#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACRC	93953	genome.wustl.edu	37	X	70824010	70824010	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chrX:70824010T>C	ENST00000373695.1	+	7	1420	c.883T>C	c.(883-885)Tcc>Ccc	p.S295P	ACRC_ENST00000373696.3_Missense_Mutation_p.S295P			Q96QF7	ACRC_HUMAN	acidic repeat containing	295	Asp/Ser-rich.					nucleus (GO:0005634)				autonomic_ganglia(1)|breast(1)|endometrium(15)|kidney(4)|large_intestine(4)|lung(20)|ovary(5)|prostate(1)|skin(2)|stomach(1)	54	Renal(35;0.156)					TTCGGAAGCTTCCGACGACAG	0.527																																																	0													132.0	124.0	127.0					X																	70824010		2203	4300	6503	SO:0001583	missense	0			AJ311392	CCDS35326.1	Xq13.1	2010-08-05			ENSG00000147174	ENSG00000147174			15805	protein-coding gene	gene with protein product		300369					Standard	NM_052957		Approved		uc004eae.2	Q96QF7	OTTHUMG00000033327	ENST00000373695.1:c.883T>C	X.37:g.70824010T>C	ENSP00000362799:p.Ser295Pro		B9EG62	Missense_Mutation	SNP	pfam_SprT-like_domain,smart_SprT-like_domain	p.S295P	ENST00000373695.1	37	c.883	CCDS35326.1	X	.	.	.	.	.	.	.	.	.	.	T	2.597	-0.293877	0.05568	.	.	ENSG00000147174	ENST00000373696;ENST00000373695	T;T	0.29397	1.57;1.57	0.14	-0.28	0.12886	.	.	.	.	.	T	0.09642	0.0237	N	0.01874	-0.695	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.30268	-0.9984	9	0.20519	T	0.43	.	4.4172	0.11463	0.0:0.6635:0.0:0.3365	.	295	Q96QF7	ACRC_HUMAN	P	295	ENSP00000362800:S295P;ENSP00000362799:S295P	ENSP00000362799:S295P	S	+	1	0	ACRC	70740735	0.000000	0.05858	0.009000	0.14445	0.009000	0.06853	-1.504000	0.02275	-1.219000	0.02597	-1.215000	0.01618	TCC	ACRC	-	NULL	ENSG00000147174		0.527	ACRC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACRC	HGNC	protein_coding	OTTHUMT00000081856.1		0.00	64	0	T			70824010	+1			no_errors	ENST00000373695	ensembl	human	known	74_37	missense	5.00	95	5	SNP	0.009	C
ADH6	130	genome.wustl.edu	37	4	100128630	100128630	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:100128630G>A	ENST00000237653.7	-	7	1321	c.937C>T	c.(937-939)Cgt>Tgt	p.R313C	RP11-696N14.1_ENST00000506454.1_RNA|ADH6_ENST00000504257.1_5'Flank|ADH6_ENST00000407820.2_Missense_Mutation_p.R104C|RP11-696N14.1_ENST00000506160.1_RNA|ADH6_ENST00000394897.1_Intron|ADH6_ENST00000394899.2_Missense_Mutation_p.R313C|RP11-696N14.1_ENST00000500358.2_RNA	NM_000672.3	NP_000663	P28332	ADH6_HUMAN	alcohol dehydrogenase 6 (class V)	313					ethanol oxidation (GO:0006069)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|ethanol binding (GO:0035276)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)	20				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)	TTCAAAGAACGTCCTGAGAAG	0.483																																																	0													138.0	133.0	135.0					4																	100128630		2203	4300	6503	SO:0001583	missense	0			AK092768	CCDS3647.1, CCDS43255.1	4q23	2008-02-05			ENSG00000172955	ENSG00000172955	1.1.1.1	"""Alcohol dehydrogenases"""	255	protein-coding gene	gene with protein product		103735				1881901	Standard	NM_000672		Approved	ADH-5	uc003huo.2	P28332	OTTHUMG00000131024	ENST00000237653.7:c.937C>T	4.37:g.100128630G>A	ENSP00000237653:p.Arg313Cys		B3KS45|Q58F53	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.R313C	ENST00000237653.7	37	c.937	CCDS3647.1	4	.	.	.	.	.	.	.	.	.	.	G	14.35	2.509527	0.44660	.	.	ENSG00000172955	ENST00000394899;ENST00000407820;ENST00000237653;ENST00000508558	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	3.37	2.52	0.30459	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.132384	0.48286	D	0.000186	T	0.49881	0.1583	H	0.94808	3.585	0.80722	D	1	D;D;D	0.89917	1.0;0.989;1.0	D;P;D	0.97110	1.0;0.633;0.997	T	0.60816	-0.7188	10	0.87932	D	0	-8.4352	11.1009	0.48174	0.0959:0.0:0.9041:0.0	.	190;313;313	B4DPD8;P28332;P28332-2	.;ADH6_HUMAN;.	C	313;104;313;249	ENSP00000378359:R313C;ENSP00000384997:R104C;ENSP00000237653:R313C;ENSP00000426187:R249C	ENSP00000237653:R313C	R	-	1	0	ADH6	100347653	1.000000	0.71417	0.501000	0.27601	0.169000	0.22640	5.850000	0.69473	0.701000	0.31803	-0.253000	0.11424	CGT	ADH6	-	pfam_ADH_C,smart_PKS_ER	ENSG00000172955		0.483	ADH6-003	KNOWN	basic|CCDS	protein_coding	ADH6	HGNC	protein_coding	OTTHUMT00000253665.1	-	0.00	57	0	G	NM_000672		100128630	-1	tier1	-	no_errors	ENST00000394899	ensembl	human	known	74_37	missense	22.06	53	15	SNP	1.000	A
ALDH6A1	4329	genome.wustl.edu	37	14	74551066	74551066	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr14:74551066C>T	ENST00000553458.1	-	1	130	c.32G>A	c.(31-33)cGa>cAa	p.R11Q	LIN52_ENST00000555028.1_5'Flank|ALDH6A1_ENST00000556852.1_5'UTR|AC005484.5_ENST00000492026.1_RNA|ALDH6A1_ENST00000350259.4_Missense_Mutation_p.R11Q	NM_001278593.1|NM_005589.2	NP_001265522.1|NP_005580.1	Q02252	MMSA_HUMAN	aldehyde dehydrogenase 6 family, member A1	11					branched-chain amino acid catabolic process (GO:0009083)|brown fat cell differentiation (GO:0050873)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|thymine metabolic process (GO:0019859)|valine catabolic process (GO:0006574)|valine metabolic process (GO:0006573)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fatty-acyl-CoA binding (GO:0000062)|malonate-semialdehyde dehydrogenase (acetylating) activity (GO:0018478)|methylmalonate-semialdehyde dehydrogenase (acylating) activity (GO:0004491)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|prostate(3)|skin(3)	21				BRCA - Breast invasive adenocarcinoma(234;0.00354)		GATCCGGGCTCGCACTGCCGC	0.682																																																	0													20.0	20.0	20.0					14																	74551066		2197	4297	6494	SO:0001583	missense	0			M93405	CCDS9826.1, CCDS61501.1	14q24.3	2014-02-03			ENSG00000119711	ENSG00000119711	1.2.1.27	"""Aldehyde dehydrogenases"""	7179	protein-coding gene	gene with protein product		603178		MMSDH		1527093	Standard	NM_005589		Approved		uc001xpo.3	Q02252	OTTHUMG00000171203	ENST00000553458.1:c.32G>A	14.37:g.74551066C>T	ENSP00000450436:p.Arg11Gln		B2R609|B4DFS8|J3KNU8|Q9UKM8	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_MeMal-semiAld_DH	p.R11Q	ENST00000553458.1	37	c.32	CCDS9826.1	14	.	.	.	.	.	.	.	.	.	.	C	16.12	3.032128	0.54790	.	.	ENSG00000119711	ENST00000553458;ENST00000350259	T;T	0.75938	-0.98;-0.95	5.38	4.5	0.54988	.	0.740751	0.13043	N	0.418354	T	0.53610	0.1807	N	0.08118	0	0.80722	D	1	B;B	0.21147	0.052;0.052	B;B	0.08055	0.003;0.003	T	0.47711	-0.9096	10	0.30854	T	0.27	.	10.06	0.42268	0.0:0.9096:0.0:0.0904	.	11;11	B4DFS8;Q02252	.;MMSA_HUMAN	Q	11	ENSP00000450436:R11Q;ENSP00000342564:R11Q	ENSP00000342564:R11Q	R	-	2	0	ALDH6A1	73620819	0.980000	0.34600	0.834000	0.33040	0.141000	0.21300	2.099000	0.41767	1.518000	0.48934	-0.150000	0.13652	CGA	ALDH6A1	-	NULL	ENSG00000119711		0.682	ALDH6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH6A1	HGNC	protein_coding	OTTHUMT00000412309.1	-	0.00	96	0	C			74551066	-1	tier1	-	no_errors	ENST00000553458	ensembl	human	known	74_37	missense	12.50	56	8	SNP	0.771	T
AMER2	219287	genome.wustl.edu	37	13	25744194	25744194	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr13:25744194C>T	ENST00000515384.1	-	1	2231	c.1564G>A	c.(1564-1566)Gag>Aag	p.E522K	AMER2_ENST00000381853.3_Missense_Mutation_p.E403K|AMER2_ENST00000357816.2_Missense_Mutation_p.E403K|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	522					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.E522*(1)|p.E403*(1)									CAGTAGCCCTCGTCGCTGTTG	0.662																																																	2	Substitution - Nonsense(2)	lung(2)											68.0	64.0	65.0					13																	25744194		2203	4300	6503	SO:0001583	missense	0			AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1564G>A	13.37:g.25744194C>T	ENSP00000426528:p.Glu522Lys		Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.E522K	ENST00000515384.1	37	c.1564	CCDS53859.1	13	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107481	0.77096	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.47528	0.84;0.84;0.84	4.98	1.14	0.20703	.	0.173505	0.49916	N	0.000131	T	0.38295	0.1035	L	0.55743	1.74	0.49582	D	0.999803	P;P	0.47841	0.901;0.719	B;B	0.38755	0.281;0.109	T	0.23119	-1.0197	10	0.59425	D	0.04	-6.7672	10.0393	0.42148	0.0:0.5344:0.3925:0.073	.	522;403	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	K	403;403;522	ENSP00000350469:E403K;ENSP00000371277:E403K;ENSP00000426528:E522K	ENSP00000350469:E403K	E	-	1	0	FAM123A	24642194	0.980000	0.34600	0.938000	0.37757	0.991000	0.79684	2.482000	0.45224	-0.001000	0.14495	0.561000	0.74099	GAG	AMER2	-	pfam_Uncharacterised_FAM123	ENSG00000165566		0.662	AMER2-002	KNOWN	basic|CCDS	protein_coding	AMER2	HGNC	protein_coding	OTTHUMT00000370229.1	-	0.00	46	0	C	NM_152704		25744194	-1	tier1	-	no_errors	ENST00000515384	ensembl	human	known	74_37	missense	28.57	30	12	SNP	1.000	T
ANKRD40	91369	genome.wustl.edu	37	17	48774476	48774476	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr17:48774476A>C	ENST00000285243.6	-	4	1054	c.785T>G	c.(784-786)gTa>gGa	p.V262G	RP11-294J22.6_ENST00000574246.1_RNA|Y_RNA_ENST00000364470.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	262										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			CACCTTGAGTACCAGCTCTAG	0.398																																																	0													69.0	64.0	66.0					17																	48774476		2203	4300	6503	SO:0001583	missense	0			BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.785T>G	17.37:g.48774476A>C	ENSP00000285243:p.Val262Gly		Q96E32	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V262G	ENST00000285243.6	37	c.785	CCDS11572.1	17	.	.	.	.	.	.	.	.	.	.	A	25.0	4.592862	0.86953	.	.	ENSG00000154945	ENST00000285243	T	0.41400	1.0	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.64681	0.2620	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.68458	-0.5403	10	0.87932	D	0	-21.1923	15.9416	0.79758	1.0:0.0:0.0:0.0	.	262	Q6AI12	ANR40_HUMAN	G	262	ENSP00000285243:V262G	ENSP00000285243:V262G	V	-	2	0	ANKRD40	46129475	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.905000	0.92613	2.225000	0.72522	0.533000	0.62120	GTA	ANKRD40	-	NULL	ENSG00000154945		0.398	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD40	HGNC	protein_coding	OTTHUMT00000368201.2	-	0.00	43	0	A	NM_052855		48774476	-1	tier1	-	no_errors	ENST00000285243	ensembl	human	known	74_37	missense	25.53	35	12	SNP	1.000	C
AP3B2	8120	genome.wustl.edu	37	15	83333651	83333653	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:83333651_83333653delCTC	ENST00000261722.3	-	17	2221_2223	c.2014_2016delGAG	c.(2014-2016)gagdel	p.E672del	AP3B2_ENST00000535359.1_In_Frame_Del_p.E691del|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000535348.1_In_Frame_Del_p.E640del	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	672	Glu/Ser-rich.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			GTTTTTCCTTCTCCTTTCTCTTC	0.571																																																	0																																										SO:0001651	inframe_deletion	0			U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.2014_2016delGAG	15.37:g.83333651_83333653delCTC	ENSP00000261722:p.Glu672del		A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	In_Frame_Del	DEL	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,pirsf_AP3_beta	p.E672in_frame_del	ENST00000261722.3	37	c.2016_2014	CCDS45331.1	15																																																																																			AP3B2	-	pirsf_AP3_beta	ENSG00000103723		0.571	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B2	HGNC	protein_coding	OTTHUMT00000397463.1		0.00	64	0	CTC			83333653	-1	tier1		no_errors	ENST00000261722	ensembl	human	known	74_37	in_frame_del	31.82	45	21	DEL	1.000:1.000:1.000	-
API5	8539	genome.wustl.edu	37	11	43364101	43364101	+	3'UTR	SNP	A	A	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:43364101A>G	ENST00000531273.1	+	0	1755				API5_ENST00000455725.2_3'UTR|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000378852.3_3'UTR|API5_ENST00000420461.2_3'UTR|API5_ENST00000534695.1_Missense_Mutation_p.I90M			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TGAGCTTAATATACTTAAATT	0.418																																					Pancreas(1;98 122 5625 20895 49453)												0													26.0	28.0	27.0					11																	43364101		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	ENST00000531273.1:c.*41A>G	11.37:g.43364101A>G			B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Missense_Mutation	SNP	pfam_API5,superfamily_ARM-type_fold	p.I90M	ENST00000531273.1	37	c.270	CCDS44572.1	11	.	.	.	.	.	.	.	.	.	.	A	11.24	1.579129	0.28180	.	.	ENSG00000166181	ENST00000534695	.	.	.	5.61	4.49	0.54785	.	.	.	.	.	T	0.65026	0.2652	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66736	-0.5848	5	0.87932	D	0	.	8.4408	0.32814	0.9117:0.0:0.0883:0.0	.	.	.	.	M	90	.	ENSP00000436189:I90M	I	+	3	3	API5	43320677	0.998000	0.40836	1.000000	0.80357	0.959000	0.62525	1.963000	0.40452	1.076000	0.40961	0.377000	0.23210	ATA	API5	-	NULL	ENSG00000166181		0.418	API5-002	KNOWN	basic|CCDS	protein_coding	API5	HGNC	protein_coding	OTTHUMT00000389545.1	-	0.00	31	0	A	NM_006595		43364101	+1	tier1	-	no_errors	ENST00000534695	ensembl	human	putative	74_37	missense	41.18	30	21	SNP	0.995	G
ATG5	9474	genome.wustl.edu	37	6	106649888	106649888	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr6:106649888T>A	ENST00000369076.3	-	7	973	c.650A>T	c.(649-651)gAt>gTt	p.D217V	ATG5_ENST00000475645.1_5'UTR|ATG5_ENST00000343245.3_Missense_Mutation_p.D217V|ATG5_ENST00000369070.1_Missense_Mutation_p.D139V|ATG5_ENST00000360666.4_3'UTR	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	217					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		TTTGAGGAGATCTCCTAGTGT	0.363																																																	0													107.0	100.0	103.0					6																	106649888		2203	4300	6503	SO:0001583	missense	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.650A>T	6.37:g.106649888T>A	ENSP00000358072:p.Asp217Val		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Atg5	p.D217V	ENST00000369076.3	37	c.650	CCDS5055.1	6	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228610	0.79576	.	.	ENSG00000057663	ENST00000369076;ENST00000343245;ENST00000369070	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.81128	0.4758	M	0.89785	3.06	0.80722	D	1	D;D	0.63880	0.983;0.993	P;D	0.72625	0.905;0.978	D	0.85541	0.1215	9	0.72032	D	0.01	-13.1997	13.8714	0.63622	0.0:0.0:0.0:1.0	.	139;217	Q9H1Y0-2;Q9H1Y0	.;ATG5_HUMAN	V	217;217;139	.	ENSP00000343313:D217V	D	-	2	0	ATG5	106756581	1.000000	0.71417	0.998000	0.56505	0.923000	0.55619	6.164000	0.71885	1.919000	0.55581	0.459000	0.35465	GAT	ATG5	-	pfam_Atg5	ENSG00000057663		0.363	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	-	0.00	56	0	T	NM_004849		106649888	-1	tier1	-	no_errors	ENST00000343245	ensembl	human	known	74_37	missense	34.69	31	17	SNP	1.000	A
BCR	613	genome.wustl.edu	37	22	23658925	23658925	+	3'UTR	SNP	G	G	A	rs550338960	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr22:23658925G>A	ENST00000305877.8	+	0	5783				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ACTCCCTCCCGGAGCAGGTGG	0.607			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*1216G>A	22.37:g.23658925G>A			P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.607	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	-	0.00	53	0	G	NM_004327		23658925	+1	tier1	-	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	20.59	54	14	SNP	0.000	A
BIRC6	57448	genome.wustl.edu	37	2	32735596	32735596	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:32735596T>C	ENST00000421745.2	+	53	10375	c.10241T>C	c.(10240-10242)tTg>tCg	p.L3414S		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	3414					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TTGCAAGATTTGAATAGTCCT	0.323																																					Pancreas(94;175 1509 16028 18060 45422)												0													106.0	114.0	111.0					2																	32735596		2203	4298	6501	SO:0001583	missense	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.10241T>C	2.37:g.32735596T>C	ENSP00000393596:p.Leu3414Ser		Q9ULD1	Missense_Mutation	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.L3414S	ENST00000421745.2	37	c.10241	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	T	17.09	3.299443	0.60195	.	.	ENSG00000115760	ENST00000421745	T	0.75154	-0.91	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000005	T	0.77651	0.4162	N	0.22421	0.69	0.52501	D	0.999958	D	0.71674	0.998	D	0.78314	0.991	T	0.80407	-0.1395	10	0.62326	D	0.03	.	14.1636	0.65461	0.0:0.0:0.0:1.0	.	3414	Q9NR09	BIRC6_HUMAN	S	3414	ENSP00000393596:L3414S	ENSP00000393596:L3414S	L	+	2	0	BIRC6	32589100	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.972000	0.88022	2.150000	0.67090	0.533000	0.62120	TTG	BIRC6	-	NULL	ENSG00000115760		0.323	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3		0.00	37	0	T	NM_016252		32735596	+1			no_errors	ENST00000421745	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	C
CCDC108	255101	genome.wustl.edu	37	2	219894879	219894879	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:219894879G>T	ENST00000341552.5	-	10	1296	c.1213C>A	c.(1213-1215)Cag>Aag	p.Q405K	CCDC108_ENST00000410037.1_Missense_Mutation_p.Q340K|CCDC108_ENST00000453220.1_Missense_Mutation_p.Q405K|CCDC108_ENST00000441968.1_Missense_Mutation_p.Q405K|CCDC108_ENST00000409865.3_Missense_Mutation_p.Q394K	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	405						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGAAGGCCTGGTCTTCGGCC	0.557											OREG0015211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													105.0	107.0	106.0					2																	219894879		2203	4300	6503	SO:0001583	missense	0			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.1213C>A	2.37:g.219894879G>T	ENSP00000340776:p.Gln405Lys	2262	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	superfamily_PapD-like,pfscan_MSP_dom	p.Q405K	ENST00000341552.5	37	c.1213	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	G	6.170	0.399519	0.11696	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.06528	3.57;3.57;3.57;3.29;3.3	4.94	4.06	0.47325	.	0.950360	0.08659	N	0.912753	T	0.05914	0.0154	L	0.51422	1.61	0.20403	N	0.999909	B;B	0.27286	0.174;0.174	B;B	0.26416	0.069;0.069	T	0.47674	-0.9099	10	0.05436	T	0.98	-4.3772	4.7011	0.12827	0.0753:0.13:0.5352:0.2595	.	394;405	E9PG25;Q6ZU64	.;CC108_HUMAN	K	405;405;405;394;340;339	ENSP00000340776:Q405K;ENSP00000413377:Q405K;ENSP00000409117:Q405K;ENSP00000386945:Q394K;ENSP00000386258:Q340K	ENSP00000340776:Q405K	Q	-	1	0	CCDC108	219603123	0.449000	0.25689	0.803000	0.32268	0.537000	0.34900	0.729000	0.26028	1.304000	0.44892	0.655000	0.94253	CAG	CCDC108	-	NULL	ENSG00000181378		0.557	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	-	0.00	29	0	G	NM_194302		219894879	-1	tier1	-	no_errors	ENST00000341552	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.193	T
CCDC96	257236	genome.wustl.edu	37	4	7043105	7043105	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:7043105G>A	ENST00000310085.4	-	1	1623	c.1561C>T	c.(1561-1563)Ctt>Ttt	p.L521F	TADA2B_ENST00000512388.1_5'Flank|RP11-367J11.2_ENST00000500031.1_RNA|TADA2B_ENST00000310074.7_5'Flank	NM_153376.2	NP_699207.1	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	521										endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11						CGCCGGTGAAGCAGTTCGGTC	0.572																																																	0													92.0	87.0	89.0					4																	7043105		2203	4300	6503	SO:0001583	missense	0			AK075056	CCDS3395.1	4p16.1	2008-02-05			ENSG00000173013	ENSG00000173013			26900	protein-coding gene	gene with protein product							Standard	NM_153376		Approved	FLJ90575	uc003gjv.2	Q2M329	OTTHUMG00000125511	ENST00000310085.4:c.1561C>T	4.37:g.7043105G>A	ENSP00000309285:p.Leu521Phe		Q8N2I7	Missense_Mutation	SNP	NULL	p.L521F	ENST00000310085.4	37	c.1561	CCDS3395.1	4	.	.	.	.	.	.	.	.	.	.	G	9.419	1.082444	0.20309	.	.	ENSG00000173013	ENST00000310085	T	0.59083	0.29	3.61	3.61	0.41365	.	0.138216	0.31772	N	0.007096	T	0.70937	0.3281	M	0.71206	2.165	0.25196	N	0.99009	D	0.89917	1.0	D	0.85130	0.997	T	0.60409	-0.7269	10	0.41790	T	0.15	-12.8808	10.2914	0.43599	0.1019:0.0:0.8981:0.0	.	521	Q2M329	CCD96_HUMAN	F	521	ENSP00000309285:L521F	ENSP00000309285:L521F	L	-	1	0	CCDC96	7094006	1.000000	0.71417	0.014000	0.15608	0.006000	0.05464	4.152000	0.58111	1.844000	0.53588	0.462000	0.41574	CTT	CCDC96	-	NULL	ENSG00000173013		0.572	CCDC96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC96	HGNC	protein_coding	OTTHUMT00000246838.1	-	0.00	84	0	G	NM_153376		7043105	-1	tier1	-	no_errors	ENST00000310085	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.420	A
CDHR5	53841	genome.wustl.edu	37	11	621243	621243	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:621243G>A	ENST00000358353.3	-	8	948	c.626C>T	c.(625-627)cCg>cTg	p.P209L	CDHR5_ENST00000349570.7_Missense_Mutation_p.P209L|CDHR5_ENST00000529337.1_5'Flank|CDHR5_ENST00000397542.2_Missense_Mutation_p.P209L			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	209	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043, ECO:0000305}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						ATTCTCCCCCGGAGTGTCCTG	0.682																																																	0													50.0	52.0	51.0					11																	621243		2203	4299	6502	SO:0001583	missense	0			AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.626C>T	11.37:g.621243G>A	ENSP00000351118:p.Pro209Leu		C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	p.P209L	ENST00000358353.3	37	c.626	CCDS7707.1	11	.	.	.	.	.	.	.	.	.	.	G	10.80	1.452852	0.26074	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000326366;ENST00000349570	T;T;T	0.37235	1.21;1.21;1.21	3.87	-5.22	0.02806	Cadherin (3);Cadherin-like (1);	3.002300	0.01541	N	0.019226	T	0.19644	0.0472	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B	0.31125	0.134;0.309;0.071;0.071;0.181	B;B;B;B;B	0.19946	0.015;0.027;0.008;0.008;0.015	T	0.07635	-1.0762	10	0.26408	T	0.33	0.1364	1.333	0.02138	0.1255:0.2295:0.3022:0.3428	.	209;209;202;209;209	Q58EZ6;Q9HBB8-4;B4DV98;Q9HBB8-2;Q9HBB8	.;.;.;.;CDHR5_HUMAN	L	209	ENSP00000380676:P209L;ENSP00000351118:P209L;ENSP00000345726:P209L	ENSP00000326527:P209L	P	-	2	0	CDHR5	611243	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.307000	0.01132	-0.478000	0.06823	0.561000	0.74099	CCG	CDHR5	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000099834		0.682	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR5	HGNC	protein_coding	OTTHUMT00000255023.2	-	0.00	96	0	G	NM_021924		621243	-1	tier1	-	no_errors	ENST00000358353	ensembl	human	known	74_37	missense	15.74	89	17	SNP	0.000	A
CDC42BPG	55561	genome.wustl.edu	37	11	64606671	64606671	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:64606671T>A	ENST00000342711.5	-	7	709	c.710A>T	c.(709-711)tAt>tTt	p.Y237F		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						AGGGGAGATATAGTCCGGCGT	0.617																																																	0													104.0	98.0	100.0					11																	64606671		2201	4297	6498	SO:0001583	missense	0			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.710A>T	11.37:g.64606671T>A	ENSP00000345133:p.Tyr237Phe			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.Y237F	ENST00000342711.5	37	c.710	CCDS31601.1	11	.	.	.	.	.	.	.	.	.	.	T	28.2	4.896693	0.91962	.	.	ENSG00000171219	ENST00000342711	T	0.57107	0.42	5.27	5.27	0.74061	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47455	D	0.000234	T	0.74520	0.3727	M	0.84683	2.71	0.50313	D	0.999866	D	0.76494	0.999	D	0.83275	0.996	T	0.79293	-0.1863	10	0.87932	D	0	.	13.4205	0.60994	0.0:0.0:0.0:1.0	.	237	Q6DT37	MRCKG_HUMAN	F	237	ENSP00000345133:Y237F	ENSP00000345133:Y237F	Y	-	2	0	CDC42BPG	64363247	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.964000	0.70379	2.118000	0.64928	0.533000	0.62120	TAT	CDC42BPG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000171219		0.617	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPG	HGNC	protein_coding	OTTHUMT00000105352.4	-	0.00	31	0	T	XM_290516		64606671	-1	tier1	-	no_errors	ENST00000342711	ensembl	human	known	74_37	missense	26.92	18	7	SNP	1.000	A
CFHR1	3078	genome.wustl.edu	37	1	196797357	196797357	+	Silent	SNP	A	A	G	rs3201739	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:196797357A>G	ENST00000320493.5	+	4	676	c.588A>G	c.(586-588)acA>acG	p.T196T	CFHR1_ENST00000367424.4_Intron|CFHR2_ENST00000367421.3_Intron	NM_002113.2	NP_002104.2	Q03591	FHR1_HUMAN	complement factor H-related 1	196	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|kidney(1)|large_intestine(2)|lung(7)	11						GAAACTGGACAGAACCACCTC	0.348																																																	0								A		1322,2228		545,232,998	66.0	100.0	90.0		588	0.6	1.0	1	dbSNP_105	90	1631,6527		669,293,3117	no	coding-synonymous	CFHR1	NM_002113.2		1214,525,4115	GG,GA,AA		19.9926,37.2394,25.2221		196/331	196797357	2953,8755	1775	4079	5854	SO:0001819	synonymous_variant	0			M65292	CCDS1386.1	1q32	2014-09-17	2004-08-09	2006-02-28	ENSG00000244414	ENSG00000244414		"""Complement system"""	4888	protein-coding gene	gene with protein product		134371	"""H factor (complement)-like 1"", ""complement factor H-related 1 pseudogene"", ""H factor (complement)-like 2"""	HFL1, CFHL1, CFHR1P, HFL2, CFHL1P		1711047, 1826708	Standard	NM_002113		Approved	H36-1, FHR1, CFHL, H36-2		Q03591	OTTHUMG00000036276	ENST00000320493.5:c.588A>G	1.37:g.196797357A>G			A8K465|Q3B774|Q9UJ17	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.T196	ENST00000320493.5	37	c.588	CCDS1386.1	1																																																																																			CFHR1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000244414		0.348	CFHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR1	HGNC	protein_coding	OTTHUMT00000088251.2		0.00	24	0	A	NM_002113		196797357	+1			no_errors	ENST00000320493	ensembl	human	known	74_37	silent	27.78	26	10	SNP	0.590	G
CLGN	1047	genome.wustl.edu	37	4	141321590	141321590	+	Silent	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:141321590G>A	ENST00000325617.5	-	7	1055	c.615C>T	c.(613-615)ttC>ttT	p.F205F	CLGN_ENST00000537281.1_Silent_p.F205F|CLGN_ENST00000414773.1_Silent_p.F205F	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	205					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					GTTTCTCTTCGAAAACTCCAG	0.333																																																	0													111.0	116.0	114.0					4																	141321590		2203	4300	6503	SO:0001819	synonymous_variant	0			D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.615C>T	4.37:g.141321590G>A			B3KS90|B4DXV8|D3DNY8	Silent	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P_dom,prints_Calret/calnex	p.F205	ENST00000325617.5	37	c.615	CCDS3751.1	4																																																																																			CLGN	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf	ENSG00000153132		0.333	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLGN	HGNC	protein_coding	OTTHUMT00000257272.2	-	0.00	41	0	G	NM_004362		141321590	-1	tier1	-	no_errors	ENST00000325617	ensembl	human	known	74_37	silent	32.56	29	14	SNP	1.000	A
CLSTN1	22883	genome.wustl.edu	37	1	9793590	9793590	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:9793590C>T	ENST00000377298.4	-	16	3088	c.2296G>A	c.(2296-2298)Gcc>Acc	p.A766T	CLSTN1_ENST00000377288.3_Missense_Mutation_p.A747T|CLSTN1_ENST00000361311.4_Missense_Mutation_p.A756T|CLSTN1_ENST00000477264.1_5'Flank	NM_001009566.1	NP_001009566.1	O94985	CSTN1_HUMAN	calsyntenin 1	766					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)|calcium ion binding (GO:0005509)|kinesin binding (GO:0019894)|X11-like protein binding (GO:0042988)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(9)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	36	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCGTAGCTGGCCATGGTGTCC	0.602																																																	0													68.0	58.0	61.0					1																	9793590		2203	4300	6503	SO:0001583	missense	0			AB020718	CCDS105.1, CCDS30580.1	1p36.22	2011-07-01			ENSG00000171603	ENSG00000171603		"""Cadherins / Cadherin-related"""	17447	protein-coding gene	gene with protein product	"""cadherin-related family member 12"""	611321				10048485	Standard	XM_005263432		Approved	CSTN1, KIAA0911, CDHR12	uc001aqh.3	O94985	OTTHUMG00000001451	ENST00000377298.4:c.2296G>A	1.37:g.9793590C>T	ENSP00000366513:p.Ala766Thr		A8K183|Q5SR52|Q5UE58|Q71MN0|Q8N4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A766T	ENST00000377298.4	37	c.2296	CCDS30580.1	1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.966118	0.34659	.	.	ENSG00000171603	ENST00000377298;ENST00000361311;ENST00000435891;ENST00000377288;ENST00000539822	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.13	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.23014	0.0556	L	0.33189	0.99	0.80722	D	1	P;P;P;B	0.45176	0.568;0.852;0.77;0.239	B;B;B;B	0.40444	0.176;0.329;0.176;0.226	T	0.02126	-1.1209	10	0.17369	T	0.5	-37.8041	13.5563	0.61761	0.0:0.9248:0.0:0.0752	.	747;756;766;121	B4E3Q1;O94985-2;O94985;B3KMD3	.;.;CSTN1_HUMAN;.	T	766;756;567;747;747	ENSP00000366513:A766T;ENSP00000354997:A756T;ENSP00000401934:A567T;ENSP00000366502:A747T	ENSP00000354997:A756T	A	-	1	0	CLSTN1	9716177	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	5.988000	0.70579	1.179000	0.42884	-0.136000	0.14681	GCC	CLSTN1	-	NULL	ENSG00000171603		0.602	CLSTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLSTN1	HGNC	protein_coding	OTTHUMT00000004239.1		0.00	59	0	C			9793590	-1			no_errors	ENST00000377298	ensembl	human	known	74_37	missense	5.45	51	3	SNP	1.000	T
COLGALT2	23127	genome.wustl.edu	37	1	183909716	183909716	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:183909716C>A	ENST00000361927.4	-	11	1974	c.1603G>T	c.(1603-1605)Gta>Tta	p.V535L	COLGALT2_ENST00000486375.1_5'UTR|COLGALT2_ENST00000546159.1_Splice_Site_p.V535F|COLGALT2_ENST00000367520.3_Splice_Site_p.V272L|COLGALT2_ENST00000367521.1_Splice_Site_p.V143L	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	535					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GAGACTCACACGGGATGCTTG	0.478																																																	0													171.0	150.0	157.0					1																	183909716		2203	4300	6503	SO:0001630	splice_region_variant	0			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1604+1G>T	1.37:g.183909716C>A			O60327|Q9BZR0	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.V535L	ENST00000361927.4	37	c.1603	CCDS1360.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.97|16.97	3.267489|3.267489	0.59540|0.59540	.|.	.|.	ENSG00000198756|ENSG00000198756	ENST00000546159|ENST00000361927;ENST00000367521;ENST00000367520	T|T	0.78595|0.77229	-1.19|-1.08	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	0.126789|0.126789	0.53938|0.53938	D|D	0.000060|0.000060	T|T	0.77864|0.77864	0.4194|0.4194	L|L	0.59436|0.59436	1.845|1.845	0.49582|0.49582	D|D	0.999804|0.999804	D|P;P	0.67145|0.40180	0.996|0.705;0.666	D|B;B	0.66497|0.40602	0.944|0.334;0.247	T|T	0.77194|0.77194	-0.2677|-0.2677	10|10	0.56958|0.38643	D|T	0.05|0.18	.|.	19.4741|19.4741	0.94979|0.94979	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	535|535;272	F5H3T5|Q8IYK4;Q5SXQ3	.|GT252_HUMAN;.	F|L	535|535;143;272	ENSP00000439112:V535F|ENSP00000354960:V535L	ENSP00000439112:V535F|ENSP00000354960:V535L	V|V	-|-	1|1	0|0	GLT25D2|GLT25D2	182176339|182176339	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	4.642000|4.642000	0.61383|0.61383	2.590000|2.590000	0.87494|0.87494	0.655000|0.655000	0.94253|0.94253	GTC|GTA	COLGALT2	-	NULL	ENSG00000198756		0.478	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLGALT2	HGNC	protein_coding	OTTHUMT00000086128.1	-	0.00	44	0	C	NM_015101	Missense_Mutation	183909716	-1	tier1	-	no_errors	ENST00000361927	ensembl	human	known	74_37	missense	30.61	34	15	SNP	1.000	A
CUEDC1	404093	genome.wustl.edu	37	17	55940324	55940324	+	3'UTR	DEL	T	T	-	rs559186385|rs59475396|rs545426418	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr17:55940324delT	ENST00000577830.1	-	0	1900				CUEDC1_ENST00000407144.2_3'UTR|CUEDC1_ENST00000578357.1_5'UTR	NM_001271875.1	NP_001258804.1	Q9NWM3	CUED1_HUMAN	CUE domain containing 1											endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(3)	12						GCTTTCTGGATTTTTTTTTTT	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000746	CCDS11599.1	17q23.2	2004-03-16				ENSG00000180891			31350	protein-coding gene	gene with protein product							Standard	NM_001271875		Approved		uc002ive.2	Q9NWM3		ENST00000577830.1:c.*326A>-	17.37:g.55940324delT			D3DTZ2|Q9NWD0	RNA	DEL	-	NULL	ENST00000577830.1	37	NULL	CCDS11599.1	17																																																																																			CUEDC1	-	-	ENSG00000180891		0.483	CUEDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUEDC1	HGNC	protein_coding	OTTHUMT00000443305.1		0.00	18	0	T	NM_017949		55940324	-1	tier1		no_errors	ENST00000577422	ensembl	human	known	74_37	rna	18.18	18	4	DEL	0.000	-
PRR32	100130613	genome.wustl.edu	37	X	125955211	125955211	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chrX:125955211C>A	ENST00000371125.3	+	2	670	c.590C>A	c.(589-591)cCc>cAc	p.P197H		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		197																	GAGGTGCCGCCCGGAAATACA	0.547																																																	0													53.0	50.0	51.0					X																	125955211		692	1591	2283	SO:0001583	missense	0																														ENST00000371125.3:c.590C>A	X.37:g.125955211C>A	ENSP00000360166:p.Pro197His			Missense_Mutation	SNP	NULL	p.P197H	ENST00000371125.3	37	c.590	CCDS48163.1	X	.	.	.	.	.	.	.	.	.	.	C	12.84	2.058135	0.36277	.	.	ENSG00000183631	ENST00000371125	T	0.34275	1.37	3.92	0.173	0.15036	.	1.107710	0.07141	N	0.847287	T	0.40886	0.1135	L	0.29908	0.895	0.09310	N	1	D	0.65815	0.995	P	0.60415	0.874	T	0.33420	-0.9869	10	0.87932	D	0	.	6.2031	0.20587	0.0:0.5045:0.0:0.4955	.	197	B1ATL7	CX064_HUMAN	H	197	ENSP00000360166:P197H	ENSP00000360166:P197H	P	+	2	0	CXorf64	125782892	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.708000	0.05035	-0.109000	0.12044	0.600000	0.82982	CCC	CXorf64	-	NULL	ENSG00000183631		0.547	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf64	HGNC	protein_coding	OTTHUMT00000058188.1	-	0.00	56	0	C			125955211	+1	tier1	-	no_errors	ENST00000371125	ensembl	human	known	74_37	missense	36.36	28	16	SNP	0.000	A
DBF4	10926	genome.wustl.edu	37	7	87536898	87536898	+	Missense_Mutation	SNP	A	A	G	rs373255355		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr7:87536898A>G	ENST00000265728.1	+	12	1949	c.1445A>G	c.(1444-1446)tAt>tGt	p.Y482C		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	482					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				GTAGATCACTATAAATGTAAC	0.358																																																	0								A	CYS/TYR	0,4406		0,0,2203	81.0	79.0	80.0		1445	2.8	0.0	7		80	1,8599	1.2+/-3.3	0,1,4299	no	missense	DBF4	NM_006716.3	194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	benign	482/675	87536898	1,13005	2203	4300	6503	SO:0001583	missense	0			AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1445A>G	7.37:g.87536898A>G	ENSP00000265728:p.Tyr482Cys		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Missense_Mutation	SNP	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.Y482C	ENST00000265728.1	37	c.1445	CCDS5611.1	7	.	.	.	.	.	.	.	.	.	.	A	0.189	-1.055222	0.01965	0.0	1.16E-4	ENSG00000006634	ENST00000265728	T	0.27890	1.64	5.67	2.81	0.32909	.	0.800277	0.11912	N	0.517545	T	0.10423	0.0255	N	0.01576	-0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.27971	-1.0058	10	0.32370	T	0.25	0.405	4.3919	0.11344	0.3251:0.1719:0.503:0.0	.	258;482	B7Z8C6;Q9UBU7	.;DBF4A_HUMAN	C	482	ENSP00000265728:Y482C	ENSP00000265728:Y482C	Y	+	2	0	DBF4	87374834	0.023000	0.18921	0.003000	0.11579	0.000000	0.00434	1.466000	0.35310	0.297000	0.22615	-0.248000	0.11899	TAT	DBF4	-	NULL	ENSG00000006634		0.358	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	HGNC	protein_coding	OTTHUMT00000253678.1	-	0.00	59	0	A	NM_006716		87536898	+1	tier1	-	no_errors	ENST00000265728	ensembl	human	known	74_37	missense	18.10	95	21	SNP	0.000	G
MIR15A	406948	genome.wustl.edu	37	13	50618819	50618819	+	IGR	DEL	T	T	-	rs199942593	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr13:50618819delT								KCNRG (23761 upstream) : MIR16-1 (4289 downstream)																							GTTTAGGTCATTTTTTTTTCC	0.303													?|TTTTTTTTT|TTTTTTTT|unsure	8	0.00159744	0.0023	0.0043	5008	,	,		14012	0.002		0.0	False		,,,				2504	0.0																0																																										SO:0001628	intergenic_variant	0																															13.37:g.50618819delT				RNA	DEL	-	NULL		37	NULL		13																																																																																			DLEU2	-	-	ENSG00000231607	0	0.303					DLEU2	HGNC				0.00	25	0	T			50618819	-1	tier1		no_errors	ENST00000235290	ensembl	human	known	74_37	rna	13.33	13	2	DEL	0.000	-
DPY19L2P1	554236	genome.wustl.edu	37	7	35131338	35131338	+	RNA	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr7:35131338C>T	ENST00000436258.1	-	0	2031							Q6NXN4	D19P1_HUMAN	DPY19L2 pseudogene 1							integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)										ACTTCCAGTACGAAAATGAGG	0.388																																																	0																																												0			BC066987		7p14.2	2014-03-18	2013-09-12		ENSG00000189212	ENSG00000189212			22305	pseudogene	pseudogene			"""dpy-19-like 2 pseudogene 1 (C. elegans)"""				Standard	NR_002833		Approved		uc031swy.1	Q6NXN4	OTTHUMG00000155026		7.37:g.35131338C>T			B4E2E3	RNA	SNP	-	NULL	ENST00000436258.1	37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212		0.388	DPY19L2P1-002	KNOWN	basic	processed_transcript	DPY19L2P1	HGNC	pseudogene	OTTHUMT00000338113.1	-	0.00	23	0	C			35131338	-1	tier1	-	no_errors	ENST00000436258	ensembl	human	known	74_37	rna	34.29	23	12	SNP	0.000	T
DLX6	1750	genome.wustl.edu	37	7	96635385	96635385	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr7:96635385G>A	ENST00000007660.5	+	1	95		c.e1+1		DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6_ENST00000518156.2_Silent_p.Q32Q|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA	NM_005222.3	NP_005213.3	P56179	DLX6_HUMAN	distal-less homeobox 6						anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					agcagcagcagcaacagcagc	0.657																																																	0													5.0	7.0	6.0					7																	96635385		1971	3959	5930	SO:0001630	splice_region_variant	0				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000007660.5:c.95+1G>A	7.37:g.96635385G>A			A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Splice_Site	SNP	-	e1+1	ENST00000007660.5	37	c.95+1		7																																																																																			DLX6	-	-	ENSG00000006377		0.657	DLX6-201	KNOWN	basic|appris_candidate	protein_coding	DLX6	HGNC	protein_coding			0.00	63	0	G	NM_005222	Intron	96635385	+1			no_errors	ENST00000007660	ensembl	human	known	74_37	splice_site	5.33	71	4	SNP	0.997	A
DRD5	1816	genome.wustl.edu	37	4	9784785	9784785	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:9784785T>G	ENST00000304374.2	+	1	1528	c.1132T>G	c.(1132-1134)Ttc>Gtc	p.F378V		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	378					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)	p.F378V(4)		NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	GTGCAGCCACTTCTGCTCCCG	0.562																																																	4	Substitution - Missense(4)	skin(2)|NS(1)|endometrium(1)											63.0	55.0	57.0					4																	9784785		2203	4300	6503	SO:0001583	missense	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1132T>G	4.37:g.9784785T>G	ENSP00000306129:p.Phe378Val		B2R9S3|Q8NEQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D5_rcpt,prints_Dopamine_rcpt	p.F378V	ENST00000304374.2	37	c.1132	CCDS3405.1	4	.	.	.	.	.	.	.	.	.	.	t	1.422	-0.572511	0.03882	.	.	ENSG00000169676	ENST00000304374	T	0.36878	1.23	4.73	-0.492	0.12041	.	1.972870	0.02341	N	0.074845	T	0.21103	0.0508	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10109	-1.0644	10	0.16420	T	0.52	.	4.5978	0.12338	0.0:0.3044:0.1738:0.5218	.	378	P21918	DRD5_HUMAN	V	378	ENSP00000306129:F378V	ENSP00000306129:F378V	F	+	1	0	DRD5	9393883	0.067000	0.21026	0.022000	0.16811	0.197000	0.23852	0.558000	0.23469	-0.022000	0.13986	-2.216000	0.00297	TTC	DRD5	-	NULL	ENSG00000169676		0.562	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1		0.00	48	0	T			9784785	+1			no_errors	ENST00000304374	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.043	G
EEFSEC	60678	genome.wustl.edu	37	3	128060142	128060142	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:128060142C>T	ENST00000254730.6	+	5	907	c.853C>T	c.(853-855)Cgg>Tgg	p.R285W	EEFSEC_ENST00000483569.1_3'UTR|EEFSEC_ENST00000483457.1_Missense_Mutation_p.R230W	NM_021937.3	NP_068756.2	P57772	SELB_HUMAN	eukaryotic elongation factor, selenocysteine-tRNA-specific	285					selenocysteine incorporation (GO:0001514)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)|translation elongation factor activity (GO:0003746)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(10)|ovary(1)	25						GCAAGGAGACCGGCTGGGCAT	0.582																																																	0													81.0	75.0	77.0					3																	128060142		2203	4300	6503	SO:0001583	missense	0				CCDS33849.1	3q21.3	2007-05-25			ENSG00000132394	ENSG00000132394			24614	protein-coding gene	gene with protein product	"""elongation factor for selenoprotein translation"""	607695				10970870, 15229221	Standard	XM_005247696		Approved	SELB, EFSEC	uc003eki.3	P57772	OTTHUMG00000159659	ENST00000254730.6:c.853C>T	3.37:g.128060142C>T	ENSP00000254730:p.Arg285Trp		Q96HZ6	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_EF_GTP-bd_dom	p.R285W	ENST00000254730.6	37	c.853	CCDS33849.1	3	.	.	.	.	.	.	.	.	.	.	C	21.7	4.180619	0.78677	.	.	ENSG00000132394	ENST00000254730;ENST00000483457	T;T	0.63913	-0.07;-0.07	5.34	4.38	0.52667	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	D	0.86368	0.5916	H	0.97829	4.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.91252	0.5030	10	0.87932	D	0	-5.451	15.0996	0.72262	0.1916:0.8084:0.0:0.0	.	230;285	C9J8T0;P57772	.;SELB_HUMAN	W	285;230	ENSP00000254730:R285W;ENSP00000417660:R230W	ENSP00000254730:R285W	R	+	1	2	EEFSEC	129542832	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.889000	0.48601	2.480000	0.83734	0.591000	0.81541	CGG	EEFSEC	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_B-barrel	ENSG00000132394		0.582	EEFSEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEFSEC	HGNC	protein_coding	OTTHUMT00000356738.2	-	0.00	57	0	C	NM_021937		128060142	+1	tier1	-	no_errors	ENST00000254730	ensembl	human	known	74_37	missense	14.10	67	11	SNP	1.000	T
ELAVL2	1993	genome.wustl.edu	37	9	23762201	23762201	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:23762201delC	ENST00000397312.2	-	2	306	c.32delG	c.(31-33)tgcfs	p.C11fs	ELAVL2_ENST00000544538.1_Frame_Shift_Del_p.C11fs|ELAVL2_ENST00000462649.1_5'Flank|ELAVL2_ENST00000380110.4_Frame_Shift_Del_p.C40fs|ELAVL2_ENST00000223951.6_Frame_Shift_Del_p.C11fs|ELAVL2_ENST00000380117.1_Frame_Shift_Del_p.C11fs	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	11					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		TGTGTTATTGCAAGTTGGCCC	0.403																																																	0													303.0	279.0	287.0					9																	23762201		2203	4299	6502	SO:0001589	frameshift_variant	0			BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.32delG	9.37:g.23762201delC	ENSP00000380479:p.Cys11fs		D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.C11fs	ENST00000397312.2	37	c.32	CCDS6515.1	9																																																																																			ELAVL2	-	NULL	ENSG00000107105		0.403	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	ELAVL2	HGNC	protein_coding	OTTHUMT00000051943.2		0.00	71	0	C	NM_004432		23762201	-1	tier1		no_errors	ENST00000380117	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	1.000	-
PRTG	283659	genome.wustl.edu	37	15	55972660	55972661	+	Intron	INS	-	-	T	rs35467969		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:55972660_55972661insT	ENST00000389286.4	-	5	862				RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AAGGAAAAGACTTTTTTTTTTT	0.322																																																	0																																										SO:0001627	intron_variant	0			AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.814+27->A	15.37:g.55972671_55972671dupT				RNA	INS	-	NULL	ENST00000389286.4	37	NULL	CCDS42040.1	15																																																																																			RP11-420M1.2	-	-	ENSG00000259180		0.322	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259180	Clone_based_vega_gene	protein_coding	OTTHUMT00000419357.1		0.00	12	0	-	NM_173814		55972661	+1	tier1		no_errors	ENST00000561155	ensembl	human	known	74_37	rna	17.39	19	4	INS	0.000:0.000	T
RP11-690I21.2	0	genome.wustl.edu	37	2	232677018	232677018	+	RNA	DEL	A	A	-	rs532945700		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:232677018delA	ENST00000563949.1	+	0	2463																											TGACTTGCTGAAAAAAAAAAA	0.373																																																	0																																												0																															2.37:g.232677018delA				RNA	DEL	-	NULL	ENST00000563949.1	37	NULL		2																																																																																			RP11-690I21.2	-	-	ENSG00000261096		0.373	RP11-690I21.2-001	KNOWN	basic	sense_overlapping	ENSG00000261096	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000431716.1		0.00	21	0	A			232677018	+1	tier1		no_errors	ENST00000563949	ensembl	human	known	74_37	rna	9.09	30	3	DEL	0.017	-
FAM65B	9750	genome.wustl.edu	37	6	24825523	24825523	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr6:24825523G>C	ENST00000259698.4	-	20	3037	c.2862C>G	c.(2860-2862)gaC>gaG	p.D954E	FAM65B_ENST00000538035.1_Missense_Mutation_p.D933E	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	954					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TAACTTCGTTGTCCTCTCTGG	0.493																																																	0													165.0	134.0	144.0					6																	24825523		692	1591	2283	SO:0001583	missense	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.2862C>G	6.37:g.24825523G>C	ENSP00000259698:p.Asp954Glu		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D954E	ENST00000259698.4	37	c.2862	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844963	0.32606	.	.	ENSG00000111913	ENST00000259698;ENST00000538035	T;T	0.76839	-1.05;-1.05	5.6	4.55	0.56014	Armadillo-like helical (1);Armadillo-type fold (1);	0.448518	0.27773	N	0.017918	T	0.58148	0.2102	L	0.56769	1.78	0.09310	N	1	B;B	0.27068	0.167;0.073	B;B	0.27380	0.053;0.079	T	0.54682	-0.8257	10	0.62326	D	0.03	-12.2716	6.8072	0.23784	0.0812:0.1286:0.6584:0.1318	.	933;954	F5GX51;Q9Y4F9	.;FA65B_HUMAN	E	954;933	ENSP00000259698:D954E;ENSP00000441138:D933E	ENSP00000259698:D954E	D	-	3	2	FAM65B	24933502	0.785000	0.28726	0.012000	0.15200	0.899000	0.52679	1.463000	0.35277	2.644000	0.89710	0.655000	0.94253	GAC	FAM65B	-	superfamily_ARM-type_fold	ENSG00000111913		0.493	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	-	0.00	81	0	G			24825523	-1	tier1	-	no_errors	ENST00000259698	ensembl	human	known	74_37	missense	6.02	78	5	SNP	0.000	C
FAM86DP	692099	genome.wustl.edu	37	3	75471400	75471400	+	RNA	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:75471400C>T	ENST00000459803.1	-	0	1741					NR_024241.1				family with sequence similarity 86, member D, pseudogene																		TGGCCAGAAGCTGAAATGACG	0.577																																																	0																																												0			BC016686		3p12.3	2010-06-04	2010-06-04	2010-06-04	ENSG00000244026	ENSG00000244026			32659	pseudogene	pseudogene			"""family with sequence similarity 86, member D"""	FAM86D			Standard	NR_024241		Approved		uc003dpp.4		OTTHUMG00000158855		3.37:g.75471400C>T				RNA	SNP	-	NULL	ENST00000459803.1	37	NULL		3																																																																																			FAM86DP	-	-	ENSG00000244026		0.577	FAM86DP-003	KNOWN	basic	processed_transcript	FAM86DP	HGNC	pseudogene	OTTHUMT00000352425.1		0.00	75	0	C	NR_024241		75471400	-1			no_errors	ENST00000459803	ensembl	human	known	74_37	rna	13.46	45	7	SNP	0.001	T
FASN	2194	genome.wustl.edu	37	17	80037129	80037129	+	Missense_Mutation	SNP	C	C	T	rs1140623		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr17:80037129C>T	ENST00000306749.2	-	43	7644	c.7426G>A	c.(7426-7428)Gtc>Atc	p.V2476I	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2476	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CCCTCGATGACGTGGACGGAT	0.662																																					Colon(59;314 1043 11189 28578 32273)												0													111.0	93.0	99.0					17																	80037129		2203	4300	6503	SO:0001583	missense	0			U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.7426G>A	17.37:g.80037129C>T	ENSP00000304592:p.Val2476Ile		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.V2476I	ENST00000306749.2	37	c.7426	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	C	1.209	-0.630371	0.03610	.	.	ENSG00000169710	ENST00000306749	T	0.26660	1.72	4.46	-1.45	0.08828	Thioesterase (1);	0.263238	0.30401	N	0.009710	T	0.15262	0.0368	L	0.33137	0.985	0.35663	D	0.812721	B	0.12013	0.005	B	0.08055	0.003	T	0.32161	-0.9917	10	0.14252	T	0.57	-32.7984	11.4927	0.50389	0.0:0.3617:0.0:0.6383	rs1140623	2476	P49327	FAS_HUMAN	I	2476	ENSP00000304592:V2476I	ENSP00000304592:V2476I	V	-	1	0	FASN	77630418	0.264000	0.24093	0.539000	0.28077	0.005000	0.04900	0.177000	0.16801	-0.432000	0.07297	-0.254000	0.11334	GTC	FASN	-	pfam_Thioesterase	ENSG00000169710		0.662	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	-	0.00	58	0	C	NM_004104		80037129	-1	tier1	rs1140623	no_errors	ENST00000306749	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.733	T
FBXO28	23219	genome.wustl.edu	37	1	224345198	224345198	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:224345198G>A	ENST00000366862.5	+	5	900	c.857G>A	c.(856-858)cGc>cAc	p.R286H	FBXO28_ENST00000424254.2_3'UTR	NM_015176.3	NP_055991.1	Q9NVF7	FBX28_HUMAN	F-box protein 28	286										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(2)|skin(1)	10	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)		TCTGAGCTTCGCACCAAAGTG	0.468																																																	0													129.0	132.0	131.0					1																	224345198		2203	4300	6503	SO:0001583	missense	0			AK001628	CCDS1539.1, CCDS44320.1	1q42.12	2011-08-12			ENSG00000143756	ENSG00000143756		"""F-boxes /  ""other"""""	29046	protein-coding gene	gene with protein product	"""centromere protein 30"""	609100				9455484	Standard	NM_015176		Approved	FLJ10766, KIAA0483, Fbx28, CENP-30	uc001hoh.3	Q9NVF7	OTTHUMG00000037495	ENST00000366862.5:c.857G>A	1.37:g.224345198G>A	ENSP00000355827:p.Arg286His		E9PEM8|O75070	Missense_Mutation	SNP	pfam_F-box_dom,superfamily_F-box_dom,pfscan_F-box_dom	p.R286H	ENST00000366862.5	37	c.857	CCDS1539.1	1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195518	0.78902	.	.	ENSG00000143756	ENST00000366862	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.75525	0.3861	L	0.43152	1.355	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.73694	-0.3902	9	0.56958	D	0.05	-8.8106	20.8794	0.99867	0.0:0.0:1.0:0.0	.	286	Q9NVF7	FBX28_HUMAN	H	286	.	ENSP00000355827:R286H	R	+	2	0	FBXO28	222411821	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.204000	0.95041	2.941000	0.99782	0.655000	0.94253	CGC	FBXO28	-	NULL	ENSG00000143756		0.468	FBXO28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO28	HGNC	protein_coding	OTTHUMT00000091283.2		0.00	28	0	G	NM_015176		224345198	+1			no_errors	ENST00000366862	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	A
FEM1C	56929	genome.wustl.edu	37	5	114860452	114860452	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr5:114860452T>C	ENST00000274457.3	-	3	1968	c.1407A>G	c.(1405-1407)atA>atG	p.I469M		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	469					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		GAAACCTGTATATAGTCTGCT	0.388																																																	0													145.0	146.0	146.0					5																	114860452		2202	4299	6501	SO:0001583	missense	0				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1407A>G	5.37:g.114860452T>C	ENSP00000274457:p.Ile469Met		B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I469M	ENST00000274457.3	37	c.1407	CCDS4118.1	5	.	.	.	.	.	.	.	.	.	.	T	13.85	2.359386	0.41801	.	.	ENSG00000145780	ENST00000274457	T	0.56941	0.43	5.55	0.193	0.15139	Ankyrin repeat-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.55242	0.1908	L	0.58669	1.825	0.41590	D	0.988794	P	0.48294	0.908	P	0.53062	0.717	T	0.55108	-0.8192	10	0.62326	D	0.03	-24.2525	8.3831	0.32483	0.1863:0.0:0.5019:0.3118	.	469	Q96JP0	FEM1C_HUMAN	M	469	ENSP00000274457:I469M	ENSP00000274457:I469M	I	-	3	3	FEM1C	114888351	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	0.677000	0.25262	0.069000	0.16605	0.533000	0.62120	ATA	FEM1C	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000145780		0.388	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1C	HGNC	protein_coding	OTTHUMT00000250857.3	-	0.00	62	0	T	NM_020177		114860452	-1	tier1	-	no_errors	ENST00000274457	ensembl	human	known	74_37	missense	65.22	16	30	SNP	0.975	C
FGFR2	2263	genome.wustl.edu	37	10	123244982	123244982	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr10:123244982G>T	ENST00000358487.5	-	16	2394	c.2122C>A	c.(2122-2124)Ccc>Acc	p.P708T	FGFR2_ENST00000369059.1_Missense_Mutation_p.P594T|FGFR2_ENST00000369061.4_Missense_Mutation_p.P596T|FGFR2_ENST00000351936.6_Missense_Mutation_p.P706T|FGFR2_ENST00000360144.3_Missense_Mutation_p.P620T|FGFR2_ENST00000346997.2_Missense_Mutation_p.P706T|FGFR2_ENST00000357555.5_Missense_Mutation_p.P619T|FGFR2_ENST00000356226.4_Missense_Mutation_p.P591T|FGFR2_ENST00000369060.4_Missense_Mutation_p.P592T|FGFR2_ENST00000457416.2_Missense_Mutation_p.P709T|FGFR2_ENST00000369056.1_Missense_Mutation_p.P709T|FGFR2_ENST00000478859.1_Missense_Mutation_p.P480T	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	708	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.P708S(1)		breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	TCCTCCACGGGAATCCCTGGG	0.522		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																															Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	1	Substitution - Missense(1)	skin(1)											131.0	114.0	120.0					10																	123244982		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.2122C>A	10.37:g.123244982G>T	ENSP00000351276:p.Pro708Thr		B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P709T	ENST00000358487.5	37	c.2125	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846604	0.91277	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000369061;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000429361;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.90844	-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74;-2.74	5.04	5.04	0.67666	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.89522	0.6739	N	0.03324	-0.35	0.80722	D	1	P;D;D;D;D;P;D;D	0.89917	0.677;0.986;1.0;0.999;0.999;0.85;0.999;1.0	P;P;D;D;D;P;D;D	0.83275	0.527;0.906;0.996;0.972;0.991;0.544;0.991;0.983	D	0.93057	0.6471	10	0.87932	D	0	.	18.7566	0.91835	0.0:0.0:1.0:0.0	.	725;707;619;591;708;620;709;611	D3DRD5;P21802-18;P21802-21;P21802-20;P21802;P21802-22;P21802-17;D3DRD3	.;.;.;.;FGFR2_HUMAN;.;.;.	T	619;709;596;708;591;592;594;300;706;709;706;620;709;709;617	ENSP00000350166:P619T;ENSP00000358057:P596T;ENSP00000351276:P708T;ENSP00000348559:P591T;ENSP00000358056:P592T;ENSP00000358055:P594T;ENSP00000404219:P300T;ENSP00000263451:P706T;ENSP00000410294:P709T;ENSP00000309878:P706T;ENSP00000353262:P620T;ENSP00000358052:P709T;ENSP00000358054:P709T;ENSP00000337665:P617T	ENSP00000337665:P617T	P	-	1	0	FGFR2	123234972	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.734000	0.84928	2.496000	0.84212	0.609000	0.83330	CCC	FGFR2	-	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000066468		0.522	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1		0.00	32	0	G	NM_022976, NM_000141		123244982	-1			no_errors	ENST00000457416	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
FIP1L1	81608	genome.wustl.edu	37	4	54325561	54325561	+	Missense_Mutation	SNP	C	C	T	rs377576240		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:54325561C>T	ENST00000337488.6	+	18	1924	c.1730C>T	c.(1729-1731)gCg>gTg	p.A577V	LNX1_ENST00000306888.2_3'UTR|FIP1L1_ENST00000507166.1_Intron|FIP1L1_ENST00000306932.6_Missense_Mutation_p.A503V|FIP1L1_ENST00000358575.5_Missense_Mutation_p.A571V	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	577	Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			GGAAAAGAAGCGGGCAGTGAG	0.438			T	PDGFRA	idiopathic hypereosinophilic syndrome																																			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	0								C	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	87.0	88.0	88.0		1712,1508,1730	5.4	1.0	4		88	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	FIP1L1	NM_001134937.1,NM_001134938.1,NM_030917.3	64,64,64	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging,possibly-damaging	571/589,503/521,577/595	54325561	2,13004	2203	4300	6503	SO:0001583	missense	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1730C>T	4.37:g.54325561C>T	ENSP00000336752:p.Ala577Val		B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	pfam_Fip1	p.A577V	ENST00000337488.6	37	c.1730	CCDS3491.1	4	.	.	.	.	.	.	.	.	.	.	C	19.11	3.764695	0.69878	0.0	2.33E-4	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000306932;ENST00000504094	T;T;D	0.94092	2.26;2.26;-3.35	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000001	D	0.89805	0.6821	L	0.44542	1.39	0.80722	D	1	P;P;P;P	0.44734	0.655;0.842;0.516;0.524	B;B;B;B	0.33960	0.064;0.173;0.064;0.043	D	0.90622	0.4560	10	0.52906	T	0.07	-13.86	19.5589	0.95364	0.0:1.0:0.0:0.0	.	571;571;503;577	G3XAD6;B4DIR3;Q6UN15-3;Q6UN15	.;.;.;FIP1_HUMAN	V	577;571;503;237	ENSP00000336752:A577V;ENSP00000351383:A571V;ENSP00000302993:A503V	ENSP00000302993:A503V	A	+	2	0	FIP1L1	54020318	0.998000	0.40836	0.988000	0.46212	0.599000	0.36880	4.035000	0.57297	2.691000	0.91804	0.650000	0.86243	GCG	FIP1L1	-	NULL	ENSG00000145216		0.438	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1		0.00	19	0	C	NM_030917		54325561	+1			no_errors	ENST00000337488	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
FUK	197258	genome.wustl.edu	37	16	70506917	70506917	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr16:70506917C>T	ENST00000288078.6	+	15	1670	c.1438C>T	c.(1438-1440)Ccc>Tcc	p.P480S	FUK_ENST00000378912.2_Missense_Mutation_p.P512S|FUK_ENST00000571514.1_5'UTR	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	480						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				TGAGACGCTGCCCGCAGAGTA	0.642																																																	0													12.0	17.0	15.0					16																	70506917		2005	4173	6178	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.1438C>T	16.37:g.70506917C>T	ENSP00000288078:p.Pro480Ser		Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.P512S	ENST00000288078.6	37	c.1534	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	C	6.968	0.548601	0.13312	.	.	ENSG00000157353	ENST00000288078;ENST00000378912	T;T	0.29655	1.56;1.56	5.84	2.49	0.30216	L-fucokinase (1);	0.988139	0.08262	N	0.972845	T	0.25494	0.0620	L	0.33485	1.01	0.09310	N	1	P;B	0.34724	0.465;0.379	B;B	0.35182	0.124;0.197	T	0.19516	-1.0303	10	0.20519	T	0.43	-2.1353	12.4895	0.55891	0.0:0.414:0.5192:0.0668	.	512;480	Q8N0W3-2;Q8N0W3	.;FUK_HUMAN	S	480;512	ENSP00000288078:P480S;ENSP00000368192:P512S	ENSP00000288078:P480S	P	+	1	0	FUK	69064418	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.910000	0.28571	0.714000	0.32081	0.655000	0.94253	CCC	FUK	-	pfam_Fucokinase	ENSG00000157353		0.642	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	-	0.00	79	0	C	NM_145059		70506917	+1	tier1	-	no_errors	ENST00000378912	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.000	T
GLUD2	2747	genome.wustl.edu	37	X	120181834	120181834	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chrX:120181834G>A	ENST00000328078.1	+	1	373	c.296G>A	c.(295-297)cGg>cAg	p.R99Q		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	99					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GAGCAGAAGCGGAACCGGGTG	0.617																																																	0													99.0	74.0	82.0					X																	120181834		2203	4300	6503	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.296G>A	X.37:g.120181834G>A	ENSP00000327589:p.Arg99Gln		B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.R99Q	ENST00000328078.1	37	c.296	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259268	0.23051	.	.	ENSG00000182890	ENST00000328078	D	0.96459	-4.02	1.62	-0.286	0.12862	.	0.060332	0.64402	N	0.000008	D	0.87350	0.6155	N	0.17082	0.46	0.40532	D	0.980941	B	0.28208	0.203	B	0.06405	0.002	T	0.75513	-0.3291	10	0.17832	T	0.49	.	5.5464	0.17065	0.3553:0.0:0.6447:0.0	.	99	P49448	DHE4_HUMAN	Q	99	ENSP00000327589:R99Q	ENSP00000327589:R99Q	R	+	2	0	GLUD2	120009515	1.000000	0.71417	0.002000	0.10522	0.037000	0.13140	6.185000	0.72013	-0.161000	0.10983	-0.412000	0.06146	CGG	GLUD2	-	NULL	ENSG00000182890		0.617	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	-	0.00	52	0	G	NM_012084		120181834	+1	tier1	-	no_errors	ENST00000328078	ensembl	human	known	74_37	missense	20.00	52	13	SNP	0.988	A
H3F3A	3020	genome.wustl.edu	37	1	226252079	226252079	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:226252079C>T	ENST00000366813.1	+	1	402	c.27C>T	c.(25-27)cgC>cgT	p.R9R	H3F3A_ENST00000366815.3_Silent_p.R9R|RP11-396C23.4_ENST00000609423.1_RNA|H3F3A_ENST00000366814.3_Silent_p.R9R|H3F3A_ENST00000366816.1_Silent_p.R9R			P84243	H33_HUMAN	H3 histone, family 3A	9				R -> L (in Ref. 7; AAH81561). {ECO:0000305}.	blood coagulation (GO:0007596)|brain development (GO:0007420)|DNA replication-independent nucleosome assembly (GO:0006336)|positive regulation of cell growth (GO:0030307)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nuclear nucleosome (GO:0000788)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	nucleosomal DNA binding (GO:0031492)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			central_nervous_system(116)|endometrium(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	123	Breast(184;0.179)			GBM - Glioblastoma multiforme(131;0.203)		AGACTGCCCGCAAATCGACCG	0.488			Mis		glioma						OREG0014293	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																												Dom	yes		1	1q42.12	3020	"""H3 histone, family 3A"""		O	0													30.0	32.0	31.0					1																	226252079		2202	4296	6498	SO:0001819	synonymous_variant	0			BC029405	CCDS1550.1	1q42.12	2011-01-27			ENSG00000163041	ENSG00000163041		"""Histones / Replication-independent"""	4764	protein-coding gene	gene with protein product		601128		H3F3		3031613	Standard	NM_002107		Approved	H3.3A	uc001hpw.3	P84243	OTTHUMG00000037507	ENST00000366813.1:c.27C>T	1.37:g.226252079C>T		2311	P06351|P33155|Q5VV55|Q5VV56|Q66I33|Q9V3W4	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R9	ENST00000366813.1	37	c.27	CCDS1550.1	1																																																																																			H3F3A	-	superfamily_Histone-fold,prints_Histone_H3	ENSG00000163041		0.488	H3F3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	H3F3A	HGNC	protein_coding	OTTHUMT00000091324.1	-	0.00	73	0	C	NM_002107		226252079	+1	tier1	-	no_errors	ENST00000366813	ensembl	human	known	74_37	silent	11.27	126	16	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112717042	112717042	+	Silent	SNP	T	T	C	rs373751710		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr12:112717042T>C	ENST00000430131.2	-	9	1640	c.495A>G	c.(493-495)tcA>tcG	p.S165S	HECTD4_ENST00000550722.1_Silent_p.S415S|HECTD4_ENST00000377560.5_Silent_p.S415S			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	165					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTTTTAAAGATGACAAACCAC	0.398																																																	0								T		1,3691		0,1,1845	72.0	71.0	71.0		1245	-2.8	1.0	12		71	0,8170		0,0,4085	no	coding-synonymous	C12orf51	NM_001109662.2		0,1,5930	CC,CT,TT		0.0,0.0271,0.0084		415/4247	112717042	1,11861	1846	4085	5931	SO:0001819	synonymous_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.495A>G	12.37:g.112717042T>C			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.S415	ENST00000430131.2	37	c.1245		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.398	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	37	0	T	NM_173813		112717042	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	37.50	20	12	SNP	0.669	C
HIST1H3B	8358	genome.wustl.edu	37	6	26032136	26032136	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr6:26032136C>G	ENST00000244661.2	-	1	152	c.153G>C	c.(151-153)gaG>gaC	p.E51D		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	51					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						AGCGGCGGATCTCGCGCAGAG	0.627																																																	0													57.0	67.0	64.0					6																	26032136		2203	4300	6503	SO:0001583	missense	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.153G>C	6.37:g.26032136C>G	ENSP00000244661:p.Glu51Asp		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E51D	ENST00000244661.2	37	c.153	CCDS4573.1	6	.	.	.	.	.	.	.	.	.	.	c	14.96	2.691336	0.48097	.	.	ENSG00000124693	ENST00000244661	T	0.57273	0.41	5.19	5.19	0.71726	.	.	.	.	.	T	0.65091	0.2658	.	.	.	0.45427	D	0.998402	.	.	.	.	.	.	T	0.68907	-0.5285	6	0.72032	D	0.01	.	18.0628	0.89382	0.0:1.0:0.0:0.0	.	.	.	.	D	51	ENSP00000244661:E51D	ENSP00000244661:E51D	E	-	3	2	HIST1H3B	26140115	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	3.191000	0.50981	2.577000	0.86979	0.561000	0.74099	GAG	HIST1H3B	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.627	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	-	0.00	72	0	C	NM_003537		26032136	-1	tier1	-	no_errors	ENST00000244661	ensembl	human	known	74_37	missense	17.07	68	14	SNP	1.000	G
HTT	3064	genome.wustl.edu	37	4	3133112	3133112	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:3133112G>A	ENST00000355072.5	+	15	2231	c.2086G>A	c.(2086-2088)Ggg>Agg	p.G696R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	696					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTTGCTAACAGGGGGAAAAAA	0.483																																																	0													99.0	92.0	94.0					4																	3133112		1967	4155	6122	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.2086G>A	4.37:g.3133112G>A	ENSP00000347184:p.Gly696Arg		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.G696R	ENST00000355072.5	37	c.2086	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	21.2	4.106000	0.77096	.	.	ENSG00000197386	ENST00000355072	T	0.64991	-0.13	5.07	4.22	0.49857	Armadillo-type fold (1);	0.049610	0.85682	D	0.000000	T	0.72961	0.3526	M	0.81341	2.54	0.58432	D	0.999997	D	0.56035	0.974	P	0.53224	0.721	T	0.77981	-0.2383	10	0.87932	D	0	.	12.8655	0.57937	0.0:0.0:0.8366:0.1634	.	696	P42858	HD_HUMAN	R	696	ENSP00000347184:G696R	ENSP00000347184:G696R	G	+	1	0	HTT	3102910	1.000000	0.71417	0.065000	0.19835	0.945000	0.59286	8.393000	0.90182	1.335000	0.45486	0.655000	0.94253	GGG	HTT	-	superfamily_ARM-type_fold	ENSG00000197386		0.483	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	-	0.00	97	0	G	NM_002111		3133112	+1	tier1	-	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	14.06	55	9	SNP	0.950	A
IGHV4-59	28392	genome.wustl.edu	37	14	107083503	107083503	+	RNA	SNP	G	G	A	rs373780081		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr14:107083503G>A	ENST00000455737.1	-	0	140									immunoglobulin heavy variable 4-59																		CAGGGTCTCCGAAGGCTTCAC	0.617																																																	0								G		0,3622		0,0,1811	27.0	28.0	28.0			1.7	0.0	14		28	4,8066		0,4,4031	no	intergenic				0,4,5842	AA,AG,GG		0.0496,0.0,0.0342			107083503	4,11688	1811	4035	5846			0			L10088		14q32.33	2012-02-08			ENSG00000224373	ENSG00000224373		"""Immunoglobulins / IGH locus"""	5654	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151973		14.37:g.107083503G>A				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S34L	ENST00000455737.1	37	c.101		14																																																																																			IGHV4-59	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000224373		0.617	IGHV4-59-002	KNOWN	basic|appris_principal	IG_V_gene	IGHV4-59	HGNC	IG_V_gene	OTTHUMT00000324620.1	-	0.00	105	0	G	NG_001019		107083503	-1	tier1	-	no_errors	ENST00000455737	ensembl	human	known	74_37	missense	39.16	87	56	SNP	0.081	A
IVL	3713	genome.wustl.edu	37	1	152882800	152882800	+	Missense_Mutation	SNP	C	C	T	rs541736259		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:152882800C>T	ENST00000368764.3	+	2	591	c.527C>T	c.(526-528)cCg>cTg	p.P176L	IVL_ENST00000392667.2_Missense_Mutation_p.P30L			P07476	INVO_HUMAN	involucrin	176	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ctgaagcacccggagcagcag	0.642																																																	0													19.0	21.0	20.0					1																	152882800		2203	4299	6502	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.527C>T	1.37:g.152882800C>T	ENSP00000357753:p.Pro176Leu		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.P176L	ENST00000368764.3	37	c.527	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	C	0.312	-0.967516	0.02232	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11930	2.97;2.73	2.13	-4.25	0.03766	.	.	.	.	.	T	0.00608	0.0020	N	0.00146	-1.995	0.09310	N	1	B	0.24823	0.112	B	0.17098	0.017	T	0.47100	-0.9143	9	0.27785	T	0.31	.	5.3469	0.16014	0.3244:0.5011:0.1746:0.0	.	176	P07476	INVO_HUMAN	L	176;30	ENSP00000357753:P176L;ENSP00000376435:P30L	ENSP00000357753:P176L	P	+	2	0	IVL	151149424	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.509000	0.02264	-0.815000	0.04346	0.436000	0.28706	CCG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.642	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1		0.00	28	0	C	NM_005547		152882800	+1			no_errors	ENST00000368764	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
JMJD7	100137047	genome.wustl.edu	37	15	42127814	42127814	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:42127814G>A	ENST00000397299.4	+	4	541	c.501G>A	c.(499-501)tgG>tgA	p.W167*	JMJD7-PLA2G4B_ENST00000342159.4_Nonsense_Mutation_p.W167*|JMJD7_ENST00000408047.1_Nonsense_Mutation_p.W68*|JMJD7-PLA2G4B_ENST00000382448.4_Nonsense_Mutation_p.W167*|PLA2G4B_ENST00000452633.1_5'Flank|PLA2G4B_ENST00000542534.2_Nonsense_Mutation_p.W167*|JMJD7-PLA2G4B_ENST00000476036.1_3'UTR	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	167	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.									NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						TGAACTTCTGGCTGGGGGAGG	0.592																																																	0													88.0	87.0	88.0					15																	42127814		2203	4300	6503	SO:0001587	stop_gained	0				CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.501G>A	15.37:g.42127814G>A	ENSP00000380467:p.Trp167*		A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Nonsense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.W167*	ENST00000397299.4	37	c.501	CCDS45240.1	15	.	.	.	.	.	.	.	.	.	.	.	35	5.577570	0.96565	.	.	ENSG00000243789;ENSG00000243789;ENSG00000243789;ENSG00000243789;ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000168970	ENST00000397299;ENST00000408047;ENST00000431823;ENST00000405106;ENST00000542534;ENST00000335032;ENST00000382448;ENST00000342159	.	.	.	4.62	4.62	0.57501	.	0.000000	0.50627	D	0.000116	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.0222	17.1133	0.86682	0.0:0.0:1.0:0.0	.	.	.	.	X	167;68;68;68;167;68;167;167	.	ENSP00000380467:W167X	W	+	3	0	JMJD7-PLA2G4B;JMJD7	39915106	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	8.657000	0.91106	2.497000	0.84241	0.655000	0.94253	TGG	JMJD7-PLA2G4B	-	smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000168970		0.592	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000326082.1	-	0.00	57	0	G	NM_001114632		42127814	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	A
KCTD19	146212	genome.wustl.edu	37	16	67354649	67354649	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr16:67354649G>A	ENST00000304372.5	-	2	198	c.143C>T	c.(142-144)tCt>tTt	p.S48F	KCTD19_ENST00000562860.1_5'UTR|RN7SKP118_ENST00000364331.1_RNA	NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	48	BTB 1.				protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		GCTTTCTGAAGAGGTCAAGGC	0.483																																																	0													93.0	90.0	90.0					16																	67354649		1917	4137	6054	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.143C>T	16.37:g.67354649G>A	ENSP00000305702:p.Ser48Phe		B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.S48F	ENST00000304372.5	37	c.143	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	G	14.48	2.548065	0.45383	.	.	ENSG00000168676	ENST00000304372	T	0.77489	-1.1	6.08	5.13	0.70059	BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.632683	0.15114	N	0.279816	T	0.61825	0.2378	N	0.17723	0.515	0.22424	N	0.999113	B	0.27316	0.175	B	0.33392	0.163	T	0.50021	-0.8876	10	0.09590	T	0.72	-3.1478	7.9391	0.29948	0.0823:0.1621:0.7556:0.0	.	48	Q17RG1	KCD19_HUMAN	F	48	ENSP00000305702:S48F	ENSP00000305702:S48F	S	-	2	0	KCTD19	65912150	0.234000	0.23783	0.831000	0.32960	0.948000	0.59901	1.053000	0.30442	2.894000	0.99253	0.591000	0.81541	TCT	KCTD19	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	ENSG00000168676		0.483	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	-	0.00	51	0	G	XM_085367		67354649	-1	tier1	-	no_errors	ENST00000304372	ensembl	human	known	74_37	missense	14.04	49	8	SNP	0.406	A
KIAA0020	9933	genome.wustl.edu	37	9	2829813	2829813	+	Silent	SNP	C	C	A	rs200827106		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:2829813C>A	ENST00000397885.2	-	8	1019	c.813G>T	c.(811-813)ctG>ctT	p.L271L	KIAA0020_ENST00000469168.1_5'UTR	NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	271	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GCTCTTCCGTCAGCATGTTCC	0.443																																																	0													254.0	236.0	242.0					9																	2829813		2203	4300	6503	SO:0001819	synonymous_variant	0			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.813G>T	9.37:g.2829813C>A			A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Silent	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.L271	ENST00000397885.2	37	c.813	CCDS6448.2	9																																																																																			KIAA0020	-	superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	ENSG00000080608		0.443	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	-	0.00	56	0	C	NM_014878		2829813	-1	tier1	-	no_errors	ENST00000397885	ensembl	human	known	74_37	silent	11.43	62	8	SNP	0.990	A
KIAA0020	9933	genome.wustl.edu	37	9	2834111	2834111	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:2834111C>T	ENST00000397885.2	-	4	566	c.360G>A	c.(358-360)ctG>ctA	p.L120L		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	120						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		TGCTTTGCTTCAGTTCTTTCT	0.348																																																	0													118.0	117.0	117.0					9																	2834111		2203	4300	6503	SO:0001819	synonymous_variant	0			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.360G>A	9.37:g.2834111C>T			A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Silent	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.L120	ENST00000397885.2	37	c.360	CCDS6448.2	9																																																																																			KIAA0020	-	NULL	ENSG00000080608		0.348	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	-	0.00	65	0	C	NM_014878		2834111	-1	tier1	-	no_errors	ENST00000397885	ensembl	human	known	74_37	silent	18.75	52	12	SNP	0.988	T
KIAA0020	9933	genome.wustl.edu	37	9	2837324	2837324	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:2837324C>T	ENST00000397885.2	-	3	366	c.160G>A	c.(160-162)Gag>Aag	p.E54K		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	54						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		ATACTTTTCTCAAAGTTCCTA	0.368																																																	0													199.0	180.0	186.0					9																	2837324		1831	4094	5925	SO:0001583	missense	0			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.160G>A	9.37:g.2837324C>T	ENSP00000380982:p.Glu54Lys		A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.E54K	ENST00000397885.2	37	c.160	CCDS6448.2	9	.	.	.	.	.	.	.	.	.	.	C	12.70	2.017952	0.35606	.	.	ENSG00000080608	ENST00000397885	T	0.11604	2.76	4.56	2.68	0.31781	.	0.445750	0.23354	N	0.049098	T	0.06325	0.0163	L	0.27053	0.805	0.33260	D	0.559621	B	0.24258	0.1	B	0.21708	0.036	T	0.30090	-0.9990	10	0.08381	T	0.77	-19.8291	8.4386	0.32801	0.0:0.7626:0.1545:0.0829	.	54	Q15397	K0020_HUMAN	K	54	ENSP00000380982:E54K	ENSP00000380982:E54K	E	-	1	0	KIAA0020	2827324	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.748000	0.38308	0.631000	0.30412	0.655000	0.94253	GAG	KIAA0020	-	NULL	ENSG00000080608		0.368	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	-	0.00	76	0	C	NM_014878		2837324	-1	tier1	-	no_errors	ENST00000397885	ensembl	human	known	74_37	missense	22.97	57	17	SNP	1.000	T
KIAA1210	57481	genome.wustl.edu	37	X	118219376	118219376	+	Silent	SNP	G	G	T	rs371643117		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chrX:118219376G>T	ENST00000402510.2	-	12	4817	c.4818C>A	c.(4816-4818)gcC>gcA	p.A1606A		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	1606										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TCTCAGCATCGGCTCCAGCAT	0.453																																																	0													170.0	153.0	158.0					X																	118219376		1889	4110	5999	SO:0001819	synonymous_variant	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.4818C>A	X.37:g.118219376G>T			B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.A1606	ENST00000402510.2	37	c.4818	CCDS48156.1	X																																																																																			KIAA1210	-	NULL	ENSG00000250423		0.453	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	-	0.00	146	0	G	NM_020721		118219376	-1	tier1	-	no_errors	ENST00000402510	ensembl	human	known	74_37	silent	36.30	86	49	SNP	0.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113377482	113377482	+	Frame_Shift_Del	DEL	T	T	-	rs78597857		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:113377482delT	ENST00000478658.1	-	5	3064	c.3047delA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N1016fs|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTCTGAGGGTTTTTTTTTTT	0.363																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)											99.0	91.0	93.0					3																	113377482		1809	4067	5876	SO:0001589	frameshift_variant	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3047delA	3.37:g.113377482delT	ENSP00000420721:p.Asn1016fs		Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3047	CCDS43133.1	3																																																																																			KIAA2018	-	NULL	ENSG00000176542		0.363	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1		0.00	30	0	T	NM_001009899		113377482	-1	tier1		no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.827	-
LARS2	23395	genome.wustl.edu	37	3	45557698	45557698	+	Silent	SNP	G	G	A	rs189078355		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:45557698G>A	ENST00000415258.1	+	16	2115	c.1974G>A	c.(1972-1974)ggG>ggA	p.G658G	LARS2_ENST00000467936.1_3'UTR|LARS2_ENST00000265537.3_Silent_p.G658G|LARS2_ENST00000414984.1_Silent_p.G615G			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	658					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	AGCAGTATGGGATCGACACGA	0.478																																																	0													248.0	197.0	214.0					3																	45557698		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.1974G>A	3.37:g.45557698G>A				Silent	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Leu-tRNA-ligase_bac/mito,tigrfam_Leu-tRNA-ligase_bac/mito	p.G658	ENST00000415258.1	37	c.1974	CCDS2728.1	3																																																																																			LARS2	-	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,tigrfam_Leu-tRNA-ligase_bac/mito	ENSG00000011376		0.478	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	HGNC	protein_coding	OTTHUMT00000345001.1	-	0.00	63	0	G	NM_015340		45557698	+1	tier1	-	no_errors	ENST00000265537	ensembl	human	known	74_37	silent	48.72	20	19	SNP	0.494	A
LDLRAD3	143458	genome.wustl.edu	37	11	36119944	36119944	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:36119944C>T	ENST00000315571.5	+	4	408	c.387C>T	c.(385-387)agC>agT	p.S129S	LDLRAD3_ENST00000524419.1_Silent_p.S80S|LDLRAD3_ENST00000528989.1_Silent_p.S80S	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	129	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				TTGACAAGAGCTTCATCTGCG	0.478																																																	0													101.0	85.0	90.0					11																	36119944		2202	4298	6500	SO:0001819	synonymous_variant	0			AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.387C>T	11.37:g.36119944C>T			B7Z1U3|B9EG81|Q8NBJ0	Silent	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.S129	ENST00000315571.5	37	c.387	CCDS31462.1	11																																																																																			LDLRAD3	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	ENSG00000179241		0.478	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD3	HGNC	protein_coding	OTTHUMT00000389085.1	-	0.00	47	0	C	NM_174902		36119944	+1	tier1	-	no_errors	ENST00000315571	ensembl	human	known	74_37	silent	6.45	58	4	SNP	1.000	T
LIN7A	8825	genome.wustl.edu	37	12	81205437	81205437	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr12:81205437T>G	ENST00000552864.1	-	5	711	c.509A>C	c.(508-510)aAa>aCa	p.K170T		NM_004664.2	NP_004655.1	O14910	LIN7A_HUMAN	lin-7 homolog A (C. elegans)	170	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				exocytosis (GO:0006887)|inner ear development (GO:0048839)|neurotransmitter secretion (GO:0007269)|protein complex assembly (GO:0006461)|protein transport (GO:0015031)|synaptic vesicle transport (GO:0048489)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	L27 domain binding (GO:0097016)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(2)	15						TTCCACAGCTTTCTCATGGTG	0.433																																																	0													126.0	109.0	115.0					12																	81205437		2203	4300	6503	SO:0001583	missense	0			AF028826	CCDS9021.1	12q21.31	2014-09-04			ENSG00000111052	ENSG00000111052			17787	protein-coding gene	gene with protein product	"""mammalian LIN-7 1"""	603380				10341223, 17237226	Standard	NM_004664		Approved	MALS-1, TIP-33, LIN-7A, VELI1	uc001szj.1	O14910	OTTHUMG00000170168	ENST00000552864.1:c.509A>C	12.37:g.81205437T>G	ENSP00000447488:p.Lys170Thr		A4FTY3|Q147W1|Q6LES3|Q7LDS4	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_C,superfamily_PDZ,smart_L27,smart_PDZ,pirsf_Lin-7_homologue,pfscan_L27,pfscan_PDZ	p.K170T	ENST00000552864.1	37	c.509	CCDS9021.1	12	.	.	.	.	.	.	.	.	.	.	T	17.53	3.412039	0.62511	.	.	ENSG00000111052	ENST00000552864	T	0.53206	0.63	5.13	3.99	0.46301	PDZ/DHR/GLGF (4);	0.178640	0.56097	D	0.000026	T	0.45637	0.1352	N	0.11698	0.16	0.80722	D	1	D	0.60575	0.988	P	0.62560	0.904	T	0.50311	-0.8843	10	0.87932	D	0	-15.7176	10.5411	0.45033	0.0:0.0759:0.0:0.9241	.	170	O14910	LIN7A_HUMAN	T	170	ENSP00000447488:K170T	ENSP00000447488:K170T	K	-	2	0	LIN7A	79729568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.257000	0.58816	0.817000	0.34445	0.482000	0.46254	AAA	LIN7A	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Lin-7_homologue,pfscan_PDZ	ENSG00000111052		0.433	LIN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN7A	HGNC	protein_coding	OTTHUMT00000407760.1	-	0.00	46	0	T			81205437	-1	tier1	-	no_errors	ENST00000552864	ensembl	human	known	74_37	missense	43.33	34	26	SNP	1.000	G
SMG1P7	100506060	genome.wustl.edu	37	16	70265027	70265027	+	RNA	SNP	G	G	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr16:70265027G>C	ENST00000459379.1	-	0	104																											GTCCTGACAAGTTTGGCAACT	0.453																																																	0																																												0																															16.37:g.70265027G>C				RNA	SNP	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.453	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	Clone_based_vega_gene	snoRNA		-	0.00	165	0	G			70265027	-1	tier1	-	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	50.00	94	94	SNP	1.000	C
LY75	4065	genome.wustl.edu	37	2	160664960	160664960	+	Splice_Site	SNP	C	C	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:160664960C>G	ENST00000263636.4	-	33	4849	c.4822G>C	c.(4822-4824)Gac>Cac	p.D1608H	LY75_ENST00000554112.1_Splice_Site_p.D1608H|LY75_ENST00000553424.1_Splice_Site_p.D1608H|LY75-CD302_ENST00000504764.1_Splice_Site_p.D1608H|LY75-CD302_ENST00000505052.1_Splice_Site_p.D1608H	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1608	C-type lectin 10. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		TTTCACTTACCAACAGAATGT	0.338																																																	0													182.0	178.0	179.0					2																	160664960		2202	4299	6501	SO:0001630	splice_region_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.4822+1G>C	2.37:g.160664960C>G			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.D1608H	ENST00000263636.4	37	c.4822	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661052	0.47572	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04	5.55	3.77	0.43336	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.35838	U	0.002948	T	0.22437	0.0541	M	0.63428	1.95	0.30539	N	0.766632	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.993;0.988;0.999	T	0.03576	-1.1023	9	.	.	.	-8.5543	9.2257	0.37405	0.0:0.7763:0.0:0.2237	.	1608;1608;1608	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	H	1608	ENSP00000451511:D1608H;ENSP00000451446:D1608H;ENSP00000263636:D1608H;ENSP00000423463:D1608H;ENSP00000421035:D1608H	.	D	-	1	0	LY75;LY75-CD302	160373206	0.762000	0.28451	0.660000	0.29694	0.545000	0.35147	1.192000	0.32150	0.715000	0.32103	0.491000	0.48974	GAC	LY75	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000054219		0.338	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	-	0.00	47	0	C		Missense_Mutation	160664960	-1	tier1	-	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	31.88	47	22	SNP	0.852	G
MEI4	101928601	genome.wustl.edu	37	6	78471096	78471096	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr6:78471096A>G	ENST00000602452.2	+	2	496	c.482A>G	c.(481-483)aAg>aGg	p.K161R		NM_001282136.1	NP_001269065.1	A8MW99	MEI4L_HUMAN	meiosis-specific 4 homolog (S. cerevisiae)	161					DNA recombination (GO:0006310)|meiotic DNA double-strand break formation (GO:0042138)|oogenesis (GO:0048477)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	lateral element (GO:0000800)											CTTGAATTAAAGAACTTGACA	0.388																																																	0																																										SO:0001583	missense	0				CCDS64463.1	6q14.1	2014-08-13			ENSG00000269964	ENSG00000269964			43638	protein-coding gene	gene with protein product						20551173	Standard	XM_005248773		Approved			A8MW99	OTTHUMG00000153472	ENST00000602452.2:c.482A>G	6.37:g.78471096A>G	ENSP00000473370:p.Lys161Arg		R4GMV8	Missense_Mutation	SNP	NULL	p.K161R	ENST00000602452.2	37	c.482		6																																																																																			MEI4	-	NULL	ENSG00000269964		0.388	MEI4-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	MEI4	HGNC	protein_coding	OTTHUMT00000331298.2	-	0.00	34	0	A			78471096	+1	tier1	-	no_errors	ENST00000602452	ensembl	human	novel	74_37	missense	12.90	27	4	SNP	1.000	G
MIB1	57534	genome.wustl.edu	37	18	19429195	19429195	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr18:19429195A>T	ENST00000261537.6	+	17	2696	c.2432A>T	c.(2431-2433)aAt>aTt	p.N811I	MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	811					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			ATGATTAGTAATGATTCTGAA	0.338																																																	0													197.0	198.0	198.0					18																	19429195		2203	4300	6503	SO:0001583	missense	0			AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.2432A>T	18.37:g.19429195A>T	ENSP00000261537:p.Asn811Ile		B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Mib_Herc2,pfam_Znf_ZZ,superfamily_Ankyrin_rpt-contain_dom,smart_Znf_ZZ,smart_Ankyrin_rpt,smart_Znf_RING,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_RING,pfscan_Znf_ZZ,prints_Ankyrin_rpt	p.N811I	ENST00000261537.6	37	c.2432	CCDS11871.1	18	.	.	.	.	.	.	.	.	.	.	A	16.30	3.083135	0.55861	.	.	ENSG00000101752	ENST00000261537	T	0.37915	1.17	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000001	T	0.37732	0.1014	N	0.08118	0	0.80722	D	1	D	0.57571	0.98	D	0.64321	0.924	T	0.41698	-0.9494	10	0.38643	T	0.18	-24.6781	15.3214	0.74124	1.0:0.0:0.0:0.0	.	811	Q86YT6	MIB1_HUMAN	I	811	ENSP00000261537:N811I	ENSP00000261537:N811I	N	+	2	0	MIB1	17683193	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.019000	0.59389	0.477000	0.44152	AAT	MIB1	-	NULL	ENSG00000101752		0.338	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIB1	HGNC	protein_coding	OTTHUMT00000254675.1	-	0.00	29	0	A	NM_020774		19429195	+1	tier1	-	no_errors	ENST00000261537	ensembl	human	known	74_37	missense	28.89	32	13	SNP	1.000	T
MICAL3	57553	genome.wustl.edu	37	22	18383650	18383650	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr22:18383650T>C	ENST00000441493.2	-	6	1157	c.805A>G	c.(805-807)Ata>Gta	p.I269V	MICAL3_ENST00000414725.2_Missense_Mutation_p.I269V|MICAL3_ENST00000207726.7_Missense_Mutation_p.I269V|MICAL3_ENST00000444520.1_Missense_Mutation_p.I269V|MICAL3_ENST00000383094.3_Missense_Mutation_p.I269V|MICAL3_ENST00000400561.2_Missense_Mutation_p.I269V|MICAL3_ENST00000585038.1_Missense_Mutation_p.I269V|MICAL3_ENST00000429452.1_Missense_Mutation_p.I269V	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	269	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TGGTTGAATATAAAAGCCACA	0.448																																																	0													101.0	91.0	94.0					22																	18383650		1568	3582	5150	SO:0001583	missense	0			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.805A>G	22.37:g.18383650T>C	ENSP00000416015:p.Ile269Val		B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.I269V	ENST00000441493.2	37	c.805	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	T	17.85	3.489609	0.64074	.	.	ENSG00000093100;ENSG00000093100;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156;ENSG00000243156	ENST00000441493;ENST00000429452;ENST00000400561;ENST00000444520;ENST00000414725;ENST00000383094;ENST00000207726	T;T;T;T;T;T;T	0.06933	3.24;3.24;3.24;3.24;3.24;3.24;3.24	5.11	5.11	0.69529	.	0.042318	0.85682	D	0.000000	T	0.23572	0.0570	M	0.91561	3.22	0.58432	D	0.999992	B;B;B;B;B	0.28208	0.203;0.074;0.072;0.139;0.142	B;B;B;B;B	0.36378	0.054;0.223;0.155;0.108;0.034	T	0.05920	-1.0856	10	0.87932	D	0	.	14.9199	0.70829	0.0:0.0:0.0:1.0	.	269;269;269;269;269	B4DJ91;B2RXJ5;Q7RTP6-2;Q7RTP6-4;Q7RTP6	.;.;.;.;MICA3_HUMAN	V	269	ENSP00000416015:I269V;ENSP00000414846:I269V;ENSP00000383406:I269V;ENSP00000410315:I269V;ENSP00000391827:I269V;ENSP00000372574:I269V;ENSP00000207726:I269V	ENSP00000207726:I269V	I	-	1	0	XXbac-B461K10.4;MICAL3	16763650	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.036000	0.88901	1.929000	0.55896	0.377000	0.23210	ATA	MICAL3	-	NULL	ENSG00000243156		0.448	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	-	0.00	65	0	T			18383650	-1	tier1	-	no_errors	ENST00000441493	ensembl	human	known	74_37	missense	24.29	53	17	SNP	1.000	C
MEST	4232	genome.wustl.edu	37	7	130135898	130135898	+	Intron	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr7:130135898G>T	ENST00000223215.4	+	2	402				MEST_ENST00000416162.2_Intron|hsa-mir-335_ENST00000604666.1_RNA|MIR335_ENST00000362173.1_RNA|MEST_ENST00000437945.1_Intron|MEST_ENST00000378576.4_Intron|MEST_ENST00000341441.5_Intron|MEST_ENST00000393187.1_Intron	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript						mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					ggagataggtgccattaacct	0.353																																					Colon(126;2182 2305 6517 35181)												0													47.0	46.0	47.0					7																	130135898		692	1591	2283	SO:0001627	intron_variant	0				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.181+535G>T	7.37:g.130135898G>T			B2R6S1|O14973|O15007|Q6AI49|Q92571	RNA	SNP	-	NULL	ENST00000223215.4	37	NULL	CCDS5822.1	7																																																																																			hsa-mir-335	-	-	ENSG00000270823		0.353	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR335	miRBase	protein_coding	OTTHUMT00000345183.2	-	0.00	23	0	G	NM_002402		130135898	-1	tier1	-	no_errors	ENST00000604666	ensembl	human	known	74_37	rna	23.81	16	5	SNP	0.182	T
RNPS1	10921	genome.wustl.edu	37	16	2320736	2320736	+	5'Flank	SNP	T	T	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr16:2320736T>A	ENST00000320225.5	-	0	0				RNPS1_ENST00000561718.1_5'Flank|RNPS1_ENST00000569598.2_5'Flank|RNPS1_ENST00000568631.1_5'Flank|RNPS1_ENST00000566458.1_5'Flank|RNPS1_ENST00000567147.1_5'Flank|MIR3677_ENST00000578964.1_RNA|RNPS1_ENST00000301730.8_5'Flank|MIR940_ENST00000401276.1_lincRNA|AC009065.2_ENST00000384982.1_RNA|RNPS1_ENST00000397086.2_5'Flank	NM_080594.2	NP_542161.1	Q15287	RNPS1_HUMAN	RNA binding protein S1, serine-rich domain						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(4)|ovary(2)|urinary_tract(1)	9						AGCCCTGCAGTGCTGGGCATG	0.662																																																	0																																										SO:0001631	upstream_gene_variant	0			AF015608	CCDS10465.1, CCDS66907.1, CCDS73811.1	16p13.3	2013-02-12	2001-11-28		ENSG00000205937	ENSG00000205937		"""RNA binding motif (RRM) containing"""	10080	protein-coding gene	gene with protein product		606447	"""RNA-binding protein S1, serine-rich domain"""			9580558, 8543184	Standard	XM_005255048		Approved		uc002cpu.3	Q15287	OTTHUMG00000128828		16.37:g.2320736T>A	Exception_encountered		A8K1P0|B4DDU8|B4DZU7|B7ZA17|O75308|Q32P25|Q8WY42|Q9NYG3	RNA	SNP	-	NULL	ENST00000320225.5	37	NULL	CCDS10465.1	16																																																																																			MIR3677	-	-	ENSG00000266643		0.662	RNPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3677	HGNC	protein_coding	OTTHUMT00000250766.2	-	0.00	30	0	T	NM_080594		2320736	+1	tier1	-	no_errors	ENST00000578964	ensembl	human	known	74_37	rna	18.75	39	9	SNP	0.000	A
MTA2	9219	genome.wustl.edu	37	11	62362771	62362771	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:62362771T>C	ENST00000278823.2	-	14	1837	c.1448A>G	c.(1447-1449)tAt>tGt	p.Y483C	MTA2_ENST00000527204.1_Missense_Mutation_p.Y310C|MTA2_ENST00000524902.1_Missense_Mutation_p.Y310C	NM_004739.3	NP_004730.2	O94776	MTA2_HUMAN	metastasis associated 1 family, member 2	483					ATP-dependent chromatin remodeling (GO:0043044)|chromatin assembly or disassembly (GO:0006333)|DNA methylation (GO:0006306)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	histone deacetylase complex (GO:0000118)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|histone deacetylase activity (GO:0004407)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	26						GATAGGAGCATAAGGCCGTCG	0.552																																																	0													98.0	97.0	97.0					11																	62362771		2202	4299	6501	SO:0001583	missense	0			AB016591	CCDS8022.1	11q12-q13.1	2013-01-25	2004-12-15	2003-12-17	ENSG00000149480	ENSG00000149480		"""GATA zinc finger domain containing"""	7411	protein-coding gene	gene with protein product		603947	"""metastasis associated gene family, member 2"""	MTA1L1		9929979	Standard	NM_004739		Approved	MTA1-L1	uc001ntq.2	O94776	OTTHUMG00000167684	ENST00000278823.2:c.1448A>G	11.37:g.62362771T>C	ENSP00000278823:p.Tyr483Cys		Q68DB1|Q9UQB5	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.Y483C	ENST00000278823.2	37	c.1448	CCDS8022.1	11	.	.	.	.	.	.	.	.	.	.	T	16.42	3.118423	0.56505	.	.	ENSG00000149480	ENST00000278823;ENST00000524902;ENST00000527204	T;T;T	0.47177	1.44;0.85;0.85	5.34	5.34	0.76211	.	0.120439	0.64402	D	0.000018	T	0.61211	0.2329	M	0.68593	2.085	0.58432	D	0.999999	D	0.76494	0.999	P	0.58454	0.839	T	0.63287	-0.6671	10	0.48119	T	0.1	-11.598	13.2657	0.60133	0.0:0.0:0.0:1.0	.	483	O94776	MTA2_HUMAN	C	483;310;310	ENSP00000278823:Y483C;ENSP00000431346:Y310C;ENSP00000431797:Y310C	ENSP00000278823:Y483C	Y	-	2	0	MTA2	62119347	1.000000	0.71417	0.195000	0.23364	0.956000	0.61745	4.622000	0.61240	2.020000	0.59435	0.533000	0.62120	TAT	MTA2	-	NULL	ENSG00000149480		0.552	MTA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTA2	HGNC	protein_coding	OTTHUMT00000395578.1	-	0.00	39	0	T	NM_004739		62362771	-1	tier1	-	no_errors	ENST00000278823	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.999	C
MTUS2	23281	genome.wustl.edu	37	13	29675026	29675026	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr13:29675026G>A	ENST00000431530.3	+	3	2651	c.2593G>A	c.(2593-2595)Gtc>Atc	p.V865I		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	855	Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.|Sufficient for interaction with KIF2C.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ATTTGGCTTTGTCCGGAGCTC	0.617																																																	0													9.0	10.0	10.0					13																	29675026		2017	4170	6187	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2593G>A	13.37:g.29675026G>A	ENSP00000392057:p.Val865Ile		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.V865I	ENST00000431530.3	37	c.2593	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349399	0.61183	.	.	ENSG00000132938	ENST00000431530	T	0.23552	1.9	5.66	4.82	0.62117	.	0.089050	0.42682	D	0.000672	T	0.31949	0.0813	M	0.70275	2.135	0.80722	D	1	P	0.41524	0.753	B	0.41174	0.349	T	0.08700	-1.0709	9	.	.	.	.	13.625	0.62159	0.0745:0.0:0.9255:0.0	.	855	Q5JR59	MTUS2_HUMAN	I	865	ENSP00000392057:V865I	.	V	+	1	0	MTUS2	28573026	1.000000	0.71417	0.953000	0.39169	0.265000	0.26407	5.897000	0.69831	1.389000	0.46526	0.563000	0.77884	GTC	MTUS2	-	NULL	ENSG00000132938		0.617	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	-	0.00	92	0	G	XM_166270		29675026	+1	tier1	-	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	15.15	56	10	SNP	1.000	A
MUC4	4585	genome.wustl.edu	37	3	195506482	195506482	+	Missense_Mutation	SNP	G	G	T	rs113936020	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:195506482G>T	ENST00000463781.3	-	2	12428	c.11969C>A	c.(11968-11970)aCt>aAt	p.T3990N	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3990N|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TACTGAGGAAGTGTCGGTGAC	0.592																																																	0													10.0	7.0	8.0					3																	195506482		623	1357	1980	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11969C>A	3.37:g.195506482G>T	ENSP00000417498:p.Thr3990Asn		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T3990N	ENST00000463781.3	37	c.11969	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	0.405	-0.916416	0.02415	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34275	1.37;1.46	0.481	0.481	0.16809	.	0.562686	0.09843	U	0.748557	T	0.35913	0.0948	N	0.14661	0.345	0.09310	N	1	D	0.57257	0.979	D	0.68192	0.956	T	0.29852	-0.9998	9	.	.	.	.	6.8687	0.24108	1.0E-4:0.0:0.9999:0.0	.	3862	E7ESK3	.	N	3990	ENSP00000417498:T3990N;ENSP00000420243:T3990N	.	T	-	2	0	MUC4	196991261	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.001000	0.12947	0.537000	0.28751	0.064000	0.15345	ACT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	28	0	G	NM_018406		195506482	-1	tier1	rs113936020	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	13.04	60	9	SNP	0.003	T
MUC4	4585	genome.wustl.edu	37	3	195513156	195513156	+	Silent	SNP	G	G	A	rs573701105		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:195513156G>A	ENST00000463781.3	-	2	5754	c.5295C>T	c.(5293-5295)gaC>gaT	p.D1765D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.D1765D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGTGTCGGTGACAG	0.582													.|||	1	0.000199681	0.0	0.0	5008	,	,		31518	0.0		0.0	False		,,,				2504	0.001																0													61.0	56.0	57.0					3																	195513156		692	1591	2283	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5295C>T	3.37:g.195513156G>A			O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D1765	ENST00000463781.3	37	c.5295	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	281	0	G	NM_018406		195513156	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	8.79	631	61	SNP	0.050	A
NBEA	26960	genome.wustl.edu	37	13	35632959	35632959	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr13:35632959G>A	ENST00000400445.3	+	8	1732	c.1198G>A	c.(1198-1200)Gca>Aca	p.A400T	NBEA_ENST00000379939.2_Missense_Mutation_p.A400T|NBEA_ENST00000310336.4_Missense_Mutation_p.A400T|NBEA_ENST00000540320.1_Missense_Mutation_p.A400T	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	400					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		ACTCAACCCAGCACAGATATT	0.378																																																	0													36.0	33.0	34.0					13																	35632959		1811	4070	5881	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1198G>A	13.37:g.35632959G>A	ENSP00000383295:p.Ala400Thr		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.A400T	ENST00000400445.3	37	c.1198	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	24.6	4.551989	0.86127	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.83138	0.5189	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78560	-0.2157	10	0.21014	T	0.42	.	19.161	0.93531	0.0:0.0:1.0:0.0	.	400	Q5T321	.	T	400	ENSP00000440951:A400T;ENSP00000383295:A400T;ENSP00000369271:A400T;ENSP00000308534:A400T	ENSP00000308534:A400T	A	+	1	0	NBEA	34530959	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.731000	0.84895	2.613000	0.88420	0.650000	0.86243	GCA	NBEA	-	NULL	ENSG00000172915		0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	62	0	G	NM_015678		35632959	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
NCAN	1463	genome.wustl.edu	37	19	19330103	19330103	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr19:19330103C>A	ENST00000252575.6	+	3	552	c.453C>A	c.(451-453)gaC>gaA	p.D151E		NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	151	Ig-like V-type.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	ATGAGCAGGACCTGGTGCCCT	0.682																																																	0													23.0	18.0	20.0					19																	19330103		2189	4291	6480	SO:0001583	missense	0			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.453C>A	19.37:g.19330103C>A	ENSP00000252575:p.Asp151Glu		Q9UPK6	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link,prints_AntifreezeII	p.D151E	ENST00000252575.6	37	c.453	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	C	19.06	3.754265	0.69648	.	.	ENSG00000130287	ENST00000539499;ENST00000252575	T	0.10573	2.86	4.07	2.93	0.34026	C-type lectin fold (1);Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.169369	0.28290	N	0.015898	T	0.23492	0.0568	M	0.84326	2.69	0.80722	D	1	P	0.51240	0.943	P	0.54431	0.752	T	0.01084	-1.1457	10	0.66056	D	0.02	.	5.6009	0.17353	0.0:0.7229:0.0:0.2771	.	151	O14594	NCAN_HUMAN	E	165;151	ENSP00000252575:D151E	ENSP00000252575:D151E	D	+	3	2	NCAN	19191103	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.844000	0.39269	0.828000	0.34709	0.491000	0.48974	GAC	NCAN	-	superfamily_C-type_lectin_fold,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000130287		0.682	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	HGNC	protein_coding	OTTHUMT00000460111.2	-	0.00	44	0	C	NM_004386		19330103	+1	tier1	-	no_errors	ENST00000252575	ensembl	human	known	74_37	missense	14.00	43	7	SNP	1.000	A
NLRP14	338323	genome.wustl.edu	37	11	7064670	7064670	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:7064670G>T	ENST00000299481.4	+	4	1759	c.1413G>T	c.(1411-1413)gaG>gaT	p.E471D		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	471	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		AGGACGCAGAGTATGAAAACT	0.408																																																	0													97.0	101.0	100.0					11																	7064670		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.1413G>T	11.37:g.7064670G>T	ENSP00000299481:p.Glu471Asp		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E471D	ENST00000299481.4	37	c.1413	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.792367	0.00623	.	.	ENSG00000158077	ENST00000299481	D	0.88741	-2.42	4.21	-2.92	0.05615	.	0.280833	0.25619	N	0.029433	T	0.74489	0.3723	N	0.25992	0.78	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.58668	-0.7596	10	0.20046	T	0.44	.	4.4415	0.11577	0.3981:0.3118:0.2901:0.0	.	471	Q86W24	NAL14_HUMAN	D	471	ENSP00000299481:E471D	ENSP00000299481:E471D	E	+	3	2	NLRP14	7021246	0.000000	0.05858	0.041000	0.18516	0.143000	0.21401	-1.570000	0.02140	-0.326000	0.08564	-0.244000	0.11960	GAG	NLRP14	-	NULL	ENSG00000158077		0.408	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1		0.00	21	0	G	NM_176822		7064670	+1			no_errors	ENST00000299481	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.004	T
OLA1	29789	genome.wustl.edu	37	2	174940204	174940204	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:174940204C>T	ENST00000409546.1	-	11	1831	c.1201G>A	c.(1201-1203)Gat>Aat	p.D401N	OLA1_ENST00000392560.2_5'UTR|OLA1_ENST00000428402.2_Silent_p.E260E|OLA1_ENST00000284719.3_Missense_Mutation_p.D381N|OLA1_ENST00000344357.5_Missense_Mutation_p.D223N					Obg-like ATPase 1											breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	11						AAGATAATATCTCCATCTTCA	0.318																																																	0													74.0	71.0	72.0					2																	174940204		2201	4293	6494	SO:0001583	missense	0				CCDS2255.1, CCDS42779.1	2q31.1	2014-06-24	2007-07-27	2007-07-27	ENSG00000138430	ENSG00000138430			28833	protein-coding gene	gene with protein product		611175	"""GTP-binding protein 9 (putative)"""	GTPBP9		17430889, 24486488	Standard	NM_013341		Approved	PTD004	uc002uih.3	Q9NTK5	OTTHUMG00000132335	ENST00000409546.1:c.1201G>A	2.37:g.174940204C>T	ENSP00000386350:p.Asp401Asn			Missense_Mutation	SNP	pfam_DUF933,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,superfamily_P-loop_NTPase,superfamily_TGS-like,pirsf_CHP00092,prints_GTP_binding_domain,tigrfam_CHP00092	p.D381N	ENST00000409546.1	37	c.1141		2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733201	0.89482	.	.	ENSG00000138430	ENST00000284719;ENST00000344357;ENST00000409546	T;T	0.65364	-0.09;-0.15	5.87	5.87	0.94306	Domain of unknown function DUF933 (1);TGS-like (1);Beta-grasp fold, ferredoxin-type (1);	0.000000	0.85682	D	0.000000	D	0.89455	0.6720	H	0.99545	4.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.993	D	0.93503	0.6846	10	0.87932	D	0	.	20.1991	0.98252	0.0:1.0:0.0:0.0	.	381;223;381	D7EHM2;Q9NTK5-2;Q9NTK5	.;.;OLA1_HUMAN	N	381;223;401	ENSP00000284719:D381N;ENSP00000386350:D401N	ENSP00000284719:D381N	D	-	1	0	OLA1	174648450	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.629000	0.83207	2.775000	0.95449	0.650000	0.86243	GAT	OLA1	-	pfam_DUF933,superfamily_TGS-like,pirsf_CHP00092,tigrfam_CHP00092	ENSG00000138430		0.318	OLA1-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	OLA1	HGNC	protein_coding	OTTHUMT00000333877.1	-	0.00	80	0	C	NM_013341		174940204	-1	tier1	-	no_errors	ENST00000284719	ensembl	human	known	74_37	missense	44.07	66	52	SNP	1.000	T
OR11L1	391189	genome.wustl.edu	37	1	248005147	248005147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:248005147G>A	ENST00000355784.2	-	1	107	c.52C>T	c.(52-54)Cag>Tag	p.Q18*		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	18						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			AGAAGGTTCTGGAATCCTAAC	0.483																																																	0													67.0	61.0	63.0					1																	248005147		2202	4299	6501	SO:0001587	stop_gained	0			AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.52C>T	1.37:g.248005147G>A	ENSP00000348033:p.Gln18*			Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.Q18*	ENST00000355784.2	37	c.52	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.143702	0.77888	.	.	ENSG00000197591	ENST00000355784	.	.	.	4.22	4.22	0.49857	.	0.238254	0.21524	U	0.073161	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	3.3413	0.07119	0.095:0.1711:0.5569:0.177	.	.	.	.	X	18	.	ENSP00000348033:Q18X	Q	-	1	0	OR11L1	246071770	0.000000	0.05858	0.949000	0.38748	0.878000	0.50629	-0.096000	0.11059	2.339000	0.79563	0.536000	0.68110	CAG	OR11L1	-	NULL	ENSG00000197591		0.483	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	-	0.00	12	0	G	NM_001001959		248005147	-1	tier1	-	no_errors	ENST00000355784	ensembl	human	known	74_37	nonsense	40.62	19	13	SNP	0.045	A
OR2AG2	338755	genome.wustl.edu	37	11	6789646	6789646	+	Silent	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:6789646G>A	ENST00000338569.2	-	1	640	c.543C>T	c.(541-543)atC>atT	p.I181I		NM_001004490.1	NP_001004490.1	A6NM03	O2AG2_HUMAN	olfactory receptor, family 2, subfamily AG, member 2	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(13)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	28		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GCAAGGGTGGGATCTCACAGA	0.498																																																	0													115.0	97.0	103.0					11																	6789646		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065539	CCDS31413.1	11p15.4	2012-08-09		2004-03-10	ENSG00000188124	ENSG00000188124		"""GPCR / Class A : Olfactory receptors"""	15143	protein-coding gene	gene with protein product				OR2AG2P			Standard	NM_001004490		Approved		uc001meq.1	A6NM03	OTTHUMG00000165868	ENST00000338569.2:c.543C>T	11.37:g.6789646G>A				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I181	ENST00000338569.2	37	c.543	CCDS31413.1	11																																																																																			OR2AG2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000188124		0.498	OR2AG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG2	HGNC	protein_coding	OTTHUMT00000386775.1	-	0.00	41	0	G	NM_001004490		6789646	-1	tier1	-	no_errors	ENST00000338569	ensembl	human	known	74_37	silent	42.86	44	33	SNP	0.555	A
OR4C46	119749	genome.wustl.edu	37	11	51515594	51515594	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:51515594T>C	ENST00000328188.1	+	1	313	c.313T>C	c.(313-315)Ttc>Ctc	p.F105L		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						AGAACATTTCTTCGGAGGTGC	0.458																																																	0													139.0	133.0	135.0					11																	51515594		2201	4296	6497	SO:0001583	missense	0				CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.313T>C	11.37:g.51515594T>C	ENSP00000329056:p.Phe105Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F105L	ENST00000328188.1	37	c.313	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	2.507	-0.313781	0.05422	.	.	ENSG00000185926	ENST00000328188	T	0.00966	5.49	2.63	1.5	0.22942	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000261	T	0.00784	0.0026	N	0.25332	0.735	0.09310	N	1	B	0.20887	0.049	B	0.20955	0.032	T	0.48490	-0.9031	10	0.48119	T	0.1	.	5.6752	0.17745	0.0:0.1514:0.0:0.8486	.	105	A6NHA9	O4C46_HUMAN	L	105	ENSP00000329056:F105L	ENSP00000329056:F105L	F	+	1	0	OR4C46	51372170	0.000000	0.05858	0.475000	0.27278	0.025000	0.11179	-0.325000	0.07976	1.239000	0.43787	0.113000	0.15668	TTC	OR4C46	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000185926		0.458	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	HGNC	protein_coding	OTTHUMT00000391155.1	-	0.00	106	0	T	NM_001004703		51515594	+1	tier1	-	no_errors	ENST00000328188	ensembl	human	known	74_37	missense	25.00	84	28	SNP	0.005	C
PCCA	5095	genome.wustl.edu	37	13	100953829	100953829	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr13:100953829G>T	ENST00000376285.1	+	13	1219	c.1181G>T	c.(1180-1182)tGg>tTg	p.W394L	PCCA_ENST00000376286.4_Missense_Mutation_p.W368L|PCCA_ENST00000376279.3_Missense_Mutation_p.W394L	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	394	Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	ATCAACGGCTGGGCAGTTGAA	0.483																																																	0													163.0	152.0	156.0					13																	100953829		2203	4300	6503	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.1181G>T	13.37:g.100953829G>T	ENSP00000365462:p.Trp394Leu		B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.W394L	ENST00000376285.1	37	c.1181	CCDS9496.2	13	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637056	0.87760	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.86562	-2.14;-2.14;-2.14	5.86	5.86	0.93980	Rudiment single hybrid motif (1);ATP-grasp fold, subdomain 2 (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.95443	0.8520	M	0.92555	3.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.995;0.987;0.98	D	0.95430	0.8515	10	0.72032	D	0.01	-18.6941	20.5632	0.99335	0.0:0.0:1.0:0.0	.	394;368;394	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	L	368;394;394	ENSP00000365463:W368L;ENSP00000365456:W394L;ENSP00000365462:W394L	ENSP00000365456:W394L	W	+	2	0	PCCA	99751830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.521000	0.98029	2.937000	0.99478	0.650000	0.86243	TGG	PCCA	-	superfamily_Rudment_hybrid_motif,pfscan_Biotin_carboxylation_dom	ENSG00000175198		0.483	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2		0.00	53	0	G			100953829	+1			no_errors	ENST00000376285	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
PCDHA9	9752	genome.wustl.edu	37	5	140230070	140230070	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr5:140230070delA	ENST00000532602.1	+	1	3023	c.1990delA	c.(1990-1992)actfs	p.T664fs	PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000378122.3_Frame_Shift_Del_p.T664fs|PCDHA5_ENST00000529619.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	664	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCACGGCCACTGTGCTGGT	0.682																																					Melanoma(55;1800 1972 14909)												0													44.0	47.0	46.0					5																	140230070		2197	4265	6462	SO:0001589	frameshift_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1990delA	5.37:g.140230070delA	ENSP00000436042:p.Thr664fs		O15053|Q2M3S5	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.T664fs	ENST00000532602.1	37	c.1990	CCDS54920.1	5																																																																																			PCDHA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204961		0.682	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2		0.00	47	0	A	NM_031857		140230070	+1	tier1		no_errors	ENST00000532602	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	0.998	-
PDE4D	5144	genome.wustl.edu	37	5	58571194	58571194	+	Intron	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr5:58571194G>T	ENST00000340635.6	-	2	631				PDE4D_ENST00000360047.5_Intron|PDE4D_ENST00000546160.1_Intron|PDE4D_ENST00000503258.1_Missense_Mutation_p.T12K|PDE4D_ENST00000502575.1_Intron|PDE4D_ENST00000405755.2_Intron|PDE4D_ENST00000507116.1_Intron|PDE4D_ENST00000502484.2_Intron	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific						adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	TAGGGAACTTGTAGATCGGGA	0.338																																																	0													100.0	97.0	98.0					5																	58571194		876	1991	2867	SO:0001627	intron_variant	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.456-59400C>A	5.37:g.58571194G>T			O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.T12K	ENST00000340635.6	37	c.35	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	G	6.505	0.461310	0.12342	.	.	ENSG00000113448	ENST00000503258	T	0.63913	-0.07	5.38	5.38	0.77491	.	.	.	.	.	T	0.69124	0.3076	.	.	.	0.80722	D	1	D	0.61080	0.989	D	0.72625	0.978	T	0.59731	-0.7399	8	0.05525	T	0.97	.	19.3311	0.94288	0.0:0.0:1.0:0.0	.	12	Q08499-10	.	K	12	ENSP00000425605:T12K	ENSP00000425605:T12K	T	-	2	0	PDE4D	58606951	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.593000	0.74100	2.813000	0.96785	0.655000	0.94253	ACA	PDE4D	-	NULL	ENSG00000113448		0.338	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	-	0.00	35	0	G			58571194	-1	tier1	-	no_errors	ENST00000503258	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	T
PGF	5228	genome.wustl.edu	37	14	75413456	75413456	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr14:75413456G>T	ENST00000405431.2	-	5	587	c.588C>A	c.(586-588)aaC>aaA	p.N196K	PGF_ENST00000238607.6_Intron|PGF_ENST00000553716.1_Intron|PGF_ENST00000555567.1_Intron			P49763	PLGF_HUMAN	placental growth factor	196	Heparin-binding. {ECO:0000305}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	gcttttttccgttccttcCAG	0.517											OREG0022810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(127;389 2301 5452 48547)												0													6.0	5.0	5.0					14																	75413456		841	1930	2771	SO:0001583	missense	0			S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.588C>A	14.37:g.75413456G>T	ENSP00000385365:p.Asn196Lys	1160	Q07101|Q9BV78|Q9Y6S8	Missense_Mutation	SNP	pfam_PDGF/VEGF_dom,smart_PDGF/VEGF_dom,pfscan_PDGF/VEGF_dom	p.N196K	ENST00000405431.2	37	c.588	CCDS9835.1	14	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.433467	0.01108	.	.	ENSG00000119630	ENST00000405431	.	.	.	3.15	-5.05	0.02955	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46679	-0.9174	5	0.87932	D	0	.	5.9215	0.19084	0.0:0.2108:0.4101:0.3791	.	.	.	.	K	196	.	ENSP00000385365:N196K	N	-	3	2	PGF	74483209	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-0.978000	0.03778	-1.403000	0.02053	-0.228000	0.12330	AAC	PGF	-	NULL	ENSG00000119630		0.517	PGF-008	KNOWN	basic|CCDS	protein_coding	PGF	HGNC	protein_coding	OTTHUMT00000414064.1	-	0.00	90	0	G	NM_002632		75413456	-1	tier1	-	no_errors	ENST00000405431	ensembl	human	known	74_37	missense	22.22	70	20	SNP	0.000	T
PJA1	64219	genome.wustl.edu	37	X	68382750	68382750	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chrX:68382750C>A	ENST00000361478.1	-	2	709	c.332G>T	c.(331-333)aGa>aTa	p.R111I	PJA1_ENST00000374571.4_Missense_Mutation_p.R56I|PJA1_ENST00000374583.1_Missense_Mutation_p.R111I|PJA1_ENST00000374584.3_Intron|PJA1_ENST00000477231.1_5'UTR	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	111					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GGCCATTCCTCTTCTGCTACC	0.527																																																	0													81.0	74.0	76.0					X																	68382750		2203	4300	6503	SO:0001583	missense	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.332G>T	X.37:g.68382750C>A	ENSP00000355014:p.Arg111Ile		A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R111I	ENST00000361478.1	37	c.332	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	C	16.36	3.101062	0.56183	.	.	ENSG00000181191	ENST00000396010;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T	0.14893	2.47;2.47;2.47	3.25	3.25	0.37280	.	0.431534	0.17930	U	0.157212	T	0.27419	0.0673	L	0.44542	1.39	0.38531	D	0.948974	D	0.65815	0.995	D	0.69142	0.962	T	0.07986	-1.0744	10	0.87932	D	0	-7.0678	5.7559	0.18172	0.0:0.8523:0.0:0.1477	.	111	Q8NG27	PJA1_HUMAN	I	56;111;111;56	ENSP00000363711:R111I;ENSP00000355014:R111I;ENSP00000363699:R56I	ENSP00000355014:R111I	R	-	2	0	PJA1	68299475	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	2.170000	0.42443	1.925000	0.55765	0.534000	0.68092	AGA	PJA1	-	NULL	ENSG00000181191		0.527	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	-	0.00	56	0	C	NM_145119		68382750	-1	tier1	-	no_errors	ENST00000361478	ensembl	human	known	74_37	missense	36.84	36	21	SNP	1.000	A
PLA2G7	7941	genome.wustl.edu	37	6	46684165	46684165	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr6:46684165A>G	ENST00000274793.7	-	4	528	c.332T>C	c.(331-333)cTt>cCt	p.L111P	PLA2G7_ENST00000538237.1_Missense_Mutation_p.L66P|PLA2G7_ENST00000537365.1_Missense_Mutation_p.L111P|PLA2G7_ENST00000541026.1_Intron	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	111					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			GTGTGTTCCAAGAAATTTGCT	0.388																																																	0													124.0	125.0	124.0					6																	46684165		2203	4300	6503	SO:0001583	missense	0			U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.332T>C	6.37:g.46684165A>G	ENSP00000274793:p.Leu111Pro		A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	pfam_PAF_acetylhydro,pirsf_PAF_acetylhydro_eukaryote	p.L111P	ENST00000274793.7	37	c.332	CCDS4917.1	6	.	.	.	.	.	.	.	.	.	.	A	12.84	2.057754	0.36277	.	.	ENSG00000146070	ENST00000274793;ENST00000537365;ENST00000538237	T;T;T	0.60171	0.21;0.21;0.21	5.29	4.13	0.48395	.	0.163737	0.53938	D	0.000048	T	0.68860	0.3047	M	0.87547	2.89	0.80722	D	1	P;D;D	0.89917	0.729;1.0;1.0	B;D;D	0.75020	0.414;0.985;0.985	T	0.73842	-0.3855	10	0.66056	D	0.02	.	9.1713	0.37083	0.9153:0.0:0.0847:0.0	.	66;111;111	F5GYY6;A8K2W6;Q13093	.;.;PAFA_HUMAN	P	111;111;66	ENSP00000274793:L111P;ENSP00000445666:L111P;ENSP00000441416:L66P	ENSP00000274793:L111P	L	-	2	0	PLA2G7	46792124	1.000000	0.71417	0.765000	0.31456	0.081000	0.17604	4.290000	0.59019	0.946000	0.37632	0.460000	0.39030	CTT	PLA2G7	-	pfam_PAF_acetylhydro,pirsf_PAF_acetylhydro_eukaryote	ENSG00000146070		0.388	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G7	HGNC	protein_coding	OTTHUMT00000040802.1	-	0.00	48	0	A			46684165	-1	tier1	-	no_errors	ENST00000274793	ensembl	human	known	74_37	missense	18.03	50	11	SNP	1.000	G
PPP1R15A	23645	genome.wustl.edu	37	19	49377829	49377829	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr19:49377829G>T	ENST00000200453.5	+	2	1608	c.1339G>T	c.(1339-1341)Gat>Tat	p.D447Y		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	447	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GGAAGATGAGGATGTGGATAG	0.557																																																	0													82.0	80.0	81.0					19																	49377829		2203	4300	6503	SO:0001583	missense	0			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1339G>T	19.37:g.49377829G>T	ENSP00000200453:p.Asp447Tyr		B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15A/B_C	p.D447Y	ENST00000200453.5	37	c.1339	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970610	0.53614	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.06294	3.32	4.14	-5.81	0.02340	.	1.802230	0.05195	U	0.503741	T	0.05135	0.0137	L	0.40543	1.245	0.09310	N	1	B	0.18461	0.028	B	0.09377	0.004	T	0.44003	-0.9356	10	0.72032	D	0.01	.	3.4697	0.07562	0.3721:0.0:0.2738:0.3541	.	447	O75807	PR15A_HUMAN	Y	447;287;405	ENSP00000200453:D447Y	ENSP00000200453:D447Y	D	+	1	0	PPP1R15A	54069641	0.006000	0.16342	0.000000	0.03702	0.017000	0.09413	0.529000	0.23019	-1.123000	0.02940	0.460000	0.39030	GAT	PPP1R15A	-	NULL	ENSG00000087074		0.557	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	HGNC	protein_coding	OTTHUMT00000466226.1	-	0.00	32	0	G	NM_014330		49377829	+1	tier1	-	no_errors	ENST00000200453	ensembl	human	known	74_37	missense	25.00	27	9	SNP	0.000	T
PRR5L	79899	genome.wustl.edu	37	11	36422705	36422705	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:36422705G>A	ENST00000378867.3	+	3	389	c.34G>A	c.(34-36)Gag>Aag	p.E12K	PRR5L_ENST00000389693.3_Intron|PRR5L_ENST00000527487.1_Missense_Mutation_p.E12K|PRR5L_ENST00000311599.5_5'UTR|PRR5L_ENST00000530639.1_Missense_Mutation_p.E12K	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like	12					negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TCTGCCCGTCGAGTTCCACAA	0.607																																																	0													53.0	46.0	48.0					11																	36422705		2202	4298	6500	SO:0001583	missense	0				CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.34G>A	11.37:g.36422705G>A	ENSP00000368144:p.Glu12Lys		A4QN22|E9PKY1|Q96H46|Q9H7V4	Missense_Mutation	SNP	pfam_HbrB	p.E12K	ENST00000378867.3	37	c.34	CCDS31463.1	11	.	.	.	.	.	.	.	.	.	.	G	13.46	2.245217	0.39697	.	.	ENSG00000135362	ENST00000530639;ENST00000527172;ENST00000532121;ENST00000526728;ENST00000378867;ENST00000524380;ENST00000526682;ENST00000530252;ENST00000530050;ENST00000526679;ENST00000527487	T;T;T;T;T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.24	5.24	0.73138	.	0.324362	0.29185	N	0.012887	T	0.16938	0.0407	N	0.24115	0.695	0.80722	D	1	P;P	0.48998	0.539;0.918	B;B	0.30716	0.041;0.119	T	0.04495	-1.0947	10	0.40728	T	0.16	-0.2165	13.5307	0.61621	0.0:0.2868:0.7132:0.0	.	12;12	E9PKY1;Q6MZQ0	.;PRR5L_HUMAN	K	12	ENSP00000435050:E12K;ENSP00000433708:E12K;ENSP00000433893:E12K;ENSP00000431610:E12K;ENSP00000368144:E12K;ENSP00000433305:E12K;ENSP00000436485:E12K;ENSP00000431475:E12K;ENSP00000432203:E12K;ENSP00000436402:E12K;ENSP00000435241:E12K	ENSP00000368144:E12K	E	+	1	0	PRR5L	36379281	0.986000	0.35501	0.924000	0.36721	0.154000	0.21943	3.606000	0.54095	2.440000	0.82611	0.655000	0.94253	GAG	PRR5L	-	NULL	ENSG00000135362		0.607	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	HGNC	protein_coding	OTTHUMT00000389209.1	-	0.00	45	0	G	NM_024841		36422705	+1	tier1	-	no_errors	ENST00000378867	ensembl	human	known	74_37	missense	42.00	29	21	SNP	0.949	A
PTPRD	5789	genome.wustl.edu	37	9	8521445	8521445	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:8521445G>T	ENST00000381196.4	-	17	1336	c.793C>A	c.(793-795)Cct>Act	p.P265T	PTPRD_ENST00000540109.1_Missense_Mutation_p.P265T|PTPRD_ENST00000356435.5_Missense_Mutation_p.P265T|PTPRD_ENST00000537002.1_Missense_Mutation_p.P262T|PTPRD_ENST00000360074.4_Missense_Mutation_p.P252T|PTPRD_ENST00000358503.5_Missense_Mutation_p.P252T|PTPRD_ENST00000397606.3_Missense_Mutation_p.P255T|PTPRD_ENST00000355233.5_Missense_Mutation_p.P265T|PTPRD_ENST00000486161.1_Missense_Mutation_p.P265T|PTPRD_ENST00000397617.3_Missense_Mutation_p.P255T|PTPRD_ENST00000397611.3_Missense_Mutation_p.P262T	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	265	Ig-like C2-type 3.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTACATAAGGCATTGGTGAC	0.478										TSP Lung(15;0.13)																																							0													164.0	144.0	151.0					9																	8521445		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.793C>A	9.37:g.8521445G>T	ENSP00000370593:p.Pro265Thr		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.P265T	ENST00000381196.4	37	c.793	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474574	0.84640	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73;-0.73	5.81	5.81	0.92471	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92051	0.7481	H	0.99368	4.535	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.987;0.987;1.0;1.0;1.0	D;D;D;D;P;D;D;D;D	0.97110	1.0;0.998;0.995;0.998;0.765;0.929;1.0;1.0;1.0	D	0.95013	0.8153	9	.	.	.	.	20.0762	0.97745	0.0:0.0:1.0:0.0	.	255;259;265;265;262;262;252;265;265	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	T	265;265;252;252;265;255;262;262;265;265;265;255	ENSP00000370593:P265T;ENSP00000348812:P265T;ENSP00000353187:P252T;ENSP00000351293:P252T;ENSP00000347373:P265T;ENSP00000380741:P255T;ENSP00000380735:P262T;ENSP00000440515:P262T;ENSP00000438164:P265T;ENSP00000417093:P265T;ENSP00000380731:P255T	.	P	-	1	0	PTPRD	8511445	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.807000	0.99171	2.756000	0.94617	0.655000	0.94253	CCT	PTPRD	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000153707		0.478	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	29	0	G			8521445	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	80.49	8	33	SNP	1.000	T
QRFPR	84109	genome.wustl.edu	37	4	122261765	122261765	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:122261765C>T	ENST00000394427.2	-	2	752	c.341G>A	c.(340-342)gGt>gAt	p.G114D	QRFPR_ENST00000334383.5_Splice_Site_p.G114D	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	114					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)	p.G114V(1)		endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						AATGAAAGCACCTGCAGTAAG	0.413																																																	1	Substitution - Missense(1)	lung(1)											100.0	84.0	90.0					4																	122261765		2203	4300	6503	SO:0001630	splice_region_variant	0			AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.341-1G>A	4.37:g.122261765C>T				Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.G114D	ENST00000394427.2	37	c.341	CCDS3719.1	4	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379408	0.61845	.	.	ENSG00000186867	ENST00000394427;ENST00000334383	T;T	0.49720	0.77;0.77	5.15	5.15	0.70609	GPCR, rhodopsin-like superfamily (1);	0.046276	0.85682	D	0.000000	T	0.74876	0.3774	M	0.88570	2.965	0.80722	D	1	D;P;P	0.89917	1.0;0.95;0.938	D;D;D	0.97110	1.0;0.97;0.949	T	0.80317	-0.1433	10	0.66056	D	0.02	.	18.66	0.91469	0.0:1.0:0.0:0.0	.	114;114;114	F2Z3L3;Q96P65;G4XH69	.;QRFPR_HUMAN;.	D	114	ENSP00000377948:G114D;ENSP00000335610:G114D	ENSP00000335610:G114D	G	-	2	0	QRFPR	122481215	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	7.315000	0.78998	2.387000	0.81309	0.579000	0.79373	GGT	QRFPR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt	ENSG00000186867		0.413	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRFPR	HGNC	protein_coding	OTTHUMT00000256641.2		0.00	34	0	C	NM_198179	Missense_Mutation	122261765	-1			no_errors	ENST00000394427	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
RAPGEF1	2889	genome.wustl.edu	37	9	134525617	134525617	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr9:134525617T>C	ENST00000372189.3	-	3	286	c.163A>G	c.(163-165)Aga>Gga	p.R55G	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.R73G|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.R72G	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	55					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		GGTAGAAATCTGTCTGTTGCC	0.502																																																	0													48.0	49.0	48.0					9																	134525617		1886	4111	5997	SO:0001583	missense	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.163A>G	9.37:g.134525617T>C	ENSP00000361263:p.Arg55Gly		Q5JUE4|Q8IV73	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R73G	ENST00000372189.3	37	c.217	CCDS48047.1	9	.	.	.	.	.	.	.	.	.	.	T	14.47	2.543598	0.45280	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000372189;ENST00000372190;ENST00000357686;ENST00000427994	T;T;T	0.25912	1.77;1.78;1.78	5.91	5.91	0.95273	.	0.679096	0.15736	N	0.247160	T	0.16727	0.0402	N	0.22421	0.69	0.30335	N	0.786278	B;B;B	0.20887	0.049;0.008;0.013	B;B;B	0.19391	0.016;0.011;0.025	T	0.17048	-1.0382	10	0.12766	T	0.61	.	10.6026	0.45375	0.143:0.0:0.0:0.857	.	72;55;73	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	G	55;72;55;73;72;73	ENSP00000361269:R72G;ENSP00000361263:R55G;ENSP00000361264:R73G	ENSP00000266110:R55G	R	-	1	2	RAPGEF1	133515438	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.749000	0.26320	2.254000	0.74563	0.533000	0.62120	AGA	RAPGEF1	-	NULL	ENSG00000107263		0.502	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	-	0.00	44	0	T	NM_005312		134525617	-1	tier1	-	no_errors	ENST00000372190	ensembl	human	known	74_37	missense	28.85	37	15	SNP	1.000	C
RIMBP3	85376	genome.wustl.edu	37	22	20457383	20457383	+	Missense_Mutation	SNP	G	G	T	rs199673858	byFrequency	TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr22:20457383G>T	ENST00000426804.1	-	1	4403	c.3919C>A	c.(3919-3921)Cct>Act	p.P1307T	RN7SKP131_ENST00000363006.1_RNA|SCARNA18_ENST00000516215.1_RNA|SCARNA17_ENST00000516762.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	1307				P -> T (in Ref. 4; AAH35246). {ECO:0000305}.						breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			TTCTCCCCAGGCTGGTCACTG	0.582													g|||	482	0.096246	0.0635	0.1455	5008	,	,		12204	0.128		0.0805	False		,,,				2504	0.089																0								G	THR/PRO	79,2731		10,59,1336	26.0	28.0	28.0		3919	-6.4	0.0	22	dbSNP_134	28	171,6761		16,139,3311	no	missense	RIMBP3	NM_015672.1	38	26,198,4647	TT,TG,GG		2.4668,2.8114,2.5662	benign	1307/1640	20457383	250,9492	1405	3466	4871	SO:0001583	missense	0			AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.3919C>A	22.37:g.20457383G>T	ENSP00000391564:p.Pro1307Thr		Q8IYP7|Q9BY94|Q9UFQ5	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,pfscan_SH3_domain	p.P1307T	ENST00000426804.1	37	c.3919	CCDS46665.1	22	103	0.04716117216117216	10	0.02032520325203252	20	0.055248618784530384	41	0.07167832167832168	32	0.04221635883905013	G	9.207	1.029914	0.19512	0.028114	0.024668	ENSG00000196622	ENST00000355186;ENST00000426804	T	0.16597	2.33	3.38	-6.4	0.01944	.	1.053850	0.07468	N	0.901812	T	0.00496	0.0016	N	0.24115	0.695	0.09310	N	1	B	0.22003	0.063	B	0.19666	0.026	T	0.39563	-0.9608	10	0.11182	T	0.66	0.5061	1.52	0.02514	0.263:0.1812:0.4054:0.1503	.	1213	Q9UFD9	RIM3A_HUMAN	T	1213;1307	ENSP00000391564:P1307T	ENSP00000347318:P1213T	P	-	1	0	RIMBP3	18837383	0.000000	0.05858	0.003000	0.11579	0.023000	0.10783	-1.468000	0.02350	-1.021000	0.03350	0.423000	0.28283	CCT	RIMBP3	-	NULL	ENSG00000196622		0.582	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP3	HGNC	protein_coding	OTTHUMT00000318945.2	-	0.00	56	0	G	NM_015672		20457383	-1	tier1	rs199673858	no_errors	ENST00000426804	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.003	T
RRBP1	6238	genome.wustl.edu	37	20	17617273	17617273	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr20:17617273C>T	ENST00000377813.1	-	6	2589	c.2286G>A	c.(2284-2286)atG>atA	p.M762I	RRBP1_ENST00000360807.4_Missense_Mutation_p.M329I|RRBP1_ENST00000246043.4_Missense_Mutation_p.M762I|RRBP1_ENST00000455029.2_Missense_Mutation_p.M103I|RRBP1_ENST00000377807.2_Missense_Mutation_p.M329I			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	762					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						AGCTGGCCTGCATGCGTGCCT	0.642																																																	0													89.0	80.0	83.0					20																	17617273		2203	4300	6503	SO:0001583	missense	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2286G>A	20.37:g.17617273C>T	ENSP00000367044:p.Met762Ile		A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.M762I	ENST00000377813.1	37	c.2286		20	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655150	0.67472	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	5.79	5.79	0.91817	.	0.000000	0.45606	D	0.000353	T	0.36138	0.0956	L	0.48174	1.505	0.80722	D	1	B	0.32507	0.373	B	0.31614	0.133	T	0.07158	-1.0787	10	0.38643	T	0.18	-34.221	19.0289	0.92946	0.0:1.0:0.0:0.0	.	329	Q9P2E9-3	.	I	329;762;329;762;103	ENSP00000354045:M329I;ENSP00000367044:M762I;ENSP00000367038:M329I;ENSP00000246043:M762I;ENSP00000401206:M103I	ENSP00000246043:M762I	M	-	3	0	RRBP1	17565273	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	7.816000	0.86201	2.746000	0.94184	0.561000	0.74099	ATG	RRBP1	-	NULL	ENSG00000125844		0.642	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1		0.00	30	0	C	NM_001042576		17617273	-1			no_errors	ENST00000246043	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
RTN1	6252	genome.wustl.edu	37	14	60212843	60212843	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr14:60212843T>G	ENST00000267484.5	-	2	933	c.598A>C	c.(598-600)Acc>Ccc	p.T200P		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	200					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TCGGGTCTGGTTATGTCAATG	0.448																																																	0													239.0	233.0	235.0					14																	60212843		2203	4300	6503	SO:0001583	missense	0			L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.598A>C	14.37:g.60212843T>G	ENSP00000267484:p.Thr200Pro		Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.T200P	ENST00000267484.5	37	c.598	CCDS9740.1	14	.	.	.	.	.	.	.	.	.	.	T	13.13	2.144667	0.37825	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.24350	1.86	5.7	-1.15	0.09709	.	0.346876	0.26627	N	0.023328	T	0.22126	0.0533	M	0.63428	1.95	0.09310	N	1	D	0.56035	0.974	P	0.45913	0.497	T	0.13764	-1.0497	10	0.51188	T	0.08	.	1.9554	0.03375	0.1191:0.2011:0.1239:0.5559	.	200	Q16799	RTN1_HUMAN	P	200;126	ENSP00000267484:T200P	ENSP00000267484:T200P	T	-	1	0	RTN1	59282596	1.000000	0.71417	0.539000	0.28077	0.423000	0.31445	1.618000	0.36954	-0.111000	0.12001	-0.503000	0.04515	ACC	RTN1	-	NULL	ENSG00000139970		0.448	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	HGNC	protein_coding	OTTHUMT00000072278.2	-	0.00	58	0	T			60212843	-1	tier1	-	no_errors	ENST00000267484	ensembl	human	known	74_37	missense	42.50	23	17	SNP	0.127	G
SCN2A	6326	genome.wustl.edu	37	2	166153528	166153528	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:166153528C>A	ENST00000375437.2	+	3	559	c.269C>A	c.(268-270)aCg>aAg	p.T90K	SCN2A_ENST00000283256.6_Splice_Site_p.T90K|SCN2A_ENST00000357398.3_Splice_Site_p.T90K|SCN2A_ENST00000375427.2_Splice_Site_p.T90K	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	90					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTTTTCAGACGTTTATAGTA	0.289																																																	0													46.0	44.0	45.0					2																	166153528		2202	4298	6500	SO:0001630	splice_region_variant	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.268-1C>A	2.37:g.166153528C>A			A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.T90K	ENST00000375437.2	37	c.269	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	29.8	5.038101	0.93630	.	.	ENSG00000136531	ENST00000424833;ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D;D	0.97642	-4.24;-4.47;-4.47;-4.47;-4.47	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000002	D	0.99096	0.9689	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99160	1.0861	10	0.87932	D	0	.	19.3637	0.94453	0.0:1.0:0.0:0.0	.	90;90	Q99250-2;Q99250	.;SCN2A_HUMAN	K	90	ENSP00000406454:T90K;ENSP00000364586:T90K;ENSP00000349973:T90K;ENSP00000283256:T90K;ENSP00000364576:T90K	ENSP00000283256:T90K	T	+	2	0	SCN2A	165861774	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	7.776000	0.85560	2.662000	0.90505	0.591000	0.81541	ACG	SCN2A	-	NULL	ENSG00000136531		0.289	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	-	0.00	74	0	C	NM_021007	Missense_Mutation	166153528	+1	tier1	-	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	45.71	38	32	SNP	1.000	A
SDHAP1	255812	genome.wustl.edu	37	3	195689994	195689994	+	RNA	SNP	T	T	C	rs73891185		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:195689994T>C	ENST00000427841.1	-	0	2325					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTATATTTTATTTAAGAGCTG	0.363																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195689994T>C				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.363	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1		0.00	12	0	T			195689994	-1			no_errors	ENST00000354559	ensembl	human	known	74_37	rna	7.27	51	4	SNP	0.428	C
SDHAP1	255812	genome.wustl.edu	37	3	195690001	195690001	+	RNA	SNP	G	G	C	rs79239338		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:195690001G>C	ENST00000427841.1	-	0	2325					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		TTATTTAAGAGCTGTGCCCAG	0.373																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195690001G>C				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.373	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1		0.00	13	0	G			195690001	-1			no_errors	ENST00000354559	ensembl	human	known	74_37	rna	6.56	57	4	SNP	0.235	C
SH3BP5L	80851	genome.wustl.edu	37	1	249107261	249107261	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:249107261T>A	ENST00000366472.5	-	6	1867	c.638A>T	c.(637-639)aAg>aTg	p.K213M	SH3BP5L_ENST00000475978.1_5'UTR|SH3BP5L_ENST00000411742.2_Missense_Mutation_p.K181M	NM_030645.1	NP_085148.1	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	213										endometrium(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CCGGAGGGTCTTCTGCAGGGC	0.647																																																	0													50.0	50.0	50.0					1																	249107261		2203	4300	6503	SO:0001583	missense	0			AB051507	CCDS31126.1	1q44	2008-02-05			ENSG00000175137	ENSG00000175137			29360	protein-coding gene	gene with protein product							Standard	NM_030645		Approved	KIAA1720	uc001iew.1	Q7L8J4	OTTHUMG00000040389	ENST00000366472.5:c.638A>T	1.37:g.249107261T>A	ENSP00000355428:p.Lys213Met		B4DQ94|Q96FI5|Q9BQH8|Q9C0E3	Missense_Mutation	SNP	pfam_SH3-bd_5	p.K213M	ENST00000366472.5	37	c.638	CCDS31126.1	1	.	.	.	.	.	.	.	.	.	.	T	19.03	3.748016	0.69533	.	.	ENSG00000175137	ENST00000366472;ENST00000411742	T	0.79749	-1.3	4.4	3.27	0.37495	.	0.000000	0.85682	D	0.000000	D	0.87900	0.6294	M	0.82716	2.605	0.53688	D	0.999971	D;D;D;D	0.89917	0.999;0.999;1.0;0.999	D;D;D;D	0.79784	0.989;0.989;0.993;0.975	D	0.87997	0.2753	10	0.87932	D	0	-58.0796	7.6036	0.28089	0.0:0.1044:0.0:0.8956	.	181;106;213;71	B4DQ94;B4DSF1;Q7L8J4;Q96MW4	.;.;3BP5L_HUMAN;.	M	213;181	ENSP00000412203:K181M	ENSP00000355428:K213M	K	-	2	0	SH3BP5L	247073884	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.410000	0.66381	1.751000	0.51876	0.383000	0.25322	AAG	SH3BP5L	-	pfam_SH3-bd_5	ENSG00000175137		0.647	SH3BP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5L	HGNC	protein_coding	OTTHUMT00000097140.1	-	0.00	36	0	T	NM_030645		249107261	-1	tier1	-	no_errors	ENST00000366472	ensembl	human	known	74_37	missense	19.35	50	12	SNP	1.000	A
SIGLEC6	946	genome.wustl.edu	37	19	52034113	52034113	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr19:52034113C>T	ENST00000425629.3	-	3	682	c.528G>A	c.(526-528)acG>acA	p.T176T	SIGLEC6_ENST00000346477.3_Silent_p.T176T|SIGLEC6_ENST00000436458.1_Silent_p.T140T|SIGLEC6_ENST00000391797.3_Silent_p.T165T|SIGLEC6_ENST00000343300.4_Silent_p.T176T|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000359982.4_Silent_p.T176T	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	176	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		AGATGGGGGGCGTCCCCTGCT	0.662																																																	0													71.0	75.0	74.0					19																	52034113		2203	4300	6503	SO:0001819	synonymous_variant	0			D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.528G>A	19.37:g.52034113C>T			A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T176	ENST00000425629.3	37	c.528	CCDS12834.3	19																																																																																			SIGLEC6	-	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105492		0.662	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	HGNC	protein_coding	OTTHUMT00000257670.3	-	0.00	45	0	C	NM_001245		52034113	-1	tier1	-	no_errors	ENST00000425629	ensembl	human	known	74_37	silent	28.57	29	12	SNP	0.001	T
SIPA1	6494	genome.wustl.edu	37	11	65409978	65409978	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr11:65409978delG	ENST00000394224.3	+	4	1148	c.852delG	c.(850-852)ccgfs	p.P284fs	SIPA1_ENST00000534313.1_Frame_Shift_Del_p.P284fs|SIPA1_ENST00000527525.1_Frame_Shift_Del_p.P284fs|SIPA1_ENST00000394227.3_Frame_Shift_Del_p.P284fs	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	284					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						CGCTGCCGCCGGGGCCCCCAC	0.672																																																	0													16.0	18.0	17.0					11																	65409978		2199	4285	6484	SO:0001589	frameshift_variant	0			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.852delG	11.37:g.65409978delG	ENSP00000377771:p.Pro284fs		O14518|O60484|O60618|Q2YD83	Frame_Shift_Del	DEL	pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.P287fs	ENST00000394224.3	37	c.852	CCDS8108.1	11																																																																																			SIPA1	-	NULL	ENSG00000213445		0.672	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIPA1	HGNC	protein_coding	OTTHUMT00000390356.1		0.00	50	0	G	NM_006747		65409978	+1	tier1		no_errors	ENST00000394224	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	0.287	-
SLC39A12	221074	genome.wustl.edu	37	10	18292265	18292265	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr10:18292265T>C	ENST00000377369.2	+	12	2198	c.1925T>C	c.(1924-1926)tTa>tCa	p.L642S	SLC39A12-AS1_ENST00000439319.1_RNA|SLC39A12-AS1_ENST00000445287.1_RNA|SLC39A12_ENST00000377371.3_Missense_Mutation_p.L641S|SLC39A12_ENST00000539911.1_Missense_Mutation_p.L508S|SLC39A12_ENST00000377374.4_Missense_Mutation_p.L605S	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	642					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GGGATGTTCTTATATTTATCC	0.383																																																	0													144.0	129.0	134.0					10																	18292265		2203	4300	6503	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1925T>C	10.37:g.18292265T>C	ENSP00000366586:p.Leu642Ser		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.L642S	ENST00000377369.2	37	c.1925	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805282	0.70682	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000001	D	0.83069	0.5174	H	0.95539	3.685	0.53688	D	0.999979	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.88415	0.3024	10	0.87932	D	0	-11.0017	15.7539	0.78009	0.0:0.0:0.0:1.0	.	641;642;605	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	S	642;605;641;508;562	ENSP00000366586:L642S;ENSP00000366591:L605S;ENSP00000366588:L641S;ENSP00000440445:L508S	ENSP00000366586:L642S	L	+	2	0	SLC39A12	18332271	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.099000	0.71466	2.189000	0.69895	0.533000	0.62120	TTA	SLC39A12	-	pfam_ZIP	ENSG00000148482		0.383	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		-	0.00	144	0	T	NM_152725		18292265	+1	tier1	-	no_errors	ENST00000377369	ensembl	human	known	74_37	missense	16.89	123	25	SNP	1.000	C
SNHG14	104472715	genome.wustl.edu	37	15	25332999	25332999	+	RNA	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:25332999T>C	ENST00000546682.1	+	0	586				SNHG14_ENST00000553108.1_RNA|SNHG14_ENST00000384430.1_RNA|SNORD116-20_ENST00000384529.1_lincRNA|SNORD116-20_ENST00000384507.1_lincRNA|SNHG14_ENST00000549804.2_RNA|SNORD116-19_ENST00000384729.1_RNA|SNORD116-18_ENST00000383961.1_RNA	NR_003361.1				small nucleolar RNA host gene 14 (non-protein coding)																		ATGTGGTCTCTTATGGGTGAT	0.488																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25332999T>C				RNA	SNP	-	NULL	ENST00000546682.1	37	NULL		15																																																																																			SNORD116-20	-	-	ENSG00000261069		0.488	SNHG14-022	KNOWN	basic	antisense	SNORD116-20	HGNC	processed_transcript	OTTHUMT00000408281.1	-	0.00	24	0	T			25332999	+1	tier1	-	no_errors	ENST00000567527	ensembl	human	known	74_37	rna	35.29	22	12	SNP	0.000	C
GNL3	26354	genome.wustl.edu	37	3	52724786	52724786	+	Intron	DEL	A	A	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:52724786delA	ENST00000418458.1	+	7	827				SNORD19B_ENST00000516978.1_RNA|SNORD19B_ENST00000459623.1_RNA|SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Intron|SNORD19_ENST00000410413.1_RNA|SNORD19_ENST00000391191.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)						cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		ATGAGTGTACAAAATCTTGAT	0.343																																																	0																																										SO:0001627	intron_variant	0			AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.654+66A>-	3.37:g.52724786delA			B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	RNA	DEL	-	NULL	ENST00000418458.1	37	NULL	CCDS2861.1	3																																																																																			SNORD19B	-	-	ENSG00000238862		0.343	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD19B	HGNC	protein_coding	OTTHUMT00000352032.1		0.00	47	0	A	NM_014366		52724786	+1	tier1		no_errors	ENST00000459623	ensembl	human	known	74_37	rna	59.26	11	16	DEL	0.001	-
SPTBN5	51332	genome.wustl.edu	37	15	42147090	42147090	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:42147090C>T	ENST00000320955.6	-	56	9735	c.9508G>A	c.(9508-9510)Ggc>Agc	p.G3170S	RNA5SP393_ENST00000363423.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	3170					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCCAGGGTGCCTGCCAACTTC	0.577																																																	0													61.0	64.0	63.0					15																	42147090		1935	4135	6070	SO:0001583	missense	0			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.9508G>A	15.37:g.42147090C>T	ENSP00000317790:p.Gly3170Ser			Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.G3170S	ENST00000320955.6	37	c.9508		15	.	.	.	.	.	.	.	.	.	.	.	4.355	0.065371	0.08388	.	.	ENSG00000137877	ENST00000320955	T	0.33865	1.39	5.2	1.2	0.21068	.	1.481950	0.04069	N	0.307666	T	0.23572	0.0570	N	0.17674	0.51	0.09310	N	1	P	0.39352	0.669	B	0.43838	0.433	T	0.12293	-1.0553	10	0.07644	T	0.81	.	1.1551	0.01794	0.2467:0.4096:0.109:0.2346	.	3170	Q9NRC6	SPTN5_HUMAN	S	3170	ENSP00000317790:G3170S	ENSP00000317790:G3170S	G	-	1	0	SPTBN5	39934382	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-0.013000	0.12678	-0.032000	0.13758	0.655000	0.94253	GGC	SPTBN5	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000137877		0.577	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1		0.00	32	0	C	NM_016642		42147090	-1			no_errors	ENST00000320955	ensembl	human	known	74_37	missense	18.60	35	8	SNP	0.000	T
SULT1A1	6817	genome.wustl.edu	37	16	28617218	28617218	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr16:28617218G>A	ENST00000395607.1	-	8	1085	c.812C>T	c.(811-813)gCg>gTg	p.A271V	SULT1A1_ENST00000395609.1_Missense_Mutation_p.A271V|SULT1A1_ENST00000350842.4_Missense_Mutation_p.A193V|SULT1A1_ENST00000314752.7_Missense_Mutation_p.A271V|SULT1A1_ENST00000569554.1_Missense_Mutation_p.A271V	NM_177530.2|NM_177534.2	NP_803566.1|NP_803878.1	P50225	ST1A1_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1	271					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|estrogen metabolic process (GO:0008210)|flavonoid metabolic process (GO:0009812)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid sulfotransferase activity (GO:0050294)|sulfotransferase activity (GO:0008146)			endometrium(2)|kidney(7)|large_intestine(2)|lung(2)|ovary(1)|stomach(2)	16					Acetaminophen(DB00316)|Tamoxifen(DB00675)	CTCATTCTGCGCCACGGTGAA	0.627																																																	0													26.0	21.0	23.0					16																	28617218		2196	4275	6471	SO:0001583	missense	0			U52852	CCDS10637.1, CCDS32420.1	16p12.1	2008-02-05			ENSG00000196502	ENSG00000196502	2.8.2.1	"""Sulfotransferases, cytosolic"""	11453	protein-coding gene	gene with protein product		171150		STP, STP1		8288252, 8912648	Standard	NM_177534		Approved	P-PST	uc002dqj.3	P50225	OTTHUMG00000131765	ENST00000395607.1:c.812C>T	16.37:g.28617218G>A	ENSP00000378971:p.Ala271Val		Q2NL71|Q86U58|Q92818|Q9BVU6|Q9UGG7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.A271V	ENST00000395607.1	37	c.812	CCDS32420.1	16	.	.	.	.	.	.	.	.	.	.	g	28.3	4.911910	0.92178	.	.	ENSG00000196502	ENST00000314752;ENST00000350842;ENST00000395609;ENST00000395607	T;T;T;T	0.02015	4.5;4.5;4.5;4.5	2.0	2.0	0.26442	Sulfotransferase domain (1);	0.000000	0.64402	D	0.000007	T	0.09512	0.0234	M	0.87827	2.91	0.40715	D	0.982605	D;D;D	0.76494	0.999;0.999;0.992	P;P;P	0.57009	0.811;0.793;0.556	T	0.04708	-1.0932	10	0.72032	D	0.01	.	10.0843	0.42408	0.0:0.0:1.0:0.0	.	223;193;271	Q59GG0;P50225-2;P50225	.;.;ST1A1_HUMAN	V	271;193;271;271	ENSP00000321988:A271V;ENSP00000329399:A193V;ENSP00000378972:A271V;ENSP00000378971:A271V	ENSP00000321988:A271V	A	-	2	0	SULT1A1	28524719	1.000000	0.71417	0.999000	0.59377	0.566000	0.35808	5.692000	0.68256	1.439000	0.47511	0.298000	0.19748	GCG	SULT1A1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000196502		0.627	SULT1A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1A1	HGNC	protein_coding	OTTHUMT00000254694.2	-	0.00	35	0	G	NM_001055		28617218	-1	tier1	-	no_errors	ENST00000314752	ensembl	human	known	74_37	missense	17.50	33	7	SNP	1.000	A
TARS	6897	genome.wustl.edu	37	5	33458676	33458676	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr5:33458676A>T	ENST00000265112.3	+	10	1301	c.990A>T	c.(988-990)caA>caT	p.Q330H	TARS_ENST00000541634.1_Missense_Mutation_p.Q226H|TARS_ENST00000414361.2_Missense_Mutation_p.Q209H|TARS_ENST00000455217.2_Missense_Mutation_p.Q363H|TARS_ENST00000502553.1_Missense_Mutation_p.Q330H	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	330					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CCCAGGACCAAGAACTATATT	0.353																																																	0													125.0	127.0	127.0					5																	33458676		2203	4300	6503	SO:0001583	missense	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.990A>T	5.37:g.33458676A>T	ENSP00000265112:p.Gln330His		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.Q330H	ENST00000265112.3	37	c.990	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964243	0.74131	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T	0.51071	0.72;0.72;0.73	6.13	-1.03	0.10102	.	0.000000	0.85682	D	0.000000	T	0.58047	0.2095	H	0.96460	3.825	0.51233	D	0.999915	P;P;B;P	0.42556	0.611;0.783;0.441;0.783	B;B;B;B	0.39590	0.304;0.179;0.222;0.179	T	0.71474	-0.4582	10	0.72032	D	0.01	-29.9662	11.9956	0.53201	0.6838:0.0:0.3162:0.0	.	209;363;226;330	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	H	330;330;226;363;209	ENSP00000424387:Q330H;ENSP00000265112:Q330H;ENSP00000387710:Q363H	ENSP00000265112:Q330H	Q	+	3	2	TARS	33494433	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.041000	0.41213	-0.048000	0.13401	0.524000	0.50904	CAA	TARS	-	tigrfam_Thr-tRNA-ligase_IIa	ENSG00000113407		0.353	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	-	0.00	32	0	A	NM_152295		33458676	+1	tier1	-	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	16.28	36	7	SNP	0.999	T
TBCK	93627	genome.wustl.edu	37	4	107037369	107037369	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr4:107037369T>C	ENST00000273980.5	-	25	2849	c.2402A>G	c.(2401-2403)aAt>aGt	p.N801S	TBCK_ENST00000432496.2_Missense_Mutation_p.N801S|TBCK_ENST00000361687.4_Missense_Mutation_p.N738S|TBCK_ENST00000394708.2_Missense_Mutation_p.N801S|TBCK_ENST00000514689.1_5'UTR|TBCK_ENST00000394706.3_Missense_Mutation_p.N762S					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						CTCTTCACTATTCCGGATGTC	0.393																																																	0													191.0	175.0	180.0					4																	107037369		2203	4300	6503	SO:0001583	missense	0				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.2402A>G	4.37:g.107037369T>C	ENSP00000273980:p.Asn801Ser			Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rhodanese-like_dom,superfamily_Kinase-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Rab-GTPase-TBC_dom,smart_Rhodanese-like_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Prot_kinase_dom,pfscan_Rhodanese-like_dom	p.N801S	ENST00000273980.5	37	c.2402	CCDS54788.1	4	.	.	.	.	.	.	.	.	.	.	T	0.059	-1.228018	0.01518	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	5.41	2.96	0.34315	Rhodanese-like (5);	0.289542	0.35677	N	0.003043	T	0.09335	0.0230	N	0.02685	-0.53	0.24340	N	0.994968	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.34354	-0.9832	10	0.15499	T	0.54	.	8.6114	0.33804	0.0:0.152:0.0:0.848	.	801;762;738	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	S	801;801;738;762;801	ENSP00000273980:N801S;ENSP00000405847:N801S;ENSP00000355338:N738S;ENSP00000378196:N762S;ENSP00000378198:N801S	ENSP00000273980:N801S	N	-	2	0	TBCK	107256818	0.929000	0.31497	0.668000	0.29813	0.572000	0.35998	1.072000	0.30678	0.364000	0.24374	0.459000	0.35465	AAT	TBCK	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	ENSG00000145348		0.393	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCK	HGNC	protein_coding	OTTHUMT00000253953.4	-	0.00	129	0	T	NM_033115		107037369	-1	tier1	-	no_errors	ENST00000273980	ensembl	human	known	74_37	missense	35.58	67	37	SNP	0.362	C
TCF7L1	83439	genome.wustl.edu	37	2	85529698	85529698	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:85529698C>A	ENST00000282111.3	+	5	892	c.617C>A	c.(616-618)tCc>tAc	p.S206Y		NM_031283.2	NP_112573.1	Q9HCS4	TF7L1_HUMAN	transcription factor 7-like 1 (T-cell specific, HMG-box)	206	Pro-rich.				anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(4)|upper_aerodigestive_tract(1)	18						TCCCCCGGCTCCCCTCCCACC	0.572																																																	0													86.0	89.0	88.0					2																	85529698		2203	4300	6503	SO:0001583	missense	0			X62870	CCDS1971.1	2p11.2	2008-02-05			ENSG00000152284	ENSG00000152284			11640	protein-coding gene	gene with protein product		604652		TCF3		1741298, 11085512	Standard	NM_031283		Approved		uc002soy.3	Q9HCS4	OTTHUMG00000130026	ENST00000282111.3:c.617C>A	2.37:g.85529698C>A	ENSP00000282111:p.Ser206Tyr		Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	pfam_CTNNB1-bd_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.S206Y	ENST00000282111.3	37	c.617	CCDS1971.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620382	0.87460	.	.	ENSG00000152284	ENST00000282111	D	0.98531	-4.98	4.53	4.53	0.55603	CTNNB1 binding, N-teminal (1);	0.177722	0.48286	D	0.000194	D	0.97971	0.9332	L	0.47190	1.495	0.42214	D	0.991821	D	0.61080	0.989	P	0.61070	0.883	D	0.98832	1.0751	10	0.72032	D	0.01	.	14.8119	0.70003	0.0:1.0:0.0:0.0	.	206	Q9HCS4	TF7L1_HUMAN	Y	206	ENSP00000282111:S206Y	ENSP00000282111:S206Y	S	+	2	0	TCF7L1	85383209	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	7.434000	0.80377	2.328000	0.79073	0.655000	0.94253	TCC	TCF7L1	-	pfam_CTNNB1-bd_N	ENSG00000152284		0.572	TCF7L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF7L1	HGNC	protein_coding	OTTHUMT00000252301.2	-	0.00	32	0	C	NM_031283		85529698	+1	tier1	-	no_errors	ENST00000282111	ensembl	human	known	74_37	missense	40.58	41	28	SNP	1.000	A
TCOF1	6949	genome.wustl.edu	37	5	149772327	149772327	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr5:149772327G>A	ENST00000504761.2	+	22	3574	c.3574G>A	c.(3574-3576)Gag>Aag	p.E1192K	TCOF1_ENST00000445265.2_Missense_Mutation_p.E1116K|TCOF1_ENST00000377797.3_Missense_Mutation_p.E1193K|TCOF1_ENST00000323668.7_Missense_Mutation_p.E1115K|TCOF1_ENST00000513346.1_Missense_Mutation_p.E1192K|TCOF1_ENST00000451292.1_Missense_Mutation_p.E1229K|TCOF1_ENST00000439160.2_Missense_Mutation_p.E1155K			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1192					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)	p.E1192K(1)|p.E1115K(1)		NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGAGTCCAGCGAGGATGATGT	0.637																																																	2	Substitution - Missense(2)	lung(2)											53.0	50.0	51.0					5																	149772327		2203	4300	6503	SO:0001583	missense	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3574G>A	5.37:g.149772327G>A	ENSP00000421655:p.Glu1192Lys		A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.E1229K	ENST00000504761.2	37	c.3685	CCDS54936.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.148387	0.94603	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08	5.55	5.55	0.83447	.	0.596735	0.14050	N	0.344855	T	0.60340	0.2261	L	0.29908	0.895	0.31452	N	0.670632	D;D;D;D;D	0.67145	0.996;0.996;0.996;0.993;0.996	P;P;P;P;P	0.57009	0.811;0.811;0.811;0.652;0.811	T	0.58994	-0.7537	10	0.28530	T	0.3	-12.0608	15.0069	0.71519	0.0:0.0:1.0:0.0	.	1155;1115;1154;1192;1116	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	K	1229;1193;1116;1115;1155;1154;1192;1192	ENSP00000400939:E1229K;ENSP00000367028:E1193K;ENSP00000409944:E1116K;ENSP00000325223:E1115K;ENSP00000406888:E1155K;ENSP00000390717:E1154K;ENSP00000421655:E1192K;ENSP00000427484:E1192K	ENSP00000325223:E1115K	E	+	1	0	TCOF1	149752520	0.997000	0.39634	0.834000	0.33040	0.981000	0.71138	4.839000	0.62810	2.621000	0.88768	0.561000	0.74099	GAG	TCOF1	-	NULL	ENSG00000070814		0.637	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	-	0.00	78	0	G	NM_001008656		149772327	+1	tier1	-	no_errors	ENST00000451292	ensembl	human	known	74_37	missense	20.59	27	7	SNP	0.950	A
TMEM127	55654	genome.wustl.edu	37	2	96919649	96919649	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:96919649T>C	ENST00000258439.3	-	4	870	c.614A>G	c.(613-615)gAg>gGg	p.E205G	TMEM127_ENST00000435268.1_Missense_Mutation_p.E121G|TMEM127_ENST00000432959.1_Missense_Mutation_p.E205G	NM_001193304.2|NM_017849.3	NP_001180233.1|NP_060319.1	O75204	TM127_HUMAN	transmembrane protein 127	205					negative regulation of cell proliferation (GO:0008285)|negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	5						CAGCGCCTGCTCCTCTTCCTC	0.612																																																	0													70.0	67.0	68.0					2																	96919649		2203	4300	6503	SO:0001583	missense	0			AK000514	CCDS2018.1	2q11.2	2014-09-17			ENSG00000135956	ENSG00000135956			26038	protein-coding gene	gene with protein product		613403				10493829	Standard	NM_017849		Approved	FLJ20507, FLJ22257	uc002svr.3	O75204	OTTHUMG00000130454	ENST00000258439.3:c.614A>G	2.37:g.96919649T>C	ENSP00000258439:p.Glu205Gly		D3DXH0	Missense_Mutation	SNP	NULL	p.E205G	ENST00000258439.3	37	c.614	CCDS2018.1	2	.	.	.	.	.	.	.	.	.	.	T	22.8	4.333460	0.81801	.	.	ENSG00000135956	ENST00000258439;ENST00000432959;ENST00000435268	D;D;D	0.95853	-3.83;-3.83;-3.03	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.90480	0.7018	N	0.14661	0.345	0.80722	D	1	B	0.34290	0.447	B	0.33254	0.16	D	0.90858	0.4736	10	0.72032	D	0.01	-17.0289	15.1122	0.72368	0.0:0.0:0.0:1.0	.	205	O75204	TM127_HUMAN	G	205;205;121	ENSP00000258439:E205G;ENSP00000416660:E205G;ENSP00000411810:E121G	ENSP00000258439:E205G	E	-	2	0	TMEM127	96283376	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	7.535000	0.82014	2.216000	0.71823	0.379000	0.24179	GAG	TMEM127	-	NULL	ENSG00000135956		0.612	TMEM127-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM127	HGNC	protein_coding	OTTHUMT00000252845.3	-	0.00	38	0	T	NM_017849		96919649	-1	tier1	-	no_errors	ENST00000258439	ensembl	human	known	74_37	missense	31.25	44	20	SNP	1.000	C
TNRC18	84629	genome.wustl.edu	37	7	5413711	5413711	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr7:5413711delG	ENST00000430969.1	-	10	3552	c.3204delC	c.(3202-3204)cccfs	p.P1068fs	TNRC18_ENST00000399537.4_Frame_Shift_Del_p.P1068fs	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1068	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGAAGGGGCTGGGGGCTTCCT	0.607																																																	0													34.0	39.0	38.0					7																	5413711		1940	4141	6081	SO:0001589	frameshift_variant	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.3204delC	7.37:g.5413711delG	ENSP00000395538:p.Pro1068fs		A8MX41|Q96JH1|Q96K91	Frame_Shift_Del	DEL	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.S1069fs	ENST00000430969.1	37	c.3204	CCDS47534.1	7																																																																																			TNRC18	-	NULL	ENSG00000182095		0.607	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding			0.00	33	0	G			5413711	-1	tier1		no_errors	ENST00000399537	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	1.000	-
TP53	7157	genome.wustl.edu	37	17	7578370	7578370	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr17:7578370C>T	ENST00000269305.4	-	5	749		c.e5+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000574684.1_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(54)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGCTGCTCACCATCGCTATC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	68	Unknown(54)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	lung(12)|breast(9)|oesophagus(7)|ovary(7)|liver(7)|urinary_tract(5)|NS(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|stomach(1)|soft_tissue(1)											48.0	46.0	47.0					17																	7578370		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.559+1G>A	17.37:g.7578370C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e4+1	ENST00000269305.4	37	c.559+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	11.89	1.774230	0.31411	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.7	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0738	0.59075	0.0:0.8363:0.1637:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519095	1.000000	0.71417	0.967000	0.41034	0.201000	0.24016	3.085000	0.50151	1.248000	0.43934	0.655000	0.94253	.	TP53	-	-	ENSG00000141510		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	365	0	C	NM_000546	Intron	7578370	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	80.13	88	359	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179593015	179593015	+	Silent	SNP	A	A	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr2:179593015A>G	ENST00000591111.1	-	65	18809	c.18585T>C	c.(18583-18585)gcT>gcC	p.A6195A	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000589042.1_Silent_p.A6512A|TTN_ENST00000342992.6_Silent_p.A5268A|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin	12975	Ig-like 43.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAAACCACTGAGCACTAATGG	0.383																																																	0													73.0	69.0	71.0					2																	179593015		1865	4093	5958	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.18585T>C	2.37:g.179593015A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A5268	ENST00000591111.1	37	c.15804		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	12	0	A	NM_133378		179593015	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	54.55	10	12	SNP	1.000	G
WDFY4	57705	genome.wustl.edu	37	10	49951516	49951516	+	Silent	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr10:49951516G>A	ENST00000325239.5	+	11	2409	c.2382G>A	c.(2380-2382)ccG>ccA	p.P794P	WDFY4_ENST00000413659.2_Silent_p.P794P	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	794						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGCAGGGGCCGGTTGTGGATG	0.597																																																	0													15.0	17.0	17.0					10																	49951516		692	1591	2283	SO:0001819	synonymous_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2382G>A	10.37:g.49951516G>A			B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P794	ENST00000325239.5	37	c.2382	CCDS44385.1	10																																																																																			WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.597	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	34	0	G	XM_033379		49951516	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	45.00	11	9	SNP	0.000	A
YY1AP1	55249	genome.wustl.edu	37	1	155630265	155630265	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:155630265G>C	ENST00000295566.4	-	11	1597	c.1574C>G	c.(1573-1575)tCt>tGt	p.S525C	YY1AP1_ENST00000347088.5_Missense_Mutation_p.S479C|YY1AP1_ENST00000355499.4_Missense_Mutation_p.S479C|YY1AP1_ENST00000404643.1_Missense_Mutation_p.S459C|MSTO1_ENST00000538143.1_Intron|YY1AP1_ENST00000535662.1_Missense_Mutation_p.S325C|MSTO1_ENST00000452804.2_Intron|YY1AP1_ENST00000311573.5_Missense_Mutation_p.S448C|YY1AP1_ENST00000407221.1_Missense_Mutation_p.S448C|YY1AP1_ENST00000359205.5_Missense_Mutation_p.S468C|YY1AP1_ENST00000368330.2_Missense_Mutation_p.S479C|YY1AP1_ENST00000368340.5_Missense_Mutation_p.S597C|YY1AP1_ENST00000361831.5_Missense_Mutation_p.S468C|YY1AP1_ENST00000368339.5_Missense_Mutation_p.S617C	NM_001198906.1|NM_139118.2	NP_001185835.1|NP_620829.1	Q9H869	YYAP1_HUMAN	YY1 associated protein 1	525					regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(7)|ovary(2)|skin(2)|urinary_tract(2)	31	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					TGCTGCAGGAGACTCAAAACT	0.567																																																	0													49.0	49.0	49.0					1																	155630265		2203	4300	6503	SO:0001583	missense	0			BC008766	CCDS1115.1, CCDS1116.1, CCDS55643.1, CCDS55644.1, CCDS55645.1	1q22	2009-05-07			ENSG00000163374	ENSG00000163374			30935	protein-coding gene	gene with protein product		607860				11710830	Standard	NM_139119		Approved	YY1AP, HCCA2, YAP		Q9H869	OTTHUMG00000035437	ENST00000295566.4:c.1574C>G	1.37:g.155630265G>C	ENSP00000295566:p.Ser525Cys		B0QZ54|B4DMP2|B4E0I0|D3DV96|D3DV98|H7BY62|Q5VYZ1|Q5VYZ4|Q5VYZ7|Q7L4C3|Q7L5E2|Q8IXA6|Q8TEW5|Q8TF04|Q96HB6|Q9BQ64|Q9NV84	Missense_Mutation	SNP	NULL	p.S617C	ENST00000295566.4	37	c.1850	CCDS1115.1	1	.	.	.	.	.	.	.	.	.	.	g	6.646	0.487687	0.12641	.	.	ENSG00000163374	ENST00000359205;ENST00000355499;ENST00000311573;ENST00000347088;ENST00000361831;ENST00000368340;ENST00000295566;ENST00000368330;ENST00000407221;ENST00000404643;ENST00000368339;ENST00000535662	T;T;T;T;T;T;T;T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5;0.5	2.53	1.57	0.23409	.	0.426528	0.22591	N	0.058096	T	0.20292	0.0488	N	0.22421	0.69	0.41117	D	0.985784	B;B;P;B;B	0.50528	0.002;0.007;0.936;0.019;0.023	B;B;P;B;B	0.44990	0.003;0.009;0.466;0.009;0.01	T	0.02751	-1.1115	10	0.39692	T	0.17	.	4.5863	0.12284	0.1857:0.2187:0.5956:0.0	.	617;459;525;479;597	B4DMP2;Q9H869-4;Q9H869;Q9H869-2;Q5VYZ1	.;.;YYAP1_HUMAN;.;.	C	468;479;448;479;468;597;525;479;448;459;617;325	ENSP00000352134:S468C;ENSP00000347686:S479C;ENSP00000311138:S448C;ENSP00000316079:S479C;ENSP00000355298:S468C;ENSP00000357324:S597C;ENSP00000295566:S525C;ENSP00000357314:S479C;ENSP00000385791:S448C;ENSP00000385390:S459C;ENSP00000357323:S617C;ENSP00000437926:S325C	ENSP00000295566:S525C	S	-	2	0	YY1AP1	153896889	0.654000	0.27367	0.436000	0.26797	0.879000	0.50718	2.121000	0.41977	0.379000	0.24794	0.306000	0.20318	TCT	YY1AP1	-	NULL	ENSG00000163374		0.567	YY1AP1-043	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	YY1AP1	HGNC	protein_coding	OTTHUMT00000086027.1	-	0.00	46	0	G	NM_139118		155630265	-1	tier1	-	no_errors	ENST00000368339	ensembl	human	known	74_37	missense	35.82	43	24	SNP	0.685	C
ZBTB20	26137	genome.wustl.edu	37	3	114099155	114099155	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:114099155C>T	ENST00000474710.1	-	3	286	c.108G>A	c.(106-108)ctG>ctA	p.L36L	ZBTB20_ENST00000393785.2_5'UTR|ZBTB20-AS1_ENST00000460210.1_RNA|ZBTB20-AS1_ENST00000475939.1_RNA|ZBTB20_ENST00000464560.1_5'UTR|ZBTB20_ENST00000357258.3_5'UTR|ZBTB20_ENST00000462705.1_5'UTR|ZBTB20_ENST00000471418.1_5'UTR|ZBTB20_ENST00000481632.1_5'UTR	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	36						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		CTTCAAAGTTCAGGCAGGGAA	0.522																																					NSCLC(69;748 1344 9802 11203 30933)												0													193.0	165.0	173.0					3																	114099155		692	1591	2283	SO:0001819	synonymous_variant	0			AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.108G>A	3.37:g.114099155C>T			Q63HP6|Q8N6R5|Q9Y410	Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L36	ENST00000474710.1	37	c.108	CCDS54626.1	3																																																																																			ZBTB20	-	NULL	ENSG00000181722		0.522	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	-	0.00	53	0	C	NM_015642		114099155	-1	tier1	-	no_errors	ENST00000474710	ensembl	human	known	74_37	silent	8.20	56	5	SNP	1.000	T
ZNF208	7757	genome.wustl.edu	37	19	22155555	22155555	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr19:22155555A>G	ENST00000397126.4	-	4	2429	c.2281T>C	c.(2281-2283)Tcc>Ccc	p.S761P	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	761					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGGGTTGAGGACCACTTATAG	0.358																																																	0													29.0	31.0	30.0					19																	22155555		1939	4148	6087	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2281T>C	19.37:g.22155555A>G	ENSP00000380315:p.Ser761Pro			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S761P	ENST00000397126.4	37	c.2281	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	A	0.984	-0.695999	0.03279	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.37411	1.2	2.28	-4.55	0.03441	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.33440	0.0863	.	.	.	0.09310	N	1	D	0.64830	0.994	P	0.52481	0.7	T	0.20075	-1.0286	8	0.34782	T	0.22	.	2.3671	0.04322	0.1618:0.1098:0.4484:0.28	.	661	O43345	ZN208_HUMAN	P	761;661	ENSP00000380315:S761P	ENSP00000380315:S761P	S	-	1	0	ZNF208	21947395	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.128000	0.03247	-3.689000	0.00120	-1.431000	0.01090	TCC	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.358	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	34	0	A	NM_007153		22155555	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	41.51	31	22	SNP	0.000	G
ZNF385A	25946	genome.wustl.edu	37	12	54764422	54764422	+	Silent	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr12:54764422G>A	ENST00000338010.5	-	7	971	c.918C>T	c.(916-918)gcC>gcT	p.A306A	ZNF385A_ENST00000352268.6_Silent_p.A225A|ZNF385A_ENST00000551771.1_Silent_p.A205A|ZNF385A_ENST00000394313.2_Silent_p.A286A|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000552382.1_5'UTR|ZNF385A_ENST00000551109.1_Silent_p.A286A|ZNF385A_ENST00000546970.1_Silent_p.A286A	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	306	Necessary for binding to ITPR1, CEBPA and p53/TP53 mRNAs. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						CCAGCTCCCCGGCGCCCCTAG	0.706											OREG0021894	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													17.0	22.0	20.0					12																	54764422		2197	4297	6494	SO:0001819	synonymous_variant	0			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.918C>T	12.37:g.54764422G>A		1002	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.A306	ENST00000338010.5	37	c.918	CCDS44911.1	12																																																																																			ZNF385A	-	NULL	ENSG00000161642		0.706	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385A	HGNC	protein_coding	OTTHUMT00000406162.1	-	0.00	17	0	G	NM_015481		54764422	-1	tier1	-	no_errors	ENST00000338010	ensembl	human	known	74_37	silent	31.58	13	6	SNP	0.673	A
ZNF445	353274	genome.wustl.edu	37	3	44489304	44489304	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr3:44489304G>A	ENST00000396077.2	-	8	2206	c.1859C>T	c.(1858-1860)aCc>aTc	p.T620I	ZNF445_ENST00000425708.2_Missense_Mutation_p.T620I	NM_181489.5	NP_852466.1	P59923	ZN445_HUMAN	zinc finger protein 445	620					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|skin(3)	31				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		CTTCTCCTGGGTGTGAATCCT	0.418																																																	0													87.0	90.0	89.0					3																	44489304		2203	4300	6503	SO:0001583	missense	0			AY262260	CCDS2713.1	3p21.32	2013-01-09	2003-10-07		ENSG00000185219	ENSG00000185219		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21018	protein-coding gene	gene with protein product			"""zinc finger protein 168"""	ZNF168		7814019	Standard	NM_181489		Approved	ZKSCAN15, ZSCAN47	uc003cnf.2	P59923	OTTHUMG00000133042	ENST00000396077.2:c.1859C>T	3.37:g.44489304G>A	ENSP00000379387:p.Thr620Ile		Q3MJD1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T620I	ENST00000396077.2	37	c.1859	CCDS2713.1	3	.	.	.	.	.	.	.	.	.	.	G	17.42	3.384264	0.61845	.	.	ENSG00000185219	ENST00000425708;ENST00000396077	T;T	0.25749	1.78;1.78	3.88	3.88	0.44766	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.131434	0.35291	N	0.003310	T	0.50086	0.1595	M	0.74647	2.275	0.40234	D	0.977887	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.56926	-0.7898	10	0.87932	D	0	.	14.1465	0.65353	0.0:0.0:1.0:0.0	.	608;620	B7ZKX2;P59923	.;ZN445_HUMAN	I	620	ENSP00000413073:T620I;ENSP00000379387:T620I	ENSP00000379387:T620I	T	-	2	0	ZNF445	44464308	1.000000	0.71417	0.998000	0.56505	0.909000	0.53808	4.576000	0.60915	2.460000	0.83146	0.591000	0.81541	ACC	ZNF445	-	pfscan_Znf_C2H2	ENSG00000185219		0.418	ZNF445-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF445	HGNC	protein_coding	OTTHUMT00000256647.2	-	0.00	60	0	G	NM_181489		44489304	-1	tier1	-	no_errors	ENST00000396077	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	A
ZNF512B	57473	genome.wustl.edu	37	20	62594469	62594469	+	Silent	SNP	C	C	T			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr20:62594469C>T	ENST00000450537.1	-	12	2007	c.1947G>A	c.(1945-1947)gtG>gtA	p.V649V	ZNF512B_ENST00000217130.3_Silent_p.V649V|ZNF512B_ENST00000369888.1_Silent_p.V649V			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GCTCCGAGCGCACGTGGTAGT	0.652																																																	0													49.0	30.0	37.0					20																	62594469		2191	4288	6479	SO:0001819	synonymous_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1947G>A	20.37:g.62594469C>T			Q08AK9|Q9ULM4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V649	ENST00000450537.1	37	c.1947	CCDS13548.1	20																																																																																			ZNF512B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196700		0.652	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	-	0.00	32	0	C	NM_020713		62594469	-1	tier1	-	no_errors	ENST00000217130	ensembl	human	known	74_37	silent	25.00	27	9	SNP	0.997	T
ZNF697	90874	genome.wustl.edu	37	1	120165681	120165681	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr1:120165681G>A	ENST00000421812.2	-	3	1404	c.1285C>T	c.(1285-1287)Cgc>Tgc	p.R429C		NM_001080470.1	NP_001073939.1	Q5TEC3	ZN697_HUMAN	zinc finger protein 697	429					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0266)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0577)		GAGTGCGTGCGCTTGTGCGTG	0.667																																																	0													15.0	17.0	16.0					1																	120165681		2191	4292	6483	SO:0001583	missense	0			AK027019, BC033126	CCDS44202.1	1p12	2013-01-08			ENSG00000143067	ENSG00000143067		"""Zinc fingers, C2H2-type"""	32034	protein-coding gene	gene with protein product							Standard	NM_001080470		Approved	MGC45731	uc001ehy.1	Q5TEC3	OTTHUMG00000012962	ENST00000421812.2:c.1285C>T	1.37:g.120165681G>A	ENSP00000396857:p.Arg429Cys		Q96IT2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R429C	ENST00000421812.2	37	c.1285	CCDS44202.1	1	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041284	0.35989	.	.	ENSG00000143067	ENST00000421812	T	0.25749	1.78	4.98	4.06	0.47325	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37053	N	0.002276	T	0.48732	0.1516	M	0.91140	3.18	0.50039	D	0.999843	D	0.89917	1.0	D	0.79784	0.993	T	0.62402	-0.6862	10	0.87932	D	0	-24.5497	12.7507	0.57306	0.0:0.0:0.8342:0.1658	.	429	Q5TEC3	ZN697_HUMAN	C	429	ENSP00000396857:R429C	ENSP00000396857:R429C	R	-	1	0	ZNF697	119967204	0.671000	0.27521	1.000000	0.80357	0.031000	0.12232	2.165000	0.42396	1.228000	0.43614	-0.311000	0.09066	CGC	ZNF697	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000143067		0.667	ZNF697-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF697	HGNC	protein_coding	OTTHUMT00000036349.3	-	0.00	35	0	G	XM_371286		120165681	-1	tier1	-	no_errors	ENST00000421812	ensembl	human	known	74_37	missense	34.38	20	11	SNP	1.000	A
ZSCAN29	146050	genome.wustl.edu	37	15	43654034	43654034	+	Missense_Mutation	SNP	C	C	A	rs141880595		TCGA-L5-A4OM-01A-11D-A27G-09	TCGA-L5-A4OM-11A-11D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	cc69240d-8283-48c1-9eb2-5621f7ab1e28	6ea0b146-106f-426a-a3a0-d043d733a81f	g.chr15:43654034C>A	ENST00000396976.2	-	5	1930	c.1796G>T	c.(1795-1797)cGg>cTg	p.R599L	ZSCAN29_ENST00000562072.1_Missense_Mutation_p.G528C|ZSCAN29_ENST00000396972.1_Missense_Mutation_p.R210L|ZSCAN29_ENST00000568898.1_Missense_Mutation_p.R209L	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	599					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R599Q(1)		cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		ATGAAGATACCGGGGAATTTT	0.438																																																	1	Substitution - Missense(1)	skin(1)											127.0	121.0	123.0					15																	43654034		2201	4299	6500	SO:0001583	missense	0			AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1796G>T	15.37:g.43654034C>A	ENSP00000380174:p.Arg599Leu		B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R599L	ENST00000396976.2	37	c.1796	CCDS10095.2	15	.	.	.	.	.	.	.	.	.	.	C	2.389	-0.340383	0.05243	.	.	ENSG00000140265	ENST00000396976;ENST00000396972	T;T	0.07800	3.16;3.17	4.87	-0.825	0.10809	.	1.195060	0.05847	N	0.620410	T	0.09730	0.0239	L	0.59436	1.845	0.09310	N	1	B;B	0.25007	0.002;0.116	B;B	0.20384	0.004;0.029	T	0.42224	-0.9464	10	0.25106	T	0.35	2.3123	8.6464	0.34007	0.0:0.4459:0.0:0.5541	.	210;599	Q8IWY8-4;Q8IWY8	.;ZSC29_HUMAN	L	599;210	ENSP00000380174:R599L;ENSP00000380170:R210L	ENSP00000380170:R210L	R	-	2	0	ZSCAN29	41441326	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.508000	0.02266	-0.026000	0.13895	0.655000	0.94253	CGG	ZSCAN29	-	NULL	ENSG00000140265		0.438	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN29	HGNC	protein_coding	OTTHUMT00000253278.1	-	0.00	50	0	C	NM_152455		43654034	-1	tier1	-	no_errors	ENST00000396976	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.000	A
