	70.0					6																	37626179		2087	4195	6282	SO:0001583	missense	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.224C>T	6.37:g.37626179G>A	ENSP00000402584:p.Thr75Met		A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.T75M	ENST00000434837.3	37	c.224	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080311	0.76528	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425;ENST00000515437;ENST00000508399	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.22	5.22	0.72569	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000108	T	0.34395	0.0896	L	0.28504	0.86	0.80722	D	1	D	0.76494	0.999	D	0.63703	0.917	T	0.15752	-1.0426	10	0.66056	D	0.02	.	18.1335	0.89609	0.0:0.0:1.0:0.0	.	75	Q8NFP4	MDGA1_HUMAN	M	75;75;75;19;19	ENSP00000402584:T75M;ENSP00000297153:T75M;ENSP00000422042:T75M;ENSP00000421510:T19M;ENSP00000427645:T19M	ENSP00000297153:T75M	T	-	2	0	MDGA1	37734157	1.000000	0.71417	0.955000	0.39395	0.366000	0.29705	9.869000	0.99810	2.596000	0.87737	0.655000	0.94253	ACG	MDGA1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000112139		0.662	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	-	0.00	76	0	G			37626179	-1	tier1	-	no_errors	ENST00000297153	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	A
MDGA1	266727	genome.wustl.edu	37	6	37626179	37626179	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:37626179G>A	ENST00000434837.3	-	3	1402	c.224C>T	c.(223-225)aCg>aTg	p.T75M	MDGA1_ENST00000505425.1_Missense_Mutation_p.T75M|MDGA1_ENST00000297153.7_Missense_Mutation_p.T75M	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	75	Ig-like 1.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						GCTACCTGCCGTCTTGGTCCA	0.662																																																	0													65.0	73.0	70.0					6																	37626179		2087	4195	6282	SO:0001583	missense	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.224C>T	6.37:g.37626179G>A	ENSP00000402584:p.Thr75Met		A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.T75M	ENST00000434837.3	37	c.224	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080311	0.76528	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425;ENST00000515437;ENST00000508399	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.22	5.22	0.72569	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.50627	D	0.000108	T	0.34395	0.0896	L	0.28504	0.86	0.80722	D	1	D	0.76494	0.999	D	0.63703	0.917	T	0.15752	-1.0426	10	0.66056	D	0.02	.	18.1335	0.89609	0.0:0.0:1.0:0.0	.	75	Q8NFP4	MDGA1_HUMAN	M	75;75;75;19;19	ENSP00000402584:T75M;ENSP00000297153:T75M;ENSP00000422042:T75M;ENSP00000421510:T19M;ENSP00000427645:T19M	ENSP00000297153:T75M	T	-	2	0	MDGA1	37734157	1.000000	0.71417	0.955000	0.39395	0.366000	0.29705	9.869000	0.99810	2.596000	0.87737	0.655000	0.94253	ACG	MDGA1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000112139		0.662	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	-	0.00	90	0	G			37626179	-1	tier1	-	no_errors	ENST00000297153	ensembl	human	known	74_37	missense	12.07	51	7	SNP	1.000	A
MISP	126353	genome.wustl.edu	37	19	757291	757291	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:757291C>T	ENST00000215582.6	+	2	448	c.345C>T	c.(343-345)gaC>gaT	p.D115D		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	115					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GCCCAGAGGACGGGGAGGACA	0.662																																																	0													56.0	48.0	51.0					19																	757291		2202	4300	6502	SO:0001819	synonymous_variant	0			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.345C>T	19.37:g.757291C>T				Silent	SNP	NULL	p.D115	ENST00000215582.6	37	c.345	CCDS12042.1	19																																																																																			MISP	-	NULL	ENSG00000099812		0.662	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	HGNC	protein_coding	OTTHUMT00000457600.2	-	0.00	46	0	C	NM_173481		757291	+1	tier1	-	no_errors	ENST00000215582	ensembl	human	known	74_37	silent	22.73	17	5	SNP	0.000	T
MISP	126353	genome.wustl.edu	37	19	757291	757291	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:757291C>T	ENST00000215582.6	+	2	448	c.345C>T	c.(343-345)gaC>gaT	p.D115D		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	115					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GCCCAGAGGACGGGGAGGACA	0.662																																																	0													56.0	48.0	51.0					19																	757291		2202	4300	6502	SO:0001819	synonymous_variant	0			BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.345C>T	19.37:g.757291C>T				Silent	SNP	NULL	p.D115	ENST00000215582.6	37	c.345	CCDS12042.1	19																																																																																			MISP	-	NULL	ENSG00000099812		0.662	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	HGNC	protein_coding	OTTHUMT00000457600.2	-	0.00	48	0	C	NM_173481		757291	+1	tier1	-	no_errors	ENST00000215582	ensembl	human	known	74_37	silent	22.73	17	5	SNP	0.000	T
MMP16	4325	genome.wustl.edu	37	8	89086955	89086955	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:89086955C>T	ENST00000286614.6	-	7	1381	c.1100G>A	c.(1099-1101)cGa>cAa	p.R367Q	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	367					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GTTTCTCACTCGCCAAAACCA	0.488																																																	0													155.0	147.0	149.0					8																	89086955		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1100G>A	8.37:g.89086955C>T	ENSP00000286614:p.Arg367Gln		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.R367Q	ENST00000286614.6	37	c.1100	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	C	30	5.057590	0.93846	.	.	ENSG00000156103	ENST00000286614	T	0.04317	3.65	4.88	4.88	0.63580	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.33585	0.0868	H	0.95224	3.64	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.74023	0.976;0.982	T	0.53878	-0.8376	10	0.87932	D	0	.	18.4198	0.90586	0.0:1.0:0.0:0.0	.	367;367	P51512-2;P51512	.;MMP16_HUMAN	Q	367	ENSP00000286614:R367Q	ENSP00000286614:R367Q	R	-	2	0	MMP16	89156071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.397000	0.81536	0.650000	0.86243	CGA	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000156103		0.488	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	68	0	C	NM_005941		89086955	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	15.69	86	16	SNP	1.000	T
MSH2	4436	genome.wustl.edu	37	2	47637242	47637242	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:47637242delG	ENST00000233146.2	+	3	599	c.376delG	c.(376-378)ggcfs	p.G126fs	MSH2_ENST00000543555.1_Frame_Shift_Del_p.G60fs|MSH2_ENST00000406134.1_Frame_Shift_Del_p.G126fs	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	126					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGCTTCTCCTGGCAATctctc	0.328			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)											162.0	166.0	164.0					2																	47637242		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.376delG	2.37:g.47637242delG	ENSP00000233146:p.Gly126fs		B4E2Z2|O75488	Frame_Shift_Del	DEL	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.G126fs	ENST00000233146.2	37	c.376	CCDS1834.1	2																																																																																			MSH2	-	pfam_DNA_mismatch_repair_MutS-lik_N,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.328	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3		0.00	44	0	G			47637242	+1	tier1		no_errors	ENST00000233146	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
MSH2	4436	genome.wustl.edu	37	2	47637242	47637242	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:47637242delG	ENST00000233146.2	+	3	599	c.376delG	c.(376-378)ggcfs	p.G126fs	MSH2_ENST00000543555.1_Frame_Shift_Del_p.G60fs|MSH2_ENST00000406134.1_Frame_Shift_Del_p.G126fs	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	126					ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGCTTCTCCTGGCAATctctc	0.328			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)											162.0	166.0	164.0					2																	47637242		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.376delG	2.37:g.47637242delG	ENSP00000233146:p.Gly126fs		B4E2Z2|O75488	Frame_Shift_Del	DEL	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_MSH2	p.G126fs	ENST00000233146.2	37	c.376	CCDS1834.1	2																																																																																			MSH2	-	pfam_DNA_mismatch_repair_MutS-lik_N,pirsf_DNA_mismatch_repair_MSH2	ENSG00000095002		0.328	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH2	HGNC	protein_coding	OTTHUMT00000250805.3		0.00	52	0	G			47637242	+1	tier1		no_errors	ENST00000233146	ensembl	human	known	74_37	frame_shift_del	5.41	35	2	DEL	1.000	-
MTUS2	23281	genome.wustl.edu	37	13	29601027	29601027	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:29601027A>G	ENST00000431530.3	+	1	2280	c.2222A>G	c.(2221-2223)aAg>aGg	p.K741R		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	731	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.K741T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ATGAGTGAAAAGTTTTTGCAG	0.403																																																	1	Substitution - Missense(1)	stomach(1)											53.0	54.0	54.0					13																	29601027		1859	4090	5949	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2222A>G	13.37:g.29601027A>G	ENSP00000392057:p.Lys741Arg		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.K741R	ENST00000431530.3	37	c.2222	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	a	19.28	3.797371	0.70567	.	.	ENSG00000132938	ENST00000431530	T	0.19105	2.17	6.17	4.97	0.65823	.	0.094048	0.45867	D	0.000324	T	0.41834	0.1176	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.16335	-1.0406	9	.	.	.	.	12.809	0.57629	0.8634:0.1366:0.0:0.0	.	731	Q5JR59	MTUS2_HUMAN	R	741	ENSP00000392057:K741R	.	K	+	2	0	MTUS2	28499027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.302000	0.72788	1.119000	0.41883	0.533000	0.62120	AAG	MTUS2	-	NULL	ENSG00000132938		0.403	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	17	0	A	XM_166270		29601027	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	50.00	7	7	SNP	1.000	G
MTUS2	23281	genome.wustl.edu	37	13	29601027	29601027	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:29601027A>G	ENST00000431530.3	+	1	2280	c.2222A>G	c.(2221-2223)aAg>aGg	p.K741R		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	731	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.K741T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ATGAGTGAAAAGTTTTTGCAG	0.403																																																	1	Substitution - Missense(1)	stomach(1)											53.0	54.0	54.0					13																	29601027		1859	4090	5949	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2222A>G	13.37:g.29601027A>G	ENSP00000392057:p.Lys741Arg		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.K741R	ENST00000431530.3	37	c.2222	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	a	19.28	3.797371	0.70567	.	.	ENSG00000132938	ENST00000431530	T	0.19105	2.17	6.17	4.97	0.65823	.	0.094048	0.45867	D	0.000324	T	0.41834	0.1176	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.16335	-1.0406	9	.	.	.	.	12.809	0.57629	0.8634:0.1366:0.0:0.0	.	731	Q5JR59	MTUS2_HUMAN	R	741	ENSP00000392057:K741R	.	K	+	2	0	MTUS2	28499027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.302000	0.72788	1.119000	0.41883	0.533000	0.62120	AAG	MTUS2	-	NULL	ENSG00000132938		0.403	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	22	0	A	XM_166270		29601027	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	50.00	7	7	SNP	1.000	G
MUC12	10071	genome.wustl.edu	37	7	100643116	100643116	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:100643116C>T	ENST00000379442.3	+	5	9701	c.9701C>T	c.(9700-9702)gCg>gTg	p.A3234V	MUC12_ENST00000536621.1_Missense_Mutation_p.A3091V			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3234	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAAACAACAGCGTTACCTGGC	0.537																																																	0													1.0	1.0	1.0					7																	100643116		463	1074	1537	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9701C>T	7.37:g.100643116C>T	ENSP00000368755:p.Ala3234Val		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.A3091V	ENST00000379442.3	37	c.9272		7	.	.	.	.	.	.	.	.	.	.	C	3.164	-0.171466	0.06421	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12774	2.65;2.65	0.869	-1.74	0.08056	.	.	.	.	.	T	0.05044	0.0135	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34477	-0.9827	7	0.25106	T	0.35	.	3.142	0.06458	0.0:0.4155:0.2447:0.3398	.	.	.	.	V	3234;3091	ENSP00000368755:A3234V;ENSP00000441929:A3091V	ENSP00000368755:A3234V	A	+	2	0	MUC12	100429836	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.020000	0.00643	-1.942000	0.01040	-1.050000	0.02344	GCG	MUC12	-	NULL	ENSG00000205277		0.537	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	26	0	C	XM_379904		100643116	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	14.29	48	8	SNP	0.000	T
MYH4	4622	genome.wustl.edu	37	17	10362574	10362574	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:10362574G>A	ENST00000255381.2	-	15	1691	c.1581C>T	c.(1579-1581)atC>atT	p.I527I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	527	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GAACCTTCTCGATGAGCTCGA	0.473																																																	0													168.0	153.0	158.0					17																	10362574		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1581C>T	17.37:g.10362574G>A				Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I527	ENST00000255381.2	37	c.1581	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000264424		0.473	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	-	0.00	113	0	G	NM_017533		10362574	-1	tier1	-	no_errors	ENST00000255381	ensembl	human	known	74_37	silent	14.67	64	11	SNP	0.470	A
MYH4	4622	genome.wustl.edu	37	17	10362574	10362574	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:10362574G>A	ENST00000255381.2	-	15	1691	c.1581C>T	c.(1579-1581)atC>atT	p.I527I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	527	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GAACCTTCTCGATGAGCTCGA	0.473																																																	0													168.0	153.0	158.0					17																	10362574		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.1581C>T	17.37:g.10362574G>A				Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I527	ENST00000255381.2	37	c.1581	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000264424		0.473	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	-	0.00	119	0	G	NM_017533		10362574	-1	tier1	-	no_errors	ENST00000255381	ensembl	human	known	74_37	silent	14.67	64	11	SNP	0.470	A
NBEA	26960	genome.wustl.edu	37	13	35733224	35733224	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:35733224C>T	ENST00000400445.3	+	22	3450	c.2916C>T	c.(2914-2916)aaC>aaT	p.N972N	NBEA_ENST00000540320.1_Silent_p.N972N|NBEA_ENST00000379939.2_Silent_p.N972N|NBEA_ENST00000310336.4_Silent_p.N972N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	972					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGGAGGAAAACATTAAAAAGG	0.378																																																	0													84.0	77.0	80.0					13																	35733224		1880	4109	5989	SO:0001819	synonymous_variant	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2916C>T	13.37:g.35733224C>T			B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.N972	ENST00000400445.3	37	c.2916	CCDS45026.1	13																																																																																			NBEA	-	NULL	ENSG00000172915		0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	32	0	C	NM_015678		35733224	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	silent	39.47	23	15	SNP	1.000	T
NBEA	26960	genome.wustl.edu	37	13	35733224	35733224	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:35733224C>T	ENST00000400445.3	+	22	3450	c.2916C>T	c.(2914-2916)aaC>aaT	p.N972N	NBEA_ENST00000540320.1_Silent_p.N972N|NBEA_ENST00000379939.2_Silent_p.N972N|NBEA_ENST00000310336.4_Silent_p.N972N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	972					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGGAGGAAAACATTAAAAAGG	0.378																																																	0													84.0	77.0	80.0					13																	35733224		1880	4109	5989	SO:0001819	synonymous_variant	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.2916C>T	13.37:g.35733224C>T			B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.N972	ENST00000400445.3	37	c.2916	CCDS45026.1	13																																																																																			NBEA	-	NULL	ENSG00000172915		0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	34	0	C	NM_015678		35733224	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	silent	39.47	23	15	SNP	1.000	T
NBEA	26960	genome.wustl.edu	37	13	36141112	36141112	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:36141112G>T	ENST00000400445.3	+	45	7527	c.6993G>T	c.(6991-6993)gaG>gaT	p.E2331D	NBEA_ENST00000540320.1_Missense_Mutation_p.E2331D|NBEA_ENST00000379939.2_Missense_Mutation_p.E2328D|NBEA_ENST00000537702.1_Missense_Mutation_p.E124D|NBEA_ENST00000310336.4_Missense_Mutation_p.E2331D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2331	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AATCAGAAGAGTTGGACCTGA	0.343																																																	0													122.0	117.0	118.0					13																	36141112		1817	4082	5899	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6993G>T	13.37:g.36141112G>T	ENSP00000383295:p.Glu2331Asp		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.E2331D	ENST00000400445.3	37	c.6993	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	13.95	2.388801	0.42308	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000543274;ENST00000537702	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.96	-0.63	0.11530	BEACH domain (4);	0.043688	0.85682	D	0.000000	T	0.68476	0.3005	L	0.35487	1.065	0.48135	D	0.999592	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.55528	-0.8127	10	0.38643	T	0.18	.	12.7307	0.57197	0.3767:0.0:0.6233:0.0	.	2331;2328	Q8NFP9;Q5T321	NBEA_HUMAN;.	D	2331;2331;2328;2331;958;124;124	ENSP00000440951:E2331D;ENSP00000383295:E2331D;ENSP00000369271:E2328D;ENSP00000308534:E2331D;ENSP00000440233:E124D	ENSP00000308534:E2331D	E	+	3	2	NBEA	35039112	1.000000	0.71417	0.820000	0.32676	0.973000	0.67179	0.725000	0.25970	-0.329000	0.08527	-1.044000	0.02363	GAG	NBEA	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000172915		0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	47	0	G	NM_015678		36141112	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.999	T
NBEA	26960	genome.wustl.edu	37	13	36141112	36141112	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:36141112G>T	ENST00000400445.3	+	45	7527	c.6993G>T	c.(6991-6993)gaG>gaT	p.E2331D	NBEA_ENST00000540320.1_Missense_Mutation_p.E2331D|NBEA_ENST00000379939.2_Missense_Mutation_p.E2328D|NBEA_ENST00000537702.1_Missense_Mutation_p.E124D|NBEA_ENST00000310336.4_Missense_Mutation_p.E2331D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2331	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026, ECO:0000305}.				protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AATCAGAAGAGTTGGACCTGA	0.343																																																	0													122.0	117.0	118.0					13																	36141112		1817	4082	5899	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.6993G>T	13.37:g.36141112G>T	ENSP00000383295:p.Glu2331Asp		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.E2331D	ENST00000400445.3	37	c.6993	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	13.95	2.388801	0.42308	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000543274;ENST00000537702	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	5.96	-0.63	0.11530	BEACH domain (4);	0.043688	0.85682	D	0.000000	T	0.68476	0.3005	L	0.35487	1.065	0.48135	D	0.999592	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.55528	-0.8127	10	0.38643	T	0.18	.	12.7307	0.57197	0.3767:0.0:0.6233:0.0	.	2331;2328	Q8NFP9;Q5T321	NBEA_HUMAN;.	D	2331;2331;2328;2331;958;124;124	ENSP00000440951:E2331D;ENSP00000383295:E2331D;ENSP00000369271:E2328D;ENSP00000308534:E2331D;ENSP00000440233:E124D	ENSP00000308534:E2331D	E	+	3	2	NBEA	35039112	1.000000	0.71417	0.820000	0.32676	0.973000	0.67179	0.725000	0.25970	-0.329000	0.08527	-1.044000	0.02363	GAG	NBEA	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000172915		0.343	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	53	0	G	NM_015678		36141112	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.999	T
NALCN	259232	genome.wustl.edu	37	13	101890257	101890257	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:101890257A>C	ENST00000251127.6	-	12	1364	c.1283T>G	c.(1282-1284)cTt>cGt	p.L428R	NALCN_ENST00000376196.3_Missense_Mutation_p.L428R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	428					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAAATCAAAAAGTACTGTAAA	0.308																																																	0													90.0	98.0	95.0					13																	101890257		2203	4299	6502	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1283T>G	13.37:g.101890257A>C	ENSP00000251127:p.Leu428Arg		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L428R	ENST00000251127.6	37	c.1283	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	17.28	3.349055	0.61183	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98701	-5.08;-5.08	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99296	0.9754	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.995;0.979;0.995	D	0.98945	1.0792	10	0.87932	D	0	.	15.4116	0.74929	1.0:0.0:0.0:0.0	.	428;428;428	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	R	428	ENSP00000251127:L428R;ENSP00000365367:L428R	ENSP00000251127:L428R	L	-	2	0	NALCN	100688258	1.000000	0.71417	0.358000	0.25811	0.610000	0.37248	8.904000	0.92590	2.096000	0.63516	0.402000	0.26972	CTT	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.308	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	33	0	A	NM_052867		101890257	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	51.11	22	23	SNP	0.998	C
NALCN	259232	genome.wustl.edu	37	13	101890257	101890257	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:101890257A>C	ENST00000251127.6	-	12	1364	c.1283T>G	c.(1282-1284)cTt>cGt	p.L428R	NALCN_ENST00000376196.3_Missense_Mutation_p.L428R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	428					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CAAATCAAAAAGTACTGTAAA	0.308																																																	0													90.0	98.0	95.0					13																	101890257		2203	4299	6502	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1283T>G	13.37:g.101890257A>C	ENSP00000251127:p.Leu428Arg		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L428R	ENST00000251127.6	37	c.1283	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	17.28	3.349055	0.61183	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98701	-5.08;-5.08	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99296	0.9754	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.81914	0.995;0.979;0.995	D	0.98945	1.0792	10	0.87932	D	0	.	15.4116	0.74929	1.0:0.0:0.0:0.0	.	428;428;428	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	R	428	ENSP00000251127:L428R;ENSP00000365367:L428R	ENSP00000251127:L428R	L	-	2	0	NALCN	100688258	1.000000	0.71417	0.358000	0.25811	0.610000	0.37248	8.904000	0.92590	2.096000	0.63516	0.402000	0.26972	CTT	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.308	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	41	0	A	NM_052867		101890257	-1	tier1	-	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	51.11	22	23	SNP	0.998	C
NCF1B	654816	genome.wustl.edu	37	7	72639938	72639938	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:72639938G>A	ENST00000423083.1	+	0	158					NR_003186.1		A6NI72	NCF1B_HUMAN	neutrophil cytosolic factor 1B pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol binding (GO:0035091)|superoxide-generating NADPH oxidase activity (GO:0016175)										GTGGTTTGACGGGCAGCGGGC	0.657																																																	0																																												0					7q11.23	2014-03-20	2006-09-19		ENSG00000182487	ENSG00000182487			32522	pseudogene	pseudogene			"""neutrophil cytosolic factor 1B"""				Standard	NR_003186		Approved	SH3PXD1B	uc011ker.1	A6NI72	OTTHUMG00000156804		7.37:g.72639938G>A				RNA	SNP	-	NULL	ENST00000423083.1	37	NULL		7																																																																																			NCF1B	-	-	ENSG00000182487		0.657	NCF1B-003	KNOWN	basic	processed_transcript	NCF1B	HGNC	pseudogene	OTTHUMT00000345924.1	-	0.00	121	0	G	NR_003186		72639938	+1	tier1	-	no_errors	ENST00000432102	ensembl	human	known	74_37	rna	35.88	84	47	SNP	0.996	A
NCF1B	654816	genome.wustl.edu	37	7	72639938	72639938	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:72639938G>A	ENST00000423083.1	+	0	158					NR_003186.1		A6NI72	NCF1B_HUMAN	neutrophil cytosolic factor 1B pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol binding (GO:0035091)|superoxide-generating NADPH oxidase activity (GO:0016175)										GTGGTTTGACGGGCAGCGGGC	0.657																																																	0																																												0					7q11.23	2014-03-20	2006-09-19		ENSG00000182487	ENSG00000182487			32522	pseudogene	pseudogene			"""neutrophil cytosolic factor 1B"""				Standard	NR_003186		Approved	SH3PXD1B	uc011ker.1	A6NI72	OTTHUMG00000156804		7.37:g.72639938G>A				RNA	SNP	-	NULL	ENST00000423083.1	37	NULL		7																																																																																			NCF1B	-	-	ENSG00000182487		0.657	NCF1B-003	KNOWN	basic	processed_transcript	NCF1B	HGNC	pseudogene	OTTHUMT00000345924.1	-	0.00	148	0	G	NR_003186		72639938	+1	tier1	-	no_errors	ENST00000432102	ensembl	human	known	74_37	rna	35.88	84	47	SNP	0.996	A
NETO1	81832	genome.wustl.edu	37	18	70417823	70417823	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:70417823T>C	ENST00000327305.6	-	9	1672	c.1015A>G	c.(1015-1017)Acc>Gcc	p.T339A	RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000299430.2_Missense_Mutation_p.T338A|NETO1_ENST00000583169.1_Missense_Mutation_p.T339A	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	339					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CTGGTGTTGGTCAGCTGGTCC	0.443																																																	0													64.0	47.0	53.0					18																	70417823		2203	4300	6503	SO:0001583	missense	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1015A>G	18.37:g.70417823T>C	ENSP00000313088:p.Thr339Ala		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.T339A	ENST00000327305.6	37	c.1015	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	T	18.73	3.685408	0.68157	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.21734	1.99;1.99	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000008	T	0.22044	0.0531	L	0.50333	1.59	0.80722	D	1	B;P	0.38420	0.341;0.63	B;B	0.35114	0.167;0.196	T	0.02868	-1.1100	10	0.56958	D	0.05	-26.8682	15.305	0.73985	0.0:0.0:0.0:1.0	.	338;339	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	A	339;338	ENSP00000313088:T339A;ENSP00000299430:T338A	ENSP00000299430:T338A	T	-	1	0	NETO1	68568803	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.232000	0.72313	2.069000	0.61940	0.374000	0.22700	ACC	NETO1	-	superfamily_LDrepeatLR_classA_rpt	ENSG00000166342		0.443	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	-	0.00	44	0	T	NM_138999		70417823	-1	tier1	-	no_errors	ENST00000327305	ensembl	human	known	74_37	missense	33.33	24	12	SNP	1.000	C
NETO1	81832	genome.wustl.edu	37	18	70417823	70417823	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr18:70417823T>C	ENST00000327305.6	-	9	1672	c.1015A>G	c.(1015-1017)Acc>Gcc	p.T339A	RNA5SP460_ENST00000516789.1_RNA|NETO1_ENST00000299430.2_Missense_Mutation_p.T338A|NETO1_ENST00000583169.1_Missense_Mutation_p.T339A	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	339					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		CTGGTGTTGGTCAGCTGGTCC	0.443																																																	0													64.0	47.0	53.0					18																	70417823		2203	4300	6503	SO:0001583	missense	0			AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1015A>G	18.37:g.70417823T>C	ENSP00000313088:p.Thr339Ala		Q86W85|Q8ND78|Q8TDF4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.T339A	ENST00000327305.6	37	c.1015	CCDS12000.1	18	.	.	.	.	.	.	.	.	.	.	T	18.73	3.685408	0.68157	.	.	ENSG00000166342	ENST00000327305;ENST00000299430	T;T	0.21734	1.99;1.99	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000008	T	0.22044	0.0531	L	0.50333	1.59	0.80722	D	1	B;P	0.38420	0.341;0.63	B;B	0.35114	0.167;0.196	T	0.02868	-1.1100	10	0.56958	D	0.05	-26.8682	15.305	0.73985	0.0:0.0:0.0:1.0	.	338;339	Q8TDF5-2;Q8TDF5	.;NETO1_HUMAN	A	339;338	ENSP00000313088:T339A;ENSP00000299430:T338A	ENSP00000299430:T338A	T	-	1	0	NETO1	68568803	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.232000	0.72313	2.069000	0.61940	0.374000	0.22700	ACC	NETO1	-	superfamily_LDrepeatLR_classA_rpt	ENSG00000166342		0.443	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NETO1	HGNC	protein_coding	OTTHUMT00000256301.2	-	0.00	78	0	T	NM_138999		70417823	-1	tier1	-	no_errors	ENST00000327305	ensembl	human	known	74_37	missense	33.33	24	12	SNP	1.000	C
NLGN4X	57502	genome.wustl.edu	37	X	6069063	6069063	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:6069063A>C	ENST00000381095.3	-	2	1072	c.445T>G	c.(445-447)Tta>Gta	p.L149V	NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381092.1_Missense_Mutation_p.L149V|NLGN4X_ENST00000275857.6_Missense_Mutation_p.L149V|NLGN4X_ENST00000381093.2_Missense_Mutation_p.L149V|NLGN4X_ENST00000538097.1_Missense_Mutation_p.L149V	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	149					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TAGATGTTTAAGTAAAGGCAG	0.428																																																	0													140.0	119.0	126.0					X																	6069063		2203	4300	6503	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.445T>G	X.37:g.6069063A>C	ENSP00000370485:p.Leu149Val		Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L149V	ENST00000381095.3	37	c.445	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	A	16.57	3.159357	0.57368	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	4.08	-1.49	0.08718	Carboxylesterase type B, conserved site (1);Carboxylesterase, type B (1);	.	.	.	.	D	0.87529	0.6200	M	0.86805	2.84	0.47547	D	0.99945	D;D;D	0.76494	0.999;0.994;0.992	D;P;P	0.66084	0.941;0.873;0.7	D	0.84415	0.0568	9	0.87932	D	0	.	8.258	0.31769	0.621:0.0:0.379:0.0	.	149;149;149	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	V	149	ENSP00000370485:L149V;ENSP00000370483:L149V;ENSP00000275857:L149V;ENSP00000370482:L149V;ENSP00000439203:L149V	ENSP00000275857:L149V	L	-	1	2	NLGN4X	6079063	0.994000	0.37717	0.021000	0.16686	0.971000	0.66376	0.597000	0.24059	-0.794000	0.04468	-0.447000	0.05616	TTA	NLGN4X	-	pfam_CarbesteraseB	ENSG00000146938		0.428	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	-	0.00	44	0	A	NM_020742		6069063	-1	tier1	-	no_errors	ENST00000381093	ensembl	human	known	74_37	missense	79.07	9	34	SNP	0.924	C
NLGN4X	57502	genome.wustl.edu	37	X	6069063	6069063	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chrX:6069063A>C	ENST00000381095.3	-	2	1072	c.445T>G	c.(445-447)Tta>Gta	p.L149V	NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381092.1_Missense_Mutation_p.L149V|NLGN4X_ENST00000275857.6_Missense_Mutation_p.L149V|NLGN4X_ENST00000381093.2_Missense_Mutation_p.L149V|NLGN4X_ENST00000538097.1_Missense_Mutation_p.L149V	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	149					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TAGATGTTTAAGTAAAGGCAG	0.428																																																	0													140.0	119.0	126.0					X																	6069063		2203	4300	6503	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.445T>G	X.37:g.6069063A>C	ENSP00000370485:p.Leu149Val		Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L149V	ENST00000381095.3	37	c.445	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	A	16.57	3.159357	0.57368	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	4.08	-1.49	0.08718	Carboxylesterase type B, conserved site (1);Carboxylesterase, type B (1);	.	.	.	.	D	0.87529	0.6200	M	0.86805	2.84	0.47547	D	0.99945	D;D;D	0.76494	0.999;0.994;0.992	D;P;P	0.66084	0.941;0.873;0.7	D	0.84415	0.0568	9	0.87932	D	0	.	8.258	0.31769	0.621:0.0:0.379:0.0	.	149;149;149	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	V	149	ENSP00000370485:L149V;ENSP00000370483:L149V;ENSP00000275857:L149V;ENSP00000370482:L149V;ENSP00000439203:L149V	ENSP00000275857:L149V	L	-	1	2	NLGN4X	6079063	0.994000	0.37717	0.021000	0.16686	0.971000	0.66376	0.597000	0.24059	-0.794000	0.04468	-0.447000	0.05616	TTA	NLGN4X	-	pfam_CarbesteraseB	ENSG00000146938		0.428	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	-	0.00	62	0	A	NM_020742		6069063	-1	tier1	-	no_errors	ENST00000381093	ensembl	human	known	74_37	missense	79.07	9	34	SNP	0.924	C
NMNAT1	64802	genome.wustl.edu	37	1	10035719	10035719	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:10035719C>T	ENST00000377205.1	+	3	329	c.185C>T	c.(184-186)cCt>cTt	p.P62L	NMNAT1_ENST00000403197.1_Missense_Mutation_p.P62L	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	62					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		GGACTCATTCCTGCCTATCAC	0.433																																																	0													118.0	105.0	109.0					1																	10035719		2203	4300	6503	SO:0001583	missense	0			AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.185C>T	1.37:g.10035719C>T	ENSP00000366410:p.Pro62Leu		B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	p.P62L	ENST00000377205.1	37	c.185	CCDS108.1	1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114038	0.37339	.	.	ENSG00000173614	ENST00000403197;ENST00000377205	D;D	0.98075	-4.7;-4.7	4.75	3.75	0.43078	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.397866	0.25964	N	0.027164	D	0.95557	0.8556	M	0.67569	2.06	0.40338	D	0.979007	P	0.37594	0.601	B	0.36719	0.231	D	0.94254	0.7496	10	0.45353	T	0.12	-10.9235	7.6081	0.28113	0.1342:0.5458:0.32:0.0	.	62	Q9HAN9	NMNA1_HUMAN	L	62	ENSP00000385131:P62L;ENSP00000366410:P62L	ENSP00000366410:P62L	P	+	2	0	NMNAT1	9958306	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.311000	0.59147	2.336000	0.79503	0.643000	0.83706	CCT	NMNAT1	-	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	ENSG00000173614		0.433	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT1	HGNC	protein_coding	OTTHUMT00000005029.1	-	0.00	76	0	C			10035719	+1	tier1	-	no_errors	ENST00000377205	ensembl	human	known	74_37	missense	60.94	25	39	SNP	1.000	T
NMNAT1	64802	genome.wustl.edu	37	1	10035719	10035719	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:10035719C>T	ENST00000377205.1	+	3	329	c.185C>T	c.(184-186)cCt>cTt	p.P62L	NMNAT1_ENST00000403197.1_Missense_Mutation_p.P62L	NM_022787.3	NP_073624.2	Q9HAN9	NMNA1_HUMAN	nicotinamide nucleotide adenylyltransferase 1	62					NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nicotinamide-nucleotide adenylyltransferase activity (GO:0000309)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)			large_intestine(2)|lung(2)|stomach(1)	5		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.31e-08)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(185;0.00028)|BRCA - Breast invasive adenocarcinoma(304;0.00032)|KIRC - Kidney renal clear cell carcinoma(229;0.00101)|STAD - Stomach adenocarcinoma(132;0.00908)|READ - Rectum adenocarcinoma(331;0.0419)		GGACTCATTCCTGCCTATCAC	0.433																																																	0													118.0	105.0	109.0					1																	10035719		2203	4300	6503	SO:0001583	missense	0			AF312734	CCDS108.1, CCDS72698.1	1p36.22	2014-01-28	2003-04-30	2003-05-02	ENSG00000173614	ENSG00000173614	2.7.7.1		17877	protein-coding gene	gene with protein product		608700	"""nicotinamide nucleotide adenylyltransferase"", ""Leber congenital amaurosis 9"", ""Leber's congenital amaurosis 9"""	LCA9		11248244, 11027696, 22842227	Standard	XR_244792		Approved	NMNAT, PNAT1	uc001aqp.3	Q9HAN9	OTTHUMG00000001799	ENST00000377205.1:c.185C>T	1.37:g.10035719C>T	ENSP00000366410:p.Pro62Leu		B1AN63|Q8TAE9|Q9H247|Q9H6B6	Missense_Mutation	SNP	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	p.P62L	ENST00000377205.1	37	c.185	CCDS108.1	1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114038	0.37339	.	.	ENSG00000173614	ENST00000403197;ENST00000377205	D;D	0.98075	-4.7;-4.7	4.75	3.75	0.43078	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.397866	0.25964	N	0.027164	D	0.95557	0.8556	M	0.67569	2.06	0.40338	D	0.979007	P	0.37594	0.601	B	0.36719	0.231	D	0.94254	0.7496	10	0.45353	T	0.12	-10.9235	7.6081	0.28113	0.1342:0.5458:0.32:0.0	.	62	Q9HAN9	NMNA1_HUMAN	L	62	ENSP00000385131:P62L;ENSP00000366410:P62L	ENSP00000366410:P62L	P	+	2	0	NMNAT1	9958306	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	4.311000	0.59147	2.336000	0.79503	0.643000	0.83706	CCT	NMNAT1	-	pfam_Cyt_trans-like,tigrfam_NAMN_adtrnsfrase	ENSG00000173614		0.433	NMNAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMNAT1	HGNC	protein_coding	OTTHUMT00000005029.1	-	0.00	77	0	C			10035719	+1	tier1	-	no_errors	ENST00000377205	ensembl	human	known	74_37	missense	60.94	25	39	SNP	1.000	T
NOX4	50507	genome.wustl.edu	37	11	89165982	89165982	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:89165982A>G	ENST00000263317.4	-	7	756	c.518T>C	c.(517-519)cTc>cCc	p.L173P	NOX4_ENST00000534731.1_Missense_Mutation_p.L173P|NOX4_ENST00000525196.1_Missense_Mutation_p.L173P|NOX4_ENST00000532825.1_Missense_Mutation_p.L149P|NOX4_ENST00000413594.2_Missense_Mutation_p.L194P|NOX4_ENST00000343727.5_Missense_Mutation_p.L149P|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000375979.3_Intron|NOX4_ENST00000528341.1_Missense_Mutation_p.L148P|NOX4_ENST00000527956.1_Missense_Mutation_p.L149P|NOX4_ENST00000535633.1_Missense_Mutation_p.L149P|NOX4_ENST00000542487.1_Missense_Mutation_p.L149P|NOX4_ENST00000424319.1_Missense_Mutation_p.L149P|NOX4_ENST00000527626.1_Missense_Mutation_p.L7P			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	173	Ferric oxidoreductase.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				TGTGATCATGAGGAATAGCAC	0.343																																																	0													91.0	85.0	87.0					11																	89165982		2201	4299	6500	SO:0001583	missense	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.518T>C	11.37:g.89165982A>G	ENSP00000263317:p.Leu173Pro		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.L194P	ENST00000263317.4	37	c.581	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	A	19.14	3.770420	0.69992	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594	D;D;D;D;D;D;D;D;D;D;D;D	0.95447	-3.14;-3.14;-3.14;-3.14;-3.14;-3.14;-3.14;-3.14;-3.14;-3.71;-3.14;-3.14	5.8	5.8	0.92144	Flavoprotein transmembrane component (1);	0.071736	0.56097	D	0.000032	D	0.97911	0.9313	M	0.90252	3.1	0.80722	D	1	D;D;D;D;D;D	0.89917	0.998;0.998;1.0;0.997;1.0;1.0	D;D;D;D;D;D	0.91635	0.979;0.959;0.998;0.995;0.999;0.993	D	0.98611	1.0663	9	.	.	.	-11.9912	12.5301	0.56109	1.0:0.0:0.0:0.0	.	149;7;148;173;173;173	E9PMY6;E9PR43;E9PPP2;E9PI95;Q9NPH5-6;Q9NPH5	.;.;.;.;.;NOX4_HUMAN	P	149;149;149;173;173;173;149;149;149;7;148;194	ENSP00000412446:L149P;ENSP00000440172:L149P;ENSP00000344747:L149P;ENSP00000436892:L173P;ENSP00000436716:L173P;ENSP00000263317:L173P;ENSP00000434924:L149P;ENSP00000433797:L149P;ENSP00000439373:L149P;ENSP00000436093:L7P;ENSP00000436970:L148P;ENSP00000405705:L194P	.	L	-	2	0	NOX4	88805630	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	4.808000	0.62583	2.219000	0.72066	0.533000	0.62120	CTC	NOX4	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000086991		0.343	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1		0.00	21	0	A	NM_016931		89165982	-1			no_errors	ENST00000413594	ensembl	human	known	74_37	missense	12.50	14	2	SNP	1.000	G
NPIPA1	9284	genome.wustl.edu	37	16	15024823	15024823	+	3'UTR	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:15024823C>G	ENST00000472413.1	+	0	3164							Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											CCATCCTGCACAAGCTGGACC	0.607																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*3161C>G	16.37:g.15024823C>G			O15102	RNA	SNP	-	NULL	ENST00000472413.1	37	NULL		16																																																																																			NPIPA1	-	-	ENSG00000183426		0.607	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	NPIPA1	HGNC	protein_coding	OTTHUMT00000207327.1	-	0.00	38	0	C	NM_006985		15024823	+1	tier1	-	no_errors	ENST00000472413	ensembl	human	known	74_37	rna	13.89	31	5	SNP	1.000	G
NRCAM	4897	genome.wustl.edu	37	7	107866669	107866669	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:107866669G>T	ENST00000425651.2	-	6	703	c.704C>A	c.(703-705)tCt>tAt	p.S235Y	NRCAM_ENST00000351718.4_Missense_Mutation_p.S229Y|NRCAM_ENST00000413765.2_Missense_Mutation_p.S235Y|NRCAM_ENST00000379022.4_Missense_Mutation_p.S235Y|NRCAM_ENST00000379024.4_Missense_Mutation_p.S235Y|NRCAM_ENST00000379028.3_Missense_Mutation_p.S235Y	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	235	Ig-like 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CACCTTCACAGAAATAGGTTG	0.368																																																	0													127.0	132.0	130.0					7																	107866669		2203	4300	6503	SO:0001583	missense	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.704C>A	7.37:g.107866669G>T	ENSP00000401244:p.Ser235Tyr		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S235Y	ENST00000425651.2	37	c.704	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297822	0.81025	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701	T;T;T;T;T;T;T	0.69435	0.21;0.49;0.22;0.29;0.21;0.27;-0.4	5.66	5.66	0.87406	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.104008	0.64402	D	0.000002	T	0.80969	0.4726	M	0.63843	1.955	0.58432	D	0.999999	D;D;D;D;P	0.76494	0.993;0.999;0.988;0.993;0.681	P;D;P;P;B	0.76071	0.905;0.987;0.805;0.905;0.282	T	0.79492	-0.1781	10	0.49607	T	0.09	.	20.1225	0.97967	0.0:0.0:1.0:0.0	.	235;235;235;229;235	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	Y	235;235;235;235;229;235;235;235;229;229	ENSP00000368314:S235Y;ENSP00000407858:S235Y;ENSP00000325269:S229Y;ENSP00000368310:S235Y;ENSP00000401244:S235Y;ENSP00000368308:S235Y;ENSP00000390421:S229Y	ENSP00000325269:S229Y	S	-	2	0	NRCAM	107653905	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.809000	0.86057	2.831000	0.97527	0.650000	0.86243	TCT	NRCAM	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000091129		0.368	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	-	0.00	76	0	G	NM_001037132		107866669	-1	tier1	-	no_errors	ENST00000379028	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
NRCAM	4897	genome.wustl.edu	37	7	107866669	107866669	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:107866669G>T	ENST00000425651.2	-	6	703	c.704C>A	c.(703-705)tCt>tAt	p.S235Y	NRCAM_ENST00000351718.4_Missense_Mutation_p.S229Y|NRCAM_ENST00000413765.2_Missense_Mutation_p.S235Y|NRCAM_ENST00000379022.4_Missense_Mutation_p.S235Y|NRCAM_ENST00000379024.4_Missense_Mutation_p.S235Y|NRCAM_ENST00000379028.3_Missense_Mutation_p.S235Y	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	235	Ig-like 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						CACCTTCACAGAAATAGGTTG	0.368																																																	0													127.0	132.0	130.0					7																	107866669		2203	4300	6503	SO:0001583	missense	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.704C>A	7.37:g.107866669G>T	ENSP00000401244:p.Ser235Tyr		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S235Y	ENST00000425651.2	37	c.704	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297822	0.81025	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701	T;T;T;T;T;T;T	0.69435	0.21;0.49;0.22;0.29;0.21;0.27;-0.4	5.66	5.66	0.87406	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.104008	0.64402	D	0.000002	T	0.80969	0.4726	M	0.63843	1.955	0.58432	D	0.999999	D;D;D;D;P	0.76494	0.993;0.999;0.988;0.993;0.681	P;D;P;P;B	0.76071	0.905;0.987;0.805;0.905;0.282	T	0.79492	-0.1781	10	0.49607	T	0.09	.	20.1225	0.97967	0.0:0.0:1.0:0.0	.	235;235;235;229;235	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	Y	235;235;235;235;229;235;235;235;229;229	ENSP00000368314:S235Y;ENSP00000407858:S235Y;ENSP00000325269:S229Y;ENSP00000368310:S235Y;ENSP00000401244:S235Y;ENSP00000368308:S235Y;ENSP00000390421:S229Y	ENSP00000325269:S229Y	S	-	2	0	NRCAM	107653905	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.809000	0.86057	2.831000	0.97527	0.650000	0.86243	TCT	NRCAM	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000091129		0.368	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	-	0.00	80	0	G	NM_001037132		107866669	-1	tier1	-	no_errors	ENST00000379028	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
NRG1	3084	genome.wustl.edu	37	8	32607094	32607094	+	Intron	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:32607094A>T	ENST00000405005.3	+	8	700				NRG1_ENST00000519301.1_Missense_Mutation_p.E181V|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000523681.1_3'UTR|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000356819.4_Missense_Mutation_p.E236V|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000287845.5_Missense_Mutation_p.E202V|NRG1_ENST00000539990.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTTGGGATTGAATTTATGGGT	0.378																																																	0													163.0	161.0	162.0					8																	32607094		2203	4300	6503	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.701-4796A>T	8.37:g.32607094A>T			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.E236V	ENST00000405005.3	37	c.707	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298455	0.81025	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000356819;ENST00000287845;ENST00000518084	T;T;T;T;T	0.79141	-1.1;-1.24;-0.89;-0.82;-0.83	5.59	5.59	0.84812	.	.	.	.	.	D	0.86522	0.5953	M	0.62723	1.935	0.80722	D	1	B;P;D;P	0.89917	0.277;0.679;1.0;0.785	B;B;D;B	0.87578	0.175;0.246;0.998;0.428	D	0.87911	0.2697	9	0.87932	D	0	.	15.7861	0.78304	1.0:0.0:0.0:0.0	.	202;236;239;236	F8W9E3;Q7RTW4;Q02297-2;Q02297-6	.;.;.;.	V	198;181;304;236;202;82	ENSP00000430053:E198V;ENSP00000429582:E181V;ENSP00000429067:E304V;ENSP00000349275:E236V;ENSP00000287845:E202V	ENSP00000287845:E202V	E	+	2	0	NRG1	32726636	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.423000	0.80229	2.134000	0.65973	0.528000	0.53228	GAA	NRG1	-	NULL	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	58	0	A			32607094	+1	tier1	-	no_errors	ENST00000356819	ensembl	human	known	74_37	missense	33.33	52	26	SNP	1.000	T
NRG1	3084	genome.wustl.edu	37	8	32607094	32607094	+	Intron	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:32607094A>T	ENST00000405005.3	+	8	700				NRG1_ENST00000519301.1_Missense_Mutation_p.E181V|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000523681.1_3'UTR|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000356819.4_Missense_Mutation_p.E236V|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000341377.5_Intron|NRG1_ENST00000287845.5_Missense_Mutation_p.E202V|NRG1_ENST00000539990.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTTGGGATTGAATTTATGGGT	0.378																																																	0													163.0	161.0	162.0					8																	32607094		2203	4300	6503	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.701-4796A>T	8.37:g.32607094A>T			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.E236V	ENST00000405005.3	37	c.707	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298455	0.81025	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000523534;ENST00000356819;ENST00000287845;ENST00000518084	T;T;T;T;T	0.79141	-1.1;-1.24;-0.89;-0.82;-0.83	5.59	5.59	0.84812	.	.	.	.	.	D	0.86522	0.5953	M	0.62723	1.935	0.80722	D	1	B;P;D;P	0.89917	0.277;0.679;1.0;0.785	B;B;D;B	0.87578	0.175;0.246;0.998;0.428	D	0.87911	0.2697	9	0.87932	D	0	.	15.7861	0.78304	1.0:0.0:0.0:0.0	.	202;236;239;236	F8W9E3;Q7RTW4;Q02297-2;Q02297-6	.;.;.;.	V	198;181;304;236;202;82	ENSP00000430053:E198V;ENSP00000429582:E181V;ENSP00000429067:E304V;ENSP00000349275:E236V;ENSP00000287845:E202V	ENSP00000287845:E202V	E	+	2	0	NRG1	32726636	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.423000	0.80229	2.134000	0.65973	0.528000	0.53228	GAA	NRG1	-	NULL	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	59	0	A			32607094	+1	tier1	-	no_errors	ENST00000356819	ensembl	human	known	74_37	missense	33.33	52	26	SNP	1.000	T
OLFM4	10562	genome.wustl.edu	37	13	53608501	53608501	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:53608501G>A	ENST00000219022.2	+	2	301	c.223G>A	c.(223-225)Ggc>Agc	p.G75S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	75					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CAATTTCACCGGCTCCGTGGA	0.483																																																	0													155.0	132.0	140.0					13																	53608501		2203	4300	6503	SO:0001583	missense	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.223G>A	13.37:g.53608501G>A	ENSP00000219022:p.Gly75Ser		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.G75S	ENST00000219022.2	37	c.223	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383253	0.61845	.	.	ENSG00000102837	ENST00000219022	D	0.90444	-2.67	5.28	5.28	0.74379	.	0.058192	0.64402	D	0.000003	D	0.91071	0.7190	M	0.69823	2.125	0.58432	D	0.999993	D	0.55800	0.973	P	0.47376	0.545	D	0.89024	0.3437	10	0.19590	T	0.45	.	17.0595	0.86543	0.0:0.0:1.0:0.0	.	75	Q6UX06	OLFM4_HUMAN	S	75	ENSP00000219022:G75S	ENSP00000219022:G75S	G	+	1	0	OLFM4	52506502	1.000000	0.71417	0.887000	0.34795	0.362000	0.29581	6.338000	0.72963	2.630000	0.89119	0.655000	0.94253	GGC	OLFM4	-	NULL	ENSG00000102837		0.483	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	-	0.00	74	0	G	NM_006418		53608501	+1	tier1	-	no_errors	ENST00000219022	ensembl	human	known	74_37	missense	42.53	50	37	SNP	0.995	A
OLFM4	10562	genome.wustl.edu	37	13	53608501	53608501	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:53608501G>A	ENST00000219022.2	+	2	301	c.223G>A	c.(223-225)Ggc>Agc	p.G75S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	75					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CAATTTCACCGGCTCCGTGGA	0.483																																																	0													155.0	132.0	140.0					13																	53608501		2203	4300	6503	SO:0001583	missense	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.223G>A	13.37:g.53608501G>A	ENSP00000219022:p.Gly75Ser		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.G75S	ENST00000219022.2	37	c.223	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	G	17.41	3.383253	0.61845	.	.	ENSG00000102837	ENST00000219022	D	0.90444	-2.67	5.28	5.28	0.74379	.	0.058192	0.64402	D	0.000003	D	0.91071	0.7190	M	0.69823	2.125	0.58432	D	0.999993	D	0.55800	0.973	P	0.47376	0.545	D	0.89024	0.3437	10	0.19590	T	0.45	.	17.0595	0.86543	0.0:0.0:1.0:0.0	.	75	Q6UX06	OLFM4_HUMAN	S	75	ENSP00000219022:G75S	ENSP00000219022:G75S	G	+	1	0	OLFM4	52506502	1.000000	0.71417	0.887000	0.34795	0.362000	0.29581	6.338000	0.72963	2.630000	0.89119	0.655000	0.94253	GGC	OLFM4	-	NULL	ENSG00000102837		0.483	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	-	0.00	93	0	G	NM_006418		53608501	+1	tier1	-	no_errors	ENST00000219022	ensembl	human	known	74_37	missense	42.53	50	37	SNP	0.995	A
OR10G8	219869	genome.wustl.edu	37	11	123901093	123901093	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:123901093T>A	ENST00000431524.1	+	1	797	c.764T>A	c.(763-765)cTt>cAt	p.L255H		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGCCCTGGTCTTTTCATTTAC	0.552																																																	0													131.0	116.0	121.0					11																	123901093		2201	4299	6500	SO:0001583	missense	0			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.764T>A	11.37:g.123901093T>A	ENSP00000389072:p.Leu255His		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L255H	ENST00000431524.1	37	c.764	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	T	6.548	0.469359	0.12461	.	.	ENSG00000234560	ENST00000431524	T	0.47869	0.83	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.603735	0.13714	N	0.367910	T	0.62624	0.2443	M	0.78049	2.395	0.09310	N	1	D	0.60575	0.988	D	0.64237	0.923	T	0.50947	-0.8767	10	0.87932	D	0	.	6.2939	0.21075	0.0:0.129:0.0:0.871	.	255	Q8NGN5	O10G8_HUMAN	H	255	ENSP00000389072:L255H	ENSP00000389072:L255H	L	+	2	0	OR10G8	123406303	0.001000	0.12720	0.169000	0.22859	0.019000	0.09904	1.126000	0.31344	1.319000	0.45190	0.455000	0.32223	CTT	OR10G8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000234560		0.552	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	HGNC	protein_coding	OTTHUMT00000387270.1	-	0.00	178	0	T	NM_001004464		123901093	+1	tier1	-	no_errors	ENST00000431524	ensembl	human	known	74_37	missense	42.51	96	71	SNP	0.001	A
OR10G8	219869	genome.wustl.edu	37	11	123901093	123901093	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:123901093T>A	ENST00000431524.1	+	1	797	c.764T>A	c.(763-765)cTt>cAt	p.L255H		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGCCCTGGTCTTTTCATTTAC	0.552																																																	0													131.0	116.0	121.0					11																	123901093		2201	4299	6500	SO:0001583	missense	0			AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.764T>A	11.37:g.123901093T>A	ENSP00000389072:p.Leu255His		B2RNJ3|Q6IEV2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L255H	ENST00000431524.1	37	c.764	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	T	6.548	0.469359	0.12461	.	.	ENSG00000234560	ENST00000431524	T	0.47869	0.83	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.603735	0.13714	N	0.367910	T	0.62624	0.2443	M	0.78049	2.395	0.09310	N	1	D	0.60575	0.988	D	0.64237	0.923	T	0.50947	-0.8767	10	0.87932	D	0	.	6.2939	0.21075	0.0:0.129:0.0:0.871	.	255	Q8NGN5	O10G8_HUMAN	H	255	ENSP00000389072:L255H	ENSP00000389072:L255H	L	+	2	0	OR10G8	123406303	0.001000	0.12720	0.169000	0.22859	0.019000	0.09904	1.126000	0.31344	1.319000	0.45190	0.455000	0.32223	CTT	OR10G8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000234560		0.552	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	HGNC	protein_coding	OTTHUMT00000387270.1	-	0.00	214	0	T	NM_001004464		123901093	+1	tier1	-	no_errors	ENST00000431524	ensembl	human	known	74_37	missense	42.51	96	71	SNP	0.001	A
OR14A16	284532	genome.wustl.edu	37	1	247978230	247978230	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:247978230C>A	ENST00000357627.1	-	1	801	c.802G>T	c.(802-804)Gat>Tat	p.D268Y		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						ATTACAGCATCCAAAATAGAA	0.423																																					Ovarian(112;180 1586 15073 21914 33526)												0													72.0	71.0	71.0					1																	247978230		2203	4300	6503	SO:0001583	missense	0			BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.802G>T	1.37:g.247978230C>A	ENSP00000350248:p.Asp268Tyr		Q6IF96	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D268Y	ENST00000357627.1	37	c.802	CCDS31097.1	1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890370	0.33348	.	.	ENSG00000196772	ENST00000357627	T	0.00256	8.42	3.55	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.281269	0.24156	U	0.041037	T	0.00784	0.0026	H	0.97291	3.975	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.33137	-0.9880	10	0.72032	D	0.01	.	6.6118	0.22755	0.0:0.7147:0.1847:0.1007	.	268	Q8NHC5	O14AG_HUMAN	Y	268	ENSP00000350248:D268Y	ENSP00000350248:D268Y	D	-	1	0	OR14A16	246044853	0.000000	0.05858	0.018000	0.16275	0.008000	0.06430	-1.288000	0.02783	0.676000	0.31285	0.596000	0.82720	GAT	OR14A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196772		0.423	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14A16	HGNC	protein_coding	OTTHUMT00000096856.1	-	0.00	27	0	C	NM_001001966		247978230	-1	tier1	-	no_errors	ENST00000357627	ensembl	human	known	74_37	missense	17.50	33	7	SNP	0.053	A
OR14A16	284532	genome.wustl.edu	37	1	247978230	247978230	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:247978230C>A	ENST00000357627.1	-	1	801	c.802G>T	c.(802-804)Gat>Tat	p.D268Y		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						ATTACAGCATCCAAAATAGAA	0.423																																					Ovarian(112;180 1586 15073 21914 33526)												0													72.0	71.0	71.0					1																	247978230		2203	4300	6503	SO:0001583	missense	0			BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.802G>T	1.37:g.247978230C>A	ENSP00000350248:p.Asp268Tyr		Q6IF96	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D268Y	ENST00000357627.1	37	c.802	CCDS31097.1	1	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890370	0.33348	.	.	ENSG00000196772	ENST00000357627	T	0.00256	8.42	3.55	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.281269	0.24156	U	0.041037	T	0.00784	0.0026	H	0.97291	3.975	0.09310	N	1	D	0.89917	1.0	D	0.81914	0.995	T	0.33137	-0.9880	10	0.72032	D	0.01	.	6.6118	0.22755	0.0:0.7147:0.1847:0.1007	.	268	Q8NHC5	O14AG_HUMAN	Y	268	ENSP00000350248:D268Y	ENSP00000350248:D268Y	D	-	1	0	OR14A16	246044853	0.000000	0.05858	0.018000	0.16275	0.008000	0.06430	-1.288000	0.02783	0.676000	0.31285	0.596000	0.82720	GAT	OR14A16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196772		0.423	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14A16	HGNC	protein_coding	OTTHUMT00000096856.1	-	0.00	35	0	C	NM_001001966		247978230	-1	tier1	-	no_errors	ENST00000357627	ensembl	human	known	74_37	missense	17.50	33	7	SNP	0.053	A
OR52E2	119678	genome.wustl.edu	37	11	5080148	5080148	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:5080148T>G	ENST00000321522.2	-	1	709	c.710A>C	c.(709-711)aAg>aCg	p.K237T		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K237M(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		GCTGAGGGACTTGAGTCGGGC	0.453																																																	1	Substitution - Missense(1)	lung(1)											82.0	76.0	78.0					11																	5080148		2201	4298	6499	SO:0001583	missense	0			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.710A>C	11.37:g.5080148T>G	ENSP00000322088:p.Lys237Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K237T	ENST00000321522.2	37	c.710	CCDS31371.1	11	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137525	0.56936	.	.	ENSG00000176787	ENST00000321522	T	0.00375	7.71	3.76	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.109676	0.40302	N	0.001137	T	0.01558	0.0050	H	0.97896	4.1	0.35685	D	0.814391	D	0.64830	0.994	P	0.61940	0.896	T	0.06643	-1.0815	10	0.87932	D	0	.	12.3384	0.55081	0.0:0.0:0.0:1.0	.	237	Q8NGJ4	O52E2_HUMAN	T	237	ENSP00000322088:K237T	ENSP00000322088:K237T	K	-	2	0	OR52E2	5036724	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.570000	0.36439	1.963000	0.57068	0.524000	0.50904	AAG	OR52E2	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176787		0.453	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1	-	0.00	33	0	T	NM_001005164		5080148	-1	tier1	-	no_errors	ENST00000321522	ensembl	human	known	74_37	missense	46.15	14	12	SNP	1.000	G
OR52E2	119678	genome.wustl.edu	37	11	5080148	5080148	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:5080148T>G	ENST00000321522.2	-	1	709	c.710A>C	c.(709-711)aAg>aCg	p.K237T		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K237M(1)		endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		GCTGAGGGACTTGAGTCGGGC	0.453																																																	1	Substitution - Missense(1)	lung(1)											82.0	76.0	78.0					11																	5080148		2201	4298	6499	SO:0001583	missense	0			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.710A>C	11.37:g.5080148T>G	ENSP00000322088:p.Lys237Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K237T	ENST00000321522.2	37	c.710	CCDS31371.1	11	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137525	0.56936	.	.	ENSG00000176787	ENST00000321522	T	0.00375	7.71	3.76	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.109676	0.40302	N	0.001137	T	0.01558	0.0050	H	0.97896	4.1	0.35685	D	0.814391	D	0.64830	0.994	P	0.61940	0.896	T	0.06643	-1.0815	10	0.87932	D	0	.	12.3384	0.55081	0.0:0.0:0.0:1.0	.	237	Q8NGJ4	O52E2_HUMAN	T	237	ENSP00000322088:K237T	ENSP00000322088:K237T	K	-	2	0	OR52E2	5036724	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.570000	0.36439	1.963000	0.57068	0.524000	0.50904	AAG	OR52E2	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176787		0.453	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1	-	0.00	41	0	T	NM_001005164		5080148	-1	tier1	-	no_errors	ENST00000321522	ensembl	human	known	74_37	missense	46.15	14	12	SNP	1.000	G
OR52E8	390079	genome.wustl.edu	37	11	5878173	5878173	+	Missense_Mutation	SNP	A	A	C	rs373000239		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:5878173A>C	ENST00000537935.1	-	1	791	c.760T>G	c.(760-762)Tta>Gta	p.L254V	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAAAGGCTAAGATAACACCA	0.418																																																	0													99.0	111.0	107.0					11																	5878173		2141	4296	6437	SO:0001583	missense	0			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.760T>G	11.37:g.5878173A>C	ENSP00000444054:p.Leu254Val		B9EH38	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L254V	ENST00000537935.1	37	c.760	CCDS31400.1	11	.	.	.	.	.	.	.	.	.	.	A	16.35	3.097761	0.56075	.	.	ENSG00000183269	ENST00000537935	T	0.33654	1.4	4.42	0.83	0.18854	GPCR, rhodopsin-like superfamily (1);	0.153894	0.30101	N	0.010417	T	0.48502	0.1503	M	0.70275	2.135	0.26935	N	0.966377	D	0.55605	0.972	P	0.61658	0.892	T	0.35624	-0.9781	10	0.38643	T	0.18	.	7.5817	0.27970	0.7405:0.0:0.2595:0.0	.	254	Q6IFG1	O52E8_HUMAN	V	254	ENSP00000444054:L254V	ENSP00000444054:L254V	L	-	1	2	OR52E8	5834749	0.000000	0.05858	0.996000	0.52242	0.912000	0.54170	0.220000	0.17660	0.045000	0.15804	0.448000	0.29417	TTA	OR52E8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183269		0.418	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	HGNC	protein_coding	OTTHUMT00000401145.1	-	0.00	33	0	A	NM_001005168		5878173	-1	tier1	-	no_errors	ENST00000537935	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.978	C
OR52E8	390079	genome.wustl.edu	37	11	5878173	5878173	+	Missense_Mutation	SNP	A	A	C	rs373000239		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:5878173A>C	ENST00000537935.1	-	1	791	c.760T>G	c.(760-762)Tta>Gta	p.L254V	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	254						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAAAAGGCTAAGATAACACCA	0.418																																																	0													99.0	111.0	107.0					11																	5878173		2141	4296	6437	SO:0001583	missense	0			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.760T>G	11.37:g.5878173A>C	ENSP00000444054:p.Leu254Val		B9EH38	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L254V	ENST00000537935.1	37	c.760	CCDS31400.1	11	.	.	.	.	.	.	.	.	.	.	A	16.35	3.097761	0.56075	.	.	ENSG00000183269	ENST00000537935	T	0.33654	1.4	4.42	0.83	0.18854	GPCR, rhodopsin-like superfamily (1);	0.153894	0.30101	N	0.010417	T	0.48502	0.1503	M	0.70275	2.135	0.26935	N	0.966377	D	0.55605	0.972	P	0.61658	0.892	T	0.35624	-0.9781	10	0.38643	T	0.18	.	7.5817	0.27970	0.7405:0.0:0.2595:0.0	.	254	Q6IFG1	O52E8_HUMAN	V	254	ENSP00000444054:L254V	ENSP00000444054:L254V	L	-	1	2	OR52E8	5834749	0.000000	0.05858	0.996000	0.52242	0.912000	0.54170	0.220000	0.17660	0.045000	0.15804	0.448000	0.29417	TTA	OR52E8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183269		0.418	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	HGNC	protein_coding	OTTHUMT00000401145.1	-	0.00	34	0	A	NM_001005168		5878173	-1	tier1	-	no_errors	ENST00000537935	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.978	C
OR5H14	403273	genome.wustl.edu	37	3	97868703	97868703	+	Missense_Mutation	SNP	C	C	G	rs181133249		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:97868703C>G	ENST00000437310.1	+	1	534	c.474C>G	c.(472-474)atC>atG	p.I158M	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATGCTTTAATCCATGAAGGAT	0.353																																																	0													111.0	111.0	111.0					3																	97868703		2202	4300	6502	SO:0001583	missense	0				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.474C>G	3.37:g.97868703C>G	ENSP00000401706:p.Ile158Met		B9EH15	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I158M	ENST00000437310.1	37	c.474	CCDS33798.1	3	.	.	.	.	.	.	.	.	.	.	T	7.865	0.726947	0.15439	.	.	ENSG00000236032	ENST00000437310	T	0.38401	1.14	2.49	-0.549	0.11829	GPCR, rhodopsin-like superfamily (1);	0.851984	0.09987	N	0.730266	T	0.33702	0.0872	L	0.56124	1.755	0.09310	N	1	P	0.41159	0.74	P	0.44673	0.457	T	0.27054	-1.0085	10	0.56958	D	0.05	.	3.0868	0.06280	0.188:0.2983:0.0:0.5137	.	158	A6NHG9	O5H14_HUMAN	M	158	ENSP00000401706:I158M	ENSP00000401706:I158M	I	+	3	3	OR5H14	99351393	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.721000	0.01870	-0.162000	0.10964	-2.620000	0.00156	ATC	OR5H14	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000236032		0.353	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	-	0.00	114	0	C			97868703	+1	tier1	-	no_errors	ENST00000437310	ensembl	human	known	74_37	missense	52.81	42	47	SNP	0.000	G
OR5H14	403273	genome.wustl.edu	37	3	97868703	97868703	+	Missense_Mutation	SNP	C	C	G	rs181133249		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:97868703C>G	ENST00000437310.1	+	1	534	c.474C>G	c.(472-474)atC>atG	p.I158M	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATGCTTTAATCCATGAAGGAT	0.353																																																	0													111.0	111.0	111.0					3																	97868703		2202	4300	6502	SO:0001583	missense	0				CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.474C>G	3.37:g.97868703C>G	ENSP00000401706:p.Ile158Met		B9EH15	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I158M	ENST00000437310.1	37	c.474	CCDS33798.1	3	.	.	.	.	.	.	.	.	.	.	T	7.865	0.726947	0.15439	.	.	ENSG00000236032	ENST00000437310	T	0.38401	1.14	2.49	-0.549	0.11829	GPCR, rhodopsin-like superfamily (1);	0.851984	0.09987	N	0.730266	T	0.33702	0.0872	L	0.56124	1.755	0.09310	N	1	P	0.41159	0.74	P	0.44673	0.457	T	0.27054	-1.0085	10	0.56958	D	0.05	.	3.0868	0.06280	0.188:0.2983:0.0:0.5137	.	158	A6NHG9	O5H14_HUMAN	M	158	ENSP00000401706:I158M	ENSP00000401706:I158M	I	+	3	3	OR5H14	99351393	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.721000	0.01870	-0.162000	0.10964	-2.620000	0.00156	ATC	OR5H14	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000236032		0.353	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H14	HGNC	protein_coding	OTTHUMT00000359112.1	-	0.00	119	0	C			97868703	+1	tier1	-	no_errors	ENST00000437310	ensembl	human	known	74_37	missense	52.81	42	47	SNP	0.000	G
OR8K3	219473	genome.wustl.edu	37	11	56086621	56086621	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:56086621T>C	ENST00000312711.1	+	1	839	c.839T>C	c.(838-840)gTt>gCt	p.V280A		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TACACCCTGGTTATCCCCATG	0.373																																																	0													84.0	74.0	77.0					11																	56086621		2201	4296	6497	SO:0001583	missense	0			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.839T>C	11.37:g.56086621T>C	ENSP00000323555:p.Val280Ala		Q6IFC4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V280A	ENST00000312711.1	37	c.839	CCDS31527.1	11	.	.	.	.	.	.	.	.	.	.	T	11.14	1.551807	0.27739	.	.	ENSG00000181689	ENST00000312711	T	0.00296	8.24	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.123718	0.36234	N	0.002715	T	0.00666	0.0022	M	0.86097	2.795	0.09310	N	1	D	0.59767	0.986	D	0.65233	0.933	T	0.31916	-0.9926	10	0.87932	D	0	.	12.487	0.55879	0.0:0.0:0.0:1.0	.	280	Q8NH51	OR8K3_HUMAN	A	280	ENSP00000323555:V280A	ENSP00000323555:V280A	V	+	2	0	OR8K3	55843197	0.994000	0.37717	0.029000	0.17559	0.007000	0.05969	5.858000	0.69532	1.888000	0.54679	0.386000	0.25728	GTT	OR8K3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181689		0.373	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	HGNC	protein_coding	OTTHUMT00000391602.1	-	0.00	49	0	T	NM_001005202		56086621	+1	tier1	-	no_errors	ENST00000312711	ensembl	human	known	74_37	missense	31.91	32	15	SNP	0.040	C
OR8K3	219473	genome.wustl.edu	37	11	56086621	56086621	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:56086621T>C	ENST00000312711.1	+	1	839	c.839T>C	c.(838-840)gTt>gCt	p.V280A		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TACACCCTGGTTATCCCCATG	0.373																																																	0													84.0	74.0	77.0					11																	56086621		2201	4296	6497	SO:0001583	missense	0			AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.839T>C	11.37:g.56086621T>C	ENSP00000323555:p.Val280Ala		Q6IFC4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V280A	ENST00000312711.1	37	c.839	CCDS31527.1	11	.	.	.	.	.	.	.	.	.	.	T	11.14	1.551807	0.27739	.	.	ENSG00000181689	ENST00000312711	T	0.00296	8.24	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.123718	0.36234	N	0.002715	T	0.00666	0.0022	M	0.86097	2.795	0.09310	N	1	D	0.59767	0.986	D	0.65233	0.933	T	0.31916	-0.9926	10	0.87932	D	0	.	12.487	0.55879	0.0:0.0:0.0:1.0	.	280	Q8NH51	OR8K3_HUMAN	A	280	ENSP00000323555:V280A	ENSP00000323555:V280A	V	+	2	0	OR8K3	55843197	0.994000	0.37717	0.029000	0.17559	0.007000	0.05969	5.858000	0.69532	1.888000	0.54679	0.386000	0.25728	GTT	OR8K3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181689		0.373	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K3	HGNC	protein_coding	OTTHUMT00000391602.1	-	0.00	64	0	T	NM_001005202		56086621	+1	tier1	-	no_errors	ENST00000312711	ensembl	human	known	74_37	missense	31.91	32	15	SNP	0.040	C
OTUD6B	51633	genome.wustl.edu	37	8	92082604	92082604	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:92082604C>T	ENST00000285420.4	+	1	181	c.82C>T	c.(82-84)Ctg>Ttg	p.L28L	GS1-251I9.4_ENST00000522817.1_RNA|GS1-251I9.4_ENST00000524003.1_RNA|OTUD6B_ENST00000404789.3_5'UTR	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	0							cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			GCTGGGGTACCTGGTCGTCAT	0.592																																																	0													94.0	97.0	96.0					8																	92082604		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.82C>T	8.37:g.92082604C>T			A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Silent	SNP	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.L28	ENST00000285420.4	37	c.82	CCDS6253.2	8																																																																																			OTUD6B	-	NULL	ENSG00000155100		0.592	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1	-	0.00	108	0	C	NM_016023		92082604	+1	tier1	-	no_errors	ENST00000285420	ensembl	human	known	74_37	silent	25.44	85	29	SNP	0.000	T
OTUD6B	51633	genome.wustl.edu	37	8	92082604	92082604	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:92082604C>T	ENST00000285420.4	+	1	181	c.82C>T	c.(82-84)Ctg>Ttg	p.L28L	GS1-251I9.4_ENST00000522817.1_RNA|GS1-251I9.4_ENST00000524003.1_RNA|OTUD6B_ENST00000404789.3_5'UTR	NM_016023.3	NP_057107.3	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	0							cysteine-type peptidase activity (GO:0008234)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11			BRCA - Breast invasive adenocarcinoma(11;0.0187)			GCTGGGGTACCTGGTCGTCAT	0.592																																																	0													94.0	97.0	96.0					8																	92082604		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6253.2, CCDS69513.1	8q21.3	2013-01-21			ENSG00000155100	ENSG00000155100		"""OTU domain containing"""	24281	protein-coding gene	gene with protein product		612021					Standard	NM_016023		Approved	CGI-77, DUBA5	uc003yeu.4	Q8N6M0	OTTHUMG00000150758	ENST00000285420.4:c.82C>T	8.37:g.92082604C>T			A8K6I1|B4DEY0|Q9NTA4|Q9Y387	Silent	SNP	pfam_OTU,pfam_Peptidase_C65_otubain,pfscan_OTU	p.L28	ENST00000285420.4	37	c.82	CCDS6253.2	8																																																																																			OTUD6B	-	NULL	ENSG00000155100		0.592	OTUD6B-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	OTUD6B	HGNC	protein_coding	OTTHUMT00000319968.1	-	0.00	82	0	C	NM_016023		92082604	+1	tier1	-	no_errors	ENST00000285420	ensembl	human	known	74_37	silent	25.44	85	29	SNP	0.000	T
PCDH10	57575	genome.wustl.edu	37	4	134072759	134072759	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:134072759C>T	ENST00000264360.5	+	1	2290	c.1464C>T	c.(1462-1464)acC>acT	p.T488T	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	488	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGAGCGCCACCGACCGGGATG	0.582																																																	0													64.0	63.0	63.0					4																	134072759		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1464C>T	4.37:g.134072759C>T			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T488	ENST00000264360.5	37	c.1464	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.582	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	35	0	C	NM_032961		134072759	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	silent	38.89	22	14	SNP	0.427	T
PCDH10	57575	genome.wustl.edu	37	4	134072759	134072759	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:134072759C>T	ENST00000264360.5	+	1	2290	c.1464C>T	c.(1462-1464)acC>acT	p.T488T	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	488	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGAGCGCCACCGACCGGGATG	0.582																																																	0													64.0	63.0	63.0					4																	134072759		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1464C>T	4.37:g.134072759C>T			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T488	ENST00000264360.5	37	c.1464	CCDS34063.1	4																																																																																			PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.582	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	36	0	C	NM_032961		134072759	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	silent	38.89	22	14	SNP	0.427	T
PCDH10	57575	genome.wustl.edu	37	4	134073022	134073022	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:134073022C>T	ENST00000264360.5	+	1	2553	c.1727C>T	c.(1726-1728)gCg>gTg	p.A576V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	576					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GCCATCGTGGCGCCTCTACCA	0.687																																																	0													27.0	32.0	31.0					4																	134073022		2118	4188	6306	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1727C>T	4.37:g.134073022C>T	ENSP00000264360:p.Ala576Val		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A576V	ENST00000264360.5	37	c.1727	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321507	0.60634	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.37752	1.18	4.5	4.5	0.54988	Cadherin-like (1);	0.000000	0.44902	D	0.000402	T	0.25419	0.0618	N	0.25825	0.765	0.47698	D	0.999491	P;B	0.51351	0.944;0.207	B;B	0.43251	0.413;0.042	T	0.01630	-1.1308	10	0.22109	T	0.4	.	11.0293	0.47763	0.0:0.753:0.247:0.0	.	576;576	Q9P2E7;Q96SF0	PCD10_HUMAN;.	V	576	ENSP00000264360:A576V	ENSP00000264360:A576V	A	+	2	0	PCDH10	134292472	0.911000	0.30947	1.000000	0.80357	0.560000	0.35617	1.020000	0.30027	2.325000	0.78763	0.655000	0.94253	GCG	PCDH10	-	superfamily_Cadherin-like	ENSG00000138650		0.687	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	24	0	C	NM_032961		134073022	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	25.00	14	5	SNP	1.000	T
PCDH10	57575	genome.wustl.edu	37	4	134073022	134073022	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:134073022C>T	ENST00000264360.5	+	1	2553	c.1727C>T	c.(1726-1728)gCg>gTg	p.A576V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	576					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		GCCATCGTGGCGCCTCTACCA	0.687																																																	0													27.0	32.0	31.0					4																	134073022		2118	4188	6306	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1727C>T	4.37:g.134073022C>T	ENSP00000264360:p.Ala576Val		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A576V	ENST00000264360.5	37	c.1727	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321507	0.60634	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.37752	1.18	4.5	4.5	0.54988	Cadherin-like (1);	0.000000	0.44902	D	0.000402	T	0.25419	0.0618	N	0.25825	0.765	0.47698	D	0.999491	P;B	0.51351	0.944;0.207	B;B	0.43251	0.413;0.042	T	0.01630	-1.1308	10	0.22109	T	0.4	.	11.0293	0.47763	0.0:0.753:0.247:0.0	.	576;576	Q9P2E7;Q96SF0	PCD10_HUMAN;.	V	576	ENSP00000264360:A576V	ENSP00000264360:A576V	A	+	2	0	PCDH10	134292472	0.911000	0.30947	1.000000	0.80357	0.560000	0.35617	1.020000	0.30027	2.325000	0.78763	0.655000	0.94253	GCG	PCDH10	-	superfamily_Cadherin-like	ENSG00000138650		0.687	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	32	0	C	NM_032961		134073022	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	25.00	14	5	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55591078	55591078	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:55591078C>T	ENST00000320301.6	-	30	4593	c.4199G>A	c.(4198-4200)aGa>aAa	p.R1400K	PCDH15_ENST00000395433.1_Missense_Mutation_p.R1378K|PCDH15_ENST00000373965.2_Missense_Mutation_p.R1407K|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.R1363K|PCDH15_ENST00000409834.1_Missense_Mutation_p.R1011K|PCDH15_ENST00000414778.1_Missense_Mutation_p.R1405K|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.R1407K|PCDH15_ENST00000361849.3_Missense_Mutation_p.R1400K|PCDH15_ENST00000395438.1_Missense_Mutation_p.R1400K|PCDH15_ENST00000395430.1_Missense_Mutation_p.R1400K|PCDH15_ENST00000437009.1_Missense_Mutation_p.R1329K	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1400					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TACTTACTGTCTGTAGCTGAC	0.453										HNSCC(58;0.16)																																							0													201.0	179.0	187.0					10																	55591078		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4199G>A	10.37:g.55591078C>T	ENSP00000322604:p.Arg1400Lys		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1400K	ENST00000320301.6	37	c.4199	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221178	0.58560	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.58652	0.55;0.61;0.56;0.55;0.48;0.52;0.47;0.54;0.48;0.5;0.32	5.57	4.66	0.58398	.	.	.	.	.	T	0.57784	0.2077	N	0.12182	0.205	0.45914	D	0.998755	B;B;B;B;B;B;D;B;B;B;B;B;B	0.57257	0.392;0.172;0.172;0.089;0.224;0.172;0.979;0.052;0.1;0.1;0.052;0.052;0.172	P;B;B;B;B;B;D;B;B;B;B;B;B	0.74348	0.545;0.07;0.07;0.034;0.07;0.07;0.983;0.016;0.039;0.039;0.016;0.058;0.07	T	0.57585	-0.7786	9	0.36615	T	0.2	.	13.8865	0.63712	0.0:0.9258:0.0:0.0742	.	1378;1400;1400;1405;1329;1363;1400;1400;1407;1407;1400;1405;1400	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	K	1407;1405;1400;1400;1011;1407;1363;1400;1378;1400;1400;1405;1329	ENSP00000363076:R1407K;ENSP00000410304:R1405K;ENSP00000378826:R1400K;ENSP00000386693:R1011K;ENSP00000378832:R1407K;ENSP00000378820:R1363K;ENSP00000354950:R1400K;ENSP00000378821:R1378K;ENSP00000322604:R1400K;ENSP00000378818:R1400K;ENSP00000412628:R1329K	ENSP00000322604:R1400K	R	-	2	0	PCDH15	55261084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.585000	0.36600	2.785000	0.95823	0.591000	0.81541	AGA	PCDH15	-	NULL	ENSG00000150275		0.453	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	55	0	C	NM_033056		55591078	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	33.93	36	19	SNP	1.000	T
PCDH15	65217	genome.wustl.edu	37	10	55591078	55591078	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:55591078C>T	ENST00000320301.6	-	30	4593	c.4199G>A	c.(4198-4200)aGa>aAa	p.R1400K	PCDH15_ENST00000395433.1_Missense_Mutation_p.R1378K|PCDH15_ENST00000373965.2_Missense_Mutation_p.R1407K|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.R1363K|PCDH15_ENST00000409834.1_Missense_Mutation_p.R1011K|PCDH15_ENST00000414778.1_Missense_Mutation_p.R1405K|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.R1407K|PCDH15_ENST00000361849.3_Missense_Mutation_p.R1400K|PCDH15_ENST00000395438.1_Missense_Mutation_p.R1400K|PCDH15_ENST00000395430.1_Missense_Mutation_p.R1400K|PCDH15_ENST00000437009.1_Missense_Mutation_p.R1329K	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1400					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TACTTACTGTCTGTAGCTGAC	0.453										HNSCC(58;0.16)																																							0													201.0	179.0	187.0					10																	55591078		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4199G>A	10.37:g.55591078C>T	ENSP00000322604:p.Arg1400Lys		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1400K	ENST00000320301.6	37	c.4199	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	16.79	3.221178	0.58560	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.58652	0.55;0.61;0.56;0.55;0.48;0.52;0.47;0.54;0.48;0.5;0.32	5.57	4.66	0.58398	.	.	.	.	.	T	0.57784	0.2077	N	0.12182	0.205	0.45914	D	0.998755	B;B;B;B;B;B;D;B;B;B;B;B;B	0.57257	0.392;0.172;0.172;0.089;0.224;0.172;0.979;0.052;0.1;0.1;0.052;0.052;0.172	P;B;B;B;B;B;D;B;B;B;B;B;B	0.74348	0.545;0.07;0.07;0.034;0.07;0.07;0.983;0.016;0.039;0.039;0.016;0.058;0.07	T	0.57585	-0.7786	9	0.36615	T	0.2	.	13.8865	0.63712	0.0:0.9258:0.0:0.0742	.	1378;1400;1400;1405;1329;1363;1400;1400;1407;1407;1400;1405;1400	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	K	1407;1405;1400;1400;1011;1407;1363;1400;1378;1400;1400;1405;1329	ENSP00000363076:R1407K;ENSP00000410304:R1405K;ENSP00000378826:R1400K;ENSP00000386693:R1011K;ENSP00000378832:R1407K;ENSP00000378820:R1363K;ENSP00000354950:R1400K;ENSP00000378821:R1378K;ENSP00000322604:R1400K;ENSP00000378818:R1400K;ENSP00000412628:R1329K	ENSP00000322604:R1400K	R	-	2	0	PCDH15	55261084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.585000	0.36600	2.785000	0.95823	0.591000	0.81541	AGA	PCDH15	-	NULL	ENSG00000150275		0.453	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	59	0	C	NM_033056		55591078	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	33.93	36	19	SNP	1.000	T
PCLO	27445	genome.wustl.edu	37	7	82580702	82580702	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:82580702T>G	ENST00000333891.9	-	6	9539	c.9202A>C	c.(9202-9204)Atg>Ctg	p.M3068L	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.M3068L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGTGGTGTCATTCTTGCTGTG	0.453																																																	0													102.0	97.0	99.0					7																	82580702		1926	4134	6060	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9202A>C	7.37:g.82580702T>G	ENSP00000334319:p.Met3068Leu			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.M3068L	ENST00000333891.9	37	c.9202	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	9.938	1.216821	0.22373	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.14766	2.48;2.48	5.37	5.37	0.77165	.	.	.	.	.	T	0.25344	0.0616	L	0.29908	0.895	0.80722	D	1	P;P;P	0.43024	0.518;0.798;0.798	P;P;P	0.60236	0.456;0.871;0.871	T	0.01684	-1.1296	9	0.87932	D	0	.	15.0315	0.71710	0.0:0.0:0.0:1.0	.	2999;3068;3068	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	L	2999;3068;3068	ENSP00000334319:M3068L;ENSP00000388393:M3068L	ENSP00000334319:M3068L	M	-	1	0	PCLO	82418638	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.958000	0.63660	2.041000	0.60428	0.460000	0.39030	ATG	PCLO	-	NULL	ENSG00000186472		0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	151	0	T	NM_014510		82580702	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	52.98	78	89	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82580702	82580702	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:82580702T>G	ENST00000333891.9	-	6	9539	c.9202A>C	c.(9202-9204)Atg>Ctg	p.M3068L	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.M3068L	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGTGGTGTCATTCTTGCTGTG	0.453																																																	0													102.0	97.0	99.0					7																	82580702		1926	4134	6060	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.9202A>C	7.37:g.82580702T>G	ENSP00000334319:p.Met3068Leu			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.M3068L	ENST00000333891.9	37	c.9202	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	9.938	1.216821	0.22373	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.14766	2.48;2.48	5.37	5.37	0.77165	.	.	.	.	.	T	0.25344	0.0616	L	0.29908	0.895	0.80722	D	1	P;P;P	0.43024	0.518;0.798;0.798	P;P;P	0.60236	0.456;0.871;0.871	T	0.01684	-1.1296	9	0.87932	D	0	.	15.0315	0.71710	0.0:0.0:0.0:1.0	.	2999;3068;3068	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	L	2999;3068;3068	ENSP00000334319:M3068L;ENSP00000388393:M3068L	ENSP00000334319:M3068L	M	-	1	0	PCLO	82418638	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.958000	0.63660	2.041000	0.60428	0.460000	0.39030	ATG	PCLO	-	NULL	ENSG00000186472		0.453	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	166	0	T	NM_014510		82580702	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	52.98	78	89	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82584392	82584392	+	Silent	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:82584392A>C	ENST00000333891.9	-	5	6214	c.5877T>G	c.(5875-5877)tcT>tcG	p.S1959S	PCLO_ENST00000423517.2_Silent_p.S1959S	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CTTCTACTAAAGATTCATAAA	0.378																																																	0													86.0	86.0	86.0					7																	82584392		1844	4094	5938	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5877T>G	7.37:g.82584392A>C				Silent	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S1959	ENST00000333891.9	37	c.5877	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.378	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	80	0	A	NM_014510		82584392	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	19.32	71	17	SNP	0.980	C
PDE6B	5158	genome.wustl.edu	37	4	661763	661765	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:661763_661765delAGG	ENST00000496514.1	+	21	2492_2494	c.2471_2473delAGG	c.(2470-2475)aaggag>aag	p.E828del	PDE6B_ENST00000255622.6_In_Frame_Del_p.E828del|PDE6B_ENST00000429163.2_In_Frame_Del_p.E549del			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	828					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTGGAGGAGAAGGAGGAGGAGGA	0.562																																					GBM(71;463 1194 9848 25922 46834)												0																																										SO:0001651	inframe_deletion	0			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2471_2473delAGG	4.37:g.661772_661774delAGG	ENSP00000420295:p.Glu828del		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	In_Frame_Del	DEL	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E828in_frame_del	ENST00000496514.1	37	c.2471_2473	CCDS33932.1	4																																																																																			PDE6B	-	NULL	ENSG00000133256		0.562	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	HGNC	protein_coding	OTTHUMT00000358109.1		0.00	24	0	AGG	NM_000283		661765	+1	tier1		no_errors	ENST00000496514	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:1.000:1.000	-
PDE6B	5158	genome.wustl.edu	37	4	661763	661765	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:661763_661765delAGG	ENST00000496514.1	+	21	2492_2494	c.2471_2473delAGG	c.(2470-2475)aaggag>aag	p.E828del	PDE6B_ENST00000255622.6_In_Frame_Del_p.E828del|PDE6B_ENST00000429163.2_In_Frame_Del_p.E549del			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	828					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	CTGGAGGAGAAGGAGGAGGAGGA	0.562																																					GBM(71;463 1194 9848 25922 46834)												0																																										SO:0001651	inframe_deletion	0			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2471_2473delAGG	4.37:g.661772_661774delAGG	ENSP00000420295:p.Glu828del		B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	In_Frame_Del	DEL	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E828in_frame_del	ENST00000496514.1	37	c.2471_2473	CCDS33932.1	4																																																																																			PDE6B	-	NULL	ENSG00000133256		0.562	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	HGNC	protein_coding	OTTHUMT00000358109.1		0.00	35	0	AGG	NM_000283		661765	+1	tier1		no_errors	ENST00000496514	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:1.000:1.000	-
PDZD9	255762	genome.wustl.edu	37	16	21995841	21995841	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:21995841G>C	ENST00000424898.2	-	4	604	c.542C>G	c.(541-543)tCc>tGc	p.S181C	PDZD9_ENST00000537222.2_Missense_Mutation_p.S121C|PDZD9_ENST00000286143.6_Missense_Mutation_p.S119C			Q8IXQ8	PDZD9_HUMAN	PDZ domain containing 9	181										breast(3)|endometrium(2)|lung(3)|pancreas(1)	9						TCTGGAGATGGATATTGGTCT	0.368																																																	0													148.0	143.0	145.0					16																	21995841		2198	4300	6498	SO:0001583	missense	0			BC039562	CCDS10602.1, CCDS10602.2	16p12.1	2010-04-14	2010-04-14	2010-04-14	ENSG00000155714	ENSG00000155714			28740	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 65"""	C16orf65		12477932	Standard	NM_173806		Approved	MGC50721	uc021ter.1	Q8IXQ8	OTTHUMG00000131586	ENST00000424898.2:c.542C>G	16.37:g.21995841G>C	ENSP00000400514:p.Ser181Cys		F5GWW8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S181C	ENST00000424898.2	37	c.542		16	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189459	0.57909	.	.	ENSG00000155714	ENST00000424898;ENST00000537222;ENST00000286143;ENST00000521513	T	0.52295	0.67	5.43	4.44	0.53790	.	0.106984	0.42548	D	0.000696	T	0.64305	0.2586	M	0.66939	2.045	0.09310	N	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.57694	-0.7767	10	0.66056	D	0.02	-7.3505	11.2491	0.49015	0.0:0.0:0.817:0.183	.	119	Q8IXQ8-2	.	C	181;121;119;121	ENSP00000400514:S181C	ENSP00000286143:S119C	S	-	2	0	PDZD9	21903342	0.972000	0.33761	0.125000	0.21846	0.987000	0.75469	2.896000	0.48656	1.230000	0.43646	0.563000	0.77884	TCC	PDZD9	-	NULL	ENSG00000155714		0.368	PDZD9-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PDZD9	HGNC	protein_coding	OTTHUMT00000381652.1	-	0.00	66	0	G	NM_173806		21995841	-1	tier1	-	no_errors	ENST00000424898	ensembl	human	known	74_37	missense	24.64	51	17	SNP	0.135	C
PDZD9	255762	genome.wustl.edu	37	16	21995841	21995841	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:21995841G>C	ENST00000424898.2	-	4	604	c.542C>G	c.(541-543)tCc>tGc	p.S181C	PDZD9_ENST00000537222.2_Missense_Mutation_p.S121C|PDZD9_ENST00000286143.6_Missense_Mutation_p.S119C			Q8IXQ8	PDZD9_HUMAN	PDZ domain containing 9	181										breast(3)|endometrium(2)|lung(3)|pancreas(1)	9						TCTGGAGATGGATATTGGTCT	0.368																																																	0													148.0	143.0	145.0					16																	21995841		2198	4300	6498	SO:0001583	missense	0			BC039562	CCDS10602.1, CCDS10602.2	16p12.1	2010-04-14	2010-04-14	2010-04-14	ENSG00000155714	ENSG00000155714			28740	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 65"""	C16orf65		12477932	Standard	NM_173806		Approved	MGC50721	uc021ter.1	Q8IXQ8	OTTHUMG00000131586	ENST00000424898.2:c.542C>G	16.37:g.21995841G>C	ENSP00000400514:p.Ser181Cys		F5GWW8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S181C	ENST00000424898.2	37	c.542		16	.	.	.	.	.	.	.	.	.	.	G	16.68	3.189459	0.57909	.	.	ENSG00000155714	ENST00000424898;ENST00000537222;ENST00000286143;ENST00000521513	T	0.52295	0.67	5.43	4.44	0.53790	.	0.106984	0.42548	D	0.000696	T	0.64305	0.2586	M	0.66939	2.045	0.09310	N	0.999997	D	0.89917	1.0	D	0.79108	0.992	T	0.57694	-0.7767	10	0.66056	D	0.02	-7.3505	11.2491	0.49015	0.0:0.0:0.817:0.183	.	119	Q8IXQ8-2	.	C	181;121;119;121	ENSP00000400514:S181C	ENSP00000286143:S119C	S	-	2	0	PDZD9	21903342	0.972000	0.33761	0.125000	0.21846	0.987000	0.75469	2.896000	0.48656	1.230000	0.43646	0.563000	0.77884	TCC	PDZD9	-	NULL	ENSG00000155714		0.368	PDZD9-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PDZD9	HGNC	protein_coding	OTTHUMT00000381652.1	-	0.00	78	0	G	NM_173806		21995841	-1	tier1	-	no_errors	ENST00000424898	ensembl	human	known	74_37	missense	24.64	51	17	SNP	0.135	C
PDXDC2P	283970	genome.wustl.edu	37	16	70010715	70010715	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:70010715T>G	ENST00000531894.1	-	0	3746				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GGTCTGCACCTTCTGTTGCTG	0.468																																																	0																																												0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010715T>G			A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-	ENSG00000196696		0.468	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1	-	0.00	57	0	T			70010715	-1	tier1	-	no_errors	ENST00000531894	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.001	G
PDXDC2P	283970	genome.wustl.edu	37	16	70010715	70010715	+	RNA	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:70010715T>G	ENST00000531894.1	-	0	3746				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GGTCTGCACCTTCTGTTGCTG	0.468																																																	0																																												0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70010715T>G			A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-	ENSG00000196696		0.468	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1	-	0.00	64	0	T			70010715	-1	tier1	-	no_errors	ENST00000531894	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.001	G
PEG3	5178	genome.wustl.edu	37	19	57326782	57326782	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:57326782A>C	ENST00000326441.9	-	10	3391	c.3028T>G	c.(3028-3030)Ttg>Gtg	p.L1010V	PEG3_ENST00000593695.1_Missense_Mutation_p.L884V|PEG3_ENST00000598410.1_Missense_Mutation_p.L886V|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.L1010V|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1010					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GTAGGGGCCAAGCTGCGAATG	0.478																																																	0													75.0	71.0	72.0					19																	57326782		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3028T>G	19.37:g.57326782A>C	ENSP00000326581:p.Leu1010Val		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L1010V	ENST00000326441.9	37	c.3028	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	A	6.215	0.407869	0.11754	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.03035	4.07;4.07	4.55	-9.11	0.00711	.	0.861723	0.09400	N	0.807362	T	0.04227	0.0117	L	0.61387	1.9	.	.	.	B;P;D	0.54601	0.027;0.817;0.967	B;B;P	0.46796	0.006;0.366;0.527	T	0.00021	-1.2347	9	0.30078	T	0.28	-1.6035	3.5037	0.07683	0.3346:0.091:0.3954:0.1789	.	886;1010;945	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	V	1010	ENSP00000326581:L1010V;ENSP00000403051:L1010V	ENSP00000326581:L1010V	L	-	1	2	ZIM2	62018594	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.865000	0.04250	-3.140000	0.00233	-1.937000	0.00501	TTG	PEG3	-	NULL	ENSG00000198300		0.478	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	41	0	A			57326782	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.000	C
PEG3	5178	genome.wustl.edu	37	19	57326782	57326782	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:57326782A>C	ENST00000326441.9	-	10	3391	c.3028T>G	c.(3028-3030)Ttg>Gtg	p.L1010V	PEG3_ENST00000593695.1_Missense_Mutation_p.L884V|PEG3_ENST00000598410.1_Missense_Mutation_p.L886V|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000391708.3_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.L1010V|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1010					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GTAGGGGCCAAGCTGCGAATG	0.478																																																	0													75.0	71.0	72.0					19																	57326782		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3028T>G	19.37:g.57326782A>C	ENSP00000326581:p.Leu1010Val		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L1010V	ENST00000326441.9	37	c.3028	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	A	6.215	0.407869	0.11754	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.03035	4.07;4.07	4.55	-9.11	0.00711	.	0.861723	0.09400	N	0.807362	T	0.04227	0.0117	L	0.61387	1.9	.	.	.	B;P;D	0.54601	0.027;0.817;0.967	B;B;P	0.46796	0.006;0.366;0.527	T	0.00021	-1.2347	9	0.30078	T	0.28	-1.6035	3.5037	0.07683	0.3346:0.091:0.3954:0.1789	.	886;1010;945	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	V	1010	ENSP00000326581:L1010V;ENSP00000403051:L1010V	ENSP00000326581:L1010V	L	-	1	2	ZIM2	62018594	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	-0.865000	0.04250	-3.140000	0.00233	-1.937000	0.00501	TTG	PEG3	-	NULL	ENSG00000198300		0.478	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	42	0	A			57326782	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.000	C
PER1	5187	genome.wustl.edu	37	17	8049732	8049732	+	Missense_Mutation	SNP	C	C	T	rs377111904		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:8049732C>T	ENST00000317276.4	-	16	2233	c.1996G>A	c.(1996-1998)Gac>Aac	p.D666N	PER1_ENST00000581082.1_Missense_Mutation_p.D646N|PER1_ENST00000354903.5_Missense_Mutation_p.D650N|PER1_ENST00000578089.1_5'UTR	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	666	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTCTGCCTGTCGTCGTCAGAG	0.602			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																																Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0								C	ASN/ASP	0,4406		0,0,2203	89.0	97.0	95.0		1996	5.3	1.0	17		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	PER1	NM_002616.2	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	666/1291	8049732	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1996G>A	17.37:g.8049732C>T	ENSP00000314420:p.Asp666Asn		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.D666N	ENST00000317276.4	37	c.1996	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091142	0.76756	0.0	1.16E-4	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.46819	2.3;0.86	5.28	5.28	0.74379	.	0.047288	0.85682	D	0.000000	T	0.69593	0.3128	M	0.80183	2.485	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.73708	0.943;0.981	T	0.69105	-0.5233	10	0.37606	T	0.19	-25.1283	16.7677	0.85528	0.0:1.0:0.0:0.0	.	650;666	B4DI49;O15534	.;PER1_HUMAN	N	666;650	ENSP00000314420:D666N;ENSP00000346979:D650N	ENSP00000314420:D666N	D	-	1	0	PER1	7990457	0.970000	0.33590	0.998000	0.56505	0.580000	0.36256	4.472000	0.60189	2.641000	0.89580	0.563000	0.77884	GAC	PER1	-	NULL	ENSG00000179094		0.602	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	-	0.00	44	0	C			8049732	-1	tier1	-	no_errors	ENST00000317276	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	T
PER1	5187	genome.wustl.edu	37	17	8049732	8049732	+	Missense_Mutation	SNP	C	C	T	rs377111904		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:8049732C>T	ENST00000317276.4	-	16	2233	c.1996G>A	c.(1996-1998)Gac>Aac	p.D666N	PER1_ENST00000581082.1_Missense_Mutation_p.D646N|PER1_ENST00000354903.5_Missense_Mutation_p.D650N|PER1_ENST00000578089.1_5'UTR	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	666	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTCTGCCTGTCGTCGTCAGAG	0.602			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																																Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0								C	ASN/ASP	0,4406		0,0,2203	89.0	97.0	95.0		1996	5.3	1.0	17		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	PER1	NM_002616.2	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	666/1291	8049732	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1996G>A	17.37:g.8049732C>T	ENSP00000314420:p.Asp666Asn		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.D666N	ENST00000317276.4	37	c.1996	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091142	0.76756	0.0	1.16E-4	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.46819	2.3;0.86	5.28	5.28	0.74379	.	0.047288	0.85682	D	0.000000	T	0.69593	0.3128	M	0.80183	2.485	0.53688	D	0.999978	D;D	0.89917	1.0;1.0	D;D	0.73708	0.943;0.981	T	0.69105	-0.5233	10	0.37606	T	0.19	-25.1283	16.7677	0.85528	0.0:1.0:0.0:0.0	.	650;666	B4DI49;O15534	.;PER1_HUMAN	N	666;650	ENSP00000314420:D666N;ENSP00000346979:D650N	ENSP00000314420:D666N	D	-	1	0	PER1	7990457	0.970000	0.33590	0.998000	0.56505	0.580000	0.36256	4.472000	0.60189	2.641000	0.89580	0.563000	0.77884	GAC	PER1	-	NULL	ENSG00000179094		0.602	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	-	0.00	51	0	C			8049732	-1	tier1	-	no_errors	ENST00000317276	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	T
PHF2P2	100873793	genome.wustl.edu	37	13	19525936	19525936	+	RNA	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:19525936G>T	ENST00000416576.1	-	0	100									PHD finger protein 2 pseudogene 2																		TGTCCGTGTCGATGTGCAGCA	0.637																																																	0																																												0					13q12.11	2011-02-09	2010-08-05		ENSG00000226057	ENSG00000226057			38808	pseudogene	pseudogene							Standard	NG_032221		Approved				OTTHUMG00000016472		13.37:g.19525936G>T				RNA	SNP	-	NULL	ENST00000416576.1	37	NULL		13																																																																																			PHF2P2	-	-	ENSG00000226057		0.637	PHF2P2-002	KNOWN	basic	processed_transcript	PHF2P2	HGNC	pseudogene	OTTHUMT00000331664.1	-	0.00	64	0	G			19525936	-1	tier1	-	no_errors	ENST00000416576	ensembl	human	known	74_37	rna	20.83	38	10	SNP	1.000	T
PHF2P2	100873793	genome.wustl.edu	37	13	19525936	19525936	+	RNA	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:19525936G>T	ENST00000416576.1	-	0	100									PHD finger protein 2 pseudogene 2																		TGTCCGTGTCGATGTGCAGCA	0.637																																																	0																																												0					13q12.11	2011-02-09	2010-08-05		ENSG00000226057	ENSG00000226057			38808	pseudogene	pseudogene							Standard	NG_032221		Approved				OTTHUMG00000016472		13.37:g.19525936G>T				RNA	SNP	-	NULL	ENST00000416576.1	37	NULL		13																																																																																			PHF2P2	-	-	ENSG00000226057		0.637	PHF2P2-002	KNOWN	basic	processed_transcript	PHF2P2	HGNC	pseudogene	OTTHUMT00000331664.1	-	0.00	73	0	G			19525936	-1	tier1	-	no_errors	ENST00000416576	ensembl	human	known	74_37	rna	20.83	38	10	SNP	1.000	T
PKHD1	5314	genome.wustl.edu	37	6	51893046	51893046	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:51893046C>T	ENST00000371117.3	-	30	3743	c.3468G>A	c.(3466-3468)tcG>tcA	p.S1156S	PKHD1_ENST00000340994.4_Silent_p.S1156S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1156	IPT/TIG 6; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGCCCCAAGCCGACTGTGTGT	0.572																																																	0													120.0	128.0	125.0					6																	51893046		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3468G>A	6.37:g.51893046C>T			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.S1156	ENST00000371117.3	37	c.3468	CCDS4935.1	6																																																																																			PKHD1	-	superfamily_Ig_E-set,smart_IPT	ENSG00000170927		0.572	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	36	0	C	NM_138694		51893046	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.000	T
PKHD1	5314	genome.wustl.edu	37	6	51893046	51893046	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:51893046C>T	ENST00000371117.3	-	30	3743	c.3468G>A	c.(3466-3468)tcG>tcA	p.S1156S	PKHD1_ENST00000340994.4_Silent_p.S1156S	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1156	IPT/TIG 6; atypical.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GGCCCCAAGCCGACTGTGTGT	0.572																																																	0													120.0	128.0	125.0					6																	51893046		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3468G>A	6.37:g.51893046C>T			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.S1156	ENST00000371117.3	37	c.3468	CCDS4935.1	6																																																																																			PKHD1	-	superfamily_Ig_E-set,smart_IPT	ENSG00000170927		0.572	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	-	0.00	62	0	C	NM_138694		51893046	-1	tier1	-	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	11.43	31	4	SNP	0.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110457538	110457538	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:110457538G>A	ENST00000378402.5	+	38	5544	c.5440G>A	c.(5440-5442)Gtt>Att	p.V1814I		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1814	IPT/TIG 10.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTCTGTTAGTGTTGTGGTGGG	0.463										HNSCC(38;0.096)																																							0													109.0	107.0	108.0					8																	110457538		1969	4175	6144	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5440G>A	8.37:g.110457538G>A	ENSP00000367655:p.Val1814Ile		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.V1814I	ENST00000378402.5	37	c.5440	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248960	0.80024	.	.	ENSG00000205038	ENST00000378402	T	0.79845	-1.31	6.03	6.03	0.97812	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.87124	0.6099	M	0.76328	2.33	0.43061	D	0.99468	P	0.51933	0.949	P	0.55577	0.779	D	0.85213	0.1022	10	0.33940	T	0.23	.	18.0507	0.89347	0.0:0.0:1.0:0.0	.	1814	Q86WI1	PKHL1_HUMAN	I	1814	ENSP00000367655:V1814I	ENSP00000367655:V1814I	V	+	1	0	PKHD1L1	110526714	1.000000	0.71417	0.912000	0.35992	0.780000	0.44128	5.967000	0.70403	2.861000	0.98227	0.655000	0.94253	GTT	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.463	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	25	0	G	NM_177531		110457538	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	46.00	27	23	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110457538	110457538	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:110457538G>A	ENST00000378402.5	+	38	5544	c.5440G>A	c.(5440-5442)Gtt>Att	p.V1814I		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1814	IPT/TIG 10.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTCTGTTAGTGTTGTGGTGGG	0.463										HNSCC(38;0.096)																																							0													109.0	107.0	108.0					8																	110457538		1969	4175	6144	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5440G>A	8.37:g.110457538G>A	ENSP00000367655:p.Val1814Ile		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.V1814I	ENST00000378402.5	37	c.5440	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.248960	0.80024	.	.	ENSG00000205038	ENST00000378402	T	0.79845	-1.31	6.03	6.03	0.97812	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	D	0.87124	0.6099	M	0.76328	2.33	0.43061	D	0.99468	P	0.51933	0.949	P	0.55577	0.779	D	0.85213	0.1022	10	0.33940	T	0.23	.	18.0507	0.89347	0.0:0.0:1.0:0.0	.	1814	Q86WI1	PKHL1_HUMAN	I	1814	ENSP00000367655:V1814I	ENSP00000367655:V1814I	V	+	1	0	PKHD1L1	110526714	1.000000	0.71417	0.912000	0.35992	0.780000	0.44128	5.967000	0.70403	2.861000	0.98227	0.655000	0.94253	GTT	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000205038		0.463	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	-	0.00	28	0	G	NM_177531		110457538	+1	tier1	-	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	46.00	27	23	SNP	1.000	A
PLXNA2	5362	genome.wustl.edu	37	1	208390629	208390629	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:208390629G>A	ENST00000367033.3	-	2	1396	c.639C>T	c.(637-639)ctC>ctT	p.L213L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	213	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCTCATAGTCGAGCATGGCTG	0.562																																																	0													150.0	159.0	156.0					1																	208390629		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.639C>T	1.37:g.208390629G>A			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L213	ENST00000367033.3	37	c.639	CCDS31013.1	1																																																																																			PLXNA2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000076356		0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	58	0	G	NM_025179		208390629	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	50.00	23	23	SNP	0.003	A
PLXNA2	5362	genome.wustl.edu	37	1	208390629	208390629	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:208390629G>A	ENST00000367033.3	-	2	1396	c.639C>T	c.(637-639)ctC>ctT	p.L213L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	213	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCTCATAGTCGAGCATGGCTG	0.562																																																	0													150.0	159.0	156.0					1																	208390629		2203	4300	6503	SO:0001819	synonymous_variant	0			X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.639C>T	1.37:g.208390629G>A			A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L213	ENST00000367033.3	37	c.639	CCDS31013.1	1																																																																																			PLXNA2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000076356		0.562	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	HGNC	protein_coding	OTTHUMT00000088932.6	-	0.00	60	0	G	NM_025179		208390629	-1	tier1	-	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	50.00	23	23	SNP	0.003	A
POM121L2	94026	genome.wustl.edu	37	6	27278366	27278366	+	Silent	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:27278366A>C	ENST00000444565.1	-	1	1583	c.1584T>G	c.(1582-1584)acT>acG	p.T528T	POM121L2_ENST00000377451.2_Silent_p.T464T	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	528										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GGTGAGCAGAAGTTGCATCAG	0.507																																																	0													31.0	31.0	31.0					6																	27278366		692	1591	2283	SO:0001819	synonymous_variant	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1584T>G	6.37:g.27278366A>C			C9J1I7	Silent	SNP	NULL	p.T528	ENST00000444565.1	37	c.1584	CCDS59497.1	6																																																																																			POM121L2	-	NULL	ENSG00000158553		0.507	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	-	0.00	41	0	A	NM_033482		27278366	-1	tier1	-	no_errors	ENST00000444565	ensembl	human	known	74_37	silent	26.92	38	14	SNP	0.350	C
POM121L2	94026	genome.wustl.edu	37	6	27278366	27278366	+	Silent	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:27278366A>C	ENST00000444565.1	-	1	1583	c.1584T>G	c.(1582-1584)acT>acG	p.T528T	POM121L2_ENST00000377451.2_Silent_p.T464T	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	528										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GGTGAGCAGAAGTTGCATCAG	0.507																																																	0													31.0	31.0	31.0					6																	27278366		692	1591	2283	SO:0001819	synonymous_variant	0			AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.1584T>G	6.37:g.27278366A>C			C9J1I7	Silent	SNP	NULL	p.T528	ENST00000444565.1	37	c.1584	CCDS59497.1	6																																																																																			POM121L2	-	NULL	ENSG00000158553		0.507	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	HGNC	protein_coding	OTTHUMT00000040143.2	-	0.00	44	0	A	NM_033482		27278366	-1	tier1	-	no_errors	ENST00000444565	ensembl	human	known	74_37	silent	26.92	38	14	SNP	0.350	C
PPP1R3A	5506	genome.wustl.edu	37	7	113519553	113519553	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:113519553T>G	ENST00000284601.3	-	4	1662	c.1594A>C	c.(1594-1596)Aaa>Caa	p.K532Q		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	532					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGGAAATTTTTTCTTTGTTTT	0.353																																																	0													82.0	76.0	78.0					7																	113519553		2203	4300	6503	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1594A>C	7.37:g.113519553T>G	ENSP00000284601:p.Lys532Gln		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.K532Q	ENST00000284601.3	37	c.1594	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	13.01	2.109380	0.37242	.	.	ENSG00000154415	ENST00000284601	T	0.18657	2.2	5.84	1.75	0.24633	.	0.907276	0.09517	N	0.791462	T	0.21509	0.0518	M	0.64997	1.995	0.09310	N	1	P	0.46277	0.875	B	0.39706	0.307	T	0.17379	-1.0371	10	0.66056	D	0.02	-0.4168	6.8357	0.23935	0.0:0.1504:0.1299:0.7197	.	532	Q16821	PPR3A_HUMAN	Q	532	ENSP00000284601:K532Q	ENSP00000284601:K532Q	K	-	1	0	PPP1R3A	113306789	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.170000	0.16663	0.464000	0.27142	-0.316000	0.08728	AAA	PPP1R3A	-	NULL	ENSG00000154415		0.353	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	-	0.00	50	0	T	NM_002711		113519553	-1	tier1	-	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	15.52	49	9	SNP	0.000	G
PPP1R3A	5506	genome.wustl.edu	37	7	113519553	113519553	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr7:113519553T>G	ENST00000284601.3	-	4	1662	c.1594A>C	c.(1594-1596)Aaa>Caa	p.K532Q		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	532					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGGAAATTTTTTCTTTGTTTT	0.353																																																	0													82.0	76.0	78.0					7																	113519553		2203	4300	6503	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1594A>C	7.37:g.113519553T>G	ENSP00000284601:p.Lys532Gln		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.K532Q	ENST00000284601.3	37	c.1594	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	13.01	2.109380	0.37242	.	.	ENSG00000154415	ENST00000284601	T	0.18657	2.2	5.84	1.75	0.24633	.	0.907276	0.09517	N	0.791462	T	0.21509	0.0518	M	0.64997	1.995	0.09310	N	1	P	0.46277	0.875	B	0.39706	0.307	T	0.17379	-1.0371	10	0.66056	D	0.02	-0.4168	6.8357	0.23935	0.0:0.1504:0.1299:0.7197	.	532	Q16821	PPR3A_HUMAN	Q	532	ENSP00000284601:K532Q	ENSP00000284601:K532Q	K	-	1	0	PPP1R3A	113306789	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.170000	0.16663	0.464000	0.27142	-0.316000	0.08728	AAA	PPP1R3A	-	NULL	ENSG00000154415		0.353	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	-	0.00	53	0	T	NM_002711		113519553	-1	tier1	-	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	15.52	49	9	SNP	0.000	G
PRAMEF6	440561	genome.wustl.edu	37	1	13111661	13111661	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:13111661T>C	ENST00000376182.1	-	3	453	c.354A>G	c.(352-354)gaA>gaG	p.E118E	PRAMEF6_ENST00000414205.2_Silent_p.E118E|PRAMEF6_ENST00000376192.5_Silent_p.E118E	NM_001282323.1	NP_001269252.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	118					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GGGCCATAGCTTCAGACCAAA	0.478																																																	0																																										SO:0001819	synonymous_variant	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376182.1:c.354A>G	1.37:g.13111661T>C			A0AUJ9	Silent	SNP	NULL	p.E118	ENST00000376182.1	37	c.354		1																																																																																			PRAMEF6	-	NULL	ENSG00000232423		0.478	PRAMEF6-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRAMEF6	HGNC	protein_coding		-	0.00	13	0	T	NM_001010889		13111661	-1	tier1	-	no_errors	ENST00000376182	ensembl	human	known	74_37	silent	63.64	4	7	SNP	0.278	C
PREX2	80243	genome.wustl.edu	37	8	68934314	68934314	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:68934314A>G	ENST00000288368.4	+	4	657	c.380A>G	c.(379-381)gAg>gGg	p.E127G	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	127	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGTAACCATGAGAAGGCACAA	0.294																																																	0													120.0	116.0	117.0					8																	68934314		2202	4300	6502	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.380A>G	8.37:g.68934314A>G	ENSP00000288368:p.Glu127Gly		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E127G	ENST00000288368.4	37	c.380	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830427	0.91036	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.64085	-0.08	6.04	6.04	0.98038	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.998	T	0.82315	-0.0518	10	0.72032	D	0.01	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	127;127;127	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	G	127	ENSP00000288368:E127G	ENSP00000288368:E127G	E	+	2	0	PREX2	69096868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.939000	0.92951	2.317000	0.78254	0.460000	0.39030	GAG	PREX2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000046889		0.294	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	59	0	A	NM_025170		68934314	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	39.24	48	31	SNP	1.000	G
PREX2	80243	genome.wustl.edu	37	8	68934314	68934314	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:68934314A>G	ENST00000288368.4	+	4	657	c.380A>G	c.(379-381)gAg>gGg	p.E127G	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	127	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGTAACCATGAGAAGGCACAA	0.294																																																	0													120.0	116.0	117.0					8																	68934314		2202	4300	6502	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.380A>G	8.37:g.68934314A>G	ENSP00000288368:p.Glu127Gly		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E127G	ENST00000288368.4	37	c.380	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	A	27.4	4.830427	0.91036	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.64085	-0.08	6.04	6.04	0.98038	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.80210	0.4581	M	0.77486	2.375	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.999;0.998	T	0.82315	-0.0518	10	0.72032	D	0.01	.	16.5885	0.84745	1.0:0.0:0.0:0.0	.	127;127;127	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	G	127	ENSP00000288368:E127G	ENSP00000288368:E127G	E	+	2	0	PREX2	69096868	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.939000	0.92951	2.317000	0.78254	0.460000	0.39030	GAG	PREX2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000046889		0.294	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	61	0	A	NM_025170		68934314	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	39.24	48	31	SNP	1.000	G
PRICKLE2	166336	genome.wustl.edu	37	3	64082806	64082806	+	3'UTR	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:64082806A>C	ENST00000295902.6	-	0	5041				PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GCATGCGGAAAACAGCCACAA	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.*1921T>G	3.37:g.64082806A>C			Q0VF44	RNA	SNP	-	NULL	ENST00000295902.6	37	NULL	CCDS2902.1	3																																																																																			RP11-129B22.1	-	-	ENSG00000241111		0.333	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000352219.1	-	0.00	27	0	A	NM_198859		64082806	+1	tier1	-	no_errors	ENST00000482609	ensembl	human	known	74_37	rna	31.82	15	7	SNP	1.000	C
PRICKLE2	166336	genome.wustl.edu	37	3	64082806	64082806	+	3'UTR	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:64082806A>C	ENST00000295902.6	-	0	5041				PRICKLE2-AS1_ENST00000476308.1_RNA|PRICKLE2-AS1_ENST00000460946.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)						establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		GCATGCGGAAAACAGCCACAA	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.*1921T>G	3.37:g.64082806A>C			Q0VF44	RNA	SNP	-	NULL	ENST00000295902.6	37	NULL	CCDS2902.1	3																																																																																			RP11-129B22.1	-	-	ENSG00000241111		0.333	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000352219.1	-	0.00	42	0	A	NM_198859		64082806	+1	tier1	-	no_errors	ENST00000482609	ensembl	human	known	74_37	rna	31.82	15	7	SNP	1.000	C
PRKD1	5587	genome.wustl.edu	37	14	30046521	30046521	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:30046521T>G	ENST00000331968.5	-	18	2891	c.2662A>C	c.(2662-2664)Agt>Cgt	p.S888R	PRKD1_ENST00000415220.2_Missense_Mutation_p.S896R	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	888					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TGGCTAGCACTTGGATTGATC	0.522																																																	0													145.0	120.0	128.0					14																	30046521		2203	4300	6503	SO:0001583	missense	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2662A>C	14.37:g.30046521T>G	ENSP00000333568:p.Ser888Arg		A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.S888R	ENST00000331968.5	37	c.2662	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490279	0.26686	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.65364	-0.15;-0.15	6.03	3.66	0.41972	Protein kinase-like domain (1);	0.308843	0.36268	N	0.002696	T	0.41766	0.1173	N	0.22421	0.69	0.09310	N	1	B	0.27380	0.177	B	0.20955	0.032	T	0.18555	-1.0333	10	0.23302	T	0.38	-6.779	7.8295	0.29334	0.0:0.0657:0.2617:0.6726	.	888	Q15139	KPCD1_HUMAN	R	888;896	ENSP00000333568:S888R;ENSP00000390535:S896R	ENSP00000333568:S888R	S	-	1	0	PRKD1	29116272	0.000000	0.05858	0.324000	0.25361	0.947000	0.59692	0.555000	0.23422	0.518000	0.28383	0.533000	0.62120	AGT	PRKD1	-	superfamily_Kinase-like_dom	ENSG00000184304		0.522	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	-	0.00	58	0	T	NM_002742		30046521	-1	tier1	-	no_errors	ENST00000331968	ensembl	human	known	74_37	missense	43.55	35	27	SNP	0.000	G
PRKD1	5587	genome.wustl.edu	37	14	30046521	30046521	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr14:30046521T>G	ENST00000331968.5	-	18	2891	c.2662A>C	c.(2662-2664)Agt>Cgt	p.S888R	PRKD1_ENST00000415220.2_Missense_Mutation_p.S896R	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	888					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TGGCTAGCACTTGGATTGATC	0.522																																																	0													145.0	120.0	128.0					14																	30046521		2203	4300	6503	SO:0001583	missense	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2662A>C	14.37:g.30046521T>G	ENSP00000333568:p.Ser888Arg		A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.S888R	ENST00000331968.5	37	c.2662	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	T	10.93	1.490279	0.26686	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.65364	-0.15;-0.15	6.03	3.66	0.41972	Protein kinase-like domain (1);	0.308843	0.36268	N	0.002696	T	0.41766	0.1173	N	0.22421	0.69	0.09310	N	1	B	0.27380	0.177	B	0.20955	0.032	T	0.18555	-1.0333	10	0.23302	T	0.38	-6.779	7.8295	0.29334	0.0:0.0657:0.2617:0.6726	.	888	Q15139	KPCD1_HUMAN	R	888;896	ENSP00000333568:S888R;ENSP00000390535:S896R	ENSP00000333568:S888R	S	-	1	0	PRKD1	29116272	0.000000	0.05858	0.324000	0.25361	0.947000	0.59692	0.555000	0.23422	0.518000	0.28383	0.533000	0.62120	AGT	PRKD1	-	superfamily_Kinase-like_dom	ENSG00000184304		0.522	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	-	0.00	59	0	T	NM_002742		30046521	-1	tier1	-	no_errors	ENST00000331968	ensembl	human	known	74_37	missense	43.55	35	27	SNP	0.000	G
SVIL	6840	genome.wustl.edu	37	10	29776292	29776292	+	Intron	SNP	C	C	T	rs372964266		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:29776292C>T	ENST00000355867.4	-	24	5101				SVIL_ENST00000375400.3_Intron|PTCHD3P1_ENST00000413405.1_RNA|SVIL_ENST00000375398.2_Intron|SVIL_ENST00000538146.1_Intron|SVIL_ENST00000535393.1_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin						cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CACCCCATATCGGAAGCATCC	0.557																																																	0																																										SO:0001627	intron_variant	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4349-64G>A	10.37:g.29776292C>T			D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	RNA	SNP	-	NULL	ENST00000355867.4	37	NULL	CCDS7164.1	10																																																																																			PTCHD3P1	-	-	ENSG00000224597		0.557	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD3P1	HGNC	protein_coding	OTTHUMT00000047395.1	-	0.00	102	0	C			29776292	+1	tier1	-	no_errors	ENST00000413405	ensembl	human	known	74_37	rna	38.00	62	38	SNP	0.000	T
SVIL	6840	genome.wustl.edu	37	10	29776292	29776292	+	Intron	SNP	C	C	T	rs372964266		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:29776292C>T	ENST00000355867.4	-	24	5101				SVIL_ENST00000375400.3_Intron|PTCHD3P1_ENST00000413405.1_RNA|SVIL_ENST00000375398.2_Intron|SVIL_ENST00000538146.1_Intron|SVIL_ENST00000535393.1_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin						cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CACCCCATATCGGAAGCATCC	0.557																																																	0																																										SO:0001627	intron_variant	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4349-64G>A	10.37:g.29776292C>T			D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	RNA	SNP	-	NULL	ENST00000355867.4	37	NULL	CCDS7164.1	10																																																																																			PTCHD3P1	-	-	ENSG00000224597		0.557	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD3P1	HGNC	protein_coding	OTTHUMT00000047395.1	-	0.00	107	0	C			29776292	+1	tier1	-	no_errors	ENST00000413405	ensembl	human	known	74_37	rna	38.00	62	38	SNP	0.000	T
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000539239.1_Intron|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|RP11-993B23.3_ENST00000538113.1_RNA			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																																	0													16.0	16.0	16.0					12																	28114898		875	1991	2866	SO:0001627	intron_variant	0				CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT			Q15251|Q6FH74	Frame_Shift_Del	DEL	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			PTHLH	-	NULL	ENSG00000087494		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1		0.00	25	0	T	NM_198965		28114898	-1	tier1		no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_del	17.39	19	4	DEL	0.135	-
PTPRQ	374462	genome.wustl.edu	37	12	80839459	80839459	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:80839459C>A	ENST00000266688.5	+	3	352	c.352C>A	c.(352-354)Ctt>Att	p.L118I				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	160	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GGAAGTTCTTCTTACTAATCT	0.318																																																	0													88.0	75.0	79.0					12																	80839459		692	1590	2282	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.352C>A	12.37:g.80839459C>A	ENSP00000266688:p.Leu118Ile			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.L118I	ENST00000266688.5	37	c.352		12	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243004	0.79912	.	.	ENSG00000139304	ENST00000551042;ENST00000266688	T;T	0.59638	0.25;0.25	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62816	0.2459	L	0.45228	1.405	0.43550	D	0.995857	D	0.61080	0.989	D	0.70716	0.97	T	0.57370	-0.7823	9	0.02654	T	1	.	13.3123	0.60386	0.0:0.9279:0.0:0.0721	.	160	Q9UMZ3	PTPRQ_HUMAN	I	320;118	ENSP00000447522:L320I;ENSP00000266688:L118I	ENSP00000266688:L118I	L	+	1	0	PTPRQ	79363590	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.954000	0.56708	2.755000	0.94549	0.591000	0.81541	CTT	PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.318	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	20	0	C	NM_001145026		80839459	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	A
PTPRQ	374462	genome.wustl.edu	37	12	80839459	80839459	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:80839459C>A	ENST00000266688.5	+	3	352	c.352C>A	c.(352-354)Ctt>Att	p.L118I				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	160	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GGAAGTTCTTCTTACTAATCT	0.318																																																	0													88.0	75.0	79.0					12																	80839459		692	1590	2282	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.352C>A	12.37:g.80839459C>A	ENSP00000266688:p.Leu118Ile			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.L118I	ENST00000266688.5	37	c.352		12	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243004	0.79912	.	.	ENSG00000139304	ENST00000551042;ENST00000266688	T;T	0.59638	0.25;0.25	5.82	5.82	0.92795	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62816	0.2459	L	0.45228	1.405	0.43550	D	0.995857	D	0.61080	0.989	D	0.70716	0.97	T	0.57370	-0.7823	9	0.02654	T	1	.	13.3123	0.60386	0.0:0.9279:0.0:0.0721	.	160	Q9UMZ3	PTPRQ_HUMAN	I	320;118	ENSP00000447522:L320I;ENSP00000266688:L118I	ENSP00000266688:L118I	L	+	1	0	PTPRQ	79363590	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.954000	0.56708	2.755000	0.94549	0.591000	0.81541	CTT	PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.318	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	21	0	C	NM_001145026		80839459	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	A
PYHIN1	149628	genome.wustl.edu	37	1	158914673	158914673	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:158914673A>C	ENST00000368140.1	+	7	1445	c.1200A>C	c.(1198-1200)aaA>aaC	p.K400N	PYHIN1_ENST00000368138.3_Missense_Mutation_p.K391N|PYHIN1_ENST00000485134.1_3'UTR|PYHIN1_ENST00000392252.3_Missense_Mutation_p.K391N|PYHIN1_ENST00000392254.2_Missense_Mutation_p.K400N	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	400					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AGATACAGAAAAATACAAACC	0.358																																																	0													52.0	52.0	52.0					1																	158914673		2203	4300	6503	SO:0001583	missense	0			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1200A>C	1.37:g.158914673A>C	ENSP00000357122:p.Lys400Asn		Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.K400N	ENST00000368140.1	37	c.1200	CCDS1178.1	1	.	.	.	.	.	.	.	.	.	.	A	5.527	0.282141	0.10458	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.09255	3.0;3.01;3.16;3.17	2.32	-1.61	0.08399	Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.01627	0.0052	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.26002	0.139;0.139;0.139;0.05	B;B;B;B	0.25987	0.044;0.065;0.044;0.02	T	0.46707	-0.9172	9	0.38643	T	0.18	.	2.9124	0.05742	0.4382:0.2483:0.3135:0.0	.	391;400;391;400	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	N	400;391;400;391	ENSP00000357122:K400N;ENSP00000357120:K391N;ENSP00000376083:K400N;ENSP00000376082:K391N	ENSP00000357120:K391N	K	+	3	2	PYHIN1	157181297	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.038000	0.12144	-0.408000	0.07565	-1.501000	0.00957	AAA	PYHIN1	-	NULL	ENSG00000163564		0.358	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	HGNC	protein_coding	OTTHUMT00000090110.1		0.00	44	0	A	NM_152501		158914673	+1			no_errors	ENST00000368140	ensembl	human	known	74_37	missense	24.32	28	9	SNP	0.000	C
RBFOX3	146713	genome.wustl.edu	37	17	77092867	77092867	+	Intron	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:77092867C>T	ENST00000453134.2	-	12	1268				RBFOX3_ENST00000580155.1_Intron|RBFOX3_ENST00000415831.1_Intron|RBFOX3_ENST00000583458.1_Silent_p.L267L|RBFOX3_ENST00000582043.1_Silent_p.L237L|RBFOX3_ENST00000584778.1_Intron			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3						mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						GGCACGGTGCCAGCCCCGCCC	0.572																																																	0																																										SO:0001627	intron_variant	0				CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.756-93G>A	17.37:g.77092867C>T			B4DEG6|B4DF29	Silent	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,pfscan_RRM_dom	p.L237	ENST00000453134.2	37	c.711	CCDS45805.1	17																																																																																			RBFOX3	-	NULL	ENSG00000167281		0.572	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RBFOX3	HGNC	protein_coding	OTTHUMT00000437658.1	-	0.00	54	0	C	NM_001082575		77092867	-1	tier1	-	no_errors	ENST00000582043	ensembl	human	putative	74_37	silent	15.22	39	7	SNP	1.000	T
RBFOX3	146713	genome.wustl.edu	37	17	77092867	77092867	+	Intron	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:77092867C>T	ENST00000453134.2	-	12	1268				RBFOX3_ENST00000580155.1_Intron|RBFOX3_ENST00000415831.1_Intron|RBFOX3_ENST00000583458.1_Silent_p.L267L|RBFOX3_ENST00000582043.1_Silent_p.L237L|RBFOX3_ENST00000584778.1_Intron			A6NFN3	RFOX3_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 3						mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perikaryon (GO:0043204)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)	2						GGCACGGTGCCAGCCCCGCCC	0.572																																																	0																																										SO:0001627	intron_variant	0				CCDS45805.1	17q25.3	2013-02-12			ENSG00000167281	ENSG00000167281		"""RNA binding motif (RRM) containing"""	27097	protein-coding gene	gene with protein product	"""neuronal nuclei"", ""hexaribonucleotide binding protein 3"""					16260614	Standard	NM_001082575		Approved	FOX-3, NeuN, HRNBP3	uc010dhs.4	A6NFN3	OTTHUMG00000150183	ENST00000453134.2:c.756-93G>A	17.37:g.77092867C>T			B4DEG6|B4DF29	Silent	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,pfscan_RRM_dom	p.L237	ENST00000453134.2	37	c.711	CCDS45805.1	17																																																																																			RBFOX3	-	NULL	ENSG00000167281		0.572	RBFOX3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RBFOX3	HGNC	protein_coding	OTTHUMT00000437658.1	-	0.00	65	0	C	NM_001082575		77092867	-1	tier1	-	no_errors	ENST00000582043	ensembl	human	putative	74_37	silent	15.22	39	7	SNP	1.000	T
RECQL	5965	genome.wustl.edu	37	12	21627775	21627775	+	Splice_Site	SNP	T	T	C	rs577044266		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:21627775T>C	ENST00000444129.2	-	11	1823	c.1355A>G	c.(1354-1356)aAa>aGa	p.K452R	RECQL_ENST00000421138.2_Splice_Site_p.K452R	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	452					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TGTGGCTTACTTGCTTATGTT	0.328								Other identified genes with known or suspected DNA repair function					T|||	1	0.000199681	0.0	0.0	5008	,	,		19406	0.0		0.0	False		,,,				2504	0.001																0													159.0	152.0	155.0					12																	21627775		2203	4299	6502	SO:0001630	splice_region_variant	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1355+1A>G	12.37:g.21627775T>C			A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.K452R	ENST00000444129.2	37	c.1355	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	T	8.709	0.911665	0.17833	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.32272	1.46;1.46	5.76	2.08	0.27032	.	0.140024	0.64402	N	0.000008	T	0.09642	0.0237	N	0.02539	-0.55	0.44402	D	0.997318	B	0.06786	0.001	B	0.04013	0.001	T	0.15235	-1.0444	9	.	.	.	-3.2468	5.0401	0.14454	0.0:0.2218:0.1445:0.6338	.	452	P46063	RECQ1_HUMAN	R	452	ENSP00000416739:K452R;ENSP00000395449:K452R	.	K	-	2	0	RECQL	21519042	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.475000	0.45162	0.117000	0.18138	0.383000	0.25322	AAA	RECQL	-	tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.328	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	42	0	T	NM_002907	Missense_Mutation	21627775	-1	tier1	-	no_errors	ENST00000421138	ensembl	human	known	74_37	missense	83.78	6	31	SNP	1.000	C
RECQL	5965	genome.wustl.edu	37	12	21627775	21627775	+	Splice_Site	SNP	T	T	C	rs577044266		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr12:21627775T>C	ENST00000444129.2	-	11	1823	c.1355A>G	c.(1354-1356)aAa>aGa	p.K452R	RECQL_ENST00000421138.2_Splice_Site_p.K452R	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	452					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						TGTGGCTTACTTGCTTATGTT	0.328								Other identified genes with known or suspected DNA repair function					T|||	1	0.000199681	0.0	0.0	5008	,	,		19406	0.0		0.0	False		,,,				2504	0.001																0													159.0	152.0	155.0					12																	21627775		2203	4299	6502	SO:0001630	splice_region_variant	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1355+1A>G	12.37:g.21627775T>C			A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.K452R	ENST00000444129.2	37	c.1355	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	T	8.709	0.911665	0.17833	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.32272	1.46;1.46	5.76	2.08	0.27032	.	0.140024	0.64402	N	0.000008	T	0.09642	0.0237	N	0.02539	-0.55	0.44402	D	0.997318	B	0.06786	0.001	B	0.04013	0.001	T	0.15235	-1.0444	9	.	.	.	-3.2468	5.0401	0.14454	0.0:0.2218:0.1445:0.6338	.	452	P46063	RECQ1_HUMAN	R	452	ENSP00000416739:K452R;ENSP00000395449:K452R	.	K	-	2	0	RECQL	21519042	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.475000	0.45162	0.117000	0.18138	0.383000	0.25322	AAA	RECQL	-	tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.328	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	45	0	T	NM_002907	Missense_Mutation	21627775	-1	tier1	-	no_errors	ENST00000421138	ensembl	human	known	74_37	missense	83.78	6	31	SNP	1.000	C
RET	5979	genome.wustl.edu	37	10	43619215	43619215	+	Silent	SNP	C	C	T	rs373693875		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:43619215C>T	ENST00000355710.3	+	17	3130	c.2898C>T	c.(2896-2898)acC>acT	p.T966T	RET_ENST00000340058.5_Silent_p.T966T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	966	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T966T(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTCTGAAGACCGGCCACCGGA	0.602		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	1	Substitution - coding silent(1)	ovary(1)						C	,	1,4405	2.1+/-5.4	0,1,2202	77.0	80.0	79.0		2898,2898	-10.3	0.3	10		79	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RET	NM_020630.4,NM_020975.4	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	966/1073,966/1115	43619215	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2898C>T	10.37:g.43619215C>T			A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.T966	ENST00000355710.3	37	c.2898	CCDS7200.1	10																																																																																			RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000165731		0.602	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	-	0.00	79	0	C	NM_020975		43619215	+1	tier1	-	no_errors	ENST00000355710	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.440	T
RET	5979	genome.wustl.edu	37	10	43619215	43619215	+	Silent	SNP	C	C	T	rs373693875		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:43619215C>T	ENST00000355710.3	+	17	3130	c.2898C>T	c.(2896-2898)acC>acT	p.T966T	RET_ENST00000340058.5_Silent_p.T966T	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	966	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.T966T(1)	CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TTCTGAAGACCGGCCACCGGA	0.602		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	1	Substitution - coding silent(1)	ovary(1)						C	,	1,4405	2.1+/-5.4	0,1,2202	77.0	80.0	79.0		2898,2898	-10.3	0.3	10		79	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RET	NM_020630.4,NM_020975.4	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	966/1073,966/1115	43619215	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2898C>T	10.37:g.43619215C>T			A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.T966	ENST00000355710.3	37	c.2898	CCDS7200.1	10																																																																																			RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000165731		0.602	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	-	0.00	81	0	C	NM_020975		43619215	+1	tier1	-	no_errors	ENST00000355710	ensembl	human	known	74_37	silent	28.07	41	16	SNP	0.440	T
RGPD4	285190	genome.wustl.edu	37	2	108487634	108487634	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:108487634A>C	ENST00000408999.3	+	20	3251	c.3174A>C	c.(3172-3174)aaA>aaC	p.K1058N	RGPD4_ENST00000354986.4_Missense_Mutation_p.K1058N	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1058	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAGGTGAAAAAGTTCTGTATT	0.393																																																	0													12.0	9.0	10.0					2																	108487634		683	1568	2251	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3174A>C	2.37:g.108487634A>C	ENSP00000386810:p.Lys1058Asn		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.K1058N	ENST00000408999.3	37	c.3174	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	8.636	0.894792	0.17613	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.44881	0.91;0.91	2.33	-0.121	0.13535	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.42988	0.1227	L	0.45470	1.425	0.26714	N	0.970911	P	0.41710	0.76	P	0.50405	0.64	T	0.36553	-0.9743	9	0.54805	T	0.06	-35.9806	6.2727	0.20963	0.7262:0.0:0.2738:0.0	.	1058	Q7Z3J3	RGPD4_HUMAN	N	1058;1058;816	ENSP00000347081:K1058N;ENSP00000386810:K1058N	ENSP00000347081:K1058N	K	+	3	2	RGPD4	107854066	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	1.168000	0.31859	0.156000	0.19299	0.136000	0.15936	AAA	RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000196862		0.393	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	208	0	A	XM_496581		108487634	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	44.32	103	82	SNP	1.000	C
RGPD4	285190	genome.wustl.edu	37	2	108487634	108487634	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:108487634A>C	ENST00000408999.3	+	20	3251	c.3174A>C	c.(3172-3174)aaA>aaC	p.K1058N	RGPD4_ENST00000354986.4_Missense_Mutation_p.K1058N	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1058	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						AAGGTGAAAAAGTTCTGTATT	0.393																																																	0													12.0	9.0	10.0					2																	108487634		683	1568	2251	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3174A>C	2.37:g.108487634A>C	ENSP00000386810:p.Lys1058Asn		B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.K1058N	ENST00000408999.3	37	c.3174	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	8.636	0.894792	0.17613	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.44881	0.91;0.91	2.33	-0.121	0.13535	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.42988	0.1227	L	0.45470	1.425	0.26714	N	0.970911	P	0.41710	0.76	P	0.50405	0.64	T	0.36553	-0.9743	9	0.54805	T	0.06	-35.9806	6.2727	0.20963	0.7262:0.0:0.2738:0.0	.	1058	Q7Z3J3	RGPD4_HUMAN	N	1058;1058;816	ENSP00000347081:K1058N;ENSP00000386810:K1058N	ENSP00000347081:K1058N	K	+	3	2	RGPD4	107854066	1.000000	0.71417	1.000000	0.80357	0.056000	0.15407	1.168000	0.31859	0.156000	0.19299	0.136000	0.15936	AAA	RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000196862		0.393	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	-	0.00	241	0	A	XM_496581		108487634	+1	tier1	-	no_errors	ENST00000354986	ensembl	human	known	74_37	missense	44.32	103	82	SNP	1.000	C
RGS12	6002	genome.wustl.edu	37	4	3417774	3417774	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:3417774G>A	ENST00000344733.5	+	7	3257	c.2353G>A	c.(2353-2355)Gac>Aac	p.D785N	RGS12_ENST00000508158.1_3'UTR|RGS12_ENST00000336727.3_Missense_Mutation_p.D785N|RGS12_ENST00000306648.7_Missense_Mutation_p.D183N|RGS12_ENST00000543385.1_3'UTR|RGS12_ENST00000382788.3_Missense_Mutation_p.D785N|RGS12_ENST00000338806.4_Missense_Mutation_p.D137N|RGS12_ENST00000538395.1_Missense_Mutation_p.D127N	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	785	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGTCAACATCGACAGCCAGGC	0.602																																																	0													72.0	62.0	66.0					4																	3417774		2203	4300	6503	SO:0001583	missense	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.2353G>A	4.37:g.3417774G>A	ENSP00000339381:p.Asp785Asn		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.D785N	ENST00000344733.5	37	c.2353	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.587162	0.96578	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	T;T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2;4.2	4.73	4.73	0.59995	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.105902	0.64402	D	0.000007	T	0.19446	0.0467	M	0.88775	2.98	0.80722	D	1	P;D;P;P;P;P;P	0.65815	0.937;0.995;0.897;0.807;0.937;0.751;0.707	P;D;P;P;P;P;P	0.74348	0.776;0.983;0.668;0.805;0.776;0.739;0.621	T	0.01956	-1.1240	10	0.87932	D	0	-31.4438	17.1317	0.86728	0.0:0.0:1.0:0.0	.	127;127;127;137;183;785;785	B7Z764;B7Z8B8;O14924-2;O14924-3;Q8WX95;O14924;O14924-4	.;.;.;.;.;RGS12_HUMAN;.	N	785;785;785;183;137;127	ENSP00000339381:D785N;ENSP00000338509:D785N;ENSP00000372238:D785N;ENSP00000304459:D183N;ENSP00000342133:D137N;ENSP00000438888:D127N	ENSP00000304459:D183N	D	+	1	0	RGS12	3387572	1.000000	0.71417	0.988000	0.46212	0.963000	0.63663	9.493000	0.97960	2.356000	0.79943	0.650000	0.86243	GAC	RGS12	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	ENSG00000159788		0.602	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	-	0.00	71	0	G	NM_002926		3417774	+1	tier1	-	no_errors	ENST00000344733	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	A
RNF103	7844	genome.wustl.edu	37	2	86831886	86831886	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:86831886G>T	ENST00000237455.4	-	4	2106	c.1138C>A	c.(1138-1140)Cta>Ata	p.L380I	RNF103-CHMP3_ENST00000604011.1_Intron|CHMP3_ENST00000439940.2_Intron|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000597638.1_RNA|AC015971.2_ENST00000424788.1_RNA|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000439077.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	380					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						AAGTAAGGTAGCTGTAAAAAG	0.368																																																	0													59.0	64.0	63.0					2																	86831886		2201	4298	6499	SO:0001583	missense	0			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.1138C>A	2.37:g.86831886G>T	ENSP00000237455:p.Leu380Ile		A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Thioredoxin-like_fold,smart_Znf_RING,pfscan_Znf_RING	p.L380I	ENST00000237455.4	37	c.1138	CCDS33237.1	2	.	.	.	.	.	.	.	.	.	.	G	15.14	2.746414	0.49257	.	.	ENSG00000239305	ENST00000237455	T	0.52295	0.67	5.59	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	M	0.64997	1.995	0.54753	D	0.99998	D	0.69078	0.997	D	0.72625	0.978	T	0.65096	-0.6251	10	0.87932	D	0	-9.874	11.232	0.48918	0.1402:0.0:0.8598:0.0	.	380	O00237	RN103_HUMAN	I	380	ENSP00000237455:L380I	ENSP00000237455:L380I	L	-	1	2	RNF103	86685397	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.532000	0.45659	2.641000	0.89580	0.460000	0.39030	CTA	RNF103	-	NULL	ENSG00000239305		0.368	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF103	HGNC	protein_coding	OTTHUMT00000330041.2		0.00	50	0	G	NM_005667		86831886	-1			no_errors	ENST00000237455	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
RP1	6101	genome.wustl.edu	37	8	55534038	55534038	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:55534038T>C	ENST00000220676.1	+	2	660	c.512T>C	c.(511-513)cTt>cCt	p.L171P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	171	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CGTGCGGTTCTTCTGAGCAGG	0.652																																					Colon(91;1014 1389 7634 14542 40420)												0													101.0	102.0	102.0					8																	55534038		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.512T>C	8.37:g.55534038T>C	ENSP00000220676:p.Leu171Pro			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L171P	ENST00000220676.1	37	c.512	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278880	0.40294	.	.	ENSG00000104237	ENST00000220676	D	0.93076	-3.16	5.14	3.97	0.46021	Doublecortin domain (5);	0.836191	0.10222	N	0.700757	D	0.94238	0.8150	L	0.46157	1.445	0.23492	N	0.997565	D	0.54397	0.966	P	0.58331	0.837	D	0.85881	0.1422	10	0.72032	D	0.01	0.0111	10.9459	0.47299	0.0:0.0742:0.0:0.9258	.	171	P56715	RP1_HUMAN	P	171	ENSP00000220676:L171P	ENSP00000220676:L171P	L	+	2	0	RP1	55696591	0.811000	0.29063	0.001000	0.08648	0.154000	0.21943	5.012000	0.64017	0.790000	0.33803	0.528000	0.53228	CTT	RP1	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000104237		0.652	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	43	0	T	NM_006269		55534038	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	43.48	39	30	SNP	0.042	C
RP1	6101	genome.wustl.edu	37	8	55534038	55534038	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:55534038T>C	ENST00000220676.1	+	2	660	c.512T>C	c.(511-513)cTt>cCt	p.L171P		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	171	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CGTGCGGTTCTTCTGAGCAGG	0.652																																					Colon(91;1014 1389 7634 14542 40420)												0													101.0	102.0	102.0					8																	55534038		2203	4300	6503	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.512T>C	8.37:g.55534038T>C	ENSP00000220676:p.Leu171Pro			Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.L171P	ENST00000220676.1	37	c.512	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	T	13.58	2.278880	0.40294	.	.	ENSG00000104237	ENST00000220676	D	0.93076	-3.16	5.14	3.97	0.46021	Doublecortin domain (5);	0.836191	0.10222	N	0.700757	D	0.94238	0.8150	L	0.46157	1.445	0.23492	N	0.997565	D	0.54397	0.966	P	0.58331	0.837	D	0.85881	0.1422	10	0.72032	D	0.01	0.0111	10.9459	0.47299	0.0:0.0742:0.0:0.9258	.	171	P56715	RP1_HUMAN	P	171	ENSP00000220676:L171P	ENSP00000220676:L171P	L	+	2	0	RP1	55696591	0.811000	0.29063	0.001000	0.08648	0.154000	0.21943	5.012000	0.64017	0.790000	0.33803	0.528000	0.53228	CTT	RP1	-	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	ENSG00000104237		0.652	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	-	0.00	59	0	T	NM_006269		55534038	+1	tier1	-	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	43.48	39	30	SNP	0.042	C
RYR2	6262	genome.wustl.edu	37	1	237886427	237886427	+	Splice_Site	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:237886427G>T	ENST00000366574.2	+	74	10871		c.e74-1		RYR2_ENST00000360064.6_Splice_Site|RYR2_ENST00000542537.1_Splice_Site|RYR2_ENST00000609119.1_Splice_Site	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTTTCTGCAGTTGGAGGATC	0.393																																																	0													183.0	168.0	172.0					1																	237886427		1854	4100	5954	SO:0001630	splice_region_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10555-1G>T	1.37:g.237886427G>T			Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	-	e75-1	ENST00000366574.2	37	c.10549-1	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652084	0.88056	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9784	0.97317	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR2	235953050	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.483000	0.97937	2.800000	0.96347	0.455000	0.32223	.	RYR2	-	-	ENSG00000198626		0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	137	0	G	NM_001035	Intron	237886427	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	splice_site	46.15	49	42	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237886427	237886427	+	Splice_Site	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:237886427G>T	ENST00000366574.2	+	74	10871		c.e74-1		RYR2_ENST00000360064.6_Splice_Site|RYR2_ENST00000542537.1_Splice_Site|RYR2_ENST00000609119.1_Splice_Site	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTTTCTGCAGTTGGAGGATC	0.393																																																	0													183.0	168.0	172.0					1																	237886427		1854	4100	5954	SO:0001630	splice_region_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10555-1G>T	1.37:g.237886427G>T			Q15411|Q546N8|Q5T3P2	Splice_Site	SNP	-	e75-1	ENST00000366574.2	37	c.10549-1	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652084	0.88056	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9784	0.97317	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RYR2	235953050	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	9.483000	0.97937	2.800000	0.96347	0.455000	0.32223	.	RYR2	-	-	ENSG00000198626		0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	155	0	G	NM_001035	Intron	237886427	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	splice_site	46.15	49	42	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23904431	23904431	+	Silent	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:23904431A>C	ENST00000382292.3	-	9	13857	c.13584T>G	c.(13582-13584)gcT>gcG	p.A4528A	SACS_ENST00000402364.1_Silent_p.A3778A|SACS_ENST00000382298.3_Silent_p.A4528A			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4528	HEPN. {ECO:0000255|PROSITE- ProRule:PRU00105}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTACACCATAAGCTTCCAATG	0.403																																																	0													185.0	163.0	171.0					13																	23904431		2203	4300	6503	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13584T>G	13.37:g.23904431A>C			O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.A4528	ENST00000382292.3	37	c.13584	CCDS9300.2	13																																																																																			SACS	-	pfam_HEPN,smart_HEPN,pfscan_HEPN	ENSG00000151835		0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	50	0	A	NM_014363		23904431	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	silent	30.51	41	18	SNP	0.177	C
SACS	26278	genome.wustl.edu	37	13	23904431	23904431	+	Silent	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:23904431A>C	ENST00000382292.3	-	9	13857	c.13584T>G	c.(13582-13584)gcT>gcG	p.A4528A	SACS_ENST00000402364.1_Silent_p.A3778A|SACS_ENST00000382298.3_Silent_p.A4528A			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	4528	HEPN. {ECO:0000255|PROSITE- ProRule:PRU00105}.				cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CTACACCATAAGCTTCCAATG	0.403																																																	0													185.0	163.0	171.0					13																	23904431		2203	4300	6503	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.13584T>G	13.37:g.23904431A>C			O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Silent	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.A4528	ENST00000382292.3	37	c.13584	CCDS9300.2	13																																																																																			SACS	-	pfam_HEPN,smart_HEPN,pfscan_HEPN	ENSG00000151835		0.403	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	59	0	A	NM_014363		23904431	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	silent	30.51	41	18	SNP	0.177	C
SCN10A	6336	genome.wustl.edu	37	3	38739688	38739689	+	Frame_Shift_Ins	INS	-	-	C	rs112795612		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:38739688_38739689insC	ENST00000449082.2	-	27	5021_5022	c.5022_5023insG	c.(5020-5025)gggcccfs	p.P1675fs		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1675					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CAGTAGGGGGGCCCTGTGTTGA	0.584																																																	0																																										SO:0001589	frameshift_variant	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5023dupG	3.37:g.38739691_38739691dupC	ENSP00000390600:p.Pro1675fs		A6NDQ1	Frame_Shift_Ins	INS	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.P1674fs	ENST00000449082.2	37	c.5023_5022	CCDS33736.1	3																																																																																			SCN10A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000185313		0.584	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3		0.00	63	0	-	NM_006514		38739689	-1	tier1		no_errors	ENST00000449082	ensembl	human	known	74_37	frame_shift_ins	24.32	28	9	INS	0.196:0.165	C
SCN10A	6336	genome.wustl.edu	37	3	38739688	38739689	+	Frame_Shift_Ins	INS	-	-	C	rs112795612		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:38739688_38739689insC	ENST00000449082.2	-	27	5021_5022	c.5022_5023insG	c.(5020-5025)gggcccfs	p.P1675fs		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1675					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CAGTAGGGGGGCCCTGTGTTGA	0.584																																																	0																																										SO:0001589	frameshift_variant	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5023dupG	3.37:g.38739691_38739691dupC	ENSP00000390600:p.Pro1675fs		A6NDQ1	Frame_Shift_Ins	INS	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.P1674fs	ENST00000449082.2	37	c.5023_5022	CCDS33736.1	3																																																																																			SCN10A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000185313		0.584	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3		0.00	64	0	-	NM_006514		38739689	-1	tier1		no_errors	ENST00000449082	ensembl	human	known	74_37	frame_shift_ins	24.32	28	9	INS	0.196:0.165	C
SEC24D	9871	genome.wustl.edu	37	4	119666217	119666218	+	Splice_Site	INS	-	-	A	rs78494615|rs35951660		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:119666217_119666218insA	ENST00000280551.6	-	14	1946		c.e14-2		SEC24D_ENST00000429811.2_Splice_Site|SEC24D_ENST00000379735.5_Splice_Site|SEC24D_ENST00000419654.2_Splice_Site|SEC24D_ENST00000511481.1_Splice_Site|SEC24D_ENST00000505134.1_Splice_Site			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GTCTGCTGCCTAAAAAAAAAAA	0.381																																																	0																																										SO:0001630	splice_region_variant	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1708-2->T	4.37:g.119666228_119666228dupA			Q8IYI7	Splice_Site	INS	-	e13-2	ENST00000280551.6	37	c.1711-3_1711-2	CCDS3710.1	4																																																																																			SEC24D	-	-	ENSG00000150961		0.381	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4		0.00	19	0	-		Intron	119666218	-1	tier1		no_errors	ENST00000379735	ensembl	human	known	74_37	splice_site_ins	12.50	21	3	INS	1.000:0.975	A
SEC24D	9871	genome.wustl.edu	37	4	119666217	119666218	+	Splice_Site	INS	-	-	A	rs78494615|rs35951660		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:119666217_119666218insA	ENST00000280551.6	-	14	1946		c.e14-2		SEC24D_ENST00000429811.2_Splice_Site|SEC24D_ENST00000379735.5_Splice_Site|SEC24D_ENST00000419654.2_Splice_Site|SEC24D_ENST00000511481.1_Splice_Site|SEC24D_ENST00000505134.1_Splice_Site			O94855	SC24D_HUMAN	SEC24 family member D						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						GTCTGCTGCCTAAAAAAAAAAA	0.381																																																	0																																										SO:0001630	splice_region_variant	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1708-2->T	4.37:g.119666228_119666228dupA			Q8IYI7	Splice_Site	INS	-	e13-2	ENST00000280551.6	37	c.1711-3_1711-2	CCDS3710.1	4																																																																																			SEC24D	-	-	ENSG00000150961		0.381	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4		0.00	23	0	-		Intron	119666218	-1	tier1		no_errors	ENST00000379735	ensembl	human	known	74_37	splice_site_ins	12.50	21	3	INS	1.000:0.975	A
SEMA5B	54437	genome.wustl.edu	37	3	122647386	122647386	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:122647386G>T	ENST00000357599.3	-	7	1000	c.614C>A	c.(613-615)tCc>tAc	p.S205Y	SEMA5B_ENST00000195173.4_Missense_Mutation_p.S205Y|SEMA5B_ENST00000451055.2_Missense_Mutation_p.S259Y|AC078794.1_ENST00000408284.1_RNA	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	205	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCACATGGGGGAAAAGGCATT	0.607																																																	0													59.0	45.0	50.0					3																	122647386		2201	4291	6492	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.614C>A	3.37:g.122647386G>T	ENSP00000350215:p.Ser205Tyr		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.S259Y	ENST00000357599.3	37	c.776	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104186	0.56291	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.345611	0.32273	N	0.006323	T	0.50188	0.1601	M	0.81239	2.535	0.38651	D	0.951844	D;D;D	0.64830	0.993;0.994;0.994	P;D;D	0.63597	0.782;0.916;0.916	T	0.56703	-0.7935	10	0.72032	D	0.01	.	13.2839	0.60232	0.0:0.0:0.8419:0.1581	.	147;205;205	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	Y	205;205;147;259;205	ENSP00000350215:S205Y;ENSP00000195173:S205Y;ENSP00000389588:S259Y;ENSP00000377208:S205Y	ENSP00000195173:S205Y	S	-	2	0	SEMA5B	124130076	1.000000	0.71417	0.998000	0.56505	0.561000	0.35649	3.387000	0.52501	2.804000	0.96469	0.462000	0.41574	TCC	SEMA5B	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000082684		0.607	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	33	0	G	NM_001031702		122647386	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.995	T
SEMA5B	54437	genome.wustl.edu	37	3	122647386	122647386	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:122647386G>T	ENST00000357599.3	-	7	1000	c.614C>A	c.(613-615)tCc>tAc	p.S205Y	SEMA5B_ENST00000195173.4_Missense_Mutation_p.S205Y|SEMA5B_ENST00000451055.2_Missense_Mutation_p.S259Y|AC078794.1_ENST00000408284.1_RNA	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	205	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		GCACATGGGGGAAAAGGCATT	0.607																																																	0													59.0	45.0	50.0					3																	122647386		2201	4291	6492	SO:0001583	missense	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.614C>A	3.37:g.122647386G>T	ENSP00000350215:p.Ser205Tyr		A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.S259Y	ENST00000357599.3	37	c.776	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	16.37	3.104186	0.56291	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.24908	1.83;1.83;1.83;1.83	5.38	5.38	0.77491	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.345611	0.32273	N	0.006323	T	0.50188	0.1601	M	0.81239	2.535	0.38651	D	0.951844	D;D;D	0.64830	0.993;0.994;0.994	P;D;D	0.63597	0.782;0.916;0.916	T	0.56703	-0.7935	10	0.72032	D	0.01	.	13.2839	0.60232	0.0:0.0:0.8419:0.1581	.	147;205;205	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	Y	205;205;147;259;205	ENSP00000350215:S205Y;ENSP00000195173:S205Y;ENSP00000389588:S259Y;ENSP00000377208:S205Y	ENSP00000195173:S205Y	S	-	2	0	SEMA5B	124130076	1.000000	0.71417	0.998000	0.56505	0.561000	0.35649	3.387000	0.52501	2.804000	0.96469	0.462000	0.41574	TCC	SEMA5B	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000082684		0.607	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	-	0.00	45	0	G	NM_001031702		122647386	-1	tier1	-	no_errors	ENST00000451055	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.995	T
SFRP1	6422	genome.wustl.edu	37	8	41166258	41166258	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:41166258C>T	ENST00000220772.3	-	1	758	c.421G>A	c.(421-423)Gag>Aag	p.E141K	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	141	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			ATGACCGGCTCGCACGAGTCG	0.657																																																	0													25.0	30.0	28.0					8																	41166258		2203	4300	6503	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.421G>A	8.37:g.41166258C>T	ENSP00000220772:p.Glu141Lys		O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.E141K	ENST00000220772.3	37	c.421	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298174	0.81025	.	.	ENSG00000104332	ENST00000220772;ENST00000535263	T	0.76316	-1.01	4.53	4.53	0.55603	Frizzled domain (5);	0.445426	0.24461	N	0.038324	T	0.75982	0.3924	M	0.66560	2.04	0.50313	D	0.999864	P	0.38420	0.63	B	0.35470	0.203	T	0.80264	-0.1455	10	0.62326	D	0.03	.	16.2365	0.82377	0.0:1.0:0.0:0.0	.	141	Q8N474	SFRP1_HUMAN	K	141	ENSP00000220772:E141K	ENSP00000220772:E141K	E	-	1	0	SFRP1	41285415	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.785000	0.55424	2.045000	0.60652	0.467000	0.42956	GAG	SFRP1	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000104332		0.657	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	-	0.00	53	0	C	NM_003012		41166258	-1	tier1	-	no_errors	ENST00000220772	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	T
SFRP1	6422	genome.wustl.edu	37	8	41166258	41166258	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:41166258C>T	ENST00000220772.3	-	1	758	c.421G>A	c.(421-423)Gag>Aag	p.E141K	SFRP1_ENST00000379845.3_5'Flank	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	141	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			ATGACCGGCTCGCACGAGTCG	0.657																																																	0													25.0	30.0	28.0					8																	41166258		2203	4300	6503	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.421G>A	8.37:g.41166258C>T	ENSP00000220772:p.Glu141Lys		O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.E141K	ENST00000220772.3	37	c.421	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	C	22.5	4.298174	0.81025	.	.	ENSG00000104332	ENST00000220772;ENST00000535263	T	0.76316	-1.01	4.53	4.53	0.55603	Frizzled domain (5);	0.445426	0.24461	N	0.038324	T	0.75982	0.3924	M	0.66560	2.04	0.50313	D	0.999864	P	0.38420	0.63	B	0.35470	0.203	T	0.80264	-0.1455	10	0.62326	D	0.03	.	16.2365	0.82377	0.0:1.0:0.0:0.0	.	141	Q8N474	SFRP1_HUMAN	K	141	ENSP00000220772:E141K	ENSP00000220772:E141K	E	-	1	0	SFRP1	41285415	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.785000	0.55424	2.045000	0.60652	0.467000	0.42956	GAG	SFRP1	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000104332		0.657	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	-	0.00	74	0	C	NM_003012		41166258	-1	tier1	-	no_errors	ENST00000220772	ensembl	human	known	74_37	missense	5.88	80	5	SNP	1.000	T
SHANK1	50944	genome.wustl.edu	37	19	51217187	51217187	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:51217187C>T	ENST00000293441.1	-	5	678	c.660G>A	c.(658-660)gcG>gcA	p.A220A	SHANK1_ENST00000391814.1_Silent_p.A220A|SHANK1_ENST00000359082.3_Silent_p.A220A	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	220					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CGGTCTGGGCCGCCAGTGTCA	0.617																																																	0													33.0	35.0	34.0					19																	51217187		2203	4300	6503	SO:0001819	synonymous_variant	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.660G>A	19.37:g.51217187C>T			A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A220	ENST00000293441.1	37	c.660	CCDS12799.1	19																																																																																			SHANK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000161681		0.617	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	-	0.00	60	0	C	NM_016148		51217187	-1	tier1	-	no_errors	ENST00000391814	ensembl	human	known	74_37	silent	18.42	31	7	SNP	0.089	T
SHANK1	50944	genome.wustl.edu	37	19	51217187	51217187	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:51217187C>T	ENST00000293441.1	-	5	678	c.660G>A	c.(658-660)gcG>gcA	p.A220A	SHANK1_ENST00000391814.1_Silent_p.A220A|SHANK1_ENST00000359082.3_Silent_p.A220A	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	220					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CGGTCTGGGCCGCCAGTGTCA	0.617																																																	0													33.0	35.0	34.0					19																	51217187		2203	4300	6503	SO:0001819	synonymous_variant	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.660G>A	19.37:g.51217187C>T			A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A220	ENST00000293441.1	37	c.660	CCDS12799.1	19																																																																																			SHANK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000161681		0.617	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	-	0.00	82	0	C	NM_016148		51217187	-1	tier1	-	no_errors	ENST00000391814	ensembl	human	known	74_37	silent	18.42	31	7	SNP	0.089	T
SIRPB2	284759	genome.wustl.edu	37	20	1456898	1456898	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:1456898G>A	ENST00000359801.3	-	5	979	c.943C>T	c.(943-945)Cgg>Tgg	p.R315W	SIRPB2_ENST00000608747.1_5'Flank|SIRPB2_ENST00000444444.2_Missense_Mutation_p.R217W	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	349	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGGCTCCTCCGAGAGGTAGCC	0.607																																																	0													100.0	89.0	92.0					20																	1456898		1568	3582	5150	SO:0001583	missense	0			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.943C>T	20.37:g.1456898G>A	ENSP00000352849:p.Arg315Trp		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R315W	ENST00000359801.3	37	c.943	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	G	9.084	0.999960	0.19121	.	.	ENSG00000196209	ENST00000359801;ENST00000444444	T;T	0.02158	4.66;4.42	3.53	-3.66	0.04489	.	3.365810	0.01204	N	0.007646	T	0.01489	0.0048	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.48019	-0.9071	10	0.48119	T	0.1	-13.4715	9.3121	0.37912	0.6932:0.0:0.3068:0.0	.	217;315	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	W	315;217	ENSP00000352849:R315W;ENSP00000402438:R217W	ENSP00000352849:R315W	R	-	1	2	SIRPB2	1404898	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.870000	0.01641	-0.791000	0.04486	-0.339000	0.08088	CGG	SIRPB2	-	NULL	ENSG00000196209		0.607	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	-	0.00	36	0	G	NM_178459		1456898	-1	tier1	-	no_errors	ENST00000359801	ensembl	human	known	74_37	missense	63.04	17	29	SNP	0.000	A
SIRPB2	284759	genome.wustl.edu	37	20	1456898	1456898	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:1456898G>A	ENST00000359801.3	-	5	979	c.943C>T	c.(943-945)Cgg>Tgg	p.R315W	SIRPB2_ENST00000608747.1_5'Flank|SIRPB2_ENST00000444444.2_Missense_Mutation_p.R217W	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	349	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGGCTCCTCCGAGAGGTAGCC	0.607																																																	0													100.0	89.0	92.0					20																	1456898		1568	3582	5150	SO:0001583	missense	0			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.943C>T	20.37:g.1456898G>A	ENSP00000352849:p.Arg315Trp		B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R315W	ENST00000359801.3	37	c.943	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	G	9.084	0.999960	0.19121	.	.	ENSG00000196209	ENST00000359801;ENST00000444444	T;T	0.02158	4.66;4.42	3.53	-3.66	0.04489	.	3.365810	0.01204	N	0.007646	T	0.01489	0.0048	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.48019	-0.9071	10	0.48119	T	0.1	-13.4715	9.3121	0.37912	0.6932:0.0:0.3068:0.0	.	217;315	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	W	315;217	ENSP00000352849:R315W;ENSP00000402438:R217W	ENSP00000352849:R315W	R	-	1	2	SIRPB2	1404898	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.870000	0.01641	-0.791000	0.04486	-0.339000	0.08088	CGG	SIRPB2	-	NULL	ENSG00000196209		0.607	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	-	0.00	62	0	G	NM_178459		1456898	-1	tier1	-	no_errors	ENST00000359801	ensembl	human	known	74_37	missense	63.04	17	29	SNP	0.000	A
SLC25A3P1	163742	genome.wustl.edu	37	1	53904142	53904142	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:53904142G>A	ENST00000566100.1	-	0	1096									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		CTGCAGGGCCGTGAGGGTGCC	0.612																																																	0																																												0					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53904142G>A				RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-	ENSG00000236253		0.612	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	-	0.00	39	0	G	NM_178501		53904142	-1	tier1	-	no_errors	ENST00000566100	ensembl	human	known	74_37	rna	21.43	22	6	SNP	0.903	A
SLC25A3P1	163742	genome.wustl.edu	37	1	53904142	53904142	+	RNA	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:53904142G>A	ENST00000566100.1	-	0	1096									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		CTGCAGGGCCGTGAGGGTGCC	0.612																																																	0																																												0					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53904142G>A				RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-	ENSG00000236253		0.612	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	-	0.00	40	0	G	NM_178501		53904142	-1	tier1	-	no_errors	ENST00000566100	ensembl	human	known	74_37	rna	21.43	22	6	SNP	0.903	A
SLCO6A1	133482	genome.wustl.edu	37	5	101735341	101735341	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:101735341A>C	ENST00000506729.1	-	10	1903	c.1732T>G	c.(1732-1734)Tta>Gta	p.L578V	SLCO6A1_ENST00000389019.3_Missense_Mutation_p.L516V|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.L325V|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.L578V|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.L325V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	578						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AACAAAGGTAACTTATAGCAC	0.363																																																	0													113.0	108.0	110.0					5																	101735341		2203	4300	6503	SO:0001583	missense	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1732T>G	5.37:g.101735341A>C	ENSP00000421339:p.Leu578Val		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L578V	ENST00000506729.1	37	c.1732	CCDS34206.1	5	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417973	0.25552	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.42	3.05	0.35203	Major facilitator superfamily domain, general substrate transporter (1);	0.117510	0.36555	N	0.002536	T	0.50922	0.1644	M	0.73962	2.25	0.38090	D	0.936936	P;P;P	0.52061	0.736;0.95;0.816	B;P;P	0.54706	0.275;0.759;0.5	T	0.52946	-0.8507	10	0.51188	T	0.08	.	5.3806	0.16189	0.7334:0.1777:0.0889:0.0	.	516;325;578	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	V	578;578;516;325;325	ENSP00000421339:L578V;ENSP00000369135:L578V;ENSP00000373671:L516V;ENSP00000421990:L325V;ENSP00000369138:L325V	ENSP00000369135:L578V	L	-	1	2	SLCO6A1	101763240	0.156000	0.22821	0.870000	0.34147	0.055000	0.15305	0.457000	0.21875	0.495000	0.27882	-0.291000	0.09656	TTA	SLCO6A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000205359		0.363	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	-	0.00	61	0	A	NM_173488		101735341	-1	tier1	-	no_errors	ENST00000379807	ensembl	human	known	74_37	missense	54.29	16	19	SNP	0.954	C
SLCO6A1	133482	genome.wustl.edu	37	5	101735341	101735341	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:101735341A>C	ENST00000506729.1	-	10	1903	c.1732T>G	c.(1732-1734)Tta>Gta	p.L578V	SLCO6A1_ENST00000389019.3_Missense_Mutation_p.L516V|SLCO6A1_ENST00000513675.1_Missense_Mutation_p.L325V|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.L578V|SLCO6A1_ENST00000379810.1_Missense_Mutation_p.L325V			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	578						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AACAAAGGTAACTTATAGCAC	0.363																																																	0													113.0	108.0	110.0					5																	101735341		2203	4300	6503	SO:0001583	missense	0			AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1732T>G	5.37:g.101735341A>C	ENSP00000421339:p.Leu578Val		A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L578V	ENST00000506729.1	37	c.1732	CCDS34206.1	5	.	.	.	.	.	.	.	.	.	.	A	10.68	1.417973	0.25552	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.42	3.05	0.35203	Major facilitator superfamily domain, general substrate transporter (1);	0.117510	0.36555	N	0.002536	T	0.50922	0.1644	M	0.73962	2.25	0.38090	D	0.936936	P;P;P	0.52061	0.736;0.95;0.816	B;P;P	0.54706	0.275;0.759;0.5	T	0.52946	-0.8507	10	0.51188	T	0.08	.	5.3806	0.16189	0.7334:0.1777:0.0889:0.0	.	516;325;578	Q86UG4-2;C9J020;Q86UG4	.;.;SO6A1_HUMAN	V	578;578;516;325;325	ENSP00000421339:L578V;ENSP00000369135:L578V;ENSP00000373671:L516V;ENSP00000421990:L325V;ENSP00000369138:L325V	ENSP00000369135:L578V	L	-	1	2	SLCO6A1	101763240	0.156000	0.22821	0.870000	0.34147	0.055000	0.15305	0.457000	0.21875	0.495000	0.27882	-0.291000	0.09656	TTA	SLCO6A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000205359		0.363	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	HGNC	protein_coding	OTTHUMT00000370335.1	-	0.00	68	0	A	NM_173488		101735341	-1	tier1	-	no_errors	ENST00000379807	ensembl	human	known	74_37	missense	54.29	16	19	SNP	0.954	C
SMC2	10592	genome.wustl.edu	37	9	106882419	106882419	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:106882419C>G	ENST00000286398.7	+	16	2396	c.2108C>G	c.(2107-2109)gCa>gGa	p.A703G	SMC2_ENST00000374787.3_Missense_Mutation_p.A703G|SMC2_ENST00000374793.3_Missense_Mutation_p.A703G|SMC2_ENST00000303219.8_Missense_Mutation_p.A703G	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	703					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GAGGAATTAGCAGGTCTTAAA	0.333																																																	0													89.0	98.0	95.0					9																	106882419		2202	4300	6502	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2108C>G	9.37:g.106882419C>G	ENSP00000286398:p.Ala703Gly		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.A703G	ENST00000286398.7	37	c.2108	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	C	13.21	2.168284	0.38315	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.79749	-1.3;-1.3;3.15;-1.3	5.43	5.43	0.79202	.	0.562057	0.19849	N	0.104700	T	0.62208	0.2409	N	0.08118	0	0.34339	D	0.688561	B;B	0.34181	0.012;0.44	B;B	0.30646	0.021;0.118	T	0.71676	-0.4521	10	0.41790	T	0.15	-9.119	11.3173	0.49399	0.0:0.9156:0.0:0.0844	.	703;703	O95347;Q2KQ72	SMC2_HUMAN;.	G	703	ENSP00000286398:A703G;ENSP00000363925:A703G;ENSP00000306152:A703G;ENSP00000363919:A703G	ENSP00000286398:A703G	A	+	2	0	SMC2	105922240	0.836000	0.29430	0.998000	0.56505	0.995000	0.86356	0.802000	0.27069	2.542000	0.85734	0.585000	0.79938	GCA	SMC2	-	superfamily_P-loop_NTPase	ENSG00000136824		0.333	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	38	0	C			106882419	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	missense	48.65	19	18	SNP	0.872	G
SMC2	10592	genome.wustl.edu	37	9	106882419	106882419	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:106882419C>G	ENST00000286398.7	+	16	2396	c.2108C>G	c.(2107-2109)gCa>gGa	p.A703G	SMC2_ENST00000374787.3_Missense_Mutation_p.A703G|SMC2_ENST00000374793.3_Missense_Mutation_p.A703G|SMC2_ENST00000303219.8_Missense_Mutation_p.A703G	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	703					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						GAGGAATTAGCAGGTCTTAAA	0.333																																																	0													89.0	98.0	95.0					9																	106882419		2202	4300	6502	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2108C>G	9.37:g.106882419C>G	ENSP00000286398:p.Ala703Gly		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.A703G	ENST00000286398.7	37	c.2108	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	C	13.21	2.168284	0.38315	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.79749	-1.3;-1.3;3.15;-1.3	5.43	5.43	0.79202	.	0.562057	0.19849	N	0.104700	T	0.62208	0.2409	N	0.08118	0	0.34339	D	0.688561	B;B	0.34181	0.012;0.44	B;B	0.30646	0.021;0.118	T	0.71676	-0.4521	10	0.41790	T	0.15	-9.119	11.3173	0.49399	0.0:0.9156:0.0:0.0844	.	703;703	O95347;Q2KQ72	SMC2_HUMAN;.	G	703	ENSP00000286398:A703G;ENSP00000363925:A703G;ENSP00000306152:A703G;ENSP00000363919:A703G	ENSP00000286398:A703G	A	+	2	0	SMC2	105922240	0.836000	0.29430	0.998000	0.56505	0.995000	0.86356	0.802000	0.27069	2.542000	0.85734	0.585000	0.79938	GCA	SMC2	-	superfamily_P-loop_NTPase	ENSG00000136824		0.333	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	42	0	C			106882419	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	missense	48.65	19	18	SNP	0.872	G
SMPD3	55512	genome.wustl.edu	37	16	68398796	68398796	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr16:68398796G>C	ENST00000219334.5	-	5	2016	c.1413C>G	c.(1411-1413)atC>atG	p.I471M	SMPD3_ENST00000566009.1_5'UTR|SMPD3_ENST00000568373.1_Missense_Mutation_p.I471M|SMPD3_ENST00000563226.1_Missense_Mutation_p.I471M	NM_018667.3	NP_061137.1	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral membrane (neutral sphingomyelinase II)	471					cell cycle (GO:0007049)|glycosphingolipid metabolic process (GO:0006687)|hematopoietic progenitor cell differentiation (GO:0002244)|peptide hormone secretion (GO:0030072)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)	Golgi cis cisterna (GO:0000137)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	GCCCACACCGGATGGCGCTGT	0.592																																																	0													44.0	38.0	40.0					16																	68398796		2198	4300	6498	SO:0001583	missense	0			AJ250460	CCDS10867.1	16q22.1	2008-02-05			ENSG00000103056	ENSG00000103056			14240	protein-coding gene	gene with protein product		605777				10823942	Standard	NM_018667		Approved	NSMASE2	uc002ewa.3	Q9NY59	OTTHUMG00000137559	ENST00000219334.5:c.1413C>G	16.37:g.68398796G>C	ENSP00000219334:p.Ile471Met		B7ZL82|Q2M1S8	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.I471M	ENST00000219334.5	37	c.1413	CCDS10867.1	16	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738629	0.69304	.	.	ENSG00000103056	ENST00000219334	T	0.80214	-1.35	5.93	2.6	0.31112	Endonuclease/exonuclease/phosphatase (2);	0.281510	0.40064	N	0.001182	T	0.82254	0.4997	L	0.58810	1.83	0.27081	N	0.96309	P;P;P	0.39624	0.487;0.681;0.681	P;P;P	0.51777	0.502;0.679;0.581	T	0.75025	-0.3463	10	0.72032	D	0.01	-10.0414	8.2931	0.31969	0.3054:0.0:0.6946:0.0	.	471;471;471	B7ZL82;B7ZL84;Q9NY59	.;.;NSMA2_HUMAN	M	471	ENSP00000219334:I471M	ENSP00000219334:I471M	I	-	3	3	SMPD3	66956297	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	0.270000	0.18607	0.844000	0.35094	0.561000	0.74099	ATC	SMPD3	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000103056		0.592	SMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMPD3	HGNC	protein_coding	OTTHUMT00000268895.3		0.00	58	0	G	NM_018667		68398796	-1			no_errors	ENST00000219334	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.997	C
SNHG14	104472715	genome.wustl.edu	37	15	25315598	25315599	+	RNA	INS	-	-	A	rs149955138	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:25315598_25315599insA	ENST00000549804.2	+	0	678				SNHG14_ENST00000551077.1_RNA|SNORD116-9_ENST00000384000.1_RNA|SNORD116-8_ENST00000384365.1_RNA|SNORD116-7_ENST00000384404.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		ATGAGTCCTCCAAAAAAACATT	0.49																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25315605_25315605dupA				RNA	INS	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			SNORD116-8	-	-	ENSG00000207093		0.490	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNORD116-8	HGNC	processed_transcript	OTTHUMT00000408278.2		0.00	107	0	-			25315599	+1	tier1		no_errors	ENST00000384365	ensembl	human	known	74_37	rna	19.05	68	16	INS	0.000:0.001	A
SNHG14	104472715	genome.wustl.edu	37	15	25315598	25315599	+	RNA	INS	-	-	A	rs149955138	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:25315598_25315599insA	ENST00000549804.2	+	0	678				SNHG14_ENST00000551077.1_RNA|SNORD116-9_ENST00000384000.1_RNA|SNORD116-8_ENST00000384365.1_RNA|SNORD116-7_ENST00000384404.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		ATGAGTCCTCCAAAAAAACATT	0.49																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25315605_25315605dupA				RNA	INS	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			SNORD116-8	-	-	ENSG00000207093		0.490	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNORD116-8	HGNC	processed_transcript	OTTHUMT00000408278.2		0.00	108	0	-			25315599	+1	tier1		no_errors	ENST00000384365	ensembl	human	known	74_37	rna	19.05	68	16	INS	0.000:0.001	A
SNHG14	104472715	genome.wustl.edu	37	15	25453130	25453130	+	RNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:25453130A>C	ENST00000424208.1	+	0	2384				SNHG14_ENST00000450809.1_RNA|SNORD115-22_ENST00000364456.1_RNA|SNHG14_ENST00000424333.1_RNA|SNORD115-21_ENST00000362963.1_RNA|SNORD115-20_ENST00000365099.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GATGCACTGAAGCTCAGGCCC	0.622																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25453130A>C				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.622	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	59	0	A			25453130	+1	tier1	-	no_errors	ENST00000424333	ensembl	human	known	74_37	rna	63.33	11	19	SNP	0.004	C
SNHG14	104472715	genome.wustl.edu	37	15	25453130	25453130	+	RNA	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr15:25453130A>C	ENST00000424208.1	+	0	2384				SNHG14_ENST00000450809.1_RNA|SNORD115-22_ENST00000364456.1_RNA|SNHG14_ENST00000424333.1_RNA|SNORD115-21_ENST00000362963.1_RNA|SNORD115-20_ENST00000365099.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GATGCACTGAAGCTCAGGCCC	0.622																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25453130A>C				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.622	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	74	0	A			25453130	+1	tier1	-	no_errors	ENST00000424333	ensembl	human	known	74_37	rna	63.33	11	19	SNP	0.004	C
SNRNP200	23020	genome.wustl.edu	37	2	96942904	96942904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:96942904G>A	ENST00000323853.5	-	42	6084	c.6007C>T	c.(6007-6009)Cag>Tag	p.Q2003*	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	2003	SEC63 2.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCTGCAATCTGGCTGTCAGTC	0.507																																																	0													147.0	137.0	140.0					2																	96942904		2203	4300	6503	SO:0001587	stop_gained	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.6007C>T	2.37:g.96942904G>A	ENSP00000317123:p.Gln2003*		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Nonsense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2003*	ENST00000323853.5	37	c.6007	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.025913	0.98616	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-21.5037	17.1135	0.86682	0.0:0.0:1.0:0.0	.	.	.	.	X	2003;462;586	.	ENSP00000317123:Q2003X	Q	-	1	0	SNRNP200	96306631	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.282000	0.78630	2.647000	0.89833	0.563000	0.77884	CAG	SNRNP200	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000144028		0.507	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	-	0.00	38	0	G	NM_014014		96942904	-1	tier1	-	no_errors	ENST00000323853	ensembl	human	known	74_37	nonsense	20.83	19	5	SNP	1.000	A
SNRNP200	23020	genome.wustl.edu	37	2	96942904	96942904	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:96942904G>A	ENST00000323853.5	-	42	6084	c.6007C>T	c.(6007-6009)Cag>Tag	p.Q2003*	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	2003	SEC63 2.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						TCTGCAATCTGGCTGTCAGTC	0.507																																																	0													147.0	137.0	140.0					2																	96942904		2203	4300	6503	SO:0001587	stop_gained	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.6007C>T	2.37:g.96942904G>A	ENSP00000317123:p.Gln2003*		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Nonsense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2003*	ENST00000323853.5	37	c.6007	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.025913	0.98616	.	.	ENSG00000144028	ENST00000323853;ENST00000536601;ENST00000543553	.	.	.	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-21.5037	17.1135	0.86682	0.0:0.0:1.0:0.0	.	.	.	.	X	2003;462;586	.	ENSP00000317123:Q2003X	Q	-	1	0	SNRNP200	96306631	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.282000	0.78630	2.647000	0.89833	0.563000	0.77884	CAG	SNRNP200	-	pfam_Sec63-dom,smart_Sec63-dom	ENSG00000144028		0.507	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	-	0.00	49	0	G	NM_014014		96942904	-1	tier1	-	no_errors	ENST00000323853	ensembl	human	known	74_37	nonsense	20.83	19	5	SNP	1.000	A
SORCS1	114815	genome.wustl.edu	37	10	108923957	108923957	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:108923957G>A	ENST00000263054.6	-	1	335	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	SORCS1_ENST00000344440.6_Missense_Mutation_p.R110W	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	110					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCTCCGCTCCGTCTCCTCCGG	0.706																																																	0													23.0	24.0	24.0					10																	108923957		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.328C>T	10.37:g.108923957G>A	ENSP00000263054:p.Arg110Trp		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.R110W	ENST00000263054.6	37	c.328	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455409	0.43634	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.18338	2.22;2.24	4.45	2.5	0.30297	.	0.333009	0.20194	N	0.097249	T	0.16938	0.0407	N	0.14661	0.345	0.32664	N	0.517636	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	P;P;P;P;P	0.60609	0.756;0.877;0.877;0.756;0.877	T	0.16482	-1.0401	9	.	.	.	-15.0269	6.9643	0.24615	0.0:0.1729:0.4714:0.3557	.	110;110;110;110;110	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	W	110	ENSP00000263054:R110W;ENSP00000345964:R110W	.	R	-	1	2	SORCS1	108913947	0.400000	0.25295	0.998000	0.56505	0.374000	0.29953	0.237000	0.17985	0.439000	0.26476	-0.293000	0.09583	CGG	SORCS1	-	NULL	ENSG00000108018		0.706	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	-	0.00	22	0	G	NM_052918		108923957	-1	tier1	-	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	29.41	11	5	SNP	0.999	A
SORCS1	114815	genome.wustl.edu	37	10	108923957	108923957	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:108923957G>A	ENST00000263054.6	-	1	335	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	SORCS1_ENST00000344440.6_Missense_Mutation_p.R110W	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	110					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		GCTCCGCTCCGTCTCCTCCGG	0.706																																																	0													23.0	24.0	24.0					10																	108923957		2203	4300	6503	SO:0001583	missense	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.328C>T	10.37:g.108923957G>A	ENSP00000263054:p.Arg110Trp		A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.R110W	ENST00000263054.6	37	c.328	CCDS7559.1	10	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455409	0.43634	.	.	ENSG00000108018	ENST00000263054;ENST00000344440	T;T	0.18338	2.22;2.24	4.45	2.5	0.30297	.	0.333009	0.20194	N	0.097249	T	0.16938	0.0407	N	0.14661	0.345	0.32664	N	0.517636	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	P;P;P;P;P	0.60609	0.756;0.877;0.877;0.756;0.877	T	0.16482	-1.0401	9	.	.	.	-15.0269	6.9643	0.24615	0.0:0.1729:0.4714:0.3557	.	110;110;110;110;110	A8K182;Q8WY21-4;Q8WY21-3;Q8WY21;Q8WY21-2	.;.;.;SORC1_HUMAN;.	W	110	ENSP00000263054:R110W;ENSP00000345964:R110W	.	R	-	1	2	SORCS1	108913947	0.400000	0.25295	0.998000	0.56505	0.374000	0.29953	0.237000	0.17985	0.439000	0.26476	-0.293000	0.09583	CGG	SORCS1	-	NULL	ENSG00000108018		0.706	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	-	0.00	29	0	G	NM_052918		108923957	-1	tier1	-	no_errors	ENST00000344440	ensembl	human	known	74_37	missense	29.41	11	5	SNP	0.999	A
SPATA31E1	286234	genome.wustl.edu	37	9	90500069	90500069	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:90500069G>A	ENST00000325643.5	+	4	733	c.667G>A	c.(667-669)Ggg>Agg	p.G223R		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	223	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G223W(1)									GAGTGCCTCCGGGCCACCAGA	0.627																																																	1	Substitution - Missense(1)	lung(1)											98.0	107.0	104.0					9																	90500069		2203	4300	6503	SO:0001583	missense	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.667G>A	9.37:g.90500069G>A	ENSP00000322640:p.Gly223Arg		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.G223R	ENST00000325643.5	37	c.667	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.086634	0.00367	.	.	ENSG00000177992	ENST00000325643	T	0.03035	4.07	1.31	-2.62	0.06152	.	.	.	.	.	T	0.01320	0.0043	N	0.03115	-0.41	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.47995	-0.9073	9	0.13853	T	0.58	.	2.2136	0.03954	0.4397:0.3173:0.243:0.0	.	223	Q6ZUB1	CI079_HUMAN	R	223	ENSP00000322640:G223R	ENSP00000322640:G223R	G	+	1	0	C9orf79	89689889	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.920000	0.04013	-0.581000	0.05937	-0.455000	0.05494	GGG	SPATA31E1	-	NULL	ENSG00000177992		0.627	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	-	0.00	32	0	G	NM_178828		90500069	+1	tier1	-	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.000	A
SPATA31E1	286234	genome.wustl.edu	37	9	90500069	90500069	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:90500069G>A	ENST00000325643.5	+	4	733	c.667G>A	c.(667-669)Ggg>Agg	p.G223R		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	223	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.G223W(1)									GAGTGCCTCCGGGCCACCAGA	0.627																																																	1	Substitution - Missense(1)	lung(1)											98.0	107.0	104.0					9																	90500069		2203	4300	6503	SO:0001583	missense	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.667G>A	9.37:g.90500069G>A	ENSP00000322640:p.Gly223Arg		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.G223R	ENST00000325643.5	37	c.667	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.086634	0.00367	.	.	ENSG00000177992	ENST00000325643	T	0.03035	4.07	1.31	-2.62	0.06152	.	.	.	.	.	T	0.01320	0.0043	N	0.03115	-0.41	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.47995	-0.9073	9	0.13853	T	0.58	.	2.2136	0.03954	0.4397:0.3173:0.243:0.0	.	223	Q6ZUB1	CI079_HUMAN	R	223	ENSP00000322640:G223R	ENSP00000322640:G223R	G	+	1	0	C9orf79	89689889	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.920000	0.04013	-0.581000	0.05937	-0.455000	0.05494	GGG	SPATA31E1	-	NULL	ENSG00000177992		0.627	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	-	0.00	57	0	G	NM_178828		90500069	+1	tier1	-	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.000	A
AKNAD1	254268	genome.wustl.edu	37	1	109400924	109400924	+	5'Flank	DEL	T	T	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:109400924delT	ENST00000370001.3	-	0	0				SPATA42_ENST00000417241.1_RNA|SPATA42_ENST00000369989.2_RNA|AKNAD1_ENST00000357393.4_Intron|AKNAD1_ENST00000369995.3_5'Flank	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AACTTTTGTCTTTTTTTTTTT	0.363																																																	0																																										SO:0001631	upstream_gene_variant	0			AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400924delT	Exception_encountered		B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	DEL	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			SPATA42	-	-	ENSG00000203897		0.363	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	HGNC	protein_coding	OTTHUMT00000030923.2		0.00	18	0	T	NM_152763		109400924	+1	tier1		no_errors	ENST00000417241	ensembl	human	known	74_37	rna	30.77	9	4	DEL	0.000	-
SPRED3	399473	genome.wustl.edu	37	19	38882864	38882866	+	In_Frame_Del	DEL	CCT	CCT	-	rs151129136		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:38882864_38882866delCCT	ENST00000338502.4	+	3	462_464	c.359_361delCCT	c.(358-363)ccctcc>ccc	p.S128del	SPRED3_ENST00000586301.1_In_Frame_Del_p.S128del|SPRED3_ENST00000587013.1_In_Frame_Del_p.S172del|SPRED3_ENST00000587564.2_3'UTR	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	128	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCACTCAccccctcctcctcctc	0.645																																																	0									,	401,4,3395		26,0,349,0,4,1521					,	3.3	0.9		dbSNP_134	44	1035,11,6892		107,0,821,1,9,3031	no	codingComplex,codingComplex	SPRED3	NM_001042522.1,NM_001039616.1	,	133,0,1170,1,13,4552	A1A1,A1A2,A1R,A2A2,A2R,RR		13.1771,10.6579,12.3616	,	,		1436,15,10287				SO:0001651	inframe_deletion	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.359_361delCCT	19.37:g.38882873_38882875delCCT	ENSP00000345405:p.Ser128del		Q2MJR1	In_Frame_Del	DEL	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.S124in_frame_del	ENST00000338502.4	37	c.359_361	CCDS42560.1	19																																																																																			SPRED3	-	NULL	ENSG00000188766		0.645	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1		0.00	30	0	CCT	XM_351191		38882866	+1	tier1		no_errors	ENST00000338502	ensembl	human	known	74_37	in_frame_del	17.65	14	3	DEL	1.000:0.995:0.997	-
SPRED3	399473	genome.wustl.edu	37	19	38882864	38882866	+	In_Frame_Del	DEL	CCT	CCT	-	rs151129136		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:38882864_38882866delCCT	ENST00000338502.4	+	3	462_464	c.359_361delCCT	c.(358-363)ccctcc>ccc	p.S128del	SPRED3_ENST00000586301.1_In_Frame_Del_p.S128del|SPRED3_ENST00000587013.1_In_Frame_Del_p.S172del|SPRED3_ENST00000587564.2_3'UTR	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	128	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCACTCAccccctcctcctcctc	0.645																																																	0									,	401,4,3395		26,0,349,0,4,1521					,	3.3	0.9		dbSNP_134	44	1035,11,6892		107,0,821,1,9,3031	no	codingComplex,codingComplex	SPRED3	NM_001042522.1,NM_001039616.1	,	133,0,1170,1,13,4552	A1A1,A1A2,A1R,A2A2,A2R,RR		13.1771,10.6579,12.3616	,	,		1436,15,10287				SO:0001651	inframe_deletion	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.359_361delCCT	19.37:g.38882873_38882875delCCT	ENSP00000345405:p.Ser128del		Q2MJR1	In_Frame_Del	DEL	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.S124in_frame_del	ENST00000338502.4	37	c.359_361	CCDS42560.1	19																																																																																			SPRED3	-	NULL	ENSG00000188766		0.645	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1		0.00	36	0	CCT	XM_351191		38882866	+1	tier1		no_errors	ENST00000338502	ensembl	human	known	74_37	in_frame_del	17.65	14	3	DEL	1.000:0.995:0.997	-
SPTA1	6708	genome.wustl.edu	37	1	158637785	158637785	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:158637785T>G	ENST00000368147.4	-	15	2081	c.1901A>C	c.(1900-1902)aAg>aCg	p.K634T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	634					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					CAGCTGGGTCTTATTAACTGC	0.418																																																	0													183.0	179.0	180.0					1																	158637785		1859	4098	5957	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1901A>C	1.37:g.158637785T>G	ENSP00000357129:p.Lys634Thr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.K634T	ENST00000368147.4	37	c.1901	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	11.24	1.580045	0.28180	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54279	0.58;0.58	4.95	4.95	0.65309	.	0.883442	0.09181	N	0.837373	T	0.44371	0.1290	L	0.58810	1.83	0.31067	N	0.713414	B	0.26041	0.14	B	0.38020	0.263	T	0.50964	-0.8765	10	0.56958	D	0.05	.	13.6072	0.62054	0.0:0.0:0.0:1.0	.	634	P02549	SPTA1_HUMAN	T	634	ENSP00000357130:K634T;ENSP00000357129:K634T	ENSP00000357129:K634T	K	-	2	0	SPTA1	156904409	1.000000	0.71417	0.005000	0.12908	0.023000	0.10783	2.571000	0.45990	2.080000	0.62538	0.528000	0.53228	AAG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.418	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	120	0	T	NM_003126		158637785	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	44.00	42	33	SNP	0.979	G
STXBP5L	9515	genome.wustl.edu	37	3	121137298	121137298	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:121137298G>A	ENST00000273666.6	+	27	3684	c.3413G>A	c.(3412-3414)cGt>cAt	p.R1138H	STXBP5L_ENST00000471454.1_Missense_Mutation_p.R1114H	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1138	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GAGCTGACCCGTGCACGGATT	0.532																																																	0													62.0	69.0	66.0					3																	121137298		2051	4195	6246	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3413G>A	3.37:g.121137298G>A	ENSP00000273666:p.Arg1138His		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.R1138H	ENST00000273666.6	37	c.3413	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635322	0.67130	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.27256	1.68;1.68;1.75	5.59	4.7	0.59300	Synaptobrevin (1);	0.216802	0.39615	N	0.001315	T	0.38401	0.1039	M	0.82056	2.57	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.45506	0.483;0.483	T	0.48375	-0.9041	10	0.52906	T	0.07	-10.144	16.2727	0.82629	0.0:0.1328:0.8672:0.0	.	1114;1138	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	H	1138;1114;1081	ENSP00000273666:R1138H;ENSP00000420019:R1114H;ENSP00000420167:R1081H	ENSP00000273666:R1138H	R	+	2	0	STXBP5L	122619988	1.000000	0.71417	0.037000	0.18230	0.985000	0.73830	9.807000	0.99171	1.318000	0.45170	0.655000	0.94253	CGT	STXBP5L	-	pfscan_Synaptobrevin	ENSG00000145087		0.532	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	38	0	G			121137298	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.658	A
STXBP5L	9515	genome.wustl.edu	37	3	121137298	121137298	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:121137298G>A	ENST00000273666.6	+	27	3684	c.3413G>A	c.(3412-3414)cGt>cAt	p.R1138H	STXBP5L_ENST00000471454.1_Missense_Mutation_p.R1114H	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1138	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		GAGCTGACCCGTGCACGGATT	0.532																																																	0													62.0	69.0	66.0					3																	121137298		2051	4195	6246	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3413G>A	3.37:g.121137298G>A	ENSP00000273666:p.Arg1138His		Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.R1138H	ENST00000273666.6	37	c.3413	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635322	0.67130	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.27256	1.68;1.68;1.75	5.59	4.7	0.59300	Synaptobrevin (1);	0.216802	0.39615	N	0.001315	T	0.38401	0.1039	M	0.82056	2.57	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.45506	0.483;0.483	T	0.48375	-0.9041	10	0.52906	T	0.07	-10.144	16.2727	0.82629	0.0:0.1328:0.8672:0.0	.	1114;1138	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	H	1138;1114;1081	ENSP00000273666:R1138H;ENSP00000420019:R1114H;ENSP00000420167:R1081H	ENSP00000273666:R1138H	R	+	2	0	STXBP5L	122619988	1.000000	0.71417	0.037000	0.18230	0.985000	0.73830	9.807000	0.99171	1.318000	0.45170	0.655000	0.94253	CGT	STXBP5L	-	pfscan_Synaptobrevin	ENSG00000145087		0.532	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	-	0.00	44	0	G			121137298	+1	tier1	-	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	37.50	15	9	SNP	0.658	A
SULT4A1	25830	genome.wustl.edu	37	22	44258218	44258218	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:44258218G>A	ENST00000330884.4	-	1	165	c.45C>T	c.(43-45)ttC>ttT	p.F15F	SULT4A1_ENST00000249130.5_Silent_p.F15F|SULT4A1_ENST00000540422.1_Silent_p.F15F	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	15					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		ACTTGCTCTCGAACTCCCCCG	0.736																																																	0													43.0	49.0	47.0					22																	44258218		2203	4298	6501	SO:0001819	synonymous_variant	0			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.45C>T	22.37:g.44258218G>A			B2R7N3|O43728	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.F15	ENST00000330884.4	37	c.45	CCDS14051.1	22																																																																																			SULT4A1	-	superfamily_P-loop_NTPase	ENSG00000130540		0.736	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT4A1	HGNC	protein_coding	OTTHUMT00000280660.2	-	0.00	27	0	G	NM_014351		44258218	-1	tier1	-	no_errors	ENST00000330884	ensembl	human	known	74_37	silent	31.03	20	9	SNP	0.996	A
SULT4A1	25830	genome.wustl.edu	37	22	44258218	44258218	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:44258218G>A	ENST00000330884.4	-	1	165	c.45C>T	c.(43-45)ttC>ttT	p.F15F	SULT4A1_ENST00000249130.5_Silent_p.F15F|SULT4A1_ENST00000540422.1_Silent_p.F15F	NM_014351.3	NP_055166.1	Q9BR01	ST4A1_HUMAN	sulfotransferase family 4A, member 1	15					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)	9		Ovarian(80;0.024)|all_neural(38;0.0416)		Colorectal(1;0.00242)|READ - Rectum adenocarcinoma(1;0.0419)		ACTTGCTCTCGAACTCCCCCG	0.736																																																	0													43.0	49.0	47.0					22																	44258218		2203	4298	6501	SO:0001819	synonymous_variant	0			AF188698	CCDS14051.1	22q13.2	2012-11-05			ENSG00000130540	ENSG00000130540		"""Sulfotransferases, cytosolic"""	14903	protein-coding gene	gene with protein product		608359				10698717	Standard	NM_014351		Approved	SULTX3, hBR-STL-1	uc003bee.1	Q9BR01	OTTHUMG00000141314	ENST00000330884.4:c.45C>T	22.37:g.44258218G>A			B2R7N3|O43728	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.F15	ENST00000330884.4	37	c.45	CCDS14051.1	22																																																																																			SULT4A1	-	superfamily_P-loop_NTPase	ENSG00000130540		0.736	SULT4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT4A1	HGNC	protein_coding	OTTHUMT00000280660.2	-	0.00	58	0	G	NM_014351		44258218	-1	tier1	-	no_errors	ENST00000330884	ensembl	human	known	74_37	silent	31.03	20	9	SNP	0.996	A
SUPT3H	8464	genome.wustl.edu	37	6	44900481	44900481	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:44900481A>C	ENST00000371459.1	-	10	986	c.821T>G	c.(820-822)gTt>gGt	p.V274G	SUPT3H_ENST00000371461.2_Missense_Mutation_p.V285G|SUPT3H_ENST00000306867.5_Missense_Mutation_p.V274G|SUPT3H_ENST00000371460.1_Missense_Mutation_p.V285G|SUPT3H_ENST00000371458.1_Missense_Mutation_p.V57G	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	356					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						GTGAGCCTCAACACCACAGGC	0.458																																																	0													76.0	59.0	65.0					6																	44900481		2203	4300	6503	SO:0001583	missense	0			AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.821T>G	6.37:g.44900481A>C	ENSP00000360514:p.Val274Gly		A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	pfam_TFIID-18,superfamily_Histone-fold	p.V285G	ENST00000371459.1	37	c.854	CCDS34465.1	6	.	.	.	.	.	.	.	.	.	.	A	9.205	1.029402	0.19512	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000371458;ENST00000306867;ENST00000371461	T;T;T;T;T	0.49720	0.84;0.87;0.77;0.87;0.84	5.43	5.43	0.79202	.	0.307048	0.33691	N	0.004641	T	0.18923	0.0454	L	0.43152	1.355	0.48185	D	0.999605	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.0	T	0.12993	-1.0526	10	0.19147	T	0.46	.	6.7539	0.23501	0.7695:0.1542:0.0764:0.0	.	285;356	O75486-3;O75486	.;SUPT3_HUMAN	G	285;274;57;274;285	ENSP00000360515:V285G;ENSP00000360514:V274G;ENSP00000360513:V57G;ENSP00000306718:V274G;ENSP00000360516:V285G	ENSP00000306718:V274G	V	-	2	0	SUPT3H	45008459	0.985000	0.35326	1.000000	0.80357	0.999000	0.98932	1.845000	0.39279	2.061000	0.61500	0.533000	0.62120	GTT	SUPT3H	-	NULL	ENSG00000196284		0.458	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT3H	HGNC	protein_coding	OTTHUMT00000106911.2	-	0.00	17	0	A	NM_181356		44900481	-1	tier1	-	no_errors	ENST00000371460	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.982	C
SUPT3H	8464	genome.wustl.edu	37	6	44900481	44900481	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:44900481A>C	ENST00000371459.1	-	10	986	c.821T>G	c.(820-822)gTt>gGt	p.V274G	SUPT3H_ENST00000371461.2_Missense_Mutation_p.V285G|SUPT3H_ENST00000306867.5_Missense_Mutation_p.V274G|SUPT3H_ENST00000371460.1_Missense_Mutation_p.V285G|SUPT3H_ENST00000371458.1_Missense_Mutation_p.V57G	NM_001261823.1|NM_003599.3	NP_001248752.1|NP_003590.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	356					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						GTGAGCCTCAACACCACAGGC	0.458																																																	0													76.0	59.0	65.0					6																	44900481		2203	4300	6503	SO:0001583	missense	0			AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371459.1:c.821T>G	6.37:g.44900481A>C	ENSP00000360514:p.Val274Gly		A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	pfam_TFIID-18,superfamily_Histone-fold	p.V285G	ENST00000371459.1	37	c.854	CCDS34465.1	6	.	.	.	.	.	.	.	.	.	.	A	9.205	1.029402	0.19512	.	.	ENSG00000196284	ENST00000371460;ENST00000371459;ENST00000371458;ENST00000306867;ENST00000371461	T;T;T;T;T	0.49720	0.84;0.87;0.77;0.87;0.84	5.43	5.43	0.79202	.	0.307048	0.33691	N	0.004641	T	0.18923	0.0454	L	0.43152	1.355	0.48185	D	0.999605	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.0	T	0.12993	-1.0526	10	0.19147	T	0.46	.	6.7539	0.23501	0.7695:0.1542:0.0764:0.0	.	285;356	O75486-3;O75486	.;SUPT3_HUMAN	G	285;274;57;274;285	ENSP00000360515:V285G;ENSP00000360514:V274G;ENSP00000360513:V57G;ENSP00000306718:V274G;ENSP00000360516:V285G	ENSP00000306718:V274G	V	-	2	0	SUPT3H	45008459	0.985000	0.35326	1.000000	0.80357	0.999000	0.98932	1.845000	0.39279	2.061000	0.61500	0.533000	0.62120	GTT	SUPT3H	-	NULL	ENSG00000196284		0.458	SUPT3H-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT3H	HGNC	protein_coding	OTTHUMT00000106911.2	-	0.00	21	0	A	NM_181356		44900481	-1	tier1	-	no_errors	ENST00000371460	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.982	C
SYBU	55638	genome.wustl.edu	37	8	110654996	110654996	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:110654996G>A	ENST00000422135.1	-	3	705	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C	SYBU_ENST00000532779.1_Intron|SYBU_ENST00000408908.2_Missense_Mutation_p.R64C|SYBU_ENST00000399066.3_Missense_Mutation_p.R61C|SYBU_ENST00000528331.1_Intron|SYBU_ENST00000446070.2_Missense_Mutation_p.R63C|SYBU_ENST00000408889.3_Intron|SYBU_ENST00000276646.9_Missense_Mutation_p.R64C|SYBU_ENST00000533065.1_Intron|SYBU_ENST00000419099.1_Missense_Mutation_p.R63C|SYBU_ENST00000533171.1_Missense_Mutation_p.R64C|SYBU_ENST00000440310.1_Missense_Mutation_p.R64C|RP11-422N16.3_ENST00000499579.1_5'Flank|SYBU_ENST00000424158.2_Missense_Mutation_p.R69C|SYBU_ENST00000533895.1_Missense_Mutation_p.R63C|SYBU_ENST00000433638.1_Missense_Mutation_p.R64C|SYBU_ENST00000528647.1_Missense_Mutation_p.R63C	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	64	Ser-rich.|Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CTCGCTGAGCGCCCAGAGCTG	0.587																																																	0													65.0	69.0	68.0					8																	110654996		1983	4153	6136	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.190C>T	8.37:g.110654996G>A	ENSP00000407118:p.Arg64Cys		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.R64C	ENST00000422135.1	37	c.190	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858915	0.91433	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000399066;ENST00000446070;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000533171;ENST00000529190;ENST00000533821;ENST00000534501;ENST00000524720;ENST00000534184;ENST00000528716;ENST00000526302;ENST00000534578;ENST00000527600	.	.	.	6.17	6.17	0.99709	.	0.199906	0.53938	D	0.000053	T	0.76849	0.4045	M	0.67953	2.075	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.62014	0.897;0.897;0.897	T	0.76631	-0.2888	9	0.62326	D	0.03	-16.9241	18.3732	0.90420	0.0:0.0:1.0:0.0	.	63;64;61	Q9NX95-3;Q9NX95;Q9NX95-4	.;SYBU_HUMAN;.	C	63;69;61;63;64;63;64;63;64;64;64;64;63;63;64;64;63;64;64;64;64	.	ENSP00000276646:R64C	R	-	1	0	SYBU	110724172	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.012000	0.57131	2.941000	0.99782	0.655000	0.94253	CGC	SYBU	-	NULL	ENSG00000147642		0.587	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	-	0.00	35	0	G	NM_017786		110654996	-1	tier1	-	no_errors	ENST00000276646	ensembl	human	known	74_37	missense	33.82	45	23	SNP	1.000	A
SYBU	55638	genome.wustl.edu	37	8	110654996	110654996	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:110654996G>A	ENST00000422135.1	-	3	705	c.190C>T	c.(190-192)Cgc>Tgc	p.R64C	SYBU_ENST00000532779.1_Intron|SYBU_ENST00000408908.2_Missense_Mutation_p.R64C|SYBU_ENST00000399066.3_Missense_Mutation_p.R61C|SYBU_ENST00000528331.1_Intron|SYBU_ENST00000446070.2_Missense_Mutation_p.R63C|SYBU_ENST00000408889.3_Intron|SYBU_ENST00000276646.9_Missense_Mutation_p.R64C|SYBU_ENST00000533065.1_Intron|SYBU_ENST00000419099.1_Missense_Mutation_p.R63C|SYBU_ENST00000533171.1_Missense_Mutation_p.R64C|SYBU_ENST00000440310.1_Missense_Mutation_p.R64C|RP11-422N16.3_ENST00000499579.1_5'Flank|SYBU_ENST00000424158.2_Missense_Mutation_p.R69C|SYBU_ENST00000533895.1_Missense_Mutation_p.R63C|SYBU_ENST00000433638.1_Missense_Mutation_p.R64C|SYBU_ENST00000528647.1_Missense_Mutation_p.R63C	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)	64	Ser-rich.|Sufficient for interaction with KIF5B.				regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CTCGCTGAGCGCCCAGAGCTG	0.587																																																	0													65.0	69.0	68.0					8																	110654996		1983	4153	6136	SO:0001583	missense	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.190C>T	8.37:g.110654996G>A	ENSP00000407118:p.Arg64Cys		A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.R64C	ENST00000422135.1	37	c.190	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858915	0.91433	.	.	ENSG00000147642	ENST00000533895;ENST00000424158;ENST00000399066;ENST00000446070;ENST00000276646;ENST00000528647;ENST00000422135;ENST00000419099;ENST00000433638;ENST00000408908;ENST00000440310;ENST00000533171;ENST00000529190;ENST00000533821;ENST00000534501;ENST00000524720;ENST00000534184;ENST00000528716;ENST00000526302;ENST00000534578;ENST00000527600	.	.	.	6.17	6.17	0.99709	.	0.199906	0.53938	D	0.000053	T	0.76849	0.4045	M	0.67953	2.075	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;P;P	0.62014	0.897;0.897;0.897	T	0.76631	-0.2888	9	0.62326	D	0.03	-16.9241	18.3732	0.90420	0.0:0.0:1.0:0.0	.	63;64;61	Q9NX95-3;Q9NX95;Q9NX95-4	.;SYBU_HUMAN;.	C	63;69;61;63;64;63;64;63;64;64;64;64;63;63;64;64;63;64;64;64;64	.	ENSP00000276646:R64C	R	-	1	0	SYBU	110724172	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.012000	0.57131	2.941000	0.99782	0.655000	0.94253	CGC	SYBU	-	NULL	ENSG00000147642		0.587	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	-	0.00	49	0	G	NM_017786		110654996	-1	tier1	-	no_errors	ENST00000276646	ensembl	human	known	74_37	missense	33.82	45	23	SNP	1.000	A
SYT5	6861	genome.wustl.edu	37	19	55686640	55686640	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:55686640C>T	ENST00000354308.3	-	6	977	c.608G>A	c.(607-609)cGc>cAc	p.R203H	SYT5_ENST00000537500.1_Missense_Mutation_p.R203H|SYT5_ENST00000590851.1_Missense_Mutation_p.R200H|SYT5_ENST00000592935.1_5'Flank|CTD-2587H24.5_ENST00000591665.1_RNA	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	203	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGCGTCATTGCGAGAGAAGCG	0.677																																																	0													44.0	38.0	40.0					19																	55686640		2203	4300	6503	SO:0001583	missense	0			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.608G>A	19.37:g.55686640C>T	ENSP00000346265:p.Arg203His		B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.R203H	ENST00000354308.3	37	c.608	CCDS12919.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.486838	0.96323	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.09163	3.01;3.01	4.34	3.31	0.37934	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.057257	0.64402	D	0.000004	T	0.20618	0.0496	L	0.53780	1.695	0.47065	D	0.999302	D;D;D	0.89917	1.0;0.995;1.0	D;P;D	0.67231	0.95;0.516;0.95	T	0.00647	-1.1628	10	0.87932	D	0	.	4.7977	0.13281	0.0:0.7094:0.0:0.2906	.	200;203;203	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	H	203;203;200	ENSP00000442896:R203H;ENSP00000346265:R203H	ENSP00000346265:R203H	R	-	2	0	SYT5	60378452	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.119000	0.71590	2.362000	0.80069	0.555000	0.69702	CGC	SYT5	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	ENSG00000129990		0.677	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT5	HGNC	protein_coding	OTTHUMT00000452501.1	-	0.00	28	0	C	NM_003180		55686640	-1	tier1	-	no_errors	ENST00000354308	ensembl	human	known	74_37	missense	35.29	11	6	SNP	1.000	T
SYT5	6861	genome.wustl.edu	37	19	55686640	55686640	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:55686640C>T	ENST00000354308.3	-	6	977	c.608G>A	c.(607-609)cGc>cAc	p.R203H	SYT5_ENST00000537500.1_Missense_Mutation_p.R203H|SYT5_ENST00000590851.1_Missense_Mutation_p.R200H|SYT5_ENST00000592935.1_5'Flank|CTD-2587H24.5_ENST00000591665.1_RNA	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	203	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGCGTCATTGCGAGAGAAGCG	0.677																																																	0													44.0	38.0	40.0					19																	55686640		2203	4300	6503	SO:0001583	missense	0			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.608G>A	19.37:g.55686640C>T	ENSP00000346265:p.Arg203His		B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.R203H	ENST00000354308.3	37	c.608	CCDS12919.1	19	.	.	.	.	.	.	.	.	.	.	C	35	5.486838	0.96323	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.09163	3.01;3.01	4.34	3.31	0.37934	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.057257	0.64402	D	0.000004	T	0.20618	0.0496	L	0.53780	1.695	0.47065	D	0.999302	D;D;D	0.89917	1.0;0.995;1.0	D;P;D	0.67231	0.95;0.516;0.95	T	0.00647	-1.1628	10	0.87932	D	0	.	4.7977	0.13281	0.0:0.7094:0.0:0.2906	.	200;203;203	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	H	203;203;200	ENSP00000442896:R203H;ENSP00000346265:R203H	ENSP00000346265:R203H	R	-	2	0	SYT5	60378452	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.119000	0.71590	2.362000	0.80069	0.555000	0.69702	CGC	SYT5	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	ENSG00000129990		0.677	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT5	HGNC	protein_coding	OTTHUMT00000452501.1	-	0.00	37	0	C	NM_003180		55686640	-1	tier1	-	no_errors	ENST00000354308	ensembl	human	known	74_37	missense	35.29	11	6	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32632004	32632004	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:32632004C>A	ENST00000242310.4	-	1	3663	c.3574G>T	c.(3574-3576)Gat>Tat	p.D1192Y	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1192					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CCCTCTTCATCTCGAAATGTG	0.443																																																	0													208.0	170.0	183.0					9																	32632004		2203	4300	6503	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3574G>T	9.37:g.32632004C>A	ENSP00000418379:p.Asp1192Tyr		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D1192Y	ENST00000242310.4	37	c.3574	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647768	0.47258	.	.	ENSG00000122728	ENST00000242310	T	0.19105	2.17	0.479	0.479	0.16796	.	0.093766	0.64402	D	0.000001	T	0.24044	0.0582	M	0.71871	2.18	0.53688	D	0.99997	P	0.47545	0.897	P	0.45753	0.492	T	0.04191	-1.0970	10	0.56958	D	0.05	.	6.6915	0.23174	0.0:0.9998:0.0:2.0E-4	.	1192	Q8IZX4	TAF1L_HUMAN	Y	1192	ENSP00000418379:D1192Y	ENSP00000418379:D1192Y	D	-	1	0	TAF1L	32622004	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	4.928000	0.63447	0.507000	0.28148	0.195000	0.17529	GAT	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2		0.00	72	0	C			32632004	-1			no_errors	ENST00000242310	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	A
TESK1	7016	genome.wustl.edu	37	9	35607308	35607309	+	Intron	DEL	TG	TG	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr9:35607308_35607309delTG	ENST00000336395.5	+	5	787				CD72_ENST00000490239.1_5'Flank|TESK1_ENST00000498522.1_Intron|MIR4667_ENST00000578933.1_RNA	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1						cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGGGATACTATGTGTGTGTGTG	0.545																																																	0																																										SO:0001627	intron_variant	0			D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.538-15TG>-	9.37:g.35607318_35607319delTG			Q8IXZ8	RNA	DEL	-	NULL	ENST00000336395.5	37	NULL	CCDS6580.1	9																																																																																			TESK1	-	-	ENSG00000107140		0.545	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	HGNC	protein_coding	OTTHUMT00000052314.1		0.00	42	0	TG	NM_006285		35607309	+1	tier1		no_errors	ENST00000463897	ensembl	human	known	74_37	rna	11.54	23	3	DEL	0.001:0.001	-
TEX15	56154	genome.wustl.edu	37	8	30704421	30704421	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:30704421C>T	ENST00000256246.2	-	1	2187	c.2113G>A	c.(2113-2115)Gaa>Aaa	p.E705K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	705					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E705K(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCACAAATTCTTCACAAAGC	0.373																																																	1	Substitution - Missense(1)	cervix(1)											93.0	84.0	87.0					8																	30704421		2203	4299	6502	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.2113G>A	8.37:g.30704421C>T	ENSP00000256246:p.Glu705Lys			Missense_Mutation	SNP	NULL	p.E705K	ENST00000256246.2	37	c.2113	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458393	0.84317	.	.	ENSG00000133863	ENST00000256246	T	0.23552	1.9	5.78	5.78	0.91487	.	0.303416	0.28176	N	0.016315	T	0.40297	0.1111	L	0.36672	1.1	0.29900	N	0.824446	D	0.71674	0.998	D	0.65233	0.933	T	0.29088	-1.0023	10	0.87932	D	0	.	15.5121	0.75793	0.0:1.0:0.0:0.0	.	705	Q9BXT5	TEX15_HUMAN	K	705	ENSP00000256246:E705K	ENSP00000256246:E705K	E	-	1	0	TEX15	30823963	0.926000	0.31397	0.329000	0.25429	0.002000	0.02628	2.902000	0.48703	2.731000	0.93534	0.655000	0.94253	GAA	TEX15	-	NULL	ENSG00000133863		0.373	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	-	0.00	54	0	C			30704421	-1	tier1	-	no_errors	ENST00000256246	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.557	T
TEX15	56154	genome.wustl.edu	37	8	30704421	30704421	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:30704421C>T	ENST00000256246.2	-	1	2187	c.2113G>A	c.(2113-2115)Gaa>Aaa	p.E705K	TEX15_ENST00000523186.1_5'Flank	NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	705					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)			p.E705K(1)		NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCACAAATTCTTCACAAAGC	0.373																																																	1	Substitution - Missense(1)	cervix(1)											93.0	84.0	87.0					8																	30704421		2203	4299	6502	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.2113G>A	8.37:g.30704421C>T	ENSP00000256246:p.Glu705Lys			Missense_Mutation	SNP	NULL	p.E705K	ENST00000256246.2	37	c.2113	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458393	0.84317	.	.	ENSG00000133863	ENST00000256246	T	0.23552	1.9	5.78	5.78	0.91487	.	0.303416	0.28176	N	0.016315	T	0.40297	0.1111	L	0.36672	1.1	0.29900	N	0.824446	D	0.71674	0.998	D	0.65233	0.933	T	0.29088	-1.0023	10	0.87932	D	0	.	15.5121	0.75793	0.0:1.0:0.0:0.0	.	705	Q9BXT5	TEX15_HUMAN	K	705	ENSP00000256246:E705K	ENSP00000256246:E705K	E	-	1	0	TEX15	30823963	0.926000	0.31397	0.329000	0.25429	0.002000	0.02628	2.902000	0.48703	2.731000	0.93534	0.655000	0.94253	GAA	TEX15	-	NULL	ENSG00000133863		0.373	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	-	0.00	58	0	C			30704421	-1	tier1	-	no_errors	ENST00000256246	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.557	T
TGFBR2	7048	genome.wustl.edu	37	3	30691871	30691872	+	Frame_Shift_Ins	INS	-	-	A	rs79375991		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:30691871_30691872insA	ENST00000295754.5	+	3	755_756	c.373_374insA	c.(373-375)gaafs	p.E125fs	TGFBR2_ENST00000359013.4_Frame_Shift_Ins_p.E150fs	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	125					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.?(1)|p.P129fs*3(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CATTATGAAGGAAAAAAAAAAG	0.421																																																	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)																																								SO:0001589	frameshift_variant	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.383dupA	3.37:g.30691881_30691881dupA	ENSP00000295754:p.Glu125fs		B4DTV5|Q15580|Q6DKT6|Q99474	Frame_Shift_Ins	INS	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.K154fs	ENST00000295754.5	37	c.448_449	CCDS2648.1	3																																																																																			TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,prints_TGFB_receptor	ENSG00000163513		0.421	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2		0.00	46	0	-			30691872	+1	tier1		no_errors	ENST00000359013	ensembl	human	known	74_37	frame_shift_ins	11.76	30	4	INS	1.000:1.000	A
TGFBR2	7048	genome.wustl.edu	37	3	30691871	30691872	+	Frame_Shift_Ins	INS	-	-	A	rs79375991		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:30691871_30691872insA	ENST00000295754.5	+	3	755_756	c.373_374insA	c.(373-375)gaafs	p.E125fs	TGFBR2_ENST00000359013.4_Frame_Shift_Ins_p.E150fs	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	125					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.?(1)|p.P129fs*3(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						CATTATGAAGGAAAAAAAAAAG	0.421																																																	2	Unknown(1)|Insertion - Frameshift(1)	large_intestine(1)|skin(1)																																								SO:0001589	frameshift_variant	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.383dupA	3.37:g.30691881_30691881dupA	ENSP00000295754:p.Glu125fs		B4DTV5|Q15580|Q6DKT6|Q99474	Frame_Shift_Ins	INS	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.K154fs	ENST00000295754.5	37	c.448_449	CCDS2648.1	3																																																																																			TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,prints_TGFB_receptor	ENSG00000163513		0.421	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2		0.00	62	0	-			30691872	+1	tier1		no_errors	ENST00000359013	ensembl	human	known	74_37	frame_shift_ins	11.76	30	4	INS	1.000:1.000	A
TIAM1	7074	genome.wustl.edu	37	21	32624335	32624335	+	Silent	SNP	C	C	T	rs374340137		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:32624335C>T	ENST00000286827.3	-	6	1605	c.1134G>A	c.(1132-1134)gcG>gcA	p.A378A	TIAM1_ENST00000541036.1_Silent_p.A378A|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	378					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCTGACGAGCCGCATCCCCGG	0.662																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	59.0	67.0	64.0		1134	-9.7	0.1	21		64	0,8598		0,0,4299	no	coding-synonymous	TIAM1	NM_003253.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		378/1592	32624335	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1134G>A	21.37:g.32624335C>T			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.A378	ENST00000286827.3	37	c.1134	CCDS13609.1	21																																																																																			TIAM1	-	NULL	ENSG00000156299		0.662	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	82	0	C	NM_003253		32624335	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	silent	39.29	34	22	SNP	0.000	T
TIAM1	7074	genome.wustl.edu	37	21	32624335	32624335	+	Silent	SNP	C	C	T	rs374340137		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:32624335C>T	ENST00000286827.3	-	6	1605	c.1134G>A	c.(1132-1134)gcG>gcA	p.A378A	TIAM1_ENST00000541036.1_Silent_p.A378A|TIAM1_ENST00000469412.1_5'UTR	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	378					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCTGACGAGCCGCATCCCCGG	0.662																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	59.0	67.0	64.0		1134	-9.7	0.1	21		64	0,8598		0,0,4299	no	coding-synonymous	TIAM1	NM_003253.2		0,1,6501	TT,TC,CC		0.0,0.0227,0.0077		378/1592	32624335	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1134G>A	21.37:g.32624335C>T			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.A378	ENST00000286827.3	37	c.1134	CCDS13609.1	21																																																																																			TIAM1	-	NULL	ENSG00000156299		0.662	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	86	0	C	NM_003253		32624335	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	silent	39.29	34	22	SNP	0.000	T
TINCR	257000	genome.wustl.edu	37	19	5561229	5561229	+	lincRNA	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:5561229G>T	ENST00000448587.1	-	0	681					NR_027064.1				tissue differentiation-inducing non-protein coding RNA																		CCCAAGAGGGGAGCAACAACC	0.577																																																	0													65.0	63.0	63.0					19																	5561229		692	1591	2283			0			BG354568		19p13.3	2013-09-11	2012-12-05	2012-12-05	ENSG00000223573	ENSG00000223573		"""Long non-coding RNAs"", ""-"""	14607	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 36"", ""long intergenic non-protein coding RNA 36"", ""terminal differentiation-induced ncRNA"""	615241	"""placenta-specific 2"", ""placenta-specific 2 (non-protein coding)"""	PLAC2		23201690, 24019000	Standard	NR_027064		Approved	FLJ90734, NCRNA00036, LINC00036	uc002mcc.5		OTTHUMG00000150390		19.37:g.5561229G>T				RNA	SNP	-	NULL	ENST00000448587.1	37	NULL		19																																																																																			TINCR	-	-	ENSG00000223573		0.577	TINCR-001	KNOWN	basic	lincRNA	TINCR	HGNC	lincRNA	OTTHUMT00000317918.1	-	0.00	50	0	G	NR_027064		5561229	-1	tier1	-	no_errors	ENST00000448587	ensembl	human	known	74_37	rna	40.00	18	12	SNP	0.001	T
TLK2	11011	genome.wustl.edu	37	17	60599574	60599574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:60599574delA	ENST00000326270.9	+	4	431	c.163delA	c.(163-165)aaafs	p.K56fs	TLK2_ENST00000582809.1_5'UTR|TLK2_ENST00000343388.7_Frame_Shift_Del_p.K56fs|TLK2_ENST00000542523.1_Frame_Shift_Del_p.K56fs|TLK2_ENST00000346027.5_Frame_Shift_Del_p.K56fs	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	56					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GACTCCCGAGAAAAAGCAGAA	0.323																																																	0													56.0	53.0	54.0					17																	60599574		2203	4300	6503	SO:0001589	frameshift_variant	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.163delA	17.37:g.60599574delA	ENSP00000316512:p.Lys56fs		D3DU07|Q9UKI7|Q9Y4F7	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K56fs	ENST00000326270.9	37	c.163		17																																																																																			TLK2	-	NULL	ENSG00000146872		0.323	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1		0.00	21	0	A	NM_006852		60599574	+1	tier1		no_errors	ENST00000326270	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
TLK2	11011	genome.wustl.edu	37	17	60599574	60599574	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:60599574delA	ENST00000326270.9	+	4	431	c.163delA	c.(163-165)aaafs	p.K56fs	TLK2_ENST00000582809.1_5'UTR|TLK2_ENST00000343388.7_Frame_Shift_Del_p.K56fs|TLK2_ENST00000542523.1_Frame_Shift_Del_p.K56fs|TLK2_ENST00000346027.5_Frame_Shift_Del_p.K56fs	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	56					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GACTCCCGAGAAAAAGCAGAA	0.323																																																	0													56.0	53.0	54.0					17																	60599574		2203	4300	6503	SO:0001589	frameshift_variant	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.163delA	17.37:g.60599574delA	ENSP00000316512:p.Lys56fs		D3DU07|Q9UKI7|Q9Y4F7	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K56fs	ENST00000326270.9	37	c.163		17																																																																																			TLK2	-	NULL	ENSG00000146872		0.323	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1		0.00	26	0	A	NM_006852		60599574	+1	tier1		no_errors	ENST00000326270	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	1.000	-
TLR2	7097	genome.wustl.edu	37	4	154626073	154626073	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:154626073T>G	ENST00000260010.6	+	1	3422	c.2014T>G	c.(2014-2016)Ttg>Gtg	p.L672V		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	672	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CCCCTTCAAGTTGTGTCTTCA	0.453																																																	0													69.0	69.0	69.0					4																	154626073		2203	4300	6503	SO:0001583	missense	0			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2014T>G	4.37:g.154626073T>G	ENSP00000260010:p.Leu672Val		B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L672V	ENST00000260010.6	37	c.2014	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	T	11.68	1.710191	0.30322	.	.	ENSG00000137462	ENST00000260010	T	0.10668	2.85	5.5	-7.28	0.01456	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.163302	0.40818	N	0.001001	T	0.28632	0.0709	M	0.67569	2.06	0.29457	N	0.858054	D	0.61697	0.99	D	0.71414	0.973	T	0.46843	-0.9162	10	0.87932	D	0	.	24.1348	0.99988	0.0:0.8396:0.0:0.1604	.	672	O60603	TLR2_HUMAN	V	672	ENSP00000260010:L672V	ENSP00000260010:L672V	L	+	1	2	TLR2	154845523	0.000000	0.05858	0.014000	0.15608	0.969000	0.65631	-0.748000	0.04818	-1.576000	0.01652	-0.256000	0.11100	TTG	TLR2	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000137462		0.453	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1	-	0.00	109	0	T			154626073	+1	tier1	-	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	22.22	70	20	SNP	0.004	G
TLR2	7097	genome.wustl.edu	37	4	154626073	154626073	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:154626073T>G	ENST00000260010.6	+	1	3422	c.2014T>G	c.(2014-2016)Ttg>Gtg	p.L672V		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	672	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CCCCTTCAAGTTGTGTCTTCA	0.453																																																	0													69.0	69.0	69.0					4																	154626073		2203	4300	6503	SO:0001583	missense	0			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2014T>G	4.37:g.154626073T>G	ENSP00000260010:p.Leu672Val		B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L672V	ENST00000260010.6	37	c.2014	CCDS3784.1	4	.	.	.	.	.	.	.	.	.	.	T	11.68	1.710191	0.30322	.	.	ENSG00000137462	ENST00000260010	T	0.10668	2.85	5.5	-7.28	0.01456	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.163302	0.40818	N	0.001001	T	0.28632	0.0709	M	0.67569	2.06	0.29457	N	0.858054	D	0.61697	0.99	D	0.71414	0.973	T	0.46843	-0.9162	10	0.87932	D	0	.	24.1348	0.99988	0.0:0.8396:0.0:0.1604	.	672	O60603	TLR2_HUMAN	V	672	ENSP00000260010:L672V	ENSP00000260010:L672V	L	+	1	2	TLR2	154845523	0.000000	0.05858	0.014000	0.15608	0.969000	0.65631	-0.748000	0.04818	-1.576000	0.01652	-0.256000	0.11100	TTG	TLR2	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000137462		0.453	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1	-	0.00	129	0	T			154626073	+1	tier1	-	no_errors	ENST00000260010	ensembl	human	known	74_37	missense	22.22	70	20	SNP	0.004	G
TM6SF2	53345	genome.wustl.edu	37	19	19375653	19375653	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:19375653C>A	ENST00000389363.4	-	10	1026	c.954G>T	c.(952-954)atG>atT	p.M318I	AC138430.4_ENST00000586064.2_RNA|HAPLN4_ENST00000291481.7_5'Flank	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	318						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			TGCGCAGGTGCATGGAAGCCC	0.612																																																	0													68.0	76.0	73.0					19																	19375653		2147	4240	6387	SO:0001583	missense	0			AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.954G>T	19.37:g.19375653C>A	ENSP00000374014:p.Met318Ile		Q0IJ64	Missense_Mutation	SNP	pfam_Transmembrane_6/97	p.M318I	ENST00000389363.4	37	c.954	CCDS42528.1	19	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519069	0.44866	.	.	ENSG00000213996	ENST00000389363;ENST00000269990	T	0.21191	2.02	4.95	0.918	0.19386	.	0.162448	0.26677	U	0.023068	T	0.15219	0.0367	L	0.51422	1.61	0.32425	N	0.548812	B	0.16802	0.019	B	0.15870	0.014	T	0.08597	-1.0714	10	0.66056	D	0.02	-3.4479	2.5175	0.04672	0.1436:0.5324:0.1405:0.1834	.	318	Q9BZW4	TM6S2_HUMAN	I	318	ENSP00000374014:M318I	ENSP00000269990:M318I	M	-	3	0	TM6SF2	19236653	0.805000	0.28982	0.982000	0.44146	0.976000	0.68499	-0.023000	0.12456	0.473000	0.27368	0.561000	0.74099	ATG	TM6SF2	-	pfam_Transmembrane_6/97	ENSG00000213996		0.612	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM6SF2	HGNC	protein_coding	OTTHUMT00000460122.2	-	0.00	20	0	C	NM_203510		19375653	-1	tier1	-	no_errors	ENST00000389363	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.951	A
TM6SF2	53345	genome.wustl.edu	37	19	19375653	19375653	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:19375653C>A	ENST00000389363.4	-	10	1026	c.954G>T	c.(952-954)atG>atT	p.M318I	AC138430.4_ENST00000586064.2_RNA|HAPLN4_ENST00000291481.7_5'Flank	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	318						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			TGCGCAGGTGCATGGAAGCCC	0.612																																																	0													68.0	76.0	73.0					19																	19375653		2147	4240	6387	SO:0001583	missense	0			AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.954G>T	19.37:g.19375653C>A	ENSP00000374014:p.Met318Ile		Q0IJ64	Missense_Mutation	SNP	pfam_Transmembrane_6/97	p.M318I	ENST00000389363.4	37	c.954	CCDS42528.1	19	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519069	0.44866	.	.	ENSG00000213996	ENST00000389363;ENST00000269990	T	0.21191	2.02	4.95	0.918	0.19386	.	0.162448	0.26677	U	0.023068	T	0.15219	0.0367	L	0.51422	1.61	0.32425	N	0.548812	B	0.16802	0.019	B	0.15870	0.014	T	0.08597	-1.0714	10	0.66056	D	0.02	-3.4479	2.5175	0.04672	0.1436:0.5324:0.1405:0.1834	.	318	Q9BZW4	TM6S2_HUMAN	I	318	ENSP00000374014:M318I	ENSP00000269990:M318I	M	-	3	0	TM6SF2	19236653	0.805000	0.28982	0.982000	0.44146	0.976000	0.68499	-0.023000	0.12456	0.473000	0.27368	0.561000	0.74099	ATG	TM6SF2	-	pfam_Transmembrane_6/97	ENSG00000213996		0.612	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM6SF2	HGNC	protein_coding	OTTHUMT00000460122.2	-	0.00	23	0	C	NM_203510		19375653	-1	tier1	-	no_errors	ENST00000389363	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.951	A
TNR	7143	genome.wustl.edu	37	1	175299237	175299237	+	Missense_Mutation	SNP	G	G	A	rs144730675		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:175299237G>A	ENST00000367674.2	-	21	4474	c.3766C>T	c.(3766-3768)Cgc>Tgc	p.R1256C	TNR_ENST00000263525.2_Missense_Mutation_p.R1256C|RP3-518E13.2_ENST00000569593.1_RNA			Q92752	TENR_HUMAN	tenascin R	1256	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CTTCCTATGCGGAGTTTGTAC	0.597																																																	0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	77.0	83.0		3766	4.7	1.0	1	dbSNP_134	83	0,8600		0,0,4300	no	missense	TNR	NM_003285.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1256/1359	175299237	1,13005	2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3766C>T	1.37:g.175299237G>A	ENSP00000356646:p.Arg1256Cys		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.R1256C	ENST00000367674.2	37	c.3766	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572298	0.45798	2.27E-4	0.0	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.77620	-1.11;-1.11	5.64	4.73	0.59995	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.056848	0.64402	D	0.000002	D	0.89368	0.6695	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91381	0.5127	10	0.87932	D	0	.	15.737	0.77853	0.0:0.0:0.8622:0.1378	.	1256	Q92752	TENR_HUMAN	C	1256;1256;1166	ENSP00000356646:R1256C;ENSP00000263525:R1256C	ENSP00000263525:R1256C	R	-	1	0	TNR	173565860	1.000000	0.71417	0.992000	0.48379	0.053000	0.15095	2.956000	0.49129	1.378000	0.46305	-0.152000	0.13540	CGC	TNR	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000116147		0.597	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	36	0	G	NM_003285		175299237	-1	tier1	rs144730675	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	63.64	12	21	SNP	1.000	A
TNR	7143	genome.wustl.edu	37	1	175299237	175299237	+	Missense_Mutation	SNP	G	G	A	rs144730675		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:175299237G>A	ENST00000367674.2	-	21	4474	c.3766C>T	c.(3766-3768)Cgc>Tgc	p.R1256C	TNR_ENST00000263525.2_Missense_Mutation_p.R1256C|RP3-518E13.2_ENST00000569593.1_RNA			Q92752	TENR_HUMAN	tenascin R	1256	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CTTCCTATGCGGAGTTTGTAC	0.597																																																	0								G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	93.0	77.0	83.0		3766	4.7	1.0	1	dbSNP_134	83	0,8600		0,0,4300	no	missense	TNR	NM_003285.2	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	1256/1359	175299237	1,13005	2203	4300	6503	SO:0001583	missense	0			X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.3766C>T	1.37:g.175299237G>A	ENSP00000356646:p.Arg1256Cys		C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.R1256C	ENST00000367674.2	37	c.3766	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.572298	0.45798	2.27E-4	0.0	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.77620	-1.11;-1.11	5.64	4.73	0.59995	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.056848	0.64402	D	0.000002	D	0.89368	0.6695	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91381	0.5127	10	0.87932	D	0	.	15.737	0.77853	0.0:0.0:0.8622:0.1378	.	1256	Q92752	TENR_HUMAN	C	1256;1256;1166	ENSP00000356646:R1256C;ENSP00000263525:R1256C	ENSP00000263525:R1256C	R	-	1	0	TNR	173565860	1.000000	0.71417	0.992000	0.48379	0.053000	0.15095	2.956000	0.49129	1.378000	0.46305	-0.152000	0.13540	CGC	TNR	-	pfam_Fibrinogen_a/b/g_C_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	ENSG00000116147		0.597	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	HGNC	protein_coding	OTTHUMT00000084414.4	-	0.00	46	0	G	NM_003285		175299237	-1	tier1	rs144730675	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	63.64	12	21	SNP	1.000	A
TNXB	7148	genome.wustl.edu	37	6	32038011	32038011	+	Missense_Mutation	SNP	C	C	T	rs371138982		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:32038011C>T	ENST00000375244.3	-	14	5372	c.5171G>A	c.(5170-5172)cGc>cAc	p.R1724H	TNXB_ENST00000375247.2_Missense_Mutation_p.R1724H			P22105	TENX_HUMAN	tenascin XB	1806	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGTGACAGAGCGCTCATGGCC	0.632																																																	0								C	HIS/ARG	1,3899		0,1,1949	27.0	30.0	29.0		5171	2.3	0.0	6		29	0,8302		0,0,4151	no	missense	TNXB	NM_019105.6	29	0,1,6100	TT,TC,CC		0.0,0.0256,0.0082	probably-damaging	1724/4243	32038011	1,12201	1950	4151	6101	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5171G>A	6.37:g.32038011C>T	ENSP00000364393:p.Arg1724His		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R1724H	ENST00000375244.3	37	c.5171		6	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732003	0.30684	2.56E-4	0.0	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04758	3.56;3.56	5.15	2.3	0.28687	.	0.696518	0.12971	N	0.424145	T	0.02083	0.0065	M	0.80028	2.48	0.09310	N	1	B	0.26775	0.159	B	0.23716	0.048	T	0.46762	-0.9168	10	0.20519	T	0.43	.	5.1818	0.15163	0.148:0.6282:0.143:0.0808	.	1724	P22105-3	.	H	1724	ENSP00000364393:R1724H;ENSP00000364396:R1724H	ENSP00000364393:R1724H	R	-	2	0	TNXB	32145989	0.975000	0.34042	0.011000	0.14972	0.056000	0.15407	0.840000	0.27600	0.160000	0.19432	0.561000	0.74099	CGC	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.632	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	40	0	C	NM_019105		32038011	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	29.55	31	13	SNP	0.001	T
TNXB	7148	genome.wustl.edu	37	6	32038011	32038011	+	Missense_Mutation	SNP	C	C	T	rs371138982		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:32038011C>T	ENST00000375244.3	-	14	5372	c.5171G>A	c.(5170-5172)cGc>cAc	p.R1724H	TNXB_ENST00000375247.2_Missense_Mutation_p.R1724H			P22105	TENX_HUMAN	tenascin XB	1806	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGTGACAGAGCGCTCATGGCC	0.632																																																	0								C	HIS/ARG	1,3899		0,1,1949	27.0	30.0	29.0		5171	2.3	0.0	6		29	0,8302		0,0,4151	no	missense	TNXB	NM_019105.6	29	0,1,6100	TT,TC,CC		0.0,0.0256,0.0082	probably-damaging	1724/4243	32038011	1,12201	1950	4151	6101	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5171G>A	6.37:g.32038011C>T	ENSP00000364393:p.Arg1724His		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R1724H	ENST00000375244.3	37	c.5171		6	.	.	.	.	.	.	.	.	.	.	C	11.75	1.732003	0.30684	2.56E-4	0.0	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.04758	3.56;3.56	5.15	2.3	0.28687	.	0.696518	0.12971	N	0.424145	T	0.02083	0.0065	M	0.80028	2.48	0.09310	N	1	B	0.26775	0.159	B	0.23716	0.048	T	0.46762	-0.9168	10	0.20519	T	0.43	.	5.1818	0.15163	0.148:0.6282:0.143:0.0808	.	1724	P22105-3	.	H	1724	ENSP00000364393:R1724H;ENSP00000364396:R1724H	ENSP00000364393:R1724H	R	-	2	0	TNXB	32145989	0.975000	0.34042	0.011000	0.14972	0.056000	0.15407	0.840000	0.27600	0.160000	0.19432	0.561000	0.74099	CGC	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.632	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	-	0.00	64	0	C	NM_019105		32038011	-1	tier1	-	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	29.55	31	13	SNP	0.001	T
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	GMAF=0.0005	0.00	29	0	C	NM_000546		7577120	-1	tier1	rs28934576	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	67.86	8	19	SNP	0.864	T
TP53	7157	genome.wustl.edu	37	17	7577120	7577120	+	Missense_Mutation	SNP	C	C	T	rs28934576		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:7577120C>T	ENST00000269305.4	-	8	1007	c.818G>A	c.(817-819)cGt>cAt	p.R273H	TP53_ENST00000420246.2_Missense_Mutation_p.R273H|TP53_ENST00000359597.4_Missense_Mutation_p.R273H|TP53_ENST00000445888.2_Missense_Mutation_p.R273H|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273H(521)|p.R273L(93)|p.R273P(32)|p.0?(8)|p.?(2)|p.R273fs*32(2)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.R273S(1)|p.E258fs*71(1)|p.R273fs*72(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.R273fs*33(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCACAAACACGCACCTCAAA	0.542	R273H(EN_ENDOMETRIUM)|R273H(HEC59_ENDOMETRIUM)|R273H(HEC6_ENDOMETRIUM)|R273H(HT29_LARGE_INTESTINE)|R273H(HT_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(MDAMB468_BREAST)|R273H(MOLT13_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(NCIH1155_LUNG)|R273H(NCIH1793_LUNG)|R273H(NCIH1975_LUNG)|R273H(NCIH2405_LUNG)|R273H(NCIH508_LARGE_INTESTINE)|R273H(OC314_OVARY)|R273H(PANC1_PANCREAS)|R273H(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SKMEL30_SKIN)|R273H(SNB19_CENTRAL_NERVOUS_SYSTEM)|R273H(SUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SUIT2_PANCREAS)|R273H(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273H(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273H(SW480_LARGE_INTESTINE)|R273H(SW620_LARGE_INTESTINE)|R273H(U251MG_CENTRAL_NERVOUS_SYSTEM)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			C|||	1	0.000199681	0.0	0.0	5008	,	,		18620	0.0		0.001	False		,,,				2504	0.0				Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	669	Substitution - Missense(647)|Whole gene deletion(8)|Deletion - Frameshift(6)|Deletion - In frame(5)|Unknown(2)|Insertion - Frameshift(1)	large_intestine(136)|lung(99)|breast(74)|ovary(59)|upper_aerodigestive_tract(55)|central_nervous_system(46)|oesophagus(35)|haematopoietic_and_lymphoid_tissue(30)|stomach(26)|urinary_tract(25)|pancreas(15)|endometrium(13)|liver(12)|skin(11)|bone(9)|biliary_tract(7)|penis(4)|cervix(2)|genital_tract(2)|NS(2)|soft_tissue(2)|vulva(1)|thyroid(1)|fallopian_tube(1)|prostate(1)|thymus(1)	GRCh37	CM004342|CM010472|CM920677	TP53	M	rs28934576						67.0	58.0	61.0					17																	7577120		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.818G>A	17.37:g.7577120C>T	ENSP00000269305:p.Arg273His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273H	ENST00000269305.4	37	c.818	CCDS11118.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.03	3.532510	0.64972	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99868	-7.32;-7.32;-7.32;-7.32;-7.32;-7.32	4.92	4.92	0.64577	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.79475	2.455	0.80722	A	1	P;D;P;P	0.89917	0.631;1.0;0.831;0.48	B;D;P;B	0.77004	0.274;0.989;0.516;0.242	D	0.96531	0.9393	9	0.72032	D	0.01	-11.9995	15.662	0.77193	0.0:1.0:0.0:0.0	rs28934576	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	H	273;273;273;273;273;262;141	ENSP00000352610:R273H;ENSP00000269305:R273H;ENSP00000398846:R273H;ENSP00000391127:R273H;ENSP00000391478:R273H;ENSP00000425104:R141H	ENSP00000269305:R273H	R	-	2	0	TP53	7517845	1.000000	0.71417	0.068000	0.19968	0.665000	0.39181	7.587000	0.82613	2.556000	0.86216	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	GMAF=0.0005	0.00	32	0	C	NM_000546		7577120	-1	tier1	rs28934576	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	67.86	8	19	SNP	0.864	T
TPTE2	93492	genome.wustl.edu	37	13	19997247	19997247	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:19997247A>C	ENST00000400230.2	-	20	1568	c.1524T>G	c.(1522-1524)atT>atG	p.I508M	TPTE2_ENST00000400103.2_Missense_Mutation_p.I397M|TPTE2_ENST00000457266.2_Missense_Mutation_p.I397M|TPTE2_ENST00000382975.4_Missense_Mutation_p.I468M|TPTE2_ENST00000382977.4_Missense_Mutation_p.I508M|TPTE2_ENST00000255310.6_Missense_Mutation_p.I431M|TPTE2_ENST00000382978.1_Missense_Mutation_p.I468M|TPTE2_ENST00000390680.2_Missense_Mutation_p.I431M			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	508	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTGGTGGATAAATTTTCCATG	0.368																																																	0													84.0	86.0	85.0					13																	19997247		2199	4299	6498	SO:0001583	missense	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1524T>G	13.37:g.19997247A>C	ENSP00000383089:p.Ile508Met		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.I508M	ENST00000400230.2	37	c.1524	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	a	0.399	-0.919253	0.02396	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266	D;D;D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	1.97	0.77	0.18497	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.139397	0.45126	U	0.000392	T	0.81903	0.4921	M	0.80616	2.505	0.29001	N	0.887494	B;B;B	0.20988	0.012;0.022;0.05	B;B;B	0.29353	0.079;0.061;0.101	T	0.70817	-0.4769	9	.	.	.	-10.1563	3.66	0.08236	0.7953:0.0:0.2047:0.0	.	397;431;508	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	M	468;397;508;431;431;508;468;397	ENSP00000372438:I468M;ENSP00000382974:I397M;ENSP00000383089:I508M;ENSP00000255310:I431M;ENSP00000375098:I431M;ENSP00000372437:I508M;ENSP00000372435:I468M;ENSP00000442218:I397M	.	I	-	3	3	TPTE2	18895247	0.994000	0.37717	0.511000	0.27724	0.065000	0.16274	0.915000	0.28638	0.221000	0.20879	0.163000	0.16589	ATT	TPTE2	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000132958		0.368	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		-	0.00	105	0	A	NM_199254		19997247	-1	tier1	-	no_errors	ENST00000382977	ensembl	human	known	74_37	missense	48.33	62	58	SNP	0.629	C
TPTE2	93492	genome.wustl.edu	37	13	19997247	19997247	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr13:19997247A>C	ENST00000400230.2	-	20	1568	c.1524T>G	c.(1522-1524)atT>atG	p.I508M	TPTE2_ENST00000400103.2_Missense_Mutation_p.I397M|TPTE2_ENST00000457266.2_Missense_Mutation_p.I397M|TPTE2_ENST00000382975.4_Missense_Mutation_p.I468M|TPTE2_ENST00000382977.4_Missense_Mutation_p.I508M|TPTE2_ENST00000255310.6_Missense_Mutation_p.I431M|TPTE2_ENST00000382978.1_Missense_Mutation_p.I468M|TPTE2_ENST00000390680.2_Missense_Mutation_p.I431M			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	508	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTGGTGGATAAATTTTCCATG	0.368																																																	0													84.0	86.0	85.0					13																	19997247		2199	4299	6498	SO:0001583	missense	0			AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.1524T>G	13.37:g.19997247A>C	ENSP00000383089:p.Ile508Met		A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Ion_trans_dom,pfam_Dual-sp_phosphatase_cat-dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.I508M	ENST00000400230.2	37	c.1524	CCDS45014.1	13	.	.	.	.	.	.	.	.	.	.	a	0.399	-0.919253	0.02396	.	.	ENSG00000132958	ENST00000382978;ENST00000400103;ENST00000400230;ENST00000255310;ENST00000390680;ENST00000382977;ENST00000382975;ENST00000457266	D;D;D;D;D;D;D;D	0.85258	-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96;-1.96	1.97	0.77	0.18497	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.139397	0.45126	U	0.000392	T	0.81903	0.4921	M	0.80616	2.505	0.29001	N	0.887494	B;B;B	0.20988	0.012;0.022;0.05	B;B;B	0.29353	0.079;0.061;0.101	T	0.70817	-0.4769	9	.	.	.	-10.1563	3.66	0.08236	0.7953:0.0:0.2047:0.0	.	397;431;508	A8MX64;Q6XPS3-3;Q6XPS3	.;.;TPTE2_HUMAN	M	468;397;508;431;431;508;468;397	ENSP00000372438:I468M;ENSP00000382974:I397M;ENSP00000383089:I508M;ENSP00000255310:I431M;ENSP00000375098:I431M;ENSP00000372437:I508M;ENSP00000372435:I468M;ENSP00000442218:I397M	.	I	-	3	3	TPTE2	18895247	0.994000	0.37717	0.511000	0.27724	0.065000	0.16274	0.915000	0.28638	0.221000	0.20879	0.163000	0.16589	ATT	TPTE2	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000132958		0.368	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TPTE2	HGNC	protein_coding		-	0.00	116	0	A	NM_199254		19997247	-1	tier1	-	no_errors	ENST00000382977	ensembl	human	known	74_37	missense	48.33	62	58	SNP	0.629	C
TRIM42	287015	genome.wustl.edu	37	3	140419756	140419756	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:140419756G>T	ENST00000286349.3	+	5	2303	c.2112G>T	c.(2110-2112)aaG>aaT	p.K704N		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	704						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GACATGGGAAGAACCGAGCTA	0.522																																																	0													149.0	125.0	133.0					3																	140419756		2203	4300	6503	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.2112G>T	3.37:g.140419756G>T	ENSP00000286349:p.Lys704Asn		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.K704N	ENST00000286349.3	37	c.2112	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176742	0.78564	.	.	ENSG00000155890	ENST00000286349	T	0.49432	0.78	5.91	5.03	0.67393	.	0.096812	0.45126	D	0.000393	T	0.50701	0.1631	N	0.19112	0.55	0.25793	N	0.984592	D	0.76494	0.999	D	0.80764	0.994	T	0.43814	-0.9368	10	0.87932	D	0	-7.5644	9.9942	0.41889	0.0888:0.0:0.9112:0.0	.	704	Q8IWZ5	TRI42_HUMAN	N	704	ENSP00000286349:K704N	ENSP00000286349:K704N	K	+	3	2	TRIM42	141902446	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.276000	0.51646	2.793000	0.96121	0.655000	0.94253	AAG	TRIM42	-	NULL	ENSG00000155890		0.522	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	32	0	G	NM_152616		140419756	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	27.59	21	8	SNP	1.000	T
TRIM42	287015	genome.wustl.edu	37	3	140419756	140419756	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:140419756G>T	ENST00000286349.3	+	5	2303	c.2112G>T	c.(2110-2112)aaG>aaT	p.K704N		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	704						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GACATGGGAAGAACCGAGCTA	0.522																																																	0													149.0	125.0	133.0					3																	140419756		2203	4300	6503	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.2112G>T	3.37:g.140419756G>T	ENSP00000286349:p.Lys704Asn		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.K704N	ENST00000286349.3	37	c.2112	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176742	0.78564	.	.	ENSG00000155890	ENST00000286349	T	0.49432	0.78	5.91	5.03	0.67393	.	0.096812	0.45126	D	0.000393	T	0.50701	0.1631	N	0.19112	0.55	0.25793	N	0.984592	D	0.76494	0.999	D	0.80764	0.994	T	0.43814	-0.9368	10	0.87932	D	0	-7.5644	9.9942	0.41889	0.0888:0.0:0.9112:0.0	.	704	Q8IWZ5	TRI42_HUMAN	N	704	ENSP00000286349:K704N	ENSP00000286349:K704N	K	+	3	2	TRIM42	141902446	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.276000	0.51646	2.793000	0.96121	0.655000	0.94253	AAG	TRIM42	-	NULL	ENSG00000155890		0.522	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	50	0	G	NM_152616		140419756	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	27.59	21	8	SNP	1.000	T
TRIM77	390231	genome.wustl.edu	37	11	89450731	89450731	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:89450731A>T	ENST00000398290.3	+	6	1044	c.1044A>T	c.(1042-1044)aaA>aaT	p.K348N		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	348	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TGGATGTGAAAGACTCTTGTA	0.448																																																	0													175.0	146.0	155.0					11																	89450731		692	1591	2283	SO:0001583	missense	0				CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.1044A>T	11.37:g.89450731A>T	ENSP00000474003:p.Lys348Asn			Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K348N	ENST00000398290.3	37	c.1044		11																																																																																			TRIM77	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000214414		0.448	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	TRIM77	HGNC	protein_coding		-	0.00	80	0	A	NM_001146162		89450731	+1	tier1	-	no_errors	ENST00000398290	ensembl	human	known	74_37	missense	20.00	56	14	SNP	0.004	T
TRIM77	390231	genome.wustl.edu	37	11	89450731	89450731	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:89450731A>T	ENST00000398290.3	+	6	1044	c.1044A>T	c.(1042-1044)aaA>aaT	p.K348N		NM_001146162.1	NP_001139634.1	I1YAP6	TRI77_HUMAN	tripartite motif containing 77	348	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)										TGGATGTGAAAGACTCTTGTA	0.448																																																	0													175.0	146.0	155.0					11																	89450731		692	1591	2283	SO:0001583	missense	0				CCDS60929.1	11q14.3	2014-02-17	2013-01-14	2013-01-14	ENSG00000214414	ENSG00000214414		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	34228	protein-coding gene	gene with protein product			"""tripartite motif-containing 77"", ""tripartite motif containing 77, pseudogene"""	TRIM77P			Standard	NM_001146162		Approved		uc010rtw.2	I1YAP6	OTTHUMG00000167624	ENST00000398290.3:c.1044A>T	11.37:g.89450731A>T	ENSP00000474003:p.Lys348Asn			Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.K348N	ENST00000398290.3	37	c.1044		11																																																																																			TRIM77	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY	ENSG00000214414		0.448	TRIM77-201	KNOWN	basic|appris_principal	protein_coding	TRIM77	HGNC	protein_coding		-	0.00	89	0	A	NM_001146162		89450731	+1	tier1	-	no_errors	ENST00000398290	ensembl	human	known	74_37	missense	20.00	56	14	SNP	0.004	T
TRIML2	205860	genome.wustl.edu	37	4	189012589	189012589	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:189012589T>C	ENST00000512729.1	-	7	1476	c.1102A>G	c.(1102-1104)Agt>Ggt	p.S368G	TRIML2_ENST00000326754.3_Missense_Mutation_p.S393G	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	368	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GAGTCTGGACTTGTGTCTCCA	0.473																																																	0													161.0	158.0	159.0					4																	189012589		2203	4300	6503	SO:0001583	missense	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.1102A>G	4.37:g.189012589T>C	ENSP00000422581:p.Ser368Gly		B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.S368G	ENST00000512729.1	37	c.1102	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434771	0.43224	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.61274	0.12;0.12	5.85	1.84	0.25277	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	1.337120	0.04909	N	0.452848	T	0.55321	0.1913	L	0.57536	1.79	0.19300	N	0.999978	B;B	0.16166	0.006;0.016	B;B	0.12156	0.007;0.007	T	0.46693	-0.9173	10	0.72032	D	0.01	.	7.7949	0.29141	0.0:0.309:0.0:0.691	.	393;368	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	G	368;393	ENSP00000422581:S368G;ENSP00000317498:S393G	ENSP00000317498:S393G	S	-	1	0	TRIML2	189249583	0.000000	0.05858	0.000000	0.03702	0.334000	0.28698	0.492000	0.22435	0.131000	0.18576	0.533000	0.62120	AGT	TRIML2	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000179046		0.473	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	57	0	T	NM_173553		189012589	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.002	C
TRIML2	205860	genome.wustl.edu	37	4	189012589	189012589	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:189012589T>C	ENST00000512729.1	-	7	1476	c.1102A>G	c.(1102-1104)Agt>Ggt	p.S368G	TRIML2_ENST00000326754.3_Missense_Mutation_p.S393G	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	368	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		GAGTCTGGACTTGTGTCTCCA	0.473																																																	0													161.0	158.0	159.0					4																	189012589		2203	4300	6503	SO:0001583	missense	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.1102A>G	4.37:g.189012589T>C	ENSP00000422581:p.Ser368Gly		B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.S368G	ENST00000512729.1	37	c.1102	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	T	14.10	2.434771	0.43224	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.61274	0.12;0.12	5.85	1.84	0.25277	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	1.337120	0.04909	N	0.452848	T	0.55321	0.1913	L	0.57536	1.79	0.19300	N	0.999978	B;B	0.16166	0.006;0.016	B;B	0.12156	0.007;0.007	T	0.46693	-0.9173	10	0.72032	D	0.01	.	7.7949	0.29141	0.0:0.309:0.0:0.691	.	393;368	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	G	368;393	ENSP00000422581:S368G;ENSP00000317498:S393G	ENSP00000317498:S393G	S	-	1	0	TRIML2	189249583	0.000000	0.05858	0.000000	0.03702	0.334000	0.28698	0.492000	0.22435	0.131000	0.18576	0.533000	0.62120	AGT	TRIML2	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000179046		0.473	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	58	0	T	NM_173553		189012589	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.002	C
TSHZ2	128553	genome.wustl.edu	37	20	51873022	51873022	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr20:51873022G>T	ENST00000371497.5	+	2	3912	c.3025G>T	c.(3025-3027)Gta>Tta	p.V1009L	TSHZ2_ENST00000329613.6_Missense_Mutation_p.V1006L|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Missense_Mutation_p.V1006L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	1009					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CAAACATGCGGTAAAACTCCA	0.473																																																	0													122.0	104.0	110.0					20																	51873022		2203	4300	6503	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.3025G>T	20.37:g.51873022G>T	ENSP00000360552:p.Val1009Leu		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.V1009L	ENST00000371497.5	37	c.3025	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663939	0.88251	.	.	ENSG00000182463	ENST00000371497;ENST00000329613	T;T	0.17691	2.26;2.26	5.69	5.69	0.88448	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	N	0.12471	0.22	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.24476	-1.0159	10	0.87932	D	0	-9.7172	19.8075	0.96536	0.0:0.0:1.0:0.0	.	1009	Q9NRE2	TSH2_HUMAN	L	1009;1006	ENSP00000360552:V1009L;ENSP00000333114:V1006L	ENSP00000333114:V1006L	V	+	1	0	TSHZ2	51306429	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	9.470000	0.97683	2.681000	0.91329	0.637000	0.83480	GTA	TSHZ2	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000182463		0.473	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6		0.00	51	0	G	NM_173485		51873022	+1			no_errors	ENST00000371497	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
TTLL8	164714	genome.wustl.edu	37	22	50470517	50470517	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:50470517G>A	ENST00000266182.6	-	11	1304	c.1305C>T	c.(1303-1305)aaC>aaT	p.N435N	TTLL8_ENST00000440475.1_Silent_p.N415N			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	451	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		TCTGGACGGCGTTGTTGCACA	0.667																																																	0													58.0	66.0	63.0					22																	50470517		2095	4210	6305	SO:0001819	synonymous_variant	0					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.1305C>T	22.37:g.50470517G>A			B5MDV0	Silent	SNP	pfam_TTL/TTLL_fam	p.N435	ENST00000266182.6	37	c.1305		22																																																																																			TTLL8	-	pfam_TTL/TTLL_fam	ENSG00000138892		0.667	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TTLL8	HGNC	protein_coding		-	0.00	46	0	G	NM_001080447		50470517	-1	tier1	-	no_errors	ENST00000266182	ensembl	human	known	74_37	silent	11.86	52	7	SNP	1.000	A
TTLL8	164714	genome.wustl.edu	37	22	50470517	50470517	+	Silent	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr22:50470517G>A	ENST00000266182.6	-	11	1304	c.1305C>T	c.(1303-1305)aaC>aaT	p.N435N	TTLL8_ENST00000440475.1_Silent_p.N415N			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	451	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		TCTGGACGGCGTTGTTGCACA	0.667																																																	0													58.0	66.0	63.0					22																	50470517		2095	4210	6305	SO:0001819	synonymous_variant	0					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.1305C>T	22.37:g.50470517G>A			B5MDV0	Silent	SNP	pfam_TTL/TTLL_fam	p.N435	ENST00000266182.6	37	c.1305		22																																																																																			TTLL8	-	pfam_TTL/TTLL_fam	ENSG00000138892		0.667	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TTLL8	HGNC	protein_coding		-	0.00	51	0	G	NM_001080447		50470517	-1	tier1	-	no_errors	ENST00000266182	ensembl	human	known	74_37	silent	11.86	52	7	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179460306	179460306	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179460306C>A	ENST00000591111.1	-	245	53076	c.52852G>T	c.(52852-52854)Gcg>Tcg	p.A17618S	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A10386S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A16691S|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A10194S|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A10319S|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A19259S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17618	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCAGCCGCAATTCGGAAA	0.408																																																	0													44.0	42.0	43.0					2																	179460306		1865	4108	5973	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52852G>T	2.37:g.179460306C>A	ENSP00000465570:p.Ala17618Ser		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A16691S	ENST00000591111.1	37	c.50071		2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635499	0.67130	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.98	5.98	0.97165	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60792	0.2296	N	0.16166	0.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.66288	-0.5961	9	0.87932	D	0	.	20.4366	0.99092	0.0:1.0:0.0:0.0	.	10194;10319;10386;17618	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	16691;10194;10386;10319;10192	ENSP00000343764:A16691S;ENSP00000434586:A10194S;ENSP00000340554:A10386S;ENSP00000352154:A10319S	ENSP00000340554:A10386S	A	-	1	0	TTN	179168552	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.770000	0.85390	2.843000	0.97960	0.585000	0.79938	GCG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	45	0	C	NM_133378		179460306	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179460306	179460306	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179460306C>A	ENST00000591111.1	-	245	53076	c.52852G>T	c.(52852-52854)Gcg>Tcg	p.A17618S	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A10386S|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A16691S|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A10194S|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A10319S|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A19259S|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17618	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTTTCAGCCGCAATTCGGAAA	0.408																																																	0													44.0	42.0	43.0					2																	179460306		1865	4108	5973	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52852G>T	2.37:g.179460306C>A	ENSP00000465570:p.Ala17618Ser		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A16691S	ENST00000591111.1	37	c.50071		2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635499	0.67130	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.98	5.98	0.97165	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.60792	0.2296	N	0.16166	0.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.66288	-0.5961	9	0.87932	D	0	.	20.4366	0.99092	0.0:1.0:0.0:0.0	.	10194;10319;10386;17618	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	16691;10194;10386;10319;10192	ENSP00000343764:A16691S;ENSP00000434586:A10194S;ENSP00000340554:A10386S;ENSP00000352154:A10319S	ENSP00000340554:A10386S	A	-	1	0	TTN	179168552	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	7.770000	0.85390	2.843000	0.97960	0.585000	0.79938	GCG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	59	0	C	NM_133378		179460306	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179500730	179500730	+	Silent	SNP	G	G	A	rs559906667		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179500730G>A	ENST00000591111.1	-	176	36869	c.36645C>T	c.(36643-36645)aaC>aaT	p.N12215N	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Silent_p.N4983N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.N11288N|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000460472.2_Silent_p.N4791N|TTN_ENST00000359218.5_Silent_p.N4916N|TTN_ENST00000589042.1_Silent_p.N13856N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12215	Ig-like 81.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTGTTGGCGTTTTCCACAG	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		19059	0.0		0.0	False		,,,				2504	0.001																0													120.0	123.0	122.0					2																	179500730		1981	4168	6149	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36645C>T	2.37:g.179500730G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.N11288	ENST00000591111.1	37	c.33864		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	35	0	G	NM_133378		179500730	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	24.14	22	7	SNP	0.101	A
TTN	7273	genome.wustl.edu	37	2	179500730	179500730	+	Silent	SNP	G	G	A	rs559906667		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179500730G>A	ENST00000591111.1	-	176	36869	c.36645C>T	c.(36643-36645)aaC>aaT	p.N12215N	TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Silent_p.N4983N|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.N11288N|TTN-AS1_ENST00000418062.1_RNA|TTN_ENST00000460472.2_Silent_p.N4791N|TTN_ENST00000359218.5_Silent_p.N4916N|TTN_ENST00000589042.1_Silent_p.N13856N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12215	Ig-like 81.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTGTTGGCGTTTTCCACAG	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		19059	0.0		0.0	False		,,,				2504	0.001																0													120.0	123.0	122.0					2																	179500730		1981	4168	6149	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36645C>T	2.37:g.179500730G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.N11288	ENST00000591111.1	37	c.33864		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	50	0	G	NM_133378		179500730	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	24.14	22	7	SNP	0.101	A
TTN	7273	genome.wustl.edu	37	2	179516898	179516898	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179516898C>A	ENST00000591111.1	-	159	34923	c.34699G>T	c.(34699-34701)Gtg>Ttg	p.V11567L	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V10640L|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V13074L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11567	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTTGGCACCTCTGGGACT	0.393																																																	0													102.0	98.0	99.0					2																	179516898		1809	4073	5882	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34699G>T	2.37:g.179516898C>A	ENSP00000465570:p.Val11567Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V10640L	ENST00000591111.1	37	c.31918		2	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334139	0.24253	.	.	ENSG00000155657	ENST00000342992	T	0.71103	-0.54	5.0	4.13	0.48395	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.65471	0.2694	L	0.56124	1.755	0.23751	N	0.99694	B	0.02656	0.0	B	0.04013	0.001	T	0.60100	-0.7329	9	0.87932	D	0	.	9.8816	0.41236	0.0:0.7821:0.1396:0.0782	.	11567	Q8WZ42	TITIN_HUMAN	L	10640	ENSP00000343764:V10640L	ENSP00000343764:V10640L	V	-	1	0	TTN	179225143	0.527000	0.26306	0.999000	0.59377	0.369000	0.29798	0.261000	0.18442	1.249000	0.43950	0.650000	0.86243	GTG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	133	0	C	NM_133378		179516898	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	20.77	103	27	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179516898	179516898	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179516898C>A	ENST00000591111.1	-	159	34923	c.34699G>T	c.(34699-34701)Gtg>Ttg	p.V11567L	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V10640L|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.V13074L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	11567	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTTGGCACCTCTGGGACT	0.393																																																	0													102.0	98.0	99.0					2																	179516898		1809	4073	5882	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34699G>T	2.37:g.179516898C>A	ENSP00000465570:p.Val11567Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.V10640L	ENST00000591111.1	37	c.31918		2	.	.	.	.	.	.	.	.	.	.	C	10.38	1.334139	0.24253	.	.	ENSG00000155657	ENST00000342992	T	0.71103	-0.54	5.0	4.13	0.48395	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.65471	0.2694	L	0.56124	1.755	0.23751	N	0.99694	B	0.02656	0.0	B	0.04013	0.001	T	0.60100	-0.7329	9	0.87932	D	0	.	9.8816	0.41236	0.0:0.7821:0.1396:0.0782	.	11567	Q8WZ42	TITIN_HUMAN	L	10640	ENSP00000343764:V10640L	ENSP00000343764:V10640L	V	-	1	0	TTN	179225143	0.527000	0.26306	0.999000	0.59377	0.369000	0.29798	0.261000	0.18442	1.249000	0.43950	0.650000	0.86243	GTG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	157	0	C	NM_133378		179516898	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	20.77	103	27	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179593075	179593075	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179593075T>G	ENST00000591111.1	-	65	18749	c.18525A>C	c.(18523-18525)aaA>aaC	p.K6175N	TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K5248N|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K6492N|RP11-171I2.1_ENST00000590024.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12956	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCCCAGAACTTTATCCATTT	0.363																																																	0													61.0	58.0	59.0					2																	179593075		1830	4089	5919	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18525A>C	2.37:g.179593075T>G	ENSP00000465570:p.Lys6175Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K5248N	ENST00000591111.1	37	c.15744		2	.	.	.	.	.	.	.	.	.	.	T	7.686	0.690099	0.15039	.	.	ENSG00000155657	ENST00000342992	T	0.66815	-0.23	5.76	3.38	0.38709	Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51958	0.1705	L	0.33339	1.005	0.80722	D	1	P	0.39717	0.684	B	0.37780	0.258	T	0.50617	-0.8807	9	0.87932	D	0	.	6.5498	0.22427	0.0:0.1961:0.1202:0.6837	.	6175	Q8WZ42	TITIN_HUMAN	N	5248	ENSP00000343764:K5248N	ENSP00000343764:K5248N	K	-	3	2	TTN	179301320	0.985000	0.35326	0.986000	0.45419	0.975000	0.68041	0.196000	0.17176	0.525000	0.28522	-0.256000	0.11100	AAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000155657		0.363	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	23	0	T	NM_133378		179593075	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	25.00	9	3	SNP	0.975	G
TTN	7273	genome.wustl.edu	37	2	179604014	179604014	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:179604014T>A	ENST00000591111.1	-	46	13219	c.12995A>T	c.(12994-12996)aAg>aTg	p.K4332M	TTN_ENST00000342175.6_Missense_Mutation_p.K4478M|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000460472.2_Missense_Mutation_p.K4286M|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K4411M|TTN_ENST00000589042.1_Missense_Mutation_p.K4649M			Q8WZ42	TITIN_HUMAN	titin	12090	Ig-like 23.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.K4478T(1)|p.K4411T(1)|p.K4286T(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACACTTGAACTTTTCATCTGA	0.378																																																	3	Substitution - Missense(3)	large_intestine(3)											137.0	121.0	126.0					2																	179604014		1894	4118	6012	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.12995A>T	2.37:g.179604014T>A	ENSP00000465570:p.Lys4332Met		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K4478M	ENST00000591111.1	37	c.13433		2	.	.	.	.	.	.	.	.	.	.	T	13.13	2.146526	0.37923	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.46819	0.86;0.86;0.86	5.83	3.28	0.37604	.	.	.	.	.	T	0.44912	0.1316	M	0.67517	2.055	0.26126	N	0.98049	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.16289	0.015;0.015;0.015	T	0.43032	-0.9416	9	0.87932	D	0	.	7.801	0.29174	0.1235:0.0681:0.0:0.8084	.	4286;4411;4478	D3DPF9;E7EQE6;E7ET18	.;.;.	M	4286;4478;4411;4286	ENSP00000434586:K4286M;ENSP00000340554:K4478M;ENSP00000352154:K4411M	ENSP00000340554:K4478M	K	-	2	0	TTN	179312259	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.447000	0.52936	2.236000	0.73375	0.533000	0.62120	AAG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	112	0	T	NM_133378		179604014	-1	tier1	-	no_errors	ENST00000342175	ensembl	human	known	74_37	missense	39.77	53	35	SNP	1.000	A
UNC5C	8633	genome.wustl.edu	37	4	96104172	96104172	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr4:96104172T>G	ENST00000453304.1	-	14	2675	c.2327A>C	c.(2326-2328)aAc>aCc	p.N776T		NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	776					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		GCAGTGCAGGTTTCTTTGAGA	0.428																																																	0													159.0	142.0	148.0					4																	96104172		2203	4300	6503	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.2327A>C	4.37:g.96104172T>G	ENSP00000406022:p.Asn776Thr		Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.N776T	ENST00000453304.1	37	c.2327	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	T	10.41	1.343179	0.24339	.	.	ENSG00000182168	ENST00000453304;ENST00000331502	T	0.48522	0.81	5.83	3.34	0.38264	.	0.251039	0.43919	D	0.000513	T	0.25195	0.0612	N	0.10837	0.055	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.04065	-1.0980	10	0.20519	T	0.43	.	8.5907	0.33686	0.0:0.067:0.1305:0.8025	.	776	O95185	UNC5C_HUMAN	T	776;735	ENSP00000406022:N776T	ENSP00000328673:N735T	N	-	2	0	UNC5C	96323195	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.285000	0.33261	0.445000	0.26639	0.533000	0.62120	AAC	UNC5C	-	NULL	ENSG00000182168		0.428	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	-	0.00	51	0	T	NM_003728		96104172	-1	tier1	-	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	25.00	24	8	SNP	0.983	G
UNC5D	137970	genome.wustl.edu	37	8	35606063	35606063	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:35606063T>C	ENST00000404895.2	+	12	2113	c.1785T>C	c.(1783-1785)tcT>tcC	p.S595S	UNC5D_ENST00000453357.2_Silent_p.S590S|UNC5D_ENST00000449677.1_Silent_p.S171S|UNC5D_ENST00000420357.1_Silent_p.S528S|UNC5D_ENST00000416672.1_Silent_p.S600S|UNC5D_ENST00000287272.2_Silent_p.S526S	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	595	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAGATGGCTCTGAGGTGCTCC	0.488																																																	0													140.0	120.0	127.0					8																	35606063		2203	4300	6503	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1785T>C	8.37:g.35606063T>C			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.S595	ENST00000404895.2	37	c.1785	CCDS6093.2	8																																																																																			UNC5D	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000156687		0.488	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	111	0	T			35606063	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	31.20	86	39	SNP	0.002	C
UNC5D	137970	genome.wustl.edu	37	8	35606063	35606063	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:35606063T>C	ENST00000404895.2	+	12	2113	c.1785T>C	c.(1783-1785)tcT>tcC	p.S595S	UNC5D_ENST00000453357.2_Silent_p.S590S|UNC5D_ENST00000449677.1_Silent_p.S171S|UNC5D_ENST00000420357.1_Silent_p.S528S|UNC5D_ENST00000416672.1_Silent_p.S600S|UNC5D_ENST00000287272.2_Silent_p.S526S	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	595	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAGATGGCTCTGAGGTGCTCC	0.488																																																	0													140.0	120.0	127.0					8																	35606063		2203	4300	6503	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1785T>C	8.37:g.35606063T>C			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.S595	ENST00000404895.2	37	c.1785	CCDS6093.2	8																																																																																			UNC5D	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000156687		0.488	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	96	0	T			35606063	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	31.20	86	39	SNP	0.002	C
USH2A	7399	genome.wustl.edu	37	1	216270459	216270459	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:216270459T>G	ENST00000307340.3	-	22	5110	c.4724A>C	c.(4723-4725)aAg>aCg	p.K1575T	USH2A_ENST00000366943.2_Missense_Mutation_p.K1575T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1575	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACGTCCCTTCTTCAACTGAAG	0.378										HNSCC(13;0.011)																																							0													69.0	67.0	68.0					1																	216270459		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4724A>C	1.37:g.216270459T>G	ENSP00000305941:p.Lys1575Thr		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.K1575T	ENST00000307340.3	37	c.4724	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476469	0.63737	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77750	-1.12;-1.12	5.89	2.31	0.28768	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.139815	0.32503	N	0.006020	T	0.78672	0.4320	L	0.59436	1.845	0.27615	N	0.948527	D	0.71674	0.998	P	0.59115	0.852	T	0.67821	-0.5571	10	0.35671	T	0.21	.	4.7672	0.13137	0.0:0.3126:0.1548:0.5326	.	1575	O75445	USH2A_HUMAN	T	1575	ENSP00000305941:K1575T;ENSP00000355910:K1575T	ENSP00000305941:K1575T	K	-	2	0	USH2A	214337082	0.554000	0.26522	0.997000	0.53966	0.994000	0.84299	0.259000	0.18405	0.454000	0.26884	0.533000	0.62120	AAG	USH2A	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G	ENSG00000042781		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	35	0	T	NM_007123		216270459	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.991	G
USH2A	7399	genome.wustl.edu	37	1	216270459	216270459	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:216270459T>G	ENST00000307340.3	-	22	5110	c.4724A>C	c.(4723-4725)aAg>aCg	p.K1575T	USH2A_ENST00000366943.2_Missense_Mutation_p.K1575T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1575	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACGTCCCTTCTTCAACTGAAG	0.378										HNSCC(13;0.011)																																							0													69.0	67.0	68.0					1																	216270459		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.4724A>C	1.37:g.216270459T>G	ENSP00000305941:p.Lys1575Thr		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.K1575T	ENST00000307340.3	37	c.4724	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476469	0.63737	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77750	-1.12;-1.12	5.89	2.31	0.28768	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.139815	0.32503	N	0.006020	T	0.78672	0.4320	L	0.59436	1.845	0.27615	N	0.948527	D	0.71674	0.998	P	0.59115	0.852	T	0.67821	-0.5571	10	0.35671	T	0.21	.	4.7672	0.13137	0.0:0.3126:0.1548:0.5326	.	1575	O75445	USH2A_HUMAN	T	1575	ENSP00000305941:K1575T;ENSP00000355910:K1575T	ENSP00000305941:K1575T	K	-	2	0	USH2A	214337082	0.554000	0.26522	0.997000	0.53966	0.994000	0.84299	0.259000	0.18405	0.454000	0.26884	0.533000	0.62120	AAG	USH2A	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G	ENSG00000042781		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	45	0	T	NM_007123		216270459	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	20.00	24	6	SNP	0.991	G
CCT8	10694	genome.wustl.edu	37	21	30426152	30426152	+	IGR	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:30426152C>G	ENST00000286788.4	-	0	2005				USP16_ENST00000535828.1_Silent_p.L370L|CCT8_ENST00000470450.1_5'Flank|USP16_ENST00000334352.4_Silent_p.L741L|USP16_ENST00000399976.2_Silent_p.L741L|USP16_ENST00000399975.3_Silent_p.L740L	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)						'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						CAAGGGTACTCTATTCCTTAT	0.393																																																	0													124.0	127.0	126.0					21																	30426152		2203	4300	6503	SO:0001628	intergenic_variant	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595		21.37:g.30426152C>G			A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.L741	ENST00000286788.4	37	c.2223	CCDS33528.1	21																																																																																			USP16	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000156256		0.393	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP16	HGNC	protein_coding	OTTHUMT00000171822.1	-	0.00	47	0	C			30426152	+1	tier1	-	no_errors	ENST00000334352	ensembl	human	known	74_37	silent	21.21	26	7	SNP	0.561	G
CCT8	10694	genome.wustl.edu	37	21	30426152	30426152	+	IGR	SNP	C	C	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr21:30426152C>G	ENST00000286788.4	-	0	2005				USP16_ENST00000535828.1_Silent_p.L370L|CCT8_ENST00000470450.1_5'Flank|USP16_ENST00000334352.4_Silent_p.L741L|USP16_ENST00000399976.2_Silent_p.L741L|USP16_ENST00000399975.3_Silent_p.L740L	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)						'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						CAAGGGTACTCTATTCCTTAT	0.393																																																	0													124.0	127.0	126.0					21																	30426152		2203	4300	6503	SO:0001628	intergenic_variant	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595		21.37:g.30426152C>G			A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.L741	ENST00000286788.4	37	c.2223	CCDS33528.1	21																																																																																			USP16	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000156256		0.393	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP16	HGNC	protein_coding	OTTHUMT00000171822.1	-	0.00	57	0	C			30426152	+1	tier1	-	no_errors	ENST00000334352	ensembl	human	known	74_37	silent	21.21	26	7	SNP	0.561	G
VAX1	11023	genome.wustl.edu	37	10	118893682	118893682	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:118893682A>C	ENST00000369206.5	-	3	841	c.842T>G	c.(841-843)cTc>cGc	p.L281R	VAX1_ENST00000277905.2_Intron	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	281					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		GACGGAGCCGAGCAGCGAGGG	0.711																																																	0													22.0	24.0	23.0					10																	118893682		692	1591	2283	SO:0001583	missense	0			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.842T>G	10.37:g.118893682A>C	ENSP00000358207:p.Leu281Arg		B1AVW5|Q6ZSX0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.L281R	ENST00000369206.5	37	c.842	CCDS44483.1	10	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842882	0.51057	.	.	ENSG00000148704	ENST00000369206	D	0.92805	-3.11	4.19	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.93700	0.7987	L	0.50333	1.59	0.50813	D	0.999896	D	0.71674	0.998	D	0.83275	0.996	D	0.91793	0.5445	10	0.23302	T	0.38	-13.4139	13.3916	0.60827	1.0:0.0:0.0:0.0	.	281	Q5SQQ9	VAX1_HUMAN	R	281	ENSP00000358207:L281R	ENSP00000358207:L281R	L	-	2	0	VAX1	118883672	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.744000	0.62118	1.753000	0.51906	0.247000	0.18012	CTC	VAX1	-	NULL	ENSG00000148704		0.711	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	HGNC	protein_coding	OTTHUMT00000050559.3	-	0.00	43	0	A	XM_301242		118893682	-1	tier1	-	no_errors	ENST00000369206	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	C
VAX1	11023	genome.wustl.edu	37	10	118893682	118893682	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr10:118893682A>C	ENST00000369206.5	-	3	841	c.842T>G	c.(841-843)cTc>cGc	p.L281R	VAX1_ENST00000277905.2_Intron	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	281					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		GACGGAGCCGAGCAGCGAGGG	0.711																																																	0													22.0	24.0	23.0					10																	118893682		692	1591	2283	SO:0001583	missense	0			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.842T>G	10.37:g.118893682A>C	ENSP00000358207:p.Leu281Arg		B1AVW5|Q6ZSX0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.L281R	ENST00000369206.5	37	c.842	CCDS44483.1	10	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842882	0.51057	.	.	ENSG00000148704	ENST00000369206	D	0.92805	-3.11	4.19	4.19	0.49359	.	0.000000	0.64402	D	0.000001	D	0.93700	0.7987	L	0.50333	1.59	0.50813	D	0.999896	D	0.71674	0.998	D	0.83275	0.996	D	0.91793	0.5445	10	0.23302	T	0.38	-13.4139	13.3916	0.60827	1.0:0.0:0.0:0.0	.	281	Q5SQQ9	VAX1_HUMAN	R	281	ENSP00000358207:L281R	ENSP00000358207:L281R	L	-	2	0	VAX1	118883672	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	4.744000	0.62118	1.753000	0.51906	0.247000	0.18012	CTC	VAX1	-	NULL	ENSG00000148704		0.711	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	HGNC	protein_coding	OTTHUMT00000050559.3	-	0.00	65	0	A	XM_301242		118893682	-1	tier1	-	no_errors	ENST00000369206	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	C
VCAN	1462	genome.wustl.edu	37	5	82876451	82876451	+	3'UTR	DEL	A	A	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:82876451delA	ENST00000265077.3	+	0	10954				VCAN_ENST00000512590.2_3'UTR|VCAN_ENST00000343200.5_3'UTR|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAAATGAAAGAAAATGAGAGC	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.*198A>-	5.37:g.82876451delA			P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	RNA	DEL	-	NULL	ENST00000265077.3	37	NULL	CCDS4060.1	5																																																																																			VCAN	-	-	ENSG00000038427		0.383	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3		0.00	38	0	A	NM_004385		82876451	+1	tier1		no_errors	ENST00000513016	ensembl	human	known	74_37	rna	5.56	34	2	DEL	0.000	-
VCAN	1462	genome.wustl.edu	37	5	82876451	82876451	+	3'UTR	DEL	A	A	-			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:82876451delA	ENST00000265077.3	+	0	10954				VCAN_ENST00000512590.2_3'UTR|VCAN_ENST00000343200.5_3'UTR|VCAN_ENST00000513016.1_3'UTR|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000342785.4_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican						carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	AAAATGAAAGAAAATGAGAGC	0.383																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.*198A>-	5.37:g.82876451delA			P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	RNA	DEL	-	NULL	ENST00000265077.3	37	NULL	CCDS4060.1	5																																																																																			VCAN	-	-	ENSG00000038427		0.383	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3		0.00	42	0	A	NM_004385		82876451	+1	tier1		no_errors	ENST00000513016	ensembl	human	known	74_37	rna	5.56	34	2	DEL	0.000	-
VIP	7432	genome.wustl.edu	37	6	153076475	153076475	+	Missense_Mutation	SNP	A	A	C	rs571217593	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:153076475A>C	ENST00000367244.3	+	4	474	c.302A>C	c.(301-303)aAg>aCg	p.K101T	VIP_ENST00000367243.3_Missense_Mutation_p.K101T	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	101					body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		TCTGCCAAAAAGTACCTTGAG	0.313																																																	0													63.0	64.0	63.0					6																	153076475		2203	4300	6503	SO:0001583	missense	0				CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.302A>C	6.37:g.153076475A>C	ENSP00000356213:p.Lys101Thr		Q5TCY8|Q5TCY9|Q96QK3	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.K101T	ENST00000367244.3	37	c.302	CCDS5240.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.1|21.1	4.095092|4.095092	0.76870|0.76870	.|.	.|.	ENSG00000146469|ENSG00000146469	ENST00000431366|ENST00000367244;ENST00000367243	T|T;T	0.44083|0.39056	0.93|1.1;1.1	6.06|6.06	4.88|4.88	0.63580|0.63580	.|Glucagon/GIP/secretin/VIP (3);	0.139603|0.139603	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.50429|0.50429	0.1615|0.1615	M|M	0.84846|0.84846	2.72|2.72	0.36970|0.36970	D|D	0.893762|0.893762	.|D;D;D	.|0.71674	.|0.992;0.991;0.998	.|D;P;D	.|0.74023	.|0.912;0.798;0.982	T|T	0.61768|0.61768	-0.6995|-0.6995	8|10	0.72032|0.72032	D|D	0.01|0.01	.|.	3.3824|3.3824	0.07259|0.07259	0.6558:0.0:0.1658:0.1784|0.6558:0.0:0.1658:0.1784	.|.	.|101;101;101	.|A8K7E4;P01282-2;P01282	.|.;.;VIP_HUMAN	N|T	50|101	ENSP00000410356:K50N|ENSP00000356213:K101T;ENSP00000356212:K101T	ENSP00000410356:K50N|ENSP00000356212:K101T	K|K	+|+	3|2	2|0	VIP|VIP	153118168|153118168	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.950000|0.950000	0.60333|0.60333	3.243000|3.243000	0.51392|0.51392	1.087000|1.087000	0.41251|0.41251	0.533000|0.533000	0.62120|0.62120	AAA|AAG	VIP	-	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	ENSG00000146469		0.313	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VIP	HGNC	protein_coding	OTTHUMT00000042751.1	-	0.00	63	0	A			153076475	+1	tier1	-	no_errors	ENST00000367244	ensembl	human	known	74_37	missense	59.26	22	32	SNP	1.000	C
VIP	7432	genome.wustl.edu	37	6	153076475	153076475	+	Missense_Mutation	SNP	A	A	C	rs571217593	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr6:153076475A>C	ENST00000367244.3	+	4	474	c.302A>C	c.(301-303)aAg>aCg	p.K101T	VIP_ENST00000367243.3_Missense_Mutation_p.K101T	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	101					body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		TCTGCCAAAAAGTACCTTGAG	0.313																																																	0													63.0	64.0	63.0					6																	153076475		2203	4300	6503	SO:0001583	missense	0				CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.302A>C	6.37:g.153076475A>C	ENSP00000356213:p.Lys101Thr		Q5TCY8|Q5TCY9|Q96QK3	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.K101T	ENST00000367244.3	37	c.302	CCDS5240.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.1|21.1	4.095092|4.095092	0.76870|0.76870	.|.	.|.	ENSG00000146469|ENSG00000146469	ENST00000431366|ENST00000367244;ENST00000367243	T|T;T	0.44083|0.39056	0.93|1.1;1.1	6.06|6.06	4.88|4.88	0.63580|0.63580	.|Glucagon/GIP/secretin/VIP (3);	0.139603|0.139603	0.64402|0.64402	D|D	0.000005|0.000005	T|T	0.50429|0.50429	0.1615|0.1615	M|M	0.84846|0.84846	2.72|2.72	0.36970|0.36970	D|D	0.893762|0.893762	.|D;D;D	.|0.71674	.|0.992;0.991;0.998	.|D;P;D	.|0.74023	.|0.912;0.798;0.982	T|T	0.61768|0.61768	-0.6995|-0.6995	8|10	0.72032|0.72032	D|D	0.01|0.01	.|.	3.3824|3.3824	0.07259|0.07259	0.6558:0.0:0.1658:0.1784|0.6558:0.0:0.1658:0.1784	.|.	.|101;101;101	.|A8K7E4;P01282-2;P01282	.|.;.;VIP_HUMAN	N|T	50|101	ENSP00000410356:K50N|ENSP00000356213:K101T;ENSP00000356212:K101T	ENSP00000410356:K50N|ENSP00000356212:K101T	K|K	+|+	3|2	2|0	VIP|VIP	153118168|153118168	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.950000|0.950000	0.60333|0.60333	3.243000|3.243000	0.51392|0.51392	1.087000|1.087000	0.41251|0.41251	0.533000|0.533000	0.62120|0.62120	AAA|AAG	VIP	-	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	ENSG00000146469		0.313	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VIP	HGNC	protein_coding	OTTHUMT00000042751.1	-	0.00	84	0	A			153076475	+1	tier1	-	no_errors	ENST00000367244	ensembl	human	known	74_37	missense	59.26	22	32	SNP	1.000	C
VWA5B1	127731	genome.wustl.edu	37	1	20637169	20637169	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:20637169C>T	ENST00000375079.2	+	2	271	c.75C>T	c.(73-75)agC>agT	p.S25S	VWA5B1_ENST00000289825.4_5'UTR|VWA5B1_ENST00000289815.8_Silent_p.S25S|RP4-745E8.2_ENST00000444923.1_RNA|VWA5B1_ENST00000375083.4_Silent_p.S25S	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	25	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						CCTGTGTCAGCGGTTATGCCC	0.642																																																	0													64.0	69.0	67.0					1																	20637169		692	1591	2283	SO:0001819	synonymous_variant	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.75C>T	1.37:g.20637169C>T			A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Silent	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S25	ENST00000375079.2	37	c.75		1																																																																																			VWA5B1	-	NULL	ENSG00000158816		0.642	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	-	0.00	55	0	C	XM_001722222		20637169	+1	tier1	-	no_errors	ENST00000289815	ensembl	human	known	74_37	silent	45.16	17	14	SNP	0.619	T
VWA5B1	127731	genome.wustl.edu	37	1	20637169	20637169	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:20637169C>T	ENST00000375079.2	+	2	271	c.75C>T	c.(73-75)agC>agT	p.S25S	VWA5B1_ENST00000289825.4_5'UTR|VWA5B1_ENST00000289815.8_Silent_p.S25S|RP4-745E8.2_ENST00000444923.1_RNA|VWA5B1_ENST00000375083.4_Silent_p.S25S	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	25	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.					extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						CCTGTGTCAGCGGTTATGCCC	0.642																																																	0													64.0	69.0	67.0					1																	20637169		692	1591	2283	SO:0001819	synonymous_variant	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.75C>T	1.37:g.20637169C>T			A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Silent	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S25	ENST00000375079.2	37	c.75		1																																																																																			VWA5B1	-	NULL	ENSG00000158816		0.642	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	-	0.00	57	0	C	XM_001722222		20637169	+1	tier1	-	no_errors	ENST00000289815	ensembl	human	known	74_37	silent	45.16	17	14	SNP	0.619	T
WDR33	55339	genome.wustl.edu	37	2	128477433	128477433	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:128477433C>T	ENST00000322313.4	-	16	2324	c.2166G>A	c.(2164-2166)ccG>ccA	p.P722P		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	722	Collagen-like.				mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GAGGGCCAGGCGGGCCTTGGG	0.637																																																	0													64.0	75.0	71.0					2																	128477433		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2166G>A	2.37:g.128477433C>T			Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P722	ENST00000322313.4	37	c.2166	CCDS2150.1	2																																																																																			WDR33	-	pfam_Collagen	ENSG00000136709		0.637	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	-	0.00	23	0	C	NM_018383		128477433	-1	tier1	-	no_errors	ENST00000322313	ensembl	human	known	74_37	silent	57.58	14	19	SNP	0.154	T
WDR33	55339	genome.wustl.edu	37	2	128477433	128477433	+	Silent	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:128477433C>T	ENST00000322313.4	-	16	2324	c.2166G>A	c.(2164-2166)ccG>ccA	p.P722P		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	722	Collagen-like.				mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		GAGGGCCAGGCGGGCCTTGGG	0.637																																																	0													64.0	75.0	71.0					2																	128477433		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.2166G>A	2.37:g.128477433C>T			Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Silent	SNP	pfam_WD40_repeat,pfam_Collagen,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P722	ENST00000322313.4	37	c.2166	CCDS2150.1	2																																																																																			WDR33	-	pfam_Collagen	ENSG00000136709		0.637	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR33	HGNC	protein_coding	OTTHUMT00000331141.2	-	0.00	47	0	C	NM_018383		128477433	-1	tier1	-	no_errors	ENST00000322313	ensembl	human	known	74_37	silent	57.58	14	19	SNP	0.154	T
WDR36	134430	genome.wustl.edu	37	5	110428069	110428069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr5:110428069G>T	ENST00000513710.2	+	1	87	c.83G>T	c.(82-84)aGg>aTg	p.R28M	WDR36_ENST00000505303.1_5'UTR|WDR36_ENST00000506538.2_Missense_Mutation_p.R28M|CTC-551A13.2_ENST00000507269.3_RNA			Q8NI36	WDR36_HUMAN	WD repeat domain 36	28					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.R28M(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CTCTGGCAGAGGACTGTTCCA	0.597																																																	1	Substitution - Missense(1)	large_intestine(1)											70.0	77.0	75.0					5																	110428069		2202	4300	6502	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.83G>T	5.37:g.110428069G>T	ENSP00000424628:p.Arg28Met		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R28M	ENST00000513710.2	37	c.83	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	10.51	1.371547	0.24771	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.68331	-0.32;-0.32	4.7	-1.8	0.07907	.	3.081050	0.01024	N	0.004035	T	0.45458	0.1343	N	0.08118	0	0.20196	N	0.999924	B	0.22683	0.073	B	0.25987	0.065	T	0.33624	-0.9861	10	0.87932	D	0	12.6157	2.0688	0.03609	0.1991:0.0992:0.3944:0.3072	.	28	Q8NI36	WDR36_HUMAN	M	28	ENSP00000423067:R28M;ENSP00000424628:R28M	ENSP00000423067:R28M	R	+	2	0	WDR36	110455968	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.650000	0.24858	-0.854000	0.04131	-1.944000	0.00493	AGG	WDR36	-	NULL	ENSG00000134987		0.597	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3		0.00	48	0	G	NM_139281		110428069	+1			no_errors	ENST00000506538	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.000	T
WDR47	22911	genome.wustl.edu	37	1	109538263	109538263	+	Missense_Mutation	SNP	G	G	T	rs537396112|rs141474361	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:109538263G>T	ENST00000369962.3	-	8	1852	c.1630C>A	c.(1630-1632)Cgt>Agt	p.R544S	WDR47_ENST00000357672.3_Missense_Mutation_p.R516S|WDR47_ENST00000361054.3_Missense_Mutation_p.R516S|WDR47_ENST00000400794.3_Missense_Mutation_p.R552S|WDR47_ENST00000369965.4_Missense_Mutation_p.R545S			O94967	WDR47_HUMAN	WD repeat domain 47	544					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		CCAGGATTACGAGGAGTGCTT	0.378																																																	0													262.0	261.0	261.0					1																	109538263		2203	4296	6499	SO:0001583	missense	0			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.1630C>A	1.37:g.109538263G>T	ENSP00000358979:p.Arg544Ser		A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R552S	ENST00000369962.3	37	c.1654	CCDS44187.1	1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643916	0.29246	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.55760	0.5;0.51;0.5;0.5;0.5	5.64	2.18	0.27775	.	0.430479	0.28589	N	0.014812	T	0.15652	0.0377	L	0.27053	0.805	0.36885	D	0.889579	B;B;B;B	0.23990	0.095;0.0;0.0;0.0	B;B;B;B	0.19391	0.025;0.001;0.0;0.0	T	0.06058	-1.0848	10	0.17832	T	0.49	0.0119	7.7717	0.29012	0.1646:0.0:0.7136:0.1218	.	516;552;544;545	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	S	552;544;516;545;516	ENSP00000383599:R552S;ENSP00000358979:R544S;ENSP00000354339:R516S;ENSP00000358982:R545S;ENSP00000350301:R516S	ENSP00000350301:R516S	R	-	1	0	WDR47	109339786	0.912000	0.30974	0.992000	0.48379	0.993000	0.82548	2.281000	0.43452	0.217000	0.20800	0.561000	0.74099	CGT	WDR47	-	NULL	ENSG00000085433		0.378	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR47	HGNC	protein_coding	OTTHUMT00000032414.2	-	0.00	54	0	G	NM_014969		109538263	-1	tier1	-	no_errors	ENST00000400794	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.943	T
WDR47	22911	genome.wustl.edu	37	1	109538263	109538263	+	Missense_Mutation	SNP	G	G	T	rs537396112|rs141474361	byFrequency	TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:109538263G>T	ENST00000369962.3	-	8	1852	c.1630C>A	c.(1630-1632)Cgt>Agt	p.R544S	WDR47_ENST00000357672.3_Missense_Mutation_p.R516S|WDR47_ENST00000361054.3_Missense_Mutation_p.R516S|WDR47_ENST00000400794.3_Missense_Mutation_p.R552S|WDR47_ENST00000369965.4_Missense_Mutation_p.R545S			O94967	WDR47_HUMAN	WD repeat domain 47	544					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20		all_lung(203;0.00519)|all_epithelial(167;0.00611)|Lung NSC(277;0.00822)		Colorectal(144;0.0165)|Lung(183;0.0484)|COAD - Colon adenocarcinoma(174;0.128)|Epithelial(280;0.168)|all cancers(265;0.201)|LUSC - Lung squamous cell carcinoma(189;0.244)		CCAGGATTACGAGGAGTGCTT	0.378																																																	0													262.0	261.0	261.0					1																	109538263		2203	4296	6499	SO:0001583	missense	0			AB020700	CCDS30787.1, CCDS44186.1, CCDS44187.1	1p13.3	2013-01-09			ENSG00000085433	ENSG00000085433		"""WD repeat domain containing"""	29141	protein-coding gene	gene with protein product		615734				10048485	Standard	NM_014969		Approved	KIAA0893	uc001dwl.3	O94967	OTTHUMG00000011734	ENST00000369962.3:c.1630C>A	1.37:g.109538263G>T	ENSP00000358979:p.Arg544Ser		A8MX09|Q5TYV7|Q5TYV8|Q5TYV9|Q8IXT7|Q8IYU9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_CTLH_C,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_CTLH_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R552S	ENST00000369962.3	37	c.1654	CCDS44187.1	1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643916	0.29246	.	.	ENSG00000085433	ENST00000400794;ENST00000369962;ENST00000361054;ENST00000369965;ENST00000357672	T;T;T;T;T	0.55760	0.5;0.51;0.5;0.5;0.5	5.64	2.18	0.27775	.	0.430479	0.28589	N	0.014812	T	0.15652	0.0377	L	0.27053	0.805	0.36885	D	0.889579	B;B;B;B	0.23990	0.095;0.0;0.0;0.0	B;B;B;B	0.19391	0.025;0.001;0.0;0.0	T	0.06058	-1.0848	10	0.17832	T	0.49	0.0119	7.7717	0.29012	0.1646:0.0:0.7136:0.1218	.	516;552;544;545	O94967-2;A8MX09;O94967;O94967-3	.;.;WDR47_HUMAN;.	S	552;544;516;545;516	ENSP00000383599:R552S;ENSP00000358979:R544S;ENSP00000354339:R516S;ENSP00000358982:R545S;ENSP00000350301:R516S	ENSP00000350301:R516S	R	-	1	0	WDR47	109339786	0.912000	0.30974	0.992000	0.48379	0.993000	0.82548	2.281000	0.43452	0.217000	0.20800	0.561000	0.74099	CGT	WDR47	-	NULL	ENSG00000085433		0.378	WDR47-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR47	HGNC	protein_coding	OTTHUMT00000032414.2	-	0.00	69	0	G	NM_014969		109538263	-1	tier1	-	no_errors	ENST00000400794	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.943	T
XKR5	389610	genome.wustl.edu	37	8	6668759	6668759	+	RNA	SNP	C	C	A	rs545052803		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:6668759C>A	ENST00000518724.1	-	0	2172							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		CTGTTCCCTGCAGCTGCAGTC	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21288	0.0		0.0	False		,,,				2504	0.0																0													55.0	51.0	52.0					8																	6668759		692	1591	2283			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6668759C>A			Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.537	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	-	0.00	52	0	C	NM_207411		6668759	-1	tier1	-	no_errors	ENST00000405979	ensembl	human	known	74_37	rna	23.19	53	16	SNP	0.000	A
XKR5	389610	genome.wustl.edu	37	8	6668759	6668759	+	RNA	SNP	C	C	A	rs545052803		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr8:6668759C>A	ENST00000518724.1	-	0	2172							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		CTGTTCCCTGCAGCTGCAGTC	0.537													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21288	0.0		0.0	False		,,,				2504	0.0																0													55.0	51.0	52.0					8																	6668759		692	1591	2283			0			AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6668759C>A			Q5GH74	RNA	SNP	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			XKR5	-	-	ENSG00000186530		0.537	XKR5-001	KNOWN	basic	processed_transcript	XKR5	HGNC	processed_transcript	OTTHUMT00000331969.2	-	0.00	54	0	C	NM_207411		6668759	-1	tier1	-	no_errors	ENST00000405979	ensembl	human	known	74_37	rna	23.19	53	16	SNP	0.000	A
ZC3H12C	85463	genome.wustl.edu	37	11	110035171	110035171	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:110035171C>T	ENST00000278590.3	+	6	1412	c.1361C>T	c.(1360-1362)aCg>aTg	p.T454M	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.T455M|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.T423M	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	454							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TCTAGAAATACGGCAGCCAAA	0.498																																																	0													59.0	61.0	60.0					11																	110035171		1928	4140	6068	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1361C>T	11.37:g.110035171C>T	ENSP00000278590:p.Thr454Met		B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.T454M	ENST00000278590.3	37	c.1361	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587661	0.46110	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.31769	1.48;1.48;1.49	5.85	5.85	0.93711	.	0.179430	0.50627	D	0.000117	T	0.28665	0.0710	N	0.08118	0	0.37360	D	0.911184	D;D;D	0.67145	0.99;0.996;0.996	P;P;P	0.53689	0.572;0.732;0.732	T	0.32455	-0.9906	10	0.62326	D	0.03	-19.3538	15.635	0.76944	0.0:0.8634:0.1366:0.0	.	455;454;454	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	M	454;455;423	ENSP00000278590:T454M;ENSP00000431821:T455M;ENSP00000413094:T423M	ENSP00000278590:T454M	T	+	2	0	ZC3H12C	109540381	0.998000	0.40836	0.975000	0.42487	0.407000	0.30961	3.224000	0.51238	2.771000	0.95319	0.561000	0.74099	ACG	ZC3H12C	-	NULL	ENSG00000149289		0.498	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	-	0.00	48	0	C	NM_033390		110035171	+1	tier1	-	no_errors	ENST00000278590	ensembl	human	known	74_37	missense	33.33	30	15	SNP	0.876	T
ZC3H12C	85463	genome.wustl.edu	37	11	110035171	110035171	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:110035171C>T	ENST00000278590.3	+	6	1412	c.1361C>T	c.(1360-1362)aCg>aTg	p.T454M	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.T455M|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.T423M	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	454							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		TCTAGAAATACGGCAGCCAAA	0.498																																																	0													59.0	61.0	60.0					11																	110035171		1928	4140	6068	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.1361C>T	11.37:g.110035171C>T	ENSP00000278590:p.Thr454Met		B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.T454M	ENST00000278590.3	37	c.1361	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587661	0.46110	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.31769	1.48;1.48;1.49	5.85	5.85	0.93711	.	0.179430	0.50627	D	0.000117	T	0.28665	0.0710	N	0.08118	0	0.37360	D	0.911184	D;D;D	0.67145	0.99;0.996;0.996	P;P;P	0.53689	0.572;0.732;0.732	T	0.32455	-0.9906	10	0.62326	D	0.03	-19.3538	15.635	0.76944	0.0:0.8634:0.1366:0.0	.	455;454;454	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	M	454;455;423	ENSP00000278590:T454M;ENSP00000431821:T455M;ENSP00000413094:T423M	ENSP00000278590:T454M	T	+	2	0	ZC3H12C	109540381	0.998000	0.40836	0.975000	0.42487	0.407000	0.30961	3.224000	0.51238	2.771000	0.95319	0.561000	0.74099	ACG	ZC3H12C	-	NULL	ENSG00000149289		0.498	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	-	0.00	51	0	C	NM_033390		110035171	+1	tier1	-	no_errors	ENST00000278590	ensembl	human	known	74_37	missense	33.33	30	15	SNP	0.876	T
ZBTB16	7704	genome.wustl.edu	37	11	114118040	114118040	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:114118040A>G	ENST00000335953.4	+	6	2125	c.1745A>G	c.(1744-1746)aAg>aGg	p.K582R	ZBTB16_ENST00000535379.1_3'UTR|RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000392996.2_Missense_Mutation_p.K582R	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	582					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TGTGGCAAGAAGTTCAGCCTC	0.597																																																	0													98.0	77.0	84.0					11																	114118040		2201	4296	6497	SO:0001583	missense	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1745A>G	11.37:g.114118040A>G	ENSP00000338157:p.Lys582Arg		Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.K582R	ENST00000335953.4	37	c.1745	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	a	13.40	2.224754	0.39300	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.17691	2.26;2.26	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.065068	0.64402	D	0.000012	T	0.23649	0.0572	N	0.05619	-0.005	0.50632	D	0.99988	D	0.69078	0.997	D	0.80764	0.994	T	0.30650	-0.9971	10	0.59425	D	0.04	.	15.7234	0.77732	1.0:0.0:0.0:0.0	.	582	Q05516	ZBT16_HUMAN	R	582;582;459	ENSP00000338157:K582R;ENSP00000376721:K582R	ENSP00000309507:K459R	K	+	2	0	ZBTB16	113623250	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.239000	0.95389	2.113000	0.64589	0.529000	0.55759	AAG	ZBTB16	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000109906		0.597	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	-	0.00	44	0	A	NM_006006		114118040	+1	tier1	-	no_errors	ENST00000335953	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
ZBTB16	7704	genome.wustl.edu	37	11	114118040	114118040	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:114118040A>G	ENST00000335953.4	+	6	2125	c.1745A>G	c.(1744-1746)aAg>aGg	p.K582R	ZBTB16_ENST00000535379.1_3'UTR|RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000392996.2_Missense_Mutation_p.K582R	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	582					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		TGTGGCAAGAAGTTCAGCCTC	0.597																																																	0													98.0	77.0	84.0					11																	114118040		2201	4296	6497	SO:0001583	missense	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1745A>G	11.37:g.114118040A>G	ENSP00000338157:p.Lys582Arg		Q8TAL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.K582R	ENST00000335953.4	37	c.1745	CCDS8367.1	11	.	.	.	.	.	.	.	.	.	.	a	13.40	2.224754	0.39300	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.17691	2.26;2.26	5.57	5.57	0.84162	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.065068	0.64402	D	0.000012	T	0.23649	0.0572	N	0.05619	-0.005	0.50632	D	0.99988	D	0.69078	0.997	D	0.80764	0.994	T	0.30650	-0.9971	10	0.59425	D	0.04	.	15.7234	0.77732	1.0:0.0:0.0:0.0	.	582	Q05516	ZBT16_HUMAN	R	582;582;459	ENSP00000338157:K582R;ENSP00000376721:K582R	ENSP00000309507:K459R	K	+	2	0	ZBTB16	113623250	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.239000	0.95389	2.113000	0.64589	0.529000	0.55759	AAG	ZBTB16	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000109906		0.597	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1	-	0.00	50	0	A	NM_006006		114118040	+1	tier1	-	no_errors	ENST00000335953	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
ZIC4	84107	genome.wustl.edu	37	3	147113975	147113975	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:147113975G>A	ENST00000383075.3	-	3	864	c.352C>T	c.(352-354)Cgc>Tgc	p.R118C	ZIC4_ENST00000525172.2_Missense_Mutation_p.R168C|ZIC4_ENST00000484399.1_Missense_Mutation_p.R118C|ZIC4_ENST00000473123.1_Missense_Mutation_p.R118C|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000425731.3_Missense_Mutation_p.R156C	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	118						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CGCATGTAGCGGAAGAAAGCG	0.662																																																	0													32.0	38.0	36.0					3																	147113975		2199	4299	6498	SO:0001583	missense	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.352C>T	3.37:g.147113975G>A	ENSP00000372553:p.Arg118Cys		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R168C	ENST00000383075.3	37	c.502	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.066753	0.93898	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	4.98	4.98	0.66077	.	0.000000	0.47093	D	0.000253	T	0.72203	0.3431	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.962;0.991	T	0.77744	-0.2473	10	0.87932	D	0	.	18.2471	0.89989	0.0:0.0:1.0:0.0	.	168;118	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	C	118;156;168;118;118;118	ENSP00000372553:R118C;ENSP00000397695:R156C;ENSP00000435509:R168C;ENSP00000417855:R118C;ENSP00000420775:R118C;ENSP00000420627:R118C	ENSP00000372553:R118C	R	-	1	0	ZIC4	148596665	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.640000	0.83355	2.299000	0.77371	0.561000	0.74099	CGC	ZIC4	-	NULL	ENSG00000174963		0.662	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	18	0	G			147113975	-1	tier1	-	no_errors	ENST00000525172	ensembl	human	known	74_37	missense	60.00	10	15	SNP	1.000	A
ZIC4	84107	genome.wustl.edu	37	3	147113975	147113975	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:147113975G>A	ENST00000383075.3	-	3	864	c.352C>T	c.(352-354)Cgc>Tgc	p.R118C	ZIC4_ENST00000525172.2_Missense_Mutation_p.R168C|ZIC4_ENST00000484399.1_Missense_Mutation_p.R118C|ZIC4_ENST00000473123.1_Missense_Mutation_p.R118C|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000425731.3_Missense_Mutation_p.R156C	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4	118						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CGCATGTAGCGGAAGAAAGCG	0.662																																																	0													32.0	38.0	36.0					3																	147113975		2199	4299	6498	SO:0001583	missense	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.352C>T	3.37:g.147113975G>A	ENSP00000372553:p.Arg118Cys		A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R168C	ENST00000383075.3	37	c.502	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.066753	0.93898	.	.	ENSG00000174963	ENST00000383075;ENST00000425731;ENST00000525172;ENST00000484399;ENST00000473123;ENST00000462748	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	4.98	4.98	0.66077	.	0.000000	0.47093	D	0.000253	T	0.72203	0.3431	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.962;0.991	T	0.77744	-0.2473	10	0.87932	D	0	.	18.2471	0.89989	0.0:0.0:1.0:0.0	.	168;118	B7Z2L2;Q8N9L1	.;ZIC4_HUMAN	C	118;156;168;118;118;118	ENSP00000372553:R118C;ENSP00000397695:R156C;ENSP00000435509:R168C;ENSP00000417855:R118C;ENSP00000420775:R118C;ENSP00000420627:R118C	ENSP00000372553:R118C	R	-	1	0	ZIC4	148596665	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.640000	0.83355	2.299000	0.77371	0.561000	0.74099	CGC	ZIC4	-	NULL	ENSG00000174963		0.662	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	26	0	G			147113975	-1	tier1	-	no_errors	ENST00000525172	ensembl	human	known	74_37	missense	60.00	10	15	SNP	1.000	A
ZMYND15	84225	genome.wustl.edu	37	17	4646627	4646627	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr17:4646627G>T	ENST00000433935.1	+	6	1231	c.1174G>T	c.(1174-1176)Gcc>Tcc	p.A392S	ZMYND15_ENST00000592813.1_Missense_Mutation_p.A392S|ZMYND15_ENST00000573751.2_Missense_Mutation_p.A392S|ZMYND15_ENST00000269289.6_Missense_Mutation_p.A392S	NM_001136046.2|NM_001267822.1	NP_001129518.1|NP_001254751.1	Q9H091	ZMY15_HUMAN	zinc finger, MYND-type containing 15	392					negative regulation of transcription, DNA-templated (GO:0045892)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)	18						CAACAAAGAGGCCTTCCTGGC	0.567																																																	0													111.0	122.0	118.0					17																	4646627		2203	4300	6503	SO:0001583	missense	0			AL136893	CCDS11053.1, CCDS45584.1, CCDS58506.1	17p13.3	2008-05-02			ENSG00000141497	ENSG00000141497		"""Zinc fingers, MYND-type"""	20997	protein-coding gene	gene with protein product		614312				11230166	Standard	NM_001136046		Approved	DKFZp434N127	uc002fyu.3	Q9H091	OTTHUMG00000090760	ENST00000433935.1:c.1174G>T	17.37:g.4646627G>T	ENSP00000391742:p.Ala392Ser		B4DXY5|I3L296	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.A392S	ENST00000433935.1	37	c.1174	CCDS45584.1	17	.	.	.	.	.	.	.	.	.	.	G	16.95	3.263134	0.59431	.	.	ENSG00000141497	ENST00000433935;ENST00000269289	T;T	0.44083	0.93;0.97	5.75	5.75	0.90469	.	0.236212	0.30028	N	0.010591	T	0.47284	0.1437	N	0.19112	0.55	0.30590	N	0.761643	D;D	0.69078	0.997;0.994	D;D	0.70716	0.914;0.97	T	0.47522	-0.9111	10	0.38643	T	0.18	-18.1837	13.0767	0.59091	0.0:0.1612:0.8388:0.0	.	392;392	B4DXY5;Q9H091	.;ZMY15_HUMAN	S	392	ENSP00000391742:A392S;ENSP00000269289:A392S	ENSP00000269289:A392S	A	+	1	0	ZMYND15	4593376	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.759000	0.47573	2.700000	0.92200	0.563000	0.77884	GCC	ZMYND15	-	NULL	ENSG00000141497		0.567	ZMYND15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYND15	HGNC	protein_coding	OTTHUMT00000439580.1		0.00	68	0	G	NM_032265		4646627	+1			no_errors	ENST00000433935	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
ZNF208	7757	genome.wustl.edu	37	19	22154774	22154774	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:22154774T>G	ENST00000397126.4	-	4	3210	c.3062A>C	c.(3061-3063)aAa>aCa	p.K1021T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1021					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGTGTGAATTTTCTTATGTTC	0.408																																																	0													98.0	104.0	102.0					19																	22154774		2114	4250	6364	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3062A>C	19.37:g.22154774T>G	ENSP00000380315:p.Lys1021Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K1021T	ENST00000397126.4	37	c.3062	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384390	0.25031	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.24908	1.83	2.58	-0.0893	0.13669	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	.	.	.	0.09310	N	1	B	0.29716	0.255	B	0.29663	0.105	T	0.22068	-1.0227	8	0.54805	T	0.06	.	4.5589	0.12151	0.3715:0.5069:0.0:0.1215	.	893	O43345	ZN208_HUMAN	T	1021;893	ENSP00000380315:K1021T	ENSP00000380315:K1021T	K	-	2	0	ZNF208	21946614	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.578000	0.05841	-0.323000	0.08602	-0.804000	0.03201	AAA	ZNF208	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.408	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	42	0	T	NM_007153		22154774	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	32.50	27	13	SNP	0.003	G
ZNF208	7757	genome.wustl.edu	37	19	22154774	22154774	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:22154774T>G	ENST00000397126.4	-	4	3210	c.3062A>C	c.(3061-3063)aAa>aCa	p.K1021T	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	1021					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGTGTGAATTTTCTTATGTTC	0.408																																																	0													98.0	104.0	102.0					19																	22154774		2114	4250	6364	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.3062A>C	19.37:g.22154774T>G	ENSP00000380315:p.Lys1021Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K1021T	ENST00000397126.4	37	c.3062	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	10.56	1.384390	0.25031	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.24908	1.83	2.58	-0.0893	0.13669	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16642	0.0400	.	.	.	0.09310	N	1	B	0.29716	0.255	B	0.29663	0.105	T	0.22068	-1.0227	8	0.54805	T	0.06	.	4.5589	0.12151	0.3715:0.5069:0.0:0.1215	.	893	O43345	ZN208_HUMAN	T	1021;893	ENSP00000380315:K1021T	ENSP00000380315:K1021T	K	-	2	0	ZNF208	21946614	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.578000	0.05841	-0.323000	0.08602	-0.804000	0.03201	AAA	ZNF208	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.408	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	46	0	T	NM_007153		22154774	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	32.50	27	13	SNP	0.003	G
ZNF208	7757	genome.wustl.edu	37	19	22157548	22157548	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:22157548T>C	ENST00000397126.4	-	4	436	c.288A>G	c.(286-288)caA>caG	p.Q96Q	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Silent_p.Q96Q	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATATCACTTTTTGGAAAGAAT	0.328																																																	0													42.0	42.0	42.0					19																	22157548		2039	4235	6274	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.288A>G	19.37:g.22157548T>C				Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.Q96	ENST00000397126.4	37	c.288	CCDS54240.1	19																																																																																			ZNF208	-	NULL	ENSG00000160321		0.328	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	76	0	T	NM_007153		22157548	-1	tier1	-	no_errors	ENST00000599916	ensembl	human	putative	74_37	silent	39.22	31	20	SNP	0.222	C
ZNF208	7757	genome.wustl.edu	37	19	22157548	22157548	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:22157548T>C	ENST00000397126.4	-	4	436	c.288A>G	c.(286-288)caA>caG	p.Q96Q	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Silent_p.Q96Q	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	96					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATATCACTTTTTGGAAAGAAT	0.328																																																	0													42.0	42.0	42.0					19																	22157548		2039	4235	6274	SO:0001819	synonymous_variant	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.288A>G	19.37:g.22157548T>C				Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.Q96	ENST00000397126.4	37	c.288	CCDS54240.1	19																																																																																			ZNF208	-	NULL	ENSG00000160321		0.328	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	79	0	T	NM_007153		22157548	-1	tier1	-	no_errors	ENST00000599916	ensembl	human	putative	74_37	silent	39.22	31	20	SNP	0.222	C
ZNF215	7762	genome.wustl.edu	37	11	6953724	6953724	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:6953724T>G	ENST00000278319.5	+	3	809	c.221T>G	c.(220-222)cTt>cGt	p.L74R	ZNF215_ENST00000529903.1_Missense_Mutation_p.L74R|ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000414517.2_Missense_Mutation_p.L74R	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	74	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GAGCTCTGTCTTCAATGGCTG	0.473																																																	0													70.0	74.0	73.0					11																	6953724		2201	4296	6497	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.221T>G	11.37:g.6953724T>G	ENSP00000278319:p.Leu74Arg		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L74R	ENST00000278319.5	37	c.221	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	T	11.10	1.539994	0.27563	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.04706	3.57;3.57;3.57	4.01	2.85	0.33270	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.503504	0.14919	N	0.290787	T	0.05456	0.0144	N	0.11131	0.1	0.27176	N	0.9608	D;D;P	0.54772	0.968;0.968;0.863	P;P;P	0.58331	0.837;0.837;0.728	T	0.40664	-0.9551	10	0.23891	T	0.37	-1.3864	6.65	0.22957	0.2112:0.0:0.0:0.7888	.	74;74;74	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	R	74	ENSP00000278319:L74R;ENSP00000393202:L74R;ENSP00000432306:L74R	ENSP00000278319:L74R	L	+	2	0	ZNF215	6910300	0.994000	0.37717	0.979000	0.43373	0.911000	0.54048	0.178000	0.16820	0.832000	0.34804	0.459000	0.35465	CTT	ZNF215	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000149054		0.473	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	-	0.00	28	0	T			6953724	+1	tier1	-	no_errors	ENST00000278319	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.988	G
ZNF215	7762	genome.wustl.edu	37	11	6953724	6953724	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr11:6953724T>G	ENST00000278319.5	+	3	809	c.221T>G	c.(220-222)cTt>cGt	p.L74R	ZNF215_ENST00000529903.1_Missense_Mutation_p.L74R|ZNF215_ENST00000527171.1_3'UTR|ZNF215_ENST00000414517.2_Missense_Mutation_p.L74R	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	74	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		GAGCTCTGTCTTCAATGGCTG	0.473																																																	0													70.0	74.0	73.0					11																	6953724		2201	4296	6497	SO:0001583	missense	0			AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.221T>G	11.37:g.6953724T>G	ENSP00000278319:p.Leu74Arg		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.L74R	ENST00000278319.5	37	c.221	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	T	11.10	1.539994	0.27563	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.04706	3.57;3.57;3.57	4.01	2.85	0.33270	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.503504	0.14919	N	0.290787	T	0.05456	0.0144	N	0.11131	0.1	0.27176	N	0.9608	D;D;P	0.54772	0.968;0.968;0.863	P;P;P	0.58331	0.837;0.837;0.728	T	0.40664	-0.9551	10	0.23891	T	0.37	-1.3864	6.65	0.22957	0.2112:0.0:0.0:0.7888	.	74;74;74	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	R	74	ENSP00000278319:L74R;ENSP00000393202:L74R;ENSP00000432306:L74R	ENSP00000278319:L74R	L	+	2	0	ZNF215	6910300	0.994000	0.37717	0.979000	0.43373	0.911000	0.54048	0.178000	0.16820	0.832000	0.34804	0.459000	0.35465	CTT	ZNF215	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000149054		0.473	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	-	0.00	36	0	T			6953724	+1	tier1	-	no_errors	ENST00000278319	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.988	G
ZNF385D	79750	genome.wustl.edu	37	3	21478450	21478450	+	Intron	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:21478450G>A	ENST00000281523.2	-	5	1192				ZNF385D_ENST00000494118.1_5'Flank	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						AAAAGAAATCGCTGCATCTCA	0.463																																																	0													85.0	71.0	76.0					3																	21478450		2203	4300	6503	SO:0001627	intron_variant	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.673+11C>T	3.37:g.21478450G>A				RNA	SNP	-	NULL	ENST00000281523.2	37	NULL	CCDS2636.1	3																																																																																			ZNF385D	-	-	ENSG00000151789		0.463	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	102	0	G	NM_024697		21478450	-1	tier1	-	no_errors	ENST00000495739	ensembl	human	putative	74_37	rna	45.61	30	26	SNP	0.000	A
ZNF385D	79750	genome.wustl.edu	37	3	21478450	21478450	+	Intron	SNP	G	G	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr3:21478450G>A	ENST00000281523.2	-	5	1192				ZNF385D_ENST00000494118.1_5'Flank	NM_024697.2	NP_078973.1	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(1)|prostate(1)|skin(4)	46						AAAAGAAATCGCTGCATCTCA	0.463																																																	0													85.0	71.0	76.0					3																	21478450		2203	4300	6503	SO:0001627	intron_variant	0			BC007212	CCDS2636.1	3p24.3	2012-10-05	2007-12-06	2007-12-06	ENSG00000151789	ENSG00000151789			26191	protein-coding gene	gene with protein product			"""zinc finger protein 659"""	ZNF659		12477932	Standard	NM_024697		Approved	FLJ22419	uc003cce.3	Q9H6B1	OTTHUMG00000130484	ENST00000281523.2:c.673+11C>T	3.37:g.21478450G>A				RNA	SNP	-	NULL	ENST00000281523.2	37	NULL	CCDS2636.1	3																																																																																			ZNF385D	-	-	ENSG00000151789		0.463	ZNF385D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385D	HGNC	protein_coding	OTTHUMT00000252884.1	-	0.00	83	0	G	NM_024697		21478450	-1	tier1	-	no_errors	ENST00000495739	ensembl	human	putative	74_37	rna	45.61	30	26	SNP	0.000	A
ZNF461	92283	genome.wustl.edu	37	19	37130776	37130776	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:37130776T>C	ENST00000588268.1	-	6	698	c.471A>G	c.(469-471)caA>caG	p.Q157Q	ZNF461_ENST00000360357.4_Silent_p.Q134Q|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AACCCTCCTCTTGTCCCTGAT	0.368																																																	0													249.0	243.0	245.0					19																	37130776		1863	4112	5975	SO:0001819	synonymous_variant	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.471A>G	19.37:g.37130776T>C			A8K9W9|Q6VSF7|Q9ULZ8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q157	ENST00000588268.1	37	c.471	CCDS54257.1	19																																																																																			ZNF461	-	NULL	ENSG00000197808		0.368	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	0.00	60	0	T	NM_153257		37130776	-1	tier1	-	no_errors	ENST00000588268	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.022	C
ZNF461	92283	genome.wustl.edu	37	19	37130776	37130776	+	Silent	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:37130776T>C	ENST00000588268.1	-	6	698	c.471A>G	c.(469-471)caA>caG	p.Q157Q	ZNF461_ENST00000360357.4_Silent_p.Q134Q|ZNF461_ENST00000540605.2_5'UTR	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			AACCCTCCTCTTGTCCCTGAT	0.368																																																	0													249.0	243.0	245.0					19																	37130776		1863	4112	5975	SO:0001819	synonymous_variant	0			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7		ENST00000588268.1:c.471A>G	19.37:g.37130776T>C			A8K9W9|Q6VSF7|Q9ULZ8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q157	ENST00000588268.1	37	c.471	CCDS54257.1	19																																																																																			ZNF461	-	NULL	ENSG00000197808		0.368	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	0.00	98	0	T	NM_153257		37130776	-1	tier1	-	no_errors	ENST00000588268	ensembl	human	known	74_37	silent	20.00	32	8	SNP	0.022	C
ZNF568	374900	genome.wustl.edu	37	19	37441118	37441118	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:37441118A>C	ENST00000333987.7	+	7	1569	c.1063A>C	c.(1063-1065)Att>Ctt	p.I355L	ZNF568_ENST00000455427.2_Intron|ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.I291L	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	355					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GCACGAGAAAATTCATACTGG	0.408																																																	0													71.0	79.0	76.0					19																	37441118		2199	4294	6493	SO:0001583	missense	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.1063A>C	19.37:g.37441118A>C	ENSP00000334685:p.Ile355Leu		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I355L	ENST00000333987.7	37	c.1063	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	A	21.3	4.121419	0.77436	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.35421	1.31;1.31	4.22	3.17	0.36434	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.207227	0.24352	N	0.039280	T	0.30008	0.0751	L	0.40543	1.245	0.80722	D	1	B	0.32382	0.368	B	0.36092	0.217	T	0.08576	-1.0715	10	0.56958	D	0.05	.	8.3042	0.32032	0.9007:0.0:0.0993:0.0	.	355	Q3ZCX4	ZN568_HUMAN	L	355;291	ENSP00000334685:I355L;ENSP00000394514:I291L	ENSP00000334685:I355L	I	+	1	0	ZNF568	42132958	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.764000	0.26532	0.714000	0.32081	0.533000	0.62120	ATT	ZNF568	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198453		0.408	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	-	0.00	44	0	A	NM_198539		37441118	+1	tier1	-	no_errors	ENST00000333987	ensembl	human	known	74_37	missense	42.86	16	12	SNP	1.000	C
ZNF648	127665	genome.wustl.edu	37	1	182026736	182026736	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:182026736T>C	ENST00000339948.3	-	2	617	c.410A>G	c.(409-411)cAg>cGg	p.Q137R		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGGTTGCATCTGACCTAACAA	0.567																																					NSCLC(71;908 1374 5429 20458 35642)												0													86.0	83.0	84.0					1																	182026736		2203	4300	6503	SO:0001583	missense	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.410A>G	1.37:g.182026736T>C	ENSP00000344129:p.Gln137Arg		B2RP16	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q137R	ENST00000339948.3	37	c.410	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	T	5.261	0.233640	0.09969	.	.	ENSG00000179930	ENST00000339948	T	0.08193	3.12	2.71	-5.43	0.02632	.	.	.	.	.	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39482	-0.9612	9	0.39692	T	0.17	.	4.2904	0.10876	0.1228:0.4719:0.2487:0.1566	.	137	Q5T619	ZN648_HUMAN	R	137	ENSP00000344129:Q137R	ENSP00000344129:Q137R	Q	-	2	0	ZNF648	180293359	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	-1.873000	0.01637	-2.283000	0.00672	0.533000	0.62120	CAG	ZNF648	-	NULL	ENSG00000179930		0.567	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	-	0.00	21	0	T	XM_060597		182026736	-1	tier1	-	no_errors	ENST00000339948	ensembl	human	novel	74_37	missense	36.84	24	14	SNP	0.000	C
ZNF648	127665	genome.wustl.edu	37	1	182026736	182026736	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr1:182026736T>C	ENST00000339948.3	-	2	617	c.410A>G	c.(409-411)cAg>cGg	p.Q137R		NM_001009992.1	NP_001009992.1	Q5T619	ZN648_HUMAN	zinc finger protein 648	137					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|large_intestine(10)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	40						AGGTTGCATCTGACCTAACAA	0.567																																					NSCLC(71;908 1374 5429 20458 35642)												0													86.0	83.0	84.0					1																	182026736		2203	4300	6503	SO:0001583	missense	0			AK128654	CCDS30952.1	1q25.3	2013-01-08			ENSG00000179930	ENSG00000179930		"""Zinc fingers, C2H2-type"""	18190	protein-coding gene	gene with protein product							Standard	NM_001009992		Approved	FLJ46813	uc001goz.3	Q5T619	OTTHUMG00000037302	ENST00000339948.3:c.410A>G	1.37:g.182026736T>C	ENSP00000344129:p.Gln137Arg		B2RP16	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q137R	ENST00000339948.3	37	c.410	CCDS30952.1	1	.	.	.	.	.	.	.	.	.	.	T	5.261	0.233640	0.09969	.	.	ENSG00000179930	ENST00000339948	T	0.08193	3.12	2.71	-5.43	0.02632	.	.	.	.	.	T	0.03305	0.0096	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39482	-0.9612	9	0.39692	T	0.17	.	4.2904	0.10876	0.1228:0.4719:0.2487:0.1566	.	137	Q5T619	ZN648_HUMAN	R	137	ENSP00000344129:Q137R	ENSP00000344129:Q137R	Q	-	2	0	ZNF648	180293359	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	-1.873000	0.01637	-2.283000	0.00672	0.533000	0.62120	CAG	ZNF648	-	NULL	ENSG00000179930		0.567	ZNF648-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF648	HGNC	protein_coding	OTTHUMT00000090794.1	-	0.00	36	0	T	XM_060597		182026736	-1	tier1	-	no_errors	ENST00000339948	ensembl	human	novel	74_37	missense	36.84	24	14	SNP	0.000	C
ZNF763	284390	genome.wustl.edu	37	19	12089188	12089188	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:12089188A>C	ENST00000358987.3	+	4	576	c.449A>C	c.(448-450)aAg>aCg	p.K150T	ZNF763_ENST00000545530.1_Missense_Mutation_p.K28T|ZNF763_ENST00000592625.1_3'UTR|ZNF763_ENST00000343949.5_Missense_Mutation_p.K153T|ZNF763_ENST00000590798.1_Missense_Mutation_p.K170T|ZNF763_ENST00000538752.1_Missense_Mutation_p.K170T			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CAACAACCTAAGAAAGCCTTC	0.408																																																	0													140.0	144.0	143.0					19																	12089188		2201	4300	6501	SO:0001583	missense	0			AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.449A>C	19.37:g.12089188A>C	ENSP00000402017:p.Lys150Thr		B3KRU3|B4DRE7	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K170T	ENST00000358987.3	37	c.509		19	.	.	.	.	.	.	.	.	.	.	a	11.56	1.674526	0.29693	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	T;T;T;T	0.06608	3.4;3.38;3.28;3.38	1.68	-0.389	0.12455	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12050	0.0293	L	0.36672	1.1	0.09310	N	1	D;D;D	0.71674	0.989;0.998;0.968	D;D;P	0.72982	0.979;0.914;0.859	T	0.20638	-1.0269	9	0.87932	D	0	.	4.7237	0.12931	0.5626:0.0:0.4374:0.0	.	170;150;153	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	T	170;153;28;150	ENSP00000438117:K170T;ENSP00000369774:K153T;ENSP00000446166:K28T;ENSP00000402017:K150T	ENSP00000369774:K153T	K	+	2	0	ZNF763	11950188	.	.	0.000000	0.03702	0.044000	0.14063	.	.	-0.288000	0.09051	0.164000	0.16699	AAG	ZNF763	-	pfscan_Znf_C2H2	ENSG00000197054		0.408	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF763	HGNC	protein_coding	OTTHUMT00000344158.1	-	0.00	44	0	A	NM_001012753		12089188	+1	tier1	-	no_errors	ENST00000538752	ensembl	human	known	74_37	missense	30.95	29	13	SNP	0.000	C
ZNF763	284390	genome.wustl.edu	37	19	12089188	12089188	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:12089188A>C	ENST00000358987.3	+	4	576	c.449A>C	c.(448-450)aAg>aCg	p.K150T	ZNF763_ENST00000545530.1_Missense_Mutation_p.K28T|ZNF763_ENST00000592625.1_3'UTR|ZNF763_ENST00000343949.5_Missense_Mutation_p.K153T|ZNF763_ENST00000590798.1_Missense_Mutation_p.K170T|ZNF763_ENST00000538752.1_Missense_Mutation_p.K170T			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	150					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						CAACAACCTAAGAAAGCCTTC	0.408																																																	0													140.0	144.0	143.0					19																	12089188		2201	4300	6501	SO:0001583	missense	0			AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.449A>C	19.37:g.12089188A>C	ENSP00000402017:p.Lys150Thr		B3KRU3|B4DRE7	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K170T	ENST00000358987.3	37	c.509		19	.	.	.	.	.	.	.	.	.	.	a	11.56	1.674526	0.29693	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	T;T;T;T	0.06608	3.4;3.38;3.28;3.38	1.68	-0.389	0.12455	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12050	0.0293	L	0.36672	1.1	0.09310	N	1	D;D;D	0.71674	0.989;0.998;0.968	D;D;P	0.72982	0.979;0.914;0.859	T	0.20638	-1.0269	9	0.87932	D	0	.	4.7237	0.12931	0.5626:0.0:0.4374:0.0	.	170;150;153	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	T	170;153;28;150	ENSP00000438117:K170T;ENSP00000369774:K153T;ENSP00000446166:K28T;ENSP00000402017:K150T	ENSP00000369774:K153T	K	+	2	0	ZNF763	11950188	.	.	0.000000	0.03702	0.044000	0.14063	.	.	-0.288000	0.09051	0.164000	0.16699	AAG	ZNF763	-	pfscan_Znf_C2H2	ENSG00000197054		0.408	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF763	HGNC	protein_coding	OTTHUMT00000344158.1	-	0.00	61	0	A	NM_001012753		12089188	+1	tier1	-	no_errors	ENST00000538752	ensembl	human	known	74_37	missense	30.95	29	13	SNP	0.000	C
ZNF681	148213	genome.wustl.edu	37	19	23927261	23927261	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:23927261T>C	ENST00000402377.3	-	4	1232	c.1091A>G	c.(1090-1092)aAg>aGg	p.K364R	ZNF681_ENST00000395385.3_Missense_Mutation_p.K295R	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TCTGTAGGGCTTCTCTCCAGT	0.408																																																	0													60.0	65.0	63.0					19																	23927261		2202	4299	6501	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1091A>G	19.37:g.23927261T>C	ENSP00000384000:p.Lys364Arg		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K364R	ENST00000402377.3	37	c.1091	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	13.71	2.317672	0.40996	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.24908	1.83;1.83	1.64	0.471	0.16752	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15176	0.0366	N	0.20574	0.59	0.24408	N	0.994671	P	0.38110	0.618	B	0.38880	0.284	T	0.16276	-1.0408	9	0.62326	D	0.03	.	4.69	0.12776	0.0:0.2018:0.0:0.7982	.	364	Q96N22	ZN681_HUMAN	R	364;295	ENSP00000384000:K364R;ENSP00000378783:K295R	ENSP00000378783:K295R	K	-	2	0	ZNF681	23719101	0.348000	0.24861	0.015000	0.15790	0.028000	0.11728	0.386000	0.20702	-0.086000	0.12550	0.383000	0.25322	AAG	ZNF681	-	pfscan_Znf_C2H2	ENSG00000196172		0.408	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	37	0	T	NM_138286		23927261	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	25.93	20	7	SNP	0.937	C
ZNF681	148213	genome.wustl.edu	37	19	23927261	23927261	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:23927261T>C	ENST00000402377.3	-	4	1232	c.1091A>G	c.(1090-1092)aAg>aGg	p.K364R	ZNF681_ENST00000395385.3_Missense_Mutation_p.K295R	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	364					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TCTGTAGGGCTTCTCTCCAGT	0.408																																																	0													60.0	65.0	63.0					19																	23927261		2202	4299	6501	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.1091A>G	19.37:g.23927261T>C	ENSP00000384000:p.Lys364Arg		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K364R	ENST00000402377.3	37	c.1091	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	13.71	2.317672	0.40996	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.24908	1.83;1.83	1.64	0.471	0.16752	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15176	0.0366	N	0.20574	0.59	0.24408	N	0.994671	P	0.38110	0.618	B	0.38880	0.284	T	0.16276	-1.0408	9	0.62326	D	0.03	.	4.69	0.12776	0.0:0.2018:0.0:0.7982	.	364	Q96N22	ZN681_HUMAN	R	364;295	ENSP00000384000:K364R;ENSP00000378783:K295R	ENSP00000378783:K295R	K	-	2	0	ZNF681	23719101	0.348000	0.24861	0.015000	0.15790	0.028000	0.11728	0.386000	0.20702	-0.086000	0.12550	0.383000	0.25322	AAG	ZNF681	-	pfscan_Znf_C2H2	ENSG00000196172		0.408	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	56	0	T	NM_138286		23927261	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	25.93	20	7	SNP	0.937	C
ZNF804A	91752	genome.wustl.edu	37	2	185802592	185802592	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:185802592T>G	ENST00000302277.6	+	4	3063	c.2469T>G	c.(2467-2469)ttT>ttG	p.F823L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	823							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ACCCCGGATTTGAAACTTTAG	0.383																																																	0													42.0	48.0	46.0					2																	185802592		2200	4299	6499	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2469T>G	2.37:g.185802592T>G	ENSP00000303252:p.Phe823Leu		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.F823L	ENST00000302277.6	37	c.2469	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	T	7.259	0.604810	0.14002	.	.	ENSG00000170396	ENST00000302277	T	0.06068	3.35	5.81	0.519	0.17035	.	1.012730	0.07917	N	0.975212	T	0.05318	0.0141	L	0.27053	0.805	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.43261	-0.9402	10	0.41790	T	0.15	2.8162	7.7606	0.28951	0.0:0.0714:0.4127:0.5159	.	823	Q7Z570	Z804A_HUMAN	L	823	ENSP00000303252:F823L	ENSP00000303252:F823L	F	+	3	2	ZNF804A	185510837	0.000000	0.05858	0.001000	0.08648	0.249000	0.25844	-0.126000	0.10563	-0.125000	0.11703	0.533000	0.62120	TTT	ZNF804A	-	NULL	ENSG00000170396		0.383	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	20	0	T	NM_194250		185802592	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.001	G
ZNF804A	91752	genome.wustl.edu	37	2	185802592	185802592	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr2:185802592T>G	ENST00000302277.6	+	4	3063	c.2469T>G	c.(2467-2469)ttT>ttG	p.F823L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	823							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						ACCCCGGATTTGAAACTTTAG	0.383																																																	0													42.0	48.0	46.0					2																	185802592		2200	4299	6499	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2469T>G	2.37:g.185802592T>G	ENSP00000303252:p.Phe823Leu		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.F823L	ENST00000302277.6	37	c.2469	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	T	7.259	0.604810	0.14002	.	.	ENSG00000170396	ENST00000302277	T	0.06068	3.35	5.81	0.519	0.17035	.	1.012730	0.07917	N	0.975212	T	0.05318	0.0141	L	0.27053	0.805	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.43261	-0.9402	10	0.41790	T	0.15	2.8162	7.7606	0.28951	0.0:0.0714:0.4127:0.5159	.	823	Q7Z570	Z804A_HUMAN	L	823	ENSP00000303252:F823L	ENSP00000303252:F823L	F	+	3	2	ZNF804A	185510837	0.000000	0.05858	0.001000	0.08648	0.249000	0.25844	-0.126000	0.10563	-0.125000	0.11703	0.533000	0.62120	TTT	ZNF804A	-	NULL	ENSG00000170396		0.383	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	21	0	T	NM_194250		185802592	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.001	G
ZNRF4	148066	genome.wustl.edu	37	19	5455995	5455995	+	Missense_Mutation	SNP	G	G	A	rs377472519		TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:5455995G>A	ENST00000222033.4	+	1	570	c.493G>A	c.(493-495)Gac>Aac	p.D165N		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	165	PA.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CCGCCGCTACGACTGCACCTT	0.662																																																	0								A	ASN/ASP	0,4300		0,0,2150	36.0	38.0	37.0		493	3.6	0.0	19		37	1,8491		0,1,4245	no	missense	ZNRF4	NM_181710.3	23	0,1,6395	AA,AG,GG		0.0118,0.0,0.0078	probably-damaging	165/430	5455995	1,12791	2150	4246	6396	SO:0001583	missense	0			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.493G>A	19.37:g.5455995G>A	ENSP00000222033:p.Asp165Asn		A8K886|O75866	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D165N	ENST00000222033.4	37	c.493	CCDS42475.1	19	.	.	.	.	.	.	.	.	.	.	g	8.358	0.832346	0.16820	0.0	1.18E-4	ENSG00000105428	ENST00000222033	T	0.06218	3.33	4.65	3.61	0.41365	Protease-associated domain, PA (1);	0.186628	0.43579	N	0.000555	T	0.13415	0.0325	L	0.47716	1.5	0.21020	N	0.999808	D	0.67145	0.996	P	0.58210	0.835	T	0.05683	-1.0870	10	0.38643	T	0.18	-14.5481	11.6338	0.51192	0.0953:0.0:0.9047:0.0	.	165	Q8WWF5	ZNRF4_HUMAN	N	165	ENSP00000222033:D165N	ENSP00000222033:D165N	D	+	1	0	ZNRF4	5406995	0.912000	0.30974	0.046000	0.18839	0.153000	0.21895	1.471000	0.35365	0.421000	0.25980	-1.280000	0.01385	GAC	ZNRF4	-	pfam_Protease-assoc_domain	ENSG00000105428		0.662	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1		0.00	60	0	G	NM_181710		5455995	+1			no_errors	ENST00000222033	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.536	A
ZNF90	7643	genome.wustl.edu	37	19	20215065	20215065	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:20215065A>G	ENST00000418063.2	+	2	133	c.21A>G	c.(19-21)agA>agG	p.R7R	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						TGGAATTTAGAGATGTGGCCA	0.413																																																	0																																										SO:0001819	synonymous_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.21A>G	19.37:g.20215065A>G			B9EH87	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R7	ENST00000418063.2	37	c.21	CCDS46028.1	19																																																																																			ZNF90	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000213988		0.413	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	79	0	A	NM_007138		20215065	+1	tier1	-	no_errors	ENST00000418063	ensembl	human	known	74_37	silent	32.73	37	18	SNP	0.894	G
ZNF90	7643	genome.wustl.edu	37	19	20215065	20215065	+	Silent	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:20215065A>G	ENST00000418063.2	+	2	133	c.21A>G	c.(19-21)agA>agG	p.R7R	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	7	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						TGGAATTTAGAGATGTGGCCA	0.413																																																	0																																										SO:0001819	synonymous_variant	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.21A>G	19.37:g.20215065A>G			B9EH87	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R7	ENST00000418063.2	37	c.21	CCDS46028.1	19																																																																																			ZNF90	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000213988		0.413	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	-	0.00	84	0	A	NM_007138		20215065	+1	tier1	-	no_errors	ENST00000418063	ensembl	human	known	74_37	silent	32.73	37	18	SNP	0.894	G
ZNF880	400713	genome.wustl.edu	37	19	52887189	52887189	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:52887189T>A	ENST00000422689.2	+	4	371	c.356T>A	c.(355-357)cTg>cAg	p.L119Q	ZNF880_ENST00000424032.2_3'UTR	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	119					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CTGAGTGAACTGCAGCTATTT	0.343																																																	0													74.0	62.0	65.0					19																	52887189		692	1591	2283	SO:0001583	missense	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.356T>A	19.37:g.52887189T>A	ENSP00000406318:p.Leu119Gln		B4DNA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L119Q	ENST00000422689.2	37	c.356	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434628	0.25813	.	.	ENSG00000221923	ENST00000422689	T	0.07114	3.22	0.744	0.744	0.18353	.	.	.	.	.	T	0.06005	0.0156	L	0.31207	0.915	0.09310	N	1	B	0.15930	0.015	B	0.10450	0.005	T	0.39961	-0.9588	8	0.28530	T	0.3	.	.	.	.	.	119	Q6PDB4	ZN880_HUMAN	Q	119	ENSP00000406318:L119Q	ENSP00000406318:L119Q	L	+	2	0	ZNF880	57579001	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.187000	0.16998	0.580000	0.29522	0.368000	0.22195	CTG	ZNF880	-	NULL	ENSG00000221923		0.343	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	38	0	T	NM_001145434		52887189	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.002	A
ZNF880	400713	genome.wustl.edu	37	19	52887189	52887189	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:52887189T>A	ENST00000422689.2	+	4	371	c.356T>A	c.(355-357)cTg>cAg	p.L119Q	ZNF880_ENST00000424032.2_3'UTR	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	119					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CTGAGTGAACTGCAGCTATTT	0.343																																																	0													74.0	62.0	65.0					19																	52887189		692	1591	2283	SO:0001583	missense	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.356T>A	19.37:g.52887189T>A	ENSP00000406318:p.Leu119Gln		B4DNA6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L119Q	ENST00000422689.2	37	c.356	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434628	0.25813	.	.	ENSG00000221923	ENST00000422689	T	0.07114	3.22	0.744	0.744	0.18353	.	.	.	.	.	T	0.06005	0.0156	L	0.31207	0.915	0.09310	N	1	B	0.15930	0.015	B	0.10450	0.005	T	0.39961	-0.9588	8	0.28530	T	0.3	.	.	.	.	.	119	Q6PDB4	ZN880_HUMAN	Q	119	ENSP00000406318:L119Q	ENSP00000406318:L119Q	L	+	2	0	ZNF880	57579001	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.187000	0.16998	0.580000	0.29522	0.368000	0.22195	CTG	ZNF880	-	NULL	ENSG00000221923		0.343	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	42	0	T	NM_001145434		52887189	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.002	A
ZNF814	730051	genome.wustl.edu	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43E-01A-11D-A247-09	TCGA-L5-A43E-10A-01D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	da409ed9-280e-4463-b1a5-34baa26ea304	6f00c9db-539a-4d31-86d7-86fd02d2b135	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597342.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																																	0													15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	0				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His		A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y324H	ENST00000435989.2	37	c.970	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT	ZNF814	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204514		0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	-	0.00	90	0	A	XM_001725708		58385788	-1	tier1	-	no_errors	ENST00000435989	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.063	G
