#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACTRT1	139741	genome.wustl.edu	37	X	127185454	127185454	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:127185454T>C	ENST00000371124.3	-	1	928	c.732A>G	c.(730-732)ccA>ccG	p.P244P		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	244						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						CATGTCCATCTGGCAGTCTGT	0.522																																																	0													135.0	120.0	125.0					X																	127185454		2203	4300	6503	SO:0001819	synonymous_variant	0			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.732A>G	X.37:g.127185454T>C			Q6X7C1|Q96L10	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.P244	ENST00000371124.3	37	c.732	CCDS14611.1	X																																																																																			ACTRT1	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000123165		0.522	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	HGNC	protein_coding	OTTHUMT00000058192.1	-	0.00	18	0	T	NM_138289		127185454	-1	tier1	-	no_errors	ENST00000371124	ensembl	human	known	74_37	silent	80.00	6	24	SNP	0.996	C
ADAM7	8756	genome.wustl.edu	37	8	24349447	24349447	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:24349447C>T	ENST00000175238.6	+	14	1471	c.1388C>T	c.(1387-1389)gCg>gTg	p.A463V	RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.A463V|ADAM7_ENST00000520720.1_Missense_Mutation_p.A235V|RP11-624C23.1_ENST00000523578.1_RNA|RP11-561E1.1_ENST00000519364.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	463	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		TGCAGACCGGCGAAAGATGAA	0.443																																																	0													66.0	58.0	61.0					8																	24349447		2203	4300	6503	SO:0001583	missense	0			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1388C>T	8.37:g.24349447C>T	ENSP00000175238:p.Ala463Val		A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.A463V	ENST00000175238.6	37	c.1388	CCDS6045.1	8	.	.	.	.	.	.	.	.	.	.	C	8.977	0.974333	0.18736	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.12672	2.66;2.66;2.66	5.68	2.81	0.32909	Blood coagulation inhibitor, Disintegrin (5);	0.217993	0.32301	N	0.006283	T	0.30198	0.0757	M	0.70787	2.145	0.43896	D	0.996524	D;B	0.89917	1.0;0.054	D;B	0.91635	0.999;0.058	T	0.01225	-1.1413	10	0.54805	T	0.06	.	5.8245	0.18546	0.1423:0.6442:0.1373:0.0761	.	235;463	E5RK87;Q9H2U9	.;ADAM7_HUMAN	V	463;463;235;278	ENSP00000175238:A463V;ENSP00000370166:A463V;ENSP00000430400:A235V	ENSP00000175238:A463V	A	+	2	0	ADAM7	24405337	0.023000	0.18921	0.449000	0.26957	0.017000	0.09413	0.188000	0.17018	0.304000	0.22809	-0.119000	0.15052	GCG	ADAM7	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000069206		0.443	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	HGNC	protein_coding	OTTHUMT00000215150.1	-	0.00	33	0	C	NM_003817		24349447	+1	tier1	rs144309204	no_errors	ENST00000175238	ensembl	human	known	74_37	missense	29.03	22	9	SNP	0.833	T
ADAMTS14	140766	genome.wustl.edu	37	10	72511953	72511953	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:72511953G>A	ENST00000373207.1	+	18	2699	c.2699G>A	c.(2698-2700)cGc>cAc	p.R900H	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R903H	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	900	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						ATCCGCCGGCGCTGCAACCAG	0.657																																																	0													56.0	51.0	53.0					10																	72511953		2203	4300	6503	SO:0001583	missense	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.2699G>A	10.37:g.72511953G>A	ENSP00000362303:p.Arg900His		Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R903H	ENST00000373207.1	37	c.2708	CCDS7306.1	10	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117807	0.56505	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.61040	0.14;0.14	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.54711	0.1875	L	0.55834	1.745	0.40437	D	0.980005	P;P	0.38677	0.512;0.642	B;B	0.37239	0.166;0.244	T	0.61922	-0.6963	10	0.48119	T	0.1	.	17.0627	0.86551	0.0:0.0:1.0:0.0	.	900;903	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	H	903;900	ENSP00000362304:R903H;ENSP00000362303:R900H	ENSP00000362303:R900H	R	+	2	0	ADAMTS14	72181959	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.715000	0.84713	2.344000	0.79699	0.655000	0.94253	CGC	ADAMTS14	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000138316		0.657	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	-	0.00	64	0	G	NM_080722		72511953	+1	tier1	-	no_errors	ENST00000373208	ensembl	human	known	74_37	missense	20.25	62	16	SNP	1.000	A
ADAMTS20	80070	genome.wustl.edu	37	12	43819398	43819398	+	Silent	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:43819398T>A	ENST00000389420.3	-	28	4202	c.4203A>T	c.(4201-4203)gtA>gtT	p.V1401V	ADAMTS20_ENST00000395541.2_Silent_p.V519V|ADAMTS20_ENST00000553158.1_Silent_p.V1401V	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1401	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTGGCTTGTTTACAATTTCAC	0.403																																																	0													201.0	157.0	172.0					12																	43819398		2203	4300	6503	SO:0001819	synonymous_variant	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.4203A>T	12.37:g.43819398T>A			A6NNC9|J3QT00	Silent	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1401	ENST00000389420.3	37	c.4203	CCDS31778.2	12																																																																																			ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000173157		0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	78	0	T	NM_025003		43819398	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	silent	19.74	61	15	SNP	0.931	A
ADCY10	55811	genome.wustl.edu	37	1	167780044	167780044	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:167780044C>T	ENST00000367851.4	-	32	4773	c.4589G>A	c.(4588-4590)tGt>tAt	p.C1530Y	ADCY10_ENST00000545172.1_Missense_Mutation_p.C1377Y|ADCY10_ENST00000367848.1_Missense_Mutation_p.C1438Y	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1530					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GAAGAGGCCACATTTCTGCCC	0.478																																																	0													80.0	74.0	76.0					1																	167780044		2203	4300	6503	SO:0001583	missense	0			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4589G>A	1.37:g.167780044C>T	ENSP00000356825:p.Cys1530Tyr		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.C1530Y	ENST00000367851.4	37	c.4589	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	C	11.49	1.655376	0.29425	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.33654	1.4;1.41;1.41	5.43	4.51	0.55191	.	0.104322	0.43747	D	0.000528	T	0.44498	0.1296	M	0.65975	2.015	0.35031	D	0.758821	D;D	0.76494	0.999;0.998	D;D	0.68943	0.961;0.915	T	0.54118	-0.8341	9	0.72032	D	0.01	-12.667	11.5052	0.50461	0.1795:0.8205:0.0:0.0	.	1438;1530	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	Y	1377;1530;1438	ENSP00000441992:C1377Y;ENSP00000356825:C1530Y;ENSP00000356822:C1438Y	ENSP00000356822:C1438Y	C	-	2	0	ADCY10	166046668	0.985000	0.35326	0.081000	0.20488	0.006000	0.05464	3.701000	0.54793	1.278000	0.44430	0.561000	0.74099	TGT	ADCY10	-	pirsf_Adenylate_cylcase_typ10	ENSG00000143199		0.478	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	-	0.00	39	0	C	NM_018417		167780044	-1	tier1	-	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.729	T
ADCY8	114	genome.wustl.edu	37	8	132051965	132051965	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:132051965C>T	ENST00000286355.5	-	1	2707	c.615G>A	c.(613-615)tcG>tcA	p.S205S	ADCY8_ENST00000377928.3_Silent_p.S205S	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	205					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCATGGGGGCCGAGGCCAGGC	0.592										HNSCC(32;0.087)																																							0													68.0	73.0	71.0					8																	132051965		2203	4300	6503	SO:0001819	synonymous_variant	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.615G>A	8.37:g.132051965C>T				Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S205	ENST00000286355.5	37	c.615	CCDS6363.1	8																																																																																			ADCY8	-	NULL	ENSG00000155897		0.592	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	11	0	C			132051965	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	silent	21.88	24	7	SNP	0.947	T
AEBP1	165	genome.wustl.edu	37	7	44153728	44153728	+	Silent	SNP	T	T	C	rs571681478	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:44153728T>C	ENST00000223357.3	+	21	3650	c.3345T>C	c.(3343-3345)ccT>ccC	p.P1115P	AEBP1_ENST00000450684.2_Silent_p.P690P	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1115	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AGTTGGAGCCTGAGTTTGAGA	0.567													T|||	2	0.000399361	0.0	0.0	5008	,	,		15409	0.0		0.0	False		,,,				2504	0.002																0													121.0	113.0	115.0					7																	44153728		2203	4300	6503	SO:0001819	synonymous_variant	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3345T>C	7.37:g.44153728T>C			Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.P1115	ENST00000223357.3	37	c.3345	CCDS5476.1	7																																																																																			AEBP1	-	NULL	ENSG00000106624		0.567	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2		0.00	17	0	T	NM_001129		44153728	+1			no_errors	ENST00000223357	ensembl	human	known	74_37	silent	13.16	33	5	SNP	0.092	C
AFF3	3899	genome.wustl.edu	37	2	100623364	100623364	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:100623364G>A	ENST00000409236.2	-	5	715	c.603C>T	c.(601-603)gcC>gcT	p.A201A	AFF3_ENST00000409579.1_Silent_p.A226A|AFF3_ENST00000356421.2_Silent_p.A226A|AFF3_ENST00000317233.4_Silent_p.A201A			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	201					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TGGCCGCCATGGCAGGTGGCC	0.587																																																	0													73.0	75.0	74.0					2																	100623364		2203	4300	6503	SO:0001819	synonymous_variant	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.603C>T	2.37:g.100623364G>A			B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Silent	SNP	pfam_TF_AF4/FMR2	p.A226	ENST00000409236.2	37	c.678	CCDS42723.1	2																																																																																			AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.587	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	-	0.00	14	0	G	NM_002285		100623364	-1	tier1	-	no_errors	ENST00000356421	ensembl	human	known	74_37	silent	25.00	21	7	SNP	0.001	A
ANK2	287	genome.wustl.edu	37	4	114275426	114275426	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:114275426G>T	ENST00000357077.4	+	38	5705	c.5652G>T	c.(5650-5652)tcG>tcT	p.S1884S	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Silent_p.S1851S|ANK2_ENST00000510275.2_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000509550.1_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1884	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TATCACCCTCGACAAAAACTG	0.468																																																	0													173.0	157.0	162.0					4																	114275426		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5652G>T	4.37:g.114275426G>T			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.S1884	ENST00000357077.4	37	c.5652	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.468	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	64	0	G	NM_001148		114275426	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	44.00	42	33	SNP	0.003	T
ANKFN1	162282	genome.wustl.edu	37	17	54588226	54588226	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:54588226C>T	ENST00000566473.2	+	20	3046	c.3046C>T	c.(3046-3048)Cgc>Tgc	p.R1016C				Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	0										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						CGGCTTCAGCCGCCATCATCG	0.632																																																	0																																										SO:0001583	missense	0			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000566473.2:c.3046C>T	17.37:g.54588226C>T	ENSP00000454224:p.Arg1016Cys			Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.R1016C	ENST00000566473.2	37	c.3046		17																																																																																			ANKFN1	-	NULL	ENSG00000153930		0.632	ANKFN1-002	NOVEL	basic|exp_conf	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000435456.2	-	0.00	36	0	C	NM_153228		54588226	+1	tier1	-	no_errors	ENST00000566473	ensembl	human	novel	74_37	missense	10.26	70	8	SNP	1.000	T
ANKMY2	57037	genome.wustl.edu	37	7	16640502	16640502	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:16640502G>C	ENST00000306999.2	-	10	1453	c.1210C>G	c.(1210-1212)Caa>Gaa	p.Q404E		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	404						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		GAATCCTTTTGAGAGATACCT	0.423																																																	0													92.0	88.0	89.0					7																	16640502		2203	4300	6503	SO:0001583	missense	0			AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.1210C>G	7.37:g.16640502G>C	ENSP00000303570:p.Gln404Glu		A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.Q404E	ENST00000306999.2	37	c.1210	CCDS5361.1	7	.	.	.	.	.	.	.	.	.	.	G	4.248	0.045062	0.08196	.	.	ENSG00000106524	ENST00000306999	T	0.70045	-0.45	5.4	4.4	0.53042	.	0.848885	0.10690	N	0.645246	T	0.50548	0.1622	N	0.24115	0.695	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.22277	-1.0221	10	0.19147	T	0.46	-23.654	10.0639	0.42292	0.0:0.0:0.7523:0.2477	.	404	Q8IV38	ANKY2_HUMAN	E	404	ENSP00000303570:Q404E	ENSP00000303570:Q404E	Q	-	1	0	ANKMY2	16607027	0.303000	0.24463	0.006000	0.13384	0.002000	0.02628	2.651000	0.46674	2.685000	0.91497	0.655000	0.94253	CAA	ANKMY2	-	NULL	ENSG00000106524		0.423	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKMY2	HGNC	protein_coding	OTTHUMT00000207600.2	-	0.00	26	0	G	NM_020319		16640502	-1	tier1	-	no_errors	ENST00000306999	ensembl	human	known	74_37	missense	36.36	28	16	SNP	0.003	C
ANKRD20A11P	391267	genome.wustl.edu	37	21	15310382	15310382	+	IGR	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr21:15310382G>A								CYP4F29P (89697 upstream) : ANKRD20A11P (5707 downstream)																							TCATGATTATGAAAATCCTAA	0.308																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.15310382G>A				RNA	SNP	-	NULL		37	NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559	0	0.308					ANKRD20A11P	HGNC			-	0.00	71	0	G			15310382	-1	tier1	-	no_errors	ENST00000428576	ensembl	human	known	74_37	rna	21.79	61	17	SNP	0.108	A
APOB	338	genome.wustl.edu	37	2	21232670	21232670	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:21232670A>T	ENST00000233242.1	-	26	7197	c.7070T>A	c.(7069-7071)tTa>tAa	p.L2357*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2357					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTATCCATTAAAACCTGGAT	0.368																																																	0													74.0	72.0	72.0					2																	21232670		2203	4300	6503	SO:0001587	stop_gained	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.7070T>A	2.37:g.21232670A>T	ENSP00000233242:p.Leu2357*		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.L2357*	ENST00000233242.1	37	c.7070	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	A	48	14.462835	0.99796	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	5.76	5.76	0.90799	.	0.136721	0.33382	N	0.004973	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.0668	0.80887	1.0:0.0:0.0:0.0	.	.	.	.	X	2357	.	ENSP00000233242:L2357X	L	-	2	0	APOB	21086175	1.000000	0.71417	0.963000	0.40424	0.795000	0.44927	9.300000	0.96151	2.192000	0.70111	0.459000	0.35465	TTA	APOB	-	superfamily_ARM-type_fold	ENSG00000084674		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	65	0	A			21232670	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	nonsense	23.23	76	23	SNP	0.978	T
ANKZF1	55139	genome.wustl.edu	37	2	220099955	220099955	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:220099955C>T	ENST00000323348.5	+	10	1786	c.1612C>T	c.(1612-1614)Ctc>Ttc	p.L538F	ANKZF1_ENST00000410034.3_Missense_Mutation_p.L538F|GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000409849.1_Missense_Mutation_p.L328F	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	538						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCTTTACTCTCCTGCATGC	0.587																																																	0													55.0	58.0	57.0					2																	220099955		1998	4172	6170	SO:0001583	missense	0			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1612C>T	2.37:g.220099955C>T	ENSP00000321617:p.Leu538Phe		Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L538F	ENST00000323348.5	37	c.1612	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	C	19.24	3.790276	0.70337	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	T;T;T	0.65549	-0.16;-0.16;-0.16	5.26	5.26	0.73747	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.70351	0.3214	L	0.33624	1.015	0.54753	D	0.999987	D	0.89917	1.0	D	0.91635	0.999	T	0.69339	-0.5171	10	0.44086	T	0.13	-14.932	16.1854	0.81948	0.0:1.0:0.0:0.0	.	538	Q9H8Y5	ANKZ1_HUMAN	F	538;328;538	ENSP00000321617:L538F;ENSP00000386815:L328F;ENSP00000386337:L538F	ENSP00000321617:L538F	L	+	1	0	ANKZF1	219808199	0.974000	0.33945	0.975000	0.42487	0.996000	0.88848	2.287000	0.43505	2.746000	0.94184	0.655000	0.94253	CTC	ANKZF1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000163516		0.587	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1	-	0.00	32	0	C	NM_018089		220099955	+1	tier1	-	no_errors	ENST00000323348	ensembl	human	known	74_37	missense	52.46	29	32	SNP	0.992	T
APOC2	344	genome.wustl.edu	37	19	45452446	45452446	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:45452446G>T	ENST00000590360.1	+	4	368	c.246G>T	c.(244-246)atG>atT	p.M82I	APOC2_ENST00000591597.1_Missense_Mutation_p.M68I|APOC4-APOC2_ENST00000589057.1_Missense_Mutation_p.M159I|APOC4_ENST00000419266.2_3'UTR|APOC2_ENST00000592257.1_3'UTR|APOC2_ENST00000252490.4_Missense_Mutation_p.M82I|APOC2_ENST00000585786.1_3'UTR			P02655	APOC2_HUMAN	apolipoprotein C-II	82					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(1)|liver(1)|lung(3)	6	Lung NSC(12;0.00858)|all_lung(12;0.0197)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00327)|Epithelial(262;0.174)		CAGCAGCCATGAGCACTTACA	0.562																																																	0													94.0	79.0	84.0					19																	45452446		2203	4300	6503	SO:0001583	missense	0			X00568	CCDS12650.1	19q13.2	2013-01-24			ENSG00000234906	ENSG00000234906		"""Apolipoproteins"""	609	protein-coding gene	gene with protein product		608083					Standard	NM_000483		Approved			P02655	OTTHUMG00000180847	ENST00000590360.1:c.246G>T	19.37:g.45452446G>T	ENSP00000466775:p.Met82Ile		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_Apo-CII	p.M82I	ENST00000590360.1	37	c.246	CCDS12650.1	19	.	.	.	.	.	.	.	.	.	.	G	8.446	0.852073	0.17034	.	.	ENSG00000234906	ENST00000252490	T	0.78707	-1.2	4.39	3.32	0.38043	ApoC-II domain (1);	0.289686	0.23483	N	0.047696	T	0.63379	0.2506	N	0.21448	0.665	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.54906	-0.8223	10	0.44086	T	0.13	-6.6389	10.4658	0.44607	0.0:0.1986:0.8014:0.0	.	82	P02655	APOC2_HUMAN	I	82	ENSP00000252490:M82I	ENSP00000252490:M82I	M	+	3	0	APOC2	50144286	0.915000	0.31059	0.006000	0.13384	0.139000	0.21198	1.828000	0.39111	0.956000	0.37904	0.393000	0.25936	ATG	APOC2	-	pfam_Apo-CII	ENSG00000234906		0.562	APOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOC2	HGNC	protein_coding	OTTHUMT00000453261.1	-	0.00	61	0	G	NM_000483		45452446	+1	tier1	-	no_errors	ENST00000252490	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.058	T
LVRN	206338	genome.wustl.edu	37	5	115335467	115335468	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:115335467_115335468insT	ENST00000357872.4	+	7	1507_1508	c.1383_1384insT	c.(1384-1386)tttfs	p.F462fs	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		462						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										AGAATGAGATCTTTTTTTCTAA	0.361																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000357872.4:c.1390dupT	5.37:g.115335474_115335474dupT	ENSP00000350541:p.Phe462fs		A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Frame_Shift_Ins	INS	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.S463fs	ENST00000357872.4	37	c.1383_1384	CCDS4124.1	5																																																																																			AQPEP	-	pfam_Peptidase_M1_N	ENSG00000172901		0.361	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Uniprot_gn	protein_coding	OTTHUMT00000250852.1		0.00	28	0	-			115335468	+1	tier1		no_errors	ENST00000357872	ensembl	human	known	74_37	frame_shift_ins	40.00	18	12	INS	0.153:0.933	T
ARF6	382	genome.wustl.edu	37	14	50360743	50360743	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:50360743G>A	ENST00000298316.5	+	2	836	c.289G>A	c.(289-291)Gat>Aat	p.D97N		NM_001663.3	NP_001654.1	P62330	ARF6_HUMAN	ADP-ribosylation factor 6	97					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell division (GO:0051301)|cellular component movement (GO:0006928)|cortical actin cytoskeleton organization (GO:0030866)|establishment of epithelial cell polarity (GO:0090162)|GTP catabolic process (GO:0006184)|hepatocyte apoptotic process (GO:0097284)|liver development (GO:0001889)|myeloid cell apoptotic process (GO:0033028)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|protein localization to cell surface (GO:0034394)|protein localization to endosome (GO:0036010)|protein transport (GO:0015031)|regulation of dendritic spine development (GO:0060998)|regulation of filopodium assembly (GO:0051489)|regulation of Rac protein signal transduction (GO:0035020)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|thioesterase binding (GO:0031996)			endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	all_epithelial(31;0.000822)|Breast(41;0.0117)					CGACCGCATCGATGAGGCTCG	0.607																																																	0													47.0	44.0	45.0					14																	50360743		2203	4300	6503	SO:0001583	missense	0				CCDS9695.1	14q21.3	2004-06-21			ENSG00000165527	ENSG00000165527		"""ADP-ribosylation factors"""	659	protein-coding gene	gene with protein product		600464				1993656, 10343114	Standard	NM_001663		Approved		uc001wxg.4	P62330	OTTHUMG00000140296	ENST00000298316.5:c.289G>A	14.37:g.50360743G>A	ENSP00000298316:p.Asp97Asn		P26438|Q6FGZ2	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D97N	ENST00000298316.5	37	c.289	CCDS9695.1	14	.	.	.	.	.	.	.	.	.	.	G	13.01	2.108728	0.37242	.	.	ENSG00000165527	ENST00000298316	T	0.63580	-0.05	5.16	3.33	0.38152	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	L	0.35249	1.045	0.80722	D	1	B	0.10296	0.003	B	0.14578	0.011	T	0.25502	-1.0130	10	0.07175	T	0.84	-12.2593	11.6215	0.51121	0.1331:0.0:0.8669:0.0	.	97	P62330	ARF6_HUMAN	N	97	ENSP00000298316:D97N	ENSP00000298316:D97N	D	+	1	0	ARF6	49430493	1.000000	0.71417	0.997000	0.53966	0.727000	0.41649	9.835000	0.99442	0.573000	0.29400	0.491000	0.48974	GAT	ARF6	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,tigrfam_Small_GTP-bd_dom	ENSG00000165527		0.607	ARF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF6	HGNC	protein_coding	OTTHUMT00000276883.1		0.00	17	0	G	NM_001663		50360743	+1			no_errors	ENST00000298316	ensembl	human	known	74_37	missense	10.20	44	5	SNP	1.000	A
ARHGAP31	57514	genome.wustl.edu	37	3	119133144	119133144	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:119133144C>G	ENST00000264245.4	+	12	2900	c.2368C>G	c.(2368-2370)Cct>Gct	p.P790A		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	790	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CCCTCCAACTCCTCTGGAGGA	0.527																																					Pancreas(7;176 297 5394 51128 51241)												0													52.0	54.0	54.0					3																	119133144		1905	4110	6015	SO:0001583	missense	0				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2368C>G	3.37:g.119133144C>G	ENSP00000264245:p.Pro790Ala		Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P790A	ENST00000264245.4	37	c.2368	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	C	10.73	1.433123	0.25813	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.05717	3.4	5.3	2.56	0.30785	.	0.527413	0.17660	N	0.166360	T	0.04724	0.0128	L	0.32530	0.975	0.09310	N	1	B	0.30406	0.278	B	0.24974	0.057	T	0.39502	-0.9611	10	0.34782	T	0.22	.	6.609	0.22741	0.0:0.6165:0.0:0.3835	.	790	Q2M1Z3	RHG31_HUMAN	A	790	ENSP00000264245:P790A	ENSP00000264245:P790A	P	+	1	0	ARHGAP31	120615834	0.000000	0.05858	0.185000	0.23176	0.907000	0.53573	0.271000	0.18626	0.386000	0.24997	0.655000	0.94253	CCT	ARHGAP31	-	NULL	ENSG00000031081		0.527	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2		0.00	26	0	C			119133144	+1			no_errors	ENST00000264245	ensembl	human	known	74_37	missense	9.30	39	4	SNP	0.009	G
ARID3B	10620	genome.wustl.edu	37	15	74889136	74889137	+	3'UTR	INS	-	-	T	rs59860926|rs56663733	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:74889136_74889137insT	ENST00000563567.1	+	0	200_201				ARID3B_ENST00000346246.5_3'UTR			Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)							nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						GCTGACTTTTGtttttttttta	0.361																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000563567.1:c.*198->T	15.37:g.74889146_74889146dupT			O95443|Q59HC9|Q6P9C9	RNA	INS	-	NULL	ENST00000563567.1	37	NULL		15																																																																																			ARID3B	-	-	ENSG00000179361		0.361	ARID3B-006	PUTATIVE	basic|exp_conf	processed_transcript	ARID3B	HGNC	protein_coding	OTTHUMT00000420641.1		0.00	25	0	-	NM_006465		74889137	+1	tier1		no_errors	ENST00000563567	ensembl	human	putative	74_37	rna	8.11	34	3	INS	0.086:0.068	T
ASCC3	10973	genome.wustl.edu	37	6	101076966	101076966	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:101076966C>A	ENST00000369162.2	-	27	4644	c.4300G>T	c.(4300-4302)Gtc>Ttc	p.V1434F		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	1434	Helicase ATP-binding 2. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		CTTCTGCTGACTCCATCCCAC	0.453																																																	0													117.0	92.0	100.0					6																	101076966		2203	4300	6503	SO:0001583	missense	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.4300G>T	6.37:g.101076966C>A	ENSP00000358159:p.Val1434Phe		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V1434F	ENST00000369162.2	37	c.4300	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223868	0.79576	.	.	ENSG00000112249	ENST00000369162	T	0.35789	1.29	5.78	-0.148	0.13424	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.064420	0.64402	D	0.000009	T	0.36908	0.0984	M	0.73753	2.245	0.80722	D	1	P	0.37955	0.612	P	0.50754	0.649	T	0.45629	-0.9248	10	0.66056	D	0.02	.	12.1104	0.53836	0.0:0.6676:0.0:0.3324	.	1434	Q8N3C0	HELC1_HUMAN	F	1434	ENSP00000358159:V1434F	ENSP00000358159:V1434F	V	-	1	0	ASCC3	101183687	0.398000	0.25279	0.994000	0.49952	0.998000	0.95712	1.010000	0.29898	-0.028000	0.13850	0.591000	0.81541	GTC	ASCC3	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,pfscan_Helicase_ATP-bd	ENSG00000112249		0.453	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2	-	0.00	56	0	C	NM_006828		101076966	-1	tier1	-	no_errors	ENST00000369162	ensembl	human	known	74_37	missense	22.86	54	16	SNP	0.992	A
ASPSCR1	79058	genome.wustl.edu	37	17	79970144	79970144	+	Silent	SNP	G	G	A	rs148162287	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:79970144G>A	ENST00000306739.4	+	12	1435	c.1338G>A	c.(1336-1338)acG>acA	p.T446T	ASPSCR1_ENST00000580534.1_Silent_p.T394T|ASPSCR1_ENST00000306729.7_Silent_p.T446T	NM_024083.3	NP_076988.1	Q9BZE9	ASPC1_HUMAN	alveolar soft part sarcoma chromosome region, candidate 1	446	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.				glucose homeostasis (GO:0042593)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|regulation of glucose import (GO:0046324)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)			ASPSCR1/TFE3(167)	breast(2)|large_intestine(2)	4	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			ACGACCACACGCAGACCCTCT	0.652			T	TFE3	alveolar soft part sarcoma																																			Dom	yes		17	17q25	79058	"""alveolar soft part sarcoma chromosome region, candidate 1"""		M	0								G		1,4405	2.1+/-5.4	0,1,2202	138.0	102.0	114.0		1338	0.3	0.4	17	dbSNP_134	114	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ASPSCR1	NM_024083.2		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		446/554	79970144	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF324219	CCDS11796.1, CCDS58611.1	17q25	2011-06-28				ENSG00000169696		"""UBX domain containing"""	13825	protein-coding gene	gene with protein product	"""UBX domain protein 9"""	606236				11244503, 10506710	Standard	NM_024083		Approved	ASPS, ASPL, UBXD9, UBXN9	uc002kcy.3	Q9BZE9		ENST00000306739.4:c.1338G>A	17.37:g.79970144G>A			A8K3K9|Q7Z6N7|Q8WV59|Q96LS5|Q96M40	Missense_Mutation	SNP	NULL	p.A410T	ENST00000306739.4	37	c.1228	CCDS11796.1	17																																																																																			ASPSCR1	-	NULL	ENSG00000169696		0.652	ASPSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPSCR1	HGNC	protein_coding	OTTHUMT00000441972.1	-	0.00	13	0	G	NM_024083		79970144	+1	tier1	rs148162287	no_errors	ENST00000584454	ensembl	human	known	74_37	missense	55.81	19	24	SNP	0.000	A
ATP1B1	481	genome.wustl.edu	37	1	169100709	169100709	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:169100709T>A	ENST00000367816.1	+	7	1357	c.828T>A	c.(826-828)tgT>tgA	p.C276*	ATP1B1_ENST00000367815.4_Nonsense_Mutation_p.C276*|ATP1B1_ENST00000499679.3_Nonsense_Mutation_p.C220*|ATP1B1_ENST00000367813.3_Nonsense_Mutation_p.C268*			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	276	immunoglobulin-like.				blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					GCATAGAGTGTAAGGCGTACG	0.458																																																	0													108.0	101.0	103.0					1																	169100709		2203	4300	6503	SO:0001587	stop_gained	0			U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.828T>A	1.37:g.169100709T>A	ENSP00000356790:p.Cys276*		Q5TGZ3	Nonsense_Mutation	SNP	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta	p.C276*	ENST00000367816.1	37	c.828	CCDS1276.1	1	.	.	.	.	.	.	.	.	.	.	T	32	5.140770	0.94560	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	.	.	.	5.46	3.13	0.36017	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3761	7.1261	0.25473	0.0:0.3928:0.0:0.6072	.	.	.	.	X	276;276;220;268	.	ENSP00000356787:C268X	C	+	3	2	ATP1B1	167367333	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.941000	0.49011	0.379000	0.24794	0.528000	0.53228	TGT	ATP1B1	-	pfam_Na/K_ATPase_sub_beta,tigrfam_Na/K_ATPase_sub_beta	ENSG00000143153		0.458	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP1B1	HGNC	protein_coding	OTTHUMT00000083696.1	-	0.00	79	0	T			169100709	+1	tier1	-	no_errors	ENST00000367815	ensembl	human	known	74_37	nonsense	27.16	59	22	SNP	1.000	A
ATP2C1	27032	genome.wustl.edu	37	3	130672710	130672710	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:130672710A>C	ENST00000510168.1	+	9	1127	c.577A>C	c.(577-579)Acg>Ccg	p.T193P	ATP2C1_ENST00000513801.1_Missense_Mutation_p.T177P|ATP2C1_ENST00000393221.4_Missense_Mutation_p.T227P|ATP2C1_ENST00000533801.2_Missense_Mutation_p.T188P|ATP2C1_ENST00000428331.2_Missense_Mutation_p.T193P|ATP2C1_ENST00000359644.3_Missense_Mutation_p.T193P|ATP2C1_ENST00000504948.1_Missense_Mutation_p.T177P|ATP2C1_ENST00000505330.1_Missense_Mutation_p.T177P|ATP2C1_ENST00000508532.1_Missense_Mutation_p.T193P|ATP2C1_ENST00000507488.2_Missense_Mutation_p.T177P|ATP2C1_ENST00000328560.8_Missense_Mutation_p.T193P|ATP2C1_ENST00000422190.2_Missense_Mutation_p.T193P|ATP2C1_ENST00000504381.1_Missense_Mutation_p.T138P			P98194	AT2C1_HUMAN	ATPase, Ca++ transporting, type 2C, member 1	193					actin cytoskeleton reorganization (GO:0031532)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cellular calcium ion homeostasis (GO:0006874)|cellular manganese ion homeostasis (GO:0030026)|epidermis development (GO:0008544)|Golgi calcium ion homeostasis (GO:0032468)|Golgi calcium ion transport (GO:0032472)|ion transmembrane transport (GO:0034220)|manganese ion transmembrane transport (GO:0071421)|manganese ion transport (GO:0006828)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-transporting ATPase activity (GO:0005388)|manganese ion binding (GO:0030145)|manganese-transporting ATPase activity (GO:0015410)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|prostate(2)|skin(2)|urinary_tract(1)	39					Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGGTGAGACAACGCCTTGTTC	0.443									Hailey-Hailey disease																												Esophageal Squamous(99;456 1443 27647 34099 42636)												0													141.0	134.0	136.0					3																	130672710		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	HHD, Familial Benign Chronic Pemphigus, Benign Familial Pemphigus	AF181120	CCDS33856.1, CCDS46912.1, CCDS46913.1, CCDS46914.1, CCDS56278.1, CCDS56279.1, CCDS56280.1, CCDS56281.1, CCDS75006.1	3q21.3	2012-10-22			ENSG00000017260	ENSG00000017260	3.6.3.8	"""ATPases / P-type"""	13211	protein-coding gene	gene with protein product	"""secretory pathway Ca2+/Mn2+ ATPase 1"", ""calcium-transporting ATPase type 2C member 1"""	604384	"""benign chronic pemphigus (Hailey-Hailey disease)"""	BCPM		10615129, 10767338	Standard	NM_001001485		Approved	KIAA1347, ATP2C1A, PMR1, SPCA1	uc011bli.2	P98194	OTTHUMG00000136802	ENST00000510168.1:c.577A>C	3.37:g.130672710A>C	ENSP00000427461:p.Thr193Pro		B2RAT7|B4DSW3|B7Z3X9|G3XAH8|G8JLN9|O76005|Q86V72|Q86V73|Q8N6V1|Q8NCJ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	p.T227P	ENST00000510168.1	37	c.679	CCDS46914.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.81|14.81	2.645270|2.645270	0.47258|0.47258	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000504612|ENST00000505330;ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000510168;ENST00000508532;ENST00000504948;ENST00000513801;ENST00000328560;ENST00000428331;ENST00000359644;ENST00000422190;ENST00000347421	.|D;D;D;D;D;D;D;D;D;D;D;D;D	.|0.90676	.|-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71;-2.71	5.42|5.42	4.21|4.21	0.49690|0.49690	.|ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	.|0.214217	.|0.48286	.|D	.|0.000188	D|D	0.88160|0.88160	0.6362|0.6362	M|M	0.65677|0.65677	2.01|2.01	0.40603|0.40603	D|D	0.981604|0.981604	.|B;P;B;B;B;B;B	.|0.35527	.|0.451;0.507;0.162;0.244;0.33;0.137;0.166	.|B;B;B;B;B;B;B	.|0.37480	.|0.113;0.18;0.251;0.113;0.251;0.113;0.18	D|D	0.84604|0.84604	0.0674|0.0674	5|10	.|0.38643	.|T	.|0.18	.|.	7.8812|7.8812	0.29623|0.29623	0.7593:0.0:0.2407:0.0|0.7593:0.0:0.2407:0.0	.|.	.|227;188;227;193;227;193;193	.|G3XAH8;B4DSW3;B4E2Q0;P98194-5;B7Z3X9;P98194-2;P98194	.|.;.;.;.;.;.;AT2C1_HUMAN	H|P	146|177;138;177;227;188;193;193;177;177;193;193;193;193;192	.|ENSP00000423774:T177P;ENSP00000425320:T138P;ENSP00000421326:T177P;ENSP00000376914:T227P;ENSP00000432956:T188P;ENSP00000427461:T193P;ENSP00000424783:T193P;ENSP00000423330:T177P;ENSP00000422872:T177P;ENSP00000329664:T193P;ENSP00000395809:T193P;ENSP00000352665:T193P;ENSP00000402677:T193P	.|ENSP00000329664:T193P	Q|T	+|+	3|1	2|0	ATP2C1|ATP2C1	132155400|132155400	0.942000|0.942000	0.31987|0.31987	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	2.118000|2.118000	0.41949|0.41949	0.849000|0.849000	0.35215|0.35215	0.528000|0.528000	0.53228|0.53228	CAA|ACG	ATP2C1	-	pfam_ATPase_P-typ_transduc_dom_A,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000017260		0.443	ATP2C1-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ATP2C1	HGNC	protein_coding	OTTHUMT00000356648.2	-	0.00	61	0	A	NM_001001486		130672710	+1	tier1	-	no_errors	ENST00000393221	ensembl	human	known	74_37	missense	10.13	71	8	SNP	0.974	C
AZGP1P1	646282	genome.wustl.edu	37	7	99581021	99581021	+	RNA	SNP	G	G	A	rs532708677		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:99581021G>A	ENST00000425474.1	+	0	342					NR_036679.1				alpha-2-glycoprotein 1, zinc-binding pseudogene 1																		TTACAACGACGGTAACGGTCA	0.547													g|||	1	0.000199681	0.0008	0.0	5008	,	,		18638	0.0		0.0	False		,,,				2504	0.0																0																																												0			AW995302		7q22.1	2010-04-16	2006-11-07		ENSG00000214313	ENSG00000214313			911	pseudogene	pseudogene			"""alpha-2-glycoprotein 1, zinc pseudogene 1"""			8241150, 8307568	Standard	NR_036679		Approved		uc003usi.2		OTTHUMG00000156513		7.37:g.99581021G>A				RNA	SNP	-	NULL	ENST00000425474.1	37	NULL		7																																																																																			AZGP1P1	-	-	ENSG00000214313		0.547	AZGP1P1-002	KNOWN	basic	processed_transcript	AZGP1P1	HGNC	pseudogene	OTTHUMT00000344467.1	-	0.00	102	0	G			99581021	+1	tier1	-	no_errors	ENST00000425474	ensembl	human	known	74_37	rna	26.26	72	26	SNP	0.001	A
ATXN7L1	222255	genome.wustl.edu	37	7	105248338	105248338	+	Splice_Site	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:105248338C>T	ENST00000419735.3	-	12	2593		c.e12-1		ATXN7L1_ENST00000477775.1_Silent_p.K726K	NM_020725.1	NP_065776.1	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1											endometrium(1)|large_intestine(4)|lung(5)	10						TGTTTGTGTTCTTCTAGGAAA	0.403																																																	0													264.0	216.0	231.0					7																	105248338		692	1591	2283	SO:0001630	splice_region_variant	0			AB033044	CCDS34727.1, CCDS47682.1, CCDS47683.1	7q22.1	2007-11-13			ENSG00000146776	ENSG00000146776			22210	protein-coding gene	gene with protein product			"""ataxin 7-like 4"""	ATXN7L4		15115762	Standard	NM_152749		Approved	KIAA1218, MGC33190	uc003vde.2	Q9ULK2	OTTHUMG00000157521	ENST00000419735.3:c.2548-1G>A	7.37:g.105248338C>T			A4D0Q2|B4DTS1|Q8N2T0	Splice_Site	SNP	-	e12-1	ENST00000419735.3	37	c.2548-1	CCDS47682.1	7	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204331	0.79127	.	.	ENSG00000146776	ENST00000419735	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9995	0.89194	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATXN7L1	105035574	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.445000	0.52921	2.691000	0.91804	0.655000	0.94253	.	ATXN7L1	-	-	ENSG00000146776		0.403	ATXN7L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L1	HGNC	protein_coding	OTTHUMT00000349037.2	-	0.00	145	0	C		Intron	105248338	-1	tier1	-	no_errors	ENST00000419735	ensembl	human	known	74_37	splice_site	15.32	188	34	SNP	1.000	T
BNC1	646	genome.wustl.edu	37	15	83932730	83932730	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:83932730C>T	ENST00000345382.2	-	4	1358	c.1273G>A	c.(1273-1275)Gac>Aac	p.D425N	RP11-382A20.4_ENST00000565495.1_RNA|BNC1_ENST00000569704.1_Missense_Mutation_p.D418N	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	425					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						TTCCTGAGGTCTTTGTCCCGG	0.567																																																	0													172.0	163.0	166.0					15																	83932730		2203	4300	6503	SO:0001583	missense	0			L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1273G>A	15.37:g.83932730C>T	ENSP00000307041:p.Asp425Asn		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D425N	ENST00000345382.2	37	c.1273	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901063	0.92035	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.60424	0.19	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.78201	0.4246	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.80207	-0.1478	10	0.72032	D	0.01	-28.6606	19.4213	0.94723	0.0:1.0:0.0:0.0	.	418;425	F5GY04;Q01954	.;BNC1_HUMAN	N	425;418	ENSP00000307041:D425N	ENSP00000307041:D425N	D	-	1	0	BNC1	81723734	1.000000	0.71417	0.986000	0.45419	0.987000	0.75469	7.755000	0.85180	2.589000	0.87451	0.655000	0.94253	GAC	BNC1	-	NULL	ENSG00000169594		0.567	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	-	0.00	24	0	C	NM_001717		83932730	-1	tier1	-	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	39.29	17	11	SNP	1.000	T
BOLL	66037	genome.wustl.edu	37	2	198636637	198636638	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T|G	T|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:198636637_198636638TG>CT	ENST00000392296.4	-	6	730_731	c.421_422CA>AG	c.(421-423)CAt>AGt	p.H141S	BOLL_ENST00000321801.7_Missense_Mutation_p.H153S|BOLL_ENST00000430004.1_Missense_Mutation_p.H141S|BOLL_ENST00000282278.8_Missense_Mutation_p.H32S|AC011997.1_ENST00000409845.1_Splice_Site_p.M73T|BOLL_ENST00000433157.1_Missense_Mutation_p.H141S	NM_033030.5	NP_149019.1	Q8N9W6	BOLL_HUMAN	boule-like RNA-binding protein	141					cell differentiation (GO:0030154)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)			central_nervous_system(1)|endometrium(2)|lung(6)|ovary(3)|prostate(1)	13						AACACCATTATGGTAAGTATAA	0.337																																																	0																																										SO:0001583	missense	0				CCDS2324.1, CCDS2325.1, CCDS63081.1	2q33	2013-10-17	2013-10-17		ENSG00000152430	ENSG00000152430		"""RNA binding motif (RRM) containing"""	14273	protein-coding gene	gene with protein product		606165	"""bol (Drosophila boule homolog)-like"", ""bol, boule-like (Drosophila)"""			11390979, 16001084	Standard	NM_197970		Approved	BOULE	uc002uut.2	Q8N9W6	OTTHUMG00000132747	ENST00000392296.4:c.421_422delinsCT	2.37:g.198636637_198636638delinsCT	ENSP00000376116:p.His141Ser		B4DZA4|Q0JW32|Q53T62|Q969U3	Missense_Mutation	SNP	pfam_RRM_dom,pfam_RRM_3,smart_RRM_dom,pfscan_RRM_dom	p.H153R|p.H153N	ENST00000392296.4	37	c.458|c.457	CCDS2325.1	2																																																																																			BOLL	-	NULL	ENSG00000152430		0.337	BOLL-001	KNOWN	basic|CCDS	protein_coding	BOLL	HGNC	protein_coding	OTTHUMT00000256107.3	-	0.00	35	0	T|G	NM_033030		198636637|198636638	-1	tier1	-	no_errors	ENST00000321801	ensembl	human	known	74_37	missense	50.00|51.16	21	21|22	SNP	1.000	C|T
BPTF	2186	genome.wustl.edu	37	17	65905706	65905717	+	In_Frame_Del	DEL	AATATGGATGAA	AATATGGATGAA	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	AATATGGATGAA	AATATGGATGAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:65905706_65905717delAATATGGATGAA	ENST00000321892.4	+	12	3260_3271	c.3199_3210delAATATGGATGAA	c.(3199-3210)aatatggatgaadel	p.NMDE1071del	BPTF_ENST00000424123.3_In_Frame_Del_p.NMDE932del|BPTF_ENST00000306378.6_In_Frame_Del_p.NMDE945del|BPTF_ENST00000335221.5_In_Frame_Del_p.NMDE1071del			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1071					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGCCAAAAATAATATGGATGAAAATATGGATG	0.292																																																	0																																										SO:0001651	inframe_deletion	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.3199_3210delAATATGGATGAA	17.37:g.65905706_65905717delAATATGGATGAA	ENSP00000315454:p.Asn1071_Glu1074del		Q6NX67|Q7Z7D6|Q9UIG2	In_Frame_Del	DEL	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.ENMD1070in_frame_del	ENST00000321892.4	37	c.3199_3210		17																																																																																			BPTF	-	NULL	ENSG00000171634		0.292	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding			0.00	56	0	AATATGGATGAA	NM_182641, NM_004459		65905717	+1			no_errors	ENST00000321892	ensembl	human	known	74_37	in_frame_del	5.19	73	4	DEL	0.655:0.030:0.014:0.037:0.156:0.668:0.995:0.999:1.000:1.000:1.000:1.000	0
BSN	8927	genome.wustl.edu	37	3	49699193	49699193	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:49699193C>T	ENST00000296452.4	+	6	10029	c.9915C>T	c.(9913-9915)ctC>ctT	p.L3305L		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3305					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GTGGCCACCTCCGGAGCATGG	0.597																																																	0													40.0	38.0	39.0					3																	49699193		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.9915C>T	3.37:g.49699193C>T			O43161|Q7LGH3	Silent	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.L3305	ENST00000296452.4	37	c.9915	CCDS2800.1	3																																																																																			BSN	-	NULL	ENSG00000164061		0.597	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	-	0.00	32	0	C	NM_003458		49699193	+1	tier1	-	no_errors	ENST00000296452	ensembl	human	known	74_37	silent	33.33	22	11	SNP	1.000	T
MALRD1	340895	genome.wustl.edu	37	10	19778070	19778070	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:19778070A>G	ENST00000454679.2	+	15	3095	c.3095A>G	c.(3094-3096)gAa>gGa	p.E1032G	C10orf112_ENST00000455457.2_5'UTR|C10orf112_ENST00000492202.1_Intron			Q5VYJ5	MALR1_HUMAN		1032					cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						CCGCCACAGGAAAAGCCTAAC	0.607																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.3095A>G	10.37:g.19778070A>G	ENSP00000412763:p.Glu1032Gly		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.E1032G	ENST00000454679.2	37	c.3095		10	.	.	.	.	.	.	.	.	.	.	A	4.785	0.145890	0.09134	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	D;D	0.88896	-2.44;-2.08	0.496	0.496	0.16896	.	.	.	.	.	D	0.83211	0.5205	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.71279	-0.4640	4	.	.	.	.	.	.	.	.	.	.	.	G	1045;1032	ENSP00000366477:E1045G;ENSP00000412763:E1032G	.	E	+	2	0	C10orf112	19818076	0.063000	0.20901	0.003000	0.11579	0.006000	0.05464	1.255000	0.32909	0.423000	0.26033	0.254000	0.18369	GAA	C10orf112	-	NULL	ENSG00000204740		0.607	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	27	0	A			19778070	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	35.29	44	24	SNP	0.003	G
BTRC	8945	genome.wustl.edu	37	10	103310478	103310478	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:103310478G>A	ENST00000370187.3	+	14	1797	c.1679G>A	c.(1678-1680)cGa>cAa	p.R560Q	BTRC_ENST00000393441.4_Missense_Mutation_p.R519Q|BTRC_ENST00000493877.1_3'UTR|BTRC_ENST00000408038.2_Missense_Mutation_p.R524Q	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	560					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		AGAGTTTTTCGACTACAGTTT	0.413																																																	0													172.0	158.0	163.0					10																	103310478		2203	4300	6503	SO:0001583	missense	0			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1679G>A	10.37:g.103310478G>A	ENSP00000359206:p.Arg560Gln		B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R560Q	ENST00000370187.3	37	c.1679	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.576790	0.96565	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.59638	0.25;0.25;0.25	6.06	5.16	0.70880	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.64402	D	0.000005	T	0.60090	0.2242	N	0.16307	0.4	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;P;P	0.66084	0.941;0.804;0.906	T	0.61969	-0.6953	10	0.36615	T	0.2	-6.067	15.57	0.76326	0.066:0.0:0.934:0.0	.	534;524;560	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	Q	560;519;524	ENSP00000359206:R560Q;ENSP00000377088:R519Q;ENSP00000385339:R524Q	ENSP00000359206:R560Q	R	+	2	0	BTRC	103300468	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.855000	0.99526	1.566000	0.49654	0.655000	0.94253	CGA	BTRC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166167		0.413	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1	-	0.00	92	0	G	NM_033637		103310478	+1	tier1	-	no_errors	ENST00000370187	ensembl	human	known	74_37	missense	32.00	51	24	SNP	1.000	A
C6orf165	154313	genome.wustl.edu	37	6	88126494	88126494	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:88126494A>C	ENST00000507897.1	+	6	663	c.580A>C	c.(580-582)Att>Ctt	p.I194L	C6ORF165_ENST00000369562.4_Missense_Mutation_p.I194L			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	194										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TGTTACTGGAATTCGTTTATT	0.358																																																	0													96.0	92.0	93.0					6																	88126494		2203	4300	6503	SO:0001583	missense	0			BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.580A>C	6.37:g.88126494A>C	ENSP00000426769:p.Ile194Leu		A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	pfam_DUF3508	p.I194L	ENST00000507897.1	37	c.580	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	A	34	5.314796	0.95655	.	.	ENSG00000213204	ENST00000369562;ENST00000480123	T;T	0.60424	0.24;0.19	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.64757	0.2627	M	0.80183	2.485	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.55260	0.772;0.695	T	0.67898	-0.5551	10	0.41790	T	0.15	.	15.6385	0.76977	1.0:0.0:0.0:0.0	.	194;194	Q8IYR0;E1P509	CF165_HUMAN;.	L	194	ENSP00000358575:I194L;ENSP00000422494:I194L	ENSP00000358575:I194L	I	+	1	0	C6orf165	88183213	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.847000	0.92166	2.165000	0.68154	0.533000	0.62120	ATT	C6ORF165	-	NULL	ENSG00000272514		0.358	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	Uniprot_gn	protein_coding	OTTHUMT00000470406.1	-	0.00	58	0	A	NM_178823		88126494	+1	tier1	-	no_errors	ENST00000369562	ensembl	human	known	74_37	missense	46.00	27	23	SNP	1.000	C
C7	730	genome.wustl.edu	37	5	40945409	40945409	+	Missense_Mutation	SNP	G	G	A	rs201503515		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:40945409G>A	ENST00000313164.9	+	7	1036	c.677G>A	c.(676-678)aGa>aAa	p.R226K		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	226	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TCCTTTTTTAGATCTTCATCA	0.313																																																	0													146.0	137.0	140.0					5																	40945409		1861	4102	5963	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.677G>A	5.37:g.40945409G>A	ENSP00000322061:p.Arg226Lys		Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.R226K	ENST00000313164.9	37	c.677	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	1.607	-0.524943	0.04141	.	.	ENSG00000112936	ENST00000313164;ENST00000515157	T	0.61510	0.1	4.51	-3.58	0.04597	Membrane attack complex component/perforin (MACPF) domain (1);	.	.	.	.	T	0.23965	0.0580	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.19946	0.027	T	0.27938	-1.0059	9	0.02654	T	1	4.3435	1.6478	0.02765	0.166:0.3626:0.2071:0.2644	.	226	P10643	CO7_HUMAN	K	226	ENSP00000322061:R226K	ENSP00000322061:R226K	R	+	2	0	C7	40981166	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.804000	0.04535	-0.758000	0.04690	-0.225000	0.12378	AGA	C7	-	NULL	ENSG00000112936		0.313	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1		0.00	47	0	G			40945409	+1			no_errors	ENST00000313164	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.000	A
C9orf64	84267	genome.wustl.edu	37	9	86554642	86554642	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:86554642A>T	ENST00000376344.3	-	4	1026	c.810T>A	c.(808-810)taT>taA	p.Y270*	C9orf64_ENST00000314700.1_Nonsense_Mutation_p.Y129*	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	270										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GCCTGTCTCCATATGAGAGCA	0.413																																																	0													86.0	92.0	90.0					9																	86554642		2203	4300	6503	SO:0001587	stop_gained	0			AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.810T>A	9.37:g.86554642A>T	ENSP00000365522:p.Tyr270*		B2RPI6|Q8N2B1|Q9BT18	Nonsense_Mutation	SNP	pfam_DUF2419	p.Y270*	ENST00000376344.3	37	c.810	CCDS6666.2	9	.	.	.	.	.	.	.	.	.	.	A	36	5.876864	0.97055	.	.	ENSG00000165118	ENST00000376344;ENST00000314700	.	.	.	4.98	3.84	0.44239	.	0.401706	0.27455	N	0.019291	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-4.7515	10.7597	0.46258	0.9245:0.0:0.0755:0.0	.	.	.	.	X	270;129	.	ENSP00000318375:Y129X	Y	-	3	2	C9orf64	85744462	1.000000	0.71417	0.961000	0.40146	0.966000	0.64601	1.060000	0.30530	0.861000	0.35504	0.446000	0.29264	TAT	C9orf64	-	pfam_DUF2419	ENSG00000165118		0.413	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf64	HGNC	protein_coding	OTTHUMT00000052865.1		0.00	26	0	A	NM_032307		86554642	-1			no_errors	ENST00000376344	ensembl	human	known	74_37	nonsense	13.33	13	2	SNP	1.000	T
CAMK2B	816	genome.wustl.edu	37	7	44279215	44279215	+	Missense_Mutation	SNP	C	C	T	rs560190297	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:44279215C>T	ENST00000395749.2	-	13	1070	c.994G>A	c.(994-996)Ggc>Agc	p.G332S	CAMK2B_ENST00000457475.1_Intron|CAMK2B_ENST00000358707.3_Intron|CAMK2B_ENST00000346990.4_Intron|CAMK2B_ENST00000353625.4_Intron|CAMK2B_ENST00000347193.4_Missense_Mutation_p.G332S|CAMK2B_ENST00000502837.2_Missense_Mutation_p.G203S|CAMK2B_ENST00000440254.2_Missense_Mutation_p.G332S|CAMK2B_ENST00000350811.3_Missense_Mutation_p.G332S|CAMK2B_ENST00000258682.6_Intron|CAMK2B_ENST00000395747.2_Intron	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	332					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						ATGGTGGTGCCGGAGGCCGCG	0.682													C|||	3	0.000599042	0.0	0.0	5008	,	,		11434	0.0		0.0	False		,,,				2504	0.0031																0													57.0	40.0	45.0					7																	44279215		1901	3632	5533	SO:0001583	missense	0			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.994G>A	7.37:g.44279215C>T	ENSP00000379098:p.Gly332Ser		A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G332S	ENST00000395749.2	37	c.994	CCDS5483.1	7	.	.	.	.	.	.	.	.	.	.	C	16.62	3.173264	0.57584	.	.	ENSG00000058404	ENST00000350811;ENST00000395749;ENST00000502837;ENST00000440254;ENST00000347193	T;T;T;T;T	0.66280	-0.2;-0.17;0.5;-0.2;-0.17	4.68	4.68	0.58851	Protein kinase-like domain (1);	.	.	.	.	T	0.37972	0.1023	N	0.11201	0.11	0.53688	D	0.999972	B;B;B	0.29212	0.025;0.237;0.001	B;B;B	0.19148	0.008;0.024;0.001	T	0.28138	-1.0053	9	0.26408	T	0.33	.	10.1656	0.42877	0.0:0.9071:0.0:0.0929	.	332;332;332	Q13554-6;Q13554;Q13554-2	.;KCC2B_HUMAN;.	S	332;332;203;332;332	ENSP00000326375:G332S;ENSP00000379098:G332S;ENSP00000422416:G203S;ENSP00000397937:G332S;ENSP00000326544:G332S	ENSP00000326544:G332S	G	-	1	0	CAMK2B	44245740	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.914000	0.39966	2.448000	0.82819	0.557000	0.71058	GGC	CAMK2B	-	superfamily_Kinase-like_dom	ENSG00000058404		0.682	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	HGNC	protein_coding	OTTHUMT00000251138.2	-	0.00	79	0	C	NM_172084		44279215	-1	tier1	-	no_errors	ENST00000395749	ensembl	human	known	74_37	missense	15.68	156	29	SNP	1.000	T
CAPN11	11131	genome.wustl.edu	37	6	44148528	44148528	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:44148528G>T	ENST00000398776.1	+	17	1828	c.1790G>T	c.(1789-1791)aGg>aTg	p.R597M	CAPN11_ENST00000542245.1_Missense_Mutation_p.R597M	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	597	Domain IV.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGCTCAACAGGATGGCCATC	0.592																																																	0													107.0	123.0	118.0					6																	44148528		2079	4199	6278	SO:0001583	missense	0			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1790G>T	6.37:g.44148528G>T	ENSP00000381758:p.Arg597Met		B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.R597M	ENST00000398776.1	37	c.1790	CCDS47436.1	6	.	.	.	.	.	.	.	.	.	.	g	11.08	1.532990	0.27387	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	T;T	0.30981	1.51;1.51	4.91	-1.31	0.09230	EF-hand-like domain (1);	0.693142	0.13119	N	0.412349	T	0.24431	0.0592	L	0.55213	1.73	0.09310	N	0.999998	D;D	0.58268	0.979;0.982	P;B	0.57371	0.819;0.226	T	0.16335	-1.0406	10	0.49607	T	0.09	.	10.664	0.45719	0.6401:0.0:0.3599:0.0	.	251;597	B4DT90;Q9UMQ6	.;CAN11_HUMAN	M	597	ENSP00000381758:R597M;ENSP00000441078:R597M	ENSP00000381758:R597M	R	+	2	0	CAPN11	44256506	0.998000	0.40836	0.109000	0.21407	0.142000	0.21351	0.953000	0.29162	-0.403000	0.07622	-0.478000	0.04885	AGG	CAPN11	-	NULL	ENSG00000137225		0.592	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPN11	HGNC	protein_coding	OTTHUMT00000040714.3		0.00	23	0	G			44148528	+1			no_errors	ENST00000398776	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.062	T
CCDC13	152206	genome.wustl.edu	37	3	42775004	42775004	+	Missense_Mutation	SNP	G	G	A	rs139169922		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:42775004G>A	ENST00000310232.6	-	11	1552	c.1469C>T	c.(1468-1470)cCg>cTg	p.P490L	CCDC13-AS1_ENST00000418161.1_RNA|CCDC13-AS1_ENST00000446950.1_RNA	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	490										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TGCTGAGGCCGGGGACTTGGT	0.547																																																	0								G	LEU/PRO	0,4406		0,0,2203	123.0	135.0	131.0		1469	3.8	0.2	3	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	missense	CCDC13	NM_144719.3	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	490/716	42775004	1,13005	2203	4300	6503	SO:0001583	missense	0			AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1469C>T	3.37:g.42775004G>A	ENSP00000309836:p.Pro490Leu			Missense_Mutation	SNP	superfamily_Prefoldin	p.P490L	ENST00000310232.6	37	c.1469	CCDS2705.1	3	.	.	.	.	.	.	.	.	.	.	G	6.626	0.483906	0.12581	0.0	1.16E-4	ENSG00000244607	ENST00000310232	T	0.12465	2.68	5.58	3.8	0.43715	.	0.331866	0.25968	N	0.027151	T	0.09730	0.0239	L	0.32530	0.975	0.22911	N	0.998575	B	0.26041	0.14	B	0.20767	0.031	T	0.28332	-1.0047	10	0.27082	T	0.32	.	8.7806	0.34789	0.1736:0.0:0.8264:0.0	.	490	Q8IYE1	CCD13_HUMAN	L	490	ENSP00000309836:P490L	ENSP00000309836:P490L	P	-	2	0	CCDC13	42750008	0.957000	0.32711	0.247000	0.24249	0.276000	0.26787	2.035000	0.41155	0.727000	0.32360	0.655000	0.94253	CCG	CCDC13	-	NULL	ENSG00000244607		0.547	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC13	HGNC	protein_coding	OTTHUMT00000256652.1	-	0.00	41	0	G	NM_144719		42775004	-1	tier1	rs139169922	no_errors	ENST00000310232	ensembl	human	known	74_37	missense	19.81	85	21	SNP	0.144	A
CCDC132	55610	genome.wustl.edu	37	7	92902025	92902025	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:92902025C>T	ENST00000305866.5	+	11	909	c.781C>T	c.(781-783)Cga>Tga	p.R261*	CCDC132_ENST00000541136.1_Nonsense_Mutation_p.R72*|CCDC132_ENST00000317751.6_5'UTR|CCDC132_ENST00000535481.1_Intron|CCDC132_ENST00000251739.5_Nonsense_Mutation_p.R261*|CCDC132_ENST00000544910.1_Nonsense_Mutation_p.R231*	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	261						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			ACAAGCTTATCGACTTCTTGG	0.323																																																	0													77.0	74.0	75.0					7																	92902025		2203	4298	6501	SO:0001587	stop_gained	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.781C>T	7.37:g.92902025C>T	ENSP00000307666:p.Arg261*		B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Nonsense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.R261*	ENST00000305866.5	37	c.781	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	C	23.4	4.414318	0.83449	.	.	ENSG00000004766	ENST00000251739;ENST00000305866;ENST00000544910;ENST00000541136	.	.	.	5.64	2.63	0.31362	.	0.121474	0.53938	D	0.000049	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-24.1895	14.5196	0.67842	0.5412:0.4588:0.0:0.0	.	.	.	.	X	261;261;231;72	.	ENSP00000251739:R261X	R	+	1	2	CCDC132	92739961	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.001000	0.49488	0.826000	0.34661	-0.158000	0.13435	CGA	CCDC132	-	pfam_Vacuolar_sorting-assoc_54	ENSG00000004766		0.323	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	-	0.00	54	0	C	NM_017667		92902025	+1	tier1	-	no_errors	ENST00000305866	ensembl	human	known	74_37	nonsense	9.09	60	6	SNP	1.000	T
CCL7	6354	genome.wustl.edu	37	17	32598171	32598171	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:32598171T>G	ENST00000378569.2	+	2	153	c.83T>G	c.(82-84)aTt>aGt	p.I28S	CCL7_ENST00000394630.3_Intron|CCL7_ENST00000200307.4_Missense_Mutation_p.I38S|CCL7_ENST00000394627.1_Missense_Mutation_p.L46V	NM_006273.2	NP_006264.2	P80098	CCL7_HUMAN	chemokine (C-C motif) ligand 7	28					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to ethanol (GO:0071361)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|positive regulation of cell migration (GO:0030335)|positive regulation of natural killer cell chemotaxis (GO:2000503)|regulation of cell shape (GO:0008360)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			autonomic_ganglia(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Breast(3;0.00224)	Breast(31;0.151)|Ovarian(249;0.17)		BRCA - Breast invasive adenocarcinoma(366;0.155)		GCAGTTGGGATTAATACTTCA	0.438																																																	0													84.0	81.0	82.0					17																	32598171		2203	4300	6503	SO:0001583	missense	0			AF043338	CCDS11278.1	17q11.2-q12	2013-02-25	2002-08-22	2002-08-23	ENSG00000108688	ENSG00000108688		"""Chemokine ligands"", ""Endogenous ligands"""	10634	protein-coding gene	gene with protein product	"""monocyte chemoattractant protein 3"", ""monocyte chemotactic protein 3"""	158106	"""small inducible cytokine A7 (monocyte chemotactic protein 3)"""	SCYA6, SCYA7		8461011	Standard	NM_006273		Approved	MCP-3, NC28, FIC, MARC, MCP3	uc002hhz.4	P80098	OTTHUMG00000132889	ENST00000378569.2:c.83T>G	17.37:g.32598171T>G	ENSP00000367832:p.Ile28Ser		Q569J6	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.I38S	ENST00000378569.2	37	c.113	CCDS11278.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.014|8.014	0.758082|0.758082	0.15846|0.15846	.|.	.|.	ENSG00000108688|ENSG00000108688	ENST00000378569;ENST00000200307|ENST00000394627	.|T	.|0.25414	.|1.8	4.94|4.94	-3.55|-3.55	0.04639|0.04639	Chemokine interleukin-8-like domain (1);|.	1.522180|.	0.03897|.	N|.	0.279741|.	T|T	0.18882|0.18882	0.0453|0.0453	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	P|.	0.35383|.	0.498|.	B|.	0.40329|.	0.326|.	T|T	0.36311|0.36311	-0.9753|-0.9753	8|6	0.30078|0.87932	T|D	0.28|0	.|.	1.2097|1.2097	0.01902|0.01902	0.1404:0.2877:0.2866:0.2853|0.1404:0.2877:0.2866:0.2853	.|.	28|.	P80098|.	CCL7_HUMAN|.	S|V	38;28|56	.|ENSP00000378124:L56V	ENSP00000200307:I28S|ENSP00000378124:L56V	I|L	+|+	2|1	0|2	CCL7|CCL7	29622284|29622284	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	0.115000|0.115000	0.15540|0.15540	-0.555000|-0.555000	0.06142|0.06142	0.533000|0.533000	0.62120|0.62120	ATT|TTA	CCL7	-	superfamily_Chemokine_IL8-like_dom	ENSG00000108688		0.438	CCL7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	CCL7	HGNC	protein_coding	OTTHUMT00000256386.2	-	0.00	24	0	T	NM_006273		32598171	+1	tier1	-	no_errors	ENST00000200307	ensembl	human	known	74_37	missense	22.37	59	17	SNP	0.000	G
CCSER2	54462	genome.wustl.edu	37	10	86259679	86259679	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:86259679G>A	ENST00000224756.8	+	10	2559	c.2374G>A	c.(2374-2376)Ggg>Agg	p.G792R	CCSER2_ENST00000543283.1_Missense_Mutation_p.G219R|CCSER2_ENST00000372088.2_Intron|CCSER2_ENST00000494144.1_Intron	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	792					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											CTCCTTCCAGGGGATCCCACG	0.537																																																	0													128.0	114.0	119.0					10																	86259679		2203	4300	6503	SO:0001583	missense	0				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.2374G>A	10.37:g.86259679G>A	ENSP00000224756:p.Gly792Arg		B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Missense_Mutation	SNP	NULL	p.G792R	ENST00000224756.8	37	c.2374	CCDS31235.1	10	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798211	0.70567	.	.	ENSG00000107771	ENST00000224756;ENST00000543283	T;T	0.36520	1.54;1.25	5.96	5.96	0.96718	.	0.063428	0.64402	D	0.000011	T	0.57577	0.2063	L	0.56769	1.78	0.42510	D	0.992961	D	0.76494	0.999	D	0.69479	0.964	T	0.57039	-0.7879	10	0.72032	D	0.01	.	17.9083	0.88926	0.0:0.0:1.0:0.0	.	792	Q9H7U1	F190B_HUMAN	R	792;219	ENSP00000224756:G792R;ENSP00000439944:G219R	ENSP00000224756:G792R	G	+	1	0	FAM190B	86249659	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.888000	0.69758	2.833000	0.97629	0.555000	0.69702	GGG	CCSER2	-	NULL	ENSG00000107771		0.537	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSER2	HGNC	protein_coding	OTTHUMT00000049132.2	-	0.00	21	0	G	NM_018999		86259679	+1	tier1	-	no_errors	ENST00000224756	ensembl	human	known	74_37	missense	50.00	16	16	SNP	1.000	A
CCT7	10574	genome.wustl.edu	37	2	73470141	73470141	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:73470141G>T	ENST00000258091.5	+	4	418	c.277G>T	c.(277-279)Ggc>Tgc	p.G93C	CCT7_ENST00000539919.1_Missense_Mutation_p.G49C|CCT7_ENST00000537131.1_Intron|CCT7_ENST00000540468.1_Missense_Mutation_p.G6C|CCT7_ENST00000538797.1_5'UTR|CCT7_ENST00000398422.2_Intron|CCT7_ENST00000473786.1_3'UTR	NM_006429.3	NP_006420.1	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 (eta)	93					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|cervix(1)|endometrium(1)|lung(3)|stomach(1)	7						GGTGGGTGATGGCACCACCTC	0.478																																																	0													73.0	71.0	71.0					2																	73470141		1944	4145	6089	SO:0001583	missense	0			AF026292	CCDS42696.1, CCDS46336.1, CCDS54366.1, CCDS54367.1	2p13.2	2011-09-02			ENSG00000135624	ENSG00000135624		"""Heat Shock Proteins / Chaperonins"""	1622	protein-coding gene	gene with protein product		605140				9819444	Standard	NM_006429		Approved	Ccth, Nip7-1	uc002siz.3	Q99832	OTTHUMG00000152765	ENST00000258091.5:c.277G>T	2.37:g.73470141G>T	ENSP00000258091:p.Gly93Cys		A8K7E6|A8MWI8|B7WNW9|B7Z4T9|B7Z4Z7|O14871|Q6FI26	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_eta	p.G93C	ENST00000258091.5	37	c.277	CCDS46336.1	2	.	.	.	.	.	.	.	.	.	.	G	24.6	4.549533	0.86127	.	.	ENSG00000135624	ENST00000540468;ENST00000539919;ENST00000258091;ENST00000399032	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	4.7	4.7	0.59300	Chaperonin TCP-1, conserved site (1);	0.102143	0.64402	D	0.000003	T	0.79661	0.4484	H	0.99487	4.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.88389	0.3007	10	0.87932	D	0	-3.5919	15.5125	0.75795	0.0:0.0:1.0:0.0	.	6;93	B7Z4Z7;Q99832	.;TCPH_HUMAN	C	6;49;93;49	ENSP00000442058:G6C;ENSP00000437824:G49C;ENSP00000258091:G93C;ENSP00000412996:G49C	ENSP00000258091:G93C	G	+	1	0	CCT7	73323649	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.503000	0.97984	2.603000	0.88011	0.462000	0.41574	GGC	CCT7	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_eta	ENSG00000135624		0.478	CCT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT7	HGNC	protein_coding	OTTHUMT00000327714.2	-	0.00	65	0	G			73470141	+1	tier1	-	no_errors	ENST00000258091	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
CD1E	913	genome.wustl.edu	37	1	158325247	158325247	+	Silent	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:158325247G>C	ENST00000368167.3	+	3	752	c.513G>C	c.(511-513)gtG>gtC	p.V171V	CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368161.3_Silent_p.V171V|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000444681.2_Silent_p.V72V|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368163.3_Silent_p.V171V|CD1E_ENST00000368156.1_Intron|CD1E_ENST00000434258.1_Silent_p.V169V|CD1E_ENST00000368160.3_Silent_p.V171V	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	171					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TCTGTAAAGTGCTCAATCGCT	0.493																																																	0													83.0	82.0	82.0					1																	158325247		1882	4120	6002	SO:0001819	synonymous_variant	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.513G>C	1.37:g.158325247G>C			B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V171	ENST00000368167.3	37	c.513	CCDS41417.1	1																																																																																			CD1E	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158488		0.493	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	49	0	G	NM_030893		158325247	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	silent	29.41	24	10	SNP	0.896	C
CDK13	8621	genome.wustl.edu	37	7	40027590	40027590	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:40027590A>G	ENST00000181839.4	+	2	2209	c.1604A>G	c.(1603-1605)gAc>gGc	p.D535G	CDK13_ENST00000340829.5_Missense_Mutation_p.D535G|CDK13_ENST00000484589.1_3'UTR	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	535					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						TTAAAAAATGACAAAGCAAAA	0.383																																																	0													65.0	57.0	60.0					7																	40027590		2203	4300	6503	SO:0001583	missense	0			M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.1604A>G	7.37:g.40027590A>G	ENSP00000181839:p.Asp535Gly		Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D535G	ENST00000181839.4	37	c.1604	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	A	18.26	3.585051	0.66105	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.69435	-0.4;-0.4	6.03	6.03	0.97812	.	.	.	.	.	T	0.68550	0.3013	L	0.51422	1.61	0.54753	D	0.999987	P;P	0.42692	0.787;0.682	P;B	0.46585	0.521;0.321	T	0.66763	-0.5841	8	.	.	.	-8.5262	16.5582	0.84512	1.0:0.0:0.0:0.0	.	535;535	Q14004-2;Q14004	.;CDK13_HUMAN	G	535	ENSP00000181839:D535G;ENSP00000340557:D535G	.	D	+	2	0	CDK13	39994115	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.863000	0.75489	2.308000	0.77769	0.533000	0.62120	GAC	CDK13	-	NULL	ENSG00000065883		0.383	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	HGNC	protein_coding	OTTHUMT00000250726.2	-	0.00	29	0	A	NM_003718		40027590	+1	tier1	-	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	G
CDHR3	222256	genome.wustl.edu	37	7	105636743	105636743	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:105636743C>T	ENST00000317716.9	+	6	736	c.656C>T	c.(655-657)tCc>tTc	p.S219F	CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000343407.5_5'UTR|CDHR3_ENST00000541203.1_Intron|CDHR3_ENST00000542731.1_Missense_Mutation_p.S219F|CDHR3_ENST00000478080.1_Missense_Mutation_p.S131F	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	219	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						CTCAAAGCCTCCACAGAGCTC	0.567																																																	0													40.0	43.0	42.0					7																	105636743		1979	4146	6125	SO:0001583	missense	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.656C>T	7.37:g.105636743C>T	ENSP00000325954:p.Ser219Phe		Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S219F	ENST00000317716.9	37	c.656	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	C	11.39	1.625390	0.28889	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.55052	0.54;0.54;0.54	5.27	4.35	0.52113	Cadherin (4);Cadherin-like (1);	0.190881	0.41823	D	0.000804	T	0.69223	0.3087	M	0.78637	2.42	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.66979	0.948;0.948	T	0.72323	-0.4328	10	0.87932	D	0	-24.187	11.3488	0.49575	0.1799:0.8201:0.0:0.0	.	206;219	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	F	219;219;131	ENSP00000439766:S219F;ENSP00000325954:S219F;ENSP00000417771:S131F	ENSP00000325954:S219F	S	+	2	0	CDHR3	105423979	0.982000	0.34865	1.000000	0.80357	0.056000	0.15407	2.377000	0.44300	2.758000	0.94735	0.555000	0.69702	TCC	CDHR3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000128536		0.567	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	-	0.00	74	0	C	NM_152750		105636743	+1	tier1	-	no_errors	ENST00000317716	ensembl	human	known	74_37	missense	20.00	120	30	SNP	1.000	T
CDK5RAP2	55755	genome.wustl.edu	37	9	123216149	123216149	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:123216149G>T	ENST00000349780.4	-	21	2557	c.2378C>A	c.(2377-2379)cCa>cAa	p.P793Q	CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.P761Q|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.P793Q|CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.P793Q	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	793					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						CAGAAGGTCTGGCCTGTTTTT	0.488																																																	0													54.0	51.0	52.0					9																	123216149		2179	4253	6432	SO:0001583	missense	0			BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.2378C>A	9.37:g.123216149G>T	ENSP00000343818:p.Pro793Gln		Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	pfam_Spindle_assoc	p.P793Q	ENST00000349780.4	37	c.2378	CCDS6823.1	9	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192157	0.58017	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000416449	T;T;T;T;T	0.17370	3.95;3.81;4.01;3.9;2.28	5.79	5.79	0.91817	.	0.103370	0.43579	D	0.000541	T	0.25680	0.0625	N	0.24115	0.695	0.41489	D	0.988213	D;D;D;D	0.89917	0.995;1.0;0.991;0.995	P;D;P;P	0.91635	0.87;0.999;0.813;0.87	T	0.02560	-1.1141	10	0.23891	T	0.37	.	12.5266	0.56089	0.0:0.0:0.8338:0.1662	.	562;793;793;187	Q6MZT4;Q96SN8-4;Q96SN8;B1AMJ5	.;.;CK5P2_HUMAN;.	Q	761;793;793;793;187	ENSP00000354065:P761Q;ENSP00000352258:P793Q;ENSP00000343818:P793Q;ENSP00000353317:P793Q;ENSP00000400395:P187Q	ENSP00000343818:P793Q	P	-	2	0	CDK5RAP2	122255970	0.999000	0.42202	0.990000	0.47175	0.849000	0.48306	3.416000	0.52707	2.733000	0.93635	0.655000	0.94253	CCA	CDK5RAP2	-	NULL	ENSG00000136861		0.488	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK5RAP2	HGNC	protein_coding	OTTHUMT00000055535.1		0.00	29	0	G	NM_018249		123216149	-1			no_errors	ENST00000349780	ensembl	human	known	74_37	missense	8.00	45	4	SNP	0.996	T
CELA1	1990	genome.wustl.edu	37	12	51723603	51723603	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:51723603G>A	ENST00000293636.1	-	7	664	c.624C>T	c.(622-624)ggC>ggT	p.G208G		NM_001971.5	NP_001962.3	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	208	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				exocrine pancreas development (GO:0031017)|inflammatory response (GO:0006954)|multicellular organism growth (GO:0035264)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas morphogenesis (GO:0061113)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15						AATGGAGGGGGCCCCCAGAGT	0.552																																																	0													60.0	61.0	61.0					12																	51723603		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8812.1	12q13	2012-10-02	2009-05-05	2009-05-05	ENSG00000139610	ENSG00000139610			3308	protein-coding gene	gene with protein product		130120	"""elastase 1, pancreatic"""	ELA1			Standard	NM_001971		Approved		uc001ryi.1	Q9UNI1	OTTHUMG00000167523	ENST00000293636.1:c.624C>T	12.37:g.51723603G>A			Q5MLF0|Q6DJT0|Q6ISM6	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G208	ENST00000293636.1	37	c.624	CCDS8812.1	12																																																																																			CELA1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000139610		0.552	CELA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA1	HGNC	protein_coding	OTTHUMT00000394901.1	-	0.00	19	0	G	NM_001971		51723603	-1	tier1	-	no_errors	ENST00000293636	ensembl	human	known	74_37	silent	50.00	14	14	SNP	0.031	A
CHD9	80205	genome.wustl.edu	37	16	53341776	53341776	+	Missense_Mutation	SNP	G	G	A	rs201884816		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:53341776G>A	ENST00000398510.3	+	32	7051	c.6964G>A	c.(6964-6966)Ggt>Agt	p.G2322S	CHD9_ENST00000447540.1_Missense_Mutation_p.G2323S|CHD9_ENST00000566029.1_Missense_Mutation_p.G2322S|CHD9_ENST00000564845.1_Missense_Mutation_p.G2322S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2322					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CCCAGGTGCCGGTGTTAAAGA	0.453																																																	0								G	SER/GLY	0,3918		0,0,1959	41.0	41.0	41.0		6964	4.6	1.0	16		41	1,8315		0,1,4157	yes	missense	CHD9	NM_025134.4	56	0,1,6116	AA,AG,GG		0.012,0.0,0.0082	possibly-damaging	2322/2882	53341776	1,12233	1959	4158	6117	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6964G>A	16.37:g.53341776G>A	ENSP00000381522:p.Gly2322Ser		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G2322S	ENST00000398510.3	37	c.6964		16	.	.	.	.	.	.	.	.	.	.	G	5.569	0.289852	0.10567	0.0	1.2E-4	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000450543	D;D	0.84800	-1.9;-1.81	5.58	4.6	0.57074	.	0.335070	0.25112	N	0.033047	T	0.64972	0.2647	N	0.05441	-0.05	0.09310	N	1	P;P;B;P;P	0.47191	0.539;0.825;0.011;0.825;0.891	B;B;B;B;B	0.40702	0.04;0.14;0.004;0.182;0.338	T	0.63189	-0.6693	10	0.02654	T	1	-4.1191	8.408	0.32627	0.0816:0.0:0.7668:0.1516	.	388;2322;2323;2322;2322	C9JR69;B7ZML1;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;.;CHD9_HUMAN;.	S	2323;2322;388	ENSP00000396345:G2323S;ENSP00000381522:G2322S	ENSP00000381522:G2322S	G	+	1	0	CHD9	51899277	1.000000	0.71417	0.962000	0.40283	0.939000	0.58152	3.350000	0.52224	1.416000	0.47057	0.557000	0.71058	GGT	CHD9	-	NULL	ENSG00000177200		0.453	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	-	0.00	32	0	G	NM_025134		53341776	+1	tier1	rs201884816	no_errors	ENST00000398510	ensembl	human	known	74_37	missense	58.82	21	30	SNP	0.177	A
CHDC2	286464	genome.wustl.edu	37	X	36103549	36103549	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:36103549A>T	ENST00000313548.4	+	5	721	c.535A>T	c.(535-537)Aaa>Taa	p.K179*		NM_173695.2	NP_775966.1	Q8N9S7	CHDC2_HUMAN	calponin homology domain containing 2	179						integral component of membrane (GO:0016021)											TTTGAGTGGAAAAATGCCACC	0.373																																																	0													88.0	83.0	84.0					X																	36103549		2202	4300	6502	SO:0001587	stop_gained	0			AK093920	CCDS14238.1	Xp21.1	2014-08-07	2012-11-28	2012-11-28	ENSG00000176034	ENSG00000176034			26708	protein-coding gene	gene with protein product			"""chromosome X open reading frame 59"""	CXorf59			Standard	NM_173695		Approved	FLJ36601, RP13-11B7.1	uc004ddk.1	Q8N9S7	OTTHUMG00000021351	ENST00000313548.4:c.535A>T	X.37:g.36103549A>T	ENSP00000324767:p.Lys179*			Nonsense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain	p.K179*	ENST00000313548.4	37	c.535	CCDS14238.1	X	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981621	0.74474	.	.	ENSG00000176034	ENST00000378660;ENST00000313548	.	.	.	5.7	2.06	0.26882	.	0.712867	0.12424	N	0.470194	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5591	6.7607	0.23538	0.3773:0.5218:0.1008:0.0	.	.	.	.	X	179	.	ENSP00000324767:K179X	K	+	1	0	CXorf59	36013470	0.859000	0.29813	0.244000	0.24202	0.099000	0.18886	0.692000	0.25482	0.266000	0.21894	0.486000	0.48141	AAA	CHDC2	-	NULL	ENSG00000176034		0.373	CHDC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CHDC2	HGNC	protein_coding		-	0.00	31	0	A	NM_173695		36103549	+1	tier1	-	no_errors	ENST00000313548	ensembl	human	known	74_37	nonsense	60.00	18	27	SNP	0.512	T
CHRD	8646	genome.wustl.edu	37	3	184105786	184105786	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:184105786G>A	ENST00000204604.1	+	20	2765	c.2519G>A	c.(2518-2520)cGt>cAt	p.R840H	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Missense_Mutation_p.R382H|CHRD_ENST00000348986.3_Missense_Mutation_p.R800H|CHRD_ENST00000450923.1_Missense_Mutation_p.R840H	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	840	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGCCTGTGCGTGTCAACCCC	0.617																																																	0													46.0	39.0	42.0					3																	184105786		2203	4300	6503	SO:0001583	missense	0			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.2519G>A	3.37:g.184105786G>A	ENSP00000204604:p.Arg840His		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	pfam_CHRD,pfam_VWF_C,smart_VWF_C,smart_CHRD,pirsf_Chordin,pfscan_CHRD,pfscan_VWF_C	p.R840H	ENST00000204604.1	37	c.2519	CCDS3266.1	3	.	.	.	.	.	.	.	.	.	.	G	28.0	4.880059	0.91740	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	4.73	4.73	0.59995	von Willebrand factor, type C (3);	0.000000	0.85682	D	0.000000	T	0.74604	0.3738	L	0.49455	1.56	0.33929	D	0.64186	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	T	0.82534	-0.0409	10	0.66056	D	0.02	-12.1947	16.2662	0.82581	0.0:0.0:1.0:0.0	.	382;800;840;840	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	H	840;840;800;382	ENSP00000204604:R840H;ENSP00000408972:R840H;ENSP00000334036:R800H;ENSP00000442948:R382H	ENSP00000204604:R840H	R	+	2	0	CHRD	185588480	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	7.086000	0.76885	2.178000	0.69098	0.557000	0.71058	CGT	CHRD	-	pfam_VWF_C,smart_VWF_C,pirsf_Chordin	ENSG00000090539		0.617	CHRD-001	KNOWN	basic|CCDS	protein_coding	CHRD	HGNC	protein_coding	OTTHUMT00000280432.1	-	0.00	32	0	G	NM_003741		184105786	+1	tier1	-	no_errors	ENST00000204604	ensembl	human	known	74_37	missense	61.11	27	44	SNP	1.000	A
CHRNA1	1134	genome.wustl.edu	37	2	175612893	175612893	+	Missense_Mutation	SNP	C	C	T	rs372104868		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:175612893C>T	ENST00000261007.5	-	10	1474	c.1408G>A	c.(1408-1410)Gtg>Atg	p.V470M	CHRNA1_ENST00000409542.1_Missense_Mutation_p.V363M|CHRNA1_ENST00000348749.5_Missense_Mutation_p.V445M|AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409219.1_Missense_Mutation_p.V365M	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	470					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CCTGCAAACACGGCTAGGGTT	0.522													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19730	0.0		0.0	False		,,,				2504	0.0																0								C	MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	98.0	90.0	93.0		1333,1408	5.2	1.0	2		93	0,8600		0,0,4300	no	missense,missense	CHRNA1	NM_000079.3,NM_001039523.2	21,21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	445/458,470/483	175612893	1,13005	2203	4300	6503	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.1408G>A	2.37:g.175612893C>T	ENSP00000261007:p.Val470Met		B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.V470M	ENST00000261007.5	37	c.1408	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368301	0.61513	2.27E-4	0.0	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-1.87	5.24	5.24	0.73138	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90417	0.7000	L	0.56199	1.76	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.67382	0.936;0.951	D	0.89969	0.4092	10	0.48119	T	0.1	.	19.1987	0.93701	0.0:1.0:0.0:0.0	.	445;470	Q53SH4;P02708	.;ACHA_HUMAN	M	445;470;363;365	ENSP00000261008:V445M;ENSP00000261007:V470M;ENSP00000387026:V363M;ENSP00000386611:V365M	ENSP00000261007:V470M	V	-	1	0	CHRNA1	175321139	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.737000	0.62066	2.607000	0.88179	0.655000	0.94253	GTG	CHRNA1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000138435		0.522	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	-	0.00	31	0	C			175612893	-1	tier1	-	no_errors	ENST00000261007	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	T
CHST5	23563	genome.wustl.edu	37	16	75563605	75563605	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:75563605C>T	ENST00000336257.3	-	3	2072	c.678G>A	c.(676-678)ccG>ccA	p.P226P	CHST5_ENST00000541075.1_Silent_p.P232P|RP11-77K12.7_ENST00000460606.1_3'UTR	NM_024533.4	NP_078809.2	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5	226					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)	24						GCACGGCCCGCGGGTCGCGCA	0.701																																																	0													28.0	35.0	32.0					16																	75563605		2190	4293	6483	SO:0001819	synonymous_variant	0			AF176839	CCDS10919.1	16q23.1	2008-02-05			ENSG00000135702	ENSG00000135702		"""Sulfotransferases, membrane-bound"""	1973	protein-coding gene	gene with protein product		604817				10491328, 11017086	Standard	NM_024533		Approved	I-GLCNAC-6-ST, FLJ22167	uc002fei.3	Q9GZS9	OTTHUMG00000137610	ENST00000336257.3:c.678G>A	16.37:g.75563605C>T			B2RV23|Q7LCN3|Q9UBY3	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.P232	ENST00000336257.3	37	c.696	CCDS10919.1	16																																																																																			CHST5	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000135702		0.701	CHST5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST5	HGNC	protein_coding	OTTHUMT00000269025.2	-	0.00	19	0	C	NM_012126		75563605	-1	tier1	-	no_errors	ENST00000541075	ensembl	human	known	74_37	silent	29.17	17	7	SNP	0.955	T
CNTNAP3B	728577	genome.wustl.edu	37	9	43844193	43844193	+	Silent	SNP	G	G	A	rs199599712		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:43844193G>A	ENST00000377564.3	+	10	1920	c.1527G>A	c.(1525-1527)ggG>ggA	p.G509G		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	509	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						CCCTGGGAGGGTTTCAGGGCT	0.512																																																	0																																										SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1527G>A	9.37:g.43844193G>A			B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G509	ENST00000377564.3	37	c.1527	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	g	6.455	0.452064	0.12283	.	.	ENSG00000154529	ENST00000377561	.	.	.	3.46	-6.92	0.01644	.	.	.	.	.	T	0.23649	0.0572	.	.	.	0.09310	P	0.999999858302	.	.	.	.	.	.	T	0.31364	-0.9946	4	0.87932	D	0	.	0.3865	0.00403	0.1991:0.2569:0.2484:0.2956	.	.	.	.	D	558	.	ENSP00000366784:G558D	G	+	2	0	CNTNAP3B	43784189	0.000000	0.05858	0.002000	0.10522	0.346000	0.29079	-2.927000	0.00690	-2.346000	0.00621	0.491000	0.48974	GGT	CNTNAP3B	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000154529		0.512	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	-	0.00	26	0	G			43844193	+1	tier1	rs199599712	no_errors	ENST00000377564	ensembl	human	known	74_37	silent	22.86	27	8	SNP	0.004	A
COMP	1311	genome.wustl.edu	37	19	18897059	18897059	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:18897059C>T	ENST00000222271.2	-	12	1341	c.1297G>A	c.(1297-1299)Gat>Aat	p.D433N	COMP_ENST00000542601.2_Missense_Mutation_p.D400N|COMP_ENST00000425807.1_Missense_Mutation_p.D380N	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	433					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TGGTCTTGATCGCTGTCACAA	0.572																																																	0													71.0	70.0	70.0					19																	18897059		2203	4300	6503	SO:0001583	missense	0			L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1297G>A	19.37:g.18897059C>T	ENSP00000222271:p.Asp433Asn		B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	pfam_Thrombospondin_C,pfam_EGF-like_Ca-bd_dom,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.D433N	ENST00000222271.2	37	c.1297	CCDS12385.1	19	.	.	.	.	.	.	.	.	.	.	C	7.240	0.601145	0.13939	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.98876	-5.2;-5.2;-5.2	4.29	3.25	0.37280	.	0.067536	0.64402	U	0.000015	D	0.92358	0.7575	N	0.10629	0.01	0.46416	D	0.999036	B;B	0.06786	0.0;0.001	B;B	0.06405	0.001;0.002	D	0.86261	0.1655	10	0.02654	T	1	-25.6768	6.1712	0.20418	0.0:0.6889:0.0:0.3111	.	380;433	B4DKJ3;P49747	.;COMP_HUMAN	N	400;433;380;420	ENSP00000439156:D400N;ENSP00000222271:D433N;ENSP00000403792:D380N	ENSP00000222271:D433N	D	-	1	0	COMP	18758059	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	4.695000	0.61767	0.785000	0.33685	0.491000	0.48974	GAT	COMP	-	NULL	ENSG00000105664		0.572	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMP	HGNC	protein_coding	OTTHUMT00000403457.1	-	0.00	24	0	C	NM_000095		18897059	-1	tier1	-	no_errors	ENST00000222271	ensembl	human	known	74_37	missense	27.50	29	11	SNP	1.000	T
CPXCR1	53336	genome.wustl.edu	37	X	88009051	88009051	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:88009051G>C	ENST00000276127.4	+	3	895	c.636G>C	c.(634-636)atG>atC	p.M212I	CPXCR1_ENST00000373111.1_Missense_Mutation_p.M212I	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	212							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CTGAGAGAATGACATCAGGAA	0.423																																																	0													74.0	60.0	65.0					X																	88009051		2203	4300	6503	SO:0001583	missense	0			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.636G>C	X.37:g.88009051G>C	ENSP00000276127:p.Met212Ile		B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.M212I	ENST00000276127.4	37	c.636	CCDS14458.1	X	.	.	.	.	.	.	.	.	.	.	G	9.965	1.223823	0.22457	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.20069	2.1;2.1	3.15	-0.873	0.10635	.	0.635593	0.13238	N	0.403095	T	0.10165	0.0249	N	0.24115	0.695	0.09310	N	1	B	0.19817	0.039	B	0.20184	0.028	T	0.32295	-0.9912	9	.	.	.	-0.8853	2.5411	0.04726	0.2596:0.0:0.338:0.4024	.	212	Q8N123	CPXCR_HUMAN	I	212	ENSP00000276127:M212I;ENSP00000362203:M212I	.	M	+	3	0	CPXCR1	87895707	0.001000	0.12720	0.000000	0.03702	0.920000	0.55202	-0.225000	0.09151	-0.356000	0.08187	0.594000	0.82650	ATG	CPXCR1	-	NULL	ENSG00000147183		0.423	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	HGNC	protein_coding	OTTHUMT00000057418.1	-	0.00	39	0	G	NM_033048		88009051	+1	tier1	-	no_errors	ENST00000276127	ensembl	human	known	74_37	missense	66.67	10	20	SNP	0.000	C
CTAGE1	64693	genome.wustl.edu	37	18	19995559	19995559	+	5'Flank	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr18:19995559A>G	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.F739S			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GGCTGGGGGGAAAAATGCAGG	0.502																																																	0													25.0	28.0	27.0					18																	19995559		2093	4247	6340	SO:0001631	upstream_gene_variant	0			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995559A>G	Exception_encountered		B0YIZ3	Missense_Mutation	SNP	NULL	p.F739S	ENST00000525417.1	37	c.2216		18	.	.	.	.	.	.	.	.	.	.	A	0.726	-0.781638	0.02929	.	.	ENSG00000212710	ENST00000391403	T	0.09163	3.01	0.185	-0.371	0.12525	.	.	.	.	.	T	0.10208	0.0250	M	0.72118	2.19	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45527	-0.9255	7	.	.	.	.	.	.	.	.	739	Q96RT6	CTGE2_HUMAN	S	739	ENSP00000375220:F739S	.	F	-	2	0	CTAGE1	18249557	0.849000	0.29639	0.000000	0.03702	0.000000	0.00434	0.374000	0.20501	-2.103000	0.00844	-2.094000	0.00368	TTC	CTAGE1	-	NULL	ENSG00000212710		0.502	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1		0.00	46	0	A	NM_022663, NM_172241		19995559	-1			no_errors	ENST00000391403	ensembl	human	known	74_37	missense	5.13	81	6	SNP	0.000	G
CTAGE1	64693	genome.wustl.edu	37	18	19995559	19995559	+	5'Flank	DEL	A	A	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr18:19995559delA	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Frame_Shift_Del_p.F739fs			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GGCTGGGGGGAAAAATGCAGG	0.502																																																	0													25.0	28.0	27.0					18																	19995559		2093	4247	6340	SO:0001631	upstream_gene_variant	0			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995559delA	Exception_encountered		B0YIZ3	Frame_Shift_Del	DEL	NULL	p.F739fs	ENST00000525417.1	37	c.2216		18																																																																																			CTAGE1	-	NULL	ENSG00000212710		0.502	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1		0.00	46	0	A	NM_022663, NM_172241		19995559	-1	tier1		no_errors	ENST00000391403	ensembl	human	known	74_37	frame_shift_del	25.64	87	30	DEL	0.000	-
CUL7	9820	genome.wustl.edu	37	6	43010843	43010843	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:43010843G>A	ENST00000265348.3	-	18	3516	c.3431C>T	c.(3430-3432)aCg>aTg	p.T1144M	CUL7_ENST00000535468.1_Missense_Mutation_p.T1228M|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	1144					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			CCAACAGCGCGTCAGGTTTCT	0.587																																																	0																																										SO:0001583	missense	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.3431C>T	6.37:g.43010843G>A	ENSP00000265348:p.Thr1144Met		B4DYZ0|F5H0L1|Q5T654	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.T1228M	ENST00000265348.3	37	c.3683	CCDS4881.1	6	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136722	0.77662	.	.	ENSG00000044090	ENST00000265348;ENST00000535468	T;T	0.74737	-0.87;-0.87	5.61	4.75	0.60458	.	0.158179	0.56097	D	0.000039	T	0.79021	0.4376	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.89917	0.985;0.994;1.0;1.0	P;P;D;D	0.83275	0.754;0.777;0.996;0.994	T	0.82283	-0.0534	10	0.87932	D	0	-4.2477	11.7164	0.51655	0.1474:0.0:0.8526:0.0	.	1228;1144;1228;1144	F5H0L1;A8K9U1;B4DYZ0;Q14999	.;.;.;CUL7_HUMAN	M	1144;1228	ENSP00000265348:T1144M;ENSP00000438788:T1228M	ENSP00000265348:T1144M	T	-	2	0	CUL7	43118821	1.000000	0.71417	0.990000	0.47175	0.938000	0.57974	4.085000	0.57657	1.370000	0.46153	0.591000	0.81541	ACG	CUL7	-	NULL	ENSG00000044090		0.587	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	-	0.00	20	0	G	NM_014780		43010843	-1	tier1	-	no_errors	ENST00000535468	ensembl	human	known	74_37	missense	60.00	12	18	SNP	1.000	A
CUX1	1523	genome.wustl.edu	37	7	101821910	101821910	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:101821910G>A	ENST00000292535.7	+	11	1028	c.990G>A	c.(988-990)caG>caA	p.Q330Q	CUX1_ENST00000550008.2_Silent_p.Q330Q|CUX1_ENST00000556210.1_Silent_p.Q330Q|CUX1_ENST00000547394.2_Silent_p.Q325Q|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000425244.2_Silent_p.Q295Q|CUX1_ENST00000546411.2_Silent_p.Q330Q|CUX1_ENST00000292538.4_Silent_p.Q341Q|CUX1_ENST00000393824.3_Silent_p.Q302Q|CUX1_ENST00000437600.4_Silent_p.Q339Q|CUX1_ENST00000360264.3_Silent_p.Q341Q|CUX1_ENST00000549414.2_Silent_p.Q330Q	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	330					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						TTGAGCAGCAGCTGAGCGCCA	0.647																																																	0													23.0	19.0	20.0					7																	101821910		2200	4300	6500	SO:0001819	synonymous_variant	0			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.990G>A	7.37:g.101821910G>A			B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.Q341	ENST00000292535.7	37	c.1023	CCDS5721.1	7																																																																																			CUX1	-	superfamily_LemA-like_dom	ENSG00000257923		0.647	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	-	0.00	22	0	G	NM_001913		101821910	+1	tier1	-	no_errors	ENST00000360264	ensembl	human	known	74_37	silent	22.22	21	6	SNP	1.000	A
CYB561D1	284613	genome.wustl.edu	37	1	110038448	110038448	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:110038448G>A	ENST00000420578.2	+	3	297	c.257G>A	c.(256-258)cGa>cAa	p.R86Q	CYB561D1_ENST00000369868.3_Missense_Mutation_p.R108Q|CYB561D1_ENST00000310611.4_Missense_Mutation_p.E121K|CYB561D1_ENST00000527072.1_3'UTR|CYB561D1_ENST00000393709.3_Missense_Mutation_p.R29Q|CYB561D1_ENST00000496961.1_3'UTR|CYB561D1_ENST00000430195.2_3'UTR|CYB561D1_ENST00000528785.1_Missense_Mutation_p.R86Q|CYB561D1_ENST00000533024.1_Missense_Mutation_p.E42K			Q8N8Q1	C56D1_HUMAN	cytochrome b561 family, member D1	86	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.				oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|prostate(1)	5		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0422)|Epithelial(280;0.0655)|all cancers(265;0.0685)|READ - Rectum adenocarcinoma(129;0.0689)|LUSC - Lung squamous cell carcinoma(189;0.227)		TTCTGCTCCCGAAAAGCACGG	0.577																																																	0													175.0	175.0	175.0					1																	110038448		2203	4300	6503	SO:0001583	missense	0			AK096354	CCDS800.1, CCDS44188.1, CCDS44189.1, CCDS44190.1, CCDS44191.1	1p13.2	2013-03-14	2013-03-14		ENSG00000174151	ENSG00000174151		"""Cytochrome b genes"""	26804	protein-coding gene	gene with protein product			"""cytochrome b-561 domain containing 1"""			23249217	Standard	NM_182580		Approved	FLJ39035, FLJ44753	uc010ovo.2	Q8N8Q1	OTTHUMG00000011051	ENST00000420578.2:c.257G>A	1.37:g.110038448G>A	ENSP00000413530:p.Arg86Gln		B4DH97|E9PCM8|Q52M36|Q5T6C2|Q5T6C3	Missense_Mutation	SNP	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	p.R108Q	ENST00000420578.2	37	c.323	CCDS800.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.8|20.8	4.054946|4.054946	0.75960|0.75960	.|.	.|.	ENSG00000174151|ENSG00000174151	ENST00000533024;ENST00000310611|ENST00000393709;ENST00000420578;ENST00000528785;ENST00000369868	.|T;T;T;T	.|0.44881	.|0.91;0.91;0.91;0.91	5.25|5.25	5.25|5.25	0.73442|0.73442	.|Cytochrome b561, eukaryote (1);Cytochrome b561/ferric reductase transmembrane (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53334|0.53334	0.1790|0.1790	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	P|D;D;D;D	0.51791|0.89917	0.948|1.0;1.0;1.0;1.0	B|P;D;D;D	0.39503|0.73380	0.301|0.873;0.98;0.971;0.98	T|T	0.57963|0.57963	-0.7720|-0.7720	7|9	0.87932|0.72032	D|D	0|0.01	-2.8484|-2.8484	9.7187|9.7187	0.40289|0.40289	0.0913:0.0:0.9087:0.0|0.0913:0.0:0.9087:0.0	.|.	121|108;86;29;48	Q8N8Q1-2|Q8N8Q1-3;Q8N8Q1;E9PCM8;Q6ZQS1	.|.;C56D1_HUMAN;.;.	K|Q	42;121|29;86;86;108	.|ENSP00000377312:R29Q;ENSP00000413530:R86Q;ENSP00000434344:R86Q;ENSP00000358884:R108Q	ENSP00000309324:E121K|ENSP00000358884:R108Q	E|R	+|+	1|2	0|0	CYB561D1|CYB561D1	109839971|109839971	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	7.651000|7.651000	0.83577|0.83577	2.731000|2.731000	0.93534|0.93534	0.555000|0.555000	0.69702|0.69702	GAA|CGA	CYB561D1	-	pfam_Cyt_b561_euk,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000174151		0.577	CYB561D1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYB561D1	HGNC	protein_coding	OTTHUMT00000030384.1	-	0.00	36	0	G	NM_182580		110038448	+1	tier1	-	no_errors	ENST00000369868	ensembl	human	known	74_37	missense	45.65	25	21	SNP	1.000	A
CYLC2	1539	genome.wustl.edu	37	9	105767543	105767543	+	Silent	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:105767543A>G	ENST00000374798.3	+	5	700	c.630A>G	c.(628-630)aaA>aaG	p.K210K	CYLC2_ENST00000487798.1_Silent_p.K210K	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	210	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				AAGGTGAAAAAGGAGGTACAG	0.358																																																	0													81.0	77.0	79.0					9																	105767543		2203	4300	6503	SO:0001819	synonymous_variant	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.630A>G	9.37:g.105767543A>G			B2R8F4|Q5VVJ9	Silent	SNP	NULL	p.K210	ENST00000374798.3	37	c.630	CCDS35085.1	9																																																																																			CYLC2	-	NULL	ENSG00000155833		0.358	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	-	0.00	12	0	A	NM_001340		105767543	+1	tier1	-	no_errors	ENST00000374798	ensembl	human	known	74_37	silent	69.23	4	9	SNP	0.000	G
DACH2	117154	genome.wustl.edu	37	X	85906159	85906159	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:85906159A>C	ENST00000373125.4	+	4	761	c.761A>C	c.(760-762)aAt>aCt	p.N254T	DACH2_ENST00000510272.1_Missense_Mutation_p.N35T|DACH2_ENST00000373131.1_Missense_Mutation_p.N241T|DACH2_ENST00000508860.1_Missense_Mutation_p.N87T	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	254					development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						GATGATCTTAATTCTAACACA	0.463																																																	0													98.0	78.0	85.0					X																	85906159		2203	4300	6503	SO:0001583	missense	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.761A>C	X.37:g.85906159A>C	ENSP00000362217:p.Asn254Thr		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.N254T	ENST00000373125.4	37	c.761	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	A	14.39	2.520075	0.44866	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125;ENST00000508860;ENST00000510272;ENST00000400297	D;D	0.84660	-1.88;-1.86	4.45	4.45	0.53987	.	0.000000	0.64402	D	0.000003	D	0.83519	0.5272	L	0.42245	1.32	0.49389	D	0.999786	D;B;B	0.55605	0.972;0.383;0.138	P;B;B	0.53360	0.724;0.237;0.119	T	0.79761	-0.1667	10	0.08837	T	0.75	.	13.0694	0.59053	1.0:0.0:0.0:0.0	.	120;241;254	Q1RMF5;Q96NX9-2;Q96NX9	.;.;DACH2_HUMAN	T	254;241;254;87;35;87	ENSP00000362223:N241T;ENSP00000362217:N254T	ENSP00000345134:N254T	N	+	2	0	DACH2	85792815	1.000000	0.71417	0.999000	0.59377	0.970000	0.65996	4.849000	0.62882	1.452000	0.47756	0.417000	0.27973	AAT	DACH2	-	NULL	ENSG00000126733		0.463	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	-	0.00	27	0	A	NM_053281		85906159	+1	tier1	-	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	68.97	9	20	SNP	1.000	C
DCHS1	8642	genome.wustl.edu	37	11	6648373	6648373	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:6648373C>T	ENST00000299441.3	-	14	6308	c.5897G>A	c.(5896-5898)cGc>cAc	p.R1966H		NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1966	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGACGTAGGCGCAGAGGACT	0.612																																																	0													77.0	71.0	73.0					11																	6648373		2200	4295	6495	SO:0001583	missense	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.5897G>A	11.37:g.6648373C>T	ENSP00000299441:p.Arg1966His		O15098	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1966H	ENST00000299441.3	37	c.5897	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	17.04	3.287912	0.59976	.	.	ENSG00000166341	ENST00000299441	T	0.61040	0.14	5.18	5.18	0.71444	Cadherin (1);Cadherin-like (1);	0.000000	0.45361	D	0.000380	T	0.30479	0.0766	N	0.08118	0	0.29655	N	0.843678	P	0.38992	0.653	B	0.22386	0.039	T	0.34279	-0.9835	10	0.42905	T	0.14	.	12.0439	0.53469	0.0:0.8124:0.1876:0.0	.	1966	Q96JQ0	PCD16_HUMAN	H	1966	ENSP00000299441:R1966H	ENSP00000299441:R1966H	R	-	2	0	DCHS1	6604949	0.223000	0.23663	0.999000	0.59377	0.892000	0.51952	4.006000	0.57083	2.700000	0.92200	0.462000	0.41574	CGC	DCHS1	-	superfamily_Cadherin-like	ENSG00000166341		0.612	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	HGNC	protein_coding	OTTHUMT00000257258.1	-	0.00	18	0	C	NM_003737		6648373	-1	tier1	-	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.864	T
DCLK2	166614	genome.wustl.edu	37	4	151160949	151160949	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:151160949C>T	ENST00000296550.7	+	11	2376	c.1622C>T	c.(1621-1623)gCg>gTg	p.A541V	DCLK2_ENST00000506325.1_Missense_Mutation_p.A540V|DCLK2_ENST00000302176.8_Missense_Mutation_p.A558V	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	541	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TTTGGGCTTGCGACTGTGGTA	0.458																																					GBM(195;186 2215 13375 16801 37459)												0													138.0	138.0	138.0					4																	151160949		2203	4300	6503	SO:0001583	missense	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1622C>T	4.37:g.151160949C>T	ENSP00000296550:p.Ala541Val		C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.A558V	ENST00000296550.7	37	c.1673	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	C	34	5.369141	0.95900	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.75821	-0.97;-0.97;-0.97	5.85	5.85	0.93711	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89241	0.6659	M	0.89414	3.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.994;0.999	D	0.90246	0.4290	10	0.87932	D	0	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	558;540;541	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	V	541;540;558	ENSP00000296550:A541V;ENSP00000427235:A540V;ENSP00000303887:A558V	ENSP00000296550:A541V	A	+	2	0	DCLK2	151380399	1.000000	0.71417	0.975000	0.42487	0.872000	0.50106	7.456000	0.80751	2.767000	0.95098	0.655000	0.94253	GCG	DCLK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000170390		0.458	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	-	0.00	116	0	C	NM_001040260		151160949	+1	tier1	-	no_errors	ENST00000302176	ensembl	human	known	74_37	missense	25.21	89	30	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155407671	155407671	+	Splice_Site	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:155407671A>C	ENST00000456341.2	-	2	2032	c.2033T>G	c.(2032-2034)cTt>cGt	p.L678R	DCHS2_ENST00000339452.1_Intron|DCHS2_ENST00000443500.1_Splice_Site_p.L685R			Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1500	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGCAGATATAAGCTGTAAAAG	0.353																																																	0													166.0	132.0	142.0					4																	155407671		692	1591	2283	SO:0001630	splice_region_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000456341.2:c.2032-1T>G	4.37:g.155407671A>C			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L685R	ENST00000456341.2	37	c.2054		4	.	.	.	.	.	.	.	.	.	.	A	9.342	1.063226	0.19987	.	.	ENSG00000197410	ENST00000456341;ENST00000443500	T;T	0.60424	0.19;0.21	3.2	2.01	0.26516	.	.	.	.	.	T	0.64692	0.2621	M	0.85197	2.74	0.09310	N	1	P	0.40398	0.716	P	0.45946	0.498	T	0.58493	-0.7627	9	0.87932	D	0	.	6.4849	0.22083	0.7207:0.2793:0.0:0.0	.	685	E9PG03	.	R	678;685	ENSP00000408543:L678R;ENSP00000395539:L685R	ENSP00000395539:L685R	L	-	2	0	DCHS2	155627121	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.642000	0.37207	0.600000	0.29862	0.459000	0.35465	CTT	DCHS2	-	superfamily_Cadherin-like	ENSG00000197410		0.353	DCHS2-005	PUTATIVE	basic	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365285.1	-	0.00	58	0	A	NM_001142552	Missense_Mutation	155407671	-1	tier1	-	no_errors	ENST00000443500	ensembl	human	known	74_37	missense	28.85	37	15	SNP	0.001	C
DHX36	170506	genome.wustl.edu	37	3	154018442	154018442	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:154018442C>T	ENST00000496811.1	-	11	1482	c.1402G>A	c.(1402-1404)Gat>Aat	p.D468N	DHX36_ENST00000329463.5_Missense_Mutation_p.D468N|DHX36_ENST00000544526.1_Missense_Mutation_p.D468N|DHX36_ENST00000308361.6_Missense_Mutation_p.D468N	NM_020865.2	NP_065916.2	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	468					ATP catabolic process (GO:0006200)|innate immune response (GO:0045087)|ossification (GO:0001503)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|transcription, DNA-templated (GO:0006351)	chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|core promoter binding (GO:0001047)|DNA-dependent ATPase activity (GO:0008094)|double-stranded RNA binding (GO:0003725)|G-quadruplex DNA binding (GO:0051880)|G-quadruplex RNA binding (GO:0002151)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	35			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCAACTTTATCATCCTCCATC	0.299																																																	0													129.0	123.0	125.0					3																	154018442		2203	4298	6501	SO:0001583	missense	0			AF217190	CCDS3171.1, CCDS54657.1	3q25.2	2012-09-20	2003-06-13	2003-06-20	ENSG00000174953	ENSG00000174953		"""DEAH-boxes"""	14410	protein-coding gene	gene with protein product		612767	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 36"""	DDX36			Standard	NM_020865		Approved	MLEL1, KIAA1488	uc003ezy.4	Q9H2U1	OTTHUMG00000159109	ENST00000496811.1:c.1402G>A	3.37:g.154018442C>T	ENSP00000417078:p.Asp468Asn		B2RB00|Q70JU3|Q8IYE5|Q9P240	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D468N	ENST00000496811.1	37	c.1402	CCDS3171.1	3	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394609	0.83011	.	.	ENSG00000174953	ENST00000496811;ENST00000308361;ENST00000544526;ENST00000329463;ENST00000481941	T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2	5.75	5.75	0.90469	.	0.214045	0.56097	D	0.000032	T	0.05868	0.0153	L	0.48986	1.54	0.52501	D	0.999959	B;B;B	0.15930	0.011;0.011;0.015	B;B;B	0.20767	0.031;0.031;0.014	T	0.35968	-0.9767	10	0.54805	T	0.06	.	20.312	0.98644	0.0:1.0:0.0:0.0	.	468;468;468	Q9H2U1-2;Q9H2U1-3;Q9H2U1	.;.;DHX36_HUMAN	N	468;468;468;468;382	ENSP00000417078:D468N;ENSP00000309296:D468N;ENSP00000444247:D468N;ENSP00000330113:D468N;ENSP00000419862:D382N	ENSP00000309296:D468N	D	-	1	0	DHX36	155501136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.277000	0.78572	2.866000	0.98385	0.650000	0.86243	GAT	DHX36	-	superfamily_P-loop_NTPase	ENSG00000174953		0.299	DHX36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX36	HGNC	protein_coding	OTTHUMT00000353349.1	-	0.00	20	0	C	NM_020865		154018442	-1	tier1	-	no_errors	ENST00000496811	ensembl	human	known	74_37	missense	33.33	20	10	SNP	1.000	T
DLC1	10395	genome.wustl.edu	37	8	12947941	12947941	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:12947941G>A	ENST00000276297.4	-	15	4303	c.3894C>T	c.(3892-3894)acC>acT	p.T1298T	DLC1_ENST00000520226.1_Silent_p.T787T|DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000358919.2_Silent_p.T861T|DLC1_ENST00000512044.2_Silent_p.T895T	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1298					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCTCTTGTTCGGTATAGGAAT	0.527																																																	0													105.0	95.0	98.0					8																	12947941		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3894C>T	8.37:g.12947941G>A			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.T1298	ENST00000276297.4	37	c.3894	CCDS5989.1	8																																																																																			DLC1	-	NULL	ENSG00000164741		0.527	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	-	0.00	17	0	G	NM_182643, NM_006094		12947941	-1	tier1	-	no_errors	ENST00000276297	ensembl	human	known	74_37	silent	33.33	16	8	SNP	0.001	A
DLG2	1740	genome.wustl.edu	37	11	83674027	83674027	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:83674027T>C	ENST00000532653.1	-	9	1228	c.926A>G	c.(925-927)aAc>aGc	p.N309S	DLG2_ENST00000280241.8_Missense_Mutation_p.N348S|DLG2_ENST00000330014.6_Missense_Mutation_p.N248S|DLG2_ENST00000524982.1_Missense_Mutation_p.N309S|DLG2_ENST00000376106.3_5'UTR|DLG2_ENST00000543673.1_Missense_Mutation_p.N414S|DLG2_ENST00000418306.2_Missense_Mutation_p.N258S|DLG2_ENST00000398301.2_Missense_Mutation_p.N348S|DLG2_ENST00000376104.2_Missense_Mutation_p.N414S|DLG2_ENST00000398309.2_Missense_Mutation_p.N309S|DLG2_ENST00000531015.1_Missense_Mutation_p.N276S|DLG2_ENST00000537455.1_Missense_Mutation_p.N63S			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	131	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AGTGCCATTGTTGCCAGAGAG	0.453																																																	0													158.0	151.0	153.0					11																	83674027		1882	4098	5980	SO:0001583	missense	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.926A>G	11.37:g.83674027T>C	ENSP00000435849:p.Asn309Ser		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.N414S	ENST00000532653.1	37	c.1241		11	.	.	.	.	.	.	.	.	.	.	T	13.49	2.252311	0.39797	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000330014;ENST00000537455;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000398301;ENST00000398299	T;T;T;T;T;T;T;T;T;T;T;T	0.18502	2.74;2.73;2.52;2.73;2.7;2.65;2.51;2.74;2.7;2.54;2.21;2.37	5.79	5.79	0.91817	PDZ-associated domain of NMDA receptors (1);	0.000000	0.85682	D	0.000000	T	0.23249	0.0562	L	0.36672	1.1	0.80722	D	1	P;B;B;P;B;P;B;B	0.48294	0.892;0.339;0.022;0.476;0.049;0.908;0.022;0.002	P;B;B;B;B;P;B;B	0.50570	0.644;0.145;0.038;0.145;0.055;0.6;0.101;0.01	T	0.00804	-1.1559	9	.	.	.	.	16.1343	0.81471	0.0:0.0:0.0:1.0	.	276;309;309;248;348;414;309;258	E9PIW2;B7Z2T4;E9PN83;B7Z264;Q6ZSU2;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	S	309;414;258;414;348;248;63;309;309;414;276;348;226	ENSP00000381355:N309S;ENSP00000365272:N414S;ENSP00000402275:N258S;ENSP00000441994:N414S;ENSP00000280241:N348S;ENSP00000381353:N248S;ENSP00000443248:N63S;ENSP00000432894:N309S;ENSP00000435849:N309S;ENSP00000433848:N276S;ENSP00000381346:N348S;ENSP00000381344:N226S	.	N	-	2	0	DLG2	83351675	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.552000	0.82192	2.209000	0.71365	0.533000	0.62120	AAC	DLG2	-	pfam_PDZ_assoc,pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.453	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	-	0.00	67	0	T	NM_001364		83674027	-1	tier1	-	no_errors	ENST00000376104	ensembl	human	known	74_37	missense	5.10	93	5	SNP	1.000	C
DNAH12	201625	genome.wustl.edu	37	3	57344830	57344830	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:57344830T>C	ENST00000351747.2	-	52	8387	c.8207A>G	c.(8206-8208)gAa>gGa	p.E2736G	DNAH12_ENST00000344804.4_Missense_Mutation_p.E323G	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2736	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						ATGAGGGTTTTCAACTATGTA	0.398																																																	0													105.0	88.0	93.0					3																	57344830		692	1591	2283	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.8207A>G	3.37:g.57344830T>C	ENSP00000295937:p.Glu2736Gly		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E2736G	ENST00000351747.2	37	c.8207		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.43|15.43	2.830266|2.830266	0.50845|0.50845	.|.	.|.	ENSG00000174844|ENSG00000174844	ENST00000351747;ENST00000466540;ENST00000344804|ENST00000462199	T;T;T|.	0.10288|.	2.89;2.89;2.89|.	5.34|5.34	4.11|4.11	0.48088|0.48088	Dynein heavy chain (1);|.	0.282690|.	0.39210|.	N|.	0.001432|.	T|.	0.52224|.	0.1721|.	L|L	0.58302|0.58302	1.8|1.8	0.25828|0.25828	N|N	0.984207|0.984207	B;P|.	0.37423|.	0.003;0.594|.	B;P|.	0.48189|.	0.013;0.57|.	T|.	0.44528|.	-0.9322|.	10|.	0.41790|.	T|.	0.15|.	.|.	11.2517|11.2517	0.49031|0.49031	0.0:0.0:0.1529:0.8471|0.0:0.0:0.1529:0.8471	.|.	323;2736|.	Q6ZR08-2;Q6ZR08|.	.;DYH12_HUMAN|.	G|W	2736;381;323|426	ENSP00000295937:E2736G;ENSP00000420359:E381G;ENSP00000340464:E323G|.	ENSP00000340464:E323G|.	E|X	-|-	2|3	0|0	DNAH12|DNAH12	57319870|57319870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.804000|0.804000	0.45430|0.45430	3.240000|3.240000	0.51368|0.51368	2.012000|2.012000	0.59069|0.59069	0.533000|0.533000	0.62120|0.62120	GAA|TGA	DNAH12	-	pfam_Dynein_heavy_dom	ENSG00000174844		0.398	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	51	0	T	NM_178504		57344830	-1	tier1	-	no_errors	ENST00000351747	ensembl	human	known	74_37	missense	27.59	42	16	SNP	1.000	C
DNMT3B	1789	genome.wustl.edu	37	20	31376728	31376728	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:31376728C>T	ENST00000328111.2	+	7	1044	c.723C>T	c.(721-723)gcC>gcT	p.A241A	DNMT3B_ENST00000353855.2_Silent_p.A241A|DNMT3B_ENST00000456297.2_Silent_p.A165A|DNMT3B_ENST00000443239.3_Silent_p.A199A|DNMT3B_ENST00000201963.3_Silent_p.A253A|DNMT3B_ENST00000375623.4_Silent_p.A199A|DNMT3B_ENST00000344505.4_Silent_p.A241A|DNMT3B_ENST00000348286.2_Silent_p.A241A	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	241	Interaction with DNMT1 and DNMT3A.|PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)	p.A241A(1)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GGTGGCCCGCCATGGTGGTGT	0.572																																																	1	Substitution - coding silent(1)	ovary(1)											87.0	83.0	84.0					20																	31376728		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.723C>T	20.37:g.31376728C>T			A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Silent	SNP	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.A241	ENST00000328111.2	37	c.723	CCDS13205.1	20																																																																																			DNMT3B	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom	ENSG00000088305		0.572	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMT3B	HGNC	protein_coding	OTTHUMT00000078643.2	-	0.00	86	0	C	NM_006892		31376728	+1	tier1	-	no_errors	ENST00000328111	ensembl	human	known	74_37	silent	50.00	95	95	SNP	1.000	T
DPP9	91039	genome.wustl.edu	37	19	4714337	4714337	+	5'UTR	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:4714337A>G	ENST00000598800.1	-	0	487				DPP9_ENST00000262960.9_Silent_p.N23N|DPP9_ENST00000594671.1_5'Flank|DPP9_ENST00000597849.1_Silent_p.N23N			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		CCCCCTCGGAATTCAGCGAGA	0.632																																																	0													5.0	6.0	6.0					19																	4714337		1933	4054	5987	SO:0001623	5_prime_UTR_variant	0			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.-19T>C	19.37:g.4714337A>G			O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Silent	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.N23	ENST00000598800.1	37	c.69		19																																																																																			DPP9	-	NULL	ENSG00000142002		0.632	DPP9-026	NOVEL	basic	protein_coding	DPP9	HGNC	protein_coding	OTTHUMT00000459343.2	-	0.00	58	0	A			4714337	-1	tier1	-	no_errors	ENST00000262960	ensembl	human	known	74_37	silent	36.62	44	26	SNP	0.117	G
DSCAM	1826	genome.wustl.edu	37	21	41416086	41416086	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr21:41416086A>T	ENST00000400454.1	-	31	5779	c.5302T>A	c.(5302-5304)Tgg>Agg	p.W1768R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1768					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				GGCAGCCTCCAGTCTGTGGTG	0.617																																					Melanoma(134;970 1778 1785 21664 32388)												0													117.0	128.0	124.0					21																	41416086		2170	4281	6451	SO:0001583	missense	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5302T>A	21.37:g.41416086A>T	ENSP00000383303:p.Trp1768Arg		O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.W1768R	ENST00000400454.1	37	c.5302	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	a	25.2	4.614392	0.87359	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.60797	0.16;0.3	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.67135	0.2861	L	0.32530	0.975	0.51767	D	0.999936	D	0.76494	0.999	D	0.83275	0.996	T	0.68977	-0.5267	10	0.52906	T	0.07	.	15.6915	0.77457	1.0:0.0:0.0:0.0	.	1768	O60469	DSCAM_HUMAN	R	1768;1520	ENSP00000383303:W1768R;ENSP00000385342:W1520R	ENSP00000383303:W1768R	W	-	1	0	DSCAM	40337956	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.228000	0.95250	2.107000	0.64212	0.533000	0.62120	TGG	DSCAM	-	NULL	ENSG00000171587		0.617	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	-	0.00	93	0	A	NM_001389		41416086	-1	tier1	-	no_errors	ENST00000400454	ensembl	human	known	74_37	missense	18.42	62	14	SNP	1.000	T
DSCAML1	57453	genome.wustl.edu	37	11	117392001	117392001	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:117392001C>T	ENST00000321322.6	-	6	1238	c.1237G>A	c.(1237-1239)Gag>Aag	p.E413K	DSCAML1_ENST00000527706.1_Missense_Mutation_p.E143K	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	353	Ig-like C2-type 5.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		AGCACCAGCTCCGTGTTGCGA	0.627																																																	0													100.0	84.0	89.0					11																	117392001		2201	4296	6497	SO:0001583	missense	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1237G>A	11.37:g.117392001C>T	ENSP00000315465:p.Glu413Lys		Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E413K	ENST00000321322.6	37	c.1237	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	C	17.44	3.391322	0.62066	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66638	-0.22;-0.22	4.67	4.67	0.58626	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.69324	0.3098	L	0.48935	1.535	0.80722	D	1	P;P	0.41710	0.76;0.689	P;P	0.50708	0.547;0.648	T	0.63346	-0.6658	9	0.15066	T	0.55	.	17.7518	0.88436	0.0:1.0:0.0:0.0	.	143;353	G3V1B5;Q8TD84	.;DSCL1_HUMAN	K	143;413;120	ENSP00000434335:E143K;ENSP00000315465:E413K	ENSP00000315465:E413K	E	-	1	0	DSCAML1	116897211	1.000000	0.71417	0.937000	0.37676	0.943000	0.58893	4.739000	0.62080	2.417000	0.82017	0.609000	0.83330	GAG	DSCAML1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000177103		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	30	0	C	NM_020693		117392001	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	missense	36.00	32	18	SNP	0.998	T
ELMO1	9844	genome.wustl.edu	37	7	36934566	36934566	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:36934566G>A	ENST00000310758.4	-	17	2141	c.1494C>T	c.(1492-1494)tcC>tcT	p.S498S	ELMO1_ENST00000442504.1_Silent_p.S498S|ELMO1_ENST00000396045.3_Silent_p.S18S|ELMO1_ENST00000341056.3_Silent_p.S200S|ELMO1_ENST00000396040.2_Silent_p.S18S|ELMO1_ENST00000448602.1_Silent_p.S498S	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	498					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						ACTGGTCCAGGGAGCTAGGCT	0.512																																																	0													210.0	189.0	196.0					7																	36934566		2203	4300	6503	SO:0001819	synonymous_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1494C>T	7.37:g.36934566G>A			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.S498	ENST00000310758.4	37	c.1494	CCDS5449.1	7																																																																																			ELMO1	-	NULL	ENSG00000155849		0.512	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	101	0	G	NM_130442		36934566	-1	tier1	-	no_errors	ENST00000310758	ensembl	human	known	74_37	silent	48.41	81	76	SNP	0.989	A
SH3PXD2B	285590	genome.wustl.edu	37	5	171866687	171866688	+	Intron	DEL	CA	CA	-	rs62387191|rs143250033|rs113620669|rs376203422		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:171866687_171866688delCA	ENST00000311601.5	-	1	246				SH3PXD2B_ENST00000519643.1_Intron|AC011407.1_ENST00000401308.1_RNA	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B						adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGCGTGCGCGcacgcgcgcgca	0.53																																																	0																																										SO:0001627	intron_variant	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.75+14593TG>-	5.37:g.171866687_171866688delCA			B6F0V2|Q9P2Q1	RNA	DEL	-	NULL	ENST00000311601.5	37	NULL	CCDS34291.1	5																																																																																			AC011407.1	-	-	ENSG00000216127		0.530	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216127	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000372449.1		0.00	18	0	CA	NM_017963		171866688	-1	tier1		no_errors	ENST00000401308	ensembl	human	novel	74_37	rna	31.25	11	5	DEL	0.026:0.017	-
RBM38	55544	genome.wustl.edu	37	20	55967675	55967675	+	Intron	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:55967675C>G	ENST00000356208.5	+	2	412				RBM38_ENST00000440234.2_Intron|RBM38_ENST00000371219.2_Intron|RP4-800J21.3_ENST00000417346.1_RNA	NM_017495.5	NP_059965.2	Q9H0Z9	RBM38_HUMAN	RNA binding motif protein 38						3'-UTR-mediated mRNA stabilization (GO:0070935)|cell cycle (GO:0007049)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|regulation of myotube differentiation (GO:0010830)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	9	Lung NSC(12;0.00242)|all_lung(29;0.00767)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.55e-12)|Epithelial(14;9.49e-09)|all cancers(14;5.01e-08)			CTGGTTCCCCCCACGGCAGCC	0.677																																																	0													9.0	12.0	11.0					20																	55967675		1903	4103	6006	SO:0001627	intron_variant	0			X75314	CCDS46617.1, CCDS46618.1	20q13.31	2013-02-12	2006-07-11	2006-07-11	ENSG00000132819	ENSG00000132819		"""RNA binding motif (RRM) containing"""	15818	protein-coding gene	gene with protein product		612428	"""RNA-binding region (RNP1, RRM) containing 1"""	RNPC1			Standard	NM_017495		Approved	HSRNASEB, SEB4D, seb4B, dJ800J21.2	uc010zzj.2	Q9H0Z9	OTTHUMG00000032820	ENST00000356208.5:c.238-35C>G	20.37:g.55967675C>G			A6NDK1|A6NMU6|Q15350|Q15351|Q9BYK3|Q9BYK4	RNA	SNP	-	NULL	ENST00000356208.5	37	NULL	CCDS46617.1	20																																																																																			RP4-800J21.3	-	-	ENSG00000218018		0.677	RBM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000218018	Clone_based_vega_gene	protein_coding	OTTHUMT00000079843.4	-	0.00	35	0	C	NM_183425		55967675	-1	tier1	-	no_errors	ENST00000417346	ensembl	human	known	74_37	rna	52.83	25	28	SNP	0.000	G
AC011718.2	0	genome.wustl.edu	37	22	20640516	20640516	+	lincRNA	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr22:20640516G>C	ENST00000577456.1	-	0	1044																											ACGGCTTGTAGAGTGTCCTTG	0.473																																																	0																																												0																															22.37:g.20640516G>C				RNA	SNP	-	NULL	ENST00000577456.1	37	NULL		22																																																																																			AC011718.2	-	-	ENSG00000223579		0.473	AC011718.2-004	KNOWN	basic	lincRNA	ENSG00000223579	Clone_based_vega_gene	lincRNA	OTTHUMT00000444810.1	-	0.00	202	0	G			20640516	-1	tier1	-	no_errors	ENST00000577456	ensembl	human	known	74_37	rna	36.63	109	63	SNP	0.928	C
ADAMTSL4	54507	genome.wustl.edu	37	1	150527021	150527021	+	Intron	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:150527021C>A	ENST00000369038.2	+	5	1435				ADAMTSL4_ENST00000271643.4_Intron|RP11-54A4.2_ENST00000442435.2_RNA|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Intron|ADAMTSL4_ENST00000369039.5_Intron			Q6UY14	ATL4_HUMAN	ADAMTS-like 4						apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CTGCTTACTCCCAGCCCTGAA	0.587																																																	0																																										SO:0001627	intron_variant	0			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.1234+78C>A	1.37:g.150527021C>A			B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	RNA	SNP	-	NULL	ENST00000369038.2	37	NULL	CCDS955.1	1																																																																																			RP11-54A4.2	-	-	ENSG00000237781		0.587	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000237781	Clone_based_vega_gene	protein_coding	OTTHUMT00000084395.4	-	0.00	74	0	C	NM_019032		150527021	-1	tier1	-	no_errors	ENST00000442435	ensembl	human	known	74_37	rna	15.22	78	14	SNP	0.001	A
TPTE2P6	374491	genome.wustl.edu	37	13	25171244	25171244	+	RNA	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr13:25171244A>G	ENST00000453498.1	+	0	1249				TPTE2P6_ENST00000440905.1_RNA																							TCACAGAGAGAAATTTAGATA	0.303																																																	0																																												0																															13.37:g.25171244A>G				RNA	SNP	-	NULL	ENST00000453498.1	37	NULL		13																																																																																			RP11-556N21.1	-	-	ENSG00000243008		0.303	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000243008	Clone_based_vega_gene	processed_transcript	OTTHUMT00000044193.1		0.00	39	0	A			25171244	+1			no_errors	ENST00000453498	ensembl	human	known	74_37	rna	11.11	32	4	SNP	0.584	G
GS1-259H13.2	100289187	genome.wustl.edu	37	7	99204390	99204390	+	3'UTR	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:99204390G>A	ENST00000455905.1	+	0	565				GS1-259H13.2_ENST00000431679.1_lincRNA																							TCCTCGGCCGGGTTTTCCTGC	0.562																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000455905.1:c.*64G>A	7.37:g.99204390G>A				RNA	SNP	-	NULL	ENST00000455905.1	37	NULL		7																																																																																			GS1-259H13.2	-	-	ENSG00000244219		0.562	GS1-259H13.10-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	ENSG00000244219	Clone_based_vega_gene	protein_coding	OTTHUMT00000344945.1	-	0.00	90	0	G			99204390	+1	tier1	-	no_errors	ENST00000431679	ensembl	human	known	74_37	rna	5.33	71	4	SNP	0.000	A
C11orf96	387763	genome.wustl.edu	37	11	43965440	43965440	+	IGR	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:43965440C>T	ENST00000339446.3	+	0	1308				C11orf96_ENST00000528572.1_3'UTR|RP11-613D13.4_ENST00000526408.1_RNA|RP11-613D13.8_ENST00000501541.1_lincRNA			Q7Z7L8	CK096_HUMAN	chromosome 11 open reading frame 96											pancreas(1)	1						TGCAGTTTTCCAGGCTCTTGA	0.522																																																	0																																										SO:0001628	intergenic_variant	0				CCDS73275.1	11p11.2	2012-08-10			ENSG00000187479	ENSG00000187479			38675	protein-coding gene	gene with protein product							Standard	NM_001145033		Approved	AG2	uc010rfl.2	Q7Z7L8	OTTHUMG00000166555		11.37:g.43965440C>T				RNA	SNP	-	NULL	ENST00000339446.3	37	NULL		11																																																																																			RP11-613D13.8	-	-	ENSG00000244953		0.522	C11orf96-201	KNOWN	basic|appris_candidate_longest	protein_coding	ENSG00000244953	Clone_based_vega_gene	protein_coding		-	0.00	25	0	C	NM_001145033		43965440	-1	tier1	-	no_errors	ENST00000501541	ensembl	human	known	74_37	rna	44.12	19	15	SNP	0.002	T
FOXD1	2297	genome.wustl.edu	37	5	72742469	72742469	+	3'UTR	DEL	T	T	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:72742469delT	ENST00000499003.3	-	0	1883				RP11-79P5.2_ENST00000514661.1_lincRNA|FOXD1_ENST00000513595.1_Intron	NM_004472.2	NP_004463.1	Q16676	FOXD1_HUMAN	forkhead box D1						axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in ureteric bud branching (GO:0060678)|metanephric capsule development (GO:0072213)|metanephric capsule specification (GO:0072267)|metanephric nephron development (GO:0072210)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme development (GO:0072076)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of gene expression (GO:0010628)|positive regulation of kidney development (GO:0090184)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|lung(2)	4		Lung NSC(167;0.00327)|Ovarian(174;0.0175)|Prostate(461;0.151)		OV - Ovarian serous cystadenocarcinoma(47;1.07e-54)		GGCTTAGTTGTTTTTCATCTG	0.493																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U59831	CCDS75259.1	5q13.2	2014-06-04			ENSG00000251493	ENSG00000251493		"""Forkhead boxes"""	3802	protein-coding gene	gene with protein product		601091		FKHL8		7957066, 8825632	Standard	NM_004472		Approved	FREAC4	uc003kcp.3	Q16676	OTTHUMG00000162495	ENST00000499003.3:c.*339A>-	5.37:g.72742469delT			Q12949	RNA	DEL	-	NULL	ENST00000499003.3	37	NULL		5																																																																																			RP11-79P5.2	-	-	ENSG00000247993		0.493	FOXD1-001	KNOWN	sequence_error|basic|appris_principal	protein_coding	ENSG00000247993	Clone_based_vega_gene	protein_coding	OTTHUMT00000369154.2		0.00	24	0	T	NM_004472		72742469	+1	tier1		no_errors	ENST00000514661	ensembl	human	known	74_37	rna	5.41	35	2	DEL	0.000	-
RPL23AP94	106481971	genome.wustl.edu	37	4	113451620	113451620	+	RNA	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:113451620C>A	ENST00000504009.1	+	0	344																											GATATTTGGGCTGCCTCCAGA	0.517																																																	0																																												0																															4.37:g.113451620C>A				RNA	SNP	-	NULL	ENST00000504009.1	37	NULL		4																																																																																			RP11-402J6.1	-	-	ENSG00000249509		0.517	RP11-402J6.1-002	KNOWN	basic	antisense	ENSG00000249509	Clone_based_vega_gene	antisense	OTTHUMT00000363894.1	-	0.00	25	0	C			113451620	+1	tier1	-	no_errors	ENST00000504009	ensembl	human	known	74_37	rna	30.43	16	7	SNP	1.000	A
RPP14	11102	genome.wustl.edu	37	3	58303843	58303843	+	3'UTR	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:58303843C>T	ENST00000445193.3	+	0	1406				RPP14_ENST00000295959.5_3'UTR|RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000528153.1_Missense_Mutation_p.S168F	NM_001098783.2	NP_001092253.1	O95059	RPP14_HUMAN	ribonuclease P/MRP 14kDa subunit						tRNA processing (GO:0008033)	nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)|RNA binding (GO:0003723)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.000187)|KIRC - Kidney renal clear cell carcinoma(10;0.0102)|Kidney(10;0.0118)|OV - Ovarian serous cystadenocarcinoma(275;0.191)		GCTTCCAAATCCTGAAATAGA	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF001175	CCDS2888.1	3p21.2	2012-05-21	2007-06-26		ENSG00000163684	ENSG00000163684			30327	protein-coding gene	gene with protein product		606112	"""ribonuclease P 14kDa subunit"""			10024167, 11929972	Standard	NM_001098783		Approved	P14	uc031sah.1	O95059	OTTHUMG00000159152	ENST00000445193.3:c.*620C>T	3.37:g.58303843C>T			Q53X97	Missense_Mutation	SNP	pfam_MaoC_dom	p.S168F	ENST00000445193.3	37	c.503	CCDS2888.1	3	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587005	0.66105	.	.	ENSG00000255154	ENST00000544156;ENST00000528153	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	T	0.52996	0.1769	.	.	.	0.80722	D	1	P	0.41313	0.745	B	0.39562	0.303	T	0.58842	-0.7565	7	0.87932	D	0	.	12.469	0.55775	0.0:0.9211:0.0:0.0789	.	168	P86397	HTD2_HUMAN	F	168	.	ENSP00000437142:S168F	S	+	2	0	RP11-80H18.3	58278883	0.450000	0.25697	0.956000	0.39512	0.623000	0.37688	0.784000	0.26816	2.722000	0.93159	0.655000	0.94253	TCC	RPP14	-	NULL	ENSG00000255154		0.388	RPP14-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000255154	Uniprot_gn	protein_coding	OTTHUMT00000353527.2	-	0.00	30	0	C	NM_007042		58303843	+1	tier1	-	no_errors	ENST00000528153	ensembl	human	novel	74_37	missense	42.86	8	6	SNP	0.965	T
LINC01169	102723165	genome.wustl.edu	37	15	66977666	66977666	+	Nonstop_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:66977666G>T	ENST00000558797.1	+	5	367	c.341G>T	c.(340-342)tGa>tTa	p.*114L																								GGTTGGCCATGATTTGGGGTC	0.542											OREG0023207	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001578	stop_lost	0																														ENST00000558797.1:c.341G>T	15.37:g.66977666G>T	ENSP00000453953:p.*114Leuext*36	136		Nonstop_Mutation	SNP	NULL	p.*114L	ENST00000558797.1	37	c.341		15																																																																																			RP11-321F6.1	-	NULL	ENSG00000259471		0.542	RP11-321F6.1-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000259471	Clone_based_vega_gene	protein_coding	OTTHUMT00000417449.1	-	0.00	67	0	G			66977666	+1	tier1	-	no_errors	ENST00000558797	ensembl	human	novel	74_37	nonstop	8.16	90	8	SNP	0.000	T
RP11-652G5.1	0	genome.wustl.edu	37	16	32621197	32621197	+	RNA	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:32621197T>G	ENST00000562976.1	+	0	573																											ATCCTCCTAGTTCTGATGAAG	0.507																																																	0																																												0																															16.37:g.32621197T>G				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.507	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	221	0	T			32621197	+1	tier1	-	no_errors	ENST00000566952	ensembl	human	known	74_37	rna	19.42	166	40	SNP	0.000	G
ENTHD2	146705	genome.wustl.edu	37	17	79206346	79206346	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:79206346G>A	ENST00000300714.3	-	8	584				AC027601.1_ENST00000569559.1_RNA|ENTHD2_ENST00000374769.2_Intron|AC027601.1_ENST00000575922.1_RNA	NM_144679.2	NP_653280.1	Q96N21	AP4AT_HUMAN	ENTH domain containing 2							cytoplasmic vesicle (GO:0031410)											GAGATGGGACGGCCGCCCAGT	0.697																																																	0																																										SO:0001627	intron_variant	0			AK056090	CCDS11779.1	17q25.3	2012-07-18	2012-07-18	2012-07-18	ENSG00000167302	ENSG00000167302			26458	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 56"""	C17orf56			Standard	NM_144679		Approved	FLJ31528	uc002jzu.2	Q96N21	OTTHUMG00000177866	ENST00000300714.3:c.527-525C>T	17.37:g.79206346G>A			Q6ZQU0|Q6ZSQ9	RNA	SNP	-	NULL	ENST00000300714.3	37	NULL	CCDS11779.1	17																																																																																			AC027601.1	-	-	ENSG00000260005		0.697	ENTHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260005	Clone_based_vega_gene	protein_coding	OTTHUMT00000439315.1	-	0.00	21	0	G	NM_144679		79206346	+1	tier1	-	no_errors	ENST00000575922	ensembl	human	known	74_37	rna	55.88	14	19	SNP	0.000	A
LOC101243545	101243545	genome.wustl.edu	37	3	161146953	161146953	+	lincRNA	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:161146953C>T	ENST00000473595.1	+	0	1231				RP11-3P17.5_ENST00000602890.1_lincRNA	NR_102265.1																						TCCAAAGCATCGTAATCAGGA	0.398																																																	0													86.0	96.0	92.0					3																	161146953		1465	2610	4075			0																															3.37:g.161146953C>T				RNA	SNP	-	NULL	ENST00000473595.1	37	NULL		3																																																																																			RP11-3P17.5	-	-	ENSG00000269888		0.398	RP11-3P17.4-001	KNOWN	basic	lincRNA	ENSG00000269888	Clone_based_vega_gene	lincRNA	OTTHUMT00000353185.1	-	0.00	47	0	C			161146953	+1	tier1	-	no_errors	ENST00000602890	ensembl	human	known	74_37	rna	35.85	34	19	SNP	1.000	T
EPC2	26122	genome.wustl.edu	37	2	149519397	149519397	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:149519397G>A	ENST00000258484.6	+	5	747	c.713G>A	c.(712-714)aGa>aAa	p.R238K		NM_015630.3	NP_056445.3	Q52LR7	EPC2_HUMAN	enhancer of polycomb homolog 2 (Drosophila)	238					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.0516)		TTGAAACTGAGACGAGAATTT	0.299																																																	0													64.0	57.0	59.0					2																	149519397		1804	4066	5870	SO:0001583	missense	0			AF286904	CCDS46422.1	2q23	2008-02-05			ENSG00000135999	ENSG00000135999			24543	protein-coding gene	gene with protein product		611000					Standard	NM_015630		Approved	DKFZP566F2124	uc010zbt.2	Q52LR7	OTTHUMG00000153739	ENST00000258484.6:c.713G>A	2.37:g.149519397G>A	ENSP00000258484:p.Arg238Lys		B3KWT7|D3DP89|Q7L9J1|Q96RR7|Q9NUT8|Q9NVR1|Q9UFM9	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.R238K	ENST00000258484.6	37	c.713	CCDS46422.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.172587	0.97348	.	.	ENSG00000135999	ENST00000258484	.	.	.	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.82797	0.5115	M	0.79343	2.45	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.83243	-0.0057	9	0.87932	D	0	-4.2919	20.5182	0.99214	0.0:0.0:1.0:0.0	.	238	Q52LR7	EPC2_HUMAN	K	238	.	ENSP00000258484:R238K	R	+	2	0	EPC2	149235867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.860000	0.98153	0.655000	0.94253	AGA	EPC2	-	NULL	ENSG00000135999		0.299	EPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPC2	HGNC	protein_coding	OTTHUMT00000332278.1	-	0.00	43	0	G	NM_015630		149519397	+1	tier1	-	no_errors	ENST00000258484	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	A
EPGN	255324	genome.wustl.edu	37	4	75178002	75178002	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:75178002G>T	ENST00000413830.1	+	3	295	c.234G>T	c.(232-234)gaG>gaT	p.E78D	EPGN_ENST00000509145.1_Missense_Mutation_p.E48D|EPGN_ENST00000502358.1_Missense_Mutation_p.E78D|EPGN_ENST00000514968.1_Missense_Mutation_p.E69D|EPGN_ENST00000505212.1_Missense_Mutation_p.E69D|EPGN_ENST00000503098.1_Missense_Mutation_p.E78D|EPGN_ENST00000332112.4_Missense_Mutation_p.E69D	NM_001270989.1	NP_001257918.1	Q6UW88	EPGN_HUMAN	epithelial mitogen	78	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|MAP kinase kinase activity (GO:0004708)			breast(3)|liver(1)|lung(1)|skin(1)	6			Lung(101;0.196)			TCCACCATGAGCTAGAGAAAG	0.423																																																	0													167.0	152.0	158.0					4																	75178002		2203	4300	6503	SO:0001583	missense	0				CCDS59475.1, CCDS59476.1, CCDS59477.1, CCDS59478.1, CCDS59479.1	4q13.3	2012-12-07	2012-12-07						17470	protein-coding gene	gene with protein product			"""epithelial mitogen homolog (mouse)"""				Standard	NM_001270989		Approved	epigen, EPG, PRO9904, ALGV3072	uc003hic.2	Q6UW88		ENST00000413830.1:c.234G>T	4.37:g.75178002G>T	ENSP00000411898:p.Glu78Asp		A1BMM3|A1BMM4|A1BMM5|A1BMM6|A1BMM7|A1BMM8|A8K090	Missense_Mutation	SNP	pfscan_EG-like_dom	p.E78D	ENST00000413830.1	37	c.234	CCDS59478.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.808611|2.808611	0.50421|0.50421	.|.	.|.	ENSG00000182585|ENSG00000182585	ENST00000446430|ENST00000413830;ENST00000332112;ENST00000514968;ENST00000503098;ENST00000502358;ENST00000509145;ENST00000505212	.|T;T;T;T;T;T;T	.|0.40756	.|2.57;2.57;2.57;2.57;1.02;1.02;1.02	5.63|5.63	2.64|2.64	0.31445|0.31445	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.119767	.|0.53938	.|D	.|0.000043	T|T	0.34106|0.34106	0.0886|0.0886	N|N	0.11255|0.11255	0.115|0.115	0.36394|0.36394	D|D	0.862675|0.862675	.|B;B;P;D;B;D;B	.|0.71674	.|0.106;0.322;0.77;0.998;0.106;0.998;0.287	.|B;B;B;D;B;D;B	.|0.77557	.|0.045;0.255;0.417;0.99;0.097;0.99;0.071	T|T	0.40156|0.40156	-0.9578|-0.9578	5|10	.|0.02654	.|T	.|1	-11.5381|-11.5381	8.0854|8.0854	0.30769|0.30769	0.1423:0.129:0.7287:0.0|0.1423:0.129:0.7287:0.0	.|.	.|48;78;78;69;78;69;69	.|Q6UW88-7;Q6UW88;Q6UW88-3;Q6UW88-5;Q6UW88-4;Q6UW88-6;Q6UW88-2	.|.;EPGN_HUMAN;.;.;.;.;.	S|D	54|78;69;69;78;78;48;69	.|ENSP00000411898:E78D;ENSP00000330375:E69D;ENSP00000426550:E69D;ENSP00000425890:E78D;ENSP00000426678:E78D;ENSP00000426630:E48D;ENSP00000424392:E69D	.|ENSP00000330375:E69D	A|E	+|+	1|3	0|2	EPGN|EPGN	75396866|75396866	0.995000|0.995000	0.38212|0.38212	0.966000|0.966000	0.40874|0.40874	0.699000|0.699000	0.40488|0.40488	0.460000|0.460000	0.21924|0.21924	0.355000|0.355000	0.24131|0.24131	-1.851000|-1.851000	0.00568|0.00568	GCT|GAG	EPGN	-	pfscan_EG-like_dom	ENSG00000182585		0.423	EPGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPGN	HGNC	protein_coding	OTTHUMT00000362738.1	-	0.00	72	0	G	NM_001013442		75178002	+1	tier1	-	no_errors	ENST00000413830	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.983	T
ERBB4	2066	genome.wustl.edu	37	2	212587123	212587123	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:212587123C>T	ENST00000342788.4	-	7	1188	c.878G>A	c.(877-879)tGt>tAt	p.C293Y	ERBB4_ENST00000402597.1_Missense_Mutation_p.C293Y|ERBB4_ENST00000436443.1_Missense_Mutation_p.C293Y|ERBB4_ENST00000484474.1_5'Flank	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	293	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.C293F(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CTTACGTGGACATTTCTTGAC	0.323										TSP Lung(8;0.080)																																							1	Substitution - Missense(1)	kidney(1)											157.0	143.0	147.0					2																	212587123		2203	4300	6503	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.878G>A	2.37:g.212587123C>T	ENSP00000342235:p.Cys293Tyr		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.C293Y	ENST00000342788.4	37	c.878	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.519600|4.519600	0.85495|0.85495	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.70399|.	-0.48;-0.48;-0.48|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Growth factor, receptor (1);Furin-like cysteine-rich domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88463|0.88463	0.6443|0.6443	H|H	0.96111|0.96111	3.77|3.77	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;0.998;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;0.999;0.993;1.0;1.0|.	D|D	0.91549|0.91549	0.5255|0.5255	10|5	0.87932|.	D|.	0|.	.|.	19.7763|19.7763	0.96395|0.96395	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	293;293;152;293;293|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	Y|I	293|293	ENSP00000342235:C293Y;ENSP00000403204:C293Y;ENSP00000385565:C293Y|.	ENSP00000342235:C293Y|.	C|V	-|-	2|1	0|0	ERBB4|ERBB4	212295368|212295368	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	7.756000|7.756000	0.85195|0.85195	2.684000|2.684000	0.91462|0.91462	0.650000|0.650000	0.86243|0.86243	TGT|GTC	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt_N_dom	ENSG00000178568		0.323	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	64	0	C	NM_001042599		212587123	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	43.84	41	32	SNP	1.000	T
ERCC6	2074	genome.wustl.edu	37	10	50714021	50714021	+	Missense_Mutation	SNP	G	G	A	rs61749175		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:50714021G>A	ENST00000355832.5	-	6	1513	c.1435C>T	c.(1435-1437)Cgt>Tgt	p.R479C		NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	479					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						AGCTTCAGACGTTTCTCTTTG	0.358								Direct reversal of damage;Nucleotide excision repair (NER)					G|||	1	0.000199681	0.0	0.0014	5008	,	,		18578	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	4,4402	8.1+/-20.4	0,4,2199	152.0	139.0	143.0		1435	-2.6	0.0	10	dbSNP_129	143	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ERCC6	NM_000124.2	180	0,5,6498	AA,AG,GG		0.0116,0.0908,0.0384	benign	479/1494	50714021	5,13001	2203	4300	6503	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.1435C>T	10.37:g.50714021G>A	ENSP00000348089:p.Arg479Cys		D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R479C	ENST00000355832.5	37	c.1435	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	G	6.350	0.432655	0.12045	9.08E-4	1.16E-4	ENSG00000225830	ENST00000355832	D	0.93366	-3.21	5.89	-2.57	0.06248	.	.	.	.	.	D	0.86372	0.5917	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.04013	0.001	T	0.72561	-0.4256	9	0.54805	T	0.06	2.7119	7.1946	0.25845	0.1832:0.0:0.61:0.2068	rs61749175	479	Q03468	ERCC6_HUMAN	C	479	ENSP00000348089:R479C	ENSP00000348089:R479C	R	-	1	0	ERCC6	50384027	0.000000	0.05858	0.000000	0.03702	0.180000	0.23129	0.364000	0.20325	-0.837000	0.04223	0.655000	0.94253	CGT	ERCC6	-	superfamily_P-loop_NTPase	ENSG00000225830		0.358	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	-	0.00	55	0	G	NM_000124		50714021	-1	tier1	rs61749175	no_errors	ENST00000355832	ensembl	human	known	74_37	missense	16.92	54	11	SNP	0.000	A
ETAA1	54465	genome.wustl.edu	37	2	67630792	67630792	+	Silent	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:67630792T>G	ENST00000272342.5	+	5	1108	c.978T>G	c.(976-978)acT>acG	p.T326T	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	326						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						AAATCATTACTAATGAAACTC	0.383																																																	0													52.0	55.0	54.0					2																	67630792		2202	4300	6502	SO:0001819	synonymous_variant	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.978T>G	2.37:g.67630792T>G			Q05BT7|Q53SC4	Silent	SNP	NULL	p.T326	ENST00000272342.5	37	c.978	CCDS1882.1	2																																																																																			ETAA1	-	NULL	ENSG00000143971		0.383	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	-	0.00	40	0	T	NM_019002		67630792	+1	tier1	-	no_errors	ENST00000272342	ensembl	human	known	74_37	silent	20.00	36	9	SNP	0.002	G
EVC2	132884	genome.wustl.edu	37	4	5696102	5696102	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:5696102T>G	ENST00000344408.5	-	3	463	c.410A>C	c.(409-411)aAg>aCg	p.K137T	EVC2_ENST00000344938.1_Missense_Mutation_p.K137T|EVC2_ENST00000310917.2_Missense_Mutation_p.K57T	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	137					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AAATAAGTTCTTCTTAGGCCA	0.398																																																	0													120.0	127.0	124.0					4																	5696102		2203	4300	6503	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.410A>C	4.37:g.5696102T>G	ENSP00000342144:p.Lys137Thr		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.K137T	ENST00000344408.5	37	c.410	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	T	11.38	1.620427	0.28801	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.77620	-1.11;-1.09;-1.1	4.36	0.496	0.16896	.	0.623726	0.14442	N	0.319371	T	0.69735	0.3144	L	0.42245	1.32	0.28475	N	0.915219	P	0.52316	0.952	P	0.46585	0.521	T	0.61845	-0.6979	10	0.41790	T	0.15	-20.5783	6.3713	0.21483	0.0:0.3194:0.0:0.6806	.	137	Q86UK5	LBN_HUMAN	T	137;57;137	ENSP00000339954:K137T;ENSP00000311683:K57T;ENSP00000342144:K137T	ENSP00000311683:K57T	K	-	2	0	EVC2	5747003	1.000000	0.71417	0.534000	0.28014	0.147000	0.21601	1.214000	0.32419	-0.157000	0.11059	-0.385000	0.06624	AAG	EVC2	-	NULL	ENSG00000173040		0.398	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	-	0.00	71	0	T	NM_147127		5696102	-1	tier1	-	no_errors	ENST00000344408	ensembl	human	known	74_37	missense	34.41	61	32	SNP	0.981	G
EVI5L	115704	genome.wustl.edu	37	19	7928412	7928412	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:7928412G>A	ENST00000270530.4	+	19	2405	c.2209G>A	c.(2209-2211)Gag>Aag	p.E737K	EVI5L_ENST00000538904.2_Missense_Mutation_p.E748K	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	737					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						GTCGTCGGACGAGGAGCTACT	0.706																																																	0													22.0	16.0	18.0					19																	7928412		2188	4280	6468	SO:0001583	missense	0			BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.2209G>A	19.37:g.7928412G>A	ENSP00000270530:p.Glu737Lys		B9A6I9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E748K	ENST00000270530.4	37	c.2242	CCDS12188.1	19	.	.	.	.	.	.	.	.	.	.	G	16.66	3.183864	0.57800	.	.	ENSG00000142459	ENST00000270530;ENST00000538904	T;T	0.07800	3.16;3.17	4.37	3.33	0.38152	.	0.154724	0.40144	N	0.001176	T	0.08891	0.0220	N	0.14661	0.345	0.39516	D	0.968434	D;D	0.64830	0.994;0.994	P;P	0.53224	0.721;0.721	T	0.23547	-1.0185	10	0.62326	D	0.03	-30.8634	9.589	0.39534	0.1031:0.0:0.8969:0.0	.	748;737	B9A6I9;Q96CN4	.;EVI5L_HUMAN	K	737;748	ENSP00000270530:E737K;ENSP00000445905:E748K	ENSP00000270530:E737K	E	+	1	0	EVI5L	7834412	1.000000	0.71417	0.915000	0.36163	0.407000	0.30961	5.864000	0.69575	1.060000	0.40578	0.491000	0.48974	GAG	EVI5L	-	NULL	ENSG00000142459		0.706	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	HGNC	protein_coding	OTTHUMT00000461347.1	-	0.00	9	0	G	NM_145245		7928412	+1	tier1	-	no_errors	ENST00000538904	ensembl	human	known	74_37	missense	42.11	11	8	SNP	1.000	A
FAM135B	51059	genome.wustl.edu	37	8	139149481	139149481	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:139149481G>A	ENST00000395297.1	-	19	4094	c.3924C>T	c.(3922-3924)gtC>gtT	p.V1308V		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	1308										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CAACCAGCACGACGTTTTTAA	0.423										HNSCC(54;0.14)																																							0													131.0	127.0	128.0					8																	139149481		1861	4108	5969	SO:0001819	synonymous_variant	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.3924C>T	8.37:g.139149481G>A			B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.V1308	ENST00000395297.1	37	c.3924	CCDS6375.2	8																																																																																			FAM135B	-	pfam_DUF676_lipase-like	ENSG00000147724		0.423	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	-	0.00	19	0	G	NM_015912		139149481	-1	tier1	-	no_errors	ENST00000395297	ensembl	human	known	74_37	silent	17.50	33	7	SNP	0.998	A
FAM86HP	729375	genome.wustl.edu	37	3	129824457	129824457	+	RNA	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:129824457C>T	ENST00000500074.2	-	0	172									family with sequence similarity 86, member H, pseudogene																		CCAAAAGCTCCGTGTGGACAG	0.542																																																	0																																												0					3q22.1	2011-07-01			ENSG00000253540	ENSG00000253540			42359	pseudogene	pseudogene							Standard	NR_024252		Approved		uc011ble.1		OTTHUMG00000159796		3.37:g.129824457C>T				RNA	SNP	-	NULL	ENST00000500074.2	37	NULL		3																																																																																			FAM86HP	-	-	ENSG00000253540		0.542	FAM86HP-002	PUTATIVE	basic	processed_transcript	FAM86HP	HGNC	pseudogene	OTTHUMT00000358348.1	-	0.00	127	0	C			129824457	-1	tier1	-	no_errors	ENST00000500074	ensembl	human	putative	74_37	rna	20.00	156	39	SNP	0.990	T
FANCA	2175	genome.wustl.edu	37	16	89813023	89813023	+	Missense_Mutation	SNP	G	G	T	rs142833057	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:89813023G>T	ENST00000389301.3	-	35	3512	c.3482C>A	c.(3481-3483)aCg>aAg	p.T1161K	FANCA_ENST00000568369.1_Missense_Mutation_p.T1161K	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1161					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.T1161M(2)		breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GGGGCATTTCGTCTGGCACTT	0.567			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				G|||	2	0.000399361	0.0	0.0	5008	,	,		19962	0.002		0.0	False		,,,				2504	0.0						yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	2	Substitution - Missense(2)	lung(1)|endometrium(1)											89.0	82.0	84.0					16																	89813023		2198	4300	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3482C>A	16.37:g.89813023G>T	ENSP00000373952:p.Thr1161Lys		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.T1161K	ENST00000389301.3	37	c.3482	CCDS32515.1	16	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	12.61	1.988834	0.35131	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.84873	-1.91	5.05	3.07	0.35406	.	0.413038	0.22913	N	0.054102	D	0.88647	0.6493	M	0.76002	2.32	0.48975	D	0.999732	B;D;D	0.64830	0.447;0.994;0.994	B;P;P	0.56216	0.267;0.794;0.794	D	0.87753	0.2593	10	0.87932	D	0	-9.444	10.0442	0.42177	0.0762:0.1373:0.7865:0.0	.	138;1161;1161	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	K	1161;138	ENSP00000373952:T1161K	ENSP00000306281:T138K	T	-	2	0	FANCA	88340524	0.679000	0.27596	0.134000	0.22075	0.002000	0.02628	1.510000	0.35790	0.525000	0.28522	-0.224000	0.12420	ACG	FANCA	-	NULL	ENSG00000187741		0.567	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1		0.00	35	0	G			89813023	-1			no_errors	ENST00000389301	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.643	T
FLG	2312	genome.wustl.edu	37	1	152277405	152277405	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:152277405C>T	ENST00000368799.1	-	3	9992	c.9957G>A	c.(9955-9957)ccG>ccA	p.P3319P	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3319	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGTCCACGCGGAATGCCTG	0.552									Ichthyosis																																								0													409.0	399.0	402.0					1																	152277405		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9957G>A	1.37:g.152277405C>T			Q01720|Q5T583|Q9UC71	Silent	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.P3319	ENST00000368799.1	37	c.9957	CCDS30860.1	1																																																																																			FLG	-	pfam_Filaggrin	ENSG00000143631		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	145	0	C	NM_002016		152277405	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	silent	24.66	168	55	SNP	0.000	T
FOLH1	2346	genome.wustl.edu	37	11	49204779	49204779	+	Missense_Mutation	SNP	C	C	T	rs116795343	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:49204779C>T	ENST00000256999.2	-	7	1102	c.842G>A	c.(841-843)cGt>cAt	p.R281H	FOLH1_ENST00000356696.3_Missense_Mutation_p.R281H|FOLH1_ENST00000343844.4_De_novo_Start_OutOfFrame|FOLH1_ENST00000340334.7_Missense_Mutation_p.R266H|FOLH1_ENST00000533034.1_Missense_Mutation_p.R266H	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	281	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)	p.R281L(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGCAATTCCACGCCTATAAGC	0.348																																																	1	Substitution - Missense(1)	lung(1)											72.0	73.0	73.0					11																	49204779		2201	4298	6499	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.842G>A	11.37:g.49204779C>T	ENSP00000256999:p.Arg281His		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.R281H	ENST00000256999.2	37	c.842	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	2.929	-0.221410	0.06061	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	2.76	-1.12	0.09808	.	0.978445	0.08346	N	0.960084	T	0.21427	0.0516	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.06405	0.001;0.0;0.002;0.0	T	0.23655	-1.0182	10	0.14656	T	0.56	.	6.6038	0.22714	0.0:0.3193:0.0:0.6807	.	266;266;281;281	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	H	281;281;266;266;281	ENSP00000256999:R281H;ENSP00000349129:R281H;ENSP00000344131:R266H;ENSP00000431463:R266H	ENSP00000256999:R281H	R	-	2	0	FOLH1	49161355	0.002000	0.14202	0.792000	0.32020	0.272000	0.26649	-0.922000	0.04004	-0.085000	0.12573	0.194000	0.17425	CGT	FOLH1	-	NULL	ENSG00000086205		0.348	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	42	0	C	NM_004476		49204779	-1	tier1	rs116795343	no_errors	ENST00000256999	ensembl	human	known	74_37	missense	5.94	95	6	SNP	0.843	T
FOLH1	2346	genome.wustl.edu	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000356696.3_Silent_p.Y277Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000533034.1_Silent_p.Y262Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																																	0													61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.Y277	ENST00000256999.2	37	c.831	CCDS7946.1	11																																																																																			FOLH1	-	NULL	ENSG00000086205		0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	36	0	A	NM_004476		49204790	-1	tier1	rs76509850	no_errors	ENST00000256999	ensembl	human	known	74_37	silent	8.14	79	7	SNP	1.000	G
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74715142	74715142	+	Splice_Site	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:74715142G>T	ENST00000370899.3	+	5	489		c.e5-1		FPGT-TNNI3K_ENST00000370895.1_Splice_Site|FPGT-TNNI3K_ENST00000557284.2_Splice_Site|TNNI3K_ENST00000326637.3_Splice_Site|TNNI3K_ENST00000370891.2_Splice_Site|FPGT-TNNI3K_ENST00000533006.1_Splice_Site	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		GTTTTTTTCAGCTCTGATGAA	0.318																																																	0													118.0	118.0	118.0					1																	74715142		2203	4300	6503	SO:0001630	splice_region_variant	0					1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.453-1G>T	1.37:g.74715142G>T				Splice_Site	SNP	-	e5-1	ENST00000370899.3	37	c.492-1		1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.186402	0.78789	.	.	ENSG00000259030;ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000370895;ENST00000557284;ENST00000370891;ENST00000326637	.	.	.	5.83	5.83	0.93111	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7289	0.96175	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RP11-653A5.2;AC093158.1	74487730	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.536000	0.73842	2.770000	0.95276	0.655000	0.94253	.	FPGT-TNNI3K	-	-	ENSG00000259030		0.318	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3		0.00	44	0	G		Intron	74715142	+1			no_errors	ENST00000557284	ensembl	human	known	74_37	splice_site	6.25	44	3	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48501614	48501614	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:48501614G>A	ENST00000503238.1	-	61	8866	c.8867C>T	c.(8866-8868)aCg>aTg	p.T2956M	FRYL_ENST00000537810.1_Missense_Mutation_p.T2956M|FRYL_ENST00000264319.7_Missense_Mutation_p.T346M|FRYL_ENST00000507873.2_Missense_Mutation_p.T346M|FRYL_ENST00000358350.4_Missense_Mutation_p.T2956M			O94915	FRYL_HUMAN	FRY-like	2956					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CTGGCCCAGCGTCTGATGATG	0.423																																																	0													124.0	117.0	119.0					4																	48501614		1883	4113	5996	SO:0001583	missense	0			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.8867C>T	4.37:g.48501614G>A	ENSP00000426064:p.Thr2956Met		O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T2956M	ENST00000503238.1	37	c.8867	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326981	0.60743	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000264319;ENST00000507873	T;T;T	0.27720	1.65;1.65;1.65	5.63	5.63	0.86233	.	0.073334	0.52532	U	0.000070	T	0.53706	0.1813	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.71184	0.931;0.968;0.972	T	0.48340	-0.9044	10	0.48119	T	0.1	.	19.6605	0.95868	0.0:0.0:1.0:0.0	.	2956;2956;346	O94915;F5GX82;O94915-2	FRYL_HUMAN;.;.	M	2956;2956;2956;346;346	ENSP00000426064:T2956M;ENSP00000351113:T2956M;ENSP00000441114:T2956M	ENSP00000264319:T346M	T	-	2	0	FRYL	48196371	1.000000	0.71417	0.991000	0.47740	0.804000	0.45430	9.864000	0.99589	2.645000	0.89757	0.484000	0.47621	ACG	FRYL	-	NULL	ENSG00000075539		0.423	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	-	0.00	49	0	G			48501614	-1	tier1	-	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	25.42	44	15	SNP	1.000	A
FSCN1	6624	genome.wustl.edu	37	7	5645038	5645038	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:5645038G>T	ENST00000382361.3	+	5	1529	c.1415G>T	c.(1414-1416)gGc>gTc	p.G472V	FSCN1_ENST00000340250.6_Missense_Mutation_p.G451V	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	472					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		TACCTGAAGGGCGACCACGCA	0.662																																																	0													47.0	41.0	43.0					7																	5645038		2203	4300	6503	SO:0001583	missense	0			U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1415G>T	7.37:g.5645038G>T	ENSP00000371798:p.Gly472Val		A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Missense_Mutation	SNP	pfam_Fascin-domain,superfamily_Actin_cross-linking	p.G472V	ENST00000382361.3	37	c.1415	CCDS5342.1	7	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872849	0.72180	.	.	ENSG00000075618	ENST00000340250;ENST00000382361;ENST00000535097	T;T	0.41065	1.01;1.01	3.83	3.83	0.44106	Fascin domain (1);Actin cross-linking (1);	0.000000	0.85682	D	0.000000	T	0.64951	0.2645	M	0.77313	2.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71889	-0.4456	10	0.87932	D	0	-2.236	15.0633	0.71973	0.0:0.0:1.0:0.0	.	472	Q16658	FSCN1_HUMAN	V	451;472;194	ENSP00000339729:G451V;ENSP00000371798:G472V	ENSP00000339729:G451V	G	+	2	0	FSCN1	5611564	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	9.350000	0.97070	1.834000	0.53371	0.555000	0.69702	GGC	FSCN1	-	pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000075618		0.662	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN1	HGNC	protein_coding	OTTHUMT00000207153.3		0.00	25	0	G	NM_003088		5645038	+1			no_errors	ENST00000382361	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
FUK	197258	genome.wustl.edu	37	16	70497528	70497528	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:70497528C>T	ENST00000288078.6	+	3	317	c.85C>T	c.(85-87)Ctg>Ttg	p.L29L	FUK_ENST00000378912.2_Silent_p.L29L|FUK_ENST00000571514.1_Intron|FUK_ENST00000428974.2_Silent_p.L29L	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	29						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GACCCTAGAACTGGAAGTGCG	0.597																																																	0													70.0	76.0	74.0					16																	70497528		2003	4162	6165	SO:0001819	synonymous_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.85C>T	16.37:g.70497528C>T			Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.L29	ENST00000288078.6	37	c.85	CCDS10891.2	16																																																																																			FUK	-	NULL	ENSG00000157353		0.597	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	-	0.00	37	0	C	NM_145059		70497528	+1	tier1	-	no_errors	ENST00000378912	ensembl	human	known	74_37	silent	22.73	34	10	SNP	1.000	T
FURIN	5045	genome.wustl.edu	37	15	91422672	91422672	+	Splice_Site	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:91422672A>C	ENST00000268171.3	+	10	1332		c.e10-1			NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TCTTCCTGGCAGGTGACGACT	0.622																																																	0													49.0	52.0	51.0					15																	91422672		2198	4298	6496	SO:0001630	splice_region_variant	0			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.1054-1A>C	15.37:g.91422672A>C			Q14336|Q6LBS3|Q9UCZ5	Splice_Site	SNP	-	e9-2	ENST00000268171.3	37	c.1054-2	CCDS10364.1	15	.	.	.	.	.	.	.	.	.	.	A	16.37	3.103748	0.56291	.	.	ENSG00000140564	ENST00000268171	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1734	0.48584	0.8467:0.1533:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FURIN	89223676	1.000000	0.71417	0.987000	0.45799	0.928000	0.56348	7.084000	0.76866	1.825000	0.53177	0.454000	0.30748	.	FURIN	-	-	ENSG00000140564		0.622	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FURIN	HGNC	protein_coding	OTTHUMT00000313492.1	-	0.00	22	0	A	NM_002569	Intron	91422672	+1	tier1	-	no_errors	ENST00000268171	ensembl	human	known	74_37	splice_site	44.83	16	13	SNP	1.000	C
GABBR1	2550	genome.wustl.edu	37	6	29577143	29577144	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:29577143_29577144insG	ENST00000377034.4	-	15	2056_2057	c.1721_1722insC	c.(1720-1722)ccafs	p.P574fs	GABBR1_ENST00000355973.3_Frame_Shift_Ins_p.P457fs|GABBR1_ENST00000376977.3_Intron|GABBR1_ENST00000377016.4_Frame_Shift_Ins_p.P512fs|GABBR1_ENST00000377012.4_Frame_Shift_Ins_p.P457fs	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	574					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TCTGGTCAGCTGGGGGGGACCC	0.54																																																	0																																										SO:0001589	frameshift_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1722dupC	6.37:g.29577150_29577150dupG	ENSP00000366233:p.Pro574fs		B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Frame_Shift_Ins	INS	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Peripla_BP_I,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.A575fs	ENST00000377034.4	37	c.1722_1721	CCDS4663.1	6																																																																																			GABBR1	-	superfamily_Peripla_BP_I	ENSG00000204681		0.540	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3		0.00	25	0	-			29577144	-1	tier1		no_errors	ENST00000377034	ensembl	human	known	74_37	frame_shift_ins	24.44	34	11	INS	0.997:1.000	G
GALNT14	79623	genome.wustl.edu	37	2	31133619	31133619	+	3'UTR	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:31133619A>G	ENST00000349752.5	-	0	2446				GALNT14_ENST00000324589.5_3'UTR|GALNT14_ENST00000406653.1_3'UTR|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000356174.3_3'UTR	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					CCTCCCTGAGACAGTTGCTCC	0.557																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.*148T>C	2.37:g.31133619A>G			B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	RNA	SNP	-	NULL	ENST00000349752.5	37	NULL	CCDS1773.2	2																																																																																			GALNT14	-	-	ENSG00000158089		0.557	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	HGNC	protein_coding	OTTHUMT00000157264.1	-	0.00	95	0	A	NM_024572		31133619	-1	tier1	-	no_errors	ENST00000475320	ensembl	human	known	74_37	rna	73.33	36	99	SNP	0.529	G
GAS2L2	246176	genome.wustl.edu	37	17	34074081	34074081	+	Missense_Mutation	SNP	G	G	A	rs369252885		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:34074081G>A	ENST00000254466.6	-	5	1066	c.1039C>T	c.(1039-1041)Cgg>Tgg	p.R347W	GAS2L2_ENST00000587565.1_Missense_Mutation_p.R331W	NM_139285.3	NP_644814.1	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	347					cell cycle arrest (GO:0007050)|microtubule bundle formation (GO:0001578)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	actin filament binding (GO:0051015)|cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCTGCTCCCCGTTCCCTGCGG	0.612																																																	0								G	TRP/ARG	1,4405		0,1,2202	29.0	34.0	32.0		1039	-4.9	0.0	17		32	0,8596		0,0,4298	no	missense	GAS2L2	NM_139285.3	101	0,1,6500	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	347/881	34074081	1,13001	2203	4298	6501	SO:0001583	missense	0			AF508784	CCDS11298.1	17q21	2014-05-06			ENSG00000132139	ENSG00000270765			24846	protein-coding gene	gene with protein product		611398				12584248	Standard	NM_139285		Approved	GAR17	uc002hjv.2	Q8NHY3	OTTHUMG00000188386	ENST00000254466.6:c.1039C>T	17.37:g.34074081G>A	ENSP00000254466:p.Arg347Trp		Q8NHY4	Missense_Mutation	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.R347W	ENST00000254466.6	37	c.1039	CCDS11298.1	17	.	.	.	.	.	.	.	.	.	.	G	8.846	0.943345	0.18281	2.27E-4	0.0	ENSG00000132139	ENST00000254466	T	0.19394	2.15	4.59	-4.89	0.03103	.	2.211840	0.01653	N	0.024643	T	0.10121	0.0248	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16482	-1.0401	10	0.37606	T	0.19	1.1167	0.8797	0.01231	0.327:0.1142:0.3268:0.2321	.	347	Q8NHY3	GA2L2_HUMAN	W	347	ENSP00000254466:R347W	ENSP00000254466:R347W	R	-	1	2	GAS2L2	31098194	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.326000	0.07965	-0.698000	0.05085	0.561000	0.74099	CGG	GAS2L2	-	NULL	ENSG00000132139		0.612	GAS2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L2	HGNC	protein_coding	OTTHUMT00000256497.1	-	0.00	21	0	G	NM_139285		34074081	-1	tier1	-	no_errors	ENST00000254466	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.000	A
GPR112	139378	genome.wustl.edu	37	X	135428495	135428495	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:135428495G>T	ENST00000394143.1	+	6	2921	c.2630G>T	c.(2629-2631)aGg>aTg	p.R877M	GPR112_ENST00000394141.1_Missense_Mutation_p.R672M|GPR112_ENST00000370652.1_Missense_Mutation_p.R877M|GPR112_ENST00000287534.4_Missense_Mutation_p.R814M|GPR112_ENST00000412101.1_Missense_Mutation_p.R672M	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	877					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCAGCACAAAGGGTGACAGCT	0.413																																																	0													133.0	125.0	128.0					X																	135428495		2203	4300	6503	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.2630G>T	X.37:g.135428495G>T	ENSP00000377699:p.Arg877Met		A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.R877M	ENST00000394143.1	37	c.2630	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.191662	0.00026	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.27557	1.7;1.7;1.66;1.81;1.66	2.09	-0.562	0.11781	.	.	.	.	.	T	0.07279	0.0184	N	0.01352	-0.895	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.31503	-0.9941	9	0.02654	T	1	.	3.7183	0.08446	0.0:0.1599:0.4706:0.3695	.	814;672;877	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	M	877;877;672;814;672	ENSP00000377699:R877M;ENSP00000359686:R877M;ENSP00000416526:R672M;ENSP00000287534:R814M;ENSP00000377697:R672M	ENSP00000287534:R814M	R	+	2	0	GPR112	135256161	0.016000	0.18221	0.136000	0.22124	0.200000	0.23975	-0.481000	0.06552	-0.654000	0.05394	-0.932000	0.02703	AGG	GPR112	-	NULL	ENSG00000156920		0.413	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1		0.00	22	0	G			135428495	+1			no_errors	ENST00000370652	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.272	T
GUCY2C	2984	genome.wustl.edu	37	12	14766154	14766154	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:14766154G>C	ENST00000261170.3	-	27	3255	c.3119C>G	c.(3118-3120)gCa>gGa	p.A1040G	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	1040					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	TCTTATCCCTGCTGCCTGTCT	0.438																																																	0													213.0	224.0	220.0					12																	14766154		2203	4300	6503	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.3119C>G	12.37:g.14766154G>C	ENSP00000261170:p.Ala1040Gly		B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_A/G_cyclase,superfamily_Peripla_BP_I,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.A1040G	ENST00000261170.3	37	c.3119	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	G	0.558	-0.846327	0.02671	.	.	ENSG00000070019	ENST00000261170	T	0.80994	-1.44	5.85	1.51	0.23008	.	1.187560	0.05776	N	0.607828	T	0.57431	0.2053	N	0.04090	-0.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47086	-0.9144	10	0.07813	T	0.8	.	6.2245	0.20700	0.139:0.0:0.3846:0.4764	.	1040	P25092	GUC2C_HUMAN	G	1040	ENSP00000261170:A1040G	ENSP00000261170:A1040G	A	-	2	0	GUCY2C	14657421	0.055000	0.20627	0.000000	0.03702	0.068000	0.16541	2.578000	0.46051	0.366000	0.24427	0.655000	0.94253	GCA	GUCY2C	-	NULL	ENSG00000070019		0.438	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	-	0.00	107	0	G			14766154	-1	tier1	-	no_errors	ENST00000261170	ensembl	human	known	74_37	missense	27.59	84	32	SNP	0.000	C
HDAC9	9734	genome.wustl.edu	37	7	18788705	18788705	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:18788705C>T	ENST00000432645.2	+	13	1978	c.1978C>T	c.(1978-1980)Cga>Tga	p.R660*	HDAC9_ENST00000406451.4_Nonsense_Mutation_p.R660*|HDAC9_ENST00000441542.2_Nonsense_Mutation_p.R663*|HDAC9_ENST00000401921.1_Nonsense_Mutation_p.R619*	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	660	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GCATGCTGGACGAATACAGAG	0.438																																																	0													83.0	82.0	82.0					7																	18788705		1933	4160	6093	SO:0001587	stop_gained	0			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1978C>T	7.37:g.18788705C>T	ENSP00000410337:p.Arg660*		A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Nonsense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.R663*	ENST00000432645.2	37	c.1987	CCDS47555.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.221734	0.98146	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	.	.	.	5.3	3.31	0.37934	.	0.000000	0.49916	D	0.000121	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.3111	11.7707	0.51956	0.5463:0.4537:0.0:0.0	.	.	.	.	X	660;619;660;663;572	.	ENSP00000339165:R572X	R	+	1	2	HDAC9	18755230	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.122000	0.41987	1.425000	0.47237	0.563000	0.77884	CGA	HDAC9	-	pfam_His_deacetylse_dom,pirsf_Histone_deAcase_II_euk	ENSG00000048052		0.438	HDAC9-023	KNOWN	basic|CCDS	protein_coding	HDAC9	HGNC	protein_coding	OTTHUMT00000376176.1	-	0.00	68	0	C			18788705	+1	tier1	-	no_errors	ENST00000441542	ensembl	human	known	74_37	nonsense	36.25	51	29	SNP	1.000	T
HECTD2	143279	genome.wustl.edu	37	10	93242782	93242783	+	In_Frame_Ins	INS	-	-	AGG			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:93242782_93242783insAGG	ENST00000298068.5	+	8	864_865	c.770_771insAGG	c.(769-774)atagct>atAGGagct	p.257_258IA>IGA	HECTD2_ENST00000446394.1_In_Frame_Ins_p.257_258IA>IGA|HECTD2_ENST00000536715.1_5'UTR|HECTD2_ENST00000371667.1_5'Flank	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	257					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						CTACGACAGATAGCTACCTTAG	0.307																																					NSCLC(12;376 469 1699 39910 41417)												0																																										SO:0001652	inframe_insertion	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	Exception_encountered	10.37:g.93242782_93242783insAGG	ENSP00000298068:p.Ile257_Ala258insGly		Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	In_Frame_Ins	INS	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.258in_frame_insG	ENST00000298068.5	37	c.770_771	CCDS7414.1	10																																																																																			HECTD2	-	NULL	ENSG00000165338		0.307	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1		0.00	16	0	-			93242783	+1	tier1		no_errors	ENST00000446394	ensembl	human	known	74_37	in_frame_ins	20.00	24	6	INS	1.000:1.000	AGG
HELZ2	85441	genome.wustl.edu	37	20	62193251	62193251	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:62193251G>A	ENST00000467148.1	-	11	6685	c.6616C>T	c.(6616-6618)Cgt>Tgt	p.R2206C	HELZ2_ENST00000427522.2_Missense_Mutation_p.R1637C	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2206	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										TTCTCCCCACGGGGGGGGCCT	0.647																																																	0																																										SO:0001583	missense	0			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.6616C>T	20.37:g.62193251G>A	ENSP00000417401:p.Arg2206Cys		Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R2206C	ENST00000467148.1	37	c.6616	CCDS33508.1	20	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429697	0.43122	.	.	ENSG00000130589	ENST00000427522;ENST00000467148	T;T	0.80214	-1.35;-1.25	3.93	-2.82	0.05787	ATPase, AAA+ type, core (1);	6.592870	0.00357	N	0.000024	T	0.73729	0.3624	L	0.27053	0.805	0.09310	N	1	D;P	0.58970	0.984;0.85	P;B	0.51918	0.684;0.235	T	0.61831	-0.6982	10	0.35671	T	0.21	.	1.8768	0.03219	0.1094:0.228:0.3039:0.3587	.	2206;1637	Q9BYK8;Q9BYK8-2	PR285_HUMAN;.	C	1637;2206	ENSP00000393257:R1637C;ENSP00000417401:R2206C	ENSP00000393257:R1637C	R	-	1	0	RP4-697K14.7	61663695	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.420000	0.07062	-1.091000	0.03065	-0.540000	0.04249	CGT	HELZ2	-	superfamily_P-loop_NTPase	ENSG00000130589		0.647	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1		0.00	10	0	G	NM_001037335		62193251	-1			no_errors	ENST00000467148	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.000	A
HIST1H4E	8367	genome.wustl.edu	37	6	26205070	26205070	+	Silent	SNP	G	G	A	rs145407769	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:26205070G>A	ENST00000360441.4	+	1	213	c.198G>A	c.(196-198)gtG>gtA	p.V66V		NM_003545.3	NP_003536.1	P62805	H4_HUMAN	histone cluster 1, H4e	66					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)	p.V66V(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	18		all_hematologic(11;0.196)				TGGAAAACGTGATTCGTGATG	0.567																																																	1	Substitution - coding silent(1)	ovary(1)											140.0	125.0	130.0					6																	26205070		2203	4300	6503	SO:0001819	synonymous_variant	0			Z80787	CCDS4593.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198518	ENSG00000276966		"""Histones / Replication-dependent"""	4790	protein-coding gene	gene with protein product		602830	"""H4 histone family, member J"", ""histone 1, H4e"""	H4FJ		9119399, 12408966	Standard	NM_003545		Approved	H4/j	uc003ngy.3	P62805	OTTHUMG00000014441	ENST00000360441.4:c.198G>A	6.37:g.26205070G>A			A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.V66	ENST00000360441.4	37	c.198	CCDS4593.1	6																																																																																			HIST1H4E	-	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000198518		0.567	HIST1H4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4E	HGNC	protein_coding	OTTHUMT00000040104.1	-	0.00	68	0	G	NM_003545		26205070	+1	tier1	-	no_errors	ENST00000360441	ensembl	human	known	74_37	silent	22.55	79	23	SNP	0.875	A
HMGN4	10473	genome.wustl.edu	37	6	26545353	26545353	+	Splice_Site	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:26545353A>T	ENST00000377575.2	+	2	97		c.e2-1			NM_006353.2	NP_006344.1	O00479	HMGN4_HUMAN	high mobility group nucleosomal binding domain 4							chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)			lung(2)|skin(1)	3						gtcttgttaaagacatctttC	0.413																																																	0																																										SO:0001630	splice_region_variant	0			U90549	CCDS4615.1	6p21.3	2011-07-01	2002-07-25	2002-07-26	ENSG00000182952	ENSG00000182952		"""High-mobility group / Canonical"""	4989	protein-coding gene	gene with protein product			"""high-mobility group (nonhistone chromosomal) protein 17-like 3"""	HMG17L3		9149941, 11410162	Standard	NM_006353		Approved	NHC	uc003nig.3	O00479	OTTHUMG00000014458	ENST00000377575.2:c.-80-1A>T	6.37:g.26545353A>T			B2R4I6|Q53XL9	Splice_Site	SNP	-	e1-2	ENST00000377575.2	37	c.1-2	CCDS4615.1	6																																																																																			HMGN4	-	-	ENSG00000182952		0.413	HMGN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN4	HGNC	protein_coding	OTTHUMT00000040123.2	-	0.00	10	0	A		Intron	26545353	+1	tier1	-	no_errors	ENST00000377575	ensembl	human	known	74_37	splice_site	55.56	8	10	SNP	0.008	T
HIST1H3H	8357	genome.wustl.edu	37	6	27777905	27777905	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:27777905C>T	ENST00000369163.2	+	1	64	c.54C>T	c.(52-54)cgC>cgT	p.R18R	HIST1H2BL_ENST00000377401.2_5'Flank	NM_003536.2	NP_003527.1	P68431	H31_HUMAN	histone cluster 1, H3h	18					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|ovary(2)|upper_aerodigestive_tract(3)	10						AGGCTCCGCGCAAGCAGCTGG	0.632																																																	0													36.0	43.0	40.0					6																	27777905		2202	4299	6501	SO:0001819	synonymous_variant	0			Z83735	CCDS4627.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000203813	ENSG00000278828		"""Histones / Replication-dependent"""	4775	protein-coding gene	gene with protein product		602818	"""H3 histone family, member K"", ""histone 1, H3h"""	H3FK		9439656, 12408966	Standard	NM_003536		Approved	H3/k, H3F1K	uc003njm.3	P68431	OTTHUMG00000014483	ENST00000369163.2:c.54C>T	6.37:g.27777905C>T			A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R18	ENST00000369163.2	37	c.54	CCDS4627.1	6																																																																																			HIST1H3H	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000203813		0.632	HIST1H3H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3H	HGNC	protein_coding	OTTHUMT00000040151.1	-	0.00	54	0	C	NM_003536		27777905	+1	tier1	-	no_errors	ENST00000369163	ensembl	human	known	74_37	silent	42.75	75	56	SNP	1.000	T
HNF1A	6927	genome.wustl.edu	37	12	121437209	121437209	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:121437209C>T	ENST00000541395.1	+	8	1663	c.1640C>T	c.(1639-1641)gCt>gTt	p.A547V	RP11-216P16.2_ENST00000606238.1_RNA|HNF1A_ENST00000544413.1_Intron|HNF1A_ENST00000257555.6_Intron	NM_000545.5	NP_000536.5	P20823	HNF1A_HUMAN	HNF1 homeobox A	542					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCCAGGCCTGCTGGCCCTCCC	0.672									Hepatic Adenoma, Familial Clustering of																																								0													70.0	71.0	70.0					12																	121437209		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000541395.1:c.1640C>T	12.37:g.121437209C>T	ENSP00000443112:p.Ala547Val		A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.A547V	ENST00000541395.1	37	c.1640		12	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514766	0.27123	.	.	ENSG00000135100	ENST00000541395	D	0.98996	-5.31	5.4	1.13	0.20643	.	.	.	.	.	D	0.96327	0.8802	.	.	.	0.09310	N	1	.	.	.	.	.	.	D	0.92716	0.6187	5	.	.	.	.	2.643	0.04976	0.1461:0.5447:0.1414:0.1678	.	.	.	.	V	547	ENSP00000443112:A547V	.	A	+	2	0	HNF1A	119921592	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.250000	0.08830	0.208000	0.20626	-0.355000	0.07637	GCT	HNF1A	-	NULL	ENSG00000135100		0.672	HNF1A-023	NOVEL	basic	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000402512.1	-	0.00	39	0	C	NM_000545		121437209	+1	tier1	-	no_errors	ENST00000541395	ensembl	human	novel	74_37	missense	69.35	19	43	SNP	0.000	T
HSPG2	3339	genome.wustl.edu	37	1	22186426	22186426	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:22186426G>A	ENST00000374695.3	-	41	5163	c.5084C>T	c.(5083-5085)tCc>tTc	p.S1695F		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1695	Ig-like C2-type 2.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACACCGCAGGGAGTGGGAGCC	0.657																																																	0													21.0	24.0	23.0					1																	22186426		2203	4300	6503	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.5084C>T	1.37:g.22186426G>A	ENSP00000363827:p.Ser1695Phe		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.S1695F	ENST00000374695.3	37	c.5084	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475368	0.84640	.	.	ENSG00000142798	ENST00000374695	T	0.12984	2.63	4.91	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.36200	N	0.002721	T	0.36908	0.0984	M	0.77406	2.37	0.58432	D	0.99999	D	0.76494	0.999	D	0.74348	0.983	T	0.05338	-1.0891	10	0.28530	T	0.3	.	15.6386	0.76977	0.0:0.0:1.0:0.0	.	1695	P98160	PGBM_HUMAN	F	1695	ENSP00000363827:S1695F	ENSP00000363827:S1695F	S	-	2	0	HSPG2	22059013	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.171000	0.77595	2.541000	0.85698	0.591000	0.81541	TCC	HSPG2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000142798		0.657	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	-	0.00	23	0	G	NM_005529		22186426	-1	tier1	-	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	26.67	44	16	SNP	1.000	A
HOOK1	51361	genome.wustl.edu	37	1	60325953	60325953	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:60325953G>T	ENST00000371208.3	+	15	1742	c.1485G>T	c.(1483-1485)caG>caT	p.Q495H	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.Q453H	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	495	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TTCAGGAGCAGCTAGAACAGA	0.408																																																	0													135.0	142.0	140.0					1																	60325953		2203	4300	6503	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1485G>T	1.37:g.60325953G>T	ENSP00000360252:p.Gln495His		A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_Hook-related_fam,superfamily_Prefoldin	p.Q495H	ENST00000371208.3	37	c.1485	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	6.968	0.548625	0.13312	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.18016	2.24;2.24	5.05	4.12	0.48240	.	0.055730	0.85682	D	0.000000	T	0.14570	0.0352	L	0.39633	1.23	0.53688	D	0.999976	B	0.19583	0.037	B	0.21360	0.034	T	0.04737	-1.0930	10	0.37606	T	0.19	.	10.5601	0.45140	0.1503:0.0:0.8497:0.0	.	495	Q9UJC3	HOOK1_HUMAN	H	495;453	ENSP00000360252:Q495H;ENSP00000378928:Q453H	ENSP00000360252:Q495H	Q	+	3	2	HOOK1	60098541	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	1.964000	0.40462	1.465000	0.48006	0.655000	0.94253	CAG	HOOK1	-	pfam_Hook-related_fam	ENSG00000134709		0.408	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	-	0.00	49	0	G	NM_015888		60325953	+1	tier1	-	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
HTT	3064	genome.wustl.edu	37	4	3076604	3076606	+	In_Frame_Del	DEL	CAG	CAG	-	rs71180116|rs374076986	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	CAG	CAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:3076604_3076606delCAG	ENST00000355072.5	+	1	197_199	c.52_54delCAG	c.(52-54)cagdel	p.Q38del	HTT-AS_ENST00000503893.1_RNA	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	38	Poly-Gln.				anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CAAGTCCTTCcagcagcagcagc	0.704																																																	0																																										SO:0001651	inframe_deletion	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.52_54delCAG	4.37:g.3076613_3076615delCAG	ENSP00000347184:p.Gln38del		Q9UQB7	In_Frame_Del	DEL	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.Q21in_frame_del	ENST00000355072.5	37	c.52_54	CCDS43206.1	4																																																																																			HTT	-	NULL	ENSG00000197386		0.704	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2		0.00	10	0	CAG	NM_002111		3076606	+1			no_errors	ENST00000355072	ensembl	human	known	74_37	in_frame_del	25.00	15	5	DEL	0.993:0.989:0.986	0
IDE	3416	genome.wustl.edu	37	10	94234656	94234656	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:94234656G>T	ENST00000265986.6	-	17	2114	c.2058C>A	c.(2056-2058)ctC>ctA	p.L686L	IDE_ENST00000371581.5_Silent_p.L131L|IDE_ENST00000496903.1_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	686					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	TCAGCAAGCGGAGGTAGTACA	0.398																																																	0													90.0	87.0	88.0					10																	94234656		2203	4300	6503	SO:0001819	synonymous_variant	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2058C>A	10.37:g.94234656G>T			B2R721|B7ZAU2|D3DR35|Q5T5N2	Silent	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.L686	ENST00000265986.6	37	c.2058	CCDS7421.1	10																																																																																			IDE	-	superfamily_Metalloenz_LuxS/M16	ENSG00000119912		0.398	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	-	0.00	49	0	G	NM_004969		94234656	-1	tier1	-	no_errors	ENST00000265986	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
IKZF1	10320	genome.wustl.edu	37	7	50435935	50435935	+	Intron	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:50435935A>T	ENST00000331340.3	+	4	315				IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000440768.2_Intron|IKZF1_ENST00000439701.1_Intron|IKZF1_ENST00000359197.5_Intron|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000343574.5_Intron|IKZF1_ENST00000438033.1_Intron|IKZF1_ENST00000413698.1_Missense_Mutation_p.N131I|IKZF1_ENST00000492782.1_Intron|IKZF1_ENST00000349824.4_Intron	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)						B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				AAAGTGCAAAACGAAGGTCTA	0.433			"""D,T"""	BCL6	"""ALL, DLBCL"""																																			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)																																								SO:0001627	intron_variant	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.161-8296A>T	7.37:g.50435935A>T			A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	NULL	p.N131I	ENST00000331340.3	37	c.392		7	.	.	.	.	.	.	.	.	.	.	A	7.486	0.649713	0.14516	.	.	ENSG00000185811	ENST00000413698	.	.	.	4.0	-2.61	0.06171	.	.	.	.	.	T	0.25121	0.0610	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.13407	0.009	T	0.31806	-0.9930	7	0.87932	D	0	.	0.829	0.01126	0.3587:0.1481:0.3153:0.1779	.	131	C9JTB0	.	I	131	.	ENSP00000388478:N131I	N	+	2	0	IKZF1	50403429	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.171000	0.16685	-0.494000	0.06669	0.533000	0.62120	AAC	IKZF1	-	NULL	ENSG00000185811		0.433	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	-	0.00	129	0	A	NM_006060		50435935	+1	tier1	-	no_errors	ENST00000413698	ensembl	human	putative	74_37	missense	58.14	54	75	SNP	0.000	T
IKZF1	10320	genome.wustl.edu	37	7	50468024	50468024	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:50468024C>T	ENST00000331340.3	+	8	1414	c.1259C>T	c.(1258-1260)cCg>cTg	p.P420L	IKZF1_ENST00000346667.4_Missense_Mutation_p.P190L|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000439701.1_Missense_Mutation_p.P378L|IKZF1_ENST00000359197.5_Missense_Mutation_p.P378L|IKZF1_ENST00000357364.4_Missense_Mutation_p.P333L|IKZF1_ENST00000343574.5_Missense_Mutation_p.P333L|IKZF1_ENST00000438033.1_Missense_Mutation_p.P333L|IKZF1_ENST00000349824.4_Missense_Mutation_p.P277L	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	420				PHARNGL -> RRAQRV (in Ref. 2; AAB50683). {ECO:0000305}.	B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				CACATCGCCCCGCACGCGCGC	0.682			"""D,T"""	BCL6	"""ALL, DLBCL"""																																			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	28	Unknown(28)	haematopoietic_and_lymphoid_tissue(28)											30.0	37.0	35.0					7																	50468024		2168	4257	6425	SO:0001583	missense	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1259C>T	7.37:g.50468024C>T	ENSP00000331614:p.Pro420Leu		A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P420L	ENST00000331340.3	37	c.1259		7	.	.	.	.	.	.	.	.	.	.	C	13.69	2.312955	0.40895	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	T;T;T;T;T;T;T;T	0.06218	4.68;3.33;3.39;4.4;3.47;3.41;3.33;3.39	5.74	4.83	0.62350	.	0.157303	0.64402	D	0.000019	T	0.06371	0.0164	.	.	.	0.80722	D	1	P;P;B;P;B	0.40066	0.701;0.685;0.434;0.633;0.348	B;B;B;B;B	0.39465	0.3;0.131;0.207;0.207;0.102	T	0.47959	-0.9076	9	0.24483	T	0.36	-19.7179	13.0775	0.59095	0.1269:0.7509:0.1222:0.0	.	333;190;333;378;420	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	L	190;333;378;277;333;420;333;378	ENSP00000340080:P190L;ENSP00000342750:P333L;ENSP00000352123:P378L;ENSP00000342485:P277L;ENSP00000349928:P333L;ENSP00000331614:P420L;ENSP00000396554:P333L;ENSP00000413025:P378L	ENSP00000331614:P420L	P	+	2	0	IKZF1	50435518	0.008000	0.16893	0.036000	0.18154	0.439000	0.31926	2.423000	0.44705	2.706000	0.92434	0.650000	0.86243	CCG	IKZF1	-	NULL	ENSG00000185811		0.682	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	-	0.00	26	0	C	NM_006060		50468024	+1	tier1	-	no_errors	ENST00000331340	ensembl	human	known	74_37	missense	59.38	13	19	SNP	0.235	T
IRF2BPL	64207	genome.wustl.edu	37	14	77493050	77493050	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:77493050G>T	ENST00000238647.3	-	1	1984	c.1086C>A	c.(1084-1086)cgC>cgA	p.R362R		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	362					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						CGGCGCGGTTGCGCAGGCTCT	0.672																																																	0													32.0	29.0	30.0					14																	77493050		2200	4298	6498	SO:0001819	synonymous_variant	0			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.1086C>A	14.37:g.77493050G>T			Q8NDQ2|Q96JG2|Q9H3I7	Silent	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.R362	ENST00000238647.3	37	c.1086	CCDS9854.1	14																																																																																			IRF2BPL	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000119669		0.672	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BPL	HGNC	protein_coding	OTTHUMT00000414298.1		0.00	10	0	G	NM_024496		77493050	-1			no_errors	ENST00000238647	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.996	T
ITGA10	8515	genome.wustl.edu	37	1	145525093	145525095	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:145525093_145525095delTTC	ENST00000369304.3	+	1	203_205	c.28_30delTTC	c.(28-30)ttcdel	p.F10del	ITGA10_ENST00000538811.1_5'UTR|ITGA10_ENST00000539363.1_In_Frame_Del_p.F10del	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	10					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CACTCACCTGTTCTTGCCCCTGG	0.468											OREG0013749	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001651	inframe_deletion	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.28_30delTTC	1.37:g.145525093_145525095delTTC	ENSP00000358310:p.Phe10del	1695	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	In_Frame_Del	DEL	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.F10in_frame_del	ENST00000369304.3	37	c.28_30	CCDS918.1	1																																																																																			ITGA10	-	NULL	ENSG00000143127		0.468	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2		0.00	125	0	TTC	NM_003637		145525095	+1	tier1		no_errors	ENST00000369304	ensembl	human	known	74_37	in_frame_del	38.93	80	51	DEL	0.724:0.719:0.746	-
ITGA10	8515	genome.wustl.edu	37	1	145525099	145525099	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:145525099delC	ENST00000369304.3	+	1	209	c.34delC	c.(34-36)cccfs	p.P12fs	ITGA10_ENST00000538811.1_5'UTR|ITGA10_ENST00000539363.1_Frame_Shift_Del_p.P12fs	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	12					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCTGTTCTTGCCCCTGGTGTT	0.463											OREG0013749	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													237.0	197.0	210.0					1																	145525099		2203	4300	6503	SO:0001589	frameshift_variant	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.34delC	1.37:g.145525099delC	ENSP00000358310:p.Pro12fs	1695	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Frame_Shift_Del	DEL	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.L13fs	ENST00000369304.3	37	c.34	CCDS918.1	1																																																																																			ITGA10	-	NULL	ENSG00000143127		0.463	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2		0.00	112	0	C	NM_003637		145525099	+1	tier1		no_errors	ENST00000369304	ensembl	human	known	74_37	frame_shift_del	36.88	89	52	DEL	0.998	-
ITGAE	3682	genome.wustl.edu	37	17	3664793	3664793	+	Missense_Mutation	SNP	G	G	A	rs373069448		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:3664793G>A	ENST00000263087.4	-	5	435	c.337C>T	c.(337-339)Cgg>Tgg	p.R113W		NM_002208.4	NP_002199.3	P38570	ITAE_HUMAN	integrin, alpha E (antigen CD103, human mucosal lymphocyte antigen 1; alpha polypeptide)	113					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	external side of plasma membrane (GO:0009897)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		TGAGGCCGCCGGACCAGCACT	0.602																																					NSCLC(182;635 2928 8995 38788)												0								G	TRP/ARG	0,4406		0,0,2203	54.0	53.0	53.0		337	2.7	0.0	17		53	1,8599	1.2+/-3.3	0,1,4299	no	missense	ITGAE	NM_002208.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	113/1180	3664793	1,13005	2203	4300	6503	SO:0001583	missense	0			L25851	CCDS32531.1	17p13	2010-03-23				ENSG00000083457		"""CD molecules"", ""Integrins"""	6147	protein-coding gene	gene with protein product		604682				8119947	Standard	NM_002208		Approved	CD103, HUMINAE	uc002fwo.4	P38570		ENST00000263087.4:c.337C>T	17.37:g.3664793G>A	ENSP00000263087:p.Arg113Trp		Q17RS6|Q9NZU9	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_VWF_A,smart_Int_alpha_beta-p,prints_Integrin_alpha,pfscan_VWF_A	p.R113W	ENST00000263087.4	37	c.337	CCDS32531.1	17	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134597	0.56828	0.0	1.16E-4	ENSG00000083457	ENST00000263087	D	0.94376	-3.41	3.69	2.68	0.31781	.	.	.	.	.	D	0.93324	0.7872	L	0.43923	1.385	0.09310	N	1	D	0.89917	1.0	P	0.60609	0.877	D	0.85301	0.1073	9	0.72032	D	0.01	.	8.1454	0.31108	0.0:0.0:0.7303:0.2697	.	113	P38570	ITAE_HUMAN	W	113	ENSP00000263087:R113W	ENSP00000263087:R113W	R	-	1	2	ITGAE	3611542	0.001000	0.12720	0.017000	0.16124	0.135000	0.20990	0.657000	0.24963	1.061000	0.40601	0.407000	0.27541	CGG	ITGAE	-	NULL	ENSG00000083457		0.602	ITGAE-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ITGAE	HGNC	protein_coding	OTTHUMT00000438169.1	-	0.00	26	0	G	NM_002208		3664793	-1	tier1	-	no_errors	ENST00000263087	ensembl	human	known	74_37	missense	78.26	5	18	SNP	0.016	A
ITIH5	80760	genome.wustl.edu	37	10	7621717	7621717	+	Splice_Site	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:7621717C>A	ENST00000256861.6	-	9	1497		c.e9+1		ITIH5_ENST00000446830.2_Splice_Site|ITIH5_ENST00000397145.2_Splice_Site|ITIH5_ENST00000434980.1_Splice_Site|ITIH5_ENST00000298441.6_Splice_Site|ITIH5_ENST00000397146.2_Splice_Site	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5						hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						AGACCACAGACCCGATGAGCT	0.617																																																	0													72.0	71.0	71.0					10																	7621717		2203	4300	6503	SO:0001630	splice_region_variant	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1418+1G>T	10.37:g.7621717C>A			Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Splice_Site	SNP	-	e9+1	ENST00000256861.6	37	c.1418+1		10	.	.	.	.	.	.	.	.	.	.	C	19.13	3.768670	0.69878	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.709	0.91649	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITIH5	7661723	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	7.233000	0.78125	2.422000	0.82143	0.462000	0.41574	.	ITIH5	-	-	ENSG00000123243		0.617	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	-	0.00	39	0	C	NM_030569	Intron	7621717	-1	tier1	-	no_errors	ENST00000256861	ensembl	human	known	74_37	splice_site	12.39	99	14	SNP	1.000	A
ITPKB	3707	genome.wustl.edu	37	1	226834869	226834869	+	Splice_Site	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:226834869T>A	ENST00000272117.3	-	3	2244	c.2245A>T	c.(2245-2247)Agg>Tgg	p.R749W	ITPKB_ENST00000429204.1_Splice_Site_p.R749W			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	749					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CTGGCTCACCTGATTCCCATC	0.627																																					Colon(84;110 1851 5306 33547)												0													132.0	95.0	108.0					1																	226834869		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2246+1A>T	1.37:g.226834869T>A			Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Missense_Mutation	SNP	pfam_IPK	p.R749W	ENST00000272117.3	37	c.2245	CCDS1555.1	1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.326810	0.81690	.	.	ENSG00000143772	ENST00000272117;ENST00000429204	T;T	0.25912	1.77;1.77	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.64918	0.2642	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77707	-0.2487	10	0.87932	D	0	-29.7842	15.4289	0.75077	0.0:0.0:0.0:1.0	.	749	P27987	IP3KB_HUMAN	W	749	ENSP00000272117:R749W;ENSP00000411152:R749W	ENSP00000272117:R749W	R	-	1	2	ITPKB	224901492	1.000000	0.71417	0.999000	0.59377	0.450000	0.32258	6.077000	0.71275	2.054000	0.61138	0.533000	0.62120	AGG	ITPKB	-	pfam_IPK	ENSG00000143772		0.627	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	-	0.00	43	0	T	NM_002221	Missense_Mutation	226834869	-1	tier1	-	no_errors	ENST00000272117	ensembl	human	known	74_37	missense	20.69	69	18	SNP	1.000	A
PLA2G4B	100137049	genome.wustl.edu	37	15	42133719	42133719	+	Missense_Mutation	SNP	G	G	A	rs372615666		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:42133719G>A	ENST00000452633.1	+	8	792	c.440G>A	c.(439-441)cGg>cAg	p.R147Q	PLA2G4B_ENST00000542534.2_Missense_Mutation_p.R378Q|JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.R378Q|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.R378Q|PLA2G4B_ENST00000458483.1_Missense_Mutation_p.R147Q			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)	147					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		ACTCAGGCCCGGGAGCTCTCC	0.612																																																	0								G	GLN/ARG,GLN/ARG,GLN/ARG	1,4405		0,1,2202	56.0	59.0	58.0		440,1133,1133	2.8	1.0	15		58	0,8600		0,0,4300	no	missense,missense,missense	JMJD7-PLA2G4B,PLA2G4B	NM_001114633.1,NM_001198588.1,NM_005090.3	43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	147/782,378/894,378/1013	42133719	1,13005	2203	4300	6503	SO:0001583	missense	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.440G>A	15.37:g.42133719G>A	ENSP00000396045:p.Arg147Gln		B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.R378Q	ENST00000452633.1	37	c.1133	CCDS45241.1	15	.	.	.	.	.	.	.	.	.	.	.	16.17	3.046705	0.55110	2.27E-4	0.0	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	T;T;T;T	0.01705	5.01;4.68;4.93;4.93	4.85	2.78	0.32641	.	0.138758	0.32548	N	0.005950	T	0.02571	0.0078	M	0.78049	2.395	0.29417	N	0.860799	B;B;B	0.31548	0.328;0.028;0.005	B;B;B	0.17433	0.018;0.005;0.002	T	0.14811	-1.0459	10	0.62326	D	0.03	-7.5237	6.5343	0.22344	0.1003:0.1817:0.718:0.0	.	147;378;378	P0C869;P0C869-7;P0C869-6	PA24B_HUMAN;.;.	Q	378;378;147;147	ENSP00000371886:R378Q;ENSP00000342785:R378Q;ENSP00000416610:R147Q;ENSP00000396045:R147Q	ENSP00000342785:R378Q	R	+	2	0	JMJD7-PLA2G4B;PLA2G4B	39921011	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	2.442000	0.44873	1.155000	0.42497	0.591000	0.81541	CGG	JMJD7-PLA2G4B	-	NULL	ENSG00000168970		0.612	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	-	0.00	42	0	G	NM_001114633		42133719	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	A
KANK4	163782	genome.wustl.edu	37	1	62740569	62740569	+	Silent	SNP	C	C	A	rs139247138		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:62740569C>A	ENST00000371153.4	-	3	585	c.207G>T	c.(205-207)ctG>ctT	p.L69L	KANK4_ENST00000371150.1_5'Flank|KANK4_ENST00000354381.3_Intron	NM_181712.4	NP_859063.3	Q5T7N3	KANK4_HUMAN	KN motif and ankyrin repeat domains 4	69						cytoplasm (GO:0005737)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(49)|ovary(3)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	81						AGTTTCGGGGCAGAGTGCTAA	0.557																																																	0													133.0	140.0	138.0					1																	62740569		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096259	CCDS620.1	1p31.3	2013-10-11	2008-01-29	2008-01-29	ENSG00000132854	ENSG00000132854		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	27263	protein-coding gene	gene with protein product		614612	"""ankyrin repeat domain 38"""	ANKRD38		17996375, 19554261	Standard	NM_181712		Approved	KIAA0172	uc001dah.4	Q5T7N3	OTTHUMG00000008971	ENST00000371153.4:c.207G>T	1.37:g.62740569C>A			B1ALP7|Q6P9A0|Q86T71|Q86VE6|Q8NAX3	Silent	SNP	pfam_KN_motif,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L69	ENST00000371153.4	37	c.207	CCDS620.1	1																																																																																			KANK4	-	NULL	ENSG00000132854		0.557	KANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK4	HGNC	protein_coding	OTTHUMT00000024877.1	-	0.00	31	0	C	NM_181712		62740569	-1	tier1	-	no_errors	ENST00000371153	ensembl	human	known	74_37	silent	40.68	35	24	SNP	1.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21319073	21319073	+	Missense_Mutation	SNP	C	C	T	rs536297311		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:21319073C>T	ENST00000583088.1	+	3	1314	c.419C>T	c.(418-420)aCg>aTg	p.T140M	KCNJ12_ENST00000331718.5_Missense_Mutation_p.T140M	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	140					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	TCCATCGAGACGCAGACCACC	0.667										Prostate(3;0.18)			.|||	1	0.000199681	0.0	0.0	5008	,	,		35355	0.001		0.0	False		,,,				2504	0.0																0													45.0	43.0	44.0					17																	21319073		2203	4300	6503	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.419C>T	17.37:g.21319073C>T	ENSP00000463778:p.Thr140Met		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.T140M	ENST00000583088.1	37	c.419	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	C	23.0	4.363062	0.82353	.	.	ENSG00000184185	ENST00000331718	D	0.98345	-4.88	5.23	5.23	0.72850	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.99405	0.9790	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98378	1.0557	10	0.87932	D	0	.	18.7906	0.91973	0.0:1.0:0.0:0.0	.	140	Q14500	IRK12_HUMAN	M	140	ENSP00000328150:T140M	ENSP00000328150:T140M	T	+	2	0	KCNJ12	21259666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.680000	0.84062	2.448000	0.82819	0.591000	0.81541	ACG	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	ENSG00000184185		0.667	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	79	0	C	NM_021012		21319073	+1	tier1	-	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	10.23	79	9	SNP	1.000	T
KCNJ9	3765	genome.wustl.edu	37	1	160054576	160054576	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:160054576C>T	ENST00000368088.3	+	2	998	c.756C>T	c.(754-756)gaC>gaT	p.D252D		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	252					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACGAGATCGACGCCGCCAGCC	0.657																																																	0													6.0	5.0	5.0					1																	160054576		2128	4156	6284	SO:0001819	synonymous_variant	0			U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.756C>T	1.37:g.160054576C>T			Q5JW75	Silent	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.3	p.D252	ENST00000368088.3	37	c.756	CCDS1194.1	1																																																																																			KCNJ9	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	ENSG00000162728		0.657	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ9	HGNC	protein_coding	OTTHUMT00000060628.1	-	0.00	14	0	C	NM_004983		160054576	+1	tier1	-	no_errors	ENST00000368088	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.974	T
KCNN2	3781	genome.wustl.edu	37	5	113740276	113740276	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:113740276G>T	ENST00000512097.3	+	4	1742	c.724G>T	c.(724-726)Gcc>Tcc	p.A242S	KCNN2_ENST00000507750.1_Intron|KCNN2_ENST00000264773.3_Missense_Mutation_p.A242S			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	242					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	GGCCCGGCTTGCCTTCTCCTA	0.428																																																	0													186.0	184.0	185.0					5																	113740276		2202	4300	6502	SO:0001583	missense	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.724G>T	5.37:g.113740276G>T	ENSP00000427120:p.Ala242Ser		A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.A242S	ENST00000512097.3	37	c.724	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	G	19.67	3.871174	0.72065	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	D;D	0.98531	-4.98;-4.98	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.98695	0.9562	M	0.80028	2.48	0.80722	D	1	D	0.55172	0.97	P	0.57960	0.83	D	0.99437	1.0937	10	0.56958	D	0.05	-0.4208	18.8127	0.92064	0.0:0.0:1.0:0.0	.	242	Q9H2S1	KCNN2_HUMAN	S	242	ENSP00000427120:A242S;ENSP00000264773:A242S	ENSP00000264773:A242S	A	+	1	0	KCNN2	113768175	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.667000	0.98616	2.536000	0.85505	0.561000	0.74099	GCC	KCNN2	-	NULL	ENSG00000080709		0.428	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	-	0.00	50	0	G	NM_021614		113740276	+1	tier1	-	no_errors	ENST00000264773	ensembl	human	known	74_37	missense	32.35	46	22	SNP	1.000	T
KCTD2	23510	genome.wustl.edu	37	17	73045404	73045404	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:73045404T>C	ENST00000322444.6	+	2	435	c.429T>C	c.(427-429)acT>acC	p.T143T	ATP5H_ENST00000301587.4_5'Flank|KCTD2_ENST00000584767.1_3'UTR|KCTD2_ENST00000581589.1_5'UTR|ATP5H_ENST00000344546.4_5'Flank	NM_015353.1	NP_056168.1	Q14681	KCTD2_HUMAN	potassium channel tetramerization domain containing 2	143	BTB.				protein homooligomerization (GO:0051260)		protein complex binding (GO:0032403)			kidney(1)|lung(2)	3	all_lung(278;0.226)					TCATCATCACTAAGGAGTTGG	0.438																																																	0													96.0	76.0	83.0					17																	73045404		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033329	CCDS32728.1	17q25.2	2013-06-20	2013-06-20			ENSG00000180901			21294	protein-coding gene	gene with protein product		613422	"""potassium channel tetramerisation domain containing 2"""			12620391	Standard	XR_248405		Approved	KIAA0176	uc002jmp.3	Q14681		ENST00000322444.6:c.429T>C	17.37:g.73045404T>C				Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.T143	ENST00000322444.6	37	c.429	CCDS32728.1	17																																																																																			KCTD2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000180901		0.438	KCTD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD2	HGNC	protein_coding	OTTHUMT00000445538.1	-	0.00	54	0	T			73045404	+1	tier1	-	no_errors	ENST00000322444	ensembl	human	known	74_37	silent	19.39	79	19	SNP	0.604	C
KIAA0195	9772	genome.wustl.edu	37	17	73482014	73482014	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:73482014G>A	ENST00000314256.7	+	4	601	c.207G>A	c.(205-207)ggG>ggA	p.G69G	KIAA0195_ENST00000579208.1_Intron|KIAA0195_ENST00000375248.5_Silent_p.G79G	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	69						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			ACTGGCCGGGGGCCTCACTCA	0.667																																																	0													25.0	24.0	24.0					17																	73482014		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.207G>A	17.37:g.73482014G>A			O75536|Q86XF1	Silent	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.G69	ENST00000314256.7	37	c.207	CCDS32732.1	17																																																																																			KIAA0195	-	NULL	ENSG00000177728		0.667	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	-	0.00	58	0	G	NM_014738		73482014	+1	tier1	-	no_errors	ENST00000314256	ensembl	human	known	74_37	silent	40.74	48	33	SNP	0.817	A
KIF4A	24137	genome.wustl.edu	37	X	69521774	69521774	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:69521774G>C	ENST00000374403.3	+	6	623	c.541G>C	c.(541-543)Gtt>Ctt	p.V181L	KIF4A_ENST00000374388.3_Missense_Mutation_p.V181L	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	181	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TGAGAAGACTGTTTTGGTTGC	0.443																																																	0													152.0	128.0	136.0					X																	69521774		2203	4299	6502	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.541G>C	X.37:g.69521774G>C	ENSP00000363524:p.Val181Leu		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V181L	ENST00000374403.3	37	c.541	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249081	0.59103	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.77620	-1.11;-1.11	5.1	5.1	0.69264	Kinesin, motor domain (4);	0.137318	0.32687	N	0.005761	D	0.84933	0.5582	M	0.89353	3.025	0.80722	D	1	B;P	0.40970	0.058;0.734	B;P	0.45428	0.151;0.48	D	0.88104	0.2821	10	0.72032	D	0.01	.	16.5735	0.84631	0.0:0.0:1.0:0.0	.	181;181	O95239;O95239-2	KIF4A_HUMAN;.	L	181	ENSP00000363509:V181L;ENSP00000363524:V181L	ENSP00000363509:V181L	V	+	1	0	KIF4A	69438499	1.000000	0.71417	0.956000	0.39512	0.661000	0.39034	9.316000	0.96319	2.115000	0.64714	0.538000	0.68166	GTT	KIF4A	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000090889		0.443	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	-	0.00	28	0	G	NM_012310		69521774	+1	tier1	-	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	C
KMT2B	9757	genome.wustl.edu	37	19	36211320	36211320	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:36211320delG	ENST00000222270.7	+	3	1071	c.1071delG	c.(1069-1071)cagfs	p.Q357fs	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_Frame_Shift_Del_p.Q357fs|KMT2B_ENST00000420124.1_Frame_Shift_Del_p.Q357fs	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	357					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GGAAAAAGCAGGAACAGAAGC	0.478																																																	0													20.0	22.0	21.0					19																	36211320		1955	4141	6096	SO:0001589	frameshift_variant	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.1071delG	19.37:g.36211320delG	ENSP00000222270:p.Gln357fs		O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Frame_Shift_Del	DEL	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E358fs	ENST00000222270.7	37	c.1071	CCDS46055.1	19																																																																																			KMT2B	-	pirsf_MeTrfase_trithorax	ENSG00000272333		0.478	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2B	Uniprot_gn	protein_coding			0.00	41	0	G	NM_014727		36211320	+1	tier1		no_errors	ENST00000222270	ensembl	human	known	74_37	frame_shift_del	29.69	45	19	DEL	0.997	-
KRT6A	3853	genome.wustl.edu	37	12	52886494	52886494	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:52886494C>T	ENST00000330722.6	-	1	547	c.479G>A	c.(478-480)cGg>cAg	p.R160Q		NM_005554.3	NP_005545.1	P02538	K2C6A_HUMAN	keratin 6A	160	Head.				cell differentiation (GO:0030154)|positive regulation of cell proliferation (GO:0008284)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)	p.R160Q(1)		breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|liver(1)|lung(14)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	39				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCCTCAGCCCGCACCCGCTG	0.587																																																	1	Substitution - Missense(1)	large_intestine(1)											167.0	155.0	159.0					12																	52886494		2203	4300	6503	SO:0001583	missense	0			BC014152, L42593, L42610	CCDS41786.1	12q13.13	2013-01-16			ENSG00000205420	ENSG00000205420		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6443	protein-coding gene	gene with protein product		148041	"""keratin 6C"", ""keratin 6D"""	KRT6C, KRT6D		1713141, 16831889	Standard	NM_005554		Approved	CK6C, K6C, CK6D, K6D	uc001sam.3	P02538	OTTHUMG00000169597	ENST00000330722.6:c.479G>A	12.37:g.52886494C>T	ENSP00000369317:p.Arg160Gln		A4QPC1|P48667|Q08AR4|Q6NT67|Q96CL4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.R160Q	ENST00000330722.6	37	c.479	CCDS41786.1	12	.	.	.	.	.	.	.	.	.	.	C	22.8	4.331881	0.81801	.	.	ENSG00000205420	ENST00000330722;ENST00000452121	D	0.85556	-2.0	5.31	2.44	0.29823	.	0.089287	0.44902	D	0.000418	D	0.89891	0.6846	M	0.94063	3.49	0.36885	D	0.889576	D	0.65815	0.995	P	0.48552	0.581	D	0.92540	0.6041	10	0.87932	D	0	.	11.5528	0.50731	0.0:0.7919:0.0:0.2081	.	160	P02538	K2C6A_HUMAN	Q	160;116	ENSP00000369317:R160Q	ENSP00000369317:R160Q	R	-	2	0	KRT6A	51172761	1.000000	0.71417	0.954000	0.39281	0.850000	0.48378	1.951000	0.40333	0.735000	0.32537	0.650000	0.86243	CGG	KRT6A	-	NULL	ENSG00000205420		0.587	KRT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT6A	HGNC	protein_coding	OTTHUMT00000404978.2	-	0.00	103	0	C	NM_005554		52886494	-1	tier1	-	no_errors	ENST00000330722	ensembl	human	known	74_37	missense	50.00	83	83	SNP	1.000	T
KRT8	3856	genome.wustl.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000546897.1_Missense_Mutation_p.S31A|KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																																	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)											12.0	14.0	13.0					12																	53298675		2120	4158	6278	SO:0001583	missense	0			BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala		A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.S31A	ENST00000552551.1	37	c.91	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	KRT8	-	NULL	ENSG00000170421		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	HGNC	protein_coding	OTTHUMT00000406385.1		0.00	45	0	A	NM_002273		53298675	-1			no_errors	ENST00000293308	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.000	C
LAPTM5	7805	genome.wustl.edu	37	1	31211879	31211879	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:31211879G>T	ENST00000294507.3	-	5	492	c.418C>A	c.(418-420)Cag>Aag	p.Q140K	MIR4420_ENST00000583944.1_RNA|LAPTM5_ENST00000476492.1_5'Flank	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	140					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		TCCAGCAGCTGCAGCGTCATC	0.532																																																	0													59.0	52.0	54.0					1																	31211879		2202	4300	6502	SO:0001583	missense	0			U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.418C>A	1.37:g.31211879G>T	ENSP00000294507:p.Gln140Lys		Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	p.Q140K	ENST00000294507.3	37	c.418	CCDS337.1	1	.	.	.	.	.	.	.	.	.	.	G	9.898	1.205998	0.22205	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.44083	0.93	5.73	1.58	0.23477	.	0.075108	0.56097	N	0.000029	T	0.33381	0.0861	L	0.37561	1.115	0.33895	D	0.637863	B	0.17465	0.022	B	0.20955	0.032	T	0.38908	-0.9639	10	0.66056	D	0.02	-18.729	12.7419	0.57257	0.0:0.0:0.4238:0.5762	.	140	Q13571	LAPM5_HUMAN	K	140	ENSP00000294507:Q140K	ENSP00000294507:Q140K	Q	-	1	0	LAPTM5	30984466	1.000000	0.71417	0.997000	0.53966	0.111000	0.19643	1.549000	0.36212	0.037000	0.15575	-0.181000	0.13052	CAG	LAPTM5	-	pfam_LAPTM4/5,tigrfam_LAPTM_4A/5	ENSG00000162511		0.532	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAPTM5	HGNC	protein_coding	OTTHUMT00000010463.1	-	0.00	51	0	G	NM_006762		31211879	-1	tier1	-	no_errors	ENST00000294507	ensembl	human	known	74_37	missense	50.00	29	29	SNP	1.000	T
LDHB	3945	genome.wustl.edu	37	12	21788572	21788572	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:21788572G>A	ENST00000396076.1	-	8	1241	c.909C>T	c.(907-909)agC>agT	p.S303S	LDHB_ENST00000350669.1_Silent_p.S303S	NM_001174097.1	NP_001167568.1	P07195	LDHB_HUMAN	lactate dehydrogenase B	303					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|lactate metabolic process (GO:0006089)|NAD metabolic process (GO:0019674)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	L-lactate dehydrogenase activity (GO:0004459)|NAD binding (GO:0051287)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	26						GGTTGATAACGCTGGTTAATC	0.468																																																	0													142.0	120.0	127.0					12																	21788572		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS8691.1	12p12.2-p12.1	2012-10-02			ENSG00000111716	ENSG00000111716	1.1.1.27		6541	protein-coding gene	gene with protein product		150100					Standard	NM_002300		Approved		uc001rfe.3	P07195	OTTHUMG00000133760	ENST00000396076.1:c.909C>T	12.37:g.21788572G>A				Silent	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.S303	ENST00000396076.1	37	c.909	CCDS8691.1	12																																																																																			LDHB	-	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,tigrfam_L-lactate_DH	ENSG00000111716		0.468	LDHB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LDHB	HGNC	protein_coding	OTTHUMT00000258220.2	-	0.00	87	0	G	NM_002300		21788572	-1	tier1	-	no_errors	ENST00000350669	ensembl	human	known	74_37	silent	38.14	60	37	SNP	0.988	A
LINC00862	554279	genome.wustl.edu	37	1	200311674	200311674	+	lincRNA	DEL	C	C	-	rs374198468|rs2790110	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:200311674delC	ENST00000367355.1	-	0	1414					NR_040064.1		A6NCI5	SIM16_HUMAN	long intergenic non-protein coding RNA 862							integral component of membrane (GO:0016021)											aacaaacaaacaaaaaacaga	0.443																																																	0																																												0			BC040731		1q32.1	2014-04-09	2013-02-22	2013-02-22	ENSG00000203721	ENSG00000203721		"""Long non-coding RNAs"""	21901	other	unknown			"""chromosome 1 open reading frame 98"", ""small integral membrane protein 16"""	C1orf98, SMIM16			Standard	NR_040064		Approved		uc001gvd.1	A6NCI5	OTTHUMG00000035722		1.37:g.200311674delC				RNA	DEL	-	NULL	ENST00000367355.1	37	NULL		1																																																																																			LINC00862	-	-	ENSG00000203721		0.443	LINC00862-001	KNOWN	basic	lincRNA	LINC00862	HGNC	lincRNA	OTTHUMT00000086877.1		0.00	22	0	C	NR_040064		200311674	-1	tier1		no_errors	ENST00000367355	ensembl	human	known	74_37	rna	29.17	17	7	DEL	0.026	-
LOC100289333	100289333	genome.wustl.edu	37	19	12318361	12318361	+	lincRNA	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:12318361G>A	ENST00000426044.1	+	0	127																											GAATACTTCAGTAAATAAACC	0.363																																																	0																																												0																															19.37:g.12318361G>A				RNA	SNP	-	NULL	ENST00000426044.1	37	NULL		19																																																																																			CTD-2666L21.1	-	-	ENSG00000234773		0.363	CTD-2666L21.1-001	KNOWN	basic	lincRNA	LOC100289333	Clone_based_vega_gene	lincRNA	OTTHUMT00000344136.1	-	0.00	33	0	G			12318361	+1	tier1	-	no_errors	ENST00000415793	ensembl	human	known	74_37	rna	20.00	28	7	SNP	0.003	A
LOC101927542	101927542	genome.wustl.edu	37	1	83912311	83912311	+	lincRNA	SNP	A	A	C	rs368581628		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:83912311A>C	ENST00000446227.1	+	0	576																											CATTTAAACCATCAGACTGTG	0.393																																																	0																																												0																															1.37:g.83912311A>C				RNA	SNP	-	NULL	ENST00000446227.1	37	NULL		1																																																																																			RP11-413G15.1	-	-	ENSG00000231364		0.393	RP11-413G15.1-001	KNOWN	basic	lincRNA	LOC101927542	Clone_based_vega_gene	lincRNA	OTTHUMT00000026942.1		0.00	33	0	A			83912311	+1			no_errors	ENST00000446227	ensembl	human	known	74_37	rna	5.45	52	3	SNP	0.000	C
POTEG	404785	genome.wustl.edu	37	14	19563255	19563255	+	Intron	SNP	T	T	G	rs61971040	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:19563255T>G	ENST00000409832.3	+	5	969				CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						ATTTTACAAATATGAACACTT	0.348													G|||	3648	0.728435	0.6203	0.7363	5008	,	,		8659	0.7192		0.7992	False		,,,				2504	0.8057																0																																										SO:0001627	intron_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.918-149T>G	14.37:g.19563255T>G			A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			CTD-2311B13.5	-	-	ENSG00000258252		0.348	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	-	0.00	26	0	T	NM_001005356		19563255	-1	tier1	rs201460973	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	35.71	18	10	SNP	0.474	G
UGT2B11	10720	genome.wustl.edu	37	4	70080532	70080532	+	5'Flank	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:70080532C>T	ENST00000446444.1	-	0	0				RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11						estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						TATAACTCCTCCAATCCAAAG	0.343																																																	0																																										SO:0001631	upstream_gene_variant	0			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395		4.37:g.70080532C>T	Exception_encountered		Q3KNV9	RNA	SNP	-	NULL	ENST00000446444.1	37	NULL	CCDS3527.1	4																																																																																			RP11-704M14.1	-	-	ENSG00000250696		0.343	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101930401	Clone_based_vega_gene	protein_coding	OTTHUMT00000251551.2	-	0.00	47	0	C	NM_001073		70080532	+1	tier1	-	no_errors	ENST00000505646	ensembl	human	known	74_37	rna	45.83	13	11	SNP	0.000	T
UGT2B11	10720	genome.wustl.edu	37	4	70080559	70080559	+	5'Flank	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:70080559G>A	ENST00000446444.1	-	0	0				RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11						estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						TATTATAGGAGCATCCTGAGT	0.303																																																	0																																										SO:0001631	upstream_gene_variant	0			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395		4.37:g.70080559G>A	Exception_encountered		Q3KNV9	RNA	SNP	-	NULL	ENST00000446444.1	37	NULL	CCDS3527.1	4																																																																																			RP11-704M14.1	-	-	ENSG00000250696		0.303	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101930401	Clone_based_vega_gene	protein_coding	OTTHUMT00000251551.2	-	0.00	38	0	G	NM_001073		70080559	+1	tier1	-	no_errors	ENST00000505646	ensembl	human	known	74_37	rna	54.17	11	13	SNP	0.012	A
LOC146880	146880	genome.wustl.edu	37	17	62750203	62750203	+	RNA	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:62750203C>T	ENST00000400873.3	-	0	2154					NR_026899.1																						ATCAACGGTTCTATTATGCCA	0.403																																																	0																																												0																															17.37:g.62750203C>T				RNA	SNP	-	NULL	ENST00000400873.3	37	NULL		17																																																																																			hsa-mir-6080	-	-	ENSG00000215769		0.403	hsa-mir-6080.1-201	KNOWN	basic	processed_transcript	LOC146880	miRBase	processed_transcript		-	0.00	86	0	C			62750203	-1	tier1	-	no_errors	ENST00000400873	ensembl	human	known	74_37	rna	54.11	67	79	SNP	1.000	T
GOLGA2P9	440518	genome.wustl.edu	37	19	22786054	22786054	+	RNA	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:22786054A>G	ENST00000599738.1	+	0	0				CTC-457E21.3_ENST00000600260.1_RNA|RN7SL860P_ENST00000473738.2_RNA|AC011467.1_ENST00000408863.1_RNA																							AGCAGCGTGGAGCCTGCACAA	0.617																																																	0																																												0																															19.37:g.22786054A>G				RNA	SNP	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.617	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	LOC440518	Clone_based_vega_gene	processed_transcript	OTTHUMT00000464575.1	-	0.00	74	0	A			22786054	+1	tier1	-	no_errors	ENST00000600260	ensembl	human	known	74_37	rna	56.67	39	51	SNP	0.170	G
LRP1	4035	genome.wustl.edu	37	12	57577916	57577916	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:57577916G>A	ENST00000243077.3	+	37	6444	c.5978G>A	c.(5977-5979)cGg>cAg	p.R1993Q		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	1993					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAGGTCGCCCGGCTCAATGGC	0.602																																																	0													77.0	59.0	65.0					12																	57577916		2203	4300	6503	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.5978G>A	12.37:g.57577916G>A	ENSP00000243077:p.Arg1993Gln		Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R1993Q	ENST00000243077.3	37	c.5978	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.928617	0.97116	.	.	ENSG00000123384	ENST00000243077	D	0.88586	-2.4	4.84	4.84	0.62591	Six-bladed beta-propeller, TolB-like (1);	0.074719	0.47093	D	0.000250	D	0.93458	0.7913	M	0.66506	2.035	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	D	0.93308	0.6682	10	0.49607	T	0.09	.	16.9352	0.86201	0.0:0.0:1.0:0.0	.	1993	Q07954	LRP1_HUMAN	Q	1993	ENSP00000243077:R1993Q	ENSP00000243077:R1993Q	R	+	2	0	LRP1	55864183	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.657000	0.98554	2.532000	0.85374	0.555000	0.69702	CGG	LRP1	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000123384		0.602	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	-	0.00	22	0	G	NM_002332		57577916	+1	tier1	-	no_errors	ENST00000243077	ensembl	human	known	74_37	missense	28.57	15	6	SNP	1.000	A
LRP1B	53353	genome.wustl.edu	37	2	141643766	141643766	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:141643766A>C	ENST00000389484.3	-	24	4876	c.3905T>G	c.(3904-3906)cTt>cGt	p.L1302R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1302					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGTCCAATAAAGTAAACTTTG	0.323										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													74.0	76.0	75.0					2																	141643766		2202	4298	6500	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3905T>G	2.37:g.141643766A>C	ENSP00000374135:p.Leu1302Arg		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.L1302R	ENST00000389484.3	37	c.3905	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	A	26.7	4.758554	0.89843	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.97888	-3.38;-4.59	5.68	5.68	0.88126	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000005	D	0.99001	0.9659	M	0.93062	3.375	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.99616	1.0982	10	0.87932	D	0	.	15.9351	0.79698	1.0:0.0:0.0:0.0	.	485;1302	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	R	1302;1240;447	ENSP00000374135:L1302R;ENSP00000413239:L447R	ENSP00000374135:L1302R	L	-	2	0	LRP1B	141360236	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.124000	0.94394	2.159000	0.67721	0.528000	0.53228	CTT	LRP1B	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000168702		0.323	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	92	0	A	NM_018557		141643766	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	16.53	100	20	SNP	1.000	C
LRRIQ1	84125	genome.wustl.edu	37	12	85492714	85492714	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:85492714G>A	ENST00000393217.2	+	13	3212	c.3151G>A	c.(3151-3153)Gaa>Aaa	p.E1051K		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1051										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TTCAACTGTGGAAGCATTTTC	0.303																																																	0													93.0	95.0	94.0					12																	85492714		2202	4290	6492	SO:0001583	missense	0			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3151G>A	12.37:g.85492714G>A	ENSP00000376910:p.Glu1051Lys		Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E1051K	ENST00000393217.2	37	c.3151	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.235634	0.79800	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.25579	1.79	5.4	5.4	0.78164	.	0.634090	0.15424	N	0.263063	T	0.32763	0.0840	L	0.46670	1.46	0.29422	N	0.860483	D;D	0.59767	0.986;0.961	P;P	0.49637	0.541;0.617	T	0.19095	-1.0316	10	0.62326	D	0.03	.	12.9476	0.58382	0.0847:0.0:0.9153:0.0	.	1051;1026	Q96JM4;C9JI57	LRIQ1_HUMAN;.	K	1051;1026;1051	ENSP00000376910:E1051K	ENSP00000256007:E1051K	E	+	1	0	LRRIQ1	84016845	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.182000	0.42556	2.521000	0.84997	0.585000	0.79938	GAA	LRRIQ1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000133640		0.303	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	-	0.00	28	0	G	NM_032165		85492714	+1	tier1	-	no_errors	ENST00000393217	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	A
LUZP2	338645	genome.wustl.edu	37	11	25098874	25098874	+	Splice_Site	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:25098874G>C	ENST00000336930.6	+	11	924		c.e11-1		LUZP2_ENST00000533227.1_Splice_Site			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						TACTTTTGTAGGAGGGCAGAC	0.413																																																	0													123.0	124.0	124.0					11																	25098874		2203	4300	6503	SO:0001630	splice_region_variant	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.859-1G>C	11.37:g.25098874G>C			A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Splice_Site	SNP	-	e11-1	ENST00000336930.6	37	c.859-1	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	G	6.828	0.521899	0.13005	.	.	ENSG00000187398	ENST00000336930;ENST00000533227	.	.	.	5.17	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5683	0.33554	0.146:0.0:0.854:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LUZP2	25055450	1.000000	0.71417	0.329000	0.25429	0.031000	0.12232	2.910000	0.48766	0.909000	0.36697	0.551000	0.68910	.	LUZP2	-	-	ENSG00000187398		0.413	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	-	0.00	53	0	G	NM_001009909	Intron	25098874	+1	tier1	-	no_errors	ENST00000336930	ensembl	human	known	74_37	splice_site	20.90	53	14	SNP	0.770	C
MACF1	23499	genome.wustl.edu	37	1	39785373	39785373	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:39785373T>C	ENST00000372915.3	+	30	4085	c.3998T>C	c.(3997-3999)cTg>cCg	p.L1333P	MACF1_ENST00000545844.1_Missense_Mutation_p.L1333P|MACF1_ENST00000567887.1_Missense_Mutation_p.L1365P|MACF1_ENST00000564288.1_Missense_Mutation_p.L1328P|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000539005.1_Missense_Mutation_p.L1333P|MACF1_ENST00000317713.7_Missense_Mutation_p.L1333P|MACF1_ENST00000361689.2_Missense_Mutation_p.L1333P			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1333					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAGACAAAACTGGATCAATGT	0.368																																																	0													116.0	114.0	115.0					1																	39785373		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.3998T>C	1.37:g.39785373T>C	ENSP00000362006:p.Leu1333Pro		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L1333P	ENST00000372915.3	37	c.3998		1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.453513	0.84209	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262	T;T;T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03;1.03;1.03	5.78	5.78	0.91487	.	.	.	.	.	T	0.62270	0.2414	M	0.63428	1.95	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.71656	0.974;0.965;0.947	T	0.65327	-0.6195	9	0.87932	D	0	.	16.1135	0.81278	0.0:0.0:0.0:1.0	.	1333;1333;1298	F8W8Q1;Q9UPN3-2;Q9UPN3-3	.;.;.	P	1333;1333;1333;1333;1333;1291;1482	ENSP00000439537:L1333P;ENSP00000362006:L1333P;ENSP00000354573:L1333P;ENSP00000313438:L1333P;ENSP00000444364:L1333P;ENSP00000435070:L1291P;ENSP00000437059:L1482P	ENSP00000313438:L1333P	L	+	2	0	MACF1	39557960	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.212000	0.71576	0.374000	0.22700	CTG	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.368	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	41	0	T	NM_033044		39785373	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	17.24	48	10	SNP	1.000	C
MAGEL2	54551	genome.wustl.edu	37	15	23890248	23890248	+	Missense_Mutation	SNP	C	C	T	rs368034669		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:23890248C>T	ENST00000532292.1	-	1	927	c.833G>A	c.(832-834)cGc>cAc	p.R278H		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	161					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTTGCCGGAGCGGCGTGGCGG	0.657																																																	0								C	HIS/ARG	0,4376		0,0,2188	39.0	46.0	44.0		2642	2.3	0.0	15		44	1,8581		0,1,4290	no	missense	MAGEL2	NM_019066.4	29	0,1,6478	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	881/1250	23890248	1,12957	2188	4291	6479	SO:0001583	missense	0			AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.833G>A	15.37:g.23890248C>T	ENSP00000433433:p.Arg278His			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R278H	ENST00000532292.1	37	c.833		15	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855836	0.32791	0.0	1.17E-4	ENSG00000254585	ENST00000532292	.	.	.	4.22	2.35	0.29111	.	.	.	.	.	T	0.22742	0.0549	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	T	0.20107	-1.0285	5	.	.	.	.	4.4156	0.11454	0.0:0.6117:0.1869:0.2014	.	.	.	.	T	310	.	.	A	-	1	0	MAGEL2	21441341	0.002000	0.14202	0.035000	0.18076	0.342000	0.28953	0.342000	0.19926	0.734000	0.32515	0.655000	0.94253	GCT	MAGEL2	-	NULL	ENSG00000254585		0.657	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	HGNC	protein_coding	OTTHUMT00000395182.2	-	0.00	61	0	C	NM_019066		23890248	-1	tier1	-	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	47.37	50	45	SNP	0.011	T
MAGI2	9863	genome.wustl.edu	37	7	77885499	77885499	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:77885499A>C	ENST00000354212.4	-	10	2061	c.1808T>G	c.(1807-1809)cTt>cGt	p.L603R	MAGI2_ENST00000522391.1_Missense_Mutation_p.L603R|MAGI2_ENST00000535697.1_Missense_Mutation_p.L440R|MAGI2_ENST00000536571.1_Missense_Mutation_p.L435R|MAGI2_ENST00000419488.1_Missense_Mutation_p.L603R	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	603					cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TAAGGTCATAAGTTCAGCTTG	0.522																																																	0													80.0	73.0	75.0					7																	77885499		2203	4300	6503	SO:0001583	missense	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.1808T>G	7.37:g.77885499A>C	ENSP00000346151:p.Leu603Arg		A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.L603R	ENST00000354212.4	37	c.1808	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727221	0.69074	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391;ENST00000536571;ENST00000535697	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.85	4.7	0.59300	PDZ/DHR/GLGF (1);	0.000000	0.33217	U	0.005151	T	0.63260	0.2496	M	0.78049	2.395	0.58432	D	0.999998	D;P;D;D;D;D	0.89917	0.999;0.856;0.991;0.991;1.0;0.996	D;P;P;P;D;P	0.79108	0.986;0.57;0.786;0.786;0.992;0.823	T	0.66384	-0.5937	10	0.87932	D	0	.	10.9973	0.47585	0.9275:0.0:0.0725:0.0	.	440;435;603;603;603;603	F5GWH1;F5GWK7;B7Z4H4;E7EWI0;Q86UL8-2;Q86UL8	.;.;.;.;.;MAGI2_HUMAN	R	603;603;603;603;435;440	ENSP00000405766:L603R;ENSP00000346151:L603R;ENSP00000428389:L603R;ENSP00000441584:L435R;ENSP00000441603:L440R	ENSP00000346151:L603R	L	-	2	0	MAGI2	77723435	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	1.038000	0.40049	0.459000	0.35465	CTT	MAGI2	-	superfamily_PDZ	ENSG00000187391		0.522	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	-	0.00	35	0	A	NM_012301		77885499	-1	tier1	-	no_errors	ENST00000354212	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	C
MAP4	4134	genome.wustl.edu	37	3	47896781	47896781	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:47896781G>T	ENST00000360240.6	-	17	3736	c.3218C>A	c.(3217-3219)tCc>tAc	p.S1073Y	MAP4_ENST00000441748.2_Missense_Mutation_p.S187Y|MAP4_ENST00000383737.4_Missense_Mutation_p.S732Y|MAP4_ENST00000395734.3_Missense_Mutation_p.S1073Y|MAP4_ENST00000420772.2_Missense_Mutation_p.S766Y|MAP4_ENST00000264724.11_Missense_Mutation_p.S808Y|MAP4_ENST00000426837.2_Missense_Mutation_p.S2218Y	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	1073					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	ATTATCGAGGGATCCCACCTT	0.552																																																	0													244.0	202.0	217.0					3																	47896781		2203	4300	6503	SO:0001583	missense	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.3218C>A	3.37:g.47896781G>T	ENSP00000353375:p.Ser1073Tyr		Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_MAP_tubulin-bd_rpt	p.S1073Y	ENST00000360240.6	37	c.3218	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533151	0.85812	.	.	ENSG00000047849	ENST00000383737;ENST00000264724;ENST00000395734;ENST00000426837;ENST00000360240;ENST00000420772;ENST00000335271;ENST00000441748	D;D;D;D;D;D;D;D	0.99527	-6.09;-6.09;-6.09;-6.09;-6.09;-6.09;-6.09;-6.09	4.9	4.9	0.64082	.	.	.	.	.	D	0.99510	0.9825	M	0.85041	2.73	0.42913	D	0.994264	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.998;1.0;1.0;1.0;0.999;1.0	D	0.98319	1.0527	9	0.87932	D	0	-12.4825	15.3796	0.74645	0.0:0.0:1.0:0.0	.	766;1073;1073;808;732;2218	F8W9U4;P27816-6;P27816;E9PGM5;B9ZVR1;E7EVA0	.;.;MAP4_HUMAN;.;.;.	Y	732;808;1073;2218;1073;766;401;187	ENSP00000373243:S732Y;ENSP00000264724:S808Y;ENSP00000379083:S1073Y;ENSP00000407602:S2218Y;ENSP00000353375:S1073Y;ENSP00000409731:S766Y;ENSP00000334770:S401Y;ENSP00000415130:S187Y	ENSP00000264724:S808Y	S	-	2	0	MAP4	47871785	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	8.706000	0.91362	2.552000	0.86080	0.561000	0.74099	TCC	MAP4	-	pfam_MAP_tubulin-bd_rpt	ENSG00000047849		0.552	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1		0.00	43	0	G	NM_002375		47896781	-1			no_errors	ENST00000360240	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	T
MASTL	84930	genome.wustl.edu	37	10	27454026	27454026	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:27454026C>T	ENST00000375940.4	+	5	644	c.587C>T	c.(586-588)tCa>tTa	p.S196L	MASTL_ENST00000375946.4_Missense_Mutation_p.S196L|MASTL_ENST00000342386.6_Missense_Mutation_p.S196L			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						ACAACACCATCAATGGCAAAA	0.318																																																	0													98.0	97.0	98.0					10																	27454026		2203	4300	6503	SO:0001583	missense	0			BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.587C>T	10.37:g.27454026C>T	ENSP00000365107:p.Ser196Leu		Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S196L	ENST00000375940.4	37	c.587	CCDS53502.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.442356	0.96187	.	.	ENSG00000120539	ENST00000375946;ENST00000342386;ENST00000375940	T;T;T	0.80480	-1.38;-1.38;-1.38	5.78	5.78	0.91487	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82586	0.5069	N	0.11892	0.195	0.80722	D	1	D;D;D	0.89917	0.988;0.992;1.0	D;D;D	0.87578	0.958;0.975;0.998	D	0.84558	0.0648	10	0.49607	T	0.09	-17.9165	20.0812	0.97776	0.0:1.0:0.0:0.0	.	196;196;196	Q96GX5-2;Q96GX5;Q96GX5-3	.;GWL_HUMAN;.	L	196	ENSP00000365113:S196L;ENSP00000343446:S196L;ENSP00000365107:S196L	ENSP00000343446:S196L	S	+	2	0	MASTL	27494032	1.000000	0.71417	0.963000	0.40424	0.996000	0.88848	7.805000	0.86005	2.744000	0.94065	0.586000	0.80456	TCA	MASTL	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000120539		0.318	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MASTL	HGNC	protein_coding	OTTHUMT00000047320.1	-	0.00	31	0	C	NM_032844		27454026	+1	tier1	-	no_errors	ENST00000375940	ensembl	human	known	74_37	missense	31.37	35	16	SNP	1.000	T
MGAM	8972	genome.wustl.edu	37	7	141765396	141765396	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:141765396G>A	ENST00000549489.2	+	38	4713				MGAM_ENST00000475668.2_Missense_Mutation_p.E1543K	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGGCATGATGGAGTTCAGCCT	0.532																																																	0													129.0	104.0	111.0					7																	141765396		876	1991	2867	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+128G>A	7.37:g.141765396G>A			Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.E1543K	ENST00000549489.2	37	c.4627	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248463	0.59103	.	.	ENSG00000257335	ENST00000475668;ENST00000548812	.	.	.	3.97	3.97	0.46021	.	.	.	.	.	T	0.73745	0.3626	.	.	.	0.45390	D	0.998379	.	.	.	.	.	.	T	0.78091	-0.2339	5	0.66056	D	0.02	.	14.8747	0.70485	0.0:0.0:1.0:0.0	.	.	.	.	K	1543;1420	.	ENSP00000316431:E1420K	E	+	1	0	MGAM	141411865	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	9.541000	0.98083	1.759000	0.51996	0.306000	0.20318	GAG	MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.532	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	71	0	G			141765396	+1	tier1	-	no_errors	ENST00000475668	ensembl	human	putative	74_37	missense	33.33	76	38	SNP	1.000	A
MGAT2	4247	genome.wustl.edu	37	14	50089073	50089073	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:50089073A>C	ENST00000305386.2	+	1	1585	c.1087A>C	c.(1087-1089)Aaa>Caa	p.K363Q	RP11-649E7.5_ENST00000555043.1_RNA|RPL36AL_ENST00000298289.6_5'Flank	NM_002408.3	NP_002399.1	Q10469	MGAT2_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	363					cellular protein metabolic process (GO:0044267)|oligosaccharide biosynthetic process (GO:0009312)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	alpha-1,6-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0008455)|carbohydrate binding (GO:0030246)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)	11	all_epithelial(31;0.0021)|Breast(41;0.0124)					AAAATTCTGGAAAGTGCTGGT	0.423																																																	0													125.0	122.0	123.0					14																	50089073		2203	4300	6503	SO:0001583	missense	0			U15128	CCDS9690.1	14q21	2013-02-25			ENSG00000168282	ENSG00000168282	2.4.1.143	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7045	protein-coding gene	gene with protein product		602616				7635144	Standard	NM_002408		Approved	GNT-II	uc001wwr.3	Q10469	OTTHUMG00000140271	ENST00000305386.2:c.1087A>C	14.37:g.50089073A>C	ENSP00000307423:p.Lys363Gln		B3KPC5|B3KQM0	Missense_Mutation	SNP	pfam_GlcNAc_II	p.K363Q	ENST00000305386.2	37	c.1087	CCDS9690.1	14	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568956	0.28003	.	.	ENSG00000168282	ENST00000305386;ENST00000504161	D	0.86497	-2.13	5.61	4.47	0.54385	.	0.049551	0.85682	D	0.000000	D	0.86104	0.5853	M	0.77820	2.39	0.38350	D	0.94432	B	0.16166	0.016	B	0.28638	0.092	T	0.81072	-0.1098	10	0.25751	T	0.34	-5.2631	9.2605	0.37610	0.8555:0.0:0.1445:0.0	.	363	Q10469	MGAT2_HUMAN	Q	363;369	ENSP00000307423:K363Q	ENSP00000307423:K363Q	K	+	1	0	MGAT2	49158823	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.174000	0.77620	0.977000	0.38444	0.454000	0.30748	AAA	MGAT2	-	pfam_GlcNAc_II	ENSG00000168282		0.423	MGAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT2	HGNC	protein_coding	OTTHUMT00000276807.1	-	0.00	27	0	A	NM_002408		50089073	+1	tier1	-	no_errors	ENST00000305386	ensembl	human	known	74_37	missense	37.04	17	10	SNP	1.000	C
MIR518F	574472	genome.wustl.edu	37	19	54200830	54200830	+	RNA	DEL	A	A	-	rs80268200		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:54200830delA	ENST00000384973.1	+	0	0				MIR519B_ENST00000385090.1_RNA|MIR523_ENST00000385281.1_RNA|MIR525_ENST00000384978.1_RNA	NR_030194.1				microRNA 518f																		CTCTTATGTGAAAAAAAAGAA	0.423																																																	0													80.0	78.0	79.0					19																	54200830		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207706	ENSG00000207706		"""ncRNAs / Micro RNAs"""	32104	non-coding RNA	RNA, micro				MIRN518F			Standard	NR_030194		Approved	hsa-mir-518f	uc021uzx.1				19.37:g.54200830delA				RNA	DEL	-	NULL	ENST00000384973.1	37	NULL		19																																																																																			MIR525	-	-	ENSG00000207711		0.423	MIR518F-201	KNOWN	basic	miRNA	MIR525	HGNC	miRNA			0.00	78	0	A	NR_030194		54200830	+1	tier1		no_errors	ENST00000384978	ensembl	human	known	74_37	rna	14.93	114	20	DEL	0.007	-
MLEC	9761	genome.wustl.edu	37	12	121131925	121131925	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:121131925G>T	ENST00000228506.3	+	2	695	c.267G>T	c.(265-267)ctG>ctT	p.L89L	MLEC_ENST00000412616.2_Silent_p.L89L	NM_014730.2	NP_055545.1	Q14165	MLEC_HUMAN	malectin	89					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|enzyme binding (GO:0019899)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)	16						TGCCAATCCTGCGTTCCAACC	0.498																																																	0													93.0	78.0	83.0					12																	121131925		2203	4300	6503	SO:0001819	synonymous_variant	0			BC000371	CCDS9206.1	12q24.31	2013-03-06	2008-11-05	2008-11-05	ENSG00000110917	ENSG00000110917			28973	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	613802	"""KIAA0152"""	KIAA0152		18524852	Standard	NM_014730		Approved		uc001tyy.1	Q14165	OTTHUMG00000169187	ENST00000228506.3:c.267G>T	12.37:g.121131925G>T				Silent	SNP	pfam_Malectin	p.L89	ENST00000228506.3	37	c.267	CCDS9206.1	12																																																																																			MLEC	-	pfam_Malectin	ENSG00000110917		0.498	MLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLEC	HGNC	protein_coding	OTTHUMT00000402781.2	-	0.00	59	0	G	NM_014730		121131925	+1	tier1	-	no_errors	ENST00000228506	ensembl	human	known	74_37	silent	9.76	37	4	SNP	1.000	T
MN1	4330	genome.wustl.edu	37	22	28146768	28146769	+	3'UTR	INS	-	-	G	rs11379447|rs377485634	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr22:28146768_28146769insG	ENST00000302326.4	-	0	5051_5052				MN1_ENST00000497225.1_5'UTR	NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1						intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ACCAACCTAGAGAAAAAAAAAA	0.441			T	ETV6	"""AML, meningioma"""								G|G|GG|insertion	2476	0.494409	0.7156	0.5101	5008	,	,		15722	0.3304		0.4404	False		,,,				2504	0.409							Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0																																										SO:0001624	3_prime_UTR_variant	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.*135->C	22.37:g.28146769_28146769dupG			A9Z1V9	RNA	INS	-	NULL	ENST00000302326.4	37	NULL	CCDS42998.1	22																																																																																			MN1	-	-	ENSG00000169184		0.441	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1		0.00	9	0	-	NM_002430		28146769	-1	tier1		no_errors	ENST00000497225	ensembl	human	putative	74_37	rna	37.50	5	3	INS	0.962:0.964	G
MSTN	2660	genome.wustl.edu	37	2	190922215	190922215	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:190922215G>T	ENST00000260950.4	-	3	1029	c.897C>A	c.(895-897)atC>atA	p.I299I	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	299					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			TTTTAGGAGCGATAATCCAAT	0.408																																																	0													94.0	89.0	91.0					2																	190922215		2203	4300	6503	SO:0001819	synonymous_variant	0			AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.897C>A	2.37:g.190922215G>T			A1C2J7|A1C2K0|Q6B0H2	Silent	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.I299	ENST00000260950.4	37	c.897	CCDS2303.1	2																																																																																			MSTN	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000138379		0.408	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTN	HGNC	protein_coding	OTTHUMT00000255917.2		0.00	28	0	G	NM_005259		190922215	-1			no_errors	ENST00000260950	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.992	T
MT-CO1	4512	genome.wustl.edu	37	M	4296	4296	+	5'Flank	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrM:4296G>A	ENST00000361624.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TN_ENST00000387400.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTACTTTGATAGAGTAAATAA	0.398																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.4296G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-TI	-	-	ENSG00000210100		0.398	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-TI	HGNC	protein_coding		-	0.00	53	0	G	YP_003024028		4296	+1	tier1	-	no_errors	ENST00000387365	ensembl	human	known	74_37	rna	93.75	2	30	SNP	NULL	A
MTCH1	23787	genome.wustl.edu	37	6	36938576	36938576	+	Intron	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:36938576C>T	ENST00000373627.5	-	9	1031				MTCH1_ENST00000373616.5_Intron|MTCH1_ENST00000538808.1_Intron|MTCH1_ENST00000471737.1_5'UTR	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						CTCACAAGCACGCTGCACATG	0.592																																																	0																																										SO:0001627	intron_variant	0			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.907-106G>A	6.37:g.36938576C>T			A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	RNA	SNP	-	NULL	ENST00000373627.5	37	NULL		6																																																																																			MTCH1	-	-	ENSG00000137409		0.592	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1	-	0.00	11	0	C	NM_014341		36938576	-1	tier1	-	no_errors	ENST00000471737	ensembl	human	known	74_37	rna	26.32	13	5	SNP	0.000	T
MTR	4548	genome.wustl.edu	37	1	236988684	236988684	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:236988684G>C	ENST00000366577.5	+	10	1306	c.912G>C	c.(910-912)atG>atC	p.M304I	MTR_ENST00000535889.1_Missense_Mutation_p.M304I	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase	304	Hcy-binding. {ECO:0000255|PROSITE- ProRule:PRU00333}.				cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	CTTCTATGATGGCCAAGCACC	0.383																																																	0													148.0	149.0	149.0					1																	236988684		2203	4300	6503	SO:0001583	missense	0			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	ENST00000366577.5:c.912G>C	1.37:g.236988684G>C	ENSP00000355536:p.Met304Ile		A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Missense_Mutation	SNP	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.M304I	ENST00000366577.5	37	c.912	CCDS1614.1	1	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281458	0.40394	.	.	ENSG00000116984	ENST00000417743;ENST00000366577;ENST00000535889	T;T	0.35789	1.29;1.29	5.45	4.48	0.54585	Homocysteine S-methyltransferase (4);	0.098932	0.64402	D	0.000002	T	0.56775	0.2008	H	0.97291	3.975	0.40686	D	0.982354	B;B;B	0.23490	0.086;0.086;0.086	B;B;B	0.31614	0.133;0.133;0.133	T	0.67764	-0.5586	10	0.87932	D	0	-32.3068	11.4483	0.50136	0.0:0.0:0.6585:0.3415	.	304;304;304	B7ZLW8;B7ZLW7;Q99707	.;.;METH_HUMAN	I	304	ENSP00000355536:M304I;ENSP00000441845:M304I	ENSP00000355536:M304I	M	+	3	0	MTR	235055307	1.000000	0.71417	1.000000	0.80357	0.785000	0.44390	1.301000	0.33447	2.837000	0.97791	0.591000	0.81541	ATG	MTR	-	pfam_S_MeTrfase,superfamily_S_MeTrfase,pirsf_MetH,pfscan_S_MeTrfase,tigrfam_MetH	ENSG00000116984		0.383	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2	-	0.00	47	0	G	NM_000254		236988684	+1	tier1	-	no_errors	ENST00000366577	ensembl	human	known	74_37	missense	18.99	64	15	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9073728	9073728	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:9073728C>A	ENST00000397910.4	-	3	13921	c.13718G>T	c.(13717-13719)aGc>aTc	p.S4573I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4575	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCCCCCATGCTGGAGGCAGG	0.517																																																	0													93.0	90.0	91.0					19																	9073728		2085	4216	6301	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13718G>T	19.37:g.9073728C>A	ENSP00000381008:p.Ser4573Ile		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S4573I	ENST00000397910.4	37	c.13718	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.213476	0.00289	.	.	ENSG00000181143	ENST00000397910	T	0.23950	1.88	1.75	-0.571	0.11749	.	.	.	.	.	T	0.15955	0.0384	L	0.34521	1.04	.	.	.	B	0.15719	0.014	B	0.08055	0.003	T	0.23797	-1.0178	8	0.87932	D	0	.	3.1604	0.06518	0.185:0.2835:0.5315:0.0	.	4573	B5ME49	.	I	4573	ENSP00000381008:S4573I	ENSP00000381008:S4573I	S	-	2	0	MUC16	8934728	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.279000	0.02807	-0.075000	0.12798	-0.689000	0.03729	AGC	MUC16	-	NULL	ENSG00000181143		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	57	0	C	NM_024690		9073728	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	44.44	45	36	SNP	0.000	A
MUC19	283463	genome.wustl.edu	37	12	40919229	40919229	+	3'UTR	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:40919229T>C	ENST00000474954.1	+	0	1927				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GAGCTCCAACTCAGGTAAAGC	0.517																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*1924T>C	12.37:g.40919229T>C			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.517	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	94	0	T	XM_003403524		40919229	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	52.94	72	81	SNP	0.035	C
MUC4	4585	genome.wustl.edu	37	3	195509178	195509178	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:195509178G>A	ENST00000463781.3	-	2	9732	c.9273C>T	c.(9271-9273)gtC>gtT	p.V3091V	MUC4_ENST00000475231.1_Silent_p.V3091V|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAAGGCTGGTGACAGGAAGAG	0.602																																																	0													14.0	11.0	12.0					3																	195509178		667	1552	2219	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9273C>T	3.37:g.195509178G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V3091	ENST00000463781.3	37	c.9273	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.602	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	278	0	G	NM_018406		195509178	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	11.39	349	45	SNP	0.947	A
MYH7B	57644	genome.wustl.edu	37	20	33586548	33586548	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:33586548G>A	ENST00000262873.7	+	33	4238	c.4146G>A	c.(4144-4146)gtG>gtA	p.V1382V		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1340						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			CCCACGCCGTGCAGGCTCTGC	0.672																																																	0													21.0	24.0	23.0					20																	33586548		2194	4291	6485	SO:0001819	synonymous_variant	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4146G>A	20.37:g.33586548G>A			Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1382	ENST00000262873.7	37	c.4146	CCDS42869.1	20																																																																																			MYH7B	-	pfam_Myosin_tail	ENSG00000078814		0.672	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	-	0.00	17	0	G	NM_020884		33586548	+1	tier1	-	no_errors	ENST00000262873	ensembl	human	novel	74_37	silent	28.57	20	8	SNP	0.991	A
NCAM2	4685	genome.wustl.edu	37	21	22910257	22910257	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr21:22910257A>C	ENST00000400546.1	+	18	2742	c.2493A>C	c.(2491-2493)aaA>aaC	p.K831N	NCAM2_ENST00000284894.7_Missense_Mutation_p.K689N	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	831					axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TTCAATCAAAAGAAGACGACA	0.358																																																	0													53.0	53.0	53.0					21																	22910257		1835	4084	5919	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2493A>C	21.37:g.22910257A>C	ENSP00000383392:p.Lys831Asn		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.K831N	ENST00000400546.1	37	c.2493	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481695	0.44147	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.62941	-0.01;0.07	5.86	5.86	0.93980	.	0.176678	0.64402	D	0.000011	T	0.53786	0.1818	N	0.20766	0.605	0.80722	D	1	D;D	0.53619	0.961;0.961	P;P	0.47206	0.541;0.541	T	0.55134	-0.8188	10	0.36615	T	0.2	-31.1757	15.0645	0.71983	1.0:0.0:0.0:0.0	.	689;831	B7Z5K2;O15394	.;NCAM2_HUMAN	N	831;689	ENSP00000383392:K831N;ENSP00000284894:K689N	ENSP00000284894:K689N	K	+	3	2	NCAM2	21832128	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	5.353000	0.66034	2.238000	0.73509	0.477000	0.44152	AAA	NCAM2	-	NULL	ENSG00000154654		0.358	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	16	0	A	NM_004540		22910257	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	46.15	7	6	SNP	1.000	C
NCAPD3	23310	genome.wustl.edu	37	11	134054596	134054596	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:134054596C>A	ENST00000534548.2	-	19	2451	c.2387G>T	c.(2386-2388)aGt>aTt	p.S796I	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	796					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AACAGCTGAACTGATCACCTC	0.458																																																	0													84.0	79.0	81.0					11																	134054596		2201	4297	6498	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2387G>T	11.37:g.134054596C>A	ENSP00000433681:p.Ser796Ile		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.S796I	ENST00000534548.2	37	c.2387	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964643	0.74131	.	.	ENSG00000151503	ENST00000534548	T	0.64803	-0.12	5.59	4.67	0.58626	Armadillo-like helical (1);Armadillo-type fold (1);	0.167713	0.64402	D	0.000005	T	0.75606	0.3872	M	0.72118	2.19	0.80722	D	1	D	0.62365	0.991	P	0.60068	0.868	T	0.78979	-0.1990	10	0.62326	D	0.03	-13.2213	16.1568	0.81675	0.0:0.8662:0.1338:0.0	.	796	P42695	CNDD3_HUMAN	I	796	ENSP00000433681:S796I	ENSP00000431612:S796I	S	-	2	0	NCAPD3	133559806	1.000000	0.71417	0.959000	0.39883	0.820000	0.46376	2.382000	0.44345	1.349000	0.45751	0.655000	0.94253	AGT	NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3	ENSG00000151503		0.458	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	-	0.00	30	0	C	NM_015261		134054596	-1	tier1	-	no_errors	ENST00000534548	ensembl	human	known	74_37	missense	40.62	19	13	SNP	0.996	A
NCKAP1L	3071	genome.wustl.edu	37	12	54925986	54925986	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:54925986T>C	ENST00000293373.6	+	26	2893	c.2814T>C	c.(2812-2814)ggT>ggC	p.G938G	NCKAP1L_ENST00000545638.2_Silent_p.G888G	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	938					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						TTCTTATGGGTCCCATTGAGT	0.413																																																	0													125.0	108.0	114.0					12																	54925986		2203	4300	6503	SO:0001819	synonymous_variant	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.2814T>C	12.37:g.54925986T>C			B4DUT5|Q52LW0	Silent	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.G938	ENST00000293373.6	37	c.2814	CCDS31813.1	12																																																																																			NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.413	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	-	0.00	48	0	T	NM_005337		54925986	+1	tier1	-	no_errors	ENST00000293373	ensembl	human	known	74_37	silent	15.62	54	10	SNP	0.964	C
NCOA6	23054	genome.wustl.edu	37	20	33337958	33337958	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:33337958G>A	ENST00000374796.2	-	10	4610	c.2040C>T	c.(2038-2040)ccC>ccT	p.P680P	NCOA6_ENST00000359003.2_Silent_p.P680P			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	680	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GCATCTGCTTGGGTGGGGTCA	0.567																																																	0													61.0	62.0	61.0					20																	33337958		2203	4300	6503	SO:0001819	synonymous_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2040C>T	20.37:g.33337958G>A			A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NULL	p.P680	ENST00000374796.2	37	c.2040	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.567	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	-	0.00	13	0	G	NM_014071		33337958	-1	tier1	-	no_errors	ENST00000359003	ensembl	human	known	74_37	silent	25.64	29	10	SNP	1.000	A
NKAPL	222698	genome.wustl.edu	37	6	28227211	28227211	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:28227211G>A	ENST00000343684.3	+	1	114	c.62G>A	c.(61-63)cGc>cAc	p.R21H	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	21										breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						AGAAGGCGACGCAGCTCCTCG	0.667																																																	0													34.0	32.0	33.0					6																	28227211		2203	4300	6503	SO:0001583	missense	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.62G>A	6.37:g.28227211G>A	ENSP00000345716:p.Arg21His		Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	pfam_DUF926	p.R21H	ENST00000343684.3	37	c.62	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205458	0.39003	.	.	ENSG00000189134	ENST00000343684	T	0.15718	2.4	3.61	2.73	0.32206	.	0.460221	0.22043	N	0.065425	T	0.04497	0.0123	L	0.39633	1.23	0.09310	N	0.999998	B	0.21688	0.059	B	0.12156	0.007	T	0.31888	-0.9927	10	0.41790	T	0.15	-0.0864	6.834	0.23925	0.1302:0.0:0.8698:0.0	.	21	Q5M9Q1	NKAPL_HUMAN	H	21	ENSP00000345716:R21H	ENSP00000345716:R21H	R	+	2	0	NKAPL	28335190	0.001000	0.12720	0.026000	0.17262	0.004000	0.04260	0.299000	0.19138	0.879000	0.35944	0.655000	0.94253	CGC	NKAPL	-	NULL	ENSG00000189134		0.667	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	-	0.00	44	0	G			28227211	+1	tier1	-	no_errors	ENST00000343684	ensembl	human	known	74_37	missense	51.19	41	43	SNP	0.018	A
NME8	51314	genome.wustl.edu	37	7	37903985	37903985	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:37903985G>T	ENST00000199447.4	+	9	862	c.490G>T	c.(490-492)Gct>Tct	p.A164S	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.A164S	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	164	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CAAACCGGATGCTGTGATTAG	0.284																																																	0													25.0	27.0	27.0					7																	37903985		2190	4288	6478	SO:0001583	missense	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.490G>T	7.37:g.37903985G>T	ENSP00000199447:p.Ala164Ser		Q9NZH1	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.A164S	ENST00000199447.4	37	c.490	CCDS5452.1	7	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640712	0.67244	.	.	ENSG00000086288	ENST00000199447;ENST00000455500;ENST00000444718;ENST00000440017	T;T;T	0.59224	0.28;0.28;0.28	4.65	4.65	0.58169	.	0.127555	0.35970	N	0.002870	T	0.73210	0.3558	M	0.83692	2.655	0.28989	N	0.888164	P	0.45986	0.87	P	0.57057	0.812	T	0.70872	-0.4754	10	0.52906	T	0.07	-13.7046	13.7472	0.62883	0.0:0.0:1.0:0.0	.	164	Q8N427	TXND3_HUMAN	S	164;109;109;164	ENSP00000199447:A164S;ENSP00000390596:A109S;ENSP00000397063:A164S	ENSP00000199447:A164S	A	+	1	0	TXNDC3	37870510	1.000000	0.71417	0.479000	0.27329	0.036000	0.12997	2.363000	0.44178	2.522000	0.85027	0.563000	0.77884	GCT	NME8	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase	ENSG00000086288		0.284	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1		0.00	32	0	G	NM_016616		37903985	+1			no_errors	ENST00000199447	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.964	T
NOX3	50508	genome.wustl.edu	37	6	155775979	155775979	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:155775979C>T	ENST00000159060.2	-	3	323	c.221G>A	c.(220-222)cGa>cAa	p.R74Q		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	74	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.R74Q(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AATAAGGTTTCGACTGACAGG	0.368																																																	1	Substitution - Missense(1)	large_intestine(1)											65.0	64.0	64.0					6																	155775979		2203	4299	6502	SO:0001583	missense	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.221G>A	6.37:g.155775979C>T	ENSP00000159060:p.Arg74Gln		Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.R74Q	ENST00000159060.2	37	c.221	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364222	0.82463	.	.	ENSG00000074771	ENST00000159060	D	0.98633	-5.04	5.91	5.05	0.67936	Flavoprotein transmembrane component (1);	0.000000	0.51477	D	0.000085	D	0.97879	0.9303	M	0.93550	3.43	0.40176	D	0.977237	P	0.39847	0.691	B	0.34180	0.177	D	0.98321	1.0528	10	0.87932	D	0	-11.3805	15.2862	0.73831	0.0:0.9327:0.0:0.0673	.	74	Q9HBY0	NOX3_HUMAN	Q	74	ENSP00000159060:R74Q	ENSP00000159060:R74Q	R	-	2	0	NOX3	155817671	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.321000	0.72881	1.509000	0.48786	0.650000	0.86243	CGA	NOX3	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000074771		0.368	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	-	0.00	17	0	C			155775979	-1	tier1	-	no_errors	ENST00000159060	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	T
NRG1	3084	genome.wustl.edu	37	8	32406297	32406297	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:32406297G>A	ENST00000405005.3	+	1	53	c.53G>A	c.(52-54)cGa>cAa	p.R18Q	NRG1_ENST00000356819.4_Missense_Mutation_p.R18Q|NRG1_ENST00000341377.5_Missense_Mutation_p.R18Q|NRG1_ENST00000523079.1_Missense_Mutation_p.R18Q|NRG1_ENST00000287842.3_Missense_Mutation_p.R18Q|NRG1_ENST00000521670.1_Missense_Mutation_p.R18Q|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000287845.5_Missense_Mutation_p.R18Q|NRG1_ENST00000338921.4_Missense_Mutation_p.R18Q|NRG1_ENST00000519301.1_Intron			Q02297	NRG1_HUMAN	neuregulin 1	18					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AAGAAGGAGCGAGGCTCCGGC	0.697																																																	0													34.0	46.0	42.0					8																	32406297		2179	4286	6465	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.53G>A	8.37:g.32406297G>A	ENSP00000384620:p.Arg18Gln		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.R18Q	ENST00000405005.3	37	c.53	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656807	0.67586	.	.	ENSG00000157168	ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T	0.77620	-0.54;-0.56;-0.56;-0.25;-0.49;-1.11;-0.35;-0.25;-0.48	4.89	4.89	0.63831	.	1.138130	0.06568	N	0.747941	T	0.68723	0.3032	N	0.24115	0.695	0.28918	N	0.892282	P;P;P;D;P;P;P;P;P	0.53619	0.804;0.799;0.804;0.961;0.876;0.804;0.876;0.953;0.953	B;B;B;B;B;B;B;B;B	0.43445	0.042;0.058;0.058;0.304;0.091;0.042;0.091;0.124;0.42	T	0.59705	-0.7404	10	0.40728	T	0.16	-5.5023	9.3455	0.38107	0.0993:0.0:0.9007:0.0	.	18;17;17;18;18;18;18;18;18	E9PHH4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8	.;.;.;.;.;NRG1_HUMAN;.;.;.	Q	18	ENSP00000430120:R18Q;ENSP00000343395:R18Q;ENSP00000349275:R18Q;ENSP00000287840:R18Q;ENSP00000287845:R18Q;ENSP00000340497:R18Q;ENSP00000287842:R18Q;ENSP00000384620:R18Q;ENSP00000428828:R18Q	ENSP00000287840:R18Q	R	+	2	0	NRG1	32525839	0.184000	0.23200	0.928000	0.36995	0.962000	0.63368	2.490000	0.45294	2.252000	0.74401	0.462000	0.41574	CGA	NRG1	-	NULL	ENSG00000157168		0.697	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1		0.00	14	0	G			32406297	+1			no_errors	ENST00000338921	ensembl	human	known	74_37	missense	16.67	25	5	SNP	0.288	A
NRXN3	9369	genome.wustl.edu	37	14	80164036	80164036	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:80164036G>T	ENST00000557594.1	+	4	1618	c.665G>T	c.(664-666)cGc>cTc	p.R222L	NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000554719.1_Missense_Mutation_p.R854L|RP11-242P2.1_ENST00000553322.1_RNA|NRXN3_ENST00000428277.2_Missense_Mutation_p.R252L|NRXN3_ENST00000281127.7_Missense_Mutation_p.R222L|NRXN3_ENST00000335750.5_Missense_Mutation_p.R854L	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	222	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)	p.R252H(1)|p.R854H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		GACAAAGGACGCCTCTTCCAA	0.453																																																	2	Substitution - Missense(2)	large_intestine(2)											81.0	78.0	79.0					14																	80164036		2203	4300	6503	SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.665G>T	14.37:g.80164036G>T	ENSP00000451672:p.Arg222Leu		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G	p.R1246L	ENST00000557594.1	37	c.3737		14	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247385	0.80024	.	.	ENSG00000021645	ENST00000330071;ENST00000332068;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	5.76	5.76	0.90799	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.89746	0.6804	M	0.84846	2.72	0.58432	D	0.999995	D;D;D;B	0.71674	0.998;0.98;0.972;0.282	D;P;P;B	0.79108	0.992;0.893;0.9;0.144	D	0.89657	0.3874	9	.	.	.	.	19.9514	0.97200	0.0:0.0:1.0:0.0	.	252;222;222;854	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	L	1227;1246;854;854;222;222;252	ENSP00000451648:R854L;ENSP00000338349:R854L;ENSP00000451672:R222L;ENSP00000281127:R222L;ENSP00000394426:R252L	.	R	+	2	0	NRXN3	79233789	1.000000	0.71417	0.994000	0.49952	0.998000	0.95712	6.828000	0.75308	2.718000	0.92993	0.557000	0.71058	CGC	NRXN3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000021645		0.453	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	30	0	G	NM_001105250		80164036	+1	tier1	-	no_errors	ENST00000554738	ensembl	human	known	74_37	missense	30.30	23	10	SNP	1.000	T
NSD1	64324	genome.wustl.edu	37	5	176638741	176638741	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:176638741T>A	ENST00000439151.2	+	5	3386	c.3341T>A	c.(3340-3342)gTt>gAt	p.V1114D	NSD1_ENST00000354179.4_Missense_Mutation_p.V845D|NSD1_ENST00000361032.4_Missense_Mutation_p.V1011D|NSD1_ENST00000347982.4_Missense_Mutation_p.V845D	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1114					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GATAGCAAGGTTAAGCAATCT	0.418			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													97.0	106.0	103.0					5																	176638741		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.3341T>A	5.37:g.176638741T>A	ENSP00000395929:p.Val1114Asp		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.V1114D	ENST00000439151.2	37	c.3341	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	T	5.379	0.255079	0.10185	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93659	-3.16;-3.16;-3.16;-3.26	4.2	-1.36	0.09085	.	0.845698	0.09813	N	0.752570	D	0.83238	0.5211	N	0.19112	0.55	0.09310	N	1	P;P;B	0.34757	0.467;0.467;0.337	B;B;B	0.35413	0.202;0.202;0.1	T	0.73398	-0.3995	9	.	.	.	.	0.916	0.01304	0.1542:0.2661:0.1581:0.4217	.	845;1011;1114	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	D	845;1114;845;1011	ENSP00000346111:V845D;ENSP00000395929:V1114D;ENSP00000343209:V845D;ENSP00000354310:V1011D	.	V	+	2	0	NSD1	176571347	0.405000	0.25336	0.009000	0.14445	0.001000	0.01503	0.744000	0.26245	-0.312000	0.08741	-0.371000	0.07208	GTT	NSD1	-	NULL	ENSG00000165671		0.418	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	-	0.00	44	0	T	NM_172349		176638741	+1	tier1	-	no_errors	ENST00000439151	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.000	A
NUP133	55746	genome.wustl.edu	37	1	229586486	229586487	+	Intron	INS	-	-	TTG	rs544272246|rs4925452|rs111922560	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:229586486_229586487insTTG	ENST00000261396.3	-	23	3191				NUP133_ENST00000537506.1_Intron|NUP133_ENST00000485119.1_5'UTR	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				ttgtttgttttttttgagacaa	0.396																																																	0																																										SO:0001627	intron_variant	0				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.3100-134->CAA	1.37:g.229586486_229586487insTTG			B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	RNA	INS	-	NULL	ENST00000261396.3	37	NULL	CCDS1579.1	1																																																																																			NUP133	-	-	ENSG00000069248		0.396	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP133	HGNC	protein_coding	OTTHUMT00000095224.1		0.00	8	0	-	NM_018230		229586487	-1	tier1		no_errors	ENST00000485119	ensembl	human	known	74_37	rna	54.55	5	6	INS	0.005:0.007	TTG
NUP153	9972	genome.wustl.edu	37	6	17649509	17649509	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:17649509G>A	ENST00000262077.2	-	12	1417	c.1418C>T	c.(1417-1419)cCg>cTg	p.P473L	NUP153_ENST00000537253.1_Missense_Mutation_p.P504L	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	473					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			AGAGATTTTCGGTAATACTGG	0.363																																																	0													178.0	166.0	170.0					6																	17649509		2203	4300	6503	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.1418C>T	6.37:g.17649509G>A	ENSP00000262077:p.Pro473Leu		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.P504L	ENST00000262077.2	37	c.1511	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332287	0.81801	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.62232	0.04;0.04	5.28	5.28	0.74379	Nucleoporin, Nup153-like (1);	0.000000	0.43579	D	0.000557	T	0.77322	0.4113	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80216	-0.1474	10	0.87932	D	0	-2.2318	17.046	0.86502	0.0:0.0:1.0:0.0	.	504;495;473	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	L	473;495;504	ENSP00000262077:P473L;ENSP00000444029:P504L	ENSP00000262077:P473L	P	-	2	0	NUP153	17757488	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	6.035000	0.70940	2.632000	0.89209	0.591000	0.81541	CCG	NUP153	-	pfam_Nucleoporin_Nup153	ENSG00000124789		0.363	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	75	0	G			17649509	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
NUP210	23225	genome.wustl.edu	37	3	13415268	13415268	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:13415268C>A	ENST00000254508.5	-	12	1619	c.1537G>T	c.(1537-1539)Gtg>Ttg	p.V513L		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	513					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					GCCTGGATCACACTGAACCCG	0.572																																																	0													165.0	119.0	135.0					3																	13415268		2203	4300	6503	SO:0001583	missense	0			AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1537G>T	3.37:g.13415268C>A	ENSP00000254508:p.Val513Leu		A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.V513L	ENST00000254508.5	37	c.1537	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049032	0.36181	.	.	ENSG00000132182	ENST00000254508	T	0.44881	0.91	5.62	4.74	0.60224	Invasin/intimin cell-adhesion (1);	0.140250	0.47852	D	0.000215	T	0.43188	0.1236	M	0.76002	2.32	0.49798	D	0.999825	B;B	0.31318	0.319;0.214	B;B	0.34301	0.179;0.087	T	0.32613	-0.9900	10	0.30854	T	0.27	.	9.5414	0.39255	0.0:0.7959:0.0:0.2041	.	513;513	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	L	513	ENSP00000254508:V513L	ENSP00000254508:V513L	V	-	1	0	NUP210	13390268	1.000000	0.71417	1.000000	0.80357	0.160000	0.22226	1.605000	0.36815	1.356000	0.45884	0.655000	0.94253	GTG	NUP210	-	superfamily_Invasin/intimin_cell_adhesion	ENSG00000132182		0.572	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	HGNC	protein_coding	OTTHUMT00000340085.1	-	0.00	42	0	C	NM_024923		13415268	-1	tier1	-	no_errors	ENST00000254508	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	A
NUP98	4928	genome.wustl.edu	37	11	3744432	3744432	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:3744432C>T	ENST00000324932.7	-	16	2521	c.2101G>A	c.(2101-2103)Gac>Aac	p.D701N	NUP98_ENST00000397004.4_Missense_Mutation_p.D701N|NUP98_ENST00000355260.3_Missense_Mutation_p.D701N|NUP98_ENST00000397007.4_Missense_Mutation_p.D718N|NUP98_ENST00000359171.4_Missense_Mutation_p.D701N	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	718					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		TCTTCTCGGTCATCCTGAAGT	0.423			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																			Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0													149.0	137.0	141.0					11																	3744432		2201	4298	6499	SO:0001583	missense	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.2101G>A	11.37:g.3744432C>T	ENSP00000316032:p.Asp701Asn		Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	pfam_Nup96,pfam_Peptidase_S59,superfamily_Peptidase_S59	p.D701N	ENST00000324932.7	37	c.2101	CCDS7746.1	11	.	.	.	.	.	.	.	.	.	.	C	22.1	4.251053	0.80135	.	.	ENSG00000110713	ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.	.	.	4.73	4.73	0.59995	.	0.130958	0.56097	D	0.000031	T	0.47581	0.1453	L	0.36672	1.1	0.33826	D	0.629641	P;P;D;P	0.57899	0.763;0.763;0.981;0.95	B;B;P;P	0.53185	0.21;0.288;0.7;0.72	T	0.52689	-0.8542	9	0.14656	T	0.56	.	14.8555	0.70332	0.0:1.0:0.0:0.0	.	718;701;701;701	P52948-3;P52948-4;P52948-2;P52948-5	.;.;.;.	N	701;701;701;701;718	.	ENSP00000316032:D701N	D	-	1	0	NUP98	3701008	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.663000	0.68038	2.185000	0.69588	0.585000	0.79938	GAC	NUP98	-	NULL	ENSG00000110713		0.423	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	-	0.00	59	0	C	NM_016320		3744432	-1	tier1	-	no_errors	ENST00000324932	ensembl	human	known	74_37	missense	35.71	45	25	SNP	1.000	T
OC90	729330	genome.wustl.edu	37	8	133067236	133067236	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:133067236G>T	ENST00000443356.2	-	2	124	c.38C>A	c.(37-39)cCc>cAc	p.P13H	OC90_ENST00000254627.3_Missense_Mutation_p.P13H|OC90_ENST00000603859.1_Missense_Mutation_p.P13H|OC90_ENST00000262283.5_Missense_Mutation_p.P209H			Q02509	OC90_HUMAN	otoconin 90	13					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			ACCGGCATGGGGGATCATCAG	0.498																																																	0													105.0	105.0	105.0					8																	133067236		692	1591	2283	SO:0001583	missense	0			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.38C>A	8.37:g.133067236G>T	ENSP00000390050:p.Pro13His		B4DNG8	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.P13H	ENST00000443356.2	37	c.38		8	.	.	.	.	.	.	.	.	.	.	G	10.08	1.253333	0.22965	.	.	ENSG00000253117;ENSG00000253117;ENSG00000258417	ENST00000254627;ENST00000443356;ENST00000262283	T;T;T	0.31769	1.48;1.49;1.48	3.53	3.53	0.40419	.	0.598283	0.16005	N	0.234088	T	0.17195	0.0413	N	0.12182	0.205	0.09310	N	1	B	0.27700	0.186	B	0.19666	0.026	T	0.15150	-1.0447	10	0.66056	D	0.02	-6.262	10.8732	0.46896	0.0:0.0:1.0:0.0	.	13	Q02509-2	.	H	13;13;209	ENSP00000254627:P13H;ENSP00000390050:P13H;ENSP00000262283:P209H	ENSP00000254627:P13H	P	-	2	0	RP11-240B13.2;OC90	133136418	0.119000	0.22226	0.017000	0.16124	0.010000	0.07245	2.409000	0.44583	2.274000	0.75844	0.563000	0.77884	CCC	OC90	-	NULL	ENSG00000258417		0.498	OC90-201	KNOWN	basic	protein_coding	OC90	Uniprot_gn	protein_coding		-	0.00	19	0	G	NM_001080399		133067236	-1	tier1	-	no_errors	ENST00000443356	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.017	T
OPA3	80207	genome.wustl.edu	37	19	46056804	46056804	+	Missense_Mutation	SNP	C	C	T	rs374639297		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:46056804C>T	ENST00000263275.4	-	2	562	c.508G>A	c.(508-510)Gct>Act	p.A170T	OPA3_ENST00000323060.3_Intron|OPA3_ENST00000544371.1_Missense_Mutation_p.A117T	NM_025136.3	NP_079412.1	Q9H6K4	OPA3_HUMAN	optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)	170					growth (GO:0040007)|mitochondrion morphogenesis (GO:0070584)|neuromuscular process (GO:0050905)|regulation of lipid metabolic process (GO:0019216)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	mitochondrion (GO:0005739)				cervix(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		GCGTGGGAAGCGGACCGGCCG	0.642																																																	0									,THR/ALA	0,4360		0,0,2180	48.0	53.0	51.0		,508	-2.6	0.0	19		51	2,8516		0,2,4257	no	intron,missense	OPA3	NM_001017989.2,NM_025136.3	,58	0,2,6437	TT,TC,CC		0.0235,0.0,0.0155	,	,170/180	46056804	2,12876	2180	4259	6439	SO:0001583	missense	0			AK025840	CCDS12668.1, CCDS33052.1	19q13.2-q13.3	2014-01-28				ENSG00000125741			8142	protein-coding gene	gene with protein product		606580				9097959, 11668429	Standard	NM_001017989		Approved	FLJ22187, MGA3	uc002pcj.4	Q9H6K4		ENST00000263275.4:c.508G>A	19.37:g.46056804C>T	ENSP00000263275:p.Ala170Thr		Q6P384|Q8N784	Missense_Mutation	SNP	pfam_OPA3-like	p.A170T	ENST00000263275.4	37	c.508	CCDS12668.1	19	.	.	.	.	.	.	.	.	.	.	C	13.79	2.343370	0.41498	0.0	2.35E-4	ENSG00000125741	ENST00000263275;ENST00000544371	D;D	0.84516	-1.86;-1.86	3.7	-2.56	0.06268	.	.	.	.	.	T	0.69441	0.3111	L	0.31926	0.97	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.51624	-0.8682	9	0.21014	T	0.42	.	0.5443	0.00651	0.177:0.3111:0.1736:0.3382	.	170	Q9H6K4	OPA3_HUMAN	T	170;117	ENSP00000263275:A170T;ENSP00000442839:A117T	ENSP00000263275:A170T	A	-	1	0	OPA3	50748644	0.000000	0.05858	0.000000	0.03702	0.238000	0.25445	-0.561000	0.05957	-0.345000	0.08325	0.491000	0.48974	GCT	OPA3	-	NULL	ENSG00000125741		0.642	OPA3-002	KNOWN	basic|CCDS	protein_coding	OPA3	HGNC	protein_coding	OTTHUMT00000459601.1	-	0.00	25	0	C			46056804	-1	tier1	-	no_errors	ENST00000263275	ensembl	human	known	74_37	missense	16.36	46	9	SNP	0.000	T
OPA3	80207	genome.wustl.edu	37	19	46056849	46056849	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:46056849C>G	ENST00000263275.4	-	2	517	c.463G>C	c.(463-465)Gag>Cag	p.E155Q	OPA3_ENST00000323060.3_Intron|OPA3_ENST00000544371.1_Missense_Mutation_p.E102Q	NM_025136.3	NP_079412.1	Q9H6K4	OPA3_HUMAN	optic atrophy 3 (autosomal recessive, with chorea and spastic paraplegia)	155					growth (GO:0040007)|mitochondrion morphogenesis (GO:0070584)|neuromuscular process (GO:0050905)|regulation of lipid metabolic process (GO:0019216)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	mitochondrion (GO:0005739)				cervix(1)|large_intestine(1)|lung(2)	4		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00778)|GBM - Glioblastoma multiforme(486;0.0976)|Epithelial(262;0.242)		TCTTGCAGCTCTGTGCGCAGT	0.692																																																	0													28.0	34.0	32.0					19																	46056849		2189	4273	6462	SO:0001583	missense	0			AK025840	CCDS12668.1, CCDS33052.1	19q13.2-q13.3	2014-01-28				ENSG00000125741			8142	protein-coding gene	gene with protein product		606580				9097959, 11668429	Standard	NM_001017989		Approved	FLJ22187, MGA3	uc002pcj.4	Q9H6K4		ENST00000263275.4:c.463G>C	19.37:g.46056849C>G	ENSP00000263275:p.Glu155Gln		Q6P384|Q8N784	Missense_Mutation	SNP	pfam_OPA3-like	p.E155Q	ENST00000263275.4	37	c.463	CCDS12668.1	19	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.928441	0.00493	.	.	ENSG00000125741	ENST00000263275;ENST00000544371	D;D	0.82893	-1.61;-1.66	3.89	1.72	0.24424	.	.	.	.	.	T	0.62332	0.2419	N	0.04508	-0.205	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.45175	-0.9279	9	0.14252	T	0.57	.	10.3643	0.44015	0.0:0.5585:0.4415:0.0	.	155	Q9H6K4	OPA3_HUMAN	Q	155;102	ENSP00000263275:E155Q;ENSP00000442839:E102Q	ENSP00000263275:E155Q	E	-	1	0	OPA3	50748689	0.276000	0.24211	0.370000	0.25965	0.026000	0.11368	0.254000	0.18314	0.621000	0.30232	-0.479000	0.04858	GAG	OPA3	-	NULL	ENSG00000125741		0.692	OPA3-002	KNOWN	basic|CCDS	protein_coding	OPA3	HGNC	protein_coding	OTTHUMT00000459601.1		0.00	11	0	C			46056849	-1			no_errors	ENST00000263275	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.373	G
OR2L8	391190	genome.wustl.edu	37	1	248112938	248112938	+	Missense_Mutation	SNP	G	G	A	rs572027464		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:248112938G>A	ENST00000357191.3	+	1	779	c.779G>A	c.(778-780)cGt>cAt	p.R260H	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R260P(1)		endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ACTTATCTACGTCCAAGATCC	0.478													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20431	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	ovary(1)											124.0	93.0	104.0					1																	248112938		2203	4297	6500	SO:0001583	missense	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.779G>A	1.37:g.248112938G>A	ENSP00000349719:p.Arg260His		Q6IF03	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R260H	ENST00000357191.3	37	c.779	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	.	3.913	-0.019694	0.07634	.	.	ENSG00000196936	ENST00000357191	T	0.37752	1.18	1.8	-0.293	0.12835	GPCR, rhodopsin-like superfamily (1);	1.357770	0.05838	N	0.618874	T	0.30823	0.0777	L	0.60455	1.87	0.09310	N	1	B	0.19073	0.033	B	0.15484	0.013	T	0.24693	-1.0153	10	0.23891	T	0.37	.	4.437	0.11555	0.5955:0.0:0.4045:0.0	.	260	Q8NGY9	OR2L8_HUMAN	H	260	ENSP00000349719:R260H	ENSP00000349719:R260H	R	+	2	0	OR2L8	246179561	0.000000	0.05858	0.056000	0.19401	0.385000	0.30292	-1.472000	0.02341	0.109000	0.17891	0.485000	0.47835	CGT	OR2L8	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196936		0.478	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	-	0.00	99	0	G			248112938	+1	tier1	-	no_errors	ENST00000357191	ensembl	human	known	74_37	missense	24.82	103	34	SNP	0.147	A
OR2T8	343172	genome.wustl.edu	37	1	248084899	248084899	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:248084899G>A	ENST00000319968.4	+	1	580	c.580G>A	c.(580-582)Gaa>Aaa	p.E194K		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TTCAGTCTTCGAAAACGCCAT	0.537																																																	0													5.0	3.0	4.0					1																	248084899		1785	3461	5246	SO:0001583	missense	0				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.580G>A	1.37:g.248084899G>A	ENSP00000326225:p.Glu194Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E194K	ENST00000319968.4	37	c.580	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563920	0.65651	.	.	ENSG00000177462	ENST00000319968	T	0.00207	8.55	3.56	2.57	0.30868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35407	U	0.003231	T	0.00524	0.0017	M	0.80847	2.515	0.09310	N	1	D	0.89917	1.0	D	0.83275	0.996	T	0.39820	-0.9595	10	0.66056	D	0.02	.	11.7228	0.51691	0.0:0.1794:0.8206:0.0	.	194	A6NH00	OR2T8_HUMAN	K	194	ENSP00000326225:E194K	ENSP00000326225:E194K	E	+	1	0	OR2T8	246151522	0.001000	0.12720	0.013000	0.15412	0.361000	0.29550	1.090000	0.30902	1.816000	0.52996	0.404000	0.27445	GAA	OR2T8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177462		0.537	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	-	0.00	24	0	G	NM_001005522		248084899	+1	tier1	-	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.003	A
OR2T33	391195	genome.wustl.edu	37	1	248436537	248436537	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:248436537C>T	ENST00000318021.2	-	1	601	c.580G>A	c.(580-582)Gaa>Aaa	p.E194K		NM_001004695.1	NP_001004695.1	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T, member 33	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(41)|ovary(1)|prostate(1)|skin(4)	67	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATGGCGTTTTCGAAGACTGAA	0.532																																																	0													23.0	26.0	25.0					1																	248436537		2190	4271	6461	SO:0001583	missense	0				CCDS31109.1	1q44	2012-08-09			ENSG00000177212	ENSG00000177212		"""GPCR / Class A : Olfactory receptors"""	31255	protein-coding gene	gene with protein product							Standard	NM_001004695		Approved		uc010pzi.2	Q8NG76	OTTHUMG00000040458	ENST00000318021.2:c.580G>A	1.37:g.248436537C>T	ENSP00000324687:p.Glu194Lys		B2RNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E194K	ENST00000318021.2	37	c.580	CCDS31109.1	1	.	.	.	.	.	.	.	.	.	.	-	10.30	1.313415	0.23908	.	.	ENSG00000177212	ENST00000318021	T	0.00207	8.55	2.52	2.52	0.30459	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35407	U	0.003231	T	0.00496	0.0016	M	0.70787	2.145	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.45323	-0.9269	10	0.66056	D	0.02	.	13.4017	0.60887	0.0:1.0:0.0:0.0	.	194	Q8NG76	O2T33_HUMAN	K	194	ENSP00000324687:E194K	ENSP00000324687:E194K	E	-	1	0	OR2T33	246503160	0.000000	0.05858	0.011000	0.14972	0.024000	0.10985	0.037000	0.13840	1.338000	0.45544	0.494000	0.49563	GAA	OR2T33	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177212		0.532	OR2T33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T33	HGNC	protein_coding	OTTHUMT00000097354.1	-	0.00	48	0	C	NM_001004695		248436537	-1	tier1	-	no_errors	ENST00000318021	ensembl	human	known	74_37	missense	23.81	48	15	SNP	0.006	T
OR4A15	81328	genome.wustl.edu	37	11	55135565	55135565	+	Missense_Mutation	SNP	G	G	T	rs202169193		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:55135565G>T	ENST00000314706.3	+	1	206	c.206G>T	c.(205-207)gGc>gTc	p.G69V		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						ACGATAATGGGCAACCTGCTT	0.428																																																	0													100.0	91.0	94.0					11																	55135565		2201	4296	6497	SO:0001583	missense	0			AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.206G>T	11.37:g.55135565G>T	ENSP00000325065:p.Gly69Val		Q6IFL4|Q96R65	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G69V	ENST00000314706.3	37	c.206	CCDS31500.1	11	.	.	.	.	.	.	.	.	.	.	g	13.55	2.271907	0.40194	.	.	ENSG00000181958	ENST00000314706	T	0.04406	3.63	3.48	3.48	0.39840	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000102	T	0.31358	0.0794	H	0.96805	3.885	0.20074	N	0.999932	D	0.89917	1.0	D	0.81914	0.995	T	0.38628	-0.9652	10	0.87932	D	0	.	12.5491	0.56216	0.0:0.0:1.0:0.0	.	69	Q8NGL6	O4A15_HUMAN	V	69	ENSP00000325065:G69V	ENSP00000325065:G69V	G	+	2	0	OR4A15	54892141	0.000000	0.05858	0.187000	0.23214	0.119000	0.20118	0.433000	0.21477	1.785000	0.52413	0.492000	0.49549	GGC	OR4A15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000181958		0.428	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A15	HGNC	protein_coding	OTTHUMT00000391161.1	-	0.00	65	0	G	NM_001005275		55135565	+1	tier1	-	no_errors	ENST00000314706	ensembl	human	known	74_37	missense	40.00	42	28	SNP	0.016	T
OR5AS1	219447	genome.wustl.edu	37	11	55798490	55798490	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:55798490T>G	ENST00000313555.1	+	1	596	c.596T>G	c.(595-597)cTc>cGc	p.L199R		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					CAGCTTCTGCTCTTTGCTTTG	0.418																																																	0													310.0	308.0	309.0					11																	55798490		2201	4296	6497	SO:0001583	missense	0			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.596T>G	11.37:g.55798490T>G	ENSP00000324111:p.Leu199Arg		Q6IFB8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L199R	ENST00000313555.1	37	c.596	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	T	17.80	3.478604	0.63849	.	.	ENSG00000181785	ENST00000313555	T	0.00237	8.47	5.23	5.23	0.72850	GPCR, rhodopsin-like superfamily (1);	0.000000	0.31697	U	0.007211	T	0.00637	0.0021	M	0.84511	2.7	0.32197	N	0.578348	D	0.76494	0.999	D	0.72338	0.977	T	0.43097	-0.9412	10	0.87932	D	0	.	13.9484	0.64101	0.0:0.0:0.0:1.0	.	199	Q8N127	O5AS1_HUMAN	R	199	ENSP00000324111:L199R	ENSP00000324111:L199R	L	+	2	0	OR5AS1	55555066	0.000000	0.05858	1.000000	0.80357	0.911000	0.54048	-0.334000	0.07883	1.973000	0.57446	0.523000	0.50628	CTC	OR5AS1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181785		0.418	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1	-	0.00	58	0	T	NM_001001921		55798490	+1	tier1	-	no_errors	ENST00000313555	ensembl	human	known	74_37	missense	18.75	65	15	SNP	1.000	G
OR5R1	219479	genome.wustl.edu	37	11	56184775	56184775	+	Missense_Mutation	SNP	A	A	C	rs570860563		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:56184775A>C	ENST00000312253.1	-	1	933	c.934T>G	c.(934-936)Tta>Gta	p.L312V		NM_001004744.1	NP_001004744.1	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R, member 1	312						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(17)|ovary(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(21;0.00448)					AATATCTGTAAGTTTTCACAA	0.308													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19134	0.0		0.0	False		,,,				2504	0.0																0													51.0	52.0	52.0					11																	56184775		2176	4285	6461	SO:0001583	missense	0			AB065504	CCDS31530.1	11q11	2012-08-09		2004-03-10	ENSG00000174942	ENSG00000174942		"""GPCR / Class A : Olfactory receptors"""	14841	protein-coding gene	gene with protein product				OR5R1P			Standard	NM_001004744		Approved		uc010rji.2	Q8NH85	OTTHUMG00000154219	ENST00000312253.1:c.934T>G	11.37:g.56184775A>C	ENSP00000308595:p.Leu312Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L312V	ENST00000312253.1	37	c.934	CCDS31530.1	11	.	.	.	.	.	.	.	.	.	.	A	6.288	0.421235	0.11928	.	.	ENSG00000174942	ENST00000312253	T	0.00044	8.83	5.65	4.5	0.54988	.	.	.	.	.	T	0.00109	0.0003	N	0.14661	0.345	0.09310	N	1	B	0.26258	0.145	B	0.24155	0.051	T	0.09228	-1.0684	9	0.30854	T	0.27	-3.2026	10.1056	0.42530	0.6747:0.3253:0.0:0.0	.	312	Q8NH85	OR5R1_HUMAN	V	312	ENSP00000308595:L312V	ENSP00000308595:L312V	L	-	1	2	OR5R1	55941351	0.000000	0.05858	0.975000	0.42487	0.155000	0.21991	-0.256000	0.08757	0.949000	0.37715	0.523000	0.50628	TTA	OR5R1	-	NULL	ENSG00000174942		0.308	OR5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5R1	HGNC	protein_coding	OTTHUMT00000334444.1	-	0.00	42	0	A	NM_001004744		56184775	-1	tier1	-	no_errors	ENST00000312253	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.032	C
OR8H3	390152	genome.wustl.edu	37	11	55890577	55890577	+	Silent	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:55890577T>A	ENST00000313472.3	+	1	729	c.729T>A	c.(727-729)tcT>tcA	p.S243S		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					CTTGCGTCTCTCATCTCTTGG	0.403																																																	0													121.0	115.0	117.0					11																	55890577		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.729T>A	11.37:g.55890577T>A			Q6IFB7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S243	ENST00000313472.3	37	c.729	CCDS31519.1	11																																																																																			OR8H3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181761		0.403	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	75	0	T	NM_001005201		55890577	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	silent	37.00	63	37	SNP	0.565	A
OR8D2	283160	genome.wustl.edu	37	11	124189525	124189525	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:124189525G>C	ENST00000357438.2	-	1	659	c.569C>G	c.(568-570)tCc>tGc	p.S190C		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	190						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		GTGGGTGCTGGAGCAAGACAG	0.418																																																	0													96.0	90.0	92.0					11																	124189525		2201	4299	6500	SO:0001583	missense	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.569C>G	11.37:g.124189525G>C	ENSP00000350022:p.Ser190Cys		B9EH49|Q6IFR0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S190C	ENST00000357438.2	37	c.569	CCDS31707.1	11	.	.	.	.	.	.	.	.	.	.	g	15.20	2.762727	0.49574	.	.	ENSG00000197263	ENST00000357438	T	0.00262	8.4	3.55	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000278	T	0.00384	0.0012	M	0.93854	3.465	0.09310	N	1	B	0.24258	0.1	B	0.26202	0.067	T	0.22871	-1.0204	10	0.87932	D	0	.	13.568	0.61830	0.0:0.1584:0.8416:0.0	.	190	Q9GZM6	OR8D2_HUMAN	C	190	ENSP00000350022:S190C	ENSP00000350022:S190C	S	-	2	0	OR8D2	123694735	0.001000	0.12720	0.243000	0.24186	0.955000	0.61496	0.986000	0.29590	1.086000	0.41228	0.530000	0.56133	TCC	OR8D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000197263		0.418	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1		0.00	65	0	G	NM_001002918		124189525	-1			no_errors	ENST00000357438	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.032	C
OXGR1	27199	genome.wustl.edu	37	13	97639710	97639710	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr13:97639710C>A	ENST00000298440.1	-	4	547	c.304G>T	c.(304-306)Gga>Tga	p.G102*	OXGR1_ENST00000543457.1_Nonsense_Mutation_p.G102*	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	102					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			ATGAAATCTCCAAAGATCCAG	0.473																																																	0													74.0	67.0	70.0					13																	97639710		2203	4300	6503	SO:0001587	stop_gained	0			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.304G>T	13.37:g.97639710C>A	ENSP00000298440:p.Gly102*		Q5T5A7|Q86TL1	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G102*	ENST00000298440.1	37	c.304	CCDS9482.1	13	.	.	.	.	.	.	.	.	.	.	C	37	6.565112	0.97667	.	.	ENSG00000165621	ENST00000298440;ENST00000543457	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.5376	0.95260	0.0:1.0:0.0:0.0	.	.	.	.	X	102	.	ENSP00000298440:G102X	G	-	1	0	OXGR1	96437711	1.000000	0.71417	0.983000	0.44433	0.962000	0.63368	6.048000	0.71046	2.620000	0.88729	0.655000	0.94253	GGA	OXGR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000165621		0.473	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXGR1	HGNC	protein_coding	OTTHUMT00000045521.3	-	0.00	41	0	C	NM_080818		97639710	-1	tier1	-	no_errors	ENST00000298440	ensembl	human	known	74_37	nonsense	72.55	14	37	SNP	1.000	A
PCDH10	57575	genome.wustl.edu	37	4	134072185	134072185	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:134072185C>T	ENST00000264360.5	+	1	1716	c.890C>T	c.(889-891)gCg>gTg	p.A297V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	297	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TCGCCCCGGGCGCGGGAGCTT	0.632																																																	0													41.0	45.0	43.0					4																	134072185		2203	4300	6503	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.890C>T	4.37:g.134072185C>T	ENSP00000264360:p.Ala297Val		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A297V	ENST00000264360.5	37	c.890	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.492356	0.01009	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.37058	1.22	4.33	3.47	0.39725	Cadherin (4);Cadherin-like (1);	0.000000	0.44902	D	0.000402	T	0.11537	0.0281	N	0.02658	-0.545	0.36301	D	0.857014	B;B	0.11235	0.004;0.002	B;B	0.06405	0.002;0.002	T	0.24404	-1.0161	10	0.02654	T	1	.	7.7575	0.28933	0.0:0.7463:0.166:0.0877	.	297;297	Q9P2E7;Q96SF0	PCD10_HUMAN;.	V	297	ENSP00000264360:A297V	ENSP00000264360:A297V	A	+	2	0	PCDH10	134291635	0.980000	0.34600	0.451000	0.26982	0.421000	0.31385	2.230000	0.42999	0.991000	0.38814	-0.416000	0.06073	GCG	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.632	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	16	0	C	NM_032961		134072185	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	43.75	18	14	SNP	0.996	T
PCDH10	57575	genome.wustl.edu	37	4	134073196	134073196	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:134073196G>A	ENST00000264360.5	+	1	2727	c.1901G>A	c.(1900-1902)cGc>cAc	p.R634H	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	634	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R634H(1)		NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		ATGGACTGGCGCACCGGGGAG	0.692																																																	1	Substitution - Missense(1)	endometrium(1)											32.0	36.0	35.0					4																	134073196		2183	4282	6465	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.1901G>A	4.37:g.134073196G>A	ENSP00000264360:p.Arg634His		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R634H	ENST00000264360.5	37	c.1901	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	G	13.25	2.180302	0.38511	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.52526	0.66	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	0.000000	0.44483	D	0.000458	T	0.44286	0.1286	N	0.05414	-0.055	0.58432	D	0.99999	D;B	0.89917	1.0;0.022	D;B	0.87578	0.998;0.013	T	0.27400	-1.0075	10	0.05721	T	0.95	.	16.5313	0.84361	0.0:0.0:1.0:0.0	.	634;634	Q9P2E7;Q96SF0	PCD10_HUMAN;.	H	634	ENSP00000264360:R634H	ENSP00000264360:R634H	R	+	2	0	PCDH10	134292646	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.685000	0.46959	2.207000	0.71202	0.655000	0.94253	CGC	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000138650		0.692	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	8	0	G	NM_032961		134073196	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	43.75	9	7	SNP	1.000	A
PCDHA12	56137	genome.wustl.edu	37	5	140257113	140257113	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140257113G>A	ENST00000398631.2	+	1	2056	c.2056G>A	c.(2056-2058)Gct>Act	p.A686T	PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	686					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCAGTGGGCGCTGTGGATCC	0.652																																					Pancreas(113;759 1672 13322 24104 50104)												0													37.0	42.0	40.0					5																	140257113		2203	4300	6503	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2056G>A	5.37:g.140257113G>A	ENSP00000381628:p.Ala686Thr		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A686T	ENST00000398631.2	37	c.2056	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	G	11.58	1.681578	0.29872	.	.	ENSG00000251664	ENST00000398631	T	0.51574	0.7	4.84	-1.89	0.07689	.	.	.	.	.	T	0.39733	0.1089	M	0.75447	2.3	0.09310	N	1	B;B	0.21688	0.059;0.012	B;B	0.18263	0.021;0.004	T	0.37126	-0.9719	9	0.36615	T	0.2	.	2.3841	0.04361	0.151:0.1172:0.2543:0.4774	.	686;686	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	686	ENSP00000381628:A686T	ENSP00000381628:A686T	A	+	1	0	PCDHA12	140237297	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.495000	0.06443	-0.473000	0.06871	-0.839000	0.03059	GCT	PCDHA12	-	NULL	ENSG00000251664		0.652	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	42	0	G	NM_018903		140257113	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	34.43	40	21	SNP	0.000	A
PCDHAC2	56134	genome.wustl.edu	37	5	140348306	140348306	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140348306G>T	ENST00000289269.5	+	1	2487	c.1955G>T	c.(1954-1956)aGt>aTt	p.S652I	PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAGATGAGAGTGGTAGCACT	0.498																																					Melanoma(190;638 2083 3390 11909 52360)												0													79.0	74.0	76.0					5																	140348306		2203	4300	6503	SO:0001583	missense	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1955G>T	5.37:g.140348306G>T	ENSP00000289269:p.Ser652Ile		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S652I	ENST00000289269.5	37	c.1955	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793354	0.50102	.	.	ENSG00000243232	ENST00000289269	T	0.54675	0.56	6.02	4.13	0.48395	Cadherin (4);Cadherin-like (1);	0.280612	0.25657	N	0.029175	T	0.54615	0.1869	L	0.42686	1.345	0.80722	D	1	B;D	0.54397	0.241;0.966	B;P	0.49192	0.273;0.602	T	0.62296	-0.6884	10	0.87932	D	0	.	16.3899	0.83531	0.0:0.2483:0.7517:0.0	.	652;652	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	I	652	ENSP00000289269:S652I	ENSP00000289269:S652I	S	+	2	0	PCDHAC2	140328490	0.349000	0.24870	1.000000	0.80357	0.929000	0.56500	2.590000	0.46154	1.547000	0.49401	0.655000	0.94253	AGT	PCDHAC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000243232		0.498	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	-	0.00	59	0	G	NM_018899		140348306	+1	tier1	-	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	19.57	74	18	SNP	0.890	T
PCDHGA11	56105	genome.wustl.edu	37	5	140801607	140801607	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140801607C>T	ENST00000398587.2	+	1	846	c.813C>T	c.(811-813)gaC>gaT	p.D271D	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_Silent_p.D271D|PCDHGA5_ENST00000518069.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGATCCAGACGAGGGAATCA	0.443																																																	0													140.0	141.0	141.0					5																	140801607		1885	4108	5993	SO:0001819	synonymous_variant	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.813C>T	5.37:g.140801607C>T			B7ZVY8|Q9Y5D8|Q9Y5D9	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D271	ENST00000398587.2	37	c.813	CCDS47294.1	5																																																																																			PCDHGA11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253873		0.443	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	-	0.00	29	0	C	NM_018914		140801607	+1	tier1	-	no_errors	ENST00000398587	ensembl	human	known	74_37	silent	18.52	44	10	SNP	1.000	T
PCDHGB1	56104	genome.wustl.edu	37	5	140730363	140730363	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140730363C>T	ENST00000523390.1	+	1	536	c.536C>T	c.(535-537)aCg>aTg	p.T179M	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T179K(1)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTCTGTCAACGAAGGAAAGT	0.438																																																	1	Substitution - Missense(1)	endometrium(1)											181.0	177.0	179.0					5																	140730363		1882	4112	5994	SO:0001583	missense	0			AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.536C>T	5.37:g.140730363C>T	ENSP00000429273:p.Thr179Met		Q3SY75|Q9Y5C8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T179M	ENST00000523390.1	37	c.536	CCDS54923.1	5	.	.	.	.	.	.	.	.	.	.	.	10.61	1.398429	0.25205	.	.	ENSG00000254221	ENST00000523390	T	0.55760	0.5	5.36	0.994	0.19832	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.33847	0.0877	N	0.25426	0.745	0.09310	N	1	B;B	0.26363	0.014;0.147	B;B	0.22753	0.016;0.041	T	0.26950	-1.0088	9	0.62326	D	0.03	.	3.5594	0.07877	0.1819:0.3255:0.0:0.4926	.	179;179	Q9Y5G3-2;Q9Y5G3	.;PCDGD_HUMAN	M	179	ENSP00000429273:T179M	ENSP00000429273:T179M	T	+	2	0	PCDHGB1	140710547	0.000000	0.05858	0.485000	0.27403	0.984000	0.73092	-0.313000	0.08103	0.339000	0.23719	0.563000	0.77884	ACG	PCDHGB1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000254221		0.438	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB1	HGNC	protein_coding	OTTHUMT00000374740.1	-	0.00	29	0	C	NM_018922		140730363	+1	tier1	-	no_errors	ENST00000523390	ensembl	human	known	74_37	missense	30.00	21	9	SNP	0.013	T
PCDHGA5	56110	genome.wustl.edu	37	5	140744501	140744501	+	Missense_Mutation	SNP	C	C	T	rs375711929		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140744501C>T	ENST00000518069.1	+	1	604	c.604C>T	c.(604-606)Cgc>Tgc	p.R202C	PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	202	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R202C(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCCCTAGACCGCGAGAAAGA	0.562																																																	1	Substitution - Missense(1)	endometrium(1)						C	,,,,CYS/ARG,,,CYS/ARG	0,4038		0,0,2019	64.0	65.0	65.0		,,,,604,,,604	5.5	1.0	5		65	1,8347		0,1,4173	no	intron,intron,intron,intron,missense,intron,intron,missense	PCDHGB2,PCDHGB1,PCDHGA5,PCDHGA4,PCDHGA3,PCDHGA2,PCDHGA1	NM_018912.2,NM_018915.2,NM_018916.3,NM_018917.2,NM_018918.2,NM_018922.2,NM_018923.2,NM_032054.1	,,,,180,,,180	0,1,6192	TT,TC,CC		0.012,0.0,0.0081	,,,,,,,	,,,,202/932,,,202/814	140744501	1,12385	2019	4174	6193	SO:0001583	missense	0			AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.604C>T	5.37:g.140744501C>T	ENSP00000429834:p.Arg202Cys		Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R202C	ENST00000518069.1	37	c.604	CCDS54925.1	5	.	.	.	.	.	.	.	.	.	.	.	18.39	3.614291	0.66672	0.0	1.2E-4	ENSG00000253485	ENST00000518069	T	0.59772	0.24	5.52	5.52	0.82312	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.83285	0.5221	H	0.96518	3.835	0.45607	D	0.998544	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87943	0.2718	9	0.87932	D	0	.	15.0931	0.72211	0.1424:0.8576:0.0:0.0	.	202;202	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	C	202	ENSP00000429834:R202C	ENSP00000429834:R202C	R	+	1	0	PCDHGA5	140724685	0.469000	0.25846	1.000000	0.80357	0.991000	0.79684	0.695000	0.25527	2.756000	0.94617	0.563000	0.77884	CGC	PCDHGA5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253485		0.562	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA5	HGNC	protein_coding	OTTHUMT00000374742.1	-	0.00	27	0	C	NM_018918		140744501	+1	tier1	-	no_errors	ENST00000518069	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	T
PCDHGA8	9708	genome.wustl.edu	37	5	140774174	140774174	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140774174G>A	ENST00000398604.2	+	1	1794	c.1794G>A	c.(1792-1794)tcG>tcA	p.S598S	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	598	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGAGACTCGGGCCAGAACG	0.711																																																	0													28.0	34.0	32.0					5																	140774174		2198	4295	6493	SO:0001819	synonymous_variant	0			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1794G>A	5.37:g.140774174G>A			A7MCZ4|O15039	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S598	ENST00000398604.2	37	c.1794	CCDS47291.1	5																																																																																			PCDHGA8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253767		0.711	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	HGNC	protein_coding	OTTHUMT00000376972.1	-	0.00	73	0	G	NM_032088		140774174	+1	tier1	-	no_errors	ENST00000398604	ensembl	human	known	74_37	silent	18.05	108	24	SNP	0.296	A
PCDHGA12	26025	genome.wustl.edu	37	5	140811293	140811293	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:140811293G>C	ENST00000252085.3	+	1	1109	c.967G>C	c.(967-969)Gat>Cat	p.D323H	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA9_ENST00000573521.1_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	323	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAAGCAATGGATAATGCAGG	0.488																																																	0													164.0	153.0	157.0					5																	140811293		2203	4300	6503	SO:0001583	missense	0			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.967G>C	5.37:g.140811293G>C	ENSP00000252085:p.Asp323His		O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D323H	ENST00000252085.3	37	c.967	CCDS4260.1	5	.	.	.	.	.	.	.	.	.	.	g	19.09	3.760019	0.69763	.	.	ENSG00000253159	ENST00000252085	T	0.80824	-1.42	4.85	4.85	0.62838	Cadherin (5);Cadherin-like (1);	.	.	.	.	D	0.95020	0.8388	H	0.99855	4.85	0.39816	D	0.972774	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98194	1.0464	9	0.87932	D	0	.	17.7569	0.88451	0.0:0.0:1.0:0.0	.	323;323	O60330-2;O60330	.;PCDGC_HUMAN	H	323	ENSP00000252085:D323H	ENSP00000252085:D323H	D	+	1	0	PCDHGA12	140791477	1.000000	0.71417	0.200000	0.23457	0.990000	0.78478	5.810000	0.69179	2.519000	0.84933	0.655000	0.94253	GAT	PCDHGA12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253159		0.488	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA12	HGNC	protein_coding	OTTHUMT00000251806.2	-	0.00	23	0	G	NM_003735		140811293	+1	tier1	-	no_errors	ENST00000252085	ensembl	human	known	74_37	missense	14.58	41	7	SNP	0.998	C
PCNXL3	399909	genome.wustl.edu	37	11	65391823	65391823	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:65391823G>A	ENST00000355703.3	+	14	3241	c.2702G>A	c.(2701-2703)cGa>cAa	p.R901Q		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	901						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						TTCTGTGCCCGAGACGTGGCC	0.662																																																	0													42.0	47.0	46.0					11																	65391823		2095	4200	6295	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2702G>A	11.37:g.65391823G>A	ENSP00000347931:p.Arg901Gln		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.R901Q	ENST00000355703.3	37	c.2702	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.299870	0.95574	.	.	ENSG00000197136	ENST00000355703	T	0.67865	-0.29	4.75	4.75	0.60458	.	.	.	.	.	T	0.77082	0.4078	M	0.62723	1.935	0.43988	D	0.996682	D	0.64830	0.994	P	0.61201	0.885	T	0.79040	-0.1966	9	0.54805	T	0.06	.	15.2199	0.73303	0.0:0.0:1.0:0.0	.	901	Q9H6A9	PCX3_HUMAN	Q	901	ENSP00000347931:R901Q	ENSP00000347931:R901Q	R	+	2	0	PCNXL3	65148399	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.926000	0.92839	2.199000	0.70637	0.462000	0.41574	CGA	PCNXL3	-	NULL	ENSG00000197136		0.662	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	35	0	G	NM_032223		65391823	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	20.34	47	12	SNP	1.000	A
PCYT1A	5130	genome.wustl.edu	37	3	195994152	195994152	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:195994152G>A	ENST00000292823.2	-	3	290				RP11-447L10.1_ENST00000431391.1_Intron|PCYT1A_ENST00000419333.1_Intron|PCYT1A_ENST00000431016.1_Intron|PCYT1A_ENST00000491544.1_Intron	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	accacataccgtatgatgtca	0.408																																																	0																																										SO:0001627	intron_variant	0			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.117+3133C>T	3.37:g.195994152G>A			A9LYK9|D3DXB1|Q86Y88	Missense_Mutation	SNP	NULL	p.R68W	ENST00000292823.2	37	c.202	CCDS3315.1	3																																																																																			PCYT1A	-	NULL	ENSG00000161217		0.408	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1A	HGNC	protein_coding	OTTHUMT00000341147.1	-	0.00	31	0	G	NM_005017		195994152	-1	tier1	-	no_errors	ENST00000438634	ensembl	human	known	74_37	missense	58.00	21	29	SNP	0.008	A
PDE3A	5139	genome.wustl.edu	37	12	20833381	20833381	+	3'UTR	SNP	A	A	C	rs556150893		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:20833381A>C	ENST00000359062.3	+	0	3642				PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	ATTGTTAAAAACTTTTTGCTC	0.348													A|||	1	0.000199681	0.0	0.0014	5008	,	,		17263	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.*176A>C	12.37:g.20833381A>C			O60865|Q13348|Q17RD1	RNA	SNP	-	NULL	ENST00000359062.3	37	NULL	CCDS31754.1	12																																																																																			PDE3A	-	-	ENSG00000172572		0.348	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	56	0	A			20833381	+1	tier1	-	no_errors	ENST00000544307	ensembl	human	known	74_37	rna	40.00	51	34	SNP	0.630	C
PHF14	9678	genome.wustl.edu	37	7	11030418	11030418	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:11030418G>A	ENST00000403050.3	+	4	1441	c.989G>A	c.(988-990)aGt>aAt	p.S330N	PHF14_ENST00000445996.2_Missense_Mutation_p.S45N	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	330					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GGAGATAATAGTGAGGACGCT	0.373																																																	0													116.0	106.0	109.0					7																	11030418		1876	4125	6001	SO:0001583	missense	0			AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.989G>A	7.37:g.11030418G>A	ENSP00000385795:p.Ser330Asn		A7MCZ3|B4DI82	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S330N	ENST00000403050.3	37	c.989	CCDS47542.1	7	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014917	0.75161	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	D;D	0.87412	-2.25;-2.25	5.08	5.08	0.68730	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.93887	0.8044	M	0.87097	2.86	0.80722	D	1	D;D;D;B	0.62365	0.981;0.985;0.991;0.375	D;D;D;B	0.76575	0.916;0.95;0.988;0.138	D	0.92058	0.5654	10	0.20046	T	0.44	.	18.86	0.92268	0.0:0.0:1.0:0.0	.	45;45;330;330	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	N	330;45	ENSP00000385795:S330N;ENSP00000403907:S45N	ENSP00000385795:S330N	S	+	2	0	PHF14	10996943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.795000	0.99099	2.529000	0.85273	0.585000	0.79938	AGT	PHF14	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000106443		0.373	PHF14-001	KNOWN	basic|CCDS	protein_coding	PHF14	HGNC	protein_coding	OTTHUMT00000318212.1	-	0.00	82	0	G	NM_014660		11030418	+1	tier1	-	no_errors	ENST00000403050	ensembl	human	known	74_37	missense	12.61	104	15	SNP	1.000	A
C10orf55	414236	genome.wustl.edu	37	10	75673432	75673432	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:75673432G>A	ENST00000409178.1	-	3	268				PLAU_ENST00000446342.1_Missense_Mutation_p.R182K|PLAU_ENST00000372762.4_Missense_Mutation_p.R163K|PLAU_ENST00000372764.3_Missense_Mutation_p.R199K|C10orf55_ENST00000412307.2_Intron|PLAU_ENST00000494287.1_3'UTR	NM_001001791.2	NP_001001791.2	Q5SWW7	CJ055_HUMAN	chromosome 10 open reading frame 55											endometrium(1)	1	Prostate(51;0.0112)					ATCTACAGGAGGCACCGGGGG	0.577																																																	0													63.0	75.0	71.0					10																	75673432		2203	4300	6503	SO:0001627	intron_variant	0				CCDS53541.1	10q22.2	2012-05-24			ENSG00000222047	ENSG00000222047			31008	protein-coding gene	gene with protein product							Standard	NM_001001791		Approved	bA417O11.3	uc001jvz.2	Q5SWW7	OTTHUMG00000018496	ENST00000409178.1:c.73-599C>T	10.37:g.75673432G>A			Q3KRG4|Q8NAK4	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Kringle,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,pfscan_EG-like_dom,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R199K	ENST00000409178.1	37	c.596	CCDS53541.1	10	.	.	.	.	.	.	.	.	.	.	G	8.601	0.886799	0.17540	.	.	ENSG00000122861	ENST00000446342;ENST00000372764;ENST00000372762;ENST00000372761	D;D;D	0.88124	-2.34;-2.34;-2.34	5.25	-7.52	0.01341	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.990993	0.08238	N	0.976508	T	0.69378	0.3104	N	0.04724	-0.175	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.06405	0.0;0.001;0.002;0.001	T	0.60459	-0.7259	10	0.08179	T	0.78	.	16.7018	0.85351	0.8291:0.0:0.1709:0.0	.	182;163;199;199	E7ET40;E7ESM2;B2R7F2;P00749	.;.;.;UROK_HUMAN	K	182;199;163;163	ENSP00000388474:R182K;ENSP00000361850:R199K;ENSP00000361848:R163K	ENSP00000361847:R163K	R	+	2	0	PLAU	75343438	0.000000	0.05858	0.004000	0.12327	0.816000	0.46133	-1.192000	0.03052	-1.597000	0.01609	-0.143000	0.13931	AGG	PLAU	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000122861		0.577	C10orf55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAU	HGNC	protein_coding	OTTHUMT00000048746.1		0.00	20	0	G	NM_001001791		75673432	+1			no_errors	ENST00000372764	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.000	A
PLCZ1	89869	genome.wustl.edu	37	12	18854523	18854523	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:18854523T>G	ENST00000538330.1	-	5	656	c.275A>C	c.(274-276)gAa>gCa	p.E92A	PLCZ1_ENST00000447925.2_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000539875.1_Intron|PLCZ1_ENST00000266505.7_Intron|PLCZ1_ENST00000542762.1_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTCCAATACTTCTGATTCTTT	0.453																																																	0													154.0	150.0	151.0					12																	18854523		2203	4300	6503	SO:0001583	missense	0			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.275A>C	12.37:g.18854523T>G	ENSP00000445880:p.Glu92Ala			Missense_Mutation	SNP	pfam_PLipase_C_Pinositol-sp_Y,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E92A	ENST00000538330.1	37	c.275		12	.	.	.	.	.	.	.	.	.	.	T	3.019	-0.202128	0.06219	.	.	ENSG00000139151	ENST00000538330	T	0.11169	2.8	5.09	3.89	0.44902	.	.	.	.	.	T	0.06690	0.0171	.	.	.	0.09310	N	0.999996	B	0.25667	0.131	B	0.22386	0.039	T	0.40515	-0.9559	7	.	.	.	.	7.0198	0.24908	0.0:0.1175:0.0:0.8825	.	92	Q8N7S5	.	A	92	ENSP00000445880:E92A	.	E	-	2	0	PLCZ1	18745790	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.773000	0.26661	0.829000	0.34733	0.377000	0.23210	GAA	PLCZ1	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000139151		0.453	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401666.3	-	0.00	31	0	T	NM_033123		18854523	-1	tier1	-	no_errors	ENST00000538330	ensembl	human	putative	74_37	missense	14.81	46	8	SNP	0.002	G
PLG	5340	genome.wustl.edu	37	6	161132264	161132264	+	Intron	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:161132264A>T	ENST00000308192.9	+	4	470				PLG_ENST00000462918.1_Intron|PLG_ENST00000366924.2_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCTACTGTAAagttgtccctc	0.433																																																	0													57.0	50.0	53.0					6																	161132264		2202	4300	6502	SO:0001627	intron_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.407+41A>T	6.37:g.161132264A>T			Q15146|Q5TEH4|Q6PA00	RNA	SNP	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			PLG	-	-	ENSG00000122194		0.433	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	-	0.00	146	0	A	NM_000301		161132264	+1	tier1	-	no_errors	ENST00000494325	ensembl	human	known	74_37	rna	52.94	88	99	SNP	0.023	T
PLOD3	8985	genome.wustl.edu	37	7	100860513	100860515	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	GCA	GCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:100860513_100860515delGCA	ENST00000223127.3	-	1	439_441	c.41_43delTGC	c.(40-45)ctgccg>ccg	p.L14del	ZNHIT1_ENST00000305105.2_5'Flank	NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	14					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	agcagcagcggcagcagcagcag	0.744																																																	0										16,2378		4,8,1185						0.9	0.9			6	23,4829		5,13,2408	no	coding	PLOD3	NM_001084.4		9,21,3593	A1A1,A1R,RR		0.474,0.6683,0.5382				39,7207				SO:0001651	inframe_deletion	0			AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.41_43delTGC	7.37:g.100860522_100860524delGCA	ENSP00000223127:p.Leu14del		B2R6W6|Q540C3	In_Frame_Del	DEL	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.L14in_frame_del	ENST00000223127.3	37	c.43_41	CCDS5715.1	7																																																																																			PLOD3	-	NULL	ENSG00000106397		0.744	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	HGNC	protein_coding	OTTHUMT00000347470.1		0.00	9	0	GCA			100860515	-1	tier1		no_errors	ENST00000223127	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	0.998:0.985:0.992	-
PLVAP	83483	genome.wustl.edu	37	19	17476700	17476700	+	Missense_Mutation	SNP	C	C	T	rs151286294		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:17476700C>T	ENST00000252590.4	-	3	635	c.574G>A	c.(574-576)Gtg>Atg	p.V192M		NM_031310.1	NP_112600.1	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	192					MAPK cascade (GO:0000165)|positive regulation of cellular extravasation (GO:0002693)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						TCCTCCGCCACGCGTTTGTTC	0.547																																																	0								C	MET/VAL	0,4406		0,0,2203	73.0	70.0	71.0		574	-4.3	0.0	19	dbSNP_134	71	1,8599	1.2+/-3.3	0,1,4299	yes	missense	PLVAP	NM_031310.1	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	192/443	17476700	1,13005	2203	4300	6503	SO:0001583	missense	0			AF326591	CCDS32952.1	19p13.2	2008-07-17				ENSG00000130300			13635	protein-coding gene	gene with protein product	"""fenestrated-endothelial linked structure protein; PV-1 protein"""	607647				11401446	Standard	NM_031310		Approved	gp68, PV-1, PV1, FELS	uc002ngk.1	Q9BX97		ENST00000252590.4:c.574G>A	19.37:g.17476700C>T	ENSP00000252590:p.Val192Met		Q86VP0|Q8N8Y0|Q8ND68|Q8TER8|Q9BZD5	Missense_Mutation	SNP	pfam_PV-1	p.V192M	ENST00000252590.4	37	c.574	CCDS32952.1	19	.	.	.	.	.	.	.	.	.	.	C	8.047	0.765233	0.15914	0.0	1.16E-4	ENSG00000130300	ENST00000252590	.	.	.	4.74	-4.33	0.03677	.	1.830820	0.02399	N	0.080429	T	0.22820	0.0551	N	0.12182	0.205	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.14699	-1.0463	9	0.29301	T	0.29	-17.0697	6.4545	0.21922	0.0:0.3689:0.4107:0.2203	.	192	Q9BX97	PLVAP_HUMAN	M	192	.	ENSP00000252590:V192M	V	-	1	0	PLVAP	17337700	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-3.762000	0.00373	-0.380000	0.07894	-0.786000	0.03341	GTG	PLVAP	-	pfam_PV-1	ENSG00000130300		0.547	PLVAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLVAP	HGNC	protein_coding	OTTHUMT00000463655.1	-	0.00	50	0	C	NM_031310		17476700	-1	tier1	rs151286294	no_errors	ENST00000252590	ensembl	human	known	74_37	missense	21.31	48	13	SNP	0.000	T
PLXNB1	5364	genome.wustl.edu	37	3	48465421	48465421	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:48465421A>T	ENST00000358536.4	-	3	869	c.600T>A	c.(598-600)taT>taA	p.Y200*	PLXNB1_ENST00000456774.1_Nonsense_Mutation_p.Y200*|PLXNB1_ENST00000296440.6_Nonsense_Mutation_p.Y200*|PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000358459.4_Nonsense_Mutation_p.Y200*	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	200	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CTGTCTCCTCATAGGAGAAGG	0.652																																																	0													14.0	16.0	15.0					3																	48465421		2201	4300	6501	SO:0001587	stop_gained	0			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.600T>A	3.37:g.48465421A>T	ENSP00000351338:p.Tyr200*		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Nonsense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.Y200*	ENST00000358536.4	37	c.600	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	A	17.13	3.311221	0.60414	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	.	.	.	4.41	-2.57	0.06248	.	0.354098	0.26923	N	0.021819	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.2822	0.49201	0.5298:0.0:0.4702:0.0	.	.	.	.	X	200	.	ENSP00000296440:Y200X	Y	-	3	2	PLXNB1	48440425	0.452000	0.25713	0.991000	0.47740	0.838000	0.47535	-0.237000	0.08990	-0.524000	0.06400	-0.353000	0.07706	TAT	PLXNB1	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000164050		0.652	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	HGNC	protein_coding	OTTHUMT00000344454.1		0.00	23	0	A	NM_002673		48465421	-1			no_errors	ENST00000296440	ensembl	human	known	74_37	nonsense	23.68	29	9	SNP	0.990	T
PMP22	5376	genome.wustl.edu	37	17	15162444	15162444	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:15162444T>G	ENST00000395938.2	-	3	339	c.145A>C	c.(145-147)Aat>Cat	p.N49H	PMP22_ENST00000494511.1_Intron|PMP22_ENST00000312280.3_Missense_Mutation_p.N49H|PMP22_ENST00000395936.1_Missense_Mutation_p.N49H|PMP22_ENST00000426385.3_Missense_Mutation_p.N49H|RP11-849N15.1_ENST00000579159.1_RNA	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22	49					cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		TGGTGGACATTTCCTGAGGAA	0.507																																																	0													205.0	157.0	173.0					17																	15162444		2203	4300	6503	SO:0001583	missense	0			D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.145A>C	17.37:g.15162444T>G	ENSP00000379269:p.Asn49His		Q8WV01	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22,prints_PMP22_EMP_MP20	p.N49H	ENST00000395938.2	37	c.145	CCDS11168.1	17	.	.	.	.	.	.	.	.	.	.	T	9.136	1.012616	0.19277	.	.	ENSG00000109099	ENST00000395938;ENST00000312280;ENST00000426385;ENST00000395936	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	4.75	3.67	0.42095	.	1.043520	0.07554	N	0.915899	D	0.85592	0.5732	L	0.48642	1.525	0.09310	N	1	P	0.47191	0.891	B	0.42959	0.403	T	0.73720	-0.3894	10	0.42905	T	0.14	-10.6659	6.5275	0.22309	0.0:0.1108:0.0:0.8892	.	49	Q01453	PMP22_HUMAN	H	49	ENSP00000379269:N49H;ENSP00000308937:N49H;ENSP00000409824:N49H;ENSP00000379268:N49H	ENSP00000308937:N49H	N	-	1	0	PMP22	15103169	0.000000	0.05858	0.006000	0.13384	0.178000	0.23041	0.550000	0.23345	0.959000	0.37980	0.460000	0.39030	AAT	PMP22	-	pfam_PMP22/EMP/MP20/Claudin,prints_PMP22	ENSG00000109099		0.507	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	HGNC	protein_coding	OTTHUMT00000130378.1	-	0.00	52	0	T	NM_000304		15162444	-1	tier1	-	no_errors	ENST00000312280	ensembl	human	known	74_37	missense	30.56	25	11	SNP	0.024	G
PMPCA	23203	genome.wustl.edu	37	9	139310802	139310802	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:139310802C>T	ENST00000371717.3	+	6	601	c.592C>T	c.(592-594)Cgg>Tgg	p.R198W	PMPCA_ENST00000462616.1_3'UTR|PMPCA_ENST00000399219.3_Missense_Mutation_p.R67W|PMPCA_ENST00000371720.1_3'UTR	NM_001282946.1|NM_015160.1	NP_001269875.1|NP_055975.1	Q10713	MPPA_HUMAN	peptidase (mitochondrial processing) alpha	198					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|proteolysis (GO:0006508)	extracellular space (GO:0005615)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|urinary_tract(1)	14		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;9.3e-06)|Epithelial(140;1.15e-05)		CCTGAACCTGCGGCCTGACCC	0.562																																																	0													97.0	90.0	92.0					9																	139310802		2203	4300	6503	SO:0001583	missense	0			D21064	CCDS35180.1, CCDS65192.1	9q34.3	2008-02-05	2003-06-13	2003-06-20	ENSG00000165688	ENSG00000165688			18667	protein-coding gene	gene with protein product		613036	"""inositol polyphosphate-5-phosphatase, 72 kD"""	INPP5E		8590280, 7788527	Standard	NM_015160		Approved	KIAA0123, Alpha-MPP	uc004chl.3	Q10713	OTTHUMG00000020926	ENST00000371717.3:c.592C>T	9.37:g.139310802C>T	ENSP00000360782:p.Arg198Trp		B4DKL3|E7ET61|Q16639|Q5SXM9|Q8N513	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.R198W	ENST00000371717.3	37	c.592	CCDS35180.1	9	.	.	.	.	.	.	.	.	.	.	C	20.5	4.009012	0.75046	.	.	ENSG00000165688	ENST00000371717;ENST00000399219	T;T	0.18174	2.23;2.23	5.34	2.1	0.27182	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);Peptidase M16, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45216	0.1331	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.81914	0.953;0.978;0.995;0.995	T	0.52756	-0.8533	10	0.87932	D	0	.	13.7051	0.62633	0.7732:0.2268:0.0:0.0	.	67;198;198;198	B4DKL3;B4DRK5;Q5SXM9;Q10713	.;.;.;MPPA_HUMAN	W	198;67	ENSP00000360782:R198W;ENSP00000416702:R67W	ENSP00000360782:R198W	R	+	1	2	PMPCA	138430623	1.000000	0.71417	0.925000	0.36789	0.864000	0.49448	3.774000	0.55341	0.231000	0.21079	0.655000	0.94253	CGG	PMPCA	-	pfam_Pept_M16_N,superfamily_Metalloenz_LuxS/M16	ENSG00000165688		0.562	PMPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMPCA	HGNC	protein_coding	OTTHUMT00000055054.1	-	0.00	26	0	C	NM_015160		139310802	+1	tier1	-	no_errors	ENST00000371717	ensembl	human	known	74_37	missense	24.44	34	11	SNP	1.000	T
POSTN	10631	genome.wustl.edu	37	13	38159038	38159038	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr13:38159038G>T	ENST00000379747.4	-	8	1040	c.923C>A	c.(922-924)aCt>aAt	p.T308N	POSTN_ENST00000541481.1_Missense_Mutation_p.T308N|POSTN_ENST00000541179.1_Missense_Mutation_p.T308N|POSTN_ENST00000379743.4_Missense_Mutation_p.T308N|POSTN_ENST00000379749.4_Missense_Mutation_p.T308N|POSTN_ENST00000379742.4_Missense_Mutation_p.T308N	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	308	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		ACACTGGAGAGTATTTAAGAT	0.388																																																	0													106.0	100.0	102.0					13																	38159038		2203	4300	6503	SO:0001583	missense	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.923C>A	13.37:g.38159038G>T	ENSP00000369071:p.Thr308Asn		B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Missense_Mutation	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.T308N	ENST00000379747.4	37	c.923	CCDS9364.1	13	.	.	.	.	.	.	.	.	.	.	G	13.74	2.325857	0.41197	.	.	ENSG00000133110	ENST00000541179;ENST00000379749;ENST00000379747;ENST00000379743;ENST00000379742;ENST00000541481;ENST00000538347	D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	5.41	5.41	0.78517	FAS1 domain (5);	0.050337	0.85682	D	0.000000	D	0.84474	0.5480	N	0.03608	-0.345	0.36010	D	0.837994	P;P;P;P;P;B;P	0.47762	0.863;0.734;0.741;0.835;0.9;0.036;0.741	P;P;P;P;P;B;P	0.49799	0.622;0.487;0.507;0.487;0.487;0.01;0.507	D	0.85542	0.1216	10	0.18710	T	0.47	.	19.2193	0.93790	0.0:0.0:1.0:0.0	.	308;308;308;308;308;308;308	C0IMJ4;F5H628;B1ALD8;Q15063-3;Q15063-4;Q15063-2;Q15063	.;.;.;.;.;.;POSTN_HUMAN	N	308;308;308;308;308;308;225	ENSP00000437959:T308N;ENSP00000369073:T308N;ENSP00000369071:T308N;ENSP00000369067:T308N;ENSP00000369066:T308N;ENSP00000437953:T308N	ENSP00000369066:T308N	T	-	2	0	POSTN	37057038	1.000000	0.71417	0.623000	0.29173	0.882000	0.50991	4.441000	0.59981	2.524000	0.85096	0.655000	0.94253	ACT	POSTN	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_FAS1_domain	ENSG00000133110		0.388	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	-	0.00	57	0	G	NM_006475		38159038	-1	tier1	-	no_errors	ENST00000379747	ensembl	human	known	74_37	missense	6.76	69	5	SNP	0.820	T
PPME1	51400	genome.wustl.edu	37	11	73936250	73936250	+	Splice_Site	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:73936250G>T	ENST00000328257.8	+	5	670	c.347G>T	c.(346-348)gGt>gTt	p.G116V	PPME1_ENST00000398427.4_Splice_Site_p.G116V			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	116					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					ttCATTTTAGGTGAAACAAAG	0.308																																																	0													46.0	42.0	43.0					11																	73936250		1785	4041	5826	SO:0001630	splice_region_variant	0				CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.347-1G>T	11.37:g.73936250G>T			B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	pirsf_PPase_methylesterase_euk	p.G116V	ENST00000328257.8	37	c.347	CCDS44678.1	11	.	.	.	.	.	.	.	.	.	.	G	26.7	4.763661	0.89932	.	.	ENSG00000214517	ENST00000328257;ENST00000398427	D;D	0.83335	-1.71;-1.71	5.93	5.93	0.95920	.	0.090270	0.85682	D	0.000000	D	0.94351	0.8184	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.95440	0.8524	9	.	.	.	.	18.8972	0.92429	0.0:0.0:1.0:0.0	.	116	Q9Y570	PPME1_HUMAN	V	116	ENSP00000329867:G116V;ENSP00000381461:G116V	.	G	+	2	0	PPME1	73613898	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	9.441000	0.97557	2.818000	0.97014	0.591000	0.81541	GGT	PPME1	-	pirsf_PPase_methylesterase_euk	ENSG00000214517		0.308	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PPME1	HGNC	protein_coding	OTTHUMT00000398254.1	-	0.00	27	0	G	NM_016147	Missense_Mutation	73936250	+1	tier1	-	no_errors	ENST00000328257	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
PPP1R1A	5502	genome.wustl.edu	37	12	54975838	54975838	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:54975838C>T	ENST00000257905.8	-	5	495	c.325G>A	c.(325-327)Gaa>Aaa	p.E109K	PPP1R1A_ENST00000547431.1_Intron	NM_006741.3	NP_006732	Q13522	PPR1A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1A	109			E -> G (in dbSNP:rs1249958). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:8611507, ECO:0000269|Ref.2, ECO:0000269|Ref.3}.		glycogen metabolic process (GO:0005977)|negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein serine/threonine phosphatase inhibitor activity (GO:0004865)			lung(2)	2						TCCTGGGTTTCTGTGCTCTCA	0.597																																																	0													65.0	68.0	67.0					12																	54975838		1917	4124	6041	SO:0001583	missense	0			U48707	CCDS44912.1	12q13.2	2012-04-17			ENSG00000135447	ENSG00000135447	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9286	protein-coding gene	gene with protein product		613246				8611507	Standard	NM_006741		Approved		uc001sgg.2	Q13522	OTTHUMG00000169934	ENST00000257905.8:c.325G>A	12.37:g.54975838C>T	ENSP00000257905:p.Glu109Lys		Q6IB01|Q8TBJ2|Q8WWV2	Missense_Mutation	SNP	pfam_PPI_1DARPP-32	p.E109K	ENST00000257905.8	37	c.325	CCDS44912.1	12	.	.	.	.	.	.	.	.	.	.	C	7.464	0.645356	0.14451	.	.	ENSG00000135447	ENST00000257905	T	0.34667	1.35	5.28	4.39	0.52855	.	0.519085	0.18141	N	0.150407	T	0.17365	0.0417	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.16722	0.016	T	0.21895	-1.0232	10	0.08837	T	0.75	.	10.1776	0.42948	0.0:0.9073:0.0:0.0927	.	109	Q13522	PPR1A_HUMAN	K	109	ENSP00000257905:E109K	ENSP00000257905:E109K	E	-	1	0	PPP1R1A	53262105	0.131000	0.22433	0.978000	0.43139	0.120000	0.20174	1.789000	0.38724	1.365000	0.46057	0.655000	0.94253	GAA	PPP1R1A	-	pfam_PPI_1DARPP-32	ENSG00000135447		0.597	PPP1R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R1A	HGNC	protein_coding	OTTHUMT00000406604.1		0.00	24	0	C	NM_006741		54975838	-1			no_errors	ENST00000257905	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.149	T
PPP2R5B	5526	genome.wustl.edu	37	11	64695824	64695824	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:64695824C>T	ENST00000164133.2	+	6	1271	c.649C>T	c.(649-651)Ctg>Ttg	p.L217L		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	217					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						CAAGACCATCCTGCACCGGGT	0.592																																																	0													95.0	83.0	87.0					11																	64695824		2201	4297	6498	SO:0001819	synonymous_variant	0			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.649C>T	11.37:g.64695824C>T			Q13853	Silent	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.L217	ENST00000164133.2	37	c.649	CCDS8085.1	11																																																																																			PPP2R5B	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000068971		0.592	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	-	0.00	41	0	C	NM_006244		64695824	+1	tier1	-	no_errors	ENST00000164133	ensembl	human	known	74_37	silent	47.30	39	35	SNP	1.000	T
PRB2	653247	genome.wustl.edu	37	12	11546493	11546493	+	Silent	SNP	A	A	G	rs549365722	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:11546493A>G	ENST00000389362.4	-	3	554	c.519T>C	c.(517-519)tcT>tcC	p.S173S	PRB2_ENST00000545829.1_5'Flank|PRB1_ENST00000546254.1_Intron	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	173	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGGAGATCGAGAACTTCGGG	0.607													G|||	4	0.000798722	0.0015	0.0	5008	,	,		20131	0.001		0.001	False		,,,				2504	0.0																0													273.0	254.0	261.0					12																	11546493		2199	4299	6498	SO:0001819	synonymous_variant	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.519T>C	12.37:g.11546493A>G			O00599|P02811|P04281	Silent	SNP	NULL	p.S173	ENST00000389362.4	37	c.519	CCDS41757.2	12																																																																																			PRB2	-	NULL	ENSG00000121335		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2		0.00	76	0	A	NM_006248		11546493	-1			no_errors	ENST00000389362	ensembl	human	known	74_37	silent	5.03	151	8	SNP	0.002	G
PRDM10	56980	genome.wustl.edu	37	11	129800980	129800980	+	Silent	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:129800980A>G	ENST00000360871.3	-	11	1692	c.1461T>C	c.(1459-1461)caT>caC	p.H487H	PRDM10_ENST00000358825.5_Silent_p.H487H|PRDM10_ENST00000528746.1_Silent_p.H461H|PRDM10_ENST00000423662.2_Silent_p.H401H|PRDM10_ENST00000526082.1_Silent_p.H401H|PRDM10_ENST00000304538.6_Silent_p.H401H	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CGCTCTCTTCATGCTGCGGCT	0.607																																																	0													173.0	159.0	164.0					11																	129800980		2201	4297	6498	SO:0001819	synonymous_variant	0			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1461T>C	11.37:g.129800980A>G			B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H487	ENST00000360871.3	37	c.1461	CCDS8484.1	11																																																																																			PRDM10	-	NULL	ENSG00000170325		0.607	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	-	0.00	112	0	A	NM_199437		129800980	-1	tier1	-	no_errors	ENST00000358825	ensembl	human	known	74_37	silent	52.38	90	99	SNP	0.055	G
PRICKLE2	166336	genome.wustl.edu	37	3	64084955	64084955	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:64084955G>T	ENST00000295902.6	-	8	2892	c.2307C>A	c.(2305-2307)ttC>ttA	p.F769L	PRICKLE2_ENST00000564377.1_Missense_Mutation_p.F825L|PRICKLE2-AS1_ENST00000460946.1_RNA|PRICKLE2-AS1_ENST00000476308.1_RNA|RP11-129B22.1_ENST00000482609.1_RNA	NM_198859.3	NP_942559.1	Q7Z3G6	PRIC2_HUMAN	prickle homolog 2 (Drosophila)	769					establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|neuron projection development (GO:0031175)	apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.F769F(1)		breast(2)|endometrium(1)|large_intestine(9)|liver(1)|lung(10)|ovary(4)|prostate(2)|skin(2)|stomach(1)	32		Lung NSC(201;0.136)		BRCA - Breast invasive adenocarcinoma(55;0.000971)|KIRC - Kidney renal clear cell carcinoma(15;0.00443)|Kidney(15;0.00497)		CATACTCGGCGAAGTAGGGTC	0.612																																																	1	Substitution - coding silent(1)	large_intestine(1)											64.0	67.0	66.0					3																	64084955		2203	4300	6503	SO:0001583	missense	0			AK127839	CCDS2902.1	3p14.3	2006-09-12	2006-09-12		ENSG00000163637	ENSG00000163637			20340	protein-coding gene	gene with protein product		608501	"""prickle-like 2 (Drosophila)"""			12525887	Standard	NM_198859		Approved	DKFZp686D143	uc003dmf.3	Q7Z3G6	OTTHUMG00000158789	ENST00000295902.6:c.2307C>A	3.37:g.64084955G>T	ENSP00000295902:p.Phe769Leu		Q0VF44	Missense_Mutation	SNP	pfam_PET_domain,pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.F769L	ENST00000295902.6	37	c.2307	CCDS2902.1	3	.	.	.	.	.	.	.	.	.	.	G	2.784	-0.252881	0.05829	.	.	ENSG00000163637	ENST00000295902	D	0.84370	-1.84	5.57	1.15	0.20763	.	0.153155	0.46442	N	0.000300	T	0.73590	0.3606	L	0.36672	1.1	0.28166	N	0.928796	B	0.24258	0.1	B	0.19946	0.027	T	0.64659	-0.6355	10	0.59425	D	0.04	-27.9312	4.5515	0.12114	0.3692:0.1683:0.4625:0.0	.	769	Q7Z3G6	PRIC2_HUMAN	L	769	ENSP00000295902:F769L	ENSP00000295902:F769L	F	-	3	2	PRICKLE2	64059995	1.000000	0.71417	0.028000	0.17463	0.164000	0.22412	0.778000	0.26732	0.386000	0.24997	0.655000	0.94253	TTC	PRICKLE2	-	NULL	ENSG00000163637		0.612	PRICKLE2-001	KNOWN	basic|CCDS	protein_coding	PRICKLE2	HGNC	protein_coding	OTTHUMT00000352219.1		0.00	27	0	G	NM_198859		64084955	-1			no_errors	ENST00000295902	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.235	T
PRMT8	56341	genome.wustl.edu	37	12	3692262	3692262	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:3692262G>A	ENST00000382622.3	+	8	1257	c.867G>A	c.(865-867)tcG>tcA	p.S289S	PRMT8_ENST00000452611.2_Silent_p.S280S|PRMT8_ENST00000261252.4_Intron	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	289	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			AAGAGCTATCGTTCACATCTG	0.502																																																	0													137.0	109.0	119.0					12																	3692262		2203	4300	6503	SO:0001819	synonymous_variant	0			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.867G>A	12.37:g.3692262G>A			B2RDP0|Q8TBJ8	Silent	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_tRNA_Trfase_Trm5/Tyw2	p.S289	ENST00000382622.3	37	c.867	CCDS8521.2	12																																																																																			PRMT8	-	pfam_Arg_MeTrfase	ENSG00000111218		0.502	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT8	HGNC	protein_coding	OTTHUMT00000250297.2	-	0.00	68	0	G	NM_019854		3692262	+1	tier1	-	no_errors	ENST00000382622	ensembl	human	known	74_37	silent	63.64	12	21	SNP	0.454	A
PRSS37	136242	genome.wustl.edu	37	7	141537729	141537729	+	Missense_Mutation	SNP	C	C	T	rs146733171		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:141537729C>T	ENST00000350549.3	-	3	732	c.361G>A	c.(361-363)Gcc>Acc	p.A121T	PRSS37_ENST00000438520.1_Missense_Mutation_p.A121T	NM_001008270.2|NM_001171951.1	NP_001008271.2|NP_001165422.1	A4D1T9	PRS37_HUMAN	protease, serine, 37	121	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				binding of sperm to zona pellucida (GO:0007339)|cell migration (GO:0016477)|protein maturation (GO:0051604)	extracellular region (GO:0005576)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(3)	15						TTGGTGGTGGCGAGGGTAAGG	0.542																																																	0								C	THR/ALA,THR/ALA	0,4406		0,0,2203	188.0	158.0	168.0		361,361	3.6	0.0	7	dbSNP_134	168	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PRSS37	NM_001008270.2,NM_001171951.1	58,58	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	121/236,121/235	141537729	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS34764.1	7q34	2010-05-07			ENSG00000165076	ENSG00000165076		"""Serine peptidases / Serine peptidases"""	29211	protein-coding gene	gene with protein product							Standard	NM_001008270		Approved		uc003vws.2	A4D1T9	OTTHUMG00000157174	ENST00000350549.3:c.361G>A	7.37:g.141537729C>T	ENSP00000297767:p.Ala121Thr		B2RPB5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A121T	ENST00000350549.3	37	c.361	CCDS34764.1	7	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246811	0.39697	0.0	1.16E-4	ENSG00000165076	ENST00000350549;ENST00000438520	T;T	0.44881	0.91;0.91	5.45	3.56	0.40772	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.442134	0.21665	N	0.070959	T	0.59569	0.2203	M	0.69358	2.11	0.27504	N	0.951898	D;D	0.58268	0.982;0.982	D;P	0.63597	0.916;0.888	T	0.56372	-0.7990	10	0.72032	D	0.01	.	14.097	0.65029	0.0:0.6973:0.3027:0.0	.	121;121	B7ZMK3;A4D1T9	.;PRS37_HUMAN	T	121	ENSP00000297767:A121T;ENSP00000414461:A121T	ENSP00000297767:A121T	A	-	1	0	PRSS37	141184198	1.000000	0.71417	0.011000	0.14972	0.001000	0.01503	4.589000	0.61006	1.517000	0.48917	-0.176000	0.13171	GCC	PRSS37	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000165076		0.542	PRSS37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS37	HGNC	protein_coding	OTTHUMT00000347763.1	-	0.00	81	0	C	NM_001008270		141537729	-1	tier1	rs146733171	no_errors	ENST00000350549	ensembl	human	known	74_37	missense	23.66	100	31	SNP	0.850	T
PSAT1	29968	genome.wustl.edu	37	9	80916876	80916876	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr9:80916876G>T	ENST00000376588.3	+	3	196	c.128G>T	c.(127-129)aGt>aTt	p.S43I	PSAT1_ENST00000347159.2_Missense_Mutation_p.S43I	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	43					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						ACAGAAATGAGTCACAGGTCA	0.318																																					Colon(34;187 791 10662 18313 37609)												0													129.0	126.0	127.0					9																	80916876		2203	4300	6503	SO:0001583	missense	0			BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.128G>T	9.37:g.80916876G>T	ENSP00000365773:p.Ser43Ile		Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,pirsf_Pser_aminoTfrase,tigrfam_Pser_aminoTfrase_subgr	p.S43I	ENST00000376588.3	37	c.128	CCDS6660.1	9	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562015	0.86335	.	.	ENSG00000135069	ENST00000347159;ENST00000376588	T;T	0.70749	-0.51;-0.51	5.42	5.42	0.78866	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.90017	0.6883	H	0.97051	3.93	0.80722	D	1	D;D	0.76494	0.973;0.999	P;D	0.79108	0.856;0.992	D	0.93176	0.6570	10	0.87932	D	0	-16.8752	19.2521	0.93929	0.0:0.0:1.0:0.0	.	43;43	Q9Y617-2;Q9Y617	.;SERC_HUMAN	I	43	ENSP00000317606:S43I;ENSP00000365773:S43I	ENSP00000317606:S43I	S	+	2	0	PSAT1	80106696	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	8.668000	0.91158	2.542000	0.85734	0.655000	0.94253	AGT	PSAT1	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,pirsf_Pser_aminoTfrase,tigrfam_Pser_aminoTfrase_subgr	ENSG00000135069		0.318	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSAT1	HGNC	protein_coding	OTTHUMT00000052777.1		0.00	69	0	G	NM_021154		80916876	+1			no_errors	ENST00000376588	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
PSG5	5673	genome.wustl.edu	37	19	43683236	43683236	+	Intron	SNP	G	G	A	rs536675616		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:43683236G>A	ENST00000366175.3	-	3	561				PSG5_ENST00000407568.1_Intron|PSG5_ENST00000404580.1_Intron|PSG5_ENST00000342951.6_Intron|PSG5_ENST00000599812.1_Silent_p.T168T|PSG5_ENST00000407356.1_Intron			Q15238	PSG5_HUMAN	pregnancy specific beta-1-glycoprotein 5						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(18)|prostate(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(69;0.00899)				CAGGATCACAGGTTAAGATCA	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18414	0.0		0.0	False		,,,				2504	0.0																0													298.0	276.0	283.0					19																	43683236		875	1989	2864	SO:0001627	intron_variant	0				CCDS12617.1	19q13.2	2013-01-29			ENSG00000204941	ENSG00000204941		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9522	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta 1 glycoprotein"""	176394				2735907	Standard	NM_002781		Approved	FL-NCA-3, PSG	uc002ovx.3	Q15238	OTTHUMG00000151539	ENST00000366175.3:c.431-2936C>T	19.37:g.43683236G>A			Q15239|Q96QJ1|Q9UQ75	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T168	ENST00000366175.3	37	c.504	CCDS12617.1	19																																																																																			PSG5	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000204941		0.522	PSG5-001	KNOWN	basic|CCDS	protein_coding	PSG5	HGNC	protein_coding	OTTHUMT00000323055.1	-	0.00	150	0	G	NM_002781		43683236	-1	tier1	-	no_errors	ENST00000599812	ensembl	human	novel	74_37	silent	17.86	161	35	SNP	0.017	A
PTPRR	5801	genome.wustl.edu	37	12	71092074	71092074	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:71092074G>T	ENST00000283228.2	-	8	1702	c.1250C>A	c.(1249-1251)aCt>aAt	p.T417N	PTPRR_ENST00000549308.1_Missense_Mutation_p.T172N|PTPRR_ENST00000440835.2_Missense_Mutation_p.T172N|PTPRR_ENST00000378778.1_Missense_Mutation_p.T211N|PTPRR_ENST00000342084.4_Missense_Mutation_p.T305N	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	417	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GCGATTTTTAGTTCCATGACG	0.358																																																	0													85.0	86.0	86.0					12																	71092074		2202	4300	6502	SO:0001583	missense	0			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1250C>A	12.37:g.71092074G>T	ENSP00000283228:p.Thr417Asn		B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.T417N	ENST00000283228.2	37	c.1250	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081231	0.76528	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308;ENST00000550661	T;T;T;T;T;T	0.28666	1.6;1.6;1.6;1.6;1.6;1.6	5.79	5.79	0.91817	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.115206	0.38436	N	0.001696	T	0.42810	0.1219	N	0.25060	0.705	0.80722	D	1	D;D;D;D	0.76494	0.963;0.999;0.999;0.999	P;D;D;D	0.68353	0.779;0.928;0.934;0.957	T	0.12578	-1.0542	10	0.30078	T	0.28	-19.3454	20.0341	0.97551	0.0:0.0:1.0:0.0	.	266;305;211;417	B7Z998;F5GXR7;Q15256-4;Q15256	.;.;.;PTPRR_HUMAN	N	172;417;211;305;172;172	ENSP00000391750:T172N;ENSP00000283228:T417N;ENSP00000368054:T211N;ENSP00000339605:T305N;ENSP00000446943:T172N;ENSP00000449616:T172N	ENSP00000283228:T417N	T	-	2	0	PTPRR	69378341	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.454000	0.60068	2.753000	0.94483	0.555000	0.69702	ACT	PTPRR	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000153233		0.358	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	HGNC	protein_coding	OTTHUMT00000404485.1		0.00	43	0	G	NM_002849		71092074	-1			no_errors	ENST00000283228	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
PTPRT	11122	genome.wustl.edu	37	20	40739098	40739098	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:40739098G>T	ENST00000373187.1	-	23	3128	c.3129C>A	c.(3127-3129)cgC>cgA	p.R1043R	PTPRT_ENST00000373198.4_Silent_p.R1062R|PTPRT_ENST00000373184.1_Silent_p.R1053R|PTPRT_ENST00000373190.1_Silent_p.R1042R|PTPRT_ENST00000356100.2_Silent_p.R1052R|PTPRT_ENST00000373201.1_Silent_p.R1033R|PTPRT_ENST00000373193.3_Silent_p.R1046R			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	1043	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				AGTGGAAGAGGCGGAGCTCCC	0.622																																																	0													59.0	70.0	67.0					20																	40739098		1976	4142	6118	SO:0001819	synonymous_variant	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.3129C>A	20.37:g.40739098G>T			A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.R1062	ENST00000373187.1	37	c.3186	CCDS42874.1	20																																																																																			PTPRT	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000196090		0.622	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	20	0	G			40739098	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	silent	23.81	32	10	SNP	0.978	T
PYROXD1	79912	genome.wustl.edu	37	12	21614035	21614035	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:21614035A>C	ENST00000240651.9	+	8	881	c.827A>C	c.(826-828)aAg>aCg	p.K276T	PYROXD1_ENST00000538582.1_Missense_Mutation_p.K205T|PYROXD1_ENST00000545178.1_3'UTR	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	276							oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						AGAATTTTGAAGAAAAAGTCC	0.289																																																	0													41.0	47.0	45.0					12																	21614035		2203	4282	6485	SO:0001583	missense	0			AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.827A>C	12.37:g.21614035A>C	ENSP00000240651:p.Lys276Thr		A6NKI6|B3KWN8|Q9H6P1	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase	p.K276T	ENST00000240651.9	37	c.827	CCDS31755.1	12	.	.	.	.	.	.	.	.	.	.	A	6.514	0.463044	0.12402	.	.	ENSG00000121350	ENST00000240651;ENST00000538582	.	.	.	5.0	3.86	0.44501	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.536026	0.20407	N	0.092937	T	0.31040	0.0784	N	0.08118	0	0.42422	D	0.992641	B	0.22746	0.074	B	0.27380	0.079	T	0.06588	-1.0818	9	0.22109	T	0.4	.	9.7199	0.40297	0.9184:0.0:0.0816:0.0	.	276	Q8WU10	PYRD1_HUMAN	T	276;205	.	ENSP00000240651:K276T	K	+	2	0	PYROXD1	21505302	0.963000	0.33076	0.825000	0.32803	0.381000	0.30169	2.553000	0.45837	0.883000	0.36040	0.528000	0.53228	AAG	PYROXD1	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000121350		0.289	PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYROXD1	HGNC	protein_coding	OTTHUMT00000402363.1	-	0.00	64	0	A	NM_024854		21614035	+1	tier1	-	no_errors	ENST00000240651	ensembl	human	known	74_37	missense	30.77	45	20	SNP	0.452	C
RASGRP3	25780	genome.wustl.edu	37	2	33749506	33749506	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:33749506T>G	ENST00000403687.3	+	9	1438	c.698T>G	c.(697-699)cTt>cGt	p.L233R	RASGRP3_ENST00000402538.3_Missense_Mutation_p.L233R|RASGRP3_ENST00000407811.1_Missense_Mutation_p.L233R	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	233	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					CAGAAGCTCCTTCAGCTCAAA	0.348																																																	0													49.0	47.0	48.0					2																	33749506		1821	4084	5905	SO:0001583	missense	0			AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.698T>G	2.37:g.33749506T>G	ENSP00000384192:p.Leu233Arg		D6W583|O94931|Q53SD7	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.L233R	ENST00000403687.3	37	c.698	CCDS46256.1	2	.	.	.	.	.	.	.	.	.	.	T	7.142	0.581952	0.13749	.	.	ENSG00000152689	ENST00000402538;ENST00000403687;ENST00000407811	T;T;T	0.27890	1.64;1.64;1.64	5.34	5.34	0.76211	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.64402	D	0.000001	T	0.14917	0.0360	N	0.02539	-0.55	0.47862	D	0.999538	B;B	0.21905	0.062;0.062	B;B	0.37451	0.25;0.25	T	0.15492	-1.0435	10	0.02654	T	1	-13.3537	11.9384	0.52886	0.0:0.0:0.145:0.8549	.	233;233	D6W583;Q8IV61	.;GRP3_HUMAN	R	233	ENSP00000385886:L233R;ENSP00000384192:L233R;ENSP00000383917:L233R	ENSP00000385886:L233R	L	+	2	0	RASGRP3	33603010	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.011000	0.49567	2.021000	0.59480	0.533000	0.62120	CTT	RASGRP3	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000152689		0.348	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	RASGRP3	HGNC	protein_coding	OTTHUMT00000325462.2	-	0.00	52	0	T	NM_015376		33749506	+1	tier1	-	no_errors	ENST00000402538	ensembl	human	known	74_37	missense	22.22	49	14	SNP	1.000	G
RBM20	282996	genome.wustl.edu	37	10	112541506	112541506	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:112541506G>A	ENST00000369519.3	+	2	1197	c.1139G>A	c.(1138-1140)cGg>cAg	p.R380Q		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	380					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						GGTGCTGGGCGGAGGGCCAAG	0.597																																																	0													66.0	61.0	62.0					10																	112541506		692	1591	2283	SO:0001583	missense	0			BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1139G>A	10.37:g.112541506G>A	ENSP00000358532:p.Arg380Gln		A6NIP5|B5A868|Q5JVI1	Missense_Mutation	SNP	smart_Znf_U1,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.R380Q	ENST00000369519.3	37	c.1139	CCDS44477.1	10	.	.	.	.	.	.	.	.	.	.	G	14.51	2.557848	0.45590	.	.	ENSG00000203867	ENST00000369519;ENST00000539821	D	0.89681	-2.55	5.33	3.42	0.39159	.	1.010050	0.07958	N	0.981885	T	0.80649	0.4663	N	0.24115	0.695	0.09310	N	0.999998	D	0.58268	0.982	B	0.44085	0.44	T	0.67960	-0.5535	10	0.23302	T	0.38	.	3.8732	0.09045	0.0869:0.1348:0.5645:0.2138	.	380	Q5T481	RBM20_HUMAN	Q	380	ENSP00000358532:R380Q	ENSP00000358532:R380Q	R	+	2	0	RBM20	112531496	0.911000	0.30947	0.959000	0.39883	0.371000	0.29859	1.307000	0.33516	0.577000	0.29470	0.467000	0.42956	CGG	RBM20	-	NULL	ENSG00000203867		0.597	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM20	HGNC	protein_coding	OTTHUMT00000050339.2	-	0.00	55	0	G	NM_001134363		112541506	+1	tier1	-	no_errors	ENST00000369519	ensembl	human	known	74_37	missense	23.53	78	24	SNP	0.215	A
RBMXL1	494115	genome.wustl.edu	37	1	89448841	89448841	+	Silent	SNP	T	T	C	rs150045246		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:89448841T>C	ENST00000321792.5	-	2	1096	c.669A>G	c.(667-669)agA>agG	p.R223R	RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Silent_p.R223R	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	223					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										TTGGGTAATCTCTGCTTGAAT	0.448																																																	0													185.0	168.0	174.0					1																	89448841		2203	4300	6503	SO:0001819	synonymous_variant	0			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.669A>G	1.37:g.89448841T>C				Silent	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.R223	ENST00000321792.5	37	c.669	CCDS716.1	1																																																																																			RBMXL1	-	NULL	ENSG00000213516		0.448	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL1	HGNC	protein_coding	OTTHUMT00000029403.3	-	0.00	107	0	T	NM_019610		89448841	-1	tier1	rs150045246	no_errors	ENST00000321792	ensembl	human	known	74_37	silent	10.43	103	12	SNP	1.000	C
RBMXL1	494115	genome.wustl.edu	37	1	89448896	89448896	+	Missense_Mutation	SNP	A	A	T	rs200284841	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:89448896A>T	ENST00000321792.5	-	2	1041	c.614T>A	c.(613-615)gTt>gAt	p.V205D	RBMXL1_ENST00000413769.1_5'Flank|CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000446900.2_Intron|CCBL2_ENST00000370491.3_Intron|CCBL2_ENST00000370485.2_Intron|RBMXL1_ENST00000399794.2_Missense_Mutation_p.V205D	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	205					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GGACAAATAAACATCTCTACG	0.483																																																	0													169.0	164.0	166.0					1																	89448896		2203	4300	6503	SO:0001583	missense	0			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.614T>A	1.37:g.89448896A>T	ENSP00000318415:p.Val205Asp			Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.V205D	ENST00000321792.5	37	c.614	CCDS716.1	1	.	.	.	.	.	.	.	.	.	.	A	8.453	0.853607	0.17106	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	T;T	0.74421	-0.84;-0.84	1.53	1.53	0.23141	RBM1CTR (1);	0.065194	0.64402	D	0.000010	T	0.24624	0.0597	N	0.11560	0.145	0.43787	D	0.99632	B	0.09022	0.002	B	0.14023	0.01	T	0.35968	-0.9767	10	0.02654	T	1	-6.4505	6.8078	0.23786	1.0:0.0:0.0:0.0	.	205	Q96E39	RBMXL_HUMAN	D	205	ENSP00000318415:V205D;ENSP00000446099:V205D	ENSP00000318415:V205D	V	-	2	0	RBMXL1	89221484	1.000000	0.71417	0.981000	0.43875	0.552000	0.35366	3.264000	0.51553	0.706000	0.31912	0.254000	0.18369	GTT	RBMXL1	-	pfam_RBM1CTR	ENSG00000213516		0.483	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL1	HGNC	protein_coding	OTTHUMT00000029403.3	-	0.00	81	0	A	NM_019610		89448896	-1	tier1	rs200284841	no_errors	ENST00000321792	ensembl	human	known	74_37	missense	11.34	85	11	SNP	1.000	T
REV3L	5980	genome.wustl.edu	37	6	111685107	111685107	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:111685107G>A	ENST00000358835.3	-	17	7282	c.6828C>T	c.(6826-6828)taC>taT	p.Y2276Y	REV3L_ENST00000435970.1_Silent_p.Y2198Y|REV3L_ENST00000368802.3_Silent_p.Y2276Y|REV3L_ENST00000368805.1_Silent_p.Y2276Y|REV3L-IT1_ENST00000411895.1_RNA			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2276					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTTTGAAACCGTAAGTATTGT	0.358								DNA polymerases (catalytic subunits)																																									0													168.0	151.0	157.0					6																	111685107		2203	4300	6503	SO:0001819	synonymous_variant	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6828C>T	6.37:g.111685107G>A			O43214|Q5TC33	Silent	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.Y2276	ENST00000358835.3	37	c.6828	CCDS5091.2	6																																																																																			REV3L	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom	ENSG00000009413		0.358	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	90	0	G	NM_002912		111685107	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	silent	23.47	75	23	SNP	0.949	A
RIMBP2	23504	genome.wustl.edu	37	12	130890731	130890731	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:130890731C>G	ENST00000261655.4	-	17	3146	c.2983G>C	c.(2983-2985)Gat>Cat	p.D995H		NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	995	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TAAAATCCATCTTCATCAATT	0.289																																																	0													54.0	57.0	56.0					12																	130890731		2203	4298	6501	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2983G>C	12.37:g.130890731C>G	ENSP00000261655:p.Asp995His		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.D995H	ENST00000261655.4	37	c.2983	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436389	0.83885	.	.	ENSG00000060709	ENST00000261655;ENST00000536632	T;T	0.57107	0.42;0.42	5.26	5.26	0.73747	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.77705	0.4170	M	0.87547	2.89	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81671	-0.0827	10	0.87932	D	0	-18.5549	19.2114	0.93757	0.0:1.0:0.0:0.0	.	995	O15034	RIMB2_HUMAN	H	995;132	ENSP00000261655:D995H;ENSP00000439030:D132H	ENSP00000261655:D995H	D	-	1	0	RIMBP2	129456684	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.702000	0.84576	2.616000	0.88540	0.563000	0.77884	GAT	RIMBP2	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000060709		0.289	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	-	0.00	37	0	C	NM_015347		130890731	-1	tier1	-	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	24.39	31	10	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	GL000220.1	118067	118067	+	IGR	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrGL000220.1:118067C>T								None (None upstream) : None (None downstream)																							cccgcccaggcggaacgatac	0.672																																																	0																																										SO:0001628	intergenic_variant	0																															GL000220.1.37:g.118067C>T				RNA	SNP	-	NULL		37	NULL		GL000220.1																																																																																			RNA28S5	-	-	ENSG00000266658	0	0.672					RNA28S5	HGNC			-	0.00	11	0	C			118067	+1	tier1	-	no_errors	ENST00000607521	ensembl	human	known	74_37	rna	31.25	22	10	SNP	NULL	T
RNA5-8SP4	100873572	genome.wustl.edu	37	19	24187248	24187248	+	RNA	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:24187248A>T	ENST00000365096.1	-	0	61									RNA, 5.8S ribosomal pseudogene 4																		ACTCACATTAATTCTCACAGC	0.493																																																	0																																												0					19p12	2012-08-07	2012-08-07	2012-08-07	ENSG00000201966	ENSG00000201966			41958	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 4"""	RN5-8S4			Standard	NG_033436		Approved						19.37:g.24187248A>T				RNA	SNP	-	NULL	ENST00000365096.1	37	NULL		19																																																																																			RNA5-8SP4	-	-	ENSG00000201966		0.493	RNA5-8SP4-201	KNOWN	basic	rRNA	RNA5-8SP4	HGNC	rRNA		-	0.00	15	0	A			24187248	-1	tier1	-	no_errors	ENST00000365096	ensembl	human	known	74_37	rna	40.00	12	8	SNP	1.000	T
RNF43	54894	genome.wustl.edu	37	17	56434537	56434537	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:56434537G>A	ENST00000584437.1	-	8	4264				RNF43_ENST00000577716.1_Intron|RNF43_ENST00000583753.1_Intron|RNF43_ENST00000500597.2_Intron|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000577625.1_Intron|RNF43_ENST00000407977.2_Intron|RNF43_ENST00000581868.1_Missense_Mutation_p.S740L			Q68DV7	RNF43_HUMAN	ring finger protein 43						negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ttacaggcatgagccatcaca	0.567																																																	0																																										SO:0001627	intron_variant	0				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.2308+291C>T	17.37:g.56434537G>A			A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S740L	ENST00000584437.1	37	c.2219	CCDS11607.1	17																																																																																			RNF43	-	NULL	ENSG00000108375		0.567	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF43	HGNC	protein_coding	OTTHUMT00000444713.1	-	0.00	14	0	G	NM_017763		56434537	-1	tier1	-	no_errors	ENST00000581868	ensembl	human	putative	74_37	missense	33.33	24	12	SNP	0.027	A
RPL12P38	645688	genome.wustl.edu	37	17	58512502	58512503	+	RNA	DEL	AC	AC	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:58512502_58512503delAC	ENST00000588627.1	-	0	854_855									ribosomal protein L12 pseudogene 38																		CACCAGATGTACACAGTTATCA	0.337																																																	0																																												0					17q23.2	2013-01-23			ENSG00000213228	ENSG00000213228			36838	pseudogene	pseudogene						19123937	Standard	NG_010298		Approved				OTTHUMG00000157897		17.37:g.58512504_58512505delAC				RNA	DEL	-	NULL	ENST00000588627.1	37	NULL		17																																																																																			RPL12P38	-	-	ENSG00000213228		0.337	RPL12P38-002	KNOWN	basic	processed_transcript	RPL12P38	HGNC	pseudogene	OTTHUMT00000449464.1		0.00	13	0	AC	NG_010298		58512503	-1	tier1		no_errors	ENST00000588627	ensembl	human	known	74_37	rna	24.00	19	6	DEL	0.989:0.989	-
RPL6P27	645387	genome.wustl.edu	37	18	6462419	6462419	+	RNA	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr18:6462419G>A	ENST00000583065.1	-	0	479									ribosomal protein L6 pseudogene 27																		TTTTGGTTGAGGTGGCAATGA	0.453																																																	0																																												0					18p11.31	2009-03-11				ENSG00000235552			36133	pseudogene	pseudogene						19123937	Standard	NG_009652		Approved						18.37:g.6462419G>A				RNA	SNP	-	NULL	ENST00000583065.1	37	NULL		18																																																																																			RPL6P27	-	-	ENSG00000235552		0.453	RPL6P27-002	KNOWN	basic	processed_transcript	RPL6P27	HGNC	pseudogene	OTTHUMT00000444194.1	-	0.00	15	0	G	NG_009652		6462419	-1	tier1	-	no_errors	ENST00000583065	ensembl	human	known	74_37	rna	25.00	15	5	SNP	0.999	A
RRH	10692	genome.wustl.edu	37	4	110758747	110758747	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:110758747A>G	ENST00000317735.4	+	5	740	c.706A>G	c.(706-708)Ata>Gta	p.I236V		NM_006583.2	NP_006574.1	O14718	OPSX_HUMAN	retinal pigment epithelium-derived rhodopsin homolog	236					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	12		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		GTCAGATCAGATAGATGTAAC	0.428																																																	0													74.0	64.0	67.0					4																	110758747		2203	4300	6503	SO:0001583	missense	0			AF012270	CCDS3687.1	4q25	2012-08-08			ENSG00000180245	ENSG00000180245		"""GPCR / Class A : Opsin receptors"""	10450	protein-coding gene	gene with protein product	"""peropsin"""	605224				9275222	Standard	NM_006583		Approved	peropsin	uc003hzv.3	O14718	OTTHUMG00000132045	ENST00000317735.4:c.706A>G	4.37:g.110758747A>G	ENSP00000314992:p.Ile236Val		A1A4V2|Q7RTS4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Peropsin,prints_GPCR_Rhodpsn	p.I236V	ENST00000317735.4	37	c.706	CCDS3687.1	4	.	.	.	.	.	.	.	.	.	.	A	2.560	-0.302119	0.05495	.	.	ENSG00000180245	ENST00000317735	T	0.71698	-0.59	5.92	4.14	0.48551	GPCR, rhodopsin-like superfamily (1);	0.475392	0.23589	N	0.046578	T	0.45397	0.1340	N	0.11023	0.085	0.21325	N	0.999728	B	0.02656	0.0	B	0.04013	0.001	T	0.23511	-1.0186	10	0.14656	T	0.56	.	6.4855	0.22087	0.1503:0.0:0.6881:0.1616	.	236	O14718	OPSX_HUMAN	V	236	ENSP00000314992:I236V	ENSP00000314992:I236V	I	+	1	0	RRH	110978196	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.555000	0.45854	0.776000	0.33473	-0.472000	0.04984	ATA	RRH	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Peropsin	ENSG00000180245		0.428	RRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRH	HGNC	protein_coding	OTTHUMT00000255066.1	-	0.00	38	0	A	NM_006583		110758747	+1	tier1	-	no_errors	ENST00000317735	ensembl	human	known	74_37	missense	60.00	18	27	SNP	1.000	G
RTN4RL1	146760	genome.wustl.edu	37	17	1840387	1840387	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:1840387C>T	ENST00000331238.6	-	2	1208	c.729G>A	c.(727-729)ccG>ccA	p.P243P		NM_178568.2	NP_848663.1			reticulon 4 receptor-like 1											breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|prostate(2)|skin(1)	11						GGGCCCCCAGCGGGGCCAGGC	0.667																																					GBM(68;949 1139 14865 32798 38342)												0													19.0	23.0	22.0					17																	1840387		1949	4142	6091	SO:0001819	synonymous_variant	0			AF532859	CCDS45569.1	17p13.3	2008-02-05				ENSG00000185924			21329	protein-coding gene	gene with protein product	"""nogo-66 receptor homolog 2"""	610461					Standard	NM_178568		Approved	NGRH2, NgR3, DKFZp547J144	uc002ftp.3	Q86UN2		ENST00000331238.6:c.729G>A	17.37:g.1840387C>T				Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P243	ENST00000331238.6	37	c.729	CCDS45569.1	17																																																																																			RTN4RL1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000185924		0.667	RTN4RL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4RL1	HGNC	protein_coding	OTTHUMT00000450155.2	-	0.00	83	0	C	NM_178568		1840387	-1	tier1	-	no_errors	ENST00000331238	ensembl	human	known	74_37	silent	20.73	65	17	SNP	0.879	T
RUNX2	860	genome.wustl.edu	37	6	45390460	45390460	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:45390460G>A	ENST00000371438.1	+	2	547	c.189G>A	c.(187-189)caG>caA	p.Q63Q	RUNX2_ENST00000371432.3_Silent_p.Q49Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000352853.5_Silent_p.Q131Q|RUNX2_ENST00000371436.6_Silent_p.Q63Q|RUNX2_ENST00000465038.2_Silent_p.Q63Q|RUNX2_ENST00000576263.1_Silent_p.Q63Q|RUNX2_ENST00000541979.1_Silent_p.Q131Q|RUNX2_ENST00000359524.5_Silent_p.Q49Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	63	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcagcagcaacagc	0.736																																																	0													12.0	17.0	16.0					6																	45390460		1448	3124	4572	SO:0001819	synonymous_variant	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.189G>A	6.37:g.45390460G>A			O14614|O14615|O95181	Silent	SNP	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pfscan_Runt_dom,prints_AML1_Runt	p.Q131	ENST00000371438.1	37	c.393	CCDS43467.2	6																																																																																			RUNX2	-	NULL	ENSG00000124813		0.736	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2		0.00	21	0	G	NM_004348		45390460	+1			no_errors	ENST00000352853	ensembl	human	known	74_37	silent	12.82	34	5	SNP	1.000	A
RXFP1	59350	genome.wustl.edu	37	4	159568033	159568033	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:159568033G>A	ENST00000307765.5	+	16	1687	c.1436G>A	c.(1435-1437)tGg>tAg	p.W479*	RXFP1_ENST00000448688.2_Nonsense_Mutation_p.W374*|RXFP1_ENST00000343542.5_Nonsense_Mutation_p.W431*|RXFP1_ENST00000470033.1_Nonsense_Mutation_p.W446*|RXFP1_ENST00000460056.2_Nonsense_Mutation_p.W398*	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	479					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GCGCAGCTGTGGATGGAGAGT	0.413																																																	0													133.0	124.0	127.0					4																	159568033		1914	4142	6056	SO:0001587	stop_gained	0			AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1436G>A	4.37:g.159568033G>A	ENSP00000303248:p.Trp479*		B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.W479*	ENST00000307765.5	37	c.1436	CCDS43276.1	4	.	.	.	.	.	.	.	.	.	.	G	46	12.447090	0.99668	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.9294	0.97114	0.0:0.0:1.0:0.0	.	.	.	.	X	398;479;374;431;446;349	.	ENSP00000303248:W479X	W	+	2	0	RXFP1	159787483	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.777000	0.99008	2.701000	0.92244	0.650000	0.86243	TGG	RXFP1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Gphrmn_rcpt_fam	ENSG00000171509		0.413	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP1	HGNC	protein_coding	OTTHUMT00000314865.1	-	0.00	56	0	G	NM_021634		159568033	+1	tier1	-	no_errors	ENST00000307765	ensembl	human	known	74_37	nonsense	22.64	41	12	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237947621	237947621	+	Silent	SNP	G	G	A	rs372943408	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:237947621G>A	ENST00000366574.2	+	90	12926	c.12609G>A	c.(12607-12609)gcG>gcA	p.A4203A	RYR2_ENST00000542537.1_Silent_p.A4187A|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.A4209A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4203					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCAGCTGGCGGCTCAGATCT	0.517																																																	0													73.0	78.0	77.0					1																	237947621		2001	4189	6190	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.12609G>A	1.37:g.237947621G>A			Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.A4209	ENST00000366574.2	37	c.12627	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.517	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	30	0	G	NM_001035		237947621	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	silent	76.36	13	42	SNP	0.015	A
SACS	26278	genome.wustl.edu	37	13	23906779	23906779	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr13:23906779C>G	ENST00000382292.3	-	9	11509	c.11236G>C	c.(11236-11238)Gat>Cat	p.D3746H	SACS_ENST00000382298.3_Missense_Mutation_p.D3746H|SACS_ENST00000402364.1_Missense_Mutation_p.D2996H			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3746					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATTACCTTATCAAGAGGAGGA	0.353																																																	0													137.0	114.0	122.0					13																	23906779		2203	4299	6502	SO:0001583	missense	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11236G>C	13.37:g.23906779C>G	ENSP00000371729:p.Asp3746His		O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.D3746H	ENST00000382292.3	37	c.11236	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003189	0.74932	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88741	-2.28;-2.42;-2.28	5.58	5.58	0.84498	.	0.103719	0.64402	D	0.000005	D	0.87330	0.6150	L	0.27053	0.805	0.49130	D	0.999753	P	0.45283	0.855	P	0.46975	0.533	D	0.88882	0.3340	10	0.87932	D	0	.	19.5659	0.95393	0.0:1.0:0.0:0.0	.	3746	Q9NZJ4	SACS_HUMAN	H	3746;2996;3746	ENSP00000371729:D3746H;ENSP00000385844:D2996H;ENSP00000371735:D3746H	ENSP00000371729:D3746H	D	-	1	0	SACS	22804779	1.000000	0.71417	0.998000	0.56505	0.387000	0.30353	7.818000	0.86416	2.619000	0.88677	0.563000	0.77884	GAT	SACS	-	NULL	ENSG00000151835		0.353	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	-	0.00	75	0	C	NM_014363		23906779	-1	tier1	-	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	17.07	136	28	SNP	1.000	G
SAMD9L	219285	genome.wustl.edu	37	7	92760745	92760745	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:92760745T>C	ENST00000318238.4	-	5	5756	c.4540A>G	c.(4540-4542)Aaa>Gaa	p.K1514E	SAMD9L_ENST00000411955.1_Missense_Mutation_p.K1514E|SAMD9L_ENST00000437805.1_Missense_Mutation_p.K1514E	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1514					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)		p.K1514E(1)		central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCATTTTTTTTCCACACATCC	0.403																																																	1	Substitution - Missense(1)	large_intestine(1)											129.0	127.0	128.0					7																	92760745		2203	4300	6503	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.4540A>G	7.37:g.92760745T>C	ENSP00000326247:p.Lys1514Glu		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.K1514E	ENST00000318238.4	37	c.4540	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	T	10.79	1.449131	0.26074	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805;ENST00000394472	T;T;T	0.27720	1.65;1.65;1.65	4.55	0.329	0.15924	.	0.290123	0.31721	N	0.007167	T	0.11707	0.0285	N	0.05441	-0.05	0.31332	N	0.684684	P	0.37573	0.6	B	0.35510	0.204	T	0.31916	-0.9926	10	0.13853	T	0.58	-7.8236	8.2306	0.31595	0.0:0.3022:0.0:0.6978	.	1514	Q8IVG5	SAM9L_HUMAN	E	1514;1514;1514;336	ENSP00000326247:K1514E;ENSP00000405760:K1514E;ENSP00000408796:K1514E	ENSP00000326247:K1514E	K	-	1	0	SAMD9L	92598681	1.000000	0.71417	0.997000	0.53966	0.686000	0.39977	2.603000	0.46266	0.185000	0.20105	0.383000	0.25322	AAA	SAMD9L	-	NULL	ENSG00000177409		0.403	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	-	0.00	34	0	T	NM_152703		92760745	-1	tier1	rs150584880	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	8.33	55	5	SNP	1.000	C
SAT1	6303	genome.wustl.edu	37	X	23801895	23801895	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:23801895delC	ENST00000379251.3	+	2	366	c.187delC	c.(187-189)cccfs	p.P63fs	SAT1_ENST00000379270.4_Intron|SAT1_ENST00000489394.1_Intron|Y_RNA_ENST00000365402.1_RNA|SAT1_ENST00000379253.3_Intron|SAT1_ENST00000379254.1_Intron|RP13-314C10.5_ENST00000366134.2_RNA			Q9H2B4	S26A1_HUMAN	spermidine/spermine N1-acetyltransferase 1	0					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|chloride transport (GO:0006821)|glycosaminoglycan metabolic process (GO:0030203)|ion transport (GO:0006811)|oxalate transport (GO:0019532)|small molecule metabolic process (GO:0044281)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|chloride transmembrane transporter activity (GO:0015108)|oxalate transmembrane transporter activity (GO:0019531)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			breast(1)|endometrium(3)|kidney(3)|lung(3)	10						GCCATTACCGCCCCTGCTCCC	0.532																																																	0													113.0	96.0	102.0					X																	23801895		2203	4300	6503	SO:0001589	frameshift_variant	0			M55580	CCDS14207.1	Xp22.1	2011-11-16	2006-08-24	2006-08-24	ENSG00000130066	ENSG00000130066	2.3.1.57		10540	protein-coding gene	gene with protein product	"""diamine N-acetyltransferase 1"""	313020	"""spermidine/spermine N1-acetyltransferase"""	SAT		1985966, 1417826	Standard	NM_002970		Approved	SSAT	uc004dau.3	P21673	OTTHUMG00000021256	ENST00000379251.3:c.187delC	X.37:g.23801895delC	ENSP00000368553:p.Pro63fs		A8K9N2|Q7Z5R3|Q96BK0	Frame_Shift_Del	DEL	superfamily_Acyl_CoA_acyltransferase	p.L64fs	ENST00000379251.3	37	c.187		X																																																																																			SAT1	-	NULL	ENSG00000130066		0.532	SAT1-004	KNOWN	basic	protein_coding	SAT1	HGNC	protein_coding	OTTHUMT00000056059.1		0.00	21	0	C	NM_002970		23801895	+1	tier1		no_errors	ENST00000379251	ensembl	human	known	74_37	frame_shift_del	62.22	17	28	DEL	0.000	-
SCN5A	6331	genome.wustl.edu	37	3	38592535	38592535	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:38592535G>A	ENST00000333535.4	-	28	5477	c.5328C>T	c.(5326-5328)agC>agT	p.S1776S	SCN5A_ENST00000450102.2_Silent_p.S1722S|SCN5A_ENST00000425664.1_Silent_p.S1758S|SCN5A_ENST00000443581.1_Silent_p.S1775S|SCN5A_ENST00000414099.2_Silent_p.S1758S|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Silent_p.S1722S|SCN5A_ENST00000449557.2_Silent_p.S1722S|SCN5A_ENST00000413689.1_Silent_p.S1776S|SCN5A_ENST00000455624.2_Silent_p.S1743S|SCN5A_ENST00000423572.2_Silent_p.S1775S			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1776					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CCGTGGCCACGCTGAAGTTCT	0.527																																																	0													102.0	102.0	102.0					3																	38592535		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5328C>T	3.37:g.38592535G>A			A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.S1776	ENST00000333535.4	37	c.5328	CCDS46796.1	3																																																																																			SCN5A	-	pfam_PKD1_2_channel	ENSG00000183873		0.527	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	55	0	G	NM_198056		38592535	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	silent	29.67	64	27	SNP	0.995	A
SCN5A	6331	genome.wustl.edu	37	3	38592950	38592950	+	Missense_Mutation	SNP	C	C	T	rs374557801		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:38592950C>T	ENST00000333535.4	-	28	5062	c.4913G>A	c.(4912-4914)cGa>cAa	p.R1638Q	SCN5A_ENST00000450102.2_Missense_Mutation_p.R1584Q|SCN5A_ENST00000425664.1_Missense_Mutation_p.R1620Q|SCN5A_ENST00000443581.1_Missense_Mutation_p.R1637Q|SCN5A_ENST00000414099.2_Missense_Mutation_p.R1620Q|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Missense_Mutation_p.R1584Q|SCN5A_ENST00000449557.2_Missense_Mutation_p.R1584Q|SCN5A_ENST00000413689.1_Missense_Mutation_p.R1638Q|SCN5A_ENST00000455624.2_Missense_Mutation_p.R1605Q|SCN5A_ENST00000423572.2_Missense_Mutation_p.R1637Q			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1638					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CTTGGCCCCTCGGATCAGTCT	0.592																																																	0								C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	108.0	109.0	109.0		4910,4913,4859,4814,4751,4913	4.5	1.0	3		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	SCN5A	NM_000335.4,NM_001099404.1,NM_001099405.1,NM_001160160.1,NM_001160161.1,NM_198056.2	43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	1637/2016,1638/2017,1620/1999,1605/1984,1584/1963,1638/2017	38592950	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.4913G>A	3.37:g.38592950C>T	ENSP00000328968:p.Arg1638Gln		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.R1638Q	ENST00000333535.4	37	c.4913	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	C	20.6	4.020928	0.75275	0.0	1.16E-4	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06;-5.06	4.54	4.54	0.55810	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98792	0.9593	M	0.74467	2.265	0.42234	D	0.991906	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.996	D;D;D;D;D;P	0.81914	0.983;0.994;0.995;0.978;0.991;0.811	D	0.99167	1.0863	10	0.87932	D	0	.	11.0403	0.47827	0.0:0.9149:0.0:0.0851	.	1584;1605;1620;1638;1637;1638	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	Q	1620;1637;1638;1584;1637;1620;1638;1605;1584;1584	ENSP00000398962:R1620Q;ENSP00000398266:R1637Q;ENSP00000410257:R1638Q;ENSP00000388797:R1584Q;ENSP00000397915:R1637Q;ENSP00000416634:R1620Q;ENSP00000328968:R1638Q;ENSP00000399524:R1605Q;ENSP00000403355:R1584Q;ENSP00000413996:R1584Q	ENSP00000328968:R1638Q	R	-	2	0	SCN5A	38567954	0.994000	0.37717	0.996000	0.52242	0.981000	0.71138	3.188000	0.50958	2.353000	0.79882	0.561000	0.74099	CGA	SCN5A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000183873		0.592	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	35	0	C	NM_198056		38592950	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	16.85	74	15	SNP	0.997	T
SH3GL3	6457	genome.wustl.edu	37	15	84286908	84286908	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:84286908G>A	ENST00000427482.2	+	9	1219	c.913G>A	c.(913-915)Gga>Aga	p.G305R	SH3GL3_ENST00000434347.1_Missense_Mutation_p.G313R|SH3GL3_ENST00000324537.5_Missense_Mutation_p.G313R|SH3GL3_ENST00000535412.1_3'UTR|AC087738.1_ENST00000411248.1_RNA|SH3GL3_ENST00000564054.1_3'UTR	NM_003027.3	NP_003018.3	Q99963	SH3G3_HUMAN	SH3-domain GRB2-like 3	305	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30						AGGAGAATTAGGATTTAAAGA	0.403																																																	0													100.0	95.0	97.0					15																	84286908		2203	4300	6503	SO:0001583	missense	0			AF036271	CCDS10325.2, CCDS73772.1	15q24	2006-11-24			ENSG00000140600	ENSG00000140600			10832	protein-coding gene	gene with protein product		603362				9169142	Standard	NR_026799		Approved	SH3D2C, SH3P13, CNSA3, EEN-B2, HsT19371	uc002bjw.3	Q99963	OTTHUMG00000147361	ENST00000427482.2:c.913G>A	15.37:g.84286908G>A	ENSP00000391372:p.Gly305Arg		O43553|O43554	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain	p.G313R	ENST00000427482.2	37	c.937	CCDS10325.2	15	.	.	.	.	.	.	.	.	.	.	G	31	5.073801	0.94000	.	.	ENSG00000140600	ENST00000427482;ENST00000324537;ENST00000434347	T;T;T	0.30448	1.53;1.53;1.53	5.6	5.6	0.85130	Src homology-3 domain (5);	0.047375	0.85682	D	0.000000	T	0.48642	0.1511	L	0.39514	1.22	0.80722	D	1	D;P	0.71674	0.998;0.589	D;B	0.73380	0.98;0.226	T	0.39014	-0.9634	10	0.52906	T	0.07	-26.6357	18.6111	0.91285	0.0:0.0:1.0:0.0	.	305;313	Q99963;Q99963-3	SH3G3_HUMAN;.	R	305;313;313	ENSP00000391372:G305R;ENSP00000320092:G313R;ENSP00000397871:G313R	ENSP00000320092:G313R	G	+	1	0	SH3GL3	82077912	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.300000	0.96151	2.628000	0.89032	0.655000	0.94253	GGA	SH3GL3	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000140600		0.403	SH3GL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL3	HGNC	protein_coding	OTTHUMT00000347797.1	-	0.00	38	0	G	NM_003027		84286908	+1	tier1	-	no_errors	ENST00000324537	ensembl	human	known	74_37	missense	31.37	35	16	SNP	1.000	A
SLC2A14	144195	genome.wustl.edu	37	12	7981305	7981305	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:7981305G>A	ENST00000543909.1	-	11	1499	c.740C>T	c.(739-741)aCg>aTg	p.T247M	SLC2A14_ENST00000535295.1_Missense_Mutation_p.T138M|SLC2A14_ENST00000396589.2_Missense_Mutation_p.T247M|SLC2A14_ENST00000340749.5_Missense_Mutation_p.T224M|SLC2A14_ENST00000542546.1_Missense_Mutation_p.T138M|SLC2A14_ENST00000431042.2_Missense_Mutation_p.T224M|SLC2A14_ENST00000539924.1_Missense_Mutation_p.T262M|SLC2A14_ENST00000542505.1_Intron			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	247					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		CTCACTCCGCGTAGCATTCTC	0.423																																																	0													117.0	111.0	113.0					12																	7981305		2203	4300	6503	SO:0001583	missense	0			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.740C>T	12.37:g.7981305G>A	ENSP00000440480:p.Thr247Met		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.T247M	ENST00000543909.1	37	c.740	CCDS8585.1	12	.	.	.	.	.	.	.	.	.	.	G	7.688	0.690375	0.15039	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91;-0.91;-0.91	3.92	-6.55	0.01854	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.415190	0.27609	N	0.018602	T	0.53578	0.1805	L	0.31845	0.965	0.20074	N	0.999935	B;B;B;B	0.24043	0.044;0.013;0.01;0.096	B;B;B;B	0.29862	0.069;0.042;0.015;0.108	T	0.42344	-0.9457	10	0.62326	D	0.03	.	3.5822	0.07958	0.1123:0.0972:0.4278:0.3626	.	262;138;224;247	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	M	224;247;224;247;138;138;262	ENSP00000340450:T224M;ENSP00000440480:T247M;ENSP00000407287:T224M;ENSP00000379834:T247M;ENSP00000440492:T138M;ENSP00000443903:T138M;ENSP00000445929:T262M	ENSP00000340450:T224M	T	-	2	0	SLC2A14	7872572	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.153000	0.10144	-1.097000	0.03042	-2.451000	0.00208	ACG	SLC2A14	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000173262		0.423	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	HGNC	protein_coding	OTTHUMT00000399836.2	-	0.00	26	0	G	NM_153449		7981305	-1	tier1	-	no_errors	ENST00000396589	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.000	A
SLC45A1	50651	genome.wustl.edu	37	1	8385415	8385415	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:8385415G>T	ENST00000471889.1	+	3	840	c.455G>T	c.(454-456)gGa>gTa	p.G152V	SLC45A1_ENST00000377479.2_Missense_Mutation_p.G186V|Y_RNA_ENST00000516445.1_RNA|SLC45A1_ENST00000289877.8_Missense_Mutation_p.G152V			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	152					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		TCAAGGTTTGGAAGGAGACGC	0.502																																																	0													180.0	160.0	167.0					1																	8385415		2203	4300	6503	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.455G>T	1.37:g.8385415G>T	ENSP00000418096:p.Gly152Val		Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G186V	ENST00000471889.1	37	c.557	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663212	0.88251	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	T;T;T	0.78816	-1.21;-1.21;-1.21	5.55	5.55	0.83447	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.90878	0.7134	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92562	0.6059	10	0.87932	D	0	-8.1571	18.489	0.90839	0.0:0.0:1.0:0.0	.	152	Q9Y2W3	S45A1_HUMAN	V	152;186;152	ENSP00000418096:G152V;ENSP00000366699:G186V;ENSP00000289877:G152V	ENSP00000289877:G152V	G	+	2	0	SLC45A1	8308002	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.826000	0.99387	2.594000	0.87642	0.650000	0.86243	GGA	SLC45A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000162426		0.502	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	-	0.00	48	0	G			8385415	+1	tier1	-	no_errors	ENST00000377479	ensembl	human	known	74_37	missense	8.06	57	5	SNP	1.000	T
SLC4A7	9497	genome.wustl.edu	37	3	27427485	27427485	+	Silent	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:27427485G>C	ENST00000295736.5	-	23	3433	c.3363C>G	c.(3361-3363)ctC>ctG	p.L1121L	SLC4A7_ENST00000446700.1_Silent_p.L1113L|SLC4A7_ENST00000437179.1_Silent_p.L1002L|SLC4A7_ENST00000454389.1_Silent_p.L1130L|SLC4A7_ENST00000435667.2_Silent_p.L1006L|SLC4A7_ENST00000428386.1_Silent_p.L997L|SLC4A7_ENST00000388777.4_Silent_p.L671L|SLC4A7_ENST00000455077.1_Silent_p.L1002L|SLC4A7_ENST00000440156.1_Silent_p.L1117L|SLC4A7_ENST00000425128.2_3'UTR|SLC4A7_ENST00000445684.1_Silent_p.L1117L	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	1121					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	ACAGGTCCATGAGTTTGCGCA	0.343																																																	0													117.0	126.0	123.0					3																	27427485		2203	4300	6503	SO:0001819	synonymous_variant	0			AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.3363C>G	3.37:g.27427485G>C			A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Silent	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.L1130	ENST00000295736.5	37	c.3390	CCDS33721.1	3																																																																																			SLC4A7	-	tigrfam_HCO3_transpt_euk	ENSG00000033867		0.343	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	-	0.00	68	0	G	NM_003615		27427485	-1	tier1	-	no_errors	ENST00000454389	ensembl	human	known	74_37	silent	18.10	86	19	SNP	0.999	C
SLC9C1	285335	genome.wustl.edu	37	3	111936291	111936291	+	Silent	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:111936291T>A	ENST00000305815.5	-	15	2040	c.1788A>T	c.(1786-1788)tcA>tcT	p.S596S	SLC9C1_ENST00000487372.1_Silent_p.S548S	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	596					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										GCACTTACTTTGATGGGCCCT	0.289																																																	0													103.0	106.0	105.0					3																	111936291		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.1788A>T	3.37:g.111936291T>A			Q6ZRP4|Q7RTP2	Silent	SNP	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.S596	ENST00000305815.5	37	c.1788	CCDS33817.1	3																																																																																			SLC9C1	-	NULL	ENSG00000172139		0.289	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	-	0.00	59	0	T	NM_183061		111936291	-1	tier1	-	no_errors	ENST00000305815	ensembl	human	known	74_37	silent	36.84	24	14	SNP	0.999	A
SLITRK3	22865	genome.wustl.edu	37	3	164907802	164907802	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:164907802G>A	ENST00000475390.1	-	2	1260	c.817C>T	c.(817-819)Cga>Tga	p.R273*	SLITRK3_ENST00000241274.3_Nonsense_Mutation_p.R273*			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	273	LRRCT 1.				axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.R273*(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CTGATTTCTCGTAGGTCCTTT	0.468										HNSCC(40;0.11)																																							1	Substitution - Nonsense(1)	large_intestine(1)											121.0	125.0	124.0					3																	164907802		2203	4300	6503	SO:0001587	stop_gained	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.817C>T	3.37:g.164907802G>A	ENSP00000420091:p.Arg273*		Q1RMY6	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R273*	ENST00000475390.1	37	c.817	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.837759	0.97877	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	.	.	.	5.85	3.98	0.46160	.	0.000000	0.30969	N	0.008502	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-10.7448	14.3566	0.66742	0.0:0.0:0.5045:0.4955	.	.	.	.	X	273	.	ENSP00000241274:R273X	R	-	1	2	SLITRK3	166390496	0.994000	0.37717	0.987000	0.45799	0.941000	0.58515	1.654000	0.37334	1.453000	0.47775	0.655000	0.94253	CGA	SLITRK3	-	smart_Cys-rich_flank_reg_C	ENSG00000121871		0.468	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	-	0.00	41	0	G	NM_014926		164907802	-1	tier1	-	no_errors	ENST00000241274	ensembl	human	known	74_37	nonsense	56.45	27	35	SNP	0.998	A
SMIM11	54065	genome.wustl.edu	37	21	35774492	35774492	+	3'UTR	DEL	T	T	-	rs534668511	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr21:35774492delT	ENST00000399299.1	+	0	450				AP000322.54_ENST00000410005.1_5'Flank|SMIM11_ENST00000481710.1_3'UTR			P58511	SIM11_HUMAN	small integral membrane protein 11							integral component of membrane (GO:0016021)											TGGAGGAGGATTTTTTTTTTT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC015596	CCDS33550.1	21q22.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000205670	ENSG00000205670			1293	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 51"", ""family with sequence similarity 165, member B"""	C21orf51, FAM165B			Standard	NM_058182		Approved		uc002ytu.4	P58511	OTTHUMG00000086193	ENST00000399299.1:c.*98T>-	21.37:g.35774492delT				RNA	DEL	-	NULL	ENST00000399299.1	37	NULL		21																																																																																			SMIM11	-	-	ENSG00000205670		0.373	SMIM11-002	PUTATIVE	basic|exp_conf	protein_coding	SMIM11	HGNC	protein_coding	OTTHUMT00000194076.1		0.00	26	0	T	NM_058182		35774492	+1	tier1		no_errors	ENST00000481710	ensembl	human	known	74_37	rna	25.00	27	9	DEL	0.002	-
SNHG14	104472715	genome.wustl.edu	37	15	25309958	25309958	+	RNA	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:25309958C>A	ENST00000549804.2	+	0	494				SNORD116-7_ENST00000384404.1_RNA|SNHG14_ENST00000551077.1_RNA|SNORD116-5_ENST00000384462.1_RNA|SNORD116-6_ENST00000384711.1_RNA					small nucleolar RNA host gene 14 (non-protein coding)																		GTCGGTGTGGCCTCGCATCCA	0.572																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25309958C>A				RNA	SNP	-	NULL	ENST00000549804.2	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.572	SNHG14-012	KNOWN	non_canonical_other|basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000408278.2		0.00	8	0	C			25309958	+1			no_errors	ENST00000549804	ensembl	human	known	74_37	rna	66.67	1	2	SNP	0.001	A
SPAM1	6677	genome.wustl.edu	37	7	123594289	123594289	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:123594289C>T	ENST00000439500.1	+	4	1278	c.665C>T	c.(664-666)cCg>cTg	p.P222L	SPAM1_ENST00000460182.1_Missense_Mutation_p.P222L|SPAM1_ENST00000340011.5_Missense_Mutation_p.P222L|SPAM1_ENST00000402183.2_Missense_Mutation_p.P222L|SPAM1_ENST00000223028.7_Missense_Mutation_p.P222L	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	222					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.P222L(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TATCTTTTTCCGGATTGTTAC	0.363																																																	2	Substitution - Missense(2)	kidney(2)											81.0	86.0	84.0					7																	123594289		2203	4300	6503	SO:0001583	missense	0			L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.665C>T	7.37:g.123594289C>T	ENSP00000402123:p.Pro222Leu		Q8TC30	Missense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.P222L	ENST00000439500.1	37	c.665	CCDS5791.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.424301	0.96111	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.87273	0.6136	H	0.96889	3.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90270	0.4307	9	.	.	.	-52.5414	19.8676	0.96824	0.0:1.0:0.0:0.0	.	222;222	Q8TC30;P38567	.;HYALP_HUMAN	L	222	ENSP00000386028:P222L;ENSP00000417934:P222L;ENSP00000345849:P222L;ENSP00000402123:P222L;ENSP00000223028:P222L	.	P	+	2	0	SPAM1	123381525	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	CCG	SPAM1	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	ENSG00000106304		0.363	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	-	0.00	28	0	C			123594289	+1	tier1	-	no_errors	ENST00000340011	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
SPIRE2	84501	genome.wustl.edu	37	16	89925754	89925754	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:89925754G>A	ENST00000378247.3	+	9	1497	c.1454G>A	c.(1453-1455)cGa>cAa	p.R485Q	SPIRE2_ENST00000393062.2_Missense_Mutation_p.R485Q	NM_032451.1	NP_115827.1	Q8WWL2	SPIR2_HUMAN	spire-type actin nucleation factor 2	485					actin cytoskeleton organization (GO:0030036)|cleavage furrow formation (GO:0036089)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|intracellular transport (GO:0046907)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(10)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		CCCGGCTCCCGAGACCAGGGC	0.697																																																	0													18.0	21.0	20.0					16																	89925754		2195	4295	6490	SO:0001583	missense	0			AL834408	CCDS32516.1	16q24	2013-08-27	2013-08-27			ENSG00000204991			30623	protein-coding gene	gene with protein product		609217	"""spire homolog 2 (Drosophila)"", ""spire family actin nucleation factor 2"""			11347906	Standard	NM_032451		Approved	spir-2, KIAA1832	uc002foz.1	Q8WWL2		ENST00000378247.3:c.1454G>A	16.37:g.89925754G>A	ENSP00000367494:p.Arg485Gln		A4QPB1|Q2TA98|Q6P433|Q8ND47|Q96JJ5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_KIND	p.R485Q	ENST00000378247.3	37	c.1454	CCDS32516.1	16	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074074	0.36566	.	.	ENSG00000204991	ENST00000378247;ENST00000393062	T;T	0.44881	0.91;0.91	5.19	-1.91	0.07641	.	1.380360	0.04041	N	0.303104	T	0.29556	0.0737	L	0.41710	1.295	0.21675	N	0.999597	B;B;B;B	0.15719	0.0;0.014;0.008;0.005	B;B;B;B	0.08055	0.0;0.001;0.001;0.003	T	0.17018	-1.0383	10	0.34782	T	0.22	-3.0556	1.7889	0.03047	0.2177:0.1755:0.4333:0.1734	.	352;485;437;485	Q8WWL2-4;Q8WWL2-2;Q8WWL2-3;Q8WWL2	.;.;.;SPIR2_HUMAN	Q	485	ENSP00000367494:R485Q;ENSP00000376782:R485Q	ENSP00000367494:R485Q	R	+	2	0	SPIRE2	88453255	0.000000	0.05858	0.191000	0.23289	0.044000	0.14063	-0.033000	0.12246	0.082000	0.17018	-0.474000	0.04947	CGA	SPIRE2	-	NULL	ENSG00000204991		0.697	SPIRE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIRE2	HGNC	protein_coding	OTTHUMT00000421843.1	-	0.00	25	0	G	XM_047462		89925754	+1	tier1	-	no_errors	ENST00000378247	ensembl	human	known	74_37	missense	18.31	57	13	SNP	0.326	A
SPTB	6710	genome.wustl.edu	37	14	65253572	65253572	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:65253572delT	ENST00000389721.5	-	15	3143	c.3111delA	c.(3109-3111)aaafs	p.K1037fs	SPTB_ENST00000542895.1_Frame_Shift_Del_p.K1037fs|SPTB_ENST00000389720.3_Frame_Shift_Del_p.K1037fs|SPTB_ENST00000556626.1_Frame_Shift_Del_p.K1037fs|SPTB_ENST00000389722.3_Frame_Shift_Del_p.K1037fs	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1037					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CCTCCAAGTGTTTTTGCCGCT	0.632																																																	0													71.0	75.0	74.0					14																	65253572		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.3111delA	14.37:g.65253572delT	ENSP00000374371:p.Lys1037fs		Q15510|Q15519	Frame_Shift_Del	DEL	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.K1037fs	ENST00000389721.5	37	c.3111	CCDS32100.1	14																																																																																			SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.632	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1		0.00	19	0	T			65253572	-1	tier1		no_errors	ENST00000389722	ensembl	human	known	74_37	frame_shift_del	8.00	23	2	DEL	0.000	-
SPTBN2	6712	genome.wustl.edu	37	11	66466512	66466512	+	Missense_Mutation	SNP	C	C	T	rs557577438		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:66466512C>T	ENST00000533211.1	-	19	4149	c.3818G>A	c.(3817-3819)cGt>cAt	p.R1273H	SPTBN2_ENST00000529997.1_Missense_Mutation_p.R1273H|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R1273H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1273					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GTCCCGAAGACGGCCCAGAAA	0.542													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18059	0.0		0.0	False		,,,				2504	0.0																0													83.0	80.0	81.0					11																	66466512		2200	4295	6495	SO:0001583	missense	0			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3818G>A	11.37:g.66466512C>T	ENSP00000432568:p.Arg1273His		O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R1273H	ENST00000533211.1	37	c.3818	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390187	0.82902	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.36340	1.26;1.26;1.26	4.7	4.7	0.59300	.	0.067294	0.56097	D	0.000021	T	0.59155	0.2173	M	0.74881	2.28	0.45205	D	0.998214	D	0.89917	1.0	D	0.67725	0.953	T	0.61797	-0.6989	10	0.49607	T	0.09	.	16.5926	0.84770	0.0:1.0:0.0:0.0	.	1273	O15020	SPTN2_HUMAN	H	1273	ENSP00000432568:R1273H;ENSP00000311489:R1273H;ENSP00000433593:R1273H	ENSP00000311489:R1273H	R	-	2	0	SPTBN2	66223088	0.658000	0.27402	1.000000	0.80357	0.987000	0.75469	1.910000	0.39927	2.441000	0.82636	0.655000	0.94253	CGT	SPTBN2	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin	ENSG00000173898		0.542	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	-	0.00	31	0	C	NM_006946		66466512	-1	tier1	-	no_errors	ENST00000309996	ensembl	human	known	74_37	missense	26.67	33	12	SNP	1.000	T
ST3GAL1	6482	genome.wustl.edu	37	8	134478219	134478219	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:134478219G>A	ENST00000319914.5	-	5	1448	c.421C>T	c.(421-423)Cgc>Tgc	p.R141C	ST3GAL1_ENST00000522652.1_Missense_Mutation_p.R141C|ST3GAL1_ENST00000521180.1_Missense_Mutation_p.R141C|ST3GAL1_ENST00000399640.2_Missense_Mutation_p.R141C			Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 1	141					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|N-acetylneuraminate metabolic process (GO:0006054)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein phosphorylation (GO:0006468)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			endometrium(3)|large_intestine(2)|lung(11)|prostate(1)	17	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			ACGGCGCAGCGCCGGCAGCCC	0.567																																																	0													84.0	83.0	83.0					8																	134478219		2203	4300	6503	SO:0001583	missense	0			L29555	CCDS6373.1	8q24.22	2013-03-01	2003-01-14	2005-02-07	ENSG00000008513	ENSG00000008513	2.4.99.4	"""Sialyltransferases"""	10862	protein-coding gene	gene with protein product	"""ST3Gal I"""	607187	"""sialyltransferase 4A (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4A		10504389, 7655169	Standard	NM_003033		Approved	ST3O, SIATFL, ST3GalA.1	uc003yuk.2	Q11201	OTTHUMG00000164534	ENST00000319914.5:c.421C>T	8.37:g.134478219G>A	ENSP00000318445:p.Arg141Cys		O60677|Q9UN51	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R141C	ENST00000319914.5	37	c.421	CCDS6373.1	8	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579993	0.65992	.	.	ENSG00000008513	ENST00000319914;ENST00000399640;ENST00000521180;ENST00000522652;ENST00000523854;ENST00000517668	T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25	4.7	4.7	0.59300	.	0.090729	0.64402	D	0.000007	T	0.60274	0.2256	M	0.82323	2.585	0.51767	D	0.999938	D	0.76494	0.999	D	0.68765	0.96	T	0.66200	-0.5983	10	0.87932	D	0	-23.446	12.1681	0.54141	0.0:0.0:0.8294:0.1706	.	141	Q11201	SIA4A_HUMAN	C	141;141;141;141;11;11	ENSP00000318445:R141C;ENSP00000414073:R141C;ENSP00000428540:R141C;ENSP00000430515:R141C;ENSP00000429638:R11C;ENSP00000427720:R11C	ENSP00000318445:R141C	R	-	1	0	ST3GAL1	134547401	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	2.605000	0.46283	2.328000	0.79073	0.561000	0.74099	CGC	ST3GAL1	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000008513		0.567	ST3GAL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL1	HGNC	protein_coding	OTTHUMT00000379132.1	-	0.00	29	0	G	NM_003033		134478219	-1	tier1	-	no_errors	ENST00000319914	ensembl	human	known	74_37	missense	20.43	72	19	SNP	1.000	A
STK32A	202374	genome.wustl.edu	37	5	146754657	146754657	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr5:146754657G>A	ENST00000397936.3	+	11	1241	c.908G>A	c.(907-909)gGc>gAc	p.G303D	STK32A_ENST00000398523.3_Missense_Mutation_p.G303D	NM_001112724.1	NP_001106195.1	Q8WU08	ST32A_HUMAN	serine/threonine kinase 32A	303							ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGCAGAAAGGCAGGCTGAAT	0.393																																																	0													55.0	51.0	53.0					5																	146754657		1568	3582	5150	SO:0001583	missense	0				CCDS47299.1, CCDS75351.1	5q32	2008-02-05			ENSG00000169302	ENSG00000169302			28317	protein-coding gene	gene with protein product						12477932	Standard	NM_001112724		Approved	MGC22688, YANK1	uc010jgn.1	Q8WU08	OTTHUMG00000163411	ENST00000397936.3:c.908G>A	5.37:g.146754657G>A	ENSP00000381030:p.Gly303Asp		B3KSY0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G303D	ENST00000397936.3	37	c.908	CCDS47299.1	5	.	.	.	.	.	.	.	.	.	.	G	13.98	2.400365	0.42613	.	.	ENSG00000169302	ENST00000397936;ENST00000398523	T;T	0.24350	1.86;1.86	5.78	5.78	0.91487	Protein kinase-like domain (1);	0.000000	0.48286	D	0.000181	T	0.31231	0.0790	L	0.28740	0.885	0.80722	D	1	B;D;B	0.64830	0.041;0.994;0.069	B;P;B	0.58130	0.05;0.833;0.051	T	0.01448	-1.1352	10	0.02654	T	1	.	18.7737	0.91901	0.0:0.0:1.0:0.0	.	303;303;303	B7Z9H7;Q8WU08;Q8WU08-3	.;ST32A_HUMAN;.	D	303	ENSP00000381030:G303D;ENSP00000381535:G303D	ENSP00000381030:G303D	G	+	2	0	STK32A	146734850	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.896000	0.92521	2.738000	0.93877	0.655000	0.94253	GGC	STK32A	-	superfamily_Kinase-like_dom	ENSG00000169302		0.393	STK32A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32A	HGNC	protein_coding	OTTHUMT00000373306.1	-	0.00	78	0	G	NM_145001		146754657	+1	tier1	-	no_errors	ENST00000397936	ensembl	human	known	74_37	missense	25.35	53	18	SNP	1.000	A
SUCO	51430	genome.wustl.edu	37	1	172547523	172547523	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:172547523G>A	ENST00000263688.3	+	14	1645	c.1426G>A	c.(1426-1428)Gac>Aac	p.D476N	SUCO_ENST00000608151.1_Missense_Mutation_p.D628N|SUCO_ENST00000610051.1_Missense_Mutation_p.D439N|SUCO_ENST00000367723.4_Missense_Mutation_p.D627N	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	476					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											ATTTGATGAGGACTATGGTAA	0.343																																																	0													118.0	109.0	112.0					1																	172547523		2203	4300	6503	SO:0001583	missense	0			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1426G>A	1.37:g.172547523G>A	ENSP00000263688:p.Asp476Asn		B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.D628N	ENST00000263688.3	37	c.1882	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.375628	0.95923	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.22	5.22	0.72569	.	0.045924	0.85682	D	0.000000	T	0.51483	0.1677	L	0.27053	0.805	0.80722	D	1	P;B;D;P	0.56287	0.952;0.166;0.975;0.822	B;B;P;P	0.55455	0.439;0.132;0.776;0.511	T	0.58346	-0.7652	9	0.66056	D	0.02	-7.5289	17.341	0.87296	0.0:0.0:1.0:0.0	.	439;476;628;476	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	N	628;476	.	ENSP00000263688:D476N	D	+	1	0	C1orf9	170814146	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.496000	0.97967	2.442000	0.82660	0.563000	0.77884	GAC	SUCO	-	NULL	ENSG00000094975		0.343	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1	-	0.00	44	0	G	NM_016227		172547523	+1	tier1	-	no_errors	ENST00000608151	ensembl	human	known	74_37	missense	17.54	47	10	SNP	1.000	A
SYNE2	23224	genome.wustl.edu	37	14	64428292	64428292	+	Silent	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:64428292A>G	ENST00000344113.4	+	9	1049	c.837A>G	c.(835-837)gcA>gcG	p.A279A	SYNE2_ENST00000554584.1_Silent_p.A279A|SYNE2_ENST00000358025.3_Silent_p.A279A|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	279	Actin-binding.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCTATGTGGCACAGTTTCTGC	0.403																																																	0													163.0	148.0	152.0					14																	64428292		1960	4158	6118	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.837A>G	14.37:g.64428292A>G			Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A279	ENST00000344113.4	37	c.837	CCDS41963.1	14																																																																																			SYNE2	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000054654		0.403	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	-	0.00	87	0	A	NM_182914		64428292	+1	tier1	-	no_errors	ENST00000358025	ensembl	human	known	74_37	silent	27.91	62	24	SNP	0.928	G
SYT11	23208	genome.wustl.edu	37	1	155838079	155838079	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:155838079G>T	ENST00000368324.4	+	2	611	c.358G>T	c.(358-360)Gac>Tac	p.D120Y	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	120					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			ATCTTGTATAGACCAATTACC	0.537																																																	0													94.0	96.0	95.0					1																	155838079		2203	4300	6503	SO:0001583	missense	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.358G>T	1.37:g.155838079G>T	ENSP00000357307:p.Asp120Tyr		Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	p.D120Y	ENST00000368324.4	37	c.358	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373480	0.61624	.	.	ENSG00000132718	ENST00000368324	T	0.45276	0.9	5.14	5.14	0.70334	.	0.105228	0.64402	D	0.000004	T	0.27278	0.0669	L	0.40543	1.245	0.80722	D	1	P	0.44877	0.845	P	0.44732	0.459	T	0.09250	-1.0683	10	0.62326	D	0.03	.	11.0141	0.47679	0.0862:0.0:0.9138:0.0	.	120	Q9BT88	SYT11_HUMAN	Y	120	ENSP00000357307:D120Y	ENSP00000357307:D120Y	D	+	1	0	SYT11	154104703	1.000000	0.71417	0.991000	0.47740	0.985000	0.73830	4.529000	0.60588	2.671000	0.90904	0.655000	0.94253	GAC	SYT11	-	NULL	ENSG00000132718		0.537	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1		0.00	40	0	G	NM_152280		155838079	+1			no_errors	ENST00000368324	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.998	T
TAF2	6873	genome.wustl.edu	37	8	120770358	120770358	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:120770358T>C	ENST00000378164.2	-	21	3021	c.2723A>G	c.(2722-2724)cAa>cGa	p.Q908R	TAF2_ENST00000519355.1_5'UTR	NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	908					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			AAGTAGCCATTGCAGTTCTTC	0.308																																																	0													152.0	153.0	152.0					8																	120770358		2203	4298	6501	SO:0001583	missense	0			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.2723A>G	8.37:g.120770358T>C	ENSP00000367406:p.Gln908Arg		B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,superfamily_ARM-type_fold	p.Q908R	ENST00000378164.2	37	c.2723	CCDS34937.1	8	.	.	.	.	.	.	.	.	.	.	T	17.73	3.462172	0.63513	.	.	ENSG00000064313	ENST00000378164;ENST00000529653	T;T	0.33216	1.42;1.42	5.66	5.66	0.87406	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.20536	0.0494	N	0.14661	0.345	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.05500	-1.0881	10	0.24483	T	0.36	-8.9051	15.8975	0.79346	0.0:0.0:0.0:1.0	.	908	Q6P1X5	TAF2_HUMAN	R	908;32	ENSP00000367406:Q908R;ENSP00000436750:Q32R	ENSP00000367406:Q908R	Q	-	2	0	TAF2	120839539	1.000000	0.71417	0.921000	0.36526	0.998000	0.95712	7.571000	0.82399	2.145000	0.66743	0.528000	0.53228	CAA	TAF2	-	superfamily_ARM-type_fold	ENSG00000064313		0.308	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF2	HGNC	protein_coding	OTTHUMT00000381436.1	-	0.00	61	0	T	NM_003184		120770358	-1	tier1	-	no_errors	ENST00000378164	ensembl	human	known	74_37	missense	12.50	70	10	SNP	1.000	C
TAGLN2	8407	genome.wustl.edu	37	1	159890152	159890152	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:159890152C>T	ENST00000368097.4	-	2	458	c.148G>A	c.(148-150)Gag>Aag	p.E50K	TAGLN2_ENST00000368096.1_Missense_Mutation_p.E71K|TAGLN2_ENST00000320307.4_Missense_Mutation_p.E50K|TAGLN2_ENST00000478033.1_5'UTR	NM_001277223.1|NM_003564.1	NP_001264152.1|NP_003555.1	P37802	TAGL2_HUMAN	transgelin 2	50	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)				endometrium(1)|large_intestine(2)|lung(6)	9	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGAAGTTCTCGCGTCCAGGC	0.587																																																	0													57.0	59.0	58.0					1																	159890152		2203	4300	6503	SO:0001583	missense	0			D21261	CCDS1189.1, CCDS60314.1	1q21-q25	2008-07-18			ENSG00000158710	ENSG00000158710			11554	protein-coding gene	gene with protein product	"""SM22-alpha homolog"""	604634				9693045	Standard	NM_001277223		Approved	KIAA0120, HA1756	uc031pqu.1	P37802	OTTHUMG00000022793	ENST00000368097.4:c.148G>A	1.37:g.159890152C>T	ENSP00000357077:p.Glu50Lys		E9KL39|Q5JRQ6|Q5JRQ7|Q6FGI1|Q9BUH5|Q9H4P0	Missense_Mutation	SNP	pfam_CH-domain,pfam_Calponin_repeat,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin	p.E71K	ENST00000368097.4	37	c.211	CCDS1189.1	1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.297102	0.23650	.	.	ENSG00000158710	ENST00000368097;ENST00000368096;ENST00000320307;ENST00000397334	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	4.92	3.99	0.46301	Calponin homology domain (5);	0.311416	0.22526	U	0.058908	T	0.47377	0.1442	L	0.38692	1.165	0.38306	D	0.943123	D;B	0.61080	0.989;0.083	P;B	0.55577	0.779;0.054	T	0.45308	-0.9270	9	.	.	.	-28.3437	13.4433	0.61125	0.0:0.8416:0.1584:0.0	.	50;50	B7Z5A2;P37802	.;TAGL2_HUMAN	K	50;71;50;50	ENSP00000357077:E50K;ENSP00000357076:E71K;ENSP00000357075:E50K;ENSP00000412429:E50K	.	E	-	1	0	TAGLN2	158156776	0.000000	0.05858	0.806000	0.32338	0.908000	0.53690	-0.130000	0.10498	1.166000	0.42689	0.561000	0.74099	GAG	TAGLN2	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000158710		0.587	TAGLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAGLN2	HGNC	protein_coding	OTTHUMT00000059105.1	-	0.00	31	0	C	NM_003564		159890152	-1	tier1	-	no_errors	ENST00000368096	ensembl	human	known	74_37	missense	33.87	41	21	SNP	0.800	T
TANGO2	128989	genome.wustl.edu	37	22	20040017	20040017	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr22:20040017G>T	ENST00000327374.4	+	4	353	c.175G>T	c.(175-177)Ggc>Tgc	p.G59C	TANGO2_ENST00000398042.2_Missense_Mutation_p.G59C|TANGO2_ENST00000432883.1_Missense_Mutation_p.G59C|TANGO2_ENST00000479679.1_3'UTR|TANGO2_ENST00000434570.2_Missense_Mutation_p.G100C|TANGO2_ENST00000456048.1_Missense_Mutation_p.G64C|TANGO2_ENST00000447208.2_Missense_Mutation_p.G59C|TANGO2_ENST00000401833.1_Missense_Mutation_p.G100C|TANGO2_ENST00000420290.2_5'UTR|TANGO2_ENST00000401886.1_Missense_Mutation_p.G59C	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)	59																	CAAGGAAGGAGGCACATGGCT	0.627																																																	0													101.0	69.0	80.0					22																	20040017		2199	4300	6499	SO:0001583	missense	0				CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.175G>T	22.37:g.20040017G>T	ENSP00000332721:p.Gly59Cys		A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	pfam_DUF833	p.G64C	ENST00000327374.4	37	c.190	CCDS13772.1	22	.	.	.	.	.	.	.	.	.	.	G	26.1	4.706636	0.89018	.	.	ENSG00000183597	ENST00000401886;ENST00000432198;ENST00000447208;ENST00000398042;ENST00000450664;ENST00000327374;ENST00000432883;ENST00000401833;ENST00000434168;ENST00000434570;ENST00000456048	T;T;T;T;T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.90133	0.6917	H	0.97896	4.1	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.93585	0.6916	10	0.87932	D	0	-36.4574	16.5095	0.84280	0.0:0.0:1.0:0.0	.	59;100;59;100;59;59;59	B7Z9Q5;B7Z730;B7Z4A5;B7WNV6;Q6AHY1;Q6ICL3;Q6ICL3-2	.;.;.;.;.;CV025_HUMAN;.	C	59;59;59;59;59;59;59;100;59;100;64	ENSP00000385662:G59C;ENSP00000413850:G59C;ENSP00000389797:G59C;ENSP00000381122:G59C;ENSP00000415450:G59C;ENSP00000332721:G59C;ENSP00000402926:G59C;ENSP00000384827:G100C;ENSP00000411602:G59C;ENSP00000391262:G100C;ENSP00000403645:G64C	ENSP00000332721:G59C	G	+	1	0	C22orf25	18420017	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.000000	0.88501	2.568000	0.86640	0.650000	0.86243	GGC	TANGO2	-	pfam_DUF833	ENSG00000183597		0.627	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO2	HGNC	protein_coding	OTTHUMT00000318689.2	-	0.00	53	0	G	NM_152906		20040017	+1	tier1	-	no_errors	ENST00000456048	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
TANGO2	128989	genome.wustl.edu	37	22	20040897	20040897	+	Intron	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr22:20040897G>A	ENST00000327374.4	+	5	443				TANGO2_ENST00000398042.2_Intron|TANGO2_ENST00000432883.1_Intron|TANGO2_ENST00000479679.1_Intron|TANGO2_ENST00000434570.2_Intron|TANGO2_ENST00000456048.1_Intron|TANGO2_ENST00000447208.2_Intron|TANGO2_ENST00000401833.1_Intron|TANGO2_ENST00000420290.2_Intron|TANGO2_ENST00000401886.1_Intron	NM_001283106.1|NM_001283116.1|NM_001283148.1|NM_001283154.1|NM_152906.4	NP_001270035.1|NP_001270045.1|NP_001270077.1|NP_001270083.1|NP_690870.3	Q6ICL3	TNG2_HUMAN	transport and golgi organization 2 homolog (Drosophila)																		CCCCATATCAGTGTTCCTGGG	0.592																																																	0																																										SO:0001627	intron_variant	0				CCDS13772.1, CCDS63404.1, CCDS63405.1, CCDS63406.1, CCDS63407.1, CCDS74821.1, CCDS74822.1	22q11.21	2012-12-13	2012-12-13	2012-12-13	ENSG00000183597	ENSG00000183597			25439	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 25"""	C22orf25		12477932	Standard	XM_005261222		Approved	DKFZp761P1121	uc002zrc.1	Q6ICL3	OTTHUMG00000150510	ENST00000327374.4:c.266-63G>A	22.37:g.20040897G>A			A8MUE9|B7WNV6|B7Z583|B7Z730|D3DX23|Q8IW05|Q8NAL0|Q8TCS0|Q96M16	Missense_Mutation	SNP	pfam_DUF833	p.V94M	ENST00000327374.4	37	c.280	CCDS13772.1	22																																																																																			TANGO2	-	pfam_DUF833	ENSG00000183597		0.592	TANGO2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO2	HGNC	protein_coding	OTTHUMT00000318689.2	-	0.00	13	0	G	NM_152906		20040897	+1	tier1	-	no_errors	ENST00000450019	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.000	A
TCERG1L	256536	genome.wustl.edu	37	10	132944841	132944841	+	Silent	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:132944841G>A	ENST00000368642.4	-	7	1202	c.1117C>T	c.(1117-1119)Ctg>Ttg	p.L373L		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	373										cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CGGTCCTTCAGGTCCATGGGC	0.542																																																	0													126.0	114.0	118.0					10																	132944841		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1117C>T	10.37:g.132944841G>A			Q5VWI2|Q86XM8	Silent	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.L373	ENST00000368642.4	37	c.1117	CCDS7662.2	10																																																																																			TCERG1L	-	superfamily_WW_dom	ENSG00000176769		0.542	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	HGNC	protein_coding	OTTHUMT00000091619.2	-	0.00	31	0	G	NM_174937		132944841	-1	tier1	-	no_errors	ENST00000368642	ensembl	human	known	74_37	silent	15.09	45	8	SNP	1.000	A
TCERG1L	256536	genome.wustl.edu	37	10	133106472	133106472	+	Splice_Site	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:133106472A>T	ENST00000368642.4	-	3	756		c.e3+1			NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like											cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TTGGGCACCAACCTGGGATGG	0.448																																																	0													43.0	41.0	42.0					10																	133106472		2203	4300	6503	SO:0001630	splice_region_variant	0			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.670+1T>A	10.37:g.133106472A>T			Q5VWI2|Q86XM8	Splice_Site	SNP	-	e3+2	ENST00000368642.4	37	c.670+2	CCDS7662.2	10	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015790	0.54468	.	.	ENSG00000176769	ENST00000368642	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9704	0.71229	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TCERG1L	132996462	1.000000	0.71417	0.930000	0.37139	0.530000	0.34684	6.598000	0.74122	2.220000	0.72140	0.383000	0.25322	.	TCERG1L	-	-	ENSG00000176769		0.448	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	HGNC	protein_coding	OTTHUMT00000091619.2	-	0.00	30	0	A	NM_174937	Intron	133106472	-1	tier1	-	no_errors	ENST00000368642	ensembl	human	known	74_37	splice_site	14.49	59	10	SNP	0.989	T
TCL6	27004	genome.wustl.edu	37	14	96130203	96130203	+	RNA	DEL	T	T	-	rs72111707|rs55881700|rs562798511|rs68018867	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr14:96130203delT	ENST00000467865.1	+	0	611				RP11-1070N10.6_ENST00000461160.1_RNA					T-cell leukemia/lymphoma 6 (non-protein coding)											large_intestine(1)|lung(7)	8		all_cancers(154;0.103)		Epithelial(152;0.0655)|all cancers(159;0.149)|BRCA - Breast invasive adenocarcinoma(234;0.206)|COAD - Colon adenocarcinoma(157;0.207)		ACCAAACACAttttttttttt	0.423			T	TRA@	T-ALL																																			Dom	yes		14	14q32.1	27004	T-cell leukemia/lymphoma 6		L	0																																												0			AB035338		14q32.1	2012-10-16	2010-06-01		ENSG00000187621	ENSG00000187621		"""Long non-coding RNAs"""	13463	non-coding RNA	RNA, long non-coding		604412	"""T-cell leukemia/lymphoma 6"""			10588720, 10851082	Standard	NR_028288		Approved	TCL6e1, TNG2, TNG1	uc001yev.2		OTTHUMG00000149979		14.37:g.96130203delT				RNA	DEL	-	NULL	ENST00000467865.1	37	NULL		14																																																																																			TCL6	-	-	ENSG00000187621		0.423	TCL6-009	KNOWN	basic	lincRNA	TCL6	HGNC	processed_transcript	OTTHUMT00000315133.1		0.00	9	0	T	NM_012468		96130203	+1			no_errors	ENST00000352367	ensembl	human	known	74_37	rna	28.57	5	2	DEL	0.012	0
TECRL	253017	genome.wustl.edu	37	4	65275035	65275035	+	Missense_Mutation	SNP	C	C	T	rs376067868		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:65275035C>T	ENST00000381210.3	-	1	145	c.35G>A	c.(34-36)cGc>cAc	p.R12H	TECRL_ENST00000507440.1_Missense_Mutation_p.R12H	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	12					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						TGCTCTCTTGCGTTCCGAAGC	0.423																																																	0								C	HIS/ARG	0,4406		0,0,2203	127.0	127.0	127.0		35	2.5	1.0	4		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	TECRL	NM_001010874.4	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	12/364	65275035	1,13005	2203	4300	6503	SO:0001583	missense	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.35G>A	4.37:g.65275035C>T	ENSP00000370607:p.Arg12His			Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.R12H	ENST00000381210.3	37	c.35	CCDS33990.1	4	.	.	.	.	.	.	.	.	.	.	C	7.416	0.635761	0.14386	0.0	1.16E-4	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.46063	0.88;0.88;0.88	5.16	2.47	0.30058	.	0.878015	0.09776	N	0.757279	T	0.34978	0.0916	L	0.57536	1.79	0.21220	N	0.999753	P;P	0.45715	0.856;0.865	B;B	0.40602	0.334;0.176	T	0.18745	-1.0327	10	0.29301	T	0.29	-4.2972	3.8935	0.09128	0.1676:0.5656:0.0:0.2668	.	12;12	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	H	12	ENSP00000426043:R12H;ENSP00000370607:R12H;ENSP00000422497:R12H	ENSP00000370607:R12H	R	-	2	0	TECRL	64957630	0.918000	0.31147	0.956000	0.39512	0.073000	0.16967	0.359000	0.20233	0.683000	0.31428	-0.157000	0.13467	CGC	TECRL	-	NULL	ENSG00000205678		0.423	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	-	0.00	42	0	C	NM_001010874		65275035	-1	tier1	-	no_errors	ENST00000381210	ensembl	human	known	74_37	missense	29.23	46	19	SNP	0.919	T
TGOLN2	10618	genome.wustl.edu	37	2	85553791	85553791	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:85553791C>T	ENST00000409232.3	-	2	1125	c.1064G>A	c.(1063-1065)cGt>cAt	p.R355H	TGOLN2_ENST00000398263.2_Missense_Mutation_p.R297H|TGOLN2_ENST00000282120.2_Missense_Mutation_p.R199H|TGOLN2_ENST00000377386.3_Missense_Mutation_p.R355H|TGOLN2_ENST00000444342.2_Missense_Mutation_p.R355H|TGOLN2_ENST00000409015.1_Missense_Mutation_p.R355H			O43493	TGON2_HUMAN	trans-golgi network protein 2	355						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											TGTCCCTTCACGGTTCTCACT	0.532																																																	0													89.0	87.0	87.0					2																	85553791		1887	4123	6010	SO:0001583	missense	0			AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.1064G>A	2.37:g.85553791C>T	ENSP00000386443:p.Arg355His		B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Missense_Mutation	SNP	NULL	p.R355H	ENST00000409232.3	37	c.1064	CCDS56126.1	2	.	.	.	.	.	.	.	.	.	.	C	18.65	3.670303	0.67814	.	.	ENSG00000152291	ENST00000377386;ENST00000282120;ENST00000398263;ENST00000409232;ENST00000409015;ENST00000444342	T;T;T;T;T;T	0.13089	2.85;2.66;2.62;2.86;2.85;2.85	4.06	-6.11	0.02131	.	.	.	.	.	T	0.20981	0.0505	L	0.55481	1.735	0.09310	N	1	D;D;D;P	0.89917	1.0;1.0;0.999;0.559	D;D;D;B	0.67900	0.952;0.952;0.954;0.06	T	0.07927	-1.0747	9	0.56958	D	0.05	-1.6813	3.3761	0.07238	0.1255:0.1773:0.1244:0.5728	.	355;355;297;355	O43493;O43493-5;O43493-4;O43493-2	TGON2_HUMAN;.;.;.	H	355;199;297;355;355;355	ENSP00000366603:R355H;ENSP00000282120:R199H;ENSP00000381312:R297H;ENSP00000386443:R355H;ENSP00000387035:R355H;ENSP00000391190:R355H	ENSP00000282120:R199H	R	-	2	0	TGOLN2	85407302	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-2.480000	0.00983	-1.238000	0.02535	-0.140000	0.14226	CGT	TGOLN2	-	NULL	ENSG00000152291		0.532	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TGOLN2	HGNC	protein_coding	OTTHUMT00000329045.2	-	0.00	63	0	C	NM_006464		85553791	-1	tier1	-	no_errors	ENST00000377386	ensembl	human	known	74_37	missense	49.46	47	46	SNP	0.000	T
THBD	7056	genome.wustl.edu	37	20	23028817	23028817	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr20:23028817A>C	ENST00000377103.2	-	1	1561	c.1325T>G	c.(1324-1326)aTc>aGc	p.I442S		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	442	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	GCACTCGTCGATGTCCGTGCA	0.642																																																	0													54.0	49.0	51.0					20																	23028817		2203	4300	6503	SO:0001583	missense	0				CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1325T>G	20.37:g.23028817A>C	ENSP00000366307:p.Ile442Ser		Q8IV29|Q9UC32	Missense_Mutation	SNP	pirsf_CD93/CD141,pfam_Tme5_EGF-like,pfam_EGF-like_Ca-bd_dom,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,prints_Thrombomodulin,pfscan_C-type_lectin	p.I442S	ENST00000377103.2	37	c.1325	CCDS13148.1	20	.	.	.	.	.	.	.	.	.	.	A	15.25	2.779153	0.49891	.	.	ENSG00000178726	ENST00000377103;ENST00000503590	D	0.93604	-3.25	4.82	4.82	0.62117	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.563014	0.15363	U	0.266307	D	0.97151	0.9069	M	0.91249	3.19	0.50313	D	0.999863	D	0.89917	1.0	D	0.71414	0.973	D	0.97277	0.9915	10	0.66056	D	0.02	-17.0391	13.5572	0.61765	1.0:0.0:0.0:0.0	.	442	P07204	TRBM_HUMAN	S	442;424	ENSP00000366307:I442S	ENSP00000366307:I442S	I	-	2	0	THBD	22976817	1.000000	0.71417	0.984000	0.44739	0.110000	0.19582	4.445000	0.60007	1.797000	0.52628	0.459000	0.35465	ATC	THBD	-	pirsf_CD93/CD141,pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom	ENSG00000178726		0.642	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBD	HGNC	protein_coding	OTTHUMT00000078307.2	-	0.00	52	0	A			23028817	-1	tier1	-	no_errors	ENST00000377103	ensembl	human	known	74_37	missense	23.53	78	24	SNP	0.986	C
TIAM2	26230	genome.wustl.edu	37	6	155458470	155458470	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:155458470G>A	ENST00000461783.3	+	7	2627	c.1354G>A	c.(1354-1356)Gat>Aat	p.D452N	TIAM2_ENST00000529824.2_Missense_Mutation_p.D452N|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000360366.4_Missense_Mutation_p.D452N|TIAM2_ENST00000456144.1_Missense_Mutation_p.D452N|TIAM2_ENST00000318981.5_Missense_Mutation_p.D452N			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	452					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		GATTGGCAGCGATCCCCTCCG	0.502																																																	0													101.0	107.0	105.0					6																	155458470		2203	4300	6503	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1354G>A	6.37:g.155458470G>A	ENSP00000437188:p.Asp452Asn		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.D452N	ENST00000461783.3	37	c.1354	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442499	0.83993	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.10288	2.97;2.89;2.95;2.97;2.98;2.95	6.08	6.08	0.98989	.	0.104462	0.64402	D	0.000005	T	0.10852	0.0265	M	0.66939	2.045	0.80722	D	1	D	0.53745	0.962	B	0.41299	0.353	T	0.04216	-1.0968	10	0.48119	T	0.1	.	20.6634	0.99662	0.0:0.0:1.0:0.0	.	452	Q8IVF5	TIAM2_HUMAN	N	452;698;452;452;452;452;452	ENSP00000437188:D452N;ENSP00000434901:D452N;ENSP00000407746:D452N;ENSP00000327315:D452N;ENSP00000353528:D452N;ENSP00000433348:D452N	ENSP00000327315:D452N	D	+	1	0	TIAM2	155500162	1.000000	0.71417	0.844000	0.33320	0.868000	0.49771	7.303000	0.78871	2.894000	0.99253	0.655000	0.94253	GAT	TIAM2	-	NULL	ENSG00000146426		0.502	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2	-	0.00	40	0	G	NM_012454		155458470	+1	tier1	-	no_errors	ENST00000456144	ensembl	human	known	74_37	missense	34.88	28	15	SNP	1.000	A
TMEM108	66000	genome.wustl.edu	37	3	133099114	133099114	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:133099114C>A	ENST00000321871.6	+	4	769	c.559C>A	c.(559-561)Cct>Act	p.P187T	TMEM108_ENST00000515826.1_Missense_Mutation_p.P187T|TMEM108_ENST00000508711.1_Intron|TMEM108_ENST00000393130.3_Missense_Mutation_p.P187T	NM_001136469.1|NM_023943.2	NP_001129941.1|NP_076432.1	Q6UXF1	TM108_HUMAN	transmembrane protein 108	187	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						CCCGCCTGCACCTGGTGGCCA	0.627																																																	0													27.0	29.0	28.0					3																	133099114		2203	4300	6503	SO:0001583	missense	0			AL136578	CCDS33858.1, CCDS75012.1	3q22.1	2014-04-07			ENSG00000144868	ENSG00000144868			28451	protein-coding gene	gene with protein product	"""cancer/testis antigen 124"""					11214970	Standard	XM_005247726		Approved	MGC3040, CT124	uc003epi.3	Q6UXF1	OTTHUMG00000159685	ENST00000321871.6:c.559C>A	3.37:g.133099114C>A	ENSP00000324651:p.Pro187Thr		D3DNC9|Q9BQH1|Q9BW81|Q9C0H3	Missense_Mutation	SNP	NULL	p.P187T	ENST00000321871.6	37	c.559	CCDS33858.1	3	.	.	.	.	.	.	.	.	.	.	C	2.179	-0.388011	0.04932	.	.	ENSG00000144868	ENST00000321871;ENST00000393130;ENST00000515826	T;T;T	0.42513	0.97;0.97;0.97	4.32	-0.0188	0.13962	.	0.459127	0.18142	N	0.150384	T	0.23965	0.0580	L	0.35414	1.06	0.09310	N	1	B;B	0.32829	0.386;0.026	B;B	0.36666	0.23;0.01	T	0.08576	-1.0715	10	0.17369	T	0.5	-1.7049	1.1928	0.01868	0.1725:0.4455:0.1687:0.2133	.	187;187	E9PB58;Q6UXF1	.;TM108_HUMAN	T	187	ENSP00000324651:P187T;ENSP00000376838:P187T;ENSP00000423338:P187T	ENSP00000324651:P187T	P	+	1	0	TMEM108	134581804	0.000000	0.05858	0.001000	0.08648	0.236000	0.25371	-0.454000	0.06770	0.359000	0.24239	0.561000	0.74099	CCT	TMEM108	-	NULL	ENSG00000144868		0.627	TMEM108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM108	HGNC	protein_coding	OTTHUMT00000356907.2	-	0.00	8	0	C	NM_023943		133099114	+1	tier1	-	no_errors	ENST00000321871	ensembl	human	known	74_37	missense	45.16	17	14	SNP	0.000	A
TMEM17	200728	genome.wustl.edu	37	2	62728353	62728353	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:62728353T>C	ENST00000335390.5	-	4	799	c.588A>G	c.(586-588)gaA>gaG	p.E196E		NM_198276.2	NP_938017.2	Q86X19	TMM17_HUMAN	transmembrane protein 17	196					cilium assembly (GO:0042384)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	Lung NSC(7;0.0274)|all_lung(7;0.0568)		LUSC - Lung squamous cell carcinoma(7;1.31e-05)|Epithelial(17;0.169)			ATCAGATCTCTTCTATACATG	0.423																																																	0													132.0	119.0	123.0					2																	62728353		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1871.1	2p15	2008-02-05			ENSG00000186889	ENSG00000186889			26623	protein-coding gene	gene with protein product		614950				12477932	Standard	NM_198276		Approved	FLJ34583	uc002sbt.2	Q86X19	OTTHUMG00000129455	ENST00000335390.5:c.588A>G	2.37:g.62728353T>C			Q53QP7|Q53R98	Silent	SNP	pfam_Uncharacterised_TM-17	p.E196	ENST00000335390.5	37	c.588	CCDS1871.1	2																																																																																			TMEM17	-	NULL	ENSG00000186889		0.423	TMEM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM17	HGNC	protein_coding	OTTHUMT00000251618.3	-	0.00	63	0	T	NM_198276		62728353	-1	tier1	-	no_errors	ENST00000335390	ensembl	human	known	74_37	silent	16.79	109	22	SNP	1.000	C
TMEM206	55248	genome.wustl.edu	37	1	212553243	212553243	+	Missense_Mutation	SNP	A	A	C	rs532279691	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:212553243A>C	ENST00000261455.4	-	5	769	c.632T>G	c.(631-633)cTg>cGg	p.L211R	TMEM206_ENST00000535273.1_Missense_Mutation_p.L272R	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	211						cell surface (GO:0009986)|integral component of membrane (GO:0016021)		p.?(1)		breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		CCACCTTTGCAGGAACTCCTG	0.498																																																	1	Unknown(1)	skin(1)											87.0	91.0	90.0					1																	212553243		2203	4300	6503	SO:0001583	missense	0			AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.632T>G	1.37:g.212553243A>C	ENSP00000261455:p.Leu211Arg		B7Z4D6|Q6IA87|Q9NV85	Missense_Mutation	SNP	NULL	p.L272R	ENST00000261455.4	37	c.815	CCDS1504.1	1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.056271	0.55325	.	.	ENSG00000065600	ENST00000261455;ENST00000535273	.	.	.	5.57	5.57	0.84162	.	0.465881	0.24022	N	0.042268	T	0.53610	0.1807	N	0.24115	0.695	0.37631	D	0.921665	D;P	0.57571	0.98;0.573	P;P	0.54312	0.748;0.468	T	0.63611	-0.6598	9	0.87932	D	0	-4.9101	15.7715	0.78173	1.0:0.0:0.0:0.0	.	272;211	B7Z4D6;Q9H813	.;TM206_HUMAN	R	211;272	.	ENSP00000261455:L211R	L	-	2	0	TMEM206	210619866	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.901000	0.56303	2.129000	0.65627	0.529000	0.55759	CTG	TMEM206	-	NULL	ENSG00000065600		0.498	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM206	HGNC	protein_coding	OTTHUMT00000089306.1		0.00	34	0	A	NM_018252		212553243	-1			no_errors	ENST00000535273	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	C
TMEM74	157753	genome.wustl.edu	37	8	109797149	109797149	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:109797149A>C	ENST00000297459.3	-	2	357	c.179T>G	c.(178-180)cTt>cGt	p.L60R	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	60					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			AGAAGAACTAAGTTTAGACCC	0.522																																																	0													117.0	117.0	117.0					8																	109797149		2203	4300	6503	SO:0001583	missense	0			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.179T>G	8.37:g.109797149A>C	ENSP00000297459:p.Leu60Arg			Missense_Mutation	SNP	NULL	p.L60R	ENST00000297459.3	37	c.179	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	A	9.318	1.057414	0.19907	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.9	-2.88	0.05682	.	0.497767	0.21192	N	0.078635	T	0.20941	0.0504	L	0.29908	0.895	0.09310	N	1	P	0.40834	0.73	B	0.42422	0.387	T	0.11991	-1.0565	9	0.41790	T	0.15	0.1406	3.2201	0.06712	0.4199:0.1127:0.3575:0.11	.	60	Q96NL1	TMM74_HUMAN	R	60	.	ENSP00000297459:L60R	L	-	2	0	TMEM74	109866325	0.000000	0.05858	0.001000	0.08648	0.739000	0.42172	0.033000	0.13754	-0.070000	0.12908	0.533000	0.62120	CTT	TMEM74	-	NULL	ENSG00000164841		0.522	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	HGNC	protein_coding	OTTHUMT00000380755.1	-	0.00	55	0	A	NM_153015		109797149	-1	tier1	-	no_errors	ENST00000297459	ensembl	human	known	74_37	missense	50.88	28	29	SNP	0.000	C
TMF1	7110	genome.wustl.edu	37	3	69079117	69079117	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:69079117G>A	ENST00000398559.2	-	11	2659	c.2443C>T	c.(2443-2445)Cgt>Tgt	p.R815C	CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|TMF1_ENST00000543976.1_Missense_Mutation_p.R818C|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA|CTD-2013N24.2_ENST00000599467.1_RNA|CTD-2013N24.2_ENST00000601511.1_RNA|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000597366.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	815					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		GTAGCTGCACGTTCTCTCTCA	0.423																																																	0													108.0	108.0	108.0					3																	69079117		1928	4144	6072	SO:0001583	missense	0				CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2443C>T	3.37:g.69079117G>A	ENSP00000381567:p.Arg815Cys		B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	pfam_TMF_TATA-bd,pfam_TMF_DNA-bd	p.R818C	ENST00000398559.2	37	c.2452	CCDS43105.1	3	.	.	.	.	.	.	.	.	.	.	G	25.0	4.590676	0.86851	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	T;T	0.24538	1.85;1.85	5.67	5.67	0.87782	.	0.049428	0.85682	D	0.000000	T	0.54743	0.1877	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.55636	-0.8110	10	0.66056	D	0.02	-8.2025	19.7602	0.96311	0.0:0.0:1.0:0.0	.	818;815	P82094-2;P82094	.;TMF1_HUMAN	C	815;818;731	ENSP00000381567:R815C;ENSP00000438706:R818C	ENSP00000348582:R731C	R	-	1	0	TMF1	69161807	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.580000	0.82523	2.661000	0.90470	0.591000	0.81541	CGT	TMF1	-	NULL	ENSG00000144747		0.423	TMF1-001	KNOWN	basic|CCDS	protein_coding	TMF1	HGNC	protein_coding	OTTHUMT00000352106.1		0.00	21	0	G	NM_007114		69079117	-1			no_errors	ENST00000543976	ensembl	human	known	74_37	missense	11.11	16	2	SNP	1.000	A
TMPRSS9	360200	genome.wustl.edu	37	19	2422216	2422216	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:2422216C>T	ENST00000332578.3	+	13	2417	c.2417C>T	c.(2416-2418)cCg>cTg	p.P806L		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	806					plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGACGCCCCGGAGGCCACC	0.632																																																	0													72.0	81.0	78.0					19																	2422216		2203	4300	6503	SO:0001583	missense	0			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.2417C>T	19.37:g.2422216C>T	ENSP00000330264:p.Pro806Leu		Q6ZND6|Q7Z411	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Trypsin-like_Pept_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1	p.P806L	ENST00000332578.3	37	c.2417	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	C	4.437	0.080939	0.08533	.	.	ENSG00000178297	ENST00000332578	D	0.88586	-2.4	3.6	-0.0249	0.13937	.	0.522309	0.17204	N	0.182993	T	0.79293	0.4421	L	0.29908	0.895	0.09310	N	1	B	0.15473	0.013	B	0.13407	0.009	T	0.62932	-0.6749	10	0.29301	T	0.29	.	8.028	0.30448	0.1299:0.702:0.0:0.168	.	806	Q7Z410	TMPS9_HUMAN	L	806	ENSP00000330264:P806L	ENSP00000330264:P806L	P	+	2	0	TMPRSS9	2373216	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.128000	0.10531	-0.289000	0.09038	-1.579000	0.00862	CCG	TMPRSS9	-	pirsf_Pept_S1A_polyserase-1	ENSG00000178297		0.632	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	-	0.00	33	0	C	NM_182973		2422216	+1	tier1	-	no_errors	ENST00000332578	ensembl	human	known	74_37	missense	58.44	31	45	SNP	0.003	T
TP53	7157	genome.wustl.edu	37	17	7577548	7577548	+	Missense_Mutation	SNP	C	C	T	rs28934575|rs397516437		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:7577548C>T	ENST00000269305.4	-	7	922	c.733G>A	c.(733-735)Ggc>Agc	p.G245S	TP53_ENST00000359597.4_Missense_Mutation_p.G245S|TP53_ENST00000420246.2_Missense_Mutation_p.G245S|TP53_ENST00000445888.2_Missense_Mutation_p.G245S|TP53_ENST00000413465.2_Missense_Mutation_p.G245S|TP53_ENST00000455263.2_Missense_Mutation_p.G245S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	245	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		G -> A (in sporadic cancers; somatic mutation).|G -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1978757}.|G -> D (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2259385}.|G -> E (in a sporadic cancer; somatic mutation).|G -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|G -> L (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|G -> R (in sporadic cancers; somatic mutation).|G -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs28934575). {ECO:0000269|PubMed:8829627}.|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:2263646}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.G245S(304)|p.G245C(59)|p.G245R(10)|p.G152S(8)|p.0?(8)|p.?(5)|p.G152C(4)|p.G244_M246>V(3)|p.G245N(2)|p.G245fs*2(2)|p.G245H(1)|p.G245L(1)|p.G244fs*17(1)|p.G245F(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*22(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.M243fs*18(1)|p.G151_M153>V(1)|p.G245del(1)|p.G245fs*14(1)|p.G245fs*17(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGGTTCATGCCGCCCATGCAG	0.577	G245S(LS1034_LARGE_INTESTINE)|G245S(NUGC2_STOMACH)|G245S(PANC0403_PANCREAS)|G245S(SKLMS1_SOFT_TISSUE)|G245S(SKMEL2_SKIN)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	420	Substitution - Missense(390)|Deletion - Frameshift(8)|Whole gene deletion(8)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)|Insertion - Frameshift(1)	large_intestine(119)|lung(51)|breast(38)|ovary(29)|central_nervous_system(27)|upper_aerodigestive_tract(25)|stomach(25)|haematopoietic_and_lymphoid_tissue(23)|oesophagus(22)|urinary_tract(14)|skin(9)|liver(7)|prostate(7)|biliary_tract(5)|bone(5)|pancreas(4)|soft_tissue(3)|vulva(2)|endometrium(2)|kidney(1)|cervix(1)|salivary_gland(1)	GRCh37	CM010463|CM900210|CM920674	TP53	M	rs28934575	C	SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY,SER/GLY	0,4406		0,0,2203	149.0	112.0	125.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	733,733,733,733,337,337,337	4.6	1.0	17	dbSNP_125	125	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	56,56,56,56,56,56,56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	245/394,245/394,245/347,245/342,113/262,113/210,113/215	7577548	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.733G>A	17.37:g.7577548C>T	ENSP00000269305:p.Gly245Ser		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.G245S	ENST00000269305.4	37	c.733	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.259904	0.95368	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99894	-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58;-7.58	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99878	0.9942	M	0.84585	2.705	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.976;0.992;0.999;0.999;1.0	D	0.96039	0.9023	10	0.87932	D	0	-19.4293	15.3618	0.74483	0.0:1.0:0.0:0.0	rs28934575	245;245;152;245;245;245	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	S	245;245;245;245;245;245;234;152;113;152	ENSP00000410739:G245S;ENSP00000352610:G245S;ENSP00000269305:G245S;ENSP00000398846:G245S;ENSP00000391127:G245S;ENSP00000391478:G245S;ENSP00000425104:G113S;ENSP00000423862:G152S	ENSP00000269305:G245S	G	-	1	0	TP53	7518273	1.000000	0.71417	0.965000	0.40720	0.974000	0.67602	7.609000	0.82925	2.564000	0.86499	0.462000	0.41574	GGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	65	0	C	NM_000546		7577548	-1	tier1	rs28934575	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	67.86	17	38	SNP	1.000	T
TPTE	7179	genome.wustl.edu	37	21	10920111	10920111	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr21:10920111T>A	ENST00000361285.4	-	19	1472	c.1143A>T	c.(1141-1143)aaA>aaT	p.K381N	TPTE_ENST00000342420.5_Missense_Mutation_p.K343N|TPTE_ENST00000298232.7_Missense_Mutation_p.K363N|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	381	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTCCCTGAAATTTTTCGCTGT	0.388																																																	0													94.0	90.0	91.0					21																	10920111		2203	4300	6503	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1143A>T	21.37:g.10920111T>A	ENSP00000355208:p.Lys381Asn		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.K381N	ENST00000361285.4	37	c.1143	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	9.389	1.075003	0.20227	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98567	-5.0;-5.0;-5.0	2.32	1.13	0.20643	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.98333	0.9447	M	0.85710	2.77	0.45464	D	0.998431	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.70227	0.964;0.964;0.968	D	0.96490	0.9363	10	0.62326	D	0.03	-19.3882	3.6756	0.08291	0.0:0.2209:0.0:0.7791	.	343;363;381	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	N	363;381;343	ENSP00000298232:K363N;ENSP00000355208:K381N;ENSP00000344441:K343N	ENSP00000298232:K363N	K	-	3	2	TPTE	9941982	1.000000	0.71417	0.736000	0.30914	0.093000	0.18481	0.263000	0.18478	0.172000	0.19760	0.155000	0.16302	AAA	TPTE	-	pfam_Dual-sp_phosphatase_cat-dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000166157		0.388	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	207	0	T			10920111	-1	tier1	-	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	20.21	154	39	SNP	0.893	A
TRMU	55687	genome.wustl.edu	37	22	46751484	46751484	+	Splice_Site	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr22:46751484A>G	ENST00000290846.4	+	9	1357	c.1017A>G	c.(1015-1017)ctA>ctG	p.L339L	TRMU_ENST00000381019.3_Splice_Site_p.L339L	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	339					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		AGATGGCACTAGGTGACTGAC	0.637											OREG0026654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													48.0	45.0	46.0					22																	46751484		2203	4300	6503	SO:0001630	splice_region_variant	0			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.1018+1A>G	22.37:g.46751484A>G		941	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Silent	SNP	pfam_tRNA-specific_2-thiouridylase,pfam_ThiI_C_dom,pfam_NAD/GMP_synthase,tigrfam_tRNA-specific_2-thiouridylase	p.L339	ENST00000290846.4	37	c.1017	CCDS14075.1	22																																																																																			TRMU	-	pfam_tRNA-specific_2-thiouridylase,tigrfam_tRNA-specific_2-thiouridylase	ENSG00000100416		0.637	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMU	HGNC	protein_coding	OTTHUMT00000318042.2	-	0.00	34	0	A	NM_018006	Silent	46751484	+1	tier1	-	no_errors	ENST00000290846	ensembl	human	known	74_37	silent	28.81	42	17	SNP	1.000	G
TSG101	7251	genome.wustl.edu	37	11	18502114	18502114	+	Silent	SNP	G	G	T	rs573872668		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:18502114G>T	ENST00000251968.3	-	10	1567	c.1152C>A	c.(1150-1152)gcC>gcA	p.A384A	TSG101_ENST00000357193.3_Silent_p.A279A|TSG101_ENST00000536719.1_Intron	NM_006292.3	NP_006283.1	Q99816	TS101_HUMAN	tumor susceptibility 101	384	SB. {ECO:0000255|PROSITE- ProRule:PRU00644}.				cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cellular protein modification process (GO:0006464)|endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|keratinocyte differentiation (GO:0030216)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell growth (GO:0001558)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|viral budding (GO:0046755)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|multivesicular body (GO:0005771)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transcription corepressor activity (GO:0003714)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	22						CACTGAGACCGGCAGTCTTTC	0.448																																					GBM(99;1348 1396 8611 26475 50572)												0													88.0	83.0	85.0					11																	18502114		2199	4293	6492	SO:0001819	synonymous_variant	0			U82130	CCDS7842.1	11p15	2013-08-22	2013-08-22		ENSG00000074319	ENSG00000074319			15971	protein-coding gene	gene with protein product		601387	"""tumor susceptibility gene 10"", ""tumor susceptibility gene 101"""	TSG10		9019400, 9241264	Standard	NM_006292		Approved	VPS23	uc001mor.3	Q99816	OTTHUMG00000167725	ENST00000251968.3:c.1152C>A	11.37:g.18502114G>T			Q9BUM5	Silent	SNP	pfam_UEV_N,pfam_Steadiness_box,superfamily_UBQ-conjugating_enzyme/RWD	p.A384	ENST00000251968.3	37	c.1152	CCDS7842.1	11																																																																																			TSG101	-	NULL	ENSG00000074319		0.448	TSG101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSG101	HGNC	protein_coding	OTTHUMT00000395906.1		0.00	44	0	G	NM_006292		18502114	-1			no_errors	ENST00000251968	ensembl	human	known	74_37	silent	7.50	37	3	SNP	0.256	T
TTN	7273	genome.wustl.edu	37	2	179539829	179539829	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:179539829G>C	ENST00000591111.1	-	146	33651	c.33427C>G	c.(33427-33429)Cct>Gct	p.P11143A	TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.P10216A|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.P11517A|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	11143	Glu-rich.|Pro-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCTTCTTAGGCACCTCAGGA	0.353																																																	0													90.0	86.0	87.0					2																	179539829		1837	4081	5918	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.33427C>G	2.37:g.179539829G>C	ENSP00000465570:p.Pro11143Ala		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P10216A	ENST00000591111.1	37	c.30646		2	.	.	.	.	.	.	.	.	.	.	G	11.23	1.576059	0.28092	.	.	ENSG00000155657	ENST00000342992	T	0.71103	-0.54	5.6	4.71	0.59529	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.62183	0.2407	L	0.33339	1.005	0.80722	D	1	B	0.16603	0.018	B	0.18871	0.023	T	0.60627	-0.7226	9	0.87932	D	0	.	14.5832	0.68305	0.0722:0.0:0.9278:0.0	.	11143	Q8WZ42	TITIN_HUMAN	A	10216	ENSP00000343764:P10216A	ENSP00000343764:P10216A	P	-	1	0	TTN	179248074	0.471000	0.25862	1.000000	0.80357	0.551000	0.35334	1.411000	0.34702	1.334000	0.45468	0.557000	0.71058	CCT	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.353	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	46	0	G	NM_133378		179539829	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	27.87	44	17	SNP	0.998	C
TYRO3	7301	genome.wustl.edu	37	15	41862356	41862356	+	Splice_Site	SNP	T	T	C	rs149022093		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:41862356T>C	ENST00000263798.3	+	10	1606		c.e10+2		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GCGGTTTGGGTAAGGGGATGG	0.567																																																	0													76.0	75.0	75.0					15																	41862356		2203	4300	6503	SO:0001630	splice_region_variant	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.1382+2T>C	15.37:g.41862356T>C			O14953|Q86VR3	Splice_Site	SNP	-	e10+2	ENST00000263798.3	37	c.1382+2	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	T	21.7	4.181954	0.78677	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3401	0.74290	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39649648	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.789000	0.75110	2.208000	0.71279	0.533000	0.62120	.	TYRO3	-	-	ENSG00000092445		0.567	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2		0.00	28	0	T		Intron	41862356	+1			no_errors	ENST00000263798	ensembl	human	known	74_37	splice_site	10.20	44	5	SNP	1.000	C
TYRO3	7301	genome.wustl.edu	37	15	41865875	41865875	+	Splice_Site	SNP	A	A	T	rs77680822		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:41865875A>T	ENST00000263798.3	+	18	2369		c.e18-1		TYRO3_ENST00000559066.1_Splice_Site	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase						apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		ATTCTGTCCCAGTGGGCGTTC	0.582																																																	0													81.0	75.0	77.0					15																	41865875		2203	4300	6503	SO:0001630	splice_region_variant	0			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.2146-1A>T	15.37:g.41865875A>T			O14953|Q86VR3	Splice_Site	SNP	-	e18-2	ENST00000263798.3	37	c.2146-2	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	A	19.63	3.863171	0.71949	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4348	0.75137	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TYRO3	39653167	1.000000	0.71417	0.957000	0.39632	0.794000	0.44872	9.339000	0.96797	2.048000	0.60808	0.533000	0.62120	.	TYRO3	-	-	ENSG00000092445		0.582	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2		0.00	31	0	A		Intron	41865875	+1			no_errors	ENST00000263798	ensembl	human	known	74_37	splice_site	14.63	35	6	SNP	1.000	T
UBR4	23352	genome.wustl.edu	37	1	19486660	19486660	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:19486660G>T	ENST00000375254.3	-	39	5549	c.5522C>A	c.(5521-5523)gCc>gAc	p.A1841D	UBR4_ENST00000375226.2_Missense_Mutation_p.A1841D|UBR4_ENST00000375267.2_Missense_Mutation_p.A1841D|UBR4_ENST00000375217.2_Missense_Mutation_p.A1841D	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1841					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTCACTGAGGGCTTGCTGAGC	0.542																																																	0													102.0	92.0	95.0					1																	19486660		2203	4300	6503	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.5522C>A	1.37:g.19486660G>T	ENSP00000364403:p.Ala1841Asp		A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.A1841D	ENST00000375254.3	37	c.5522	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.285243	0.95517	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.32272	1.5;1.5;1.49;1.46	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.54727	0.1876	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.52697	-0.8541	10	0.59425	D	0.04	.	19.7262	0.96165	0.0:0.0:1.0:0.0	.	1841	Q5T4S7	UBR4_HUMAN	D	1841;1841;1841;1841;551;1057	ENSP00000364403:A1841D;ENSP00000364416:A1841D;ENSP00000364365:A1841D;ENSP00000364374:A1841D	ENSP00000364365:A1841D	A	-	2	0	UBR4	19359247	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.446000	0.97590	2.671000	0.90904	0.552000	0.68991	GCC	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.542	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	0.00	33	0	G	NM_020765		19486660	-1	tier1	-	no_errors	ENST00000375267	ensembl	human	known	74_37	missense	50.00	22	22	SNP	1.000	T
UBR5	51366	genome.wustl.edu	37	8	103269913	103269913	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:103269913G>A	ENST00000520539.1	-	58	8740	c.8134C>T	c.(8134-8136)Cgt>Tgt	p.R2712C	UBR5_ENST00000518205.1_Missense_Mutation_p.R440C|KB-431C1.5_ENST00000606361.1_RNA|UBR5_ENST00000521922.1_Missense_Mutation_p.R2705C|UBR5_ENST00000220959.4_Missense_Mutation_p.R2711C	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2712	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CAGAACCAACGCTTGAACTGC	0.318																																					Ovarian(131;96 1741 5634 7352 27489)												0													83.0	78.0	80.0					8																	103269913		2203	4300	6503	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.8134C>T	8.37:g.103269913G>A	ENSP00000429084:p.Arg2712Cys		B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_RCC1/BLIP-II,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.R2712C	ENST00000520539.1	37	c.8134	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.178172	0.94846	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.47	5.47	0.80525	HECT (4);	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	M	0.85777	2.775	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.993	T	0.82866	-0.0245	10	0.87932	D	0	.	19.3216	0.94243	0.0:0.0:1.0:0.0	.	2705;2712	E7EMW7;O95071	.;UBR5_HUMAN	C	2712;2711;440;2705	ENSP00000429084:R2712C;ENSP00000220959:R2711C;ENSP00000428693:R440C;ENSP00000427819:R2705C	ENSP00000220959:R2711C	R	-	1	0	UBR5	103339089	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.578000	0.87016	0.585000	0.79938	CGT	UBR5	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000104517		0.318	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	-	0.00	44	0	G	NM_015902		103269913	-1	tier1	-	no_errors	ENST00000520539	ensembl	human	known	74_37	missense	76.92	36	120	SNP	1.000	A
UGT2B11	10720	genome.wustl.edu	37	4	70080140	70080140	+	Silent	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr4:70080140G>T	ENST00000446444.1	-	1	309	c.301C>A	c.(301-303)Cga>Aga	p.R101R	RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	101					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.R101*(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CTATCTTTTCGAATGTCTGAC	0.299																																																	1	Substitution - Nonsense(1)	large_intestine(1)											63.0	79.0	73.0					4																	70080140		2189	4291	6480	SO:0001819	synonymous_variant	0			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.301C>A	4.37:g.70080140G>T			Q3KNV9	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R101	ENST00000446444.1	37	c.301	CCDS3527.1	4																																																																																			UGT2B11	-	pfam_UDP_glucos_trans	ENSG00000213759		0.299	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	HGNC	protein_coding	OTTHUMT00000251551.2		0.00	70	0	G	NM_001073		70080140	-1			no_errors	ENST00000446444	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.000	T
UNC5D	137970	genome.wustl.edu	37	8	35616888	35616888	+	Silent	SNP	A	A	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:35616888A>G	ENST00000404895.2	+	14	2542	c.2214A>G	c.(2212-2214)ccA>ccG	p.P738P	UNC5D_ENST00000453357.2_Silent_p.P733P|UNC5D_ENST00000287272.2_Silent_p.P669P|UNC5D_ENST00000449677.1_Silent_p.P314P|UNC5D_ENST00000416672.1_Silent_p.P743P|UNC5D_ENST00000420357.1_Silent_p.P671P	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	738					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGGAAGAACCAAAATTGCTGC	0.403																																																	0													168.0	162.0	164.0					8																	35616888		2203	4300	6503	SO:0001819	synonymous_variant	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2214A>G	8.37:g.35616888A>G			Q8WYP7	Silent	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.P738	ENST00000404895.2	37	c.2214	CCDS6093.2	8																																																																																			UNC5D	-	NULL	ENSG00000156687		0.403	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	53	0	A			35616888	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	silent	51.79	27	29	SNP	0.999	G
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																																	1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	0			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met		O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	UNC93B1	-	NULL	ENSG00000110057		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding			0.00	23	0	C	NM_030930		67759316	-1			no_errors	ENST00000227471	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.997	T
USP29	57663	genome.wustl.edu	37	19	57642310	57642310	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:57642310G>A	ENST00000254181.4	+	4	2721	c.2267G>A	c.(2266-2268)aGg>aAg	p.R756K	USP29_ENST00000598197.1_Missense_Mutation_p.R756K	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	756	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCAGGTGTTAGGAAGCTGGAT	0.478																																																	0													51.0	45.0	47.0					19																	57642310		2203	4300	6503	SO:0001583	missense	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.2267G>A	19.37:g.57642310G>A	ENSP00000254181:p.Arg756Lys			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R756K	ENST00000254181.4	37	c.2267	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.771975	0.00645	.	.	ENSG00000131864	ENST00000254181	T	0.44482	0.92	1.72	0.571	0.17352	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.	.	.	.	T	0.18257	0.0438	N	0.22421	0.69	0.09310	N	1	P	0.39576	0.679	B	0.32465	0.146	T	0.15752	-1.0426	9	0.02654	T	1	.	5.7828	0.18316	0.0:0.3408:0.6592:0.0	.	756	Q9HBJ7	UBP29_HUMAN	K	756	ENSP00000254181:R756K	ENSP00000254181:R756K	R	+	2	0	USP29	62334122	0.005000	0.15991	0.001000	0.08648	0.000000	0.00434	1.057000	0.30492	0.230000	0.21059	-0.479000	0.04858	AGG	USP29	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000131864		0.478	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	-	0.00	24	0	G			57642310	+1	tier1	-	no_errors	ENST00000254181	ensembl	human	known	74_37	missense	29.41	36	15	SNP	0.001	A
USP31	57478	genome.wustl.edu	37	16	23093862	23093862	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:23093862G>T	ENST00000219689.7	-	12	1846	c.1847C>A	c.(1846-1848)gCc>gAc	p.A616D		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	267	DUSP 2. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		GCAACGCCAGGCATCATCGGG	0.498																																																	0													82.0	71.0	75.0					16																	23093862		2197	4300	6497	SO:0001583	missense	0			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1847C>A	16.37:g.23093862G>T	ENSP00000219689:p.Ala616Asp		B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.A616D	ENST00000219689.7	37	c.1847	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	G	23.7	4.452447	0.84209	.	.	ENSG00000103404	ENST00000219689	T	0.03094	4.05	4.9	3.94	0.45596	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.14313	0.0346	M	0.62016	1.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00386	-1.1772	10	0.59425	D	0.04	-11.6957	12.3398	0.55087	0.0817:0.0:0.9183:0.0	.	616	Q70CQ4	UBP31_HUMAN	D	616	ENSP00000219689:A616D	ENSP00000219689:A616D	A	-	2	0	USP31	23001363	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.370000	0.97159	1.181000	0.42912	0.650000	0.86243	GCC	USP31	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000103404		0.498	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	-	0.00	32	0	G	NM_020718		23093862	-1	tier1	-	no_errors	ENST00000219689	ensembl	human	known	74_37	missense	51.52	16	17	SNP	1.000	T
USP35	57558	genome.wustl.edu	37	11	77924720	77924720	+	Missense_Mutation	SNP	C	C	T	rs570683097	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr11:77924720C>T	ENST00000529308.1	+	11	3179	c.2918C>T	c.(2917-2919)gCg>gTg	p.A973V	USP35_ENST00000530535.1_3'UTR|USP35_ENST00000441408.2_Missense_Mutation_p.A559V|USP35_ENST00000526425.1_Missense_Mutation_p.A704V|USP35_ENST00000530267.1_Missense_Mutation_p.A541V	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	973					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CGGAGCAGGGCGGCCTACATC	0.577													c|||	2	0.000399361	0.0	0.0014	5008	,	,		19001	0.001		0.0	False		,,,				2504	0.0																0													49.0	51.0	51.0					11																	77924720		1955	4123	6078	SO:0001583	missense	0			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2918C>T	11.37:g.77924720C>T	ENSP00000431876:p.Ala973Val			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,superfamily_ARM-type_fold,pfscan_Peptidase_C19/C67	p.A973V	ENST00000529308.1	37	c.2918	CCDS41693.1	11	.	.	.	.	.	.	.	.	.	.	c	20.7	4.035406	0.75617	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T	0.17213	2.91;3.04;2.29;2.96	4.7	4.7	0.59300	.	0.440036	0.18692	N	0.133821	T	0.25121	0.0610	N	0.22421	0.69	0.26596	N	0.973104	B;D	0.65815	0.342;0.995	B;P	0.62740	0.054;0.906	T	0.03898	-1.0994	10	0.54805	T	0.06	-15.5715	13.1795	0.59647	0.0:0.7096:0.2904:0.0	.	973;559	Q9P2H5;E7EWV7	UBP35_HUMAN;.	V	541;973;559;704	ENSP00000435468:A541V;ENSP00000431876:A973V;ENSP00000400825:A559V;ENSP00000434942:A704V	ENSP00000400825:A559V	A	+	2	0	USP35	77602368	0.948000	0.32251	0.968000	0.41197	0.910000	0.53928	1.996000	0.40776	2.436000	0.82500	0.558000	0.71614	GCG	USP35	-	NULL	ENSG00000118369		0.577	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	HGNC	protein_coding	OTTHUMT00000390026.1	-	0.00	31	0	C	XM_290527		77924720	+1	tier1	-	no_errors	ENST00000529308	ensembl	human	known	74_37	missense	41.18	29	21	SNP	0.761	T
USP42	84132	genome.wustl.edu	37	7	6183719	6183719	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:6183719T>C	ENST00000306177.5	+	9	1040	c.882T>C	c.(880-882)tgT>tgC	p.C294C		NM_032172.2	NP_115548.1	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	294	USP.				cell differentiation (GO:0030154)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(2)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	35		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		TTTCAAGGTGTAAAAAGATGG	0.323																																																	0													125.0	113.0	116.0					7																	6183719		1829	4091	5920	SO:0001819	synonymous_variant	0			AK022759	CCDS47535.1	7p22.2	2005-08-08	2005-08-08		ENSG00000106346	ENSG00000106346		"""Ubiquitin-specific peptidases"""	20068	protein-coding gene	gene with protein product			"""ubiquitin specific protease 42"""			12838346	Standard	NM_032172		Approved	FLJ12697	uc011jwp.2	Q9H9J4	OTTHUMG00000151888	ENST00000306177.5:c.882T>C	7.37:g.6183719T>C			A2RUE3|B5MDA5|Q0VIN8|Q3C166|Q6P9B4	Silent	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.C294	ENST00000306177.5	37	c.882	CCDS47535.1	7																																																																																			USP42	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000106346		0.323	USP42-005	KNOWN	basic|appris_principal|CCDS	protein_coding	USP42	HGNC	protein_coding	OTTHUMT00000324262.3	-	0.00	92	0	T	XM_166526		6183719	+1	tier1	-	no_errors	ENST00000306177	ensembl	human	known	74_37	silent	10.47	154	18	SNP	1.000	C
USP6	9098	genome.wustl.edu	37	17	5042962	5042962	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr17:5042962C>T	ENST00000574788.1	+	22	3721	c.1491C>T	c.(1489-1491)tgC>tgT	p.C497C	USP6_ENST00000332776.4_Silent_p.C497C|USP6_ENST00000250066.6_Silent_p.C497C|USP6_ENST00000304328.5_Silent_p.C180C			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	497					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CTGAACACTGCGGAGAGGGTG	0.607			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													39.0	42.0	41.0					17																	5042962		2203	4300	6503	SO:0001819	synonymous_variant	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1491C>T	17.37:g.5042962C>T			Q15634|Q86WP6|Q8IWT4	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19/C67	p.C497	ENST00000574788.1	37	c.1491	CCDS11069.2	17																																																																																			USP6	-	NULL	ENSG00000129204		0.607	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	-	0.00	53	0	C	NM_004505		5042962	+1	tier1	-	no_errors	ENST00000250066	ensembl	human	known	74_37	silent	68.85	17	42	SNP	0.001	T
UTS2B	257313	genome.wustl.edu	37	3	190995876	190995876	+	Silent	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr3:190995876T>G	ENST00000340524.5	-	6	973	c.187A>C	c.(187-189)Aga>Cga	p.R63R	UTS2B_ENST00000427544.2_Silent_p.R63R	NM_198152.3	NP_937795.2	Q765I0	UTS2B_HUMAN	urotensin 2B	63					regulation of blood pressure (GO:0008217)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)											TTGAAAGGTCTTTGGAAATCA	0.264																																																	0													60.0	61.0	61.0					3																	190995876		2203	4293	6496	SO:0001819	synonymous_variant	0			AB116021	CCDS3300.1	3q28	2013-02-28	2013-02-28	2013-02-28	ENSG00000188958	ENSG00000188958		"""Endogenous ligands"""	30894	protein-coding gene	gene with protein product	"""prepro-URP"""		"""urotensin 2 domain containing"""	UTS2D		14550283	Standard	NM_198152		Approved	URP, U2B	uc003fsu.3	Q765I0	OTTHUMG00000156192	ENST00000340524.5:c.187A>C	3.37:g.190995876T>G			B3KQY8|D3DNW1|Q2M1Z2	Silent	SNP	NULL	p.R63	ENST00000340524.5	37	c.187	CCDS3300.1	3																																																																																			UTS2B	-	NULL	ENSG00000188958		0.264	UTS2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTS2B	HGNC	protein_coding	OTTHUMT00000343353.1	-	0.00	82	0	T	NM_198152		190995876	-1	tier1	-	no_errors	ENST00000446788	ensembl	human	known	74_37	silent	20.93	68	18	SNP	0.015	G
VN1R2	317701	genome.wustl.edu	37	19	53761767	53761767	+	Missense_Mutation	SNP	G	G	A	rs111541974		TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:53761767G>A	ENST00000341702.3	+	1	223	c.139G>A	c.(139-141)Ggt>Agt	p.G47S		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	47					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		ggccactaccggtctccgcgt	0.493																																																	0																																										SO:0001583	missense	0			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.139G>A	19.37:g.53761767G>A	ENSP00000351244:p.Gly47Ser		A1L411|Q8TDU4	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.G47S	ENST00000341702.3	37	c.139	CCDS12862.1	19	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.275758	0.01410	.	.	ENSG00000196131	ENST00000341702	T	0.13089	2.62	0.0465	-0.093	0.13652	.	.	.	.	.	T	0.03783	0.0107	N	0.08118	0	0.09310	N	1	P	0.41393	0.748	B	0.19391	0.025	T	0.34750	-0.9816	8	0.87932	D	0	.	.	.	.	.	47	Q8NFZ6	VN1R2_HUMAN	S	47	ENSP00000351244:G47S	ENSP00000351244:G47S	G	+	1	0	VN1R2	58453579	0.012000	0.17670	0.020000	0.16555	0.021000	0.10359	-2.813000	0.00753	-1.443000	0.01953	-1.435000	0.01079	GGT	VN1R2	-	NULL	ENSG00000196131		0.493	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	HGNC	protein_coding	OTTHUMT00000464285.1	-	0.00	23	0	G	NM_173856		53761767	+1	tier1	rs111541974	no_errors	ENST00000341702	ensembl	human	known	74_37	missense	33.33	36	18	SNP	0.025	A
VPS33A	65082	genome.wustl.edu	37	12	122750679	122750680	+	Intron	INS	-	-	C	rs573638817|rs146100866	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr12:122750679_122750680insC	ENST00000267199.4	-	1	215				VPS33A_ENST00000542310.1_5'UTR|VPS33A_ENST00000451053.2_Intron|RP11-512M8.5_ENST00000535844.1_Intron	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)						lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		TACGCCCAGGGCCCCCCCCTTC	0.619													cCCCCCCC|CCCCCCCC|CCCCCCCCC|insertion	414	0.0826677	0.1929	0.0432	5008	,	,		18334	0.0079		0.0636	False		,,,				2504	0.0583																0																																										SO:0001627	intron_variant	0			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.102+173->G	12.37:g.122750687_122750687dupC			Q547V4|Q9H5Q0	RNA	INS	-	NULL	ENST00000267199.4	37	NULL	CCDS9231.1	12																																																																																			VPS33A	-	-	ENSG00000139719		0.619	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2		0.00	8	0	-			122750680	-1	tier1		no_errors	ENST00000542310	ensembl	human	known	74_37	rna	26.67	11	4	INS	0.000:0.000	C
VWA3B	200403	genome.wustl.edu	37	2	98851174	98851174	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr2:98851174A>T	ENST00000477737.1	+	17	2576	c.2372A>T	c.(2371-2373)gAa>gTa	p.E791V		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	791										NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						GCTTGCAGTGAAAGGAAGGAT	0.527																																																	0													75.0	78.0	77.0					2																	98851174		2012	4188	6200	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2372A>T	2.37:g.98851174A>T	ENSP00000417955:p.Glu791Val		B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.E791V	ENST00000477737.1	37	c.2372	CCDS42718.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.80|13.80	2.344848|2.344848	0.41498|0.41498	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000477737|ENST00000473149	T|.	0.06608|.	3.28|.	4.47|4.47	-6.89|-6.89	0.01660|0.01660	.|.	0.511994|.	0.17756|.	N|.	0.163058|.	T|.	0.28366|.	0.0701|.	L|L	0.43152|0.43152	1.355|1.355	0.09310|0.09310	N|N	1|1	P;B;B;B|.	0.38020|.	0.615;0.091;0.358;0.007|.	B;B;B;B|.	0.40256|.	0.324;0.024;0.153;0.012|.	T|.	0.34825|.	-0.9813|.	10|.	0.46703|.	T|.	0.11|.	.|.	2.2965|2.2965	0.04152|0.04152	0.2152:0.275:0.3746:0.1352|0.2152:0.275:0.3746:0.1352	.|.	183;791;791;791|.	Q502W6-5;Q502W6;Q502W6-8;Q502W6-6|.	.;VWA3B_HUMAN;.;.|.	V|C	791|201	ENSP00000417955:E791V|.	ENSP00000417955:E791V|.	E|X	+|+	2|3	0|0	VWA3B|VWA3B	98217606|98217606	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.277000|0.277000	0.26821|0.26821	-0.061000|-0.061000	0.11693|0.11693	-1.005000|-1.005000	0.03417|0.03417	0.397000|0.397000	0.26171|0.26171	GAA|TGA	VWA3B	-	NULL	ENSG00000168658		0.527	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2	-	0.00	54	0	A	NM_144992		98851174	+1	tier1	-	no_errors	ENST00000477737	ensembl	human	known	74_37	missense	21.62	58	16	SNP	0.000	T
WDFY4	57705	genome.wustl.edu	37	10	49951287	49951287	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr10:49951287T>C	ENST00000325239.5	+	11	2180	c.2153T>C	c.(2152-2154)cTg>cCg	p.L718P	WDFY4_ENST00000413659.2_Missense_Mutation_p.L718P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	718						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTCTGCCTGCTGGGCTGTTTT	0.592																																																	0													32.0	31.0	31.0					10																	49951287		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2153T>C	10.37:g.49951287T>C	ENSP00000320563:p.Leu718Pro		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L718P	ENST00000325239.5	37	c.2153	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	T	21.5	4.155243	0.78114	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.67171	-0.25;0.48	5.04	5.04	0.67666	Armadillo-type fold (1);	.	.	.	.	T	0.81143	0.4761	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82532	-0.0410	8	.	.	.	.	13.9428	0.64066	0.0:0.0:0.0:1.0	.	718	Q6ZS81	WDFY4_HUMAN	P	727;718;718;718	ENSP00000320563:L718P;ENSP00000403789:L718P	.	L	+	2	0	WDFY4	49621293	1.000000	0.71417	0.983000	0.44433	0.972000	0.66771	7.268000	0.78473	1.904000	0.55121	0.460000	0.39030	CTG	WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.592	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	23	0	T	XM_033379		49951287	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	21.05	30	8	SNP	1.000	C
WDR72	256764	genome.wustl.edu	37	15	53907630	53907630	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr15:53907630C>T	ENST00000396328.1	-	15	3012	c.2773G>A	c.(2773-2775)Gtt>Att	p.V925I	WDR72_ENST00000360509.5_Missense_Mutation_p.V925I|WDR72_ENST00000559418.1_Missense_Mutation_p.V935I|WDR72_ENST00000557913.1_Missense_Mutation_p.V922I	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	925										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TACCTGCCAACTCTACATGCC	0.294																																																	0													22.0	24.0	24.0					15																	53907630		2172	4279	6451	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2773G>A	15.37:g.53907630C>T	ENSP00000379619:p.Val925Ile		Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V925I	ENST00000396328.1	37	c.2773	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.370159	0.00209	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.32753	1.44;1.44	5.63	-1.58	0.08479	.	1.349760	0.04531	N	0.386348	T	0.10252	0.0251	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15723	-1.0427	10	0.36615	T	0.2	.	1.6537	0.02777	0.1236:0.2322:0.1277:0.5165	.	925	Q3MJ13	WDR72_HUMAN	I	925	ENSP00000379619:V925I;ENSP00000353699:V925I	ENSP00000353699:V925I	V	-	1	0	WDR72	51694922	0.000000	0.05858	0.002000	0.10522	0.091000	0.18340	0.124000	0.15728	-0.195000	0.10382	-0.345000	0.07892	GTT	WDR72	-	NULL	ENSG00000166415		0.294	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	-	0.00	29	0	C	NM_182758		53907630	-1	tier1	-	no_errors	ENST00000360509	ensembl	human	known	74_37	missense	47.50	21	19	SNP	0.000	T
ZIM3	114026	genome.wustl.edu	37	19	57648269	57648269	+	Silent	SNP	T	T	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:57648269T>C	ENST00000269834.1	-	4	598	c.213A>G	c.(211-213)gaA>gaG	p.E71E	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GCACTTCCTCTTCCTCCAACC	0.522																																																	0													287.0	193.0	225.0					19																	57648269		2203	4300	6503	SO:0001819	synonymous_variant	0			AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.213A>G	19.37:g.57648269T>C			Q14CA6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E71	ENST00000269834.1	37	c.213	CCDS33125.1	19																																																																																			ZIM3	-	pfscan_Krueppel-associated_box	ENSG00000141946		0.522	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM3	HGNC	protein_coding	OTTHUMT00000465078.1	-	0.00	79	0	T			57648269	-1	tier1	-	no_errors	ENST00000269834	ensembl	human	known	74_37	silent	15.04	113	20	SNP	0.000	C
ZMYM6	9204	genome.wustl.edu	37	1	35485185	35485185	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr1:35485185C>T	ENST00000357182.4	-	4	424	c.197G>A	c.(196-198)gGc>gAc	p.G66D	ZMYM6_ENST00000317538.5_Missense_Mutation_p.G66D|ZMYM6_ENST00000487874.1_Missense_Mutation_p.G66D|ZMYM6_ENST00000493328.1_Intron|ZMYM6_ENST00000373333.1_Missense_Mutation_p.G66D|ZMYM6_ENST00000373340.2_Missense_Mutation_p.G66D	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	66					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				AAGCTGAAAGCCTGGGTTCAA	0.368																																																	0													47.0	46.0	46.0					1																	35485185		2203	4300	6503	SO:0001583	missense	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.197G>A	1.37:g.35485185C>T	ENSP00000349708:p.Gly66Asp		B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Missense_Mutation	SNP	pfam_Znf_MYM,superfamily_RNaseH-like_dom,smart_TRASH_dom	p.G66D	ENST00000357182.4	37	c.197	CCDS387.2	1	.	.	.	.	.	.	.	.	.	.	C	11.43	1.637528	0.29157	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531;ENST00000317538;ENST00000373333	T;T;T;T;T	0.45668	1.94;3.1;1.51;0.89;0.89	5.15	0.534	0.17127	.	1.155990	0.06213	N	0.685426	T	0.49270	0.1547	L	0.59436	1.845	0.33997	D	0.649826	P;B;B	0.52842	0.956;0.194;0.294	P;B;P	0.51016	0.656;0.197;0.462	T	0.54768	-0.8244	10	0.34782	T	0.22	2.4092	10.1193	0.42609	0.0:0.4654:0.4564:0.0781	.	66;66;66	O95789-4;O95789;O95789-1	.;ZMYM6_HUMAN;.	D	66	ENSP00000362437:G66D;ENSP00000349708:G66D;ENSP00000391337:G66D;ENSP00000326695:G66D;ENSP00000362430:G66D	ENSP00000326695:G66D	G	-	2	0	ZMYM6	35257772	1.000000	0.71417	0.992000	0.48379	0.400000	0.30750	0.864000	0.27926	0.003000	0.14656	-0.291000	0.09656	GGC	ZMYM6	-	NULL	ENSG00000163867		0.368	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	27	0	C	NM_007167		35485185	-1	tier1	-	no_errors	ENST00000357182	ensembl	human	known	74_37	missense	15.79	32	6	SNP	1.000	T
ZNF275	10838	genome.wustl.edu	37	X	152613161	152613161	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chrX:152613161G>A	ENST00000421401.3	+	4	1195	c.1018G>A	c.(1018-1020)Gca>Aca	p.A340T	ZNF275_ENST00000440091.1_Missense_Mutation_p.A370T|ZNF275_ENST00000370249.2_Missense_Mutation_p.A287T|ZNF275_ENST00000370251.3_Intron			Q9NSD4	ZN275_HUMAN	zinc finger protein 275	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCTGGAGCACGCACGCATCCA	0.692																																																	0													18.0	19.0	18.0					X																	152613161		2200	4294	6494	SO:0001583	missense	0			BC041602		Xq28	2013-01-08			ENSG00000063587	ENSG00000063587		"""Zinc fingers, C2H2-type"", ""-"""	13069	protein-coding gene	gene with protein product							Standard	NM_001080485		Approved		uc004fhg.2	Q9NSD4	OTTHUMG00000067450	ENST00000421401.3:c.1018G>A	X.37:g.152613161G>A	ENSP00000398977:p.Ala340Thr		A6NE92	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A370T	ENST00000421401.3	37	c.1108		X	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365005	0.61513	.	.	ENSG00000063587	ENST00000421401;ENST00000440091;ENST00000370249	T;T;T	0.36157	1.27;1.27;1.27	3.96	1.63	0.23807	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.665589	0.12427	N	0.469864	T	0.19685	0.0473	.	.	.	0.21473	N	0.999673	B	0.06786	0.001	B	0.06405	0.002	T	0.25572	-1.0128	8	.	.	.	-13.6609	5.5519	0.17095	0.2405:0.5106:0.2489:0.0	.	340	Q9NSD4	ZN275_HUMAN	T	340;370;287	ENSP00000398977:A340T;ENSP00000411097:A370T;ENSP00000359269:A287T	.	A	+	1	0	ZNF275	152266355	0.011000	0.17503	0.968000	0.41197	0.915000	0.54546	0.173000	0.16724	0.130000	0.18549	0.436000	0.28706	GCA	ZNF275	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000063587		0.692	ZNF275-201	KNOWN	basic	protein_coding	ZNF275	HGNC	protein_coding		-	0.00	29	0	G	NM_001080485		152613161	+1	tier1	-	no_errors	ENST00000440091	ensembl	human	known	74_37	missense	95.12	2	39	SNP	0.933	A
ZNF276	92822	genome.wustl.edu	37	16	89804219	89804219	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr16:89804219C>T	ENST00000443381.2	+	10	1577	c.1480C>T	c.(1480-1482)Cgg>Tgg	p.R494W	ZNF276_ENST00000446326.2_Missense_Mutation_p.R280W|FANCA_ENST00000389301.3_3'UTR|ZNF276_ENST00000289816.5_Missense_Mutation_p.R419W|ZNF276_ENST00000568064.1_Missense_Mutation_p.R402W	NM_001113525.1	NP_001106997.1	Q8N554	ZN276_HUMAN	zinc finger protein 276	494					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)	14		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CTCAGAGGTGCGGAACTATAT	0.552																																																	0													108.0	99.0	102.0					16																	89804219		2198	4300	6498	SO:0001583	missense	0			AK026482	CCDS10986.1, CCDS45554.1	16q24.3	2014-02-17	2006-02-10	2006-02-10	ENSG00000158805	ENSG00000158805		"""Zinc fingers, C2H2-type"""	23330	protein-coding gene	gene with protein product	"""centromere protein Z"", ""zinc finger, AD-type"""	608460	"""zinc finger protein 276 homolog (mouse)"""	ZFP276		10936049, 20813266	Standard	NM_152287		Approved	MGC45417, ZNF477, CENPZ, CENP-Z, ZADT	uc002fos.4	Q8N554	OTTHUMG00000138050	ENST00000443381.2:c.1480C>T	16.37:g.89804219C>T	ENSP00000415836:p.Arg494Trp		Q0VGA1|Q2TBE8|Q3B7H7	Missense_Mutation	SNP	pfam_Znf_AD,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R494W	ENST00000443381.2	37	c.1480	CCDS45554.1	16	.	.	.	.	.	.	.	.	.	.	C	14.85	2.659441	0.47467	.	.	ENSG00000158805	ENST00000446326;ENST00000289816;ENST00000443381	T;T;T	0.78816	-1.21;2.3;2.3	5.62	4.66	0.58398	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.76169	0.3950	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.995;0.999;0.995;0.996	T	0.81132	-0.1072	10	0.87932	D	0	-37.0204	12.8268	0.57725	0.297:0.703:0.0:0.0	.	332;494;280;419	B4DIT3;Q8N554;A8K186;Q8N554-2	.;ZN276_HUMAN;.;.	W	280;419;494	ENSP00000415999:R280W;ENSP00000289816:R419W;ENSP00000415836:R494W	ENSP00000289816:R419W	R	+	1	2	ZNF276	88331720	1.000000	0.71417	0.977000	0.42913	0.093000	0.18481	3.549000	0.53681	1.357000	0.45904	-0.324000	0.08512	CGG	ZNF276	-	pfscan_Znf_C2H2	ENSG00000158805		0.552	ZNF276-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF276	HGNC	protein_coding	OTTHUMT00000422517.1	-	0.00	62	0	C	NM_152287		89804219	+1	tier1	-	no_errors	ENST00000443381	ensembl	human	known	74_37	missense	23.08	69	21	SNP	1.000	T
ZNF28	7576	genome.wustl.edu	37	19	53303155	53303155	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:53303155G>A	ENST00000457749.2	-	4	2062	c.1943C>T	c.(1942-1944)tCa>tTa	p.S648L	ZNF28_ENST00000414252.2_Missense_Mutation_p.S595L|ZNF28_ENST00000360272.4_Missense_Mutation_p.S595L|ZNF28_ENST00000438150.2_Missense_Mutation_p.S595L	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	648					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TACGAGGGATGACATCTGACT	0.428																																																	0													200.0	189.0	193.0					19																	53303155		2203	4300	6503	SO:0001583	missense	0			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1943C>T	19.37:g.53303155G>A	ENSP00000397693:p.Ser648Leu		A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S648L	ENST00000457749.2	37	c.1943	CCDS33093.2	19	.	.	.	.	.	.	.	.	.	.	-	13.93	2.382897	0.42207	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252	T;T;T;T	0.01705	4.68;4.68;4.68;4.68	1.81	1.81	0.25067	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06872	0.0175	M	0.70842	2.15	0.09310	N	1	D	0.54601	0.967	D	0.63597	0.916	T	0.17319	-1.0373	9	0.62326	D	0.03	.	7.3061	0.26449	0.0:0.0:0.7383:0.2617	.	648	P17035	ZNF28_HUMAN	L	595;648;595;595	ENSP00000412143:S595L;ENSP00000397693:S648L;ENSP00000353410:S595L;ENSP00000444965:S595L	ENSP00000353410:S595L	S	-	2	0	ZNF28	57994967	0.000000	0.05858	0.003000	0.11579	0.007000	0.05969	-0.487000	0.06505	0.995000	0.38917	0.298000	0.19748	TCA	ZNF28	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198538		0.428	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF28	HGNC	protein_coding	OTTHUMT00000336038.2	-	0.00	87	0	G	NM_006969		53303155	-1	tier1	-	no_errors	ENST00000457749	ensembl	human	known	74_37	missense	15.33	127	23	SNP	0.005	A
ZNF292	23036	genome.wustl.edu	37	6	87966408	87966408	+	Missense_Mutation	SNP	T	T	A	rs146673055	byFrequency	TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr6:87966408T>A	ENST00000369577.3	+	8	3104	c.3061T>A	c.(3061-3063)Tta>Ata	p.L1021I	ZNF292_ENST00000339907.4_Missense_Mutation_p.L1016I	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	1021						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CCCACAAAACTTAGAAAGACA	0.348																																																	0													59.0	57.0	58.0					6																	87966408		1844	4082	5926	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.3061T>A	6.37:g.87966408T>A	ENSP00000358590:p.Leu1021Ile		Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1021I	ENST00000369577.3	37	c.3061	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	T	15.96	2.986829	0.53934	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.09723	2.95;2.96	5.55	5.55	0.83447	.	0.218305	0.38663	N	0.001604	T	0.06917	0.0176	L	0.50333	1.59	0.32487	N	0.540704	P	0.47350	0.894	B	0.43950	0.437	T	0.06752	-1.0809	10	0.72032	D	0.01	.	10.8312	0.46661	0.0:0.0737:0.0:0.9263	.	1021	O60281	ZN292_HUMAN	I	1021;1016	ENSP00000358590:L1021I;ENSP00000342847:L1016I	ENSP00000342847:L1016I	L	+	1	2	ZNF292	88023127	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.573000	0.36472	2.111000	0.64477	0.482000	0.46254	TTA	ZNF292	-	NULL	ENSG00000188994		0.348	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	-	0.00	35	0	T	NM_015021		87966408	+1	tier1	-	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	42.86	16	12	SNP	1.000	A
ZNF440	126070	genome.wustl.edu	37	19	11941178	11941178	+	Silent	SNP	C	C	T			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:11941178C>T	ENST00000304060.5	+	2	248	c.84C>T	c.(82-84)ctC>ctT	p.L28L		NM_152357.2	NP_689570.2	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	28	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(9)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						AGAGGAAACTCTACAGGGAAG	0.468																																																	0													132.0	139.0	137.0					19																	11941178		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095252	CCDS42503.1	19p13.13	2013-01-08	2006-08-14	2006-08-14	ENSG00000171295	ENSG00000171295		"""Zinc fingers, C2H2-type"", ""-"""	20874	protein-coding gene	gene with protein product							Standard	NM_152357		Approved	FLJ37933	uc002msp.1	Q8IYI8	OTTHUMG00000156403	ENST00000304060.5:c.84C>T	19.37:g.11941178C>T			Q8N1R9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L28	ENST00000304060.5	37	c.84	CCDS42503.1	19																																																																																			ZNF440	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171295		0.468	ZNF440-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF440	HGNC	protein_coding	OTTHUMT00000344508.1	-	0.00	134	0	C	NM_152357		11941178	+1	tier1	-	no_errors	ENST00000304060	ensembl	human	known	74_37	silent	28.78	99	40	SNP	0.779	T
ZNF566	84924	genome.wustl.edu	37	19	36939893	36939893	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:36939893T>G	ENST00000434377.2	-	5	1324	c.1243A>C	c.(1243-1245)Aat>Cat	p.N415H	ZNF566_ENST00000493391.1_Missense_Mutation_p.N311H|ZNF566_ENST00000454319.1_Missense_Mutation_p.N416H|ZNF566_ENST00000392170.2_Missense_Mutation_p.N416H|ZNF566_ENST00000424129.2_Missense_Mutation_p.N415H	NM_032838.4	NP_116227.1	Q969W8	ZN566_HUMAN	zinc finger protein 566	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24	Esophageal squamous(110;0.162)					CAGTACAAATTTTGATGCTGA	0.313																																																	0													52.0	52.0	52.0					19																	36939893		2203	4300	6503	SO:0001583	missense	0			AK074497	CCDS12494.1, CCDS46061.1, CCDS74346.1	19q13.12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25919	protein-coding gene	gene with protein product						12477932	Standard	NM_001145343		Approved	FLJ14779, MGC12515	uc010xtf.2	Q969W8		ENST00000434377.2:c.1243A>C	19.37:g.36939893T>G	ENSP00000415520:p.Asn415His		B7ZL95|Q2M3J1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N416H	ENST00000434377.2	37	c.1246	CCDS12494.1	19	.	.	.	.	.	.	.	.	.	.	T	14.49	2.550335	0.45383	.	.	ENSG00000186017	ENST00000454319;ENST00000434377;ENST00000392170;ENST00000424129	T;T;T;T	0.04917	3.53;3.53;3.53;3.53	3.37	3.37	0.38596	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45867	D	0.000333	T	0.07143	0.0181	L	0.27053	0.805	0.31047	N	0.71571	P;P	0.38167	0.621;0.621	B;B	0.42882	0.401;0.308	T	0.03651	-1.1016	10	0.87932	D	0	.	11.7702	0.51953	0.0:0.0:0.0:1.0	.	416;415	B7ZL95;Q969W8	.;ZN566_HUMAN	H	416;415;416;415	ENSP00000394207:N416H;ENSP00000415520:N415H;ENSP00000376010:N416H;ENSP00000401259:N415H	ENSP00000376010:N416H	N	-	1	0	ZNF566	41631733	.	.	0.999000	0.59377	0.938000	0.57974	.	.	1.802000	0.52723	0.449000	0.29647	AAT	ZNF566	-	NULL	ENSG00000186017		0.313	ZNF566-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF566	HGNC	protein_coding	OTTHUMT00000341054.1	-	0.00	45	0	T	NM_032838		36939893	-1	tier1	-	no_errors	ENST00000392170	ensembl	human	known	74_37	missense	24.59	46	15	SNP	1.000	G
ZNF623	9831	genome.wustl.edu	37	8	144732067	144732067	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr8:144732067G>C	ENST00000501748.2	+	1	114	c.25G>C	c.(25-27)Gat>Cat	p.D9H	ZNF623_ENST00000526926.1_Splice_Site|ZNF623_ENST00000458270.2_Splice_Site	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TTTTGTTTCAGATTCTAATGT	0.433																																																	0													109.0	93.0	98.0					8																	144732067		2203	4300	6503	SO:0001583	missense	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.25G>C	8.37:g.144732067G>C	ENSP00000445979:p.Asp9His		A4FU80|B4DGP3|E7ENV5	Splice_Site	SNP	-	e1-1	ENST00000501748.2	37	c.1-1	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855826	0.51376	.	.	ENSG00000183309	ENST00000532796;ENST00000501748	T	0.08193	3.12	3.5	3.5	0.40072	.	.	.	.	.	T	0.05868	0.0153	N	0.08118	0	0.30765	N	0.743709	D	0.59767	0.986	P	0.51453	0.67	T	0.00950	-1.1503	9	0.02654	T	1	.	10.8182	0.46589	0.0:0.0:1.0:0.0	.	9	O75123	ZN623_HUMAN	H	9	ENSP00000445979:D9H	ENSP00000445979:D9H	D	+	1	0	ZNF623	144803210	0.997000	0.39634	0.962000	0.40283	0.911000	0.54048	1.794000	0.38774	2.272000	0.75746	0.655000	0.94253	GAT	ZNF623	-	-	ENSG00000183309		0.433	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	-	0.00	30	0	G	NM_014789		144732067	+1	tier1	-	no_errors	ENST00000458270	ensembl	human	known	74_37	splice_site	19.35	50	12	SNP	0.995	C
ZNF681	148213	genome.wustl.edu	37	19	23927603	23927603	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr19:23927603C>G	ENST00000402377.3	-	4	890	c.749G>C	c.(748-750)aGa>aCa	p.R250T	ZNF681_ENST00000395385.3_Missense_Mutation_p.R181T	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	250					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GAGTTTGTCTCTAGTATAAAT	0.348																																																	0													98.0	97.0	97.0					19																	23927603		2203	4300	6503	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.749G>C	19.37:g.23927603C>G	ENSP00000384000:p.Arg250Thr		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R250T	ENST00000402377.3	37	c.749	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	9.862	1.196441	0.22037	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	T;T	0.07688	3.31;3.17	1.6	0.427	0.16489	Zinc finger, C2H2 (1);	.	.	.	.	T	0.06600	0.0169	L	0.34521	1.04	0.20873	N	0.99984	B	0.23377	0.084	B	0.20384	0.029	T	0.35076	-0.9803	9	0.72032	D	0.01	.	5.8991	0.18955	0.0:0.8048:0.0:0.1952	.	250	Q96N22	ZN681_HUMAN	T	250;181	ENSP00000384000:R250T;ENSP00000378783:R181T	ENSP00000378783:R181T	R	-	2	0	ZNF681	23719443	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.110000	0.15437	0.007000	0.14760	-0.384000	0.06662	AGA	ZNF681	-	pfscan_Znf_C2H2	ENSG00000196172		0.348	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	81	0	C	NM_138286		23927603	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	54.12	39	46	SNP	0.820	G
ZNF736	728927	genome.wustl.edu	37	7	63808677	63808677	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A43I-01A-11D-A247-09	TCGA-L5-A43I-11A-11D-A247-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	635a8384-40d5-4c35-9158-dae828f2e500	93b3f33a-3f0b-4e16-9f0f-16370129bfe6	g.chr7:63808677C>A	ENST00000423484.2	+	4	558	c.436C>A	c.(436-438)Caa>Aaa	p.Q146K	ZNF736_ENST00000355095.4_Missense_Mutation_p.Q146K			B4DX44	ZN736_HUMAN	zinc finger protein 736	146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						CAAAACCTGTCAATGTAATAA	0.383																																																	0													153.0	126.0	134.0					7																	63808677		692	1591	2283	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.436C>A	7.37:g.63808677C>A	ENSP00000400852:p.Gln146Lys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q146K	ENST00000423484.2	37	c.436	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.492737	0.01009	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.04360	3.64;3.64	0.593	-1.08	0.09936	.	.	.	.	.	T	0.01592	0.0051	N	0.01410	-0.885	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.47787	-0.9090	9	0.25106	T	0.35	.	5.7515	0.18150	0.0:0.3626:0.6374:0.0	.	146	B4DX44	ZN736_HUMAN	K	146	ENSP00000347210:Q146K;ENSP00000400852:Q146K	ENSP00000347210:Q146K	Q	+	1	0	ZNF736	63446112	0.002000	0.14202	0.002000	0.10522	0.012000	0.07955	0.424000	0.21330	-0.435000	0.07264	0.305000	0.20034	CAA	ZNF736	-	NULL	ENSG00000234444		0.383	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	-	0.00	33	0	C	NM_001170905		63808677	+1	tier1	-	no_errors	ENST00000355095	ensembl	human	known	74_37	missense	50.00	40	40	SNP	0.000	A
