#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ALPK3	57538	genome.wustl.edu	37	15	85406098	85406098	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:85406098C>T	ENST00000258888.5	+	10	5135	c.4968C>T	c.(4966-4968)ccC>ccT	p.P1656P		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1656	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			TGTTTGGGCCCAGCAGTGAGA	0.567																																																	0													139.0	139.0	139.0					15																	85406098		2203	4299	6502	SO:0001819	synonymous_variant	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4968C>T	15.37:g.85406098C>T			Q9P2L6	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.P1656	ENST00000258888.5	37	c.4968	CCDS10333.1	15																																																																																			ALPK3	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	ENSG00000136383		0.567	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	-	0.00	63	0	C	NM_020778		85406098	+1	tier1	-	no_errors	ENST00000258888	ensembl	human	known	74_37	silent	28.89	32	13	SNP	1.000	T
APOBR	55911	genome.wustl.edu	37	16	28507417	28507417	+	Intron	SNP	A	A	G	rs148114931|rs365499		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:28507417A>G	ENST00000431282.1	+	2	1058				CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000328423.5_Intron|APOBR_ENST00000564831.1_Missense_Mutation_p.E352G			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						TCAGGAGGGGAGGAGGCCGGG	0.706																																																	0													8.0	11.0	10.0					16																	28507417		1855	4001	5856	SO:0001627	intron_variant	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1048+7A>G	16.37:g.28507417A>G			H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.E352G	ENST00000431282.1	37	c.1055		16																																																																																			APOBR	-	NULL	ENSG00000184730		0.706	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		-	0.00	30	0	A	NM_182804		28507417	+1	tier1	rs365499	no_errors	ENST00000564831	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.010	G
ARPC1B	10095	genome.wustl.edu	37	7	98992032	98992032	+	Intron	SNP	A	A	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:98992032A>C	ENST00000451682.1	+	12	1389				PDAP1_ENST00000496335.1_Intron|ARPC1B_ENST00000252725.5_Intron			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GGGTGCCTGCAGGACAGCTGA	0.567																																																	0													103.0	90.0	95.0					7																	98992032		2203	4300	6503	SO:0001627	intron_variant	0			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.1081-42A>C	7.37:g.98992032A>C			Q9BU00	RNA	SNP	-	NULL	ENST00000451682.1	37	NULL	CCDS5661.1	7																																																																																			ARPC1B	-	-	ENSG00000130429		0.567	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	HGNC	protein_coding	OTTHUMT00000335894.1	-	0.00	69	0	A	NM_005720		98992032	+1	tier1	-	no_errors	ENST00000463078	ensembl	human	known	74_37	rna	22.86	53	16	SNP	0.000	C
ASAP2	8853	genome.wustl.edu	37	2	9437513	9437513	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:9437513G>T	ENST00000281419.3	+	3	624	c.284G>T	c.(283-285)gGa>gTa	p.G95V	ASAP2_ENST00000315273.4_Missense_Mutation_p.G95V	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	95					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						CCAGATTTAGGAAGTGCGTTC	0.468																																																	0													127.0	109.0	115.0					2																	9437513		2203	4300	6503	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.284G>T	2.37:g.9437513G>T	ENSP00000281419:p.Gly95Val		D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.G95V	ENST00000281419.3	37	c.284	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	G	25.5	4.647863	0.87958	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.05081	3.5;3.5	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.26738	0.0654	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.78314	0.956;0.991	T	0.00379	-1.1777	10	0.72032	D	0.01	.	19.3857	0.94555	0.0:0.0:1.0:0.0	.	95;95	O43150-2;O43150	.;ASAP2_HUMAN	V	95	ENSP00000281419:G95V;ENSP00000316404:G95V	ENSP00000281419:G95V	G	+	2	0	ASAP2	9354964	1.000000	0.71417	0.534000	0.28014	0.842000	0.47809	9.860000	0.99555	2.573000	0.86826	0.650000	0.86243	GGA	ASAP2	-	NULL	ENSG00000151693		0.468	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	-	0.00	58	0	G	NM_003887		9437513	+1	tier1	-	no_errors	ENST00000281419	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
ASTE1	28990	genome.wustl.edu	37	3	130735055	130735055	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:130735055A>G	ENST00000264992.3	-	5	2083	c.1642T>C	c.(1642-1644)Tgt>Cgt	p.C548R	ATP2C1_ENST00000328560.8_3'UTR|ASTE1_ENST00000514044.1_Missense_Mutation_p.C548R|ATP2C1_ENST00000507488.2_Silent_p.T912T|ATP2C1_ENST00000422190.2_Silent_p.T928T|ATP2C1_ENST00000513801.1_Silent_p.T912T|ATP2C1_ENST00000533801.2_Silent_p.T933T|ATP2C1_ENST00000504381.1_Silent_p.T883T|ATP2C1_ENST00000393221.4_Silent_p.T962T|ATP2C1_ENST00000359644.3_Silent_p.T938T	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	548					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						ATCTGGAGACAGGACTGCCAC	0.512																																																	0													165.0	145.0	152.0					3																	130735055		2203	4300	6503	SO:0001583	missense	0			AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1642T>C	3.37:g.130735055A>G	ENSP00000264992:p.Cys548Arg		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	pfam_XPG_DNA_repair_N	p.C548R	ENST00000264992.3	37	c.1642	CCDS3068.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	24.6|24.6	4.550702|4.550702	0.86127|0.86127	.|.	.|.	ENSG00000034533|ENSG00000017260	ENST00000514044;ENST00000264992|ENST00000504612	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71854|0.71854	0.3389|0.3389	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.71020|0.71020	-0.4713|-0.4713	8|4	0.87932|.	D|.	0|.	-17.0561|-17.0561	15.6639|15.6639	0.77209|0.77209	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	548;548|.	D6RG30;Q2TB18|.	.;ASTE1_HUMAN|.	R|R	548|892	.|.	ENSP00000264992:C548R|.	C|Q	-|+	1|2	0|0	ASTE1|ATP2C1	132217745|132217745	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	5.416000|5.416000	0.66417|0.66417	2.176000|2.176000	0.68965|0.68965	0.533000|0.533000	0.62120|0.62120	TGT|CAG	ASTE1	-	NULL	ENSG00000034533		0.512	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1	-	0.00	51	0	A	NM_014065		130735055	-1	tier1	-	no_errors	ENST00000264992	ensembl	human	known	74_37	missense	15.69	43	8	SNP	1.000	G
ATP2A2	488	genome.wustl.edu	37	12	110777494	110777494	+	Missense_Mutation	SNP	C	C	T	rs147733067		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:110777494C>T	ENST00000539276.2	+	13	1838	c.1729C>T	c.(1729-1731)Ctt>Ttt	p.L577F	ATP2A2_ENST00000395494.2_Missense_Mutation_p.L550F|ATP2A2_ENST00000308664.6_Missense_Mutation_p.L577F			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	577	Interacts with HAX1.				blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						AGAAATGCACCTTGAGGACTC	0.463																																																	0													48.0	53.0	51.0					12																	110777494		2203	4300	6503	SO:0001583	missense	0				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1729C>T	12.37:g.110777494C>T	ENSP00000440045:p.Leu577Phe		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.L577F	ENST00000539276.2	37	c.1729	CCDS9144.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.47|19.47	3.834486|3.834486	0.71373|0.71373	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.96168|.	-3.93;-3.93;-3.93|.	5.78|5.78	4.9|4.9	0.64082|0.64082	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);ATPase, P-type, cytoplasmic domain N (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71651|0.71651	0.3365|0.3365	M|M	0.66439|0.66439	2.03|2.03	0.80722|0.80722	D|D	1|1	B;B;B|.	0.30973|.	0.302;0.045;0.049|.	B;B;B|.	0.31547|.	0.132;0.026;0.046|.	T|T	0.71540|0.71540	-0.4562|-0.4562	10|5	0.51188|.	T|.	0.08|.	.|.	14.8007|14.8007	0.69913|0.69913	0.0:0.9307:0.0:0.0693|0.0:0.9307:0.0:0.0693	.|.	550;577;577|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	F|L	577;550;577|467	ENSP00000311186:L577F;ENSP00000378872:L550F;ENSP00000440045:L577F|.	ENSP00000311186:L577F|.	L|P	+|+	1|2	0|0	ATP2A2|ATP2A2	109261877|109261877	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.968000|0.968000	0.65278|0.65278	4.070000|4.070000	0.57548|0.57548	1.457000|1.457000	0.47850|0.47850	0.563000|0.563000	0.77884|0.77884	CTT|CCT	ATP2A2	-	superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Ca-transp_IIA	ENSG00000174437		0.463	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	HGNC	protein_coding	OTTHUMT00000403539.1	-	0.00	71	0	C	NM_001681		110777494	+1	tier1	-	no_errors	ENST00000539276	ensembl	human	known	74_37	missense	11.76	60	8	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181453096	181453096	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:181453096C>T	ENST00000367573.2	+	1	216	c.216C>T	c.(214-216)ttC>ttT	p.F72F	CACNA1E_ENST00000367570.1_Silent_p.F72F|CACNA1E_ENST00000357570.5_Silent_p.F23F|CACNA1E_ENST00000360108.3_Silent_p.F72F|CACNA1E_ENST00000358338.5_Silent_p.F23F|CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000526775.1_Silent_p.F72F	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	72					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.F72F(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TGTTCATCTTCGGAGAAGATA	0.498																																																	1	Substitution - coding silent(1)	large_intestine(1)											169.0	173.0	172.0					1																	181453096		1913	4133	6046	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.216C>T	1.37:g.181453096C>T			B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.F72	ENST00000367573.2	37	c.216	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.498	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	-	0.00	81	0	C	NM_000721		181453096	+1	tier1	-	no_errors	ENST00000367573	ensembl	human	known	74_37	silent	20.73	65	17	SNP	1.000	T
CADPS2	93664	genome.wustl.edu	37	7	122194686	122194686	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:122194686C>T	ENST00000449022.2	-	8	1412	c.1393G>A	c.(1393-1395)Gtt>Att	p.V465I	CADPS2_ENST00000313070.7_Missense_Mutation_p.V465I|CADPS2_ENST00000412584.2_Missense_Mutation_p.V465I|CADPS2_ENST00000476131.1_5'UTR|CADPS2_ENST00000334010.7_Missense_Mutation_p.V465I	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	465					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						TTTTTTGGAACTACCATTCGG	0.378																																																	0													128.0	113.0	117.0					7																	122194686		1822	4069	5891	SO:0001583	missense	0				CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.1393G>A	7.37:g.122194686C>T	ENSP00000398481:p.Val465Ile		A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,pfam_Pleckstrin_homology,superfamily_C2_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.V465I	ENST00000449022.2	37	c.1393	CCDS55158.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.76|17.76	3.469376|3.469376	0.63625|0.63625	.|.	.|.	ENSG00000081803|ENSG00000081803	ENST00000397721|ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	.|T;T;T;T	.|0.71579	.|-0.58;-0.58;-0.58;-0.58	5.55|5.55	5.55|5.55	0.83447|0.83447	.|C2 calcium/lipid-binding domain, CaLB (1);	.|0.077111	.|0.53938	.|D	.|0.000051	T|T	0.73583|0.73583	0.3605|0.3605	M|M	0.76574|0.76574	2.34|2.34	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B;B	.|0.23540	.|0.033;0.087;0.015	.|B;B;B	.|0.23150	.|0.044;0.018;0.028	T|T	0.71659|0.71659	-0.4526|-0.4526	5|10	.|0.56958	.|D	.|0.05	-18.1944|-18.1944	19.5003|19.5003	0.95091|0.95091	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|465;465;465	.|Q86UW7-2;Q86UW7;Q86UW7-3	.|.;CAPS2_HUMAN;.	N|I	113|465;465;465;432;465;465	.|ENSP00000325581:V465I;ENSP00000333940:V465I;ENSP00000400401:V465I;ENSP00000398481:V465I	.|ENSP00000325581:V465I	S|V	-|-	2|1	0|0	CADPS2|CADPS2	121981922|121981922	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.976000|0.976000	0.68499|0.68499	4.731000|4.731000	0.62022|0.62022	2.594000|2.594000	0.87642|0.87642	0.585000|0.585000	0.79938|0.79938	AGT|GTT	CADPS2	-	superfamily_C2_dom	ENSG00000081803		0.378	CADPS2-001	KNOWN	basic|CCDS	protein_coding	CADPS2	HGNC	protein_coding	OTTHUMT00000347414.2	-	0.00	74	0	C	NM_017954		122194686	-1	tier1	-	no_errors	ENST00000449022	ensembl	human	known	74_37	missense	14.61	76	13	SNP	0.997	T
CAMK1G	57172	genome.wustl.edu	37	1	209768386	209768386	+	Missense_Mutation	SNP	C	C	T	rs375301374		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:209768386C>T	ENST00000009105.1	+	2	303	c.58C>T	c.(58-60)Cgg>Tgg	p.R20W	CAMK1G_ENST00000361322.2_Missense_Mutation_p.R20W			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	20						calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		CACCAACATCCGGAAAACCTT	0.512																																					Ovarian(163;530 1939 9680 28669 48710)												0								C	TRP/ARG	0,4406		0,0,2203	96.0	94.0	95.0		58	3.4	1.0	1		95	1,8599	1.2+/-3.3	0,1,4299	no	missense	CAMK1G	NM_020439.2	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	20/477	209768386	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.58C>T	1.37:g.209768386C>T	ENSP00000009105:p.Arg20Trp		Q86UH5|Q9Y3J7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R20W	ENST00000009105.1	37	c.58	CCDS1486.1	1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694064	0.68386	0.0	1.16E-4	ENSG00000008118	ENST00000009105;ENST00000423146;ENST00000361322	T;T;T	0.67523	1.04;-0.27;1.04	5.31	3.39	0.38822	Protein kinase-like domain (1);	0.000000	0.46442	D	0.000284	T	0.74450	0.3718	L	0.59436	1.845	0.53005	D	0.999961	D;D	0.89917	1.0;1.0	D;D	0.68621	0.959;0.95	T	0.73375	-0.4002	10	0.72032	D	0.01	.	8.0241	0.30427	0.3467:0.5755:0.0:0.0778	.	20;20	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	W	20	ENSP00000009105:R20W;ENSP00000392173:R20W;ENSP00000354861:R20W	ENSP00000009105:R20W	R	+	1	2	CAMK1G	207835009	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	0.476000	0.22180	0.565000	0.29255	0.655000	0.94253	CGG	CAMK1G	-	superfamily_Kinase-like_dom	ENSG00000008118		0.512	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1G	HGNC	protein_coding	OTTHUMT00000088526.1	-	0.00	60	0	C	NM_020439		209768386	+1	tier1	-	no_errors	ENST00000009105	ensembl	human	known	74_37	missense	21.11	71	19	SNP	1.000	T
CDH5	1003	genome.wustl.edu	37	16	66423357	66423357	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:66423357A>G	ENST00000341529.3	+	5	861	c.713A>G	c.(712-714)gAc>gGc	p.D238G	CDH5_ENST00000563425.2_Missense_Mutation_p.D238G	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	238	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CTCCGGGGGGACTCGGGCACG	0.597																																																	0													61.0	61.0	61.0					16																	66423357		2202	4300	6502	SO:0001583	missense	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.713A>G	16.37:g.66423357A>G	ENSP00000344115:p.Asp238Gly		Q4VAI5|Q4VAI6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D238G	ENST00000341529.3	37	c.713	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	A	15.06	2.721977	0.48728	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.52057	0.68	5.69	5.69	0.88448	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.45637	0.1352	L	0.29908	0.895	0.80722	D	1	B	0.27264	0.173	B	0.38156	0.266	T	0.48592	-0.9022	9	0.87932	D	0	.	15.1403	0.72607	1.0:0.0:0.0:0.0	.	238	P33151	CADH5_HUMAN	G	238	ENSP00000344115:D238G	ENSP00000344115:D238G	D	+	2	0	CDH5	64980858	1.000000	0.71417	0.621000	0.29145	0.606000	0.37113	6.454000	0.73493	2.175000	0.68902	0.533000	0.62120	GAC	CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000179776		0.597	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1	-	0.00	51	0	A	NM_001795		66423357	+1	tier1	-	no_errors	ENST00000341529	ensembl	human	known	74_37	missense	12.28	50	7	SNP	0.993	G
CBFA2T3	863	genome.wustl.edu	37	16	88947727	88947727	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:88947727G>A	ENST00000268679.4	-	9	1770	c.1374C>T	c.(1372-1374)agC>agT	p.S458S	CBFA2T3_ENST00000360302.2_Silent_p.S372S|CBFA2T3_ENST00000327483.5_Silent_p.S372S|RP11-830F9.5_ENST00000565053.1_RNA|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000562574.1_RNA|CBFA2T3_ENST00000448839.1_Silent_p.S382S|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000436887.2_Silent_p.S420S	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	458					cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		GACCGGCGGAGCTGCTgcggg	0.736			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0													9.0	10.0	10.0					16																	88947727		2143	4239	6382	SO:0001819	synonymous_variant	0			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.1374C>T	16.37:g.88947727G>A			D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Silent	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.S458	ENST00000268679.4	37	c.1374	CCDS10972.1	16																																																																																			CBFA2T3	-	NULL	ENSG00000129993		0.736	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2	-	0.00	48	0	G	NM_005187		88947727	-1	tier1	-	no_errors	ENST00000268679	ensembl	human	known	74_37	silent	25.93	20	7	SNP	0.997	A
CDKN2A	1029	genome.wustl.edu	37	9	21974695	21974695	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:21974695G>T	ENST00000304494.5	-	1	402	c.132C>A	c.(130-132)taC>taA	p.Y44*	CDKN2A_ENST00000579755.1_Intron|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000494262.1_Intron|CDKN2A_ENST00000446177.1_Nonsense_Mutation_p.Y44*|CDKN2A_ENST00000361570.3_Intron|CDKN2A_ENST00000498628.2_Intron|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000498124.1_Nonsense_Mutation_p.Y44*|CDKN2A_ENST00000579122.1_Nonsense_Mutation_p.Y44*	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	44					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(25)|p.Y44*(3)|p.0(1)|p.V28_V51del(1)|p.G45del(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCCTCCGACCGTAACTATTCG	0.682		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1346	Whole gene deletion(1316)|Unknown(25)|Substitution - Nonsense(3)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(278)|skin(168)|central_nervous_system(163)|lung(151)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(52)|oesophagus(51)|upper_aerodigestive_tract(48)|ovary(34)|kidney(31)|breast(30)|pancreas(29)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CI056876|CI075603|CM980323	CDKN2A	I|M							56.0	66.0	63.0					9																	21974695		2203	4300	6503	SO:0001587	stop_gained	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.132C>A	9.37:g.21974695G>T	ENSP00000307101:p.Tyr44*		A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Nonsense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.Y44*	ENST00000304494.5	37	c.132	CCDS6510.1	9	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584668	0.65992	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	.	.	.	4.89	-2.57	0.06248	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.5958	0.08005	0.2792:0.0:0.3159:0.4049	.	.	.	.	X	44	.	ENSP00000307101:Y44X	Y	-	3	2	CDKN2A	21964695	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.597000	0.05713	-0.621000	0.05633	-0.182000	0.12963	TAC	CDKN2A	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000147889		0.682	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1	-	0.00	30	0	G	NM_000077		21974695	-1	tier1	-	no_errors	ENST00000446177	ensembl	human	known	74_37	nonsense	33.33	8	4	SNP	0.020	T
CDKN2D	1032	genome.wustl.edu	37	19	10677846	10677846	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:10677846G>T	ENST00000393599.2	-	2	713	c.389C>A	c.(388-390)tCt>tAt	p.S130Y	CDKN2D_ENST00000335766.2_Missense_Mutation_p.S130Y|KRI1_ENST00000312962.6_5'Flank|KRI1_ENST00000361821.5_5'Flank|KRI1_ENST00000537964.1_5'Flank	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	130					autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ATGGAGATCAGATTCAGCTGC	0.607																																																	0													119.0	111.0	114.0					19																	10677846		2203	4300	6503	SO:0001583	missense	0				CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273		ENST00000393599.2:c.389C>A	19.37:g.10677846G>T	ENSP00000377224:p.Ser130Tyr		Q13102|Q6FGE9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S130Y	ENST00000393599.2	37	c.389	CCDS12244.1	19	.	.	.	.	.	.	.	.	.	.	g	23.2	4.392728	0.83011	.	.	ENSG00000129355	ENST00000335766;ENST00000393599	T;T	0.65364	-0.15;-0.15	4.96	4.96	0.65561	Ankyrin repeat-containing domain (4);	0.132945	0.51477	D	0.000086	T	0.74974	0.3787	L	0.54323	1.7	0.58432	D	0.999996	D	0.76494	0.999	D	0.69479	0.964	T	0.78059	-0.2352	10	0.87932	D	0	-15.0509	16.9548	0.86256	0.0:0.0:1.0:0.0	.	130	P55273	CDN2D_HUMAN	Y	130	ENSP00000337056:S130Y;ENSP00000377224:S130Y	ENSP00000337056:S130Y	S	-	2	0	CDKN2D	10538846	1.000000	0.71417	0.718000	0.30602	0.907000	0.53573	8.564000	0.90726	2.293000	0.77203	0.462000	0.41574	TCT	CDKN2D	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000129355		0.607	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2D	HGNC	protein_coding	OTTHUMT00000452030.1	-	0.00	45	0	G	NM_079421		10677846	-1	tier1	-	no_errors	ENST00000335766	ensembl	human	known	74_37	missense	22.22	28	8	SNP	0.827	T
CHEK2	11200	genome.wustl.edu	37	22	29091840	29091840	+	Missense_Mutation	SNP	T	T	C	rs142470496	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:29091840T>C	ENST00000405598.1	-	12	1308	c.1117A>G	c.(1117-1119)Aag>Gag	p.K373E	CHEK2_ENST00000404276.1_Missense_Mutation_p.K373E|CHEK2_ENST00000464581.1_5'Flank|CHEK2_ENST00000348295.3_Missense_Mutation_p.K344E|CHEK2_ENST00000382580.2_Missense_Mutation_p.K416E|CHEK2_ENST00000403642.1_Missense_Mutation_p.K282E|CHEK2_ENST00000382578.1_Missense_Mutation_p.K282E|CHEK2_ENST00000402731.1_Missense_Mutation_p.K344E|CHEK2_ENST00000328354.6_Missense_Mutation_p.K373E|CHEK2_ENST00000382566.1_3'UTR|CHEK2_ENST00000382565.1_Intron|CHEK2_ENST00000544772.1_Missense_Mutation_p.K152E			O96017	CHK2_HUMAN	checkpoint kinase 2	373	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|T-loop/activation segment.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.K373E(9)		central_nervous_system(17)|endometrium(2)|kidney(11)|large_intestine(2)|lung(11)|ovary(1)|prostate(4)|stomach(2)	50						CCCAAAATCTTGGAGTGCCCA	0.418			F			breast		Direct reversal of damage;Other conserved DNA damage response genes																															yes	Rec		familial breast cancer	22	22q12.1	11200	CHK2 checkpoint homolog (S. pombe)		E	9	Substitution - Missense(9)	kidney(4)|prostate(2)|endometrium(1)|stomach(1)|central_nervous_system(1)																																								SO:0001583	missense	0			AF086904	CCDS13843.1, CCDS13844.1, CCDS33629.1	22q12.1	2014-09-17	2011-11-11	2001-09-27	ENSG00000183765	ENSG00000183765			16627	protein-coding gene	gene with protein product		604373	"""CHK2 (checkpoint, S.pombe) homolog"", ""CHK2 checkpoint homolog (S. pombe)"""	RAD53		9836640, 10097108	Standard	NM_001257387		Approved	CDS1, CHK2, HuCds1, PP1425, bA444G7	uc003adt.1	O96017	OTTHUMG00000151023	ENST00000405598.1:c.1117A>G	22.37:g.29091840T>C	ENSP00000386087:p.Lys373Glu		A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_FHA_dom,superfamily_Kinase-like_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FHA_dom,pfscan_Prot_kinase_dom	p.K416E	ENST00000405598.1	37	c.1246	CCDS13843.1	22	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754336	0.69648	.	.	ENSG00000183765	ENST00000348295;ENST00000382578;ENST00000544772;ENST00000328354;ENST00000404276;ENST00000405598;ENST00000382580;ENST00000403642;ENST00000402731	T;T;T;T;T;T;T;T;T	0.54071	0.9;0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.9	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.043710	0.85682	D	0.000000	T	0.56292	0.1975	N	0.11756	0.17	0.80722	D	1	D;D;D;D;D;D	0.76494	0.996;0.999;0.998;0.998;0.993;0.991	P;D;D;D;D;P	0.74674	0.905;0.984;0.943;0.969;0.923;0.896	T	0.64769	-0.6329	10	0.87932	D	0	-1.7726	15.4726	0.75453	0.0:0.0:0.0:1.0	.	282;152;373;344;373;416	O96017-4;Q9HBS5;A8JZZ5;O96017-12;O96017;O96017-9	.;.;.;.;CHK2_HUMAN;.	E	344;282;152;373;373;373;416;282;344	ENSP00000329012:K344E;ENSP00000372021:K282E;ENSP00000442458:K152E;ENSP00000329178:K373E;ENSP00000385747:K373E;ENSP00000386087:K373E;ENSP00000372023:K416E;ENSP00000384919:K282E;ENSP00000384835:K344E	ENSP00000329178:K373E	K	-	1	0	CHEK2	27421840	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	4.270000	0.58896	2.248000	0.74166	0.528000	0.53228	AAG	CHEK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183765		0.418	CHEK2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHEK2	HGNC	protein_coding	OTTHUMT00000321150.1		0.00	55	0	T	NM_001005735		29091840	-1			no_errors	ENST00000382580	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	C
CHSY1	22856	genome.wustl.edu	37	15	101718692	101718692	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:101718692C>T	ENST00000254190.3	-	3	1785	c.1310G>A	c.(1309-1311)cGc>cAc	p.R437H	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	437					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GTTCACCCGGCGGTAGCCGTA	0.532																																																	0													54.0	54.0	54.0					15																	101718692		2203	4300	6503	SO:0001583	missense	0			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1310G>A	15.37:g.101718692C>T	ENSP00000254190:p.Arg437His		Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.R437H	ENST00000254190.3	37	c.1310	CCDS10390.1	15	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071577	0.36566	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.20332	2.08	5.8	4.89	0.63831	.	0.059827	0.64402	N	0.000004	T	0.24198	0.0586	L	0.45285	1.41	0.58432	D	0.999999	P	0.41947	0.766	B	0.43680	0.427	T	0.01356	-1.1376	10	0.39692	T	0.17	-43.9336	14.9774	0.71286	0.0:0.9317:0.0:0.0683	.	437	Q86X52	CHSS1_HUMAN	H	437;165	ENSP00000254190:R437H	ENSP00000254190:R437H	R	-	2	0	CHSY1	99536215	1.000000	0.71417	0.591000	0.28745	0.946000	0.59487	5.818000	0.69236	1.454000	0.47793	0.655000	0.94253	CGC	CHSY1	-	pfam_Chond_GalNAc	ENSG00000131873		0.532	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY1	HGNC	protein_coding	OTTHUMT00000313624.1	-	0.00	55	0	C	NM_014918		101718692	-1	tier1	-	no_errors	ENST00000254190	ensembl	human	known	74_37	missense	7.58	61	5	SNP	0.997	T
CLEC18A	348174	genome.wustl.edu	37	16	69988452	69988452	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:69988452C>T	ENST00000288040.6	+	3	619	c.432C>T	c.(430-432)aaC>aaT	p.N144N	CLEC18A_ENST00000568461.1_Silent_p.N144N|CLEC18A_ENST00000449317.2_Silent_p.N144N|CLEC18A_ENST00000393701.2_Silent_p.N144N	NM_001136214.2	NP_001129686.1	A5D8T8	CL18A_HUMAN	C-type lectin domain family 18, member A	144	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(2)|lung(1)|skin(1)	5						GTGCTCGCAACGCCACCTGCA	0.612																																																	0													19.0	21.0	20.0					16																	69988452		2190	4250	6440	SO:0001819	synonymous_variant	0			AF428259	CCDS10886.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157322		"""C-type lectin domain containing"""	30388	protein-coding gene	gene with protein product	"""mannose receptor-like"""					12975309	Standard	NM_001136214		Approved	MRCL	uc010vlo.3	A5D8T8		ENST00000288040.6:c.432C>T	16.37:g.69988452C>T			A8K1G9|Q6DCB3|Q7Z5K9|Q96HH2	Silent	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EG-like_dom,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.N144	ENST00000288040.6	37	c.432	CCDS10886.1	16																																																																																			CLEC18A	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000157322		0.612	CLEC18A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC18A	HGNC	protein_coding	OTTHUMT00000268955.2		0.00	64	0	C	NM_182619		69988452	+1			no_errors	ENST00000449317	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.211	T
CNTLN	54875	genome.wustl.edu	37	9	17330768	17330768	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:17330768C>T	ENST00000380647.3	+	9	1564	c.1480C>T	c.(1480-1482)Cga>Tga	p.R494*	CNTLN_ENST00000262360.5_Nonsense_Mutation_p.R494*|CNTLN_ENST00000425824.1_Nonsense_Mutation_p.R494*			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	494					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.R494R(1)		breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGGTTTCTCCCGAAAGAGCAT	0.383																																																	1	Substitution - coding silent(1)	lung(1)											117.0	110.0	112.0					9																	17330768		1861	4092	5953	SO:0001587	stop_gained	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1480C>T	9.37:g.17330768C>T	ENSP00000370021:p.Arg494*		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Nonsense_Mutation	SNP	superfamily_Prefoldin	p.R494*	ENST00000380647.3	37	c.1480	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	C	23.7	4.448101	0.84101	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	.	.	.	5.0	2.13	0.27403	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	7.4358	0.27154	0.2075:0.1252:0.6673:0.0	.	.	.	.	X	494	.	ENSP00000262360:R494X	R	+	1	2	CNTLN	17320768	0.819000	0.29175	0.342000	0.25602	0.015000	0.08874	1.507000	0.35758	0.617000	0.30160	-0.139000	0.14373	CGA	CNTLN	-	NULL	ENSG00000044459		0.383	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3	-	0.00	39	0	C	NM_017738		17330768	+1	tier1	-	no_errors	ENST00000380647	ensembl	human	known	74_37	nonsense	23.68	29	9	SNP	0.043	T
CRB2	286204	genome.wustl.edu	37	9	126118544	126118544	+	Missense_Mutation	SNP	C	C	T	rs201425854	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:126118544C>T	ENST00000373631.3	+	1	6	c.5C>T	c.(4-6)gCg>gTg	p.A2V	CRB2_ENST00000359999.3_Missense_Mutation_p.A2V	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	2					cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						GCTGCCATGGCGCTGGCCAGG	0.711													C|||	2	0.000399361	0.0	0.0	5008	,	,		8172	0.0		0.002	False		,,,				2504	0.0																0								C	VAL/ALA	1,3509		0,1,1754	4.0	5.0	4.0		5	3.2	1.0	9		4	10,6758		0,10,3374	no	missense	CRB2	NM_173689.5	64	0,11,5128	TT,TC,CC		0.1478,0.0285,0.107	benign	2/1286	126118544	11,10267	1755	3384	5139	SO:0001583	missense	0			AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.5C>T	9.37:g.126118544C>T	ENSP00000362734:p.Ala2Val		A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.A2V	ENST00000373631.3	37	c.5	CCDS6852.2	9	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969239	0.74246	2.85E-4	0.001478	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.86432	-2.12;-1.96	3.23	3.23	0.37069	.	0.919640	0.08827	U	0.887925	D	0.82370	0.5022	N	0.14661	0.345	0.80722	D	1	D;D	0.63880	0.968;0.993	B;P	0.54270	0.27;0.747	T	0.75900	-0.3154	10	0.31617	T	0.26	.	6.9641	0.24613	0.0:0.8631:0.0:0.1369	.	2;2	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	V	2	ENSP00000353092:A2V;ENSP00000362734:A2V	ENSP00000353092:A2V	A	+	2	0	CRB2	125158365	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.712000	0.37940	1.755000	0.51935	0.471000	0.43371	GCG	CRB2	-	NULL	ENSG00000148204		0.711	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB2	HGNC	protein_coding	OTTHUMT00000053990.3	-	0.00	61	0	C	NM_173689		126118544	+1	tier1	rs201425854	no_errors	ENST00000373631	ensembl	human	known	74_37	missense	37.50	55	33	SNP	1.000	T
DCDC1	341019	genome.wustl.edu	37	11	31149099	31149099	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:31149099G>T	ENST00000597505.1	-	9	1401	c.1402C>A	c.(1402-1404)Cag>Aag	p.Q468K	DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					AATTGCTCCTGCTCAGCCTGT	0.478																																																	0																																										SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1402C>A	11.37:g.31149099G>T	ENSP00000472625:p.Gln468Lys		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.Q468K	ENST00000597505.1	37	c.1402		11																																																																																			DCDC1	-	NULL	ENSG00000170959		0.478	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	145	0	G	NM_181807		31149099	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	14.05	104	17	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155241544	155241544	+	Silent	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:155241544T>C	ENST00000357232.4	-	14	3641	c.3642A>G	c.(3640-3642)ctA>ctG	p.L1214L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1214	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATGACTCATCTAGCATAAACG	0.383																																																	0													170.0	152.0	158.0					4																	155241544		2203	4300	6503	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3642A>G	4.37:g.155241544T>C			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L1214	ENST00000357232.4	37	c.3642	CCDS3785.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.383	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	82	0	T	NM_001142552		155241544	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	silent	18.60	70	16	SNP	0.772	C
DDX27	55661	genome.wustl.edu	37	20	47860465	47860465	+	3'UTR	DEL	A	A	-	rs528816213|rs142292900	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr20:47860465delA	ENST00000371764.4	+	0	2494				ZNFX1_ENST00000469991.1_Intron|ZNFX1_ENST00000371754.4_Intron|DDX27_ENST00000484427.1_3'UTR	NM_017895.7	NP_060365.7	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	45			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CCATTTGTTTAAAAAAAAAAC	0.428																																																	0										72,130,4042		2,0,68,0,130,1922						-1.7	0.0		dbSNP_134	33	133,194,7917		0,0,133,0,194,3795	no	utr-3	DDX27	NM_017895.7		2,0,201,0,324,5717	A1A1,A1A2,A1R,A2A2,A2R,RR		3.9665,4.7597,4.2361				205,324,11959				SO:0001624	3_prime_UTR_variant	0			AL049766	CCDS13416.1	20q13.13	2010-07-06	2003-06-13		ENSG00000124228	ENSG00000124228		"""DEAD-boxes"""	15837	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 27"""				Standard	NM_017895		Approved	dJ686N3.1, DRS1	uc002xuh.3	Q96GQ7	OTTHUMG00000033072	ENST00000371764.4:c.*94A>-	20.37:g.47860465delA			A0AVB6|B7ZLY1|Q5VXM7|Q8WYG4|Q969N7|Q96F57|Q96L97|Q9BWY9|Q9BXF0|Q9H990|Q9NWU3|Q9P0C2|Q9UGD6	RNA	DEL	-	NULL	ENST00000371764.4	37	NULL	CCDS13416.1	20																																																																																			DDX27	-	-	ENSG00000124228		0.428	DDX27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX27	HGNC	protein_coding	OTTHUMT00000080485.1		0.00	22	0	A			47860465	+1	tier1		no_errors	ENST00000471144	ensembl	human	known	74_37	rna	6.90	27	2	DEL	0.005	-
DDX60L	91351	genome.wustl.edu	37	4	169351738	169351738	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:169351738T>A	ENST00000511577.1	-	13	1815	c.1568A>T	c.(1567-1569)tAt>tTt	p.Y523F	DDX60L_ENST00000260184.7_Missense_Mutation_p.Y523F|DDX60L_ENST00000505890.1_Missense_Mutation_p.Y523F			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	523							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AAATTGCTGATAATCCTGAAT	0.348																																																	0													51.0	46.0	48.0					4																	169351738		1816	4071	5887	SO:0001583	missense	0			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1568A>T	4.37:g.169351738T>A	ENSP00000422423:p.Tyr523Phe		Q96ND6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Y523F	ENST00000511577.1	37	c.1568		4	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.483269	0.01027	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.12361	2.69;2.69;2.69;3.42	3.54	-7.08	0.01558	.	0.865878	0.09312	U	0.819401	T	0.04407	0.0121	N	0.12443	0.215	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.42481	-0.9449	10	0.06757	T	0.87	.	5.0552	0.14529	0.5463:0.1951:0.0:0.2586	.	523;523;523	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	F	523;523;523;251	ENSP00000260184:Y523F;ENSP00000422423:Y523F;ENSP00000422202:Y523F;ENSP00000421026:Y251F	ENSP00000260184:Y523F	Y	-	2	0	DDX60L	169588313	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.184000	0.03076	-1.272000	0.02427	-0.538000	0.04264	TAT	DDX60L	-	NULL	ENSG00000181381		0.348	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1	-	0.00	41	0	T	NM_001012967		169351738	-1	tier1	-	no_errors	ENST00000260184	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.000	A
DGCR9	25787	genome.wustl.edu	37	22	19005960	19005960	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:19005960C>T	ENST00000609630.1	+	0	614				DGCR5_ENST00000440005.2_RNA	NR_024159.1				DiGeorge syndrome critical region gene 9 (non-protein coding)																		TGAGGCCGGTCCTCACTCACT	0.607																																																	0																																												0			L77571		22q11.21	2014-06-12	2014-06-12			ENSG00000273032			17227	non-coding RNA	RNA, long non-coding			"""DiGeorge syndrome critical region gene 9"""			8776594	Standard	NR_024159		Approved	DGS-A, POM121L5P	uc002zop.3				22.37:g.19005960C>T				RNA	SNP	-	NULL	ENST00000609630.1	37	NULL		22																																																																																			DGCR9	-	-	ENSG00000273032		0.607	DGCR9-001	KNOWN	basic	lincRNA	DGCR9	HGNC	lincRNA	OTTHUMT00000472253.1	-	0.00	95	0	C			19005960	+1	tier1	-	no_errors	ENST00000609630	ensembl	human	known	74_37	rna	26.45	89	32	SNP	0.000	T
DHH	50846	genome.wustl.edu	37	12	49485080	49485080	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:49485080G>A	ENST00000266991.2	-	2	702	c.396C>T	c.(394-396)gaC>gaT	p.D132D	RP11-386G11.8_ENST00000553174.1_RNA|RP11-386G11.8_ENST00000548030.1_RNA	NM_021044.2	NP_066382.1	O43323	DHH_HUMAN	desert hedgehog	132					cell-cell signaling (GO:0007267)|Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|myelination (GO:0042552)|regulation of steroid biosynthetic process (GO:0050810)|response to estradiol (GO:0032355)|spermatid development (GO:0007286)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|lung(4)	8						CGTGGTGGCCGTCCTCGTCCC	0.622																																																	0													161.0	119.0	133.0					12																	49485080		2203	4300	6503	SO:0001819	synonymous_variant	0			AB010994	CCDS8779.1	12q13.1	2010-06-24	2010-06-24			ENSG00000139549			2865	protein-coding gene	gene with protein product		605423	"""desert hedgehog (Drosophila) homolog"""			10773676, 10640830	Standard	NM_021044		Approved	HHG-3, MGC35145	uc001rtf.3	O43323	OTTHUMG00000170408	ENST00000266991.2:c.396C>T	12.37:g.49485080G>A			Q15794	Silent	SNP	pfam_Hedgehog_signaling_dom,pfam_Hint_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,smart_Hint_dom_N,smart_Hint_dom_C,pirsf_Hedgehog,prints_Hedgehog	p.D132	ENST00000266991.2	37	c.396	CCDS8779.1	12																																																																																			DHH	-	pfam_Hedgehog_signaling_dom,superfamily_Hedgehog_sig/DD-Pept_Zn-bd_dom,pirsf_Hedgehog,prints_Hedgehog	ENSG00000139549		0.622	DHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHH	HGNC	protein_coding	OTTHUMT00000408973.1	-	0.00	91	0	G	NM_021044		49485080	-1	tier1	-	no_errors	ENST00000266991	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.995	A
DLX4	1748	genome.wustl.edu	37	17	48050513	48050513	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:48050513G>A	ENST00000240306.3	+	2	655	c.360G>A	c.(358-360)ccG>ccA	p.P120P	DLX4_ENST00000411890.2_Silent_p.P48P|DLX4_ENST00000503410.1_3'UTR	NM_138281.2	NP_612138.1	Q92988	DLX4_HUMAN	distal-less homeobox 4	120					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P120P(1)		central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(3)	10						TCCGCAAGCCGAGGACCATCT	0.677																																																	1	Substitution - coding silent(1)	kidney(1)											32.0	36.0	34.0					17																	48050513		2201	4300	6501	SO:0001819	synonymous_variant	0				CCDS11555.1, CCDS45728.1	17q21.33	2011-06-20			ENSG00000108813	ENSG00000108813		"""Homeoboxes / ANTP class : NKL subclass"""	2917	protein-coding gene	gene with protein product		601911		DLX7, DLX9			Standard	NM_138281		Approved	DLX8, BP1	uc002ipv.3	Q92988	OTTHUMG00000161839	ENST00000240306.3:c.360G>A	17.37:g.48050513G>A			D3DTX2|D3DTX3|O60480|Q13265|Q6PJK0|Q9HBE0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.P120	ENST00000240306.3	37	c.360	CCDS11555.1	17																																																																																			DLX4	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000108813		0.677	DLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX4	HGNC	protein_coding	OTTHUMT00000366214.1	-	0.00	60	0	G			48050513	+1	tier1	-	no_errors	ENST00000240306	ensembl	human	known	74_37	silent	23.44	49	15	SNP	0.001	A
DNER	92737	genome.wustl.edu	37	2	230450599	230450599	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:230450599G>A	ENST00000341772.4	-	4	956	c.822C>T	c.(820-822)ctC>ctT	p.L274L	DNER_ENST00000482831.1_5'UTR	NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	274					central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		TCCCCAAGGCGAGCATCTCCT	0.502																																																	0													84.0	82.0	83.0					2																	230450599		2203	4300	6503	SO:0001819	synonymous_variant	0			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.822C>T	2.37:g.230450599G>A			A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Silent	SNP	pfam_EG-like_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.L274	ENST00000341772.4	37	c.822	CCDS33390.1	2																																																																																			DNER	-	NULL	ENSG00000187957		0.502	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNER	HGNC	protein_coding	OTTHUMT00000331902.1	-	0.00	43	0	G	NM_139072		230450599	-1	tier1	-	no_errors	ENST00000341772	ensembl	human	known	74_37	silent	25.49	38	13	SNP	0.000	A
DPF3	8110	genome.wustl.edu	37	14	73141063	73141063	+	Silent	SNP	C	C	T	rs374644462		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr14:73141063C>T	ENST00000556509.1	-	8	755	c.756G>A	c.(754-756)ccG>ccA	p.P252P	DPF3_ENST00000557704.1_5'UTR|DPF3_ENST00000546183.1_Silent_p.P262P|DPF3_ENST00000541685.1_Silent_p.P252P	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	252					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		CTGTTCCATCCGGTCCTTTCT	0.498																																																	0								C		0,3946		0,0,1973	58.0	63.0	62.0		756	-1.3	1.0	14		62	2,8310		0,2,4154	no	coding-synonymous	DPF3	NM_012074.3		0,2,6127	TT,TC,CC		0.0241,0.0,0.0163		252/358	73141063	2,12256	1973	4156	6129	SO:0001819	synonymous_variant	0			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.756G>A	14.37:g.73141063C>T			A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P307	ENST00000556509.1	37	c.921		14																																																																																			DPF3	-	NULL	ENSG00000205683		0.498	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2	-	0.00	63	0	C			73141063	-1	tier1	-	no_errors	ENST00000366353	ensembl	human	known	74_37	silent	17.28	67	14	SNP	0.906	T
EEF1E1	9521	genome.wustl.edu	37	6	8090462	8090462	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:8090462G>T	ENST00000379715.5	-	3	397	c.341C>A	c.(340-342)aCa>aAa	p.T114K	EEF1E1_ENST00000429723.2_Missense_Mutation_p.T114K|EEF1E1-BLOC1S5_ENST00000397456.2_Missense_Mutation_p.T114K|EEF1E1_ENST00000507463.1_Missense_Mutation_p.T114K	NM_004280.4	NP_004271.1	O43324	MCA3_HUMAN	eukaryotic translation elongation factor 1 epsilon 1	114	C-terminal.|GST C-terminal.				gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				endometrium(1)|prostate(1)	2	Ovarian(93;0.0398)					ATCTGCTAATGTAAAGTTATA	0.259																																																	0													64.0	64.0	64.0					6																	8090462		2199	4295	6494	SO:0001583	missense	0			AF054186	CCDS4507.1, CCDS47370.1	6p24.3	2009-05-20			ENSG00000124802	ENSG00000124802			3212	protein-coding gene	gene with protein product	"""aminoacyl tRNA synthetase complex-interacting multifunctional protein 3"""	609206		P18		9653160	Standard	NM_004280		Approved	AIMP3	uc003mxz.3	O43324	OTTHUMG00000014221	ENST00000379715.5:c.341C>A	6.37:g.8090462G>T	ENSP00000369038:p.Thr114Lys		C9JLK5|Q5THS2	Missense_Mutation	SNP	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	p.T114K	ENST00000379715.5	37	c.341	CCDS4507.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.9|22.9	4.348614|4.348614	0.82132|0.82132	.|.	.|.	ENSG00000124802|ENSG00000124802	ENST00000502429|ENST00000429723;ENST00000379715;ENST00000507463	.|T	.|0.56776	.|0.44	4.82|4.82	4.82|4.82	0.62117|0.62117	.|Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75852|0.75852	0.3906|0.3906	M|M	0.93197|0.93197	3.39|3.39	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.68192	.|0.945;0.956	D|D	0.83678|0.83678	0.0170|0.0170	5|9	.|.	.|.	.|.	-16.1144|-16.1144	17.902|17.902	0.88907|0.88907	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|114;114	.|C9JLK5;O43324	.|.;MCA3_HUMAN	N|K	101|114	.|ENSP00000369038:T114K	.|.	H|T	-|-	1|2	0|0	EEF1E1|EEF1E1	8035461|8035461	1.000000|1.000000	0.71417|0.71417	0.827000|0.827000	0.32855|0.32855	0.832000|0.832000	0.47134|0.47134	8.532000|8.532000	0.90613|0.90613	2.202000|2.202000	0.70862|0.70862	0.462000|0.462000	0.41574|0.41574	CAT|ACA	EEF1E1	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000124802		0.259	EEF1E1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1E1	HGNC	protein_coding	OTTHUMT00000039799.2	-	0.00	61	0	G	NM_004280		8090462	-1	tier1	-	no_errors	ENST00000379715	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
EHF	26298	genome.wustl.edu	37	11	34680266	34680266	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:34680266G>A	ENST00000533754.1	+	8	1011	c.794G>A	c.(793-795)cGa>cAa	p.R265Q	EHF_ENST00000531794.1_Missense_Mutation_p.R287Q|EHF_ENST00000450654.2_Missense_Mutation_p.R242Q|EHF_ENST00000530286.1_Missense_Mutation_p.R265Q|EHF_ENST00000257831.3_Missense_Mutation_p.R265Q					ets homologous factor										NFIA/EHF(2)	autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|lung(8)|upper_aerodigestive_tract(1)	17		all_hematologic(20;0.117)	Epithelial(1;0.055)|all cancers(1;0.137)|STAD - Stomach adenocarcinoma(6;0.235)			AAGCTCAGCCGAGCTATGAGG	0.458																																																	0													76.0	81.0	79.0					11																	34680266		2202	4298	6500	SO:0001583	missense	0			AF170583	CCDS7894.1, CCDS55752.1, CCDS55753.1	11p12	2008-07-18				ENSG00000135373			3246	protein-coding gene	gene with protein product	"""epithelium-specific ets factor 3"", ""ESE3 transcription factor"""	605439				10527851	Standard	NM_012153		Approved	ESE3, ESEJ	uc021qfu.1	Q9NZC4		ENST00000533754.1:c.794G>A	11.37:g.34680266G>A	ENSP00000435837:p.Arg265Gln			Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.R265Q	ENST00000533754.1	37	c.794	CCDS7894.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.350110	0.95830	.	.	ENSG00000135373	ENST00000257831;ENST00000450654;ENST00000530286;ENST00000533754;ENST00000531794	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	5.7	5.7	0.88788	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.68430	0.3000	M	0.93594	3.435	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.975;0.998	T	0.76759	-0.2841	10	0.87932	D	0	.	19.8388	0.96673	0.0:0.0:1.0:0.0	.	287;242;265	E9PSB2;Q9NZC4-2;Q9NZC4	.;.;EHF_HUMAN	Q	265;242;265;265;287	ENSP00000257831:R265Q;ENSP00000399733:R242Q;ENSP00000433508:R265Q;ENSP00000435837:R265Q;ENSP00000435835:R287Q	ENSP00000257831:R265Q	R	+	2	0	EHF	34636842	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.869000	0.99810	2.695000	0.91970	0.561000	0.74099	CGA	EHF	-	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	ENSG00000135373		0.458	EHF-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EHF	HGNC	protein_coding	OTTHUMT00000389855.1		0.00	45	0	G	NM_012153		34680266	+1			no_errors	ENST00000257831	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	A
ELK3	2004	genome.wustl.edu	37	12	96661219	96661219	+	3'UTR	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:96661219A>G	ENST00000228741.3	+	0	1811				ELK3_ENST00000552142.1_3'UTR|ELK3_ENST00000549529.1_3'UTR	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					AGTGTTGAACACTGTTGACAG	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.*261A>G	12.37:g.96661219A>G			B2R6S6|Q6FG57|Q6GU29|Q9UD17	RNA	SNP	-	NULL	ENST00000228741.3	37	NULL	CCDS9060.1	12																																																																																			ELK3	-	-	ENSG00000111145		0.284	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK3	HGNC	protein_coding	OTTHUMT00000408694.1	-	0.00	44	0	A	NM_005230		96661219	+1	tier1	-	no_errors	ENST00000549529	ensembl	human	putative	74_37	rna	34.48	19	10	SNP	1.000	G
ELP5	23587	genome.wustl.edu	37	17	7161975	7161975	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:7161975G>T	ENST00000396628.2	+	6	925	c.708G>T	c.(706-708)caG>caT	p.Q236H	ELP5_ENST00000574993.1_Missense_Mutation_p.Q236H|ELP5_ENST00000354429.2_Missense_Mutation_p.Q236H|RP1-4G17.5_ENST00000577138.1_Intron|ELP5_ENST00000396627.2_Missense_Mutation_p.Q236H|ELP5_ENST00000356683.2_Missense_Mutation_p.Q236H	NM_203414.1	NP_981959.1	Q8TE02	ELP5_HUMAN	elongator acetyltransferase complex subunit 5	236					chromatin organization (GO:0006325)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Elongator holoenzyme complex (GO:0033588)|nucleus (GO:0005634)											TAGAGTCCCAGCCCTACTCCG	0.468																																																	0													100.0	113.0	109.0					17																	7161975		2203	4300	6503	SO:0001583	missense	0			BC002762	CCDS11094.1, CCDS11095.1	17p13.1	2012-08-14	2012-08-08	2012-08-08	ENSG00000170291	ENSG00000170291		"""Elongator acetyltransferase complex subunits"""	30617	protein-coding gene	gene with protein product	"""dermal papilla derived protein 6"", ""S-phase 2 protein"""	615019	"""chromosome 17 open reading frame 81"""	C17orf81		22854966	Standard	NM_203415		Approved	DERP6	uc002gfi.1	Q8TE02	OTTHUMG00000177974	ENST00000396628.2:c.708G>T	17.37:g.7161975G>T	ENSP00000379869:p.Gln236His		A8K1M5|D3DTN9|Q659B6|Q7Z2T4|Q8TDR9|Q9BUB2|Q9Y2Q4	Missense_Mutation	SNP	pfam_Elp5	p.Q236H	ENST00000396628.2	37	c.708	CCDS11094.1	17	.	.	.	.	.	.	.	.	.	.	G	15.87	2.962154	0.53400	.	.	ENSG00000170291	ENST00000354429;ENST00000396628;ENST00000396627;ENST00000356683	T;T;T;T	0.46819	1.5;1.5;1.5;0.86	4.88	4.88	0.63580	.	0.325603	0.30920	N	0.008613	T	0.60183	0.2249	L	0.57536	1.79	0.22034	N	0.999401	P;P;D	0.53462	0.95;0.917;0.96	P;P;P	0.61533	0.824;0.671;0.89	T	0.52704	-0.8540	10	0.38643	T	0.18	-7.7525	13.3914	0.60827	0.0:0.0:1.0:0.0	.	236;236;236	Q8TE02-2;A8K1M5;Q8TE02	.;.;DERP6_HUMAN	H	236	ENSP00000346412:Q236H;ENSP00000379869:Q236H;ENSP00000379868:Q236H;ENSP00000349111:Q236H	ENSP00000346412:Q236H	Q	+	3	2	C17orf81	7102699	0.931000	0.31567	0.375000	0.26029	0.008000	0.06430	2.779000	0.47734	2.527000	0.85204	0.561000	0.74099	CAG	ELP5	-	pfam_Elp5	ENSG00000170291		0.468	ELP5-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ELP5	HGNC	protein_coding	OTTHUMT00000440111.1	-	0.00	33	0	G	NM_015362		7161975	+1	tier1	-	no_errors	ENST00000354429	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.539	T
LINC01597	400841	genome.wustl.edu	37	20	29516389	29516389	+	lincRNA	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr20:29516389A>G	ENST00000380888.3	-	0	520																											gcggagcgcgagtccgcccag	0.632																																																	0																																												0																															20.37:g.29516389A>G				RNA	SNP	-	NULL	ENST00000380888.3	37	NULL		20																																																																																			RP4-610C12.4	-	-	ENSG00000205611		0.632	RP4-610C12.4-001	KNOWN	basic	lincRNA	ENSG00000205611	Clone_based_vega_gene	lincRNA	OTTHUMT00000256907.1	-	0.00	41	0	A			29516389	-1	tier1	-	no_errors	ENST00000380888	ensembl	human	known	74_37	rna	30.77	27	12	SNP	0.000	G
RP11-166B2.1	0	genome.wustl.edu	37	16	12027708	12027708	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:12027708C>G	ENST00000399147.4	-	3	265	c.266G>C	c.(265-267)aGg>aCg	p.R89T	RP11-166B2.1_ENST00000532936.1_5'UTR																lung(2)	2						GTTGGACCTCCTGGCTCTCTG	0.458																																																	0																																										SO:0001583	missense	0																														ENST00000399147.4:c.266G>C	16.37:g.12027708C>G	ENSP00000382101:p.Arg89Thr			Missense_Mutation	SNP	NULL	p.R89T	ENST00000399147.4	37	c.266		16	.	.	.	.	.	.	.	.	.	.	C	8.396	0.840942	0.16891	.	.	ENSG00000234719	ENST00000399147;ENST00000547494	T;T	0.47528	0.84;0.84	.	.	.	.	.	.	.	.	T	0.48409	0.1498	.	.	.	.	.	.	.	.	.	.	.	.	T	0.58329	-0.7655	3	0.87932	D	0	.	.	.	.	.	.	.	.	T	89	ENSP00000382101:R89T;ENSP00000448752:R89T	ENSP00000382101:R89T	R	-	2	0	RP11-166B2.1	11935209	0.996000	0.38824	0.321000	0.25320	0.322000	0.28314	0.638000	0.24674	0.064000	0.16427	0.064000	0.15345	AGG	RP11-166B2.1	-	NULL	ENSG00000234719		0.458	RP11-166B2.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000234719	Clone_based_vega_gene	protein_coding	OTTHUMT00000388781.3	-	0.00	327	0	C			12027708	-1	tier1	-	no_errors	ENST00000399147	ensembl	human	putative	74_37	missense	20.47	237	61	SNP	0.325	G
IGHA1	3493	genome.wustl.edu	37	14	106170814	106170814	+	RNA	SNP	G	G	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr14:106170814G>C	ENST00000390547.2	-	0	1110				AL928768.3_ENST00000497872.2_lincRNA			P01876	IGHA1_HUMAN	immunoglobulin heavy constant alpha 1						antibacterial humoral response (GO:0019731)|glomerular filtration (GO:0003094)|immune response (GO:0006955)|positive regulation of respiratory burst (GO:0060267)|protein-chromophore linkage (GO:0018298)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|monomeric IgA immunoglobulin complex (GO:0071748)|secretory dimeric IgA immunoglobulin complex (GO:0071752)|secretory IgA immunoglobulin complex (GO:0071751)	antigen binding (GO:0003823)										AGCAGGAAGAGGGTGAGGAAG	0.657																																																	0																																												0			J00220		14q32.33	2012-10-02			ENSG00000211895	ENSG00000211895		"""Immunoglobulins / IGH locus"""	5478	other	immunoglobulin gene		146900					Standard	NG_001019		Approved			P01876	OTTHUMG00000152494		14.37:g.106170814G>C				RNA	SNP	-	NULL	ENST00000390547.2	37	NULL		14																																																																																			AL928768.3	-	-	ENSG00000253701		0.657	IGHA1-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	ENSG00000253701	Clone_based_vega_gene	IG_C_gene	OTTHUMT00000326459.1	-	0.00	121	0	G	NG_001019		106170814	-1	tier1	-	no_errors	ENST00000497872	ensembl	human	known	74_37	rna	16.84	79	16	SNP	1.000	C
GPR146	115330	genome.wustl.edu	37	7	1098297	1098297	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:1098297C>T	ENST00000397095.1	+	0	1369				C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397100.2_Intron|RP11-449P15.1_ENST00000549241.1_RNA|C7orf50_ENST00000397098.3_Intron|C7orf50_ENST00000357429.6_Intron|GPR146_ENST00000297468.3_3'UTR			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TCCTTTTTCCCACAAATGCCA	0.567																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.*144C>T	7.37:g.1098297C>T			Q86SP5	RNA	SNP	-	NULL	ENST00000397095.1	37	NULL	CCDS5321.1	7																																																																																			RP11-449P15.1	-	-	ENSG00000257607		0.567	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257607	Clone_based_vega_gene	protein_coding	OTTHUMT00000206855.1	-	0.00	19	0	C	NM_138445		1098297	-1	tier1	-	no_errors	ENST00000549241	ensembl	human	known	74_37	rna	30.77	9	4	SNP	0.027	T
NOB1	28987	genome.wustl.edu	37	16	69776090	69776090	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:69776090G>T	ENST00000268802.5	-	0	1413				CTD-2033A16.3_ENST00000575838.1_RNA	NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)						visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CAGACCCAGCGGGGCATGGGC	0.602																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.*145C>A	16.37:g.69776090G>T			Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	RNA	SNP	-	NULL	ENST00000268802.5	37	NULL	CCDS10884.1	16																																																																																			CTD-2033A16.3	-	-	ENSG00000262136		0.602	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262136	Clone_based_vega_gene	protein_coding	OTTHUMT00000268958.2	-	0.00	25	0	G	NM_014062		69776090	+1	tier1	-	no_errors	ENST00000575838	ensembl	human	known	74_37	rna	26.09	34	12	SNP	0.000	T
ENTPD2	954	genome.wustl.edu	37	9	139946015	139946016	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	TC	TC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:139946015_139946016delTC	ENST00000355097.2	-	3	379_380	c.332_333delGA	c.(331-333)agafs	p.R111fs	RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank|ENTPD2_ENST00000312665.5_Frame_Shift_Del_p.R111fs	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	111					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TGCCCGCGTGTCTCTCTTTGGG	0.619																																																	0																																										SO:0001589	frameshift_variant	0			U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.332_333delGA	9.37:g.139946019_139946020delTC	ENSP00000347213:p.Arg111fs		O15464|Q5SPY6|Q5SPY7	Frame_Shift_Del	DEL	pfam_GDA1_CD39_NTPase	p.R111fs	ENST00000355097.2	37	c.333_332	CCDS7026.1	9																																																																																			ENTPD2	-	pfam_GDA1_CD39_NTPase	ENSG00000054179		0.619	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD2	HGNC	protein_coding	OTTHUMT00000055169.1		0.00	29	0	TC	NM_203468		139946016	-1	tier1		no_errors	ENST00000355097	ensembl	human	known	74_37	frame_shift_del	36.00	16	9	DEL	0.990:0.993	-
ENTPD4	9583	genome.wustl.edu	37	8	23306283	23306283	+	Silent	SNP	G	G	T	rs372620648		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr8:23306283G>T	ENST00000358689.4	-	3	413	c.178C>A	c.(178-180)Cga>Aga	p.R60R	ENTPD4_ENST00000417069.2_Silent_p.R60R|ENTPD4_ENST00000356206.6_Silent_p.R60R	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	60					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		CTGGTTAGTCGCCCATACTTA	0.378																																																	0													81.0	85.0	84.0					8																	23306283		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.178C>A	8.37:g.23306283G>T			D3DSS3|O15092	Silent	SNP	pfam_GDA1_CD39_NTPase	p.R60	ENST00000358689.4	37	c.178	CCDS6041.1	8																																																																																			ENTPD4	-	NULL	ENSG00000197217		0.378	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1		0.00	47	0	G	NM_004901		23306283	-1			no_errors	ENST00000358689	ensembl	human	known	74_37	silent	5.88	32	2	SNP	0.045	T
EPYC	1833	genome.wustl.edu	37	12	91396276	91396276	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:91396276G>T	ENST00000261172.3	-	2	159	c.67C>A	c.(67-69)Cta>Ata	p.L23I		NM_004950.4	NP_004941.2	Q99645	EPYC_HUMAN	epiphycan	23					female pregnancy (GO:0007565)	proteinaceous extracellular matrix (GO:0005578)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(8)|skin(2)	18						ATGGACTCTAGAGTTGGGGCA	0.368																																																	0													107.0	105.0	106.0					12																	91396276		2203	4300	6503	SO:0001583	missense	0			AF031658	CCDS31870.1	12q21	2010-03-19	2006-11-21	2006-11-21	ENSG00000083782	ENSG00000083782		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3053	protein-coding gene	gene with protein product	"""epiphycan proteoglycan"""	601657	"""dermatan sulphate proteoglycan 3"", ""dermatan sulfate proteoglycan 3"""	DSPG3		8975717	Standard	NM_004950		Approved	Pg-Lb, SLRR3B	uc001tbk.3	Q99645	OTTHUMG00000170072	ENST00000261172.3:c.67C>A	12.37:g.91396276G>T	ENSP00000261172:p.Leu23Ile		A8K3M7|Q8NEJ5	Missense_Mutation	SNP	pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.L23I	ENST00000261172.3	37	c.67	CCDS31870.1	12	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375826	0.24857	.	.	ENSG00000083782	ENST00000261172;ENST00000551767	T;T	0.66995	0.43;-0.24	6.16	1.82	0.25136	.	0.735756	0.13394	N	0.391153	T	0.43033	0.1229	N	0.12182	0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22730	-1.0208	10	0.32370	T	0.25	.	5.6821	0.17782	0.1682:0.0:0.3591:0.4727	.	23	Q99645	EPYC_HUMAN	I	23	ENSP00000261172:L23I;ENSP00000448272:L23I	ENSP00000261172:L23I	L	-	1	2	EPYC	89920407	0.003000	0.15002	0.046000	0.18839	0.972000	0.66771	0.851000	0.27751	0.366000	0.24427	0.650000	0.86243	CTA	EPYC	-	NULL	ENSG00000083782		0.368	EPYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPYC	HGNC	protein_coding	OTTHUMT00000407146.2	-	0.00	84	0	G	NM_004950		91396276	-1	tier1	-	no_errors	ENST00000261172	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.001	T
ERBB4	2066	genome.wustl.edu	37	2	212530156	212530156	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:212530156T>C	ENST00000342788.4	-	15	2073	c.1763A>G	c.(1762-1764)aAc>aGc	p.N588S	ERBB4_ENST00000402597.1_Missense_Mutation_p.N588S|ERBB4_ENST00000436443.1_Missense_Mutation_p.N588S	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	588	Cys-rich.				cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TTCCACACAGTTTGGGCCATC	0.423										TSP Lung(8;0.080)																																							0													120.0	109.0	113.0					2																	212530156		2203	4300	6503	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.1763A>G	2.37:g.212530156T>C	ENSP00000342235:p.Asn588Ser		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.N588S	ENST00000342788.4	37	c.1763	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.79|13.79	2.340961|2.340961	0.41498|0.41498	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597|ENST00000260943	T;T;T|.	0.40756|.	1.02;1.02;1.02|.	5.26|5.26	4.08|4.08	0.47627|0.47627	Growth factor, receptor (1);|.	0.040621|.	0.85682|.	D|.	0.000000|.	T|T	0.48519|0.48519	0.1504|0.1504	N|N	0.25031|0.25031	0.7|0.7	0.58432|0.58432	D|D	0.999991|0.999991	P;B;P;D;P|.	0.59357|.	0.833;0.122;0.463;0.985;0.951|.	B;B;B;P;B|.	0.47206|.	0.437;0.022;0.079;0.541;0.34|.	T|T	0.35375|0.35375	-0.9791|-0.9791	10|5	0.35671|.	T|.	0.21|.	.|.	11.697|11.697	0.51548|0.51548	0.1327:0.0:0.0:0.8673|0.1327:0.0:0.0:0.8673	.|.	588;588;447;588;588|.	Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303|.	.;.;.;.;ERBB4_HUMAN|.	S|A	588|588	ENSP00000342235:N588S;ENSP00000403204:N588S;ENSP00000385565:N588S|.	ENSP00000342235:N588S|.	N|T	-|-	2|1	0|0	ERBB4|ERBB4	212238401|212238401	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.998000|0.998000	0.95712|0.95712	7.990000|7.990000	0.88215|0.88215	0.920000|0.920000	0.36970|0.36970	0.533000|0.533000	0.62120|0.62120	AAC|ACT	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat	ENSG00000178568		0.423	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	146	0	T	NM_001042599		212530156	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	19.54	140	34	SNP	1.000	C
ERCC6L2	375748	genome.wustl.edu	37	9	98638319	98638319	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:98638319G>T	ENST00000288985.7	+	1	337	c.32G>T	c.(31-33)cGg>cTg	p.R11L	LINC00476_ENST00000429781.1_RNA	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	11					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CCCCCTGGCCGGATGGATCCG	0.701																																																	0													9.0	11.0	10.0					9																	98638319		2160	4249	6409	SO:0001583	missense	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.32G>T	9.37:g.98638319G>T	ENSP00000288985:p.Arg11Leu		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R11L	ENST00000288985.7	37	c.32	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960350	0.34565	.	.	ENSG00000182150	ENST00000288985	D	0.89810	-2.57	3.63	-7.26	0.01466	.	.	.	.	.	T	0.75715	0.3887	N	0.22421	0.69	0.46131	D	0.998887	B	0.06786	0.001	B	0.08055	0.003	T	0.32903	-0.9889	9	0.30078	T	0.28	6.6101	8.2321	0.31603	0.1853:0.4694:0.3453:0.0	.	11	Q5T890	RAD26_HUMAN	L	11	ENSP00000288985:R11L	ENSP00000288985:R11L	R	+	2	0	C9orf102	97678140	0.574000	0.26684	0.023000	0.16930	0.030000	0.12068	-0.286000	0.08399	-2.228000	0.00721	-1.031000	0.02408	CGG	ERCC6L2	-	NULL	ENSG00000182150		0.701	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	-	0.00	35	0	G	NM_001010895		98638319	+1	tier1	-	no_errors	ENST00000288985	ensembl	human	novel	74_37	missense	33.33	34	17	SNP	0.026	T
ERVMER61-1	339476	genome.wustl.edu	37	1	187610544	187610544	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:187610544C>T	ENST00000429725.1	+	0	81									endogenous retrovirus group MER61, member 1																		agaaccccgtctttagctgaa	0.468																																																	0													54.0	61.0	59.0					1																	187610544		692	1591	2283			0			BC040856		1q31.1	2013-10-11	2011-05-05	2011-05-05	ENSG00000230426	ENSG00000230426			27919	other	endogenous retrovirus			"""chromosome 1 open reading frame 99"""	C1orf99		21542922	Standard			Approved				OTTHUMG00000035624		1.37:g.187610544C>T				RNA	SNP	-	NULL	ENST00000429725.1	37	NULL		1																																																																																			ERVMER61-1	-	-	ENSG00000230426		0.468	ERVMER61-1-001	KNOWN	basic	lincRNA	ERVMER61-1	HGNC	lincRNA	OTTHUMT00000086446.2	-	0.00	40	0	C	NM_001012274		187610544	+1	tier1	-	no_errors	ENST00000429725	ensembl	human	known	74_37	rna	8.16	45	4	SNP	0.007	T
ESRRB	2103	genome.wustl.edu	37	14	76948947	76948947	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr14:76948947A>C	ENST00000509242.1	+	6	730	c.632A>C	c.(631-633)aAg>aCg	p.K211T	ESRRB_ENST00000261532.7_Missense_Mutation_p.K211T|ESRRB_ENST00000380887.2_Missense_Mutation_p.K211T|ESRRB_ENST00000556177.1_Missense_Mutation_p.K211T	NM_004452.3	NP_004443.3	O95718	ERR2_HUMAN	estrogen-related receptor beta	211					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|trophectodermal cell proliferation (GO:0001834)|trophectodermal cellular morphogenesis (GO:0001831)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	24				BRCA - Breast invasive adenocarcinoma(234;0.0213)		GCAGTGACCAAGATTGTCTCA	0.557																																																	0													79.0	73.0	75.0					14																	76948947		2203	4300	6503	SO:0001583	missense	0			X51417	CCDS9850.1, CCDS9850.2	14q24.3	2013-01-16				ENSG00000119715		"""Nuclear hormone receptors"""	3473	protein-coding gene	gene with protein product		602167	"""deafness, autosomal recessive 35"""	ESRL2, DFNB35		3267207, 9344655, 18179891	Standard	NM_004452		Approved	ERR2, ERRbeta, NR3B2, ERRb	uc001xsr.3	O95718		ENST00000509242.1:c.632A>C	14.37:g.76948947A>C	ENSP00000422488:p.Lys211Thr		A2VDJ2|B6ZGU4|Q5F0P7|Q5F0P8|Q9HCB4	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.K211T	ENST00000509242.1	37	c.632	CCDS9850.2	14	.	.	.	.	.	.	.	.	.	.	A	27.6	4.846024	0.91277	.	.	ENSG00000119715	ENST00000512784;ENST00000509242;ENST00000556177;ENST00000380887;ENST00000261532	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.64182	0.2575	M	0.88775	2.98	0.80722	D	1	P;B	0.37688	0.605;0.418	P;B	0.44696	0.458;0.379	T	0.71424	-0.4597	10	0.87932	D	0	.	15.5185	0.75846	1.0:0.0:0.0:0.0	.	211;216	Q5F0P7;E7EWD9	.;.	T	216;211;211;211;211	ENSP00000424992:K216T;ENSP00000422488:K211T;ENSP00000451658:K211T;ENSP00000370270:K211T;ENSP00000261532:K211T	ENSP00000261532:K211T	K	+	2	0	ESRRB	76018700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.185000	0.77714	2.070000	0.61991	0.533000	0.62120	AAG	ESRRB	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000119715		0.557	ESRRB-003	KNOWN	basic|CCDS	protein_coding	ESRRB	HGNC	protein_coding	OTTHUMT00000360663.1		0.00	65	0	A			76948947	+1			no_errors	ENST00000380887	ensembl	human	known	74_37	missense	6.52	43	3	SNP	1.000	C
FAM157C	100996541	genome.wustl.edu	37	16	90229167	90229167	+	RNA	SNP	C	C	T	rs375782868		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:90229167C>T	ENST00000570230.1	+	0	1142				RP11-356C4.5_ENST00000565965.1_lincRNA			P0CG43	F157C_HUMAN	family with sequence similarity 157, member C																		TCCTACCTCCCGGCAGCCTCT	0.438																																																	0																																												0					16q24.3	2013-01-24	2013-01-18	2013-01-18	ENSG00000260528	ENSG00000260528			34081	other	unknown							Standard	XR_429804		Approved			P0CG43	OTTHUMG00000172848		16.37:g.90229167C>T				RNA	SNP	-	NULL	ENST00000570230.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.438	FAM157C-004	KNOWN	basic	processed_transcript	FAM157C	HGNC	processed_transcript	OTTHUMT00000420872.1		0.00	38	0	C			90229167	+1			no_errors	ENST00000570230	ensembl	human	known	74_37	rna	11.54	23	3	SNP	0.000	T
FAM170A	340069	genome.wustl.edu	37	5	118970289	118970289	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:118970289G>C	ENST00000515256.1	+	3	1018	c.846G>C	c.(844-846)gaG>gaC	p.E282D				A1A519	F170A_HUMAN	family with sequence similarity 170, member A	282	Glu-rich.				positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	24						agcaggaggaggaaaatggaa	0.542																																																	0													97.0	113.0	107.0					5																	118970289		2034	4193	6227	SO:0001583	missense	0			AF427126	CCDS43353.1, CCDS54889.1	5q23.1	2008-06-12			ENSG00000164334	ENSG00000164334			27963	protein-coding gene	gene with protein product						12477932	Standard	NM_182761		Approved		uc003ksn.3	A1A519	OTTHUMG00000162946	ENST00000515256.1:c.846G>C	5.37:g.118970289G>C	ENSP00000422684:p.Glu282Asp		Q66LM8|Q7Z4V2|Q8IW94	Missense_Mutation	SNP	NULL	p.E282D	ENST00000515256.1	37	c.846		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.087|7.087	0.571387|0.571387	0.13623|0.13623	.|.	.|.	ENSG00000164334|ENSG00000164334	ENST00000515256|ENST00000296787	T|.	0.35421|.	1.31|.	4.39|4.39	-3.45|-3.45	0.04781|0.04781	.|.	0.477177|.	0.15519|.	N|.	0.258154|.	T|T	0.35008|0.35008	0.0917|0.0917	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	B;B|.	0.11235|.	0.002;0.004|.	B;B|.	0.13407|.	0.002;0.009|.	T|T	0.37197|0.37197	-0.9716|-0.9716	9|5	.|.	.|.	.|.	-0.0209|-0.0209	1.9827|1.9827	0.03429|0.03429	0.248:0.382:0.2402:0.1298|0.248:0.382:0.2402:0.1298	.|.	235;282|.	D6RIE9;A1A519|.	.;F170A_HUMAN|.	D|T	282|217	ENSP00000422684:E282D|.	.|.	E|R	+|+	3|2	2|0	FAM170A|FAM170A	118998188|118998188	0.696000|0.696000	0.27757|0.27757	0.000000|0.000000	0.03702|0.03702	0.008000|0.008000	0.06430|0.06430	1.150000|1.150000	0.31639|0.31639	-0.765000|-0.765000	0.04645|0.04645	-1.331000|-1.331000	0.01271|0.01271	GAG|AGG	FAM170A	-	NULL	ENSG00000164334		0.542	FAM170A-001	KNOWN	basic|appris_principal	protein_coding	FAM170A	HGNC	protein_coding	OTTHUMT00000371126.1		0.00	25	0	G	NM_182761		118970289	+1			no_errors	ENST00000515256	ensembl	human	known	74_37	missense	20.00	16	4	SNP	0.000	C
FAM193A	8603	genome.wustl.edu	37	4	2674072	2674072	+	Nonsense_Mutation	SNP	T	T	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:2674072T>G	ENST00000324666.5	+	11	1782	c.1431T>G	c.(1429-1431)taT>taG	p.Y477*	FAM193A_ENST00000502458.1_Nonsense_Mutation_p.Y499*|FAM193A_ENST00000382839.3_Nonsense_Mutation_p.Y477*|FAM193A_ENST00000545951.1_Nonsense_Mutation_p.Y477*|FAM193A_ENST00000505311.1_Nonsense_Mutation_p.Y477*	NM_001256666.1	NP_001243595.1	P78312	F193A_HUMAN	family with sequence similarity 193, member A	477										NS(2)|breast(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(12)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	40						CCACCTTGTATGCAACGCCCC	0.522																																																	0													111.0	79.0	90.0					4																	2674072		2203	4300	6503	SO:0001587	stop_gained	0			AB000459	CCDS33943.1, CCDS58874.1, CCDS58875.1, CCDS58876.1	4p16.3	2009-09-04	2009-09-04	2009-09-04					16822	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 8"""	C4orf8		9734812	Standard	NR_046335		Approved	RES4-22	uc010ick.3	P78312		ENST00000324666.5:c.1431T>G	4.37:g.2674072T>G	ENSP00000324587:p.Tyr477*		B7ZM85|B9EGR0|E9PFA1|O43607|P78311|P78313|Q9UEG8	Nonsense_Mutation	SNP	NULL	p.Y477*	ENST00000324666.5	37	c.1431	CCDS58875.1	4	.	.	.	.	.	.	.	.	.	.	T	38	7.116910	0.98074	.	.	ENSG00000125386	ENST00000382839;ENST00000324666;ENST00000545951;ENST00000502458;ENST00000513350	.	.	.	4.82	-3.87	0.04218	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.73	14.6981	0.69136	0.0:0.6496:0.0:0.3504	.	.	.	.	X	477;477;477;499;331	.	ENSP00000324587:Y477X	Y	+	3	2	FAM193A	2643870	0.213000	0.23551	0.032000	0.17829	0.802000	0.45316	0.129000	0.15830	-0.925000	0.03775	-0.248000	0.11899	TAT	FAM193A	-	NULL	ENSG00000125386		0.522	FAM193A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM193A	HGNC	protein_coding	OTTHUMT00000360903.1	-	0.00	42	0	T	NM_003704		2674072	+1	tier1	-	no_errors	ENST00000324666	ensembl	human	known	74_37	nonsense	40.00	24	16	SNP	0.065	G
FAM230B	642633	genome.wustl.edu	37	22	21539182	21539182	+	RNA	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:21539182G>A	ENST00000451257.1	+	0	2168									family with sequence similarity 230, member B (non-protein coding)																		ACCATACAAGGCATCGCTAAC	0.403																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21539182G>A				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.403	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1	-	0.00	38	0	G	NR_108107		21539182	+1	tier1	-	no_errors	ENST00000451257	ensembl	human	known	74_37	rna	10.26	35	4	SNP	0.591	A
FMNL3	91010	genome.wustl.edu	37	12	50050234	50050234	+	Silent	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:50050234G>T	ENST00000293590.5	-	9	1071	c.838C>A	c.(838-840)Cga>Aga	p.R280R	FMNL3_ENST00000335154.5_Silent_p.R280R|FMNL3_ENST00000550488.1_Silent_p.R280R|FMNL3_ENST00000352151.5_Silent_p.R229R			Q8IVF7	FMNL3_HUMAN	formin-like 3	280	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						TGACCTCCTCGCACCAAACAC	0.507																																																	0													76.0	77.0	77.0					12																	50050234		2043	4228	6271	SO:0001819	synonymous_variant	0			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.838C>A	12.37:g.50050234G>T			B0JZA7|Q6ZRJ1	Silent	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.R280	ENST00000293590.5	37	c.838		12																																																																																			FMNL3	-	superfamily_ARM-type_fold	ENSG00000161791		0.507	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	HGNC	protein_coding		-	0.00	85	0	G	NM_175736		50050234	-1	tier1	-	no_errors	ENST00000293590	ensembl	human	known	74_37	silent	6.94	67	5	SNP	1.000	T
FOLR3	2352	genome.wustl.edu	37	11	71847017	71847017	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:71847017A>G	ENST00000445078.2	+	2	84	c.13A>G	c.(13-15)Atg>Gtg	p.M5V	FOLR3_ENST00000456237.1_Missense_Mutation_p.M7V|FOLR3_ENST00000442948.2_Missense_Mutation_p.M7V			P41439	FOLR3_HUMAN	folate receptor 3 (gamma)	5					folic acid transport (GO:0015884)	extracellular region (GO:0005576)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	folic acid binding (GO:0005542)			large_intestine(3)|lung(8)|prostate(2)	13					Folic Acid(DB00158)	GGCCTGGCAGATGATGCAGCT	0.597																																																	0													100.0	109.0	106.0					11																	71847017		2193	4287	6480	SO:0001583	missense	0			U08471	CCDS73344.1	11q13.4	2012-11-14			ENSG00000110203	ENSG00000110203			3795	protein-coding gene	gene with protein product		602469				8110752	Standard	NM_000804		Approved	FR-G	uc001orx.1	P41439	OTTHUMG00000167870	ENST00000445078.2:c.13A>G	11.37:g.71847017A>G	ENSP00000390338:p.Met5Val		J3KQ90|Q05C14	Missense_Mutation	SNP	pfam_Folate_rcpt-like	p.M7V	ENST00000445078.2	37	c.19		11	.	.	.	.	.	.	.	.	.	.	A	10.90	1.481161	0.26598	.	.	ENSG00000110203	ENST00000445078;ENST00000456237;ENST00000442948;ENST00000546166	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	3.5	-6.56	0.01848	.	1.762590	0.04570	U	0.393060	T	0.29882	0.0747	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.08764	-1.0706	9	0.20046	T	0.44	.	1.4729	0.02420	0.2844:0.2805:0.3041:0.131	.	7;5	E9PGT2;P41439	.;FOLR3_HUMAN	V	5;7;7;5	ENSP00000390338:M5V;ENSP00000399235:M7V;ENSP00000411161:M7V;ENSP00000446279:M5V	ENSP00000325032:M5V	M	+	1	0	FOLR3	71524665	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.296000	0.08287	-0.845000	0.04179	0.402000	0.26972	ATG	FOLR3	-	NULL	ENSG00000110203		0.597	FOLR3-001	NOVEL	upstream_ATG|basic	protein_coding	FOLR3	HGNC	protein_coding	OTTHUMT00000396739.1	-	0.00	69	0	A	NM_000804		71847017	+1	tier1	-	no_errors	ENST00000456237	ensembl	human	known	74_37	missense	6.58	71	5	SNP	0.000	G
FOXA2	3170	genome.wustl.edu	37	20	22563091	22563091	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr20:22563091G>A	ENST00000377115.4	-	3	952	c.771C>T	c.(769-771)tgC>tgT	p.C257C	FOXA2_ENST00000419308.2_Silent_p.C263C	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	257					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					GCTGCTTCTCGCACTTGAAGC	0.697																																																	0													9.0	11.0	10.0					20																	22563091		2179	4272	6451	SO:0001819	synonymous_variant	0			AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.771C>T	20.37:g.22563091G>A			Q8WUW4|Q96DF7	Silent	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.C263	ENST00000377115.4	37	c.789	CCDS13147.1	20																																																																																			FOXA2	-	NULL	ENSG00000125798		0.697	FOXA2-001	KNOWN	basic|CCDS	protein_coding	FOXA2	HGNC	protein_coding	OTTHUMT00000078289.1		0.00	37	0	G			22563091	-1			no_errors	ENST00000419308	ensembl	human	known	74_37	silent	17.65	28	6	SNP	1.000	A
FSTL4	23105	genome.wustl.edu	37	5	132553042	132553042	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:132553042delT	ENST00000265342.7	-	13	1736	c.1487delA	c.(1486-1488)aatfs	p.N496fs	CTB-49A3.2_ENST00000509051.1_RNA|CTB-49A3.2_ENST00000502776.1_RNA	NM_015082.1	NP_055897.1	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	496						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(8)|skin(2)|upper_aerodigestive_tract(1)	23		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CTGGGTTGCATTTTTTTCTCT	0.493																																																	0													87.0	85.0	86.0					5																	132553042		2203	4300	6503	SO:0001589	frameshift_variant	0			AB028984	CCDS34238.1	5q31.1	2013-01-29			ENSG00000053108	ENSG00000053108		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21389	protein-coding gene	gene with protein product						10470851, 15527507	Standard	NM_015082		Approved	KIAA1061	uc003kyn.1	Q6MZW2	OTTHUMG00000162729	ENST00000265342.7:c.1487delA	5.37:g.132553042delT	ENSP00000265342:p.Asn496fs		Q8TBU0|Q9UPU1	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Kazal_dom,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.N496fs	ENST00000265342.7	37	c.1487	CCDS34238.1	5																																																																																			FSTL4	-	NULL	ENSG00000053108		0.493	FSTL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSTL4	HGNC	protein_coding	OTTHUMT00000370212.1		0.00	34	0	T	XM_048786		132553042	-1			no_errors	ENST00000265342	ensembl	human	known	74_37	frame_shift_del	15.52	49	9	DEL	0.000	0
GABRA4	2557	genome.wustl.edu	37	4	46995416	46995416	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:46995416G>A	ENST00000264318.3	-	1	1008	c.26C>T	c.(25-27)gCg>gTg	p.A9V	GABRA4_ENST00000509316.1_5'UTR	NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	9					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CAGAGCGATCGCGGGTACCTT	0.587																																					Ovarian(6;283 369 8234 12290 33402)												0													107.0	99.0	102.0					4																	46995416		2203	4300	6503	SO:0001583	missense	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.26C>T	4.37:g.46995416G>A	ENSP00000264318:p.Ala9Val		Q8IYR7	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABBAa4_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A9V	ENST00000264318.3	37	c.26	CCDS3473.1	4	.	.	.	.	.	.	.	.	.	.	G	13.22	2.170754	0.38315	.	.	ENSG00000109158	ENST00000264318	T	0.79940	-1.32	4.5	2.65	0.31530	.	0.696041	0.14374	N	0.323611	T	0.63236	0.2494	N	0.12182	0.205	0.28699	N	0.904169	B	0.10296	0.003	B	0.04013	0.001	T	0.54200	-0.8329	10	0.28530	T	0.3	.	10.2916	0.43599	0.0:0.4264:0.5736:0.0	.	9	P48169	GBRA4_HUMAN	V	9	ENSP00000264318:A9V	ENSP00000264318:A9V	A	-	2	0	GABRA4	46690173	1.000000	0.71417	0.996000	0.52242	0.677000	0.39632	2.481000	0.45215	1.087000	0.41251	-0.283000	0.09986	GCG	GABRA4	-	NULL	ENSG00000109158		0.587	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	-	0.00	61	0	G			46995416	-1	tier1	-	no_errors	ENST00000264318	ensembl	human	known	74_37	missense	25.84	65	23	SNP	1.000	A
GATA2	2624	genome.wustl.edu	37	3	128205135	128205135	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:128205135delT	ENST00000341105.2	-	3	637	c.306delA	c.(304-306)aaafs	p.K102fs	RP11-475N22.4_ENST00000473958.1_RNA|GATA2_ENST00000430265.2_Frame_Shift_Del_p.K102fs|GATA2_ENST00000487848.1_Frame_Shift_Del_p.K102fs|RP11-475N22.4_ENST00000468377.1_RNA|RP11-475N22.4_ENST00000464242.1_RNA	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	102					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		AGAGGGCTGCTTTGCCCCCGT	0.682			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0													10.0	12.0	12.0					3																	128205135		2184	4273	6457	SO:0001589	frameshift_variant	0			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.306delA	3.37:g.128205135delT	ENSP00000345681:p.Lys102fs		D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Frame_Shift_Del	DEL	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.A103fs	ENST00000341105.2	37	c.306	CCDS3049.1	3																																																																																			GATA2	-	pirsf_TF_GATA-1/2/3	ENSG00000179348		0.682	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1		0.00	9	0	T	NM_032638		128205135	-1	tier1		no_errors	ENST00000341105	ensembl	human	known	74_37	frame_shift_del	33.33	4	2	DEL	0.998	-
NDUFS1	4719	genome.wustl.edu	37	2	206980714	206980715	+	3'UTR	INS	-	-	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:206980714_206980715insT	ENST00000233190.6	-	0	10644_10645				AC007383.4_ENST00000453039.1_RNA	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)						apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GTTAACAGTAGTTTTTTTTTCC	0.327																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.*8195->A	2.37:g.206980723_206980723dupT			B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	RNA	INS	-	NULL	ENST00000233190.6	37	NULL	CCDS2366.1	2																																																																																			AC007383.4	-	-	ENSG00000231955		0.327	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCSHP3	Clone_based_vega_gene	protein_coding	OTTHUMT00000256391.4		0.00	84	0	-	NM_005006		206980715	+1	tier1		no_errors	ENST00000453039	ensembl	human	known	74_37	rna	12.62	90	13	INS	0.025:0.033	T
GOPC	57120	genome.wustl.edu	37	6	117894703	117894703	+	Missense_Mutation	SNP	C	C	T	rs373946370		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:117894703C>T	ENST00000368498.2	-	5	818	c.743G>A	c.(742-744)cGt>cAt	p.R248H	GOPC_ENST00000535237.1_Missense_Mutation_p.R248H|GOPC_ENST00000467125.1_5'UTR|GOPC_ENST00000052569.6_Missense_Mutation_p.R240H	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	248					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		AGTTTTGTGACGATGCAAATG	0.453			O	ROS1	glioblastoma																																			Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	0								C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	294.0	237.0	257.0		719,743	5.2	1.0	6		257	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GOPC	NM_001017408.2,NM_020399.3	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	240/455,248/463	117894703	1,13005	2203	4300	6503	SO:0001583	missense	0			AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.743G>A	6.37:g.117894703C>T	ENSP00000357484:p.Arg248His		A6NM30|Q59FS4|Q969U8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R248H	ENST00000368498.2	37	c.743	CCDS5117.1	6	.	.	.	.	.	.	.	.	.	.	C	35	5.463424	0.96257	0.0	1.16E-4	ENSG00000047932	ENST00000052569;ENST00000368498;ENST00000535237	T;T;T	0.26067	1.78;1.8;1.76	6.06	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.45438	0.1342	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.34453	-0.9828	10	0.59425	D	0.04	-23.5309	16.8247	0.85927	0.1291:0.8709:0.0:0.0	.	240;248;248	Q9HD26-2;Q9HD26;F5H1Y4	.;GOPC_HUMAN;.	H	240;248;248	ENSP00000052569:R240H;ENSP00000357484:R248H;ENSP00000445690:R248H	ENSP00000052569:R240H	R	-	2	0	GOPC	118001396	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.067000	0.71193	2.882000	0.98803	0.655000	0.94253	CGT	GOPC	-	NULL	ENSG00000047932		0.453	GOPC-002	KNOWN	basic|CCDS	protein_coding	GOPC	HGNC	protein_coding	OTTHUMT00000041988.1	-	0.00	136	0	C	NM_020399		117894703	-1	tier1	-	no_errors	ENST00000368498	ensembl	human	known	74_37	missense	15.22	117	21	SNP	1.000	T
GPD2	2820	genome.wustl.edu	37	2	157426715	157426715	+	Silent	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:157426715A>G	ENST00000310454.6	+	12	1965	c.1593A>G	c.(1591-1593)ccA>ccG	p.P531P	GPD2_ENST00000409125.4_Silent_p.P304P|GPD2_ENST00000409674.1_Silent_p.P531P|GPD2_ENST00000540309.1_Intron|GPD2_ENST00000438166.2_Silent_p.P531P	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	531					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						CAGAATTTCCATATATTGAAG	0.408																																																	0													194.0	181.0	186.0					2																	157426715		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1593A>G	2.37:g.157426715A>G			A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Silent	SNP	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_G3P_DH_FAD-dep	p.P531	ENST00000310454.6	37	c.1593	CCDS2202.1	2																																																																																			GPD2	-	NULL	ENSG00000115159		0.408	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	HGNC	protein_coding	OTTHUMT00000254910.3	-	0.00	48	0	A			157426715	+1	tier1	-	no_errors	ENST00000310454	ensembl	human	known	74_37	silent	13.04	40	6	SNP	0.951	G
GPR98	84059	genome.wustl.edu	37	5	89968456	89968456	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:89968456G>A	ENST00000405460.2	+	22	4942	c.4846G>A	c.(4846-4848)Gaa>Aaa	p.E1616K	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1616	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTCACAGATTGAAACTGATGG	0.403																																																	0													197.0	180.0	185.0					5																	89968456		1886	4107	5993	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4846G>A	5.37:g.89968456G>A	ENSP00000384582:p.Glu1616Lys		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E1616K	ENST00000405460.2	37	c.4846	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434126	0.83776	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.30182	1.54	6.07	3.24	0.37175	Na-Ca exchanger/integrin-beta4 (1);	0.085415	0.85682	D	0.000000	T	0.29556	0.0737	N	0.22421	0.69	0.80722	D	1	P	0.42296	0.775	P	0.52066	0.689	T	0.04811	-1.0925	10	0.62326	D	0.03	.	7.1749	0.25738	0.0631:0.2311:0.5861:0.1196	.	1616	Q8WXG9	GPR98_HUMAN	K	1616	ENSP00000384582:E1616K	ENSP00000296619:E1616K	E	+	1	0	GPR98	90004212	1.000000	0.71417	0.987000	0.45799	0.961000	0.63080	5.043000	0.64208	0.400000	0.25396	0.655000	0.94253	GAA	GPR98	-	pfam_Calx_beta	ENSG00000164199		0.403	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	75	0	G	NM_032119		89968456	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	18.84	56	13	SNP	1.000	A
GRB14	2888	genome.wustl.edu	37	2	165353533	165353533	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:165353533T>C	ENST00000263915.3	-	12	1905	c.1367A>G	c.(1366-1368)cAa>cGa	p.Q456R	GRB14_ENST00000497306.1_5'UTR|GRB14_ENST00000543549.1_Missense_Mutation_p.Q369R	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	456	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						CACAAGTCCTTGCTGAATAAT	0.378																																																	0													76.0	73.0	74.0					2																	165353533		2203	4300	6503	SO:0001583	missense	0				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.1367A>G	2.37:g.165353533T>C	ENSP00000263915:p.Gln456Arg		B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.Q456R	ENST00000263915.3	37	c.1367	CCDS2222.1	2	.	.	.	.	.	.	.	.	.	.	T	20.4	3.978141	0.74360	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;D	0.92397	0.99;0.99;-3.03	5.91	5.91	0.95273	SH2 motif (4);	0.048839	0.85682	D	0.000000	D	0.93595	0.7955	L	0.38649	1.16	0.80722	D	1	P;D	0.53885	0.84;0.963	P;D	0.64595	0.578;0.927	D	0.94329	0.7560	10	0.72032	D	0.01	-15.5725	16.3364	0.83064	0.0:0.0:0.0:1.0	.	369;456	B7Z7F9;Q14449	.;GRB14_HUMAN	R	456;369;411	ENSP00000263915:Q456R;ENSP00000443699:Q369R;ENSP00000416786:Q411R	ENSP00000263915:Q456R	Q	-	2	0	GRB14	165061779	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.841000	0.86834	2.252000	0.74401	0.528000	0.53228	CAA	GRB14	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000115290		0.378	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	HGNC	protein_coding	OTTHUMT00000255180.2	-	0.00	55	0	T			165353533	-1	tier1	-	no_errors	ENST00000263915	ensembl	human	known	74_37	missense	21.92	57	16	SNP	1.000	C
HECW1	23072	genome.wustl.edu	37	7	43351452	43351452	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:43351452C>T	ENST00000395891.2	+	4	723	c.118C>T	c.(118-120)Cga>Tga	p.R40*	HECW1_ENST00000453890.1_Nonsense_Mutation_p.R40*	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	40					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GGAGCCGCTCCGATACAGCTA	0.617																																																	0													51.0	60.0	57.0					7																	43351452		1996	4148	6144	SO:0001587	stop_gained	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.118C>T	7.37:g.43351452C>T	ENSP00000379228:p.Arg40*		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.R40*	ENST00000395891.2	37	c.118	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838602	0.91117	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	.	.	.	5.96	5.05	0.67936	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.103	0.65070	0.3056:0.6944:0.0:0.0	.	.	.	.	X	40;40;39	.	ENSP00000265522:R39X	R	+	1	2	HECW1	43317977	0.992000	0.36948	0.995000	0.50966	0.246000	0.25737	2.924000	0.48876	2.813000	0.96785	0.655000	0.94253	CGA	HECW1	-	NULL	ENSG00000002746		0.617	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	-	0.00	48	0	C	NM_015052		43351452	+1	tier1	-	no_errors	ENST00000395891	ensembl	human	known	74_37	nonsense	22.73	34	10	SNP	0.987	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29977317	29977317	+	RNA	SNP	G	G	A	rs145867142		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:29977317G>A	ENST00000376797.3	-	0	731				ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TATAGTGTGAGACAGCTGCCT	0.428																																																	0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977317G>A				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.428	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1		0.00	57	0	G	NR_026751		29977317	+1			no_errors	ENST00000462773	ensembl	human	known	74_37	rna	9.09	50	5	SNP	0.009	A
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29977327	29977327	+	RNA	SNP	T	T	C	rs200662795		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:29977327T>C	ENST00000376797.3	-	0	731				ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		GACAGCTGCCTTGTGTGGGAC	0.438																																																	0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977327T>C				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.438	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1		0.00	58	0	T	NR_026751		29977327	+1			no_errors	ENST00000462773	ensembl	human	known	74_37	rna	9.62	47	5	SNP	0.010	C
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29977342	29977342	+	RNA	SNP	A	A	T	rs113017032	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:29977342A>T	ENST00000376797.3	-	0	731				ZNRD1-AS1_ENST00000448093.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|ZNRD1-AS1_ENST00000444051.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TGGGACTGAGAGGCAAGATTT	0.438													A|||	16	0.00319489	0.003	0.0029	5008	,	,		21762	0.0		0.003	False		,,,				2504	0.0072																0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29977342A>T				RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.438	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1		0.00	50	0	A	NR_026751		29977342	+1			no_errors	ENST00000462773	ensembl	human	known	74_37	rna	10.42	43	5	SNP	0.005	T
SLC27A3	11000	genome.wustl.edu	37	1	153746474	153746475	+	5'Flank	INS	-	-	T	rs369652122|rs200086354|rs200538501|rs372321518|rs577478018		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:153746474_153746475insT	ENST00000368661.3	+	0	0				INTS3_ENST00000318967.2_3'UTR|INTS3_ENST00000476843.1_3'UTR|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000456435.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ttttttttttgtttttttttgt	0.376																																																	0																																										SO:0001631	upstream_gene_variant	0			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153746483_153746483dupT	Exception_encountered		Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	RNA	INS	-	NULL	ENST00000368661.3	37	NULL	CCDS1053.1	1																																																																																			INTS3	-	-	ENSG00000143624		0.376	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding			0.00	27	0	-	NM_024330		153746475	+1	tier1		no_errors	ENST00000476843	ensembl	human	known	74_37	rna	14.29	18	3	INS	0.000:0.001	T
ITGA4	3676	genome.wustl.edu	37	2	182339903	182339904	+	Frame_Shift_Ins	INS	-	-	A	rs201063607		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:182339903_182339904insA	ENST00000397033.2	+	4	874_875	c.444_445insA	c.(445-447)aaafs	p.K149fs	ITGA4_ENST00000478440.1_Intron|ITGA4_ENST00000339307.4_Frame_Shift_Ins_p.K149fs	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	149					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GGCATAGATGGAAAAATATATT	0.406																																																	0																																										SO:0001589	frameshift_variant	0				CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.449dupA	2.37:g.182339908_182339908dupA	ENSP00000380227:p.Lys149fs		D3DPG4|Q7Z4L6	Frame_Shift_Ins	INS	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.N149fs	ENST00000397033.2	37	c.444_445	CCDS42788.1	2																																																																																			ITGA4	-	NULL	ENSG00000115232		0.406	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA4	HGNC	protein_coding	OTTHUMT00000334427.1		0.00	69	0	-			182339904	+1	tier1		no_errors	ENST00000397033	ensembl	human	known	74_37	frame_shift_ins	15.48	71	13	INS	1.000:1.000	A
KCNA6	3742	genome.wustl.edu	37	12	4919422	4919422	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:4919422G>A	ENST00000280684.3	+	1	1081	c.215G>A	c.(214-216)cGg>cAg	p.R72Q	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.R72Q			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	72					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GACCCTGGCCGGCGAGTCCGC	0.622										HNSCC(72;0.22)																																							0													45.0	47.0	47.0					12																	4919422		2203	4300	6503	SO:0001583	missense	0			X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.215G>A	12.37:g.4919422G>A	ENSP00000280684:p.Arg72Gln			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.R72Q	ENST00000280684.3	37	c.215	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842701	0.71488	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	T;T	0.75938	-0.98;-0.98	4.57	3.68	0.42216	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.517604	0.20049	N	0.100352	T	0.72162	0.3426	M	0.84433	2.695	0.42298	D	0.992165	P	0.43788	0.817	B	0.36845	0.234	T	0.74931	-0.3496	10	0.62326	D	0.03	.	7.7934	0.29133	0.2611:0.0:0.7389:0.0	.	72	P17658	KCNA6_HUMAN	Q	72	ENSP00000408321:R72Q;ENSP00000280684:R72Q	ENSP00000280684:R72Q	R	+	2	0	KCNA6	4789683	0.002000	0.14202	0.993000	0.49108	0.938000	0.57974	1.405000	0.34635	1.146000	0.42352	0.462000	0.41574	CGG	KCNA6	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1	ENSG00000151079		0.622	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA6	HGNC	protein_coding	OTTHUMT00000398909.1	-	0.00	119	0	G	NM_002235		4919422	+1	tier1	-	no_errors	ENST00000280684	ensembl	human	known	74_37	missense	26.92	94	35	SNP	0.983	A
KIF4B	285643	genome.wustl.edu	37	5	154393463	154393463	+	Missense_Mutation	SNP	G	G	A	rs200942753		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:154393463G>A	ENST00000435029.4	+	1	204	c.44G>A	c.(43-45)cGt>cAt	p.R15H		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	15	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GTGGCACTGCGTTGTCGCCCT	0.547																																																	0								G	HIS/ARG	0,4406		0,0,2203	123.0	117.0	119.0		44	0.6	0.6	5		119	1,8599	1.2+/-3.3	0,1,4299	no	missense	KIF4B	NM_001099293.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	15/1235	154393463	1,13005	2203	4300	6503	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.44G>A	5.37:g.154393463G>A	ENSP00000387875:p.Arg15His			Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R15H	ENST00000435029.4	37	c.44	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	g	16.75	3.208770	0.58343	0.0	1.16E-4	ENSG00000226650	ENST00000435029	D	0.86562	-2.14	1.48	0.582	0.17412	Kinesin, motor domain (4);	.	.	.	.	D	0.94644	0.8273	H	0.98754	4.32	0.54753	D	0.999984	D	0.65815	0.995	D	0.64776	0.929	D	0.91504	0.5221	9	0.66056	D	0.02	.	6.0528	0.19794	0.1884:0.0:0.8116:0.0	.	15	Q2VIQ3	KIF4B_HUMAN	H	15	ENSP00000387875:R15H	ENSP00000387875:R15H	R	+	2	0	KIF4B	154373656	0.998000	0.40836	0.634000	0.29324	0.848000	0.48234	4.868000	0.63021	0.193000	0.20303	-0.244000	0.11960	CGT	KIF4B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000226650		0.547	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	-	0.00	98	0	G			154393463	+1	tier1	rs200942753	no_errors	ENST00000435029	ensembl	human	known	74_37	missense	7.62	97	8	SNP	0.995	A
KIF6	221458	genome.wustl.edu	37	6	39602636	39602636	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:39602636C>A	ENST00000287152.7	-	5	592	c.498G>T	c.(496-498)ttG>ttT	p.L166F	KIF6_ENST00000538893.1_Missense_Mutation_p.L166F|KIF6_ENST00000373215.3_Missense_Mutation_p.L166F|KIF6_ENST00000373216.3_Missense_Mutation_p.L166F	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	166	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						GCAAATCTTCCAAACTGGAGG	0.363																																																	0													125.0	123.0	124.0					6																	39602636		2203	4300	6503	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.498G>T	6.37:g.39602636C>A	ENSP00000287152:p.Leu166Phe		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L166F	ENST00000287152.7	37	c.498	CCDS4844.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.86|15.86	2.957491|2.957491	0.53400|0.53400	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373215;ENST00000538893|ENST00000458470	T;T;T;T|.	0.75154|.	-0.91;-0.91;-0.91;-0.91|.	5.28|5.28	3.46|3.46	0.39613|0.39613	Kinesin, motor domain (4);|.	.|.	.|.	.|.	.|.	T|T	0.64897|0.64897	0.2640|0.2640	M|M	0.84683|0.84683	2.71|2.71	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.97;1.0|.	D;P;D|.	0.85130|.	0.995;0.708;0.997|.	T|T	0.68116|0.68116	-0.5494|-0.5494	9|5	0.56958|.	D|.	0.05|.	.|.	7.93|7.93	0.29897|0.29897	0.0:0.708:0.0:0.292|0.0:0.708:0.0:0.292	.|.	166;166;166|.	E7EUN7;F6VGH2;Q6ZMV9|.	.;.;KIF6_HUMAN|.	F|L	166|58	ENSP00000287152:L166F;ENSP00000362312:L166F;ENSP00000362311:L166F;ENSP00000441435:L166F|.	ENSP00000287152:L166F|.	L|W	-|-	3|2	2|0	KIF6|KIF6	39710614|39710614	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.651000|1.651000	0.37302|0.37302	1.196000|1.196000	0.43129|0.43129	0.557000|0.557000	0.71058|0.71058	TTG|TGG	KIF6	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000164627		0.363	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	-	0.00	56	0	C	NM_145027		39602636	-1	tier1	-	no_errors	ENST00000287152	ensembl	human	known	74_37	missense	12.31	57	8	SNP	1.000	A
KMT2A	4297	genome.wustl.edu	37	11	118374955	118374955	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:118374955T>C	ENST00000389506.5	+	27	8339	c.8339T>C	c.(8338-8340)aTg>aCg	p.M2780T	KMT2A_ENST00000354520.4_Missense_Mutation_p.M2742T|KMT2A_ENST00000534358.1_Missense_Mutation_p.M2783T			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2780					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										GAGCCAAAGATGGATAACTGC	0.438																																																	0													94.0	93.0	93.0					11																	118374955		2200	4296	6496	SO:0001583	missense	0			L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.8339T>C	11.37:g.118374955T>C	ENSP00000374157:p.Met2780Thr		E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.M2780T	ENST00000389506.5	37	c.8339	CCDS31686.1	11	.	.	.	.	.	.	.	.	.	.	T	4.767	0.142656	0.09083	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	T;T;T	0.81163	-1.46;-1.46;-1.42	6.17	5.05	0.67936	.	0.359374	0.36268	N	0.002691	T	0.69522	0.3120	N	0.22421	0.69	0.29356	N	0.865013	B;B	0.17038	0.02;0.02	B;B	0.14023	0.01;0.01	T	0.64761	-0.6331	10	0.54805	T	0.06	.	12.3147	0.54948	0.0:0.0655:0.0:0.9345	.	2783;2780	E9PQG7;Q03164	.;MLL1_HUMAN	T	2783;2780;2742;1690	ENSP00000436786:M2783T;ENSP00000374157:M2780T;ENSP00000346516:M2742T	ENSP00000346516:M2742T	M	+	2	0	MLL	117880165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.227000	0.58612	1.155000	0.42497	0.533000	0.62120	ATG	KMT2A	-	pirsf_MeTrfase_trithorax	ENSG00000118058		0.438	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	HGNC	protein_coding	OTTHUMT00000399085.2	-	0.00	47	0	T	NM_005933		118374955	+1	tier1	-	no_errors	ENST00000389506	ensembl	human	known	74_37	missense	43.75	27	21	SNP	1.000	C
KRT9	3857	genome.wustl.edu	37	17	39723706	39723706	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:39723706G>A	ENST00000246662.4	-	7	1756	c.1691C>T	c.(1690-1692)tCt>tTt	p.S564F	KRT9_ENST00000588431.1_Missense_Mutation_p.S331F	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	564	Tail.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				tcctcctccagagccacttcc	0.592																																																	0													263.0	189.0	214.0					17																	39723706		2162	4244	6406	SO:0001583	missense	0				CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.1691C>T	17.37:g.39723706G>A	ENSP00000246662:p.Ser564Phe		O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.S564F	ENST00000246662.4	37	c.1691	CCDS32654.1	17	.	.	.	.	.	.	.	.	.	.	G	0.048	-1.259651	0.01445	.	.	ENSG00000171403	ENST00000246662	D	0.91068	-2.78	3.11	-0.641	0.11490	.	1.236650	0.06253	N	0.692464	D	0.84106	0.5399	N	0.24115	0.695	0.20074	N	0.999937	P	0.36065	0.535	B	0.39771	0.309	T	0.75068	-0.3448	10	0.87932	D	0	.	5.4453	0.16531	0.0:0.1946:0.4078:0.3976	.	564	P35527	K1C9_HUMAN	F	564	ENSP00000246662:S564F	ENSP00000246662:S564F	S	-	2	0	KRT9	36977232	0.000000	0.05858	0.264000	0.24511	0.024000	0.10985	0.123000	0.15708	0.054000	0.16065	-0.296000	0.09543	TCT	KRT9	-	NULL	ENSG00000171403		0.592	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT9	HGNC	protein_coding	OTTHUMT00000257707.1	-	0.00	179	0	G	NM_000226		39723706	-1	tier1	-	no_errors	ENST00000246662	ensembl	human	known	74_37	missense	17.53	127	27	SNP	0.147	A
KRTAP13-1	140258	genome.wustl.edu	37	21	31768834	31768834	+	Missense_Mutation	SNP	G	G	A	rs374257240		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr21:31768834G>A	ENST00000355459.2	+	1	443	c.430G>A	c.(430-432)Gtt>Att	p.V144I		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	144						intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GGGCTATGGCGTTGGATTCTG	0.542																																																	0								G	ILE/VAL	0,4406		0,0,2203	61.0	57.0	59.0		430	1.8	0.0	21		59	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRTAP13-1	NM_181599.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	144/173	31768834	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.430G>A	21.37:g.31768834G>A	ENSP00000347635:p.Val144Ile		Q14D20|Q3LI79	Missense_Mutation	SNP	pfam_KRTAP_PMG	p.V144I	ENST00000355459.2	37	c.430	CCDS13590.2	21	.	.	.	.	.	.	.	.	.	.	G	11.60	1.685832	0.29962	0.0	1.16E-4	ENSG00000198390	ENST00000355459	T	0.03035	4.07	4.41	1.76	0.24704	.	0.557606	0.14727	N	0.301981	T	0.02848	0.0085	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.41324	-0.9515	10	0.66056	D	0.02	.	5.945	0.19213	0.0:0.0984:0.1624:0.7392	.	144	Q8IUC0	KR131_HUMAN	I	144	ENSP00000347635:V144I	ENSP00000347635:V144I	V	+	1	0	KRTAP13-1	30690705	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.068000	0.14531	0.372000	0.24591	-0.272000	0.10252	GTT	KRTAP13-1	-	pfam_KRTAP_PMG	ENSG00000198390		0.542	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-1	HGNC	protein_coding	OTTHUMT00000128252.3	-	0.00	112	0	G			31768834	+1	tier1	-	no_errors	ENST00000355459	ensembl	human	known	74_37	missense	14.56	88	15	SNP	0.001	A
KRTAP17-1	83902	genome.wustl.edu	37	17	39471766	39471767	+	Frame_Shift_Ins	INS	-	-	C	rs572148015|rs386797077	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:39471766_39471767insC	ENST00000334202.3	-	1	180_181	c.136_137insG	c.(136-138)tctfs	p.S46fs		NM_031964.1	NP_114170.1	Q9BYP8	KR171_HUMAN	keratin associated protein 17-1	46						intermediate filament (GO:0005882)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			cccgcagccagagcccccgcag	0.683																																																	0																																										SO:0001589	frameshift_variant	0			AJ406952	CCDS11387.1	17q21.2	2013-06-20			ENSG00000186860	ENSG00000186860		"""Keratin associated proteins"""	18917	protein-coding gene	gene with protein product							Standard	NM_031964		Approved	KAP17.1	uc002hwj.3	Q9BYP8	OTTHUMG00000133433	ENST00000334202.3:c.136_137insG	17.37:g.39471766_39471767insC	ENSP00000333993:p.Ser46fs			Frame_Shift_Ins	INS	NULL	p.S46fs	ENST00000334202.3	37	c.137_136	CCDS11387.1	17																																																																																			KRTAP17-1	-	NULL	ENSG00000186860		0.683	KRTAP17-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP17-1	HGNC	protein_coding	OTTHUMT00000257296.1		0.00	20	0	-			39471767	-1	tier1		no_errors	ENST00000334202	ensembl	human	known	74_37	frame_shift_ins	15.62	27	5	INS	0.000:0.001	C
LIFR	3977	genome.wustl.edu	37	5	38484942	38484942	+	Silent	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:38484942G>T	ENST00000263409.4	-	18	2688	c.2526C>A	c.(2524-2526)atC>atA	p.I842I	LIFR_ENST00000453190.2_Silent_p.I842I	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	842					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					CTGCCACTGGGATGAGAATGG	0.383			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													69.0	66.0	67.0					5																	38484942		2203	4300	6503	SO:0001819	synonymous_variant	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2526C>A	5.37:g.38484942G>T			Q6LCD9	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.I842	ENST00000263409.4	37	c.2526	CCDS3927.1	5																																																																																			LIFR	-	NULL	ENSG00000113594		0.383	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1		0.00	55	0	G	NM_002310		38484942	-1			no_errors	ENST00000263409	ensembl	human	known	74_37	silent	5.00	57	3	SNP	1.000	T
LOC100287934	100287934	genome.wustl.edu	37	1	717521	717521	+	IGR	SNP	G	G	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:717521G>C								RP11-206L10.2 (3515 upstream) : RP11-206L10.9 (3658 downstream)																							TTAGAGGTAAGATGCAAATTT	0.313																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.717521G>C				RNA	SNP	-	NULL		37	NULL		1																																																																																			RP11-206L10.9	-	-	ENSG00000237491	0	0.313					LOC101930657	Clone_based_vega_gene			-	0.00	99	0	G			717521	+1	tier1	-	no_errors	ENST00000457084	ensembl	human	known	74_37	rna	7.08	104	8	SNP	0.346	C
LOXHD1	125336	genome.wustl.edu	37	18	44087570	44087570	+	Missense_Mutation	SNP	C	C	T	rs367623969		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr18:44087570C>T	ENST00000398722.4	-	29	4788	c.4789G>A	c.(4789-4791)Gtt>Att	p.V1597I	LOXHD1_ENST00000582408.1_Missense_Mutation_p.V702I|LOXHD1_ENST00000300591.6_Missense_Mutation_p.V764I|LOXHD1_ENST00000441893.2_Missense_Mutation_p.V746I|LOXHD1_ENST00000398705.2_Missense_Mutation_p.V114I|LOXHD1_ENST00000579038.1_Missense_Mutation_p.V668I|LOXHD1_ENST00000398686.4_Missense_Mutation_p.V114I|LOXHD1_ENST00000441551.2_Missense_Mutation_p.V1669I|LOXHD1_ENST00000536736.1_Missense_Mutation_p.V1813I			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1597					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCATCGATAACGGCACACATT	0.552																																																	0								C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,1384		0,0,692	203.0	167.0	178.0		2290,340,340,5437	5.4	1.0	18		178	1,3181		0,1,1590	no	missense,missense,missense,missense	LOXHD1	NM_001145472.2,NM_001145473.2,NM_001173129.1,NM_144612.6	29,29,29,29	0,1,2282	TT,TC,CC		0.0314,0.0,0.0219	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	764/1115,114/513,114/458,1813/2212	44087570	1,4565	692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.4789G>A	18.37:g.44087570C>T	ENSP00000381707:p.Val1597Ile		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.V1813I	ENST00000398722.4	37	c.5437		18	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336860	0.41398	0.0	3.14E-4	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000398705;ENST00000536736;ENST00000441893;ENST00000398686;ENST00000414184	T;T;T;T;T;T;T	0.23552	1.9;3.32;3.4;3.34;3.34;3.39;3.21	5.43	5.43	0.79202	.	.	.	.	.	T	0.25158	0.0611	M	0.78049	2.395	0.37862	D	0.929757	P;B;B	0.37500	0.597;0.366;0.251	B;B;B	0.26094	0.066;0.046;0.021	T	0.18335	-1.0340	9	0.37606	T	0.19	.	9.291	0.37786	0.0:0.8003:0.0:0.1997	.	1813;746;1597	F5GZB4;F8WA52;Q8IVV2	.;.;LOXH1_HUMAN	I	764;1597;114;1813;746;114;114	ENSP00000300591:V764I;ENSP00000381707:V1597I;ENSP00000381692:V114I;ENSP00000444586:V1813I;ENSP00000409062:V746I;ENSP00000381676:V114I;ENSP00000392440:V114I	ENSP00000300591:V764I	V	-	1	0	LOXHD1	42341568	0.980000	0.34600	0.959000	0.39883	0.953000	0.61014	2.561000	0.45905	2.561000	0.86390	0.561000	0.74099	GTT	LOXHD1	-	NULL	ENSG00000167210		0.552	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	82	0	C	NM_144612		44087570	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.987	T
LRP2	4036	genome.wustl.edu	37	2	170044680	170044680	+	Missense_Mutation	SNP	C	C	T	rs143078432		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:170044680C>T	ENST00000263816.3	-	49	9413	c.9128G>A	c.(9127-9129)cGc>cAc	p.R3043H		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3043	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.R3043H(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ACTAATGCAGCGCCCGTTCTG	0.517																																																	1	Substitution - Missense(1)	ovary(1)						C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	142.0	134.0	137.0		9128	0.2	0.3	2	dbSNP_134	137	0,8600		0,0,4300	no	missense	LRP2	NM_004525.2	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	3043/4656	170044680	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9128G>A	2.37:g.170044680C>T	ENSP00000263816:p.Arg3043His		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.R3043H	ENST00000263816.3	37	c.9128	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394317	0.83011	2.27E-4	0.0	ENSG00000081479	ENST00000263816	D	0.96041	-3.89	5.68	0.217	0.15264	.	0.436137	0.26159	N	0.025985	D	0.90570	0.7044	L	0.43757	1.38	0.80722	D	1	P	0.45283	0.855	B	0.38562	0.276	D	0.85430	0.1148	10	0.54805	T	0.06	.	8.5804	0.33626	0.2541:0.6156:0.0:0.1303	.	3043	P98164	LRP2_HUMAN	H	3043	ENSP00000263816:R3043H	ENSP00000263816:R3043H	R	-	2	0	LRP2	169752926	1.000000	0.71417	0.322000	0.25334	0.874000	0.50279	2.327000	0.43858	-0.018000	0.14079	0.650000	0.86243	CGC	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.517	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	99	0	C	NM_004525		170044680	-1	tier1	rs143078432	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	20.37	86	22	SNP	0.961	T
LRRC28	123355	genome.wustl.edu	37	15	99796172	99796172	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:99796172G>A	ENST00000301981.3	+	2	250	c.10G>A	c.(10-12)Gaa>Aaa	p.E4K	AC022819.1_ENST00000581052.1_RNA|LRRC28_ENST00000447360.2_Missense_Mutation_p.E4K|LRRC28_ENST00000331450.5_Missense_Mutation_p.E4K|LRRC28_ENST00000442993.2_Missense_Mutation_p.E4K|LRRC28_ENST00000422500.2_Missense_Mutation_p.E4K|LRRC28_ENST00000559399.1_3'UTR|LRRC28_ENST00000558879.1_Missense_Mutation_p.E4K	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	4										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			CATGGCGTCCGAACTTTGTAA	0.378																																																	0													97.0	92.0	94.0					15																	99796172		2197	4297	6494	SO:0001583	missense	0			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.10G>A	15.37:g.99796172G>A	ENSP00000304923:p.Glu4Lys		A8KA22|Q6UY49|Q6ZSS6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E4K	ENST00000301981.3	37	c.10	CCDS10380.1	15	.	.	.	.	.	.	.	.	.	.	G	21.6	4.177786	0.78564	.	.	ENSG00000168904	ENST00000301981;ENST00000447360;ENST00000422500;ENST00000442993;ENST00000331450	T;T;T;T	0.47177	0.97;0.85;1.58;0.99	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.55721	0.1938	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.995;0.999	D;D;D;D	0.74023	0.981;0.982;0.97;0.972	T	0.54748	-0.8247	10	0.39692	T	0.17	.	19.0086	0.92863	0.0:0.0:1.0:0.0	.	4;4;4;4	B4DHL3;Q8WUS2;Q86X40-2;Q86X40	.;.;.;LRC28_HUMAN	K	4	ENSP00000304923:E4K;ENSP00000404520:E4K;ENSP00000398606:E4K;ENSP00000404206:E4K	ENSP00000304923:E4K	E	+	1	0	LRRC28	97613695	1.000000	0.71417	0.970000	0.41538	0.848000	0.48234	9.209000	0.95087	2.729000	0.93468	0.650000	0.86243	GAA	LRRC28	-	NULL	ENSG00000168904		0.378	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	HGNC	protein_coding	OTTHUMT00000313546.1	-	0.00	77	0	G	NM_144598		99796172	+1	tier1	-	no_errors	ENST00000301981	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	A
LUM	4060	genome.wustl.edu	37	12	91502498	91502498	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:91502498C>G	ENST00000266718.4	-	2	713	c.259G>C	c.(259-261)Gag>Cag	p.E87Q	LUM_ENST00000548071.1_Intron	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	87					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						GTTACATTCTCAAAGGCCTTT	0.373																																																	0													99.0	100.0	100.0					12																	91502498		2203	4300	6503	SO:0001583	missense	0			BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.259G>C	12.37:g.91502498C>G	ENSP00000266718:p.Glu87Gln		B2R6R5|Q96QM7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.E87Q	ENST00000266718.4	37	c.259	CCDS9038.1	12	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088456	0.76756	.	.	ENSG00000139329	ENST00000266718	T	0.57907	0.37	5.66	5.66	0.87406	.	0.149852	0.64402	D	0.000016	T	0.33440	0.0863	N	0.04063	-0.285	0.45995	D	0.998807	P	0.41188	0.741	B	0.42062	0.374	T	0.21759	-1.0236	10	0.32370	T	0.25	-14.612	13.3479	0.60584	0.0:0.9279:0.0:0.0721	.	87	P51884	LUM_HUMAN	Q	87	ENSP00000266718:E87Q	ENSP00000266718:E87Q	E	-	1	0	LUM	90026629	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.742000	0.68646	2.831000	0.97527	0.650000	0.86243	GAG	LUM	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000139329		0.373	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LUM	HGNC	protein_coding	OTTHUMT00000407150.2		0.00	52	0	C	NM_002345		91502498	-1			no_errors	ENST00000266718	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	G
MAP3K10	4294	genome.wustl.edu	37	19	40710471	40710471	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:40710471G>A	ENST00000253055.3	+	3	1231	c.943G>A	c.(943-945)Gtg>Atg	p.V315M	AC118344.1_ENST00000408124.1_RNA|MAP3K10_ENST00000593906.1_3'UTR	NM_002446.3	NP_002437.2	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase 10	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|JNK cascade (GO:0007254)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|bHLH transcription factor binding (GO:0043425)|JUN kinase kinase kinase activity (GO:0004706)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription corepressor activity (GO:0003714)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	24						GGCGTATGGCGTGGCTATGAA	0.682																																																	0													107.0	72.0	84.0					19																	40710471		2203	4300	6503	SO:0001583	missense	0			X90846	CCDS12549.1	19q13.2	2014-08-12			ENSG00000130758		2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6849	protein-coding gene	gene with protein product	"""MKN28 kinase"", ""mixed lineage kinase 2"", ""MKN28 derived nonreceptor_type serine/threonine kinase"""	600137		MLK2		8536694, 7731697	Standard	NM_002446		Approved	MST, MEKK10	uc002ona.3	Q02779	OTTHUMG00000182591	ENST00000253055.3:c.943G>A	19.37:g.40710471G>A	ENSP00000253055:p.Val315Met		Q12761|Q14871	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.V315M	ENST00000253055.3	37	c.943	CCDS12549.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.135101	0.94517	.	.	ENSG00000130758	ENST00000253055	D	0.84442	-1.85	5.13	5.13	0.70059	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.142016	0.46442	D	0.000296	D	0.91314	0.7261	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.92122	0.5705	10	0.87932	D	0	.	16.4246	0.83810	0.0:0.0:1.0:0.0	.	315	Q02779	M3K10_HUMAN	M	315	ENSP00000253055:V315M	ENSP00000253055:V315M	V	+	1	0	MAP3K10	45402311	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.790000	0.99075	2.542000	0.85734	0.650000	0.86243	GTG	MAP3K10	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000130758		0.682	MAP3K10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K10	HGNC	protein_coding	OTTHUMT00000462552.1	-	0.00	48	0	G	NM_002446		40710471	+1	tier1	-	no_errors	ENST00000253055	ensembl	human	known	74_37	missense	40.68	35	24	SNP	1.000	A
MAMSTR	284358	genome.wustl.edu	37	19	49218580	49218580	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:49218580C>T	ENST00000318083.6	-	5	427	c.364G>A	c.(364-366)Gcc>Acc	p.A122T	MAMSTR_ENST00000594582.1_Missense_Mutation_p.A19T|MAMSTR_ENST00000356751.4_Missense_Mutation_p.A19T|MAMSTR_ENST00000419611.1_Missense_Mutation_p.A19T|MAMSTR_ENST00000377367.3_Missense_Mutation_p.A19T			Q6ZN01	MASTR_HUMAN	MEF2 activating motif and SAP domain containing transcriptional regulator	122	Pro-rich.				positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(1)|ovary(1)	2						GGACCCAGGGCGGACCCCTCG	0.622																																																	0													22.0	27.0	26.0					19																	49218580		2190	4282	6472	SO:0001583	missense	0			AK093389	CCDS12730.1, CCDS46137.1, CCDS74415.1	19q13.33	2009-07-09			ENSG00000176909	ENSG00000176909			26689	protein-coding gene	gene with protein product	"""MEF2-activating SAP transcriptional regulator"""	610349				16818234	Standard	NM_182574		Approved	MASTR, FLJ36070	uc002pkg.2	Q6ZN01		ENST00000318083.6:c.364G>A	19.37:g.49218580C>T	ENSP00000324175:p.Ala122Thr		B7ZKX4|Q3KQU9|Q8N9Y3	Missense_Mutation	SNP	pfam_SAP_dom,smart_SAP_dom,pfscan_SAP_dom	p.A122T	ENST00000318083.6	37	c.364	CCDS46137.1	19	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746015	0.30955	.	.	ENSG00000176909	ENST00000318083;ENST00000419611;ENST00000377367;ENST00000356751	.	.	.	3.38	1.17	0.20885	.	0.720175	0.11428	N	0.565055	T	0.16385	0.0394	N	0.14661	0.345	0.09310	N	1	B	0.25486	0.127	B	0.12156	0.007	T	0.23583	-1.0184	9	0.18710	T	0.47	-1.5896	4.2309	0.10602	0.0:0.6212:0.2405:0.1383	.	122	Q6ZN01	MASTR_HUMAN	T	122;19;19;19	.	ENSP00000324175:A122T	A	-	1	0	MAMSTR	53910392	0.006000	0.16342	0.001000	0.08648	0.943000	0.58893	0.533000	0.23082	0.410000	0.25675	0.549000	0.68633	GCC	MAMSTR	-	NULL	ENSG00000176909		0.622	MAMSTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMSTR	HGNC	protein_coding	OTTHUMT00000466179.1	-	0.00	28	0	C	NM_182574		49218580	-1	tier1	-	no_errors	ENST00000318083	ensembl	human	known	74_37	missense	17.31	43	9	SNP	0.003	T
MAPRE1	22919	genome.wustl.edu	37	20	31434572	31434572	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr20:31434572C>T	ENST00000375571.5	+	6	885	c.746C>T	c.(745-747)aCa>aTa	p.T249I	RP5-1085F17.4_ENST00000565572.1_RNA	NM_012325.2	NP_036457.1	Q15691	MARE1_HUMAN	microtubule-associated protein, RP/EB family, member 1	249	DCTN1-binding.|EB1 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00576}.|Interaction with CDK5RAP2.|Interaction with MTUS2/TIP150.				cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of microtubule plus-end binding (GO:1903033)|protein localization to microtubule (GO:0035372)	cell projection membrane (GO:0031253)|centrosome (GO:0005813)|cortical microtubule cytoskeleton (GO:0030981)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule plus-end (GO:0035371)	microtubule plus-end binding (GO:0051010)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8						CTGTATGCCACAGATGTATGT	0.413																																																	0													166.0	158.0	161.0					20																	31434572		2203	4300	6503	SO:0001583	missense	0			U24166	CCDS13208.1	20q11.1-q11.3	2013-01-17			ENSG00000101367	ENSG00000101367			6890	protein-coding gene	gene with protein product	"""adenomatous polyposis coli-binding protein EB1"""	603108				7606712, 9724749, 11470413	Standard	NM_012325		Approved	EB1	uc002wyh.3	Q15691	OTTHUMG00000032228	ENST00000375571.5:c.746C>T	20.37:g.31434572C>T	ENSP00000364721:p.Thr249Ile		B2R6I7|E1P5M8|Q3KQS8	Missense_Mutation	SNP	pfam_EB1_C,pfam_CH-domain,superfamily_CH-domain,superfamily_EB1_C,pfscan_CH-domain	p.T249I	ENST00000375571.5	37	c.746	CCDS13208.1	20	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874618	0.91664	.	.	ENSG00000101367	ENST00000375571	T	0.55588	0.51	4.87	4.87	0.63330	EB1, C-terminal (1);	0.046492	0.85682	N	0.000000	T	0.79885	0.4523	H	0.96111	3.77	0.80722	D	1	D	0.64830	0.994	P	0.61658	0.892	D	0.86627	0.1883	10	0.87932	D	0	-8.1966	17.5349	0.87827	0.0:1.0:0.0:0.0	.	249	Q15691	MARE1_HUMAN	I	249	ENSP00000364721:T249I	ENSP00000364721:T249I	T	+	2	0	MAPRE1	30898233	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.609000	0.82925	2.692000	0.91855	0.655000	0.94253	ACA	MAPRE1	-	superfamily_EB1_C	ENSG00000101367		0.413	MAPRE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPRE1	HGNC	protein_coding	OTTHUMT00000078647.2	-	0.00	127	0	C	NM_012325		31434572	+1	tier1	-	no_errors	ENST00000375571	ensembl	human	known	74_37	missense	20.27	118	30	SNP	1.000	T
MBTPS2	51360	genome.wustl.edu	37	X	21861368	21861368	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrX:21861368G>T	ENST00000379484.5	+	2	255	c.156G>T	c.(154-156)tgG>tgT	p.W52C	MBTPS2_ENST00000365779.2_Missense_Mutation_p.W52C|MBTPS2_ENST00000465888.1_3'UTR	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	52					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						ACATAAGATGGCAAACTGCTG	0.403																																																	0													199.0	191.0	194.0					X																	21861368		2203	4300	6503	SO:0001583	missense	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.156G>T	X.37:g.21861368G>T	ENSP00000368798:p.Trp52Cys		Q9UM70|Q9UMD3	Missense_Mutation	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_MBTPS2	p.W52C	ENST00000379484.5	37	c.156	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	G	16.14	3.039106	0.55003	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.94758	-3.51;-2.33	5.49	5.49	0.81192	.	0.126318	0.64402	D	0.000016	D	0.93989	0.8075	M	0.77103	2.36	0.80722	D	1	B;B;B	0.33549	0.417;0.417;0.251	B;B;B	0.31442	0.13;0.13;0.055	D	0.93084	0.6494	10	0.37606	T	0.19	-3.5813	18.4734	0.90782	0.0:0.0:1.0:0.0	.	52;52;52	A8KA68;O43462;B9ZVQ3	.;MBTP2_HUMAN;.	C	52	ENSP00000368798:W52C;ENSP00000368796:W52C	ENSP00000368796:W52C	W	+	3	0	MBTPS2	21771289	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.655000	0.91098	2.305000	0.77605	0.544000	0.68410	TGG	MBTPS2	-	NULL	ENSG00000012174		0.403	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	-	0.00	38	0	G			21861368	+1	tier1	-	no_errors	ENST00000379484	ensembl	human	known	74_37	missense	42.86	31	24	SNP	1.000	T
MKI67	4288	genome.wustl.edu	37	10	129908757	129908757	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr10:129908757C>T	ENST00000368654.3	-	12	2676	c.2301G>A	c.(2299-2301)ccG>ccA	p.P767P	MKI67_ENST00000484853.1_5'Flank|MKI67_ENST00000368653.3_Silent_p.P407P	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	767					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGTCAACTGCGGTTGCTCCT	0.403																																																	0													145.0	146.0	146.0					10																	129908757		2203	4300	6503	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.2301G>A	10.37:g.129908757C>T			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.P767	ENST00000368654.3	37	c.2301	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.403	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1		0.00	36	0	C	NM_002417		129908757	-1			no_errors	ENST00000368654	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.000	T
MMAB	326625	genome.wustl.edu	37	12	109999611	109999611	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:109999611C>G	ENST00000545712.2	-	5	788	c.395G>C	c.(394-396)tGc>tCc	p.C132S	MMAB_ENST00000266839.5_Missense_Mutation_p.C41S|MMAB_ENST00000540016.1_Missense_Mutation_p.C80S	NM_052845.3	NP_443077.1	Q96EY8	MMAB_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblB type	132					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|cob(I)yrinic acid a,c-diamide adenosyltransferase activity (GO:0008817)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCCGAGGAGCATGGTGTCGC	0.582																																																	0													38.0	36.0	37.0					12																	109999611		2203	4300	6503	SO:0001583	missense	0			AF550404	CCDS9131.1	12q24	2014-07-18	2005-07-11		ENSG00000139428	ENSG00000139428			19331	protein-coding gene	gene with protein product	"""ATP:cob(I)alamin adenosyltransferase"", ""cilia and flagella associated protein 23"""	607568	"""methylmalonic aciduria (cobalamin deficiency) type B"""			12471062, 12514191	Standard	NM_052845		Approved	cblB, CFAP23	uc001tou.3	Q96EY8	OTTHUMG00000169255	ENST00000545712.2:c.395G>C	12.37:g.109999611C>G	ENSP00000445920:p.Cys132Ser		C5HU05|Q9BSH0	Missense_Mutation	SNP	pfam_AdoCbl_synth_CblAdoTrfase-like,superfamily_AdoCbl_synth_CblAdoTrfase-like,tigrfam_AdoCbl_synth_CblAdoTrfase-like	p.C132S	ENST00000545712.2	37	c.395	CCDS9131.1	12	.	.	.	.	.	.	.	.	.	.	C	9.445	1.088968	0.20390	.	.	ENSG00000139428	ENST00000545712;ENST00000266839;ENST00000542390	D;D	0.94613	-3.47;-3.47	5.56	2.47	0.30058	Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase, PduO-type, N-terminal (2);Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase-like (2);Adenosylcobalamin biosynthesis, ATP:cob(I)alamin adenosyltransferase, EutT/PduO type (1);	0.398802	0.27821	N	0.017709	T	0.74076	0.3669	N	0.00510	-1.415	0.09310	N	0.999994	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.01281	0.0;0.0;0.0	T	0.68853	-0.5299	10	0.06757	T	0.87	-11.0729	4.3676	0.11232	0.2377:0.572:0.0:0.1903	.	41;132;132	B4DHP4;B2R6J3;Q96EY8	.;.;MMAB_HUMAN	S	132;41;132	ENSP00000445920:C132S;ENSP00000266839:C41S	ENSP00000266839:C41S	C	-	2	0	MMAB	108483994	0.783000	0.28701	0.926000	0.36857	0.573000	0.36030	0.591000	0.23969	1.341000	0.45600	0.655000	0.94253	TGC	MMAB	-	pfam_AdoCbl_synth_CblAdoTrfase-like,superfamily_AdoCbl_synth_CblAdoTrfase-like,tigrfam_AdoCbl_synth_CblAdoTrfase-like	ENSG00000139428		0.582	MMAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMAB	HGNC	protein_coding	OTTHUMT00000403128.2		0.00	55	0	C			109999611	-1			no_errors	ENST00000545712	ensembl	human	known	74_37	missense	5.13	36	2	SNP	0.865	G
MMD2	221938	genome.wustl.edu	37	7	4965092	4965092	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:4965092G>T	ENST00000404774.3	-	2	313	c.119C>A	c.(118-120)gCc>gAc	p.A40D	MMD2_ENST00000406755.1_Missense_Mutation_p.A40D|MMD2_ENST00000401401.3_Missense_Mutation_p.A40D	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	40						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		AGCATGGGTGGCACAGTTGGC	0.587																																																	0													130.0	129.0	129.0					7																	4965092		1934	4130	6064	SO:0001583	missense	0			BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.119C>A	7.37:g.4965092G>T	ENSP00000384690:p.Ala40Asp		B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	pfam_HlyIII-related	p.A40D	ENST00000404774.3	37	c.119	CCDS47529.1	7	.	.	.	.	.	.	.	.	.	.	g	20.5	4.001848	0.74932	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.31247	1.5;1.5;1.5	3.82	3.82	0.43975	.	0.000000	0.64402	D	0.000002	T	0.50599	0.1625	M	0.73598	2.24	0.54753	D	0.99998	D;D;P	0.57571	0.963;0.98;0.812	P;D;P	0.65573	0.906;0.936;0.642	T	0.54146	-0.8337	10	0.66056	D	0.02	-27.3641	10.3259	0.43793	0.0:0.0:0.8035:0.1965	.	40;40;40	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	D	40	ENSP00000384690:A40D;ENSP00000385963:A40D;ENSP00000384141:A40D	ENSP00000384141:A40D	A	-	2	0	MMD2	4931618	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.842000	0.75379	1.965000	0.57142	0.561000	0.74099	GCC	MMD2	-	pfam_HlyIII-related	ENSG00000136297		0.587	MMD2-001	KNOWN	basic|CCDS	protein_coding	MMD2	HGNC	protein_coding	OTTHUMT00000324136.1	-	0.00	35	0	G	NM_198403		4965092	-1	tier1	-	no_errors	ENST00000404774	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
MORC1	27136	genome.wustl.edu	37	3	108698360	108698360	+	Splice_Site	SNP	A	A	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:108698360A>T	ENST00000483760.1	-	23	2458		c.e23+1		MORC1_ENST00000232603.5_Splice_Site					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						AAATATCTTTACCTTAACTTA	0.373																																																	0													106.0	114.0	112.0					3																	108698360		2203	4300	6503	SO:0001630	splice_region_variant	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2414+1T>A	3.37:g.108698360A>T				Splice_Site	SNP	-	e24+2	ENST00000483760.1	37	c.2477+2		3	.	.	.	.	.	.	.	.	.	.	A	16.15	3.040497	0.55003	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.1498	0.48451	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MORC1	110181050	1.000000	0.71417	0.998000	0.56505	0.583000	0.36354	3.944000	0.56629	2.141000	0.66446	0.533000	0.62120	.	MORC1	-	-	ENSG00000114487		0.373	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	-	0.00	33	0	A		Intron	108698360	-1	tier1	-	no_errors	ENST00000232603	ensembl	human	known	74_37	splice_site	30.95	28	13	SNP	1.000	T
MROH1	727957	genome.wustl.edu	37	8	145245830	145245830	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr8:145245830G>T	ENST00000528919.1	+	7	827	c.706G>T	c.(706-708)Gaa>Taa	p.E236*	MROH1_ENST00000398656.4_Nonsense_Mutation_p.E236*|MROH1_ENST00000423230.2_Nonsense_Mutation_p.E236*|MROH1_ENST00000326134.5_Nonsense_Mutation_p.E236*|MROH1_ENST00000534366.1_Nonsense_Mutation_p.E236*	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	236																	GCAGAGTCGAGAAGCCAAGGT	0.612																																																	0													39.0	43.0	42.0					8																	145245830		2067	4211	6278	SO:0001587	stop_gained	0				CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.706G>T	8.37:g.145245830G>T	ENSP00000435565:p.Glu236*		C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Nonsense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E236*	ENST00000528919.1	37	c.706	CCDS47938.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.029605	0.98013	.	.	ENSG00000179832	ENST00000423230;ENST00000398656;ENST00000534366;ENST00000528919;ENST00000326134;ENST00000356585	.	.	.	5.95	5.95	0.96441	.	0.076368	0.49916	U	0.000131	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	17.8792	0.88835	0.0:0.0:1.0:0.0	.	.	.	.	X	236;236;236;236;236;168	.	ENSP00000321737:E236X	E	+	1	0	HEATR7A	145317818	1.000000	0.71417	0.463000	0.27130	0.896000	0.52359	9.432000	0.97498	2.825000	0.97269	0.655000	0.94253	GAA	MROH1	-	superfamily_ARM-type_fold	ENSG00000179832		0.612	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MROH1	HGNC	protein_coding	OTTHUMT00000386183.1		0.00	24	0	G	NM_032450		145245830	+1			no_errors	ENST00000326134	ensembl	human	known	74_37	nonsense	16.00	21	4	SNP	1.000	T
MSL1	339287	genome.wustl.edu	37	17	38285497	38285497	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:38285497G>T	ENST00000398532.4	+	3	1307		c.e3-1		MSL1_ENST00000579565.1_Splice_Site|MSL1_ENST00000578648.1_Splice_Site|MSL1_ENST00000577454.1_Splice_Site	NM_001012241.1	NP_001012241.1	Q68DK7	MSL1_HUMAN	male-specific lethal 1 homolog (Drosophila)						chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	7						CTATCTAATAGGAAATCCCCA	0.333																																																	0													48.0	50.0	50.0					17																	38285497		1786	4052	5838	SO:0001630	splice_region_variant	0				CCDS45670.1	17q21.1	2011-03-21			ENSG00000188895	ENSG00000188895			27905	protein-coding gene	gene with protein product		614801				16227571, 16543150	Standard	NM_001012241		Approved	hMSL1, MSL-1, DKFZp686P24239	uc002hua.4	Q68DK7		ENST00000398532.4:c.993-1G>T	17.37:g.38285497G>T			Q0VF46|Q69Z03	Splice_Site	SNP	-	e3-1	ENST00000398532.4	37	c.993-1		17	.	.	.	.	.	.	.	.	.	.	G	23.1	4.379818	0.82682	.	.	ENSG00000188895	ENST00000339569;ENST00000398532	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2052	0.98274	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MSL1	35539023	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.925000	0.87563	2.873000	0.98535	0.563000	0.77884	.	MSL1	-	-	ENSG00000188895		0.333	MSL1-003	KNOWN	basic	protein_coding	MSL1	HGNC	protein_coding	OTTHUMT00000447409.2		0.00	26	0	G	NM_001012241	Intron	38285497	+1			no_errors	ENST00000398532	ensembl	human	known	74_37	splice_site	7.41	25	2	SNP	1.000	T
MSL3P1	151507	genome.wustl.edu	37	2	234775170	234775170	+	RNA	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:234775170C>T	ENST00000438684.1	-	0	944					NR_024322.1		P0C860	MS3L2_HUMAN	male-specific lethal 3 homolog (Drosophila) pseudogene 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											CAGGTGTCTTCTTTTCCAGGT	0.522																																																	0													108.0	87.0	93.0					2																	234775170		692	1591	2283			0			BI831020		2q37.1	2011-03-21	2011-03-21	2011-03-21	ENSG00000224287	ENSG00000224287			17837	pseudogene	pseudogene			"""male-specific lethal 3-like 2 (Drosophila)"""	MSL3L2			Standard	NR_024322		Approved		uc010znf.2	P0C860	OTTHUMG00000059126		2.37:g.234775170C>T				RNA	SNP	-	NULL	ENST00000438684.1	37	NULL		2																																																																																			MSL3P1	-	-	ENSG00000224287		0.522	MSL3P1-002	KNOWN	basic	processed_transcript	MSL3P1	HGNC	pseudogene	OTTHUMT00000131002.2		0.00	26	0	C	NR_024322		234775170	-1			no_errors	ENST00000438684	ensembl	human	known	74_37	rna	10.34	26	3	SNP	0.967	T
MT-CO1	4512	genome.wustl.edu	37	M	3091	3091	+	5'Flank	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrM:3091G>A	ENST00000361624.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TA_ENST00000387392.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TC_ENST00000387405.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GGAGTAATCCAGGTCGGTTTC	0.453																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3091G>A	Exception_encountered		Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MT-RNR2	-	-	ENSG00000210082		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		-	0.00	127	0	G	YP_003024028		3091	+1	tier1	-	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	39.02	25	16	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	12244	12244	+	5'Flank	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrM:12244G>T	ENST00000361567.2	+	0	0				MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CATGCCCCCATGTCTAACAAC	0.388																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915			M.37:g.12244G>T	Exception_encountered		Q34773|Q8WCY3	RNA	SNP	-	NULL	ENST00000361567.2	37	NULL		MT																																																																																			MT-TS2	-	-	ENSG00000210184		0.388	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-TS2	HGNC	protein_coding		-	0.00	31	0	G	YP_003024036		12244	+1	tier1	-	no_errors	ENST00000387449	ensembl	human	known	74_37	rna	50.00	2	2	SNP	NULL	T
MTERF1	7978	genome.wustl.edu	37	7	91509448	91509448	+	Intron	SNP	C	C	A	rs373119611	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:91509448C>A	ENST00000351870.3	-	2	64				MTERF_ENST00000419292.1_Intron|MTERF_ENST00000406735.2_Intron|MTERF_ENST00000481516.1_5'UTR	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN							DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			CACACACACACAAAAAAAAGG	0.413													C|||	13	0.00259585	0.0038	0.0029	5008	,	,		19840	0.001		0.001	False		,,,				2504	0.0041																0													54.0	50.0	51.0					7																	91509448		2203	4300	6503	SO:0001627	intron_variant	0																														ENST00000351870.3:c.30-21G>T	7.37:g.91509448C>A			A4D1E3|Q32NF8|Q53H51|Q9BVR7	RNA	SNP	-	NULL	ENST00000351870.3	37	NULL	CCDS5621.1	7																																																																																			MTERF	-	-	ENSG00000127989		0.413	MTERF-003	KNOWN	basic|CCDS	protein_coding	MTERF	HGNC	protein_coding	OTTHUMT00000342896.1	-	0.00	16	0	C			91509448	-1	tier1	-	no_errors	ENST00000481516	ensembl	human	known	74_37	rna	25.00	15	5	SNP	0.000	A
MYH9	4627	genome.wustl.edu	37	22	36685336	36685336	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:36685336G>A	ENST00000216181.5	-	32	4582	c.4352C>T	c.(4351-4353)gCg>gTg	p.A1451V		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1451					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTTCTCCTCCGCCAGGAGCTG	0.677			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													18.0	17.0	18.0					22																	36685336		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4352C>T	22.37:g.36685336G>A	ENSP00000216181:p.Ala1451Val		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1451V	ENST00000216181.5	37	c.4352	CCDS13927.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.6|26.6	4.756095|4.756095	0.89843|0.89843	.|.	.|.	ENSG00000100345|ENSG00000100345	ENST00000337818;ENST00000216181|ENST00000397231	T|.	0.79653|.	-1.29|.	5.02|5.02	5.02|5.02	0.67125|0.67125	Myosin tail (1);|.	0.055266|.	0.64402|.	D|.	0.000001|.	T|T	0.76807|0.76807	0.4039|0.4039	M|M	0.79926|0.79926	2.475|2.475	0.80722|0.80722	D|D	1|1	D|.	0.57257|.	0.979|.	P|.	0.55055|.	0.767|.	T|T	0.80372|0.80372	-0.1410|-0.1410	10|6	0.66056|0.87932	D|D	0.02|0	.|.	14.3358|14.3358	0.66589|0.66589	0.0:0.1483:0.8517:0.0|0.0:0.1483:0.8517:0.0	.|.	1451|.	P35579|.	MYH9_HUMAN|.	V|W	873;1451|54	ENSP00000216181:A1451V|.	ENSP00000216181:A1451V|ENSP00000380408:R54W	A|R	-|-	2|1	0|2	MYH9|MYH9	35015282|35015282	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.882000|0.882000	0.50991|0.50991	7.824000|7.824000	0.86668|0.86668	2.495000|2.495000	0.84180|0.84180	0.491000|0.491000	0.48974|0.48974	GCG|CGG	MYH9	-	pfam_Myosin_tail	ENSG00000100345		0.677	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	0.00	54	0	G	NM_002473		36685336	-1	tier1	-	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	21.28	37	10	SNP	0.999	A
NADK	65220	genome.wustl.edu	37	1	1688112	1688112	+	Intron	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:1688112C>T	ENST00000341426.5	-	5	615				NADK_ENST00000492768.1_5'UTR|NADK_ENST00000378625.1_Intron|NADK_ENST00000344463.4_Intron|NADK_ENST00000341991.3_Intron|NADK_ENST00000342348.5_Intron	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		GGGAGGTTCCCGACTCACGGG	0.597																																																	0																																										SO:0001627	intron_variant	0			BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.394-65G>A	1.37:g.1688112C>T			A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	RNA	SNP	-	NULL	ENST00000341426.5	37	NULL	CCDS30565.1	1																																																																																			NADK	-	-	ENSG00000008130		0.597	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	NADK	HGNC	protein_coding	OTTHUMT00000002769.1	-	0.00	22	0	C	NM_023018		1688112	-1	tier1	-	no_errors	ENST00000492768	ensembl	human	known	74_37	rna	14.29	24	4	SNP	0.003	T
NLRC4	58484	genome.wustl.edu	37	2	32477568	32477568	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:32477568T>C	ENST00000404025.2	-	4	670	c.182A>G	c.(181-183)aAg>aGg	p.K61R	NLRC4_ENST00000342905.6_Missense_Mutation_p.K61R|NLRC4_ENST00000402280.1_Missense_Mutation_p.K61R|NLRC4_ENST00000360906.5_Missense_Mutation_p.K61R			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	61	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CTCTGAACCCTTTTTCAAAAT	0.398																																																	0													135.0	127.0	130.0					2																	32477568		2203	4300	6503	SO:0001583	missense	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.182A>G	2.37:g.32477568T>C	ENSP00000385090:p.Lys61Arg		A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.K61R	ENST00000404025.2	37	c.182	CCDS33174.1	2	.	.	.	.	.	.	.	.	.	.	T	14.28	2.489736	0.44249	.	.	ENSG00000091106	ENST00000360906;ENST00000402280;ENST00000342905;ENST00000404025	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	4.1	2.9	0.33743	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.48286	D	0.000184	T	0.26048	0.0635	L	0.34521	1.04	0.30094	N	0.808046	P;D	0.56287	0.939;0.975	P;P	0.56042	0.538;0.79	T	0.24584	-1.0156	9	0.13108	T	0.6	-16.6244	8.2538	0.31743	0.1781:0.0:0.0:0.8219	.	61;61	Q9NPP4-2;Q9NPP4	.;NLRC4_HUMAN	R	61	ENSP00000354159:K61R;ENSP00000385428:K61R;ENSP00000339666:K61R;ENSP00000385090:K61R	ENSP00000339666:K61R	K	-	2	0	NLRC4	32331072	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	1.904000	0.39868	0.706000	0.31912	0.338000	0.21704	AAG	NLRC4	-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	ENSG00000091106		0.398	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2		0.00	45	0	T	NM_021209		32477568	-1			no_errors	ENST00000360906	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	C
NAT8	9027	genome.wustl.edu	37	2	73868104	73868104	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:73868104G>A	ENST00000272425.3	-	2	801	c.652C>T	c.(652-654)Cac>Tac	p.H218Y		NM_003960.3|NM_016347.2	NP_003951.3|NP_057431.2			N-acetyltransferase 8 (GCN5-related, putative)											breast(1)|endometrium(2)|kidney(2)|lung(2)|ovary(1)|prostate(1)	9						GAAGGGAGGTGGTAGATGAAA	0.488																																																	0													53.0	52.0	52.0					2																	73868104		2203	4300	6503	SO:0001583	missense	0			AB013094	CCDS1926.1	2p13.2	2012-03-20	2008-09-24		ENSG00000144035	ENSG00000144035			18069	protein-coding gene	gene with protein product		606716	"""N-acetyltransferase 8"""			11397015, 9852678, 19011241	Standard	NM_003960		Approved	Hcml1, TSC501, GLA, ATase2	uc002sji.1	Q9UHE5	OTTHUMG00000129818	ENST00000272425.3:c.652C>T	2.37:g.73868104G>A	ENSP00000272425:p.His218Tyr			Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.H218Y	ENST00000272425.3	37	c.652	CCDS1926.1	2	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.620773	0.00828	.	.	ENSG00000144035	ENST00000272425	T	0.30981	1.51	3.72	0.772	0.18510	GCN5-related N-acetyltransferase (GNAT) domain (1);Acyl-CoA N-acyltransferase (2);	2.979050	0.00931	N	0.002717	T	0.23532	0.0569	N	0.22421	0.69	0.09310	N	1	B	0.17038	0.02	B	0.15484	0.013	T	0.24621	-1.0155	10	0.54805	T	0.06	3.2332	6.5254	0.22299	0.3474:0.0:0.6526:0.0	.	218	Q9UHE5	NAT8_HUMAN	Y	218	ENSP00000272425:H218Y	ENSP00000272425:H218Y	H	-	1	0	NAT8	73721612	0.000000	0.05858	0.002000	0.10522	0.110000	0.19582	-0.509000	0.06336	0.018000	0.15052	0.644000	0.83932	CAC	NAT8	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000144035		0.488	NAT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT8	HGNC	protein_coding	OTTHUMT00000327854.1	-	0.00	39	0	G	NM_003960		73868104	-1	tier1	-	no_errors	ENST00000272425	ensembl	human	known	74_37	missense	26.67	33	12	SNP	0.018	A
NLRP11	204801	genome.wustl.edu	37	19	56321171	56321171	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:56321171G>T	ENST00000589093.1	-	3	898	c.805C>A	c.(805-807)Cca>Aca	p.P269T	NLRP11_ENST00000592953.1_Missense_Mutation_p.P170T|NLRP11_ENST00000360133.3_Missense_Mutation_p.P269T|NLRP11_ENST00000443188.1_Missense_Mutation_p.P269T|NLRP11_ENST00000589824.2_Missense_Mutation_p.P269T			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	269	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAGCAGCCTGGAGCCATTTTT	0.458																																																	0													65.0	67.0	66.0					19																	56321171		2203	4300	6503	SO:0001583	missense	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.805C>A	19.37:g.56321171G>T	ENSP00000466285:p.Pro269Thr		C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P269T	ENST00000589093.1	37	c.805	CCDS12935.1	19	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535042	0.27475	.	.	ENSG00000179873	ENST00000443188;ENST00000360133	T;T	0.80653	-1.4;-1.4	2.42	1.37	0.22104	NACHT nucleoside triphosphatase (1);	.	.	.	.	D	0.86904	0.6045	M	0.80422	2.495	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.73757	-0.3882	9	0.87932	D	0	.	3.7538	0.08578	0.1531:0.2578:0.5891:0.0	.	269;269	P59045;P59045-2	NAL11_HUMAN;.	T	269	ENSP00000409898:P269T;ENSP00000353251:P269T	ENSP00000353251:P269T	P	-	1	0	NLRP11	61012983	0.029000	0.19370	0.004000	0.12327	0.001000	0.01503	1.703000	0.37846	0.581000	0.29539	-0.253000	0.11424	CCA	NLRP11	-	pfscan_NACHT_NTPase	ENSG00000179873		0.458	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1		0.00	47	0	G	NM_145007		56321171	-1			no_errors	ENST00000443188	ensembl	human	known	74_37	missense	6.25	44	3	SNP	0.001	T
NPAP1	23742	genome.wustl.edu	37	15	24921975	24921975	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:24921975G>T	ENST00000329468.2	+	1	1435	c.961G>T	c.(961-963)Gcc>Tcc	p.A321S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	321	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											TCCCAGAGCTGCCCGCAACAG	0.587																																																	0													47.0	47.0	47.0					15																	24921975		2203	4300	6503	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.961G>T	15.37:g.24921975G>T	ENSP00000333735:p.Ala321Ser			Missense_Mutation	SNP	NULL	p.A321S	ENST00000329468.2	37	c.961	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	14.17	2.455840	0.43634	.	.	ENSG00000185823	ENST00000329468	T	0.11385	2.78	1.93	-0.129	0.13502	.	1.076680	0.07393	N	0.889451	T	0.19485	0.0468	L	0.42245	1.32	0.09310	N	1	D	0.61697	0.99	D	0.70487	0.969	T	0.36817	-0.9732	10	0.13853	T	0.58	.	7.6597	0.28396	0.0:0.5241:0.4759:0.0	.	321	Q9NZP6	CO002_HUMAN	S	321	ENSP00000333735:A321S	ENSP00000333735:A321S	A	+	1	0	C15orf2	22473068	0.000000	0.05858	0.000000	0.03702	0.331000	0.28603	-1.280000	0.02804	-0.022000	0.13986	-0.676000	0.03789	GCC	NPAP1	-	NULL	ENSG00000185823		0.587	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1		0.00	15	0	G	NM_018958		24921975	+1			no_errors	ENST00000329468	ensembl	human	known	74_37	missense	33.33	6	3	SNP	0.000	T
OR2M7	391196	genome.wustl.edu	37	1	248487210	248487210	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:248487210C>T	ENST00000317965.2	-	1	689	c.661G>A	c.(661-663)Gtt>Att	p.V221I		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCCAGAATAACTCGAGCATAG	0.428																																																	0													325.0	307.0	313.0					1																	248487210		2203	4300	6503	SO:0001583	missense	0			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.661G>A	1.37:g.248487210C>T	ENSP00000324557:p.Val221Ile		B2RNL0|Q6IEX6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V221I	ENST00000317965.2	37	c.661	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.006124	0.00426	.	.	ENSG00000177186	ENST00000317965	T	0.00005	9.78	1.55	0.563	0.17296	GPCR, rhodopsin-like superfamily (1);	0.620826	0.12134	N	0.496471	T	0.00039	0.0001	N	0.00572	-1.36	0.09310	N	1	P	0.49447	0.924	D	0.64237	0.923	T	0.51052	-0.8754	10	0.02654	T	1	.	3.5808	0.07952	0.0:0.3474:0.0:0.6526	.	221	Q8NG81	OR2M7_HUMAN	I	221	ENSP00000324557:V221I	ENSP00000324557:V221I	V	-	1	0	OR2M7	246553833	0.906000	0.30813	0.125000	0.21846	0.142000	0.21351	1.660000	0.37397	0.850000	0.35239	0.194000	0.17425	GTT	OR2M7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177186		0.428	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1	-	0.00	162	0	C	NM_001004691		248487210	-1	tier1	-	no_errors	ENST00000317965	ensembl	human	known	74_37	missense	29.81	113	48	SNP	0.310	T
OR4C12	283093	genome.wustl.edu	37	11	50003895	50003895	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:50003895G>T	ENST00000335238.4	-	1	176	c.143C>A	c.(142-144)aCc>aAc	p.T48N		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						CTGGCTGGTGGTAATGGTAAC	0.428																																																	0													67.0	68.0	68.0					11																	50003895		2201	4296	6497	SO:0001583	missense	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.143C>A	11.37:g.50003895G>T	ENSP00000334418:p.Thr48Asn		B2RNF0|Q6IF49	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.T48N	ENST00000335238.4	37	c.143	CCDS31496.1	11	.	.	.	.	.	.	.	.	.	.	.	6.728	0.503051	0.12822	.	.	ENSG00000221954	ENST00000335238	T	0.01084	5.36	3.31	-2.4	0.06583	GPCR, rhodopsin-like superfamily (1);	1.196060	0.06544	U	0.743782	T	0.01387	0.0045	L	0.55481	1.735	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.47341	-0.9125	10	0.25751	T	0.34	.	4.5449	0.12076	0.2567:0.3266:0.4167:0.0	.	48	Q96R67	OR4CC_HUMAN	N	48	ENSP00000334418:T48N	ENSP00000334418:T48N	T	-	2	0	OR4C12	49960471	0.000000	0.05858	0.000000	0.03702	0.793000	0.44817	-1.967000	0.01508	-0.590000	0.05866	0.398000	0.26397	ACC	OR4C12	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221954		0.428	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	-	0.00	87	0	G	NM_001005270		50003895	-1	tier1	-	no_errors	ENST00000335238	ensembl	human	known	74_37	missense	32.56	58	28	SNP	0.000	T
OTOF	9381	genome.wustl.edu	37	2	26700314	26700314	+	Silent	SNP	C	C	T	rs142933937	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:26700314C>T	ENST00000272371.2	-	20	2502	c.2376G>A	c.(2374-2376)cgG>cgA	p.R792R	OTOF_ENST00000402415.3_Silent_p.R102R|OTOF_ENST00000339598.3_Silent_p.R45R|OTOF_ENST00000338581.6_Silent_p.R45R|OTOF_ENST00000403946.3_Silent_p.R792R	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	792					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGGCGCTCCCGGTCAAGCC	0.662																																					GBM(102;732 1451 20652 24062 31372)												0								C	,,,	0,4342		0,0,2171	32.0	32.0	32.0		135,2376,306,135	0.6	1.0	2	dbSNP_134	32	2,8574		1,0,4287	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	OTOF	NM_004802.3,NM_194248.2,NM_194322.2,NM_194323.2	,,,	1,0,6458	TT,TC,CC		0.0233,0.0,0.0155	,,,	45/1231,792/1998,102/1308,45/1231	26700314	2,12916	2171	4288	6459	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.2376G>A	2.37:g.26700314C>T			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R792	ENST00000272371.2	37	c.2376	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.662	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3		0.00	88	0	C			26700314	-1			no_errors	ENST00000272371	ensembl	human	known	74_37	silent	5.56	51	3	SNP	1.000	T
PARP4	143	genome.wustl.edu	37	13	25068765	25068765	+	Silent	SNP	T	T	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr13:25068765T>A	ENST00000381989.3	-	7	792	c.687A>T	c.(685-687)ctA>ctT	p.L229L		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	229					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AATGTTCTCTTAGTAGAAATC	0.313																																																	0													146.0	144.0	145.0					13																	25068765		2203	4300	6503	SO:0001819	synonymous_variant	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.687A>T	13.37:g.25068765T>A			O75903|Q14682|Q5QNZ9|Q9H1M6	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.L229	ENST00000381989.3	37	c.687	CCDS9307.1	13																																																																																			PARP4	-	NULL	ENSG00000102699		0.313	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	-	0.00	106	0	T	NM_006437		25068765	-1	tier1	-	no_errors	ENST00000381989	ensembl	human	known	74_37	silent	8.41	98	9	SNP	0.220	A
PCDH10	57575	genome.wustl.edu	37	4	134071343	134071343	+	Silent	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:134071343C>A	ENST00000264360.5	+	1	874	c.48C>A	c.(46-48)gtC>gtA	p.V16V	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	16					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		TGGAAGGAGTCTTTTCCCAGC	0.493																																																	0													136.0	129.0	132.0					4																	134071343		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.48C>A	4.37:g.134071343C>A			Q4W5F6|Q96SF0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V16	ENST00000264360.5	37	c.48	CCDS34063.1	4																																																																																			PCDH10	-	NULL	ENSG00000138650		0.493	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	62	0	C	NM_032961		134071343	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	silent	17.28	67	14	SNP	1.000	A
PCDH11X	27328	genome.wustl.edu	37	X	91873880	91873880	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrX:91873880C>T	ENST00000373094.1	+	7	4830	c.3985C>T	c.(3985-3987)Cgc>Tgc	p.R1329C	PCDH11X_ENST00000298274.8_Missense_Mutation_p.R1292C|PCDH11X_ENST00000361655.2_Missense_Mutation_p.R1311C|PCDH11X_ENST00000373097.1_Missense_Mutation_p.R1319C|PCDH11X_ENST00000373088.1_Missense_Mutation_p.R1292C|PCDH11X_ENST00000406881.1_Missense_Mutation_p.R1321C|PCDH11X_ENST00000504220.2_3'UTR	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1329					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CTTCACTCCACGCCAACAGGC	0.403													C|||	1	0.000264901	0.0	0.0	3775	,	,		15247	0.0		0.0	False		,,,				2504	0.001				NSCLC(38;925 1092 2571 38200 45895)												0													140.0	132.0	135.0					X																	91873880		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3985C>T	X.37:g.91873880C>T	ENSP00000362186:p.Arg1329Cys		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R1329C	ENST00000373094.1	37	c.3985	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	5.673	0.308772	0.10733	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.54479	0.59;0.61;0.61;0.57;0.59;0.61	4.57	2.75	0.32379	.	.	.	.	.	T	0.30665	0.0772	N	0.08118	0	0.09310	N	0.999996	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.20538	-1.0272	9	0.52906	T	0.07	.	7.4117	0.27021	0.0:0.1431:0.3888:0.4681	.	1292;1311;1321;1319;1329	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	C	1329;1319;1292;1311;1321;1329;1292	ENSP00000362186:R1329C;ENSP00000362189:R1319C;ENSP00000362180:R1292C;ENSP00000355105:R1311C;ENSP00000384758:R1321C;ENSP00000298274:R1292C	ENSP00000298274:R1292C	R	+	1	0	PCDH11X	91760536	0.000000	0.05858	0.004000	0.12327	0.071000	0.16799	0.065000	0.14466	0.206000	0.20587	-0.499000	0.04595	CGC	PCDH11X	-	NULL	ENSG00000102290		0.403	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	51	0	C	NM_032969		91873880	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.136	T
PCDHA10	56139	genome.wustl.edu	37	5	140236546	140236546	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:140236546G>T	ENST00000307360.5	+	1	913	c.913G>T	c.(913-915)Gat>Tat	p.D305Y	PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Missense_Mutation_p.D305Y|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	305	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.D305N(2)		NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAAGTAAATGATGCTATTGA	0.383																																																	2	Substitution - Missense(2)	kidney(2)											92.0	89.0	90.0					5																	140236546		2196	4270	6466	SO:0001583	missense	0			AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.913G>T	5.37:g.140236546G>T	ENSP00000304234:p.Asp305Tyr		A1L493|O75280|Q9NRU2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D305Y	ENST00000307360.5	37	c.913	CCDS54921.1	5	.	.	.	.	.	.	.	.	.	.	G	15.47	2.844294	0.51164	.	.	ENSG00000250120	ENST00000506939;ENST00000307360	T;T	0.52295	4.65;0.67	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.61098	0.2320	M	0.63843	1.955	0.09310	N	0.999999	D;D;D	0.60575	0.988;0.982;0.975	P;P;P	0.57204	0.815;0.722;0.796	T	0.54938	-0.8218	9	0.87932	D	0	.	14.5539	0.68086	0.0:0.1466:0.8534:0.0	.	305;305;305	Q9Y5I2-3;Q9Y5I2;Q9Y5I2-2	.;PCDAA_HUMAN;.	Y	305	ENSP00000421030:D305Y;ENSP00000304234:D305Y	ENSP00000304234:D305Y	D	+	1	0	PCDHA10	140216730	0.969000	0.33509	0.018000	0.16275	0.994000	0.84299	5.302000	0.65733	2.383000	0.81215	0.561000	0.74099	GAT	PCDHA10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000250120		0.383	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA10	HGNC	protein_coding	OTTHUMT00000372895.2		0.00	22	0	G	NM_018901		140236546	+1			no_errors	ENST00000307360	ensembl	human	known	74_37	missense	13.04	20	3	SNP	0.225	T
PCDHA6	56142	genome.wustl.edu	37	5	140209709	140209709	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:140209709C>T	ENST00000529310.1	+	1	2147	c.2033C>T	c.(2032-2034)gCg>gTg	p.A678V	PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018909.2|NM_031848.2|NM_031849.1	NP_061732.1|NP_114036.1|NP_114037.1	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6	678	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(42)|prostate(8)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	89			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCAAAGGCGTCATCACGG	0.677																																																	0													38.0	44.0	42.0					5																	140209709		2199	4298	6497	SO:0001583	missense	0			AF152484	CCDS47281.1, CCDS47282.1	5q31	2010-11-26			ENSG00000081842	ENSG00000081842		"""Cadherins / Protocadherins : Clustered"""	8672	other	complex locus constituent	"""KIAA0345-like 8"""	606312		CNRS2		10380929, 10662547	Standard	NM_018909		Approved	CNR2, CRNR2, PCDH-ALPHA6		Q9UN73	OTTHUMG00000163353	ENST00000529310.1:c.2033C>T	5.37:g.140209709C>T	ENSP00000433378:p.Ala678Val		O75283|Q9NRT8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A678V	ENST00000529310.1	37	c.2033	CCDS47281.1	5	.	.	.	.	.	.	.	.	.	.	C	11.42	1.634901	0.29068	.	.	ENSG00000081842	ENST00000529310	T	0.51071	0.72	3.98	2.17	0.27698	Cadherin (1);	0.211384	0.22969	U	0.053457	T	0.39118	0.1066	L	0.55743	1.74	0.09310	N	0.999999	B;B	0.21753	0.012;0.06	B;B	0.18263	0.021;0.009	T	0.32188	-0.9916	10	0.49607	T	0.09	.	7.6841	0.28530	0.0:0.7348:0.0:0.2652	.	678;678	Q9UN73-3;Q9UN73	.;PCDA6_HUMAN	V	678	ENSP00000433378:A678V	ENSP00000433378:A678V	A	+	2	0	PCDHA6	140189893	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.568000	0.23623	0.450000	0.26774	0.306000	0.20318	GCG	PCDHA6	-	pfscan_Cadherin	ENSG00000081842		0.677	PCDHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA6	HGNC	protein_coding	OTTHUMT00000372829.3	-	0.00	85	0	C	NM_018909		140209709	+1	tier1	-	no_errors	ENST00000529310	ensembl	human	known	74_37	missense	26.04	71	25	SNP	0.002	T
PCDHA13	56136	genome.wustl.edu	37	5	140263491	140263491	+	Silent	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:140263491C>A	ENST00000289272.2	+	1	1638	c.1638C>A	c.(1636-1638)ggC>ggA	p.G546G	PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA13_ENST00000409494.1_Silent_p.G546G|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	546	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCTCTGGGCAGCAACGTGA	0.687																																					Melanoma(147;1739 1852 5500 27947 37288)												0													72.0	77.0	76.0					5																	140263491		2203	4299	6502	SO:0001819	synonymous_variant	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1638C>A	5.37:g.140263491C>A			O75277	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G546	ENST00000289272.2	37	c.1638	CCDS4240.1	5																																																																																			PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000239389		0.687	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	-	0.00	179	0	C	NM_018904		140263491	+1	tier1	-	no_errors	ENST00000289272	ensembl	human	known	74_37	silent	21.29	159	43	SNP	1.000	A
PCDHGA4	56111	genome.wustl.edu	37	5	140734952	140734952	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:140734952G>A	ENST00000571252.1	+	1	185	c.185G>A	c.(184-186)cGc>cAc	p.R62H	PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	62	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCGGAGCGCGGAGTCCGC	0.637																																																	0													52.0	63.0	59.0					5																	140734952		2191	4300	6491	SO:0001583	missense	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.185G>A	5.37:g.140734952G>A	ENSP00000458570:p.Arg62His		Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R62H	ENST00000571252.1	37	c.185	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000262576		0.637	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	-	0.00	71	0	G	NM_018917		140734952	+1	tier1	-	no_errors	ENST00000571252	ensembl	human	known	74_37	missense	22.78	61	18	SNP	1.000	A
PCNP	57092	genome.wustl.edu	37	3	101304301	101304301	+	Silent	SNP	A	A	G	rs533548683	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:101304301A>G	ENST00000265260.3	+	3	421	c.300A>G	c.(298-300)ccA>ccG	p.P100P	PCNP_ENST00000296024.5_Silent_p.P100P|PCNP_ENST00000486406.1_Intron|PCNP_ENST00000469941.1_5'UTR	NM_020357.1	NP_065090.1	Q8WW12	PCNP_HUMAN	PEST proteolytic signal containing nuclear protein	100					cell cycle (GO:0007049)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	nucleus (GO:0005634)				large_intestine(1)|lung(1)	2						AAACTGTTCCAACTCTTGCTC	0.279																																																	0													90.0	89.0	89.0					3																	101304301		2202	4298	6500	SO:0001819	synonymous_variant	0				CCDS2942.1	3q12.3	2006-03-09			ENSG00000081154	ENSG00000081154			30023	protein-coding gene	gene with protein product		615210				12176013	Standard	NM_020357		Approved		uc003dva.3	Q8WW12	OTTHUMG00000159108	ENST00000265260.3:c.300A>G	3.37:g.101304301A>G			B2RBE7|D3DN52|Q53GF3|Q6AI44|Q96CU3|Q9NS81	Silent	SNP	NULL	p.P100	ENST00000265260.3	37	c.300	CCDS2942.1	3																																																																																			PCNP	-	NULL	ENSG00000081154		0.279	PCNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNP	HGNC	protein_coding	OTTHUMT00000353338.2	-	0.00	61	0	A	NM_020357		101304301	+1	tier1	-	no_errors	ENST00000265260	ensembl	human	known	74_37	silent	20.27	59	15	SNP	1.000	G
PDCD10	11235	genome.wustl.edu	37	3	167437888	167437888	+	Missense_Mutation	SNP	T	T	C	rs138275885		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:167437888T>C	ENST00000392750.2	-	3	475	c.58A>G	c.(58-60)Atg>Gtg	p.M20V	PDCD10_ENST00000461494.1_Missense_Mutation_p.M20V|PDCD10_ENST00000492396.1_Intron|PDCD10_ENST00000473645.2_Missense_Mutation_p.M20V|PDCD10_ENST00000487678.1_5'Flank|PDCD10_ENST00000487947.2_Missense_Mutation_p.M20V|PDCD10_ENST00000470131.1_Missense_Mutation_p.M20V|PDCD10_ENST00000497056.2_Missense_Mutation_p.M20V|PDCD10_ENST00000471885.1_Missense_Mutation_p.M20V	NM_007217.3	NP_009148.2	Q9BUL8	PDC10_HUMAN	programmed cell death 10	20					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|kidney(1)|lung(8)|urinary_tract(2)	12						TAGAGGGGCATAGAAACCATG	0.388																																																	0								T	VAL/MET,VAL/MET,VAL/MET	0,4406		0,0,2203	254.0	240.0	245.0		58,58,58	6.2	1.0	3	dbSNP_134	245	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	PDCD10	NM_007217.3,NM_145859.1,NM_145860.1	21,21,21	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign,benign,benign	20/213,20/213,20/213	167437888	1,13005	2203	4300	6503	SO:0001583	missense	0			AF022385	CCDS3202.1	3q26.1	2014-09-17			ENSG00000114209	ENSG00000114209			8761	protein-coding gene	gene with protein product		609118	"""cerebral cavernous malformations 3"""	CCM3		15543491	Standard	NM_007217		Approved	TFAR15	uc003fez.3	Q9BUL8	OTTHUMG00000158415	ENST00000392750.2:c.58A>G	3.37:g.167437888T>C	ENSP00000376506:p.Met20Val		A8K515|D3DNN5|O14811	Missense_Mutation	SNP	pfam_DUF1241	p.M20V	ENST00000392750.2	37	c.58	CCDS3202.1	3	.	.	.	.	.	.	.	.	.	.	T	16.80	3.223202	0.58668	0.0	1.16E-4	ENSG00000114209	ENST00000392750;ENST00000473645;ENST00000497056;ENST00000461494;ENST00000470131;ENST00000475915;ENST00000487947;ENST00000471885;ENST00000462725;ENST00000492139;ENST00000464360	T;T;T;T;T;T;T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96;0.96	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.35856	0.0946	L	0.38175	1.15	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07233	-1.0783	10	0.34782	T	0.22	-5.7105	15.3933	0.74767	0.0:0.0:0.0:1.0	.	20	Q9BUL8	PDC10_HUMAN	V	20	ENSP00000376506:M20V;ENSP00000418317:M20V;ENSP00000420553:M20V;ENSP00000420021:M20V;ENSP00000417202:M20V;ENSP00000417118:M20V;ENSP00000420266:M20V;ENSP00000417876:M20V;ENSP00000420424:M20V;ENSP00000420014:M20V;ENSP00000418160:M20V	ENSP00000376506:M20V	M	-	1	0	PDCD10	168920582	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.660000	0.83776	2.371000	0.80710	0.533000	0.62120	ATG	PDCD10	-	pfam_DUF1241	ENSG00000114209		0.388	PDCD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD10	HGNC	protein_coding	OTTHUMT00000350966.2	-	0.00	68	0	T	NM_007217		167437888	-1	tier1	rs138275885	no_errors	ENST00000392750	ensembl	human	known	74_37	missense	25.26	71	24	SNP	1.000	C
PDE4DIP	9659	genome.wustl.edu	37	1	144881481	144881481	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:144881481C>T	ENST00000369354.3	-	25	3904	c.3715G>A	c.(3715-3717)Gcc>Acc	p.A1239T	PDE4DIP_ENST00000369356.4_Missense_Mutation_p.A1239T|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.A1376T|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.A1376T|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.A1195T			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1239					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGACAGTGGCTTCTGATAGC	0.458			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													187.0	178.0	181.0					1																	144881481		2203	4296	6499	SO:0001583	missense	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3715G>A	1.37:g.144881481C>T	ENSP00000358360:p.Ala1239Thr		A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.A1239T	ENST00000369354.3	37	c.3715	CCDS30824.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.880107|4.880107	0.91740|0.91740	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359|ENST00000530592	T;T;T;T;T|.	0.03272|.	3.99;4.16;4.12;4.19;4.19|.	6.06|6.06	5.15|5.15	0.70609|0.70609	.|.	.|.	.|.	.|.	.|.	T|T	0.66548|0.66548	0.2800|0.2800	M|M	0.76838|0.76838	2.35|2.35	0.80722|0.80722	D|D	1|1	P;D|.	0.89917|.	0.457;1.0|.	B;D|.	0.85130|.	0.135;0.997|.	T|T	0.69573|0.69573	-0.5109|-0.5109	9|5	0.87932|.	D|.	0|.	.|.	13.4449|13.4449	0.61136|0.61136	0.0:0.9243:0.0:0.0757|0.0:0.9243:0.0:0.0757	.|.	1195;1239|.	Q5VU43-3;Q5VU43|.	.;MYOME_HUMAN|.	T|N	1195;1239;1239;1376;1376|133	ENSP00000327209:A1195T;ENSP00000358360:A1239T;ENSP00000358363:A1239T;ENSP00000435654:A1376T;ENSP00000358366:A1376T|.	ENSP00000327209:A1195T|.	A|S	-|-	1|2	0|0	PDE4DIP|PDE4DIP	143592838|143592838	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.648000|0.648000	0.38561|0.38561	5.149000|5.149000	0.64863|0.64863	1.575000|1.575000	0.49775|0.49775	0.655000|0.655000	0.94253|0.94253	GCC|AGC	PDE4DIP	-	NULL	ENSG00000178104		0.458	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	-	0.00	178	0	C	NM_022359		144881481	-1	tier1	-	no_errors	ENST00000369356	ensembl	human	known	74_37	missense	8.43	152	14	SNP	1.000	T
PF4	5196	genome.wustl.edu	37	4	74847138	74847138	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr4:74847138G>T	ENST00000296029.3	-	2	384	c.214C>A	c.(214-216)Ctg>Atg	p.L72M		NM_002619.3	NP_002610.1	P02776	PLF4_HUMAN	platelet factor 4	72					blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|leukocyte chemotaxis (GO:0030595)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cytolysis (GO:0045918)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of MHC class II biosynthetic process (GO:0045347)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|platelet alpha granule lumen (GO:0031093)	chemokine activity (GO:0008009)|CXCR3 chemokine receptor binding (GO:0048248)|heparin binding (GO:0008201)			kidney(1)|lung(1)	2	Breast(15;0.00136)		all cancers(17;0.0034)|Lung(101;0.196)		Drotrecogin alfa(DB00055)	ACTCACATCAGTTGGGCAGTG	0.607																																																	0													87.0	81.0	83.0					4																	74847138		2203	4300	6503	SO:0001583	missense	0			M25897	CCDS3562.1	4q12-q21	2012-10-02	2008-08-29		ENSG00000163737	ENSG00000163737			8861	protein-coding gene	gene with protein product	"""chemokine (C-X-C motif) ligand 4"""	173460	"""platelet factor 4"""			3622011	Standard	NM_002619		Approved	SCYB4, CXCL4	uc003hhi.3	P02776	OTTHUMG00000130009	ENST00000296029.3:c.214C>A	4.37:g.74847138G>T	ENSP00000296029:p.Leu72Met		Q53X61|Q9UC64|Q9UC65	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.L72M	ENST00000296029.3	37	c.214	CCDS3562.1	4	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066866	0.55539	.	.	ENSG00000163737	ENST00000296029	T	0.05081	3.5	2.48	-2.7	0.06004	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.956894	0.08652	N	0.913809	T	0.12008	0.0292	M	0.67953	2.075	0.20196	N	0.999923	P	0.36086	0.536	B	0.43623	0.425	T	0.38329	-0.9666	10	0.66056	D	0.02	.	11.0225	0.47726	0.0:0.7123:0.2877:0.0	.	72	P02776	PLF4_HUMAN	M	72	ENSP00000296029:L72M	ENSP00000296029:L72M	L	-	1	2	PF4	75066002	0.000000	0.05858	0.508000	0.27688	0.609000	0.37215	-2.385000	0.01062	-0.317000	0.08677	0.305000	0.20034	CTG	PF4	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	ENSG00000163737		0.607	PF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PF4	HGNC	protein_coding	OTTHUMT00000252282.1	-	0.00	54	0	G			74847138	-1	tier1	-	no_errors	ENST00000296029	ensembl	human	known	74_37	missense	24.56	43	14	SNP	0.310	T
PFKM	5213	genome.wustl.edu	37	12	48516582	48516582	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:48516582G>A	ENST00000312352.7	+	2	64	c.25G>A	c.(25-27)Gcc>Acc	p.A9T	PFKM_ENST00000359794.5_Missense_Mutation_p.A9T|PFKM_ENST00000340802.6_Missense_Mutation_p.A80T|PFKM_ENST00000551804.1_Missense_Mutation_p.A9T|PFKM_ENST00000395233.2_Missense_Mutation_p.A9T|PFKM_ENST00000551548.1_3'UTR|PFKM_ENST00000547587.1_Missense_Mutation_p.A9T	NM_001166687.1	NP_001160159.1	P08237	PFKAM_HUMAN	phosphofructokinase, muscle	9	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|muscle cell cellular homeostasis (GO:0046716)|positive regulation of insulin secretion (GO:0032024)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|sperm principal piece (GO:0097228)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			NS(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	35						GCACCATGCAGCCAAAACCCT	0.488																																																	0													106.0	110.0	109.0					12																	48516582		2203	4300	6503	SO:0001583	missense	0			M26066	CCDS8760.1, CCDS53786.1	12q13.11	2014-06-13					2.7.1.11		8877	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 122"""	610681	"""phosphofructokinase, polypeptide X"""	PFKX			Standard	NM_001166686		Approved	PFK-1, PPP1R122	uc001rrb.2	P08237		ENST00000312352.7:c.25G>A	12.37:g.48516582G>A	ENSP00000309438:p.Ala9Thr		J3KNX3|Q16814|Q16815|Q6ZTT1	Missense_Mutation	SNP	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.A9T	ENST00000312352.7	37	c.25	CCDS8760.1	12	.	.	.	.	.	.	.	.	.	.	G	10.96	1.499885	0.26861	.	.	ENSG00000152556	ENST00000550345;ENST00000549003;ENST00000550924;ENST00000549941;ENST00000550257;ENST00000340802;ENST00000546755;ENST00000549366;ENST00000552792;ENST00000548288;ENST00000359794;ENST00000551339;ENST00000395233;ENST00000548345;ENST00000551804;ENST00000549022;ENST00000547587;ENST00000312352;ENST00000546465	T;T;T;T;D;T;D;D;D;T;T;T;T;T;T;T;T;T	0.86865	-0.48;-1.07;-1.08;-1.1;-2.18;-1.42;-2.13;-2.17;-2.18;-1.42;-1.06;-1.42;-1.07;-1.42;-0.48;-1.42;-1.42;-1.41	5.3	5.3	0.74995	.	0.054376	0.64402	D	0.000001	T	0.79986	0.4541	L	0.39898	1.24	0.43342	D	0.995395	B;B;B	0.33883	0.43;0.304;0.027	B;B;B	0.29267	0.1;0.046;0.008	T	0.75619	-0.3255	10	0.14252	T	0.57	-21.7718	14.6753	0.68975	0.0:0.0:1.0:0.0	.	9;9;80	P08237-2;P08237;Q6ZTT1	.;K6PF_HUMAN;.	T	9;9;9;42;83;80;112;112;80;80;9;9;9;9;9;9;9;9;9	ENSP00000450369:A9T;ENSP00000449835:A9T;ENSP00000446945:A9T;ENSP00000446829:A42T;ENSP00000447997:A83T;ENSP00000345771:A80T;ENSP00000449622:A112T;ENSP00000448940:A80T;ENSP00000448018:A80T;ENSP00000352842:A9T;ENSP00000448253:A9T;ENSP00000378656:A9T;ENSP00000449269:A9T;ENSP00000448177:A9T;ENSP00000446805:A9T;ENSP00000449426:A9T;ENSP00000309438:A9T;ENSP00000446519:A9T	ENSP00000309438:A9T	A	+	1	0	PFKM	46802849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.417000	0.59822	2.932000	0.99384	0.643000	0.83706	GCC	PFKM	-	pirsf_6-phosphofructokinase_euk	ENSG00000152556		0.488	PFKM-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKM	HGNC	protein_coding	OTTHUMT00000406490.1	-	0.00	42	0	G	NM_000289		48516582	+1	tier1	-	no_errors	ENST00000312352	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	A
LRRC7	57554	genome.wustl.edu	37	1	70385455	70385455	+	Intron	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:70385455C>T	ENST00000035383.5	+	6	563				PIN1P1_ENST00000412108.1_RNA|LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GTTTGCGCGGCGGACGGGGGA	0.627																																																	0																																										SO:0001627	intron_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-11735C>T	1.37:g.70385455C>T			Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	-	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			PIN1P1	-	-	ENSG00000229359		0.627	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	75	0	C	NM_020794		70385455	+1	tier1	-	no_errors	ENST00000412108	ensembl	human	known	74_37	rna	8.57	64	6	SNP	0.664	T
PIPSL	266971	genome.wustl.edu	37	10	95720806	95720806	+	RNA	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr10:95720806C>T	ENST00000480546.1	-	0	491					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										GTTCAATCAGCGGCTCACTGC	0.493																																																	0																																												0			BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95720806C>T			Q6NUK8	RNA	SNP	-	NULL	ENST00000480546.1	37	NULL		10																																																																																			PIPSL	-	-	ENSG00000180764		0.493	PIPSL-002	PUTATIVE	basic	processed_transcript	PIPSL	HGNC	pseudogene	OTTHUMT00000351483.1	-	0.00	80	0	C	NR_002319		95720806	-1	tier1	-	no_errors	ENST00000480546	ensembl	human	putative	74_37	rna	19.10	72	17	SNP	1.000	T
PPP2R1A	5518	genome.wustl.edu	37	19	52729031	52729031	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:52729031G>A	ENST00000322088.6	+	14	1781	c.1723G>A	c.(1723-1725)Gtc>Atc	p.V575I	CTD-2525I3.3_ENST00000599125.1_RNA|CTD-2525I3.3_ENST00000593857.1_RNA|PPP2R1A_ENST00000444322.2_Missense_Mutation_p.V520I|PPP2R1A_ENST00000462990.1_Missense_Mutation_p.V396I	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	575	PP2A subunit C binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GGATGTGGACGTCAAATACTT	0.572			Mis		clear cell ovarian carcinoma																																			Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	0													150.0	144.0	146.0					19																	52729031		2203	4300	6503	SO:0001583	missense	0				CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.1723G>A	19.37:g.52729031G>A	ENSP00000324804:p.Val575Ile		Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V575I	ENST00000322088.6	37	c.1723	CCDS12849.1	19	.	.	.	.	.	.	.	.	.	.	G	26.7	4.762454	0.89932	.	.	ENSG00000105568	ENST00000423369;ENST00000391791;ENST00000322088;ENST00000436460;ENST00000444322	T;T	0.40476	1.03;1.74	4.12	4.12	0.48240	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.50627	D	0.000105	T	0.72036	0.3411	H	0.94264	3.515	0.58432	D	0.999996	P;D	0.76494	0.912;0.999	P;D	0.71656	0.465;0.974	T	0.81197	-0.1042	10	0.87932	D	0	-37.928	14.2799	0.66205	0.0:0.0:1.0:0.0	.	520;575	F5H3X9;P30153	.;2AAA_HUMAN	I	565;495;575;142;520	ENSP00000324804:V575I;ENSP00000415067:V520I	ENSP00000324804:V575I	V	+	1	0	PPP2R1A	57420843	1.000000	0.71417	0.983000	0.44433	0.969000	0.65631	8.607000	0.90891	2.302000	0.77476	0.650000	0.86243	GTC	PPP2R1A	-	superfamily_ARM-type_fold,pfscan_HEAT_type_2	ENSG00000105568		0.572	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1A	HGNC	protein_coding	OTTHUMT00000267967.2	-	0.00	53	0	G	NM_014225		52729031	+1	tier1	-	no_errors	ENST00000322088	ensembl	human	known	74_37	missense	26.42	39	14	SNP	0.999	A
PRDM15	63977	genome.wustl.edu	37	21	43221756	43221756	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr21:43221756C>T	ENST00000269844.3	-	31	4278	c.4168G>A	c.(4168-4170)Gtg>Atg	p.V1390M	PRDM15_ENST00000447207.2_Missense_Mutation_p.V1024M|PRDM15_ENST00000470586.1_5'UTR|PRDM15_ENST00000398548.1_Missense_Mutation_p.V1061M|PRDM15_ENST00000422911.1_Missense_Mutation_p.V1081M|PRDM15_ENST00000538201.1_Missense_Mutation_p.V1044M	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1390					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						AGGTGCCCCACGGCCACCGGC	0.587																																																	0													45.0	45.0	45.0					21																	43221756		2203	4300	6503	SO:0001583	missense	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.4168G>A	21.37:g.43221756C>T	ENSP00000269844:p.Val1390Met		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.V1390M	ENST00000269844.3	37	c.4168	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	c	21.4	4.139342	0.77775	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	4.41	4.41	0.53225	.	.	.	.	.	T	0.43433	0.1247	L	0.27053	0.805	0.51482	D	0.999922	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.85130	0.997;0.992;0.828	T	0.48502	-0.9030	9	0.87932	D	0	-22.5769	16.0101	0.80396	0.0:1.0:0.0:0.0	.	1390;1081;1061	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	M	1081;1061;1044;1024;1390	ENSP00000408592:V1081M;ENSP00000381556:V1061M;ENSP00000444044:V1044M;ENSP00000390245:V1024M;ENSP00000269844:V1390M	ENSP00000269844:V1390M	V	-	1	0	PRDM15	42094825	1.000000	0.71417	0.868000	0.34077	0.653000	0.38743	5.448000	0.66612	2.003000	0.58678	0.509000	0.49947	GTG	PRDM15	-	NULL	ENSG00000141956		0.587	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		-	0.00	61	0	C	NM_022115		43221756	-1	tier1	-	no_errors	ENST00000269844	ensembl	human	known	74_37	missense	14.75	52	9	SNP	1.000	T
PRELID1P1	728666	genome.wustl.edu	37	6	126964866	126964866	+	RNA	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:126964866G>T	ENST00000567272.1	+	0	233									PRELI domain containing 1 pseudogene 1																		AGCGGTACCCGAATCCCTATA	0.587																																																	0																																												0					6q22.32	2012-04-23			ENSG00000217325	ENSG00000217325			43886	pseudogene	pseudogene							Standard	NG_022903		Approved				OTTHUMG00000015520		6.37:g.126964866G>T				RNA	SNP	-	NULL	ENST00000567272.1	37	NULL		6																																																																																			PRELID1P1	-	-	ENSG00000217325		0.587	PRELID1P1-002	KNOWN	basic	processed_transcript	PRELID1P1	HGNC	pseudogene	OTTHUMT00000436205.1	-	0.00	47	0	G	NG_022903		126964866	+1	tier1	-	no_errors	ENST00000567272	ensembl	human	known	74_37	rna	18.31	58	13	SNP	0.219	T
PRMT8	56341	genome.wustl.edu	37	12	3600835	3600835	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:3600835A>T	ENST00000382622.3	+	1	434	c.44A>T	c.(43-45)aAa>aTa	p.K15I	PRMT8_ENST00000452611.2_Intron	NM_019854.4	NP_062828.3	Q9NR22	ANM8_HUMAN	protein arginine methyltransferase 8	15					histone arginine methylation (GO:0034969)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(31;0.0109)|COAD - Colon adenocarcinoma(12;0.0264)			CTGAGGAGGAAAATGGCGGAG	0.662																																																	0													49.0	47.0	48.0					12																	3600835		2202	4300	6502	SO:0001583	missense	0			AF263539	CCDS8521.2, CCDS58200.1	12p13.3	2006-03-03	2006-02-16	2006-02-16	ENSG00000111218	ENSG00000111218		"""Protein arginine methyltransferases"""	5188	protein-coding gene	gene with protein product		610086	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"", ""HMT1 hnRNP methyltransferase-like 4 (S. cerevisiae)"""	HRMT1L3, HRMT1L4		16051612	Standard	NM_019854		Approved		uc001qmf.4	Q9NR22	OTTHUMG00000128493	ENST00000382622.3:c.44A>T	12.37:g.3600835A>T	ENSP00000372067:p.Lys15Ile		B2RDP0|Q8TBJ8	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_tRNA_Trfase_Trm5/Tyw2	p.K15I	ENST00000382622.3	37	c.44	CCDS8521.2	12	.	.	.	.	.	.	.	.	.	.	A	19.30	3.800977	0.70567	.	.	ENSG00000111218	ENST00000382622	T	0.32988	1.43	3.54	3.54	0.40534	.	0.258488	0.28301	N	0.015851	T	0.21468	0.0517	L	0.36672	1.1	0.45366	D	0.998358	P	0.35011	0.48	B	0.31101	0.124	T	0.08027	-1.0742	10	0.72032	D	0.01	.	8.6442	0.33996	1.0:0.0:0.0:0.0	.	15	Q9NR22	ANM8_HUMAN	I	15	ENSP00000372067:K15I	ENSP00000372067:K15I	K	+	2	0	PRMT8	3471096	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.476000	0.73587	1.610000	0.50200	0.459000	0.35465	AAA	PRMT8	-	NULL	ENSG00000111218		0.662	PRMT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT8	HGNC	protein_coding	OTTHUMT00000250297.2	-	0.00	17	0	A	NM_019854		3600835	+1	tier1	-	no_errors	ENST00000382622	ensembl	human	known	74_37	missense	16.00	20	4	SNP	1.000	T
PRSS3	5646	genome.wustl.edu	37	9	33798037	33798037	+	Silent	SNP	T	T	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:33798037T>C	ENST00000361005.5	+	3	582	c.582T>C	c.(580-582)acT>acC	p.T194T	PRSS3_ENST00000429677.3_Silent_p.T130T|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Silent_p.T151T|PRSS3_ENST00000379405.3_Silent_p.T137T	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	194	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			CTGCTGGCACTGAGTGCCTCA	0.562																																																	0													161.0	127.0	138.0					9																	33798037		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.582T>C	9.37:g.33798037T>C			A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Silent	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.T194	ENST00000361005.5	37	c.582	CCDS47958.1	9																																																																																			PRSS3	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000010438		0.562	PRSS3-003	KNOWN	basic|CCDS	protein_coding	PRSS3	HGNC	protein_coding	OTTHUMT00000052121.1		0.00	102	0	T	NM_002771		33798037	+1			no_errors	ENST00000361005	ensembl	human	known	74_37	silent	5.62	84	5	SNP	0.688	C
PSG1	5669	genome.wustl.edu	37	19	43376083	43376083	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:43376083A>G	ENST00000436291.2	-	3	661	c.545T>C	c.(544-546)aTg>aCg	p.M182T	PSG1_ENST00000403380.3_Intron|PSG1_ENST00000244296.2_Missense_Mutation_p.M182T|PSG1_ENST00000595124.1_Intron|PSG1_ENST00000595356.1_Missense_Mutation_p.M182T|PSG1_ENST00000312439.6_Missense_Mutation_p.M182T	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	182	Ig-like C2-type 1.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				CTGACCATTCATCCACCACAG	0.522																																																	0													269.0	259.0	263.0					19																	43376083		2201	4298	6499	SO:0001583	missense	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.545T>C	19.37:g.43376083A>G	ENSP00000413041:p.Met182Thr		O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.M182T	ENST00000436291.2	37	c.545	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	5.712	0.315874	0.10789	.	.	ENSG00000231924	ENST00000436291;ENST00000312439;ENST00000244296	T;T;T	0.11930	2.73;2.73;2.73	1.46	1.46	0.22682	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.09069	0.0224	N	0.11201	0.11	0.09310	N	1	B;B;P;B;B;B;B;B	0.39131	0.389;0.143;0.661;0.074;0.21;0.387;0.389;0.409	B;B;P;B;B;B;B;B	0.44447	0.369;0.173;0.45;0.113;0.266;0.158;0.369;0.253	T	0.25257	-1.0137	9	0.72032	D	0.01	.	4.9592	0.14057	1.0:0.0:0.0:0.0	.	182;182;182;182;182;54;182;182	O75238;P11464-4;P11464;P11464-3;Q9UPK8;B4DTG5;O75237;P11464-2	.;.;PSG1_HUMAN;.;.;.;.;.	T	182	ENSP00000413041:M182T;ENSP00000308970:M182T;ENSP00000244296:M182T	ENSP00000244296:M182T	M	-	2	0	PSG1	48067923	0.003000	0.15002	0.006000	0.13384	0.018000	0.09664	0.914000	0.28624	0.652000	0.30806	0.155000	0.16302	ATG	PSG1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000231924		0.522	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	-	0.00	215	0	A			43376083	-1	tier1	-	no_errors	ENST00000312439	ensembl	human	known	74_37	missense	6.61	240	17	SNP	0.013	G
PSG9	5678	genome.wustl.edu	37	19	43763024	43763024	+	Missense_Mutation	SNP	T	T	A	rs140571643		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:43763024T>A	ENST00000270077.3	-	4	1069	c.973A>T	c.(973-975)Atc>Ttc	p.I325F	PSG9_ENST00000244293.7_Intron|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000418820.2_Missense_Mutation_p.I232F|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000443718.3_Missense_Mutation_p.I232F	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	325	Ig-like C2-type 2.		I -> T (in dbSNP:rs1135905).		female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				ACATTTAGGATGACTGGGTTA	0.498																																																	0								A	PHE/ILE	1,4267		0,1,2133	98.0	102.0	100.0		973	-2.1	0.0	19	dbSNP_134	100	0,8558		0,0,4279	no	missense	PSG9	NM_002784.3	21	0,1,6412	AA,AT,TT		0.0,0.0234,0.0078	benign	325/427	43763024	1,12825	2134	4279	6413	SO:0001583	missense	0			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.973A>T	19.37:g.43763024T>A	ENSP00000270077:p.Ile325Phe		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.I325F	ENST00000270077.3	37	c.973	CCDS12618.1	19	.	.	.	.	.	.	.	.	.	.	N	0.920	-0.716186	0.03206	2.34E-4	0.0	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.12672	2.66;2.66	1.39	-2.06	0.07298	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07728	0.0194	N	0.24115	0.695	0.09310	N	1	B;B	0.17852	0.024;0.0	B;B	0.19391	0.025;0.002	T	0.30937	-0.9961	9	0.56958	D	0.05	.	2.3522	0.04286	0.2772:0.0:0.2833:0.4395	.	232;325	E7EW65;Q00887	.;PSG9_HUMAN	F	325;232;286	ENSP00000270077:I325F;ENSP00000396753:I232F	ENSP00000270077:I325F	I	-	1	0	PSG9	48454864	0.014000	0.17966	0.002000	0.10522	0.000000	0.00434	0.635000	0.24629	-2.196000	0.00751	-3.801000	0.00020	ATC	PSG9	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000183668		0.498	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG9	HGNC	protein_coding	OTTHUMT00000323065.1	-	0.00	226	0	T	NM_002784		43763024	-1	tier1	rs140571643	no_errors	ENST00000270077	ensembl	human	known	74_37	missense	23.78	218	68	SNP	0.023	A
PTPN23	25930	genome.wustl.edu	37	3	47449841	47449841	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:47449841C>G	ENST00000265562.4	+	15	1268	c.1191C>G	c.(1189-1191)ttC>ttG	p.F397L	PTPN23_ENST00000431726.1_Missense_Mutation_p.F271L	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	397					cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACAGCCAGTTCATGGATTCAA	0.587																																																	0													84.0	78.0	80.0					3																	47449841		2203	4300	6503	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1191C>G	3.37:g.47449841C>G	ENSP00000265562:p.Phe397Leu		A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.F397L	ENST00000265562.4	37	c.1191	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202622	0.58234	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.02631	4.22	4.2	3.33	0.38152	.	0.000000	0.85682	D	0.000000	T	0.04092	0.0114	L	0.52206	1.635	0.58432	D	0.999997	B;P	0.49447	0.002;0.924	B;B	0.43950	0.006;0.437	T	0.46871	-0.9160	10	0.62326	D	0.03	-24.2561	7.6644	0.28421	0.0:0.8031:0.0:0.1969	.	271;397	B4DST5;Q9H3S7	.;PTN23_HUMAN	L	362;397	ENSP00000265562:F397L	ENSP00000265562:F397L	F	+	3	2	PTPN23	47424845	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	2.542000	0.45744	1.009000	0.39289	-0.262000	0.10625	TTC	PTPN23	-	NULL	ENSG00000076201		0.587	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	-	0.00	88	0	C	NM_015466		47449841	+1	tier1	-	no_errors	ENST00000265562	ensembl	human	known	74_37	missense	20.29	55	14	SNP	1.000	G
RAB5C	5878	genome.wustl.edu	37	17	40282551	40282551	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs370734734		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:40282551G>A	ENST00000346213.4	-	0	182				RAB5C_ENST00000547517.1_Silent_p.H23H|CTD-2132N18.3_ENST00000592574.1_De_novo_Start_OutOfFrame|RAB5C_ENST00000393860.3_De_novo_Start_OutOfFrame	NM_004583.3	NP_004574.2	P51148	RAB5C_HUMAN	RAB5C, member RAS oncogene family						endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)|skin(1)	7		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		TCCAGAGAGCGTGCGGGTGGG	0.577																																																	0								G	,	0,4406		0,0,2203	29.0	26.0	27.0		,	4.8	1.0	17		27	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,utr-5	RAB5C	NM_004583.2,NM_201434.1	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	,	40282551	1,13005	2203	4300	6503			0			U18420	CCDS11419.1, CCDS58551.1	17q21.2	2013-02-15			ENSG00000108774	ENSG00000108774		"""RAB, member RAS oncogene"""	9785	protein-coding gene	gene with protein product	"""RAB, member of RAS oncogene family-like"", ""RAB5C, member of RAS oncogene family"""	604037		RABL		8646882	Standard	NM_004583		Approved	RAB5CL	uc010cxx.3	P51148	OTTHUMG00000169703	ENST00000346213.4:c.-31C>T	17.37:g.40282551G>A			F8W1H5|Q6FH55|Q9P0Y5	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.H23	ENST00000346213.4	37	c.69	CCDS11419.1	17																																																																																			RAB5C	-	NULL	ENSG00000108774		0.577	RAB5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB5C	HGNC	protein_coding	OTTHUMT00000405509.1	-	0.00	17	0	G	NM_004583		40282551	-1	tier1	-	no_errors	ENST00000547517	ensembl	human	putative	74_37	silent	20.59	27	7	SNP	0.987	A
RANBP6	26953	genome.wustl.edu	37	9	6012690	6012690	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:6012690delT	ENST00000259569.5	-	1	2928	c.2918delA	c.(2917-2919)aatfs	p.N973fs	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	973					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.N973fs*12(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		AGCAATGACATTTTTTTTGGT	0.358																																																	1	Deletion - Frameshift(1)	ovary(1)											109.0	102.0	104.0					9																	6012690		2203	4300	6503	SO:0001589	frameshift_variant	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2918delA	9.37:g.6012690delT	ENSP00000259569:p.Asn973fs		Q5T7X4|Q7Z3V2|Q96E78	Frame_Shift_Del	DEL	pfam_HEAT,superfamily_ARM-type_fold	p.N973fs	ENST00000259569.5	37	c.2918	CCDS6467.1	9																																																																																			RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.358	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1		0.00	42	0	T	NM_012416		6012690	-1	tier1		no_errors	ENST00000259569	ensembl	human	known	74_37	frame_shift_del	6.82	41	3	DEL	1.000	-
RIBC2	26150	genome.wustl.edu	37	22	45821833	45821833	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:45821833C>T	ENST00000342894.3	+	5	876	c.462C>T	c.(460-462)atC>atT	p.I154I	RIBC2_ENST00000538017.1_Silent_p.I222I|RIBC2_ENST00000466226.1_3'UTR			Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2	154						nucleus (GO:0005634)		p.I154I(2)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|skin(2)|urinary_tract(1)	10		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTTAGGCCATCGAGTCAGTGG	0.552																																																	2	Substitution - coding silent(2)	large_intestine(1)|endometrium(1)											106.0	94.0	98.0					22																	45821833		2203	4299	6502	SO:0001819	synonymous_variant	0			AK098586		22q13.3	2004-08-18	2004-08-18	2004-08-18	ENSG00000128408	ENSG00000128408			13241	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 11"""	C22orf11		12477932	Standard	NM_015653		Approved	DKFZp566F0546, FLJ25720	uc011aqs.3	Q9H4K1	OTTHUMG00000151332	ENST00000342894.3:c.462C>T	22.37:g.45821833C>T			Q6ICD0|Q9Y413	Silent	SNP	pfam_RIB43A	p.I222	ENST00000342894.3	37	c.666		22																																																																																			RIBC2	-	pfam_RIB43A	ENSG00000128408		0.552	RIBC2-001	KNOWN	basic	protein_coding	RIBC2	HGNC	protein_coding	OTTHUMT00000322250.1	-	0.00	33	0	C	NM_015653		45821833	+1	tier1	-	no_errors	ENST00000538017	ensembl	human	known	74_37	silent	26.67	22	8	SNP	0.000	T
RNF103	7844	genome.wustl.edu	37	2	86847539	86847539	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:86847539C>T	ENST00000237455.4	-	2	1248	c.280G>A	c.(280-282)Gaa>Aaa	p.E94K	AC015971.2_ENST00000426549.1_RNA|CHMP3_ENST00000439940.2_Missense_Mutation_p.E16K|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000439077.1_RNA|RNF103-CHMP3_ENST00000604011.1_Missense_Mutation_p.E16K|AC015971.2_ENST00000424788.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	94					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E94K(1)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						GAAACCGATTCGGATGCTTCT	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)											93.0	90.0	91.0					2																	86847539		2203	4300	6503	SO:0001583	missense	0			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.280G>A	2.37:g.86847539C>T	ENSP00000237455:p.Glu94Lys		A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Thioredoxin-like_fold,smart_Znf_RING,pfscan_Znf_RING	p.E94K	ENST00000237455.4	37	c.280	CCDS33237.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.412267	0.96072	.	.	ENSG00000115561;ENSG00000249884;ENSG00000239305	ENST00000439940;ENST00000440757;ENST00000237455	D;T;T	0.92249	-3.0;-1.25;0.83	5.96	5.96	0.96718	.	0.047576	0.85682	D	0.000000	D	0.90525	0.7031	L	0.51422	1.61	0.58432	D	0.99999	P;D	0.54964	0.935;0.969	B;B	0.40636	0.212;0.335	D	0.91155	0.4956	10	0.62326	D	0.03	-14.7187	20.422	0.99049	0.0:1.0:0.0:0.0	.	16;94	Q9Y3E7-3;O00237	.;RN103_HUMAN	K	16;94;94	ENSP00000405575:E16K;ENSP00000392995:E94K;ENSP00000237455:E94K	ENSP00000237455:E94K	E	-	1	0	RNF103;VPS24;RNF103-VPS24	86701050	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	5.484000	0.66844	2.832000	0.97577	0.655000	0.94253	GAA	RNF103	-	NULL	ENSG00000239305		0.423	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF103	HGNC	protein_coding	OTTHUMT00000330041.2	-	0.00	54	0	C	NM_005667		86847539	-1	tier1	-	no_errors	ENST00000237455	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
RPUSD2	27079	genome.wustl.edu	37	15	40864010	40864010	+	Missense_Mutation	SNP	C	C	T	rs140454770		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:40864010C>T	ENST00000315616.7	+	2	852	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	RPUSD2_ENST00000559271.1_Missense_Mutation_p.R211W	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	272					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)	p.R272W(1)		kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		CCCCTTGCATCGGCTTGACCG	0.562													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21419	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	skin(1)											143.0	122.0	129.0					15																	40864010		2203	4300	6503	SO:0001583	missense	0			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.814C>T	15.37:g.40864010C>T	ENSP00000323288:p.Arg272Trp		B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	p.R272W	ENST00000315616.7	37	c.814	CCDS10061.1	15	.	.	.	.	.	.	.	.	.	.	C	22.0	4.228251	0.79576	.	.	ENSG00000166133	ENST00000315616;ENST00000417769	T	0.61040	0.14	6.17	5.19	0.71726	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase, RluC/RluD, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.86698	0.5995	H	0.99498	4.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91736	0.5400	10	0.87932	D	0	-19.5561	16.3651	0.83317	0.2155:0.7845:0.0:0.0	.	272	Q8IZ73	RUSD2_HUMAN	W	272;251	ENSP00000323288:R272W	ENSP00000323288:R272W	R	+	1	2	RPUSD2	38651302	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.103000	0.50298	2.941000	0.99782	0.655000	0.94253	CGG	RPUSD2	-	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	ENSG00000166133		0.562	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPUSD2	HGNC	protein_coding	OTTHUMT00000252308.2	-	0.00	52	0	C	NM_152260		40864010	+1	tier1	rs140454770	no_errors	ENST00000315616	ensembl	human	known	74_37	missense	15.87	53	10	SNP	1.000	T
RTN4R	65078	genome.wustl.edu	37	22	20229382	20229382	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr22:20229382G>A	ENST00000043402.7	-	2	1712	c.1274C>T	c.(1273-1275)aCc>aTc	p.T425I	RTN4R_ENST00000469601.1_5'Flank	NM_023004.5	NP_075380.1	Q9BZR6	RTN4R_HUMAN	reticulon 4 receptor	425					axonogenesis (GO:0007409)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			lung(1)|ovary(1)|prostate(1)	3	Colorectal(54;0.0993)					GTGGCTGCGGGTGCGGTTCTT	0.721																																																	0													10.0	11.0	11.0					22																	20229382		2168	4260	6428	SO:0001583	missense	0			AF283463	CCDS13777.1	22q11	2008-05-02			ENSG00000040608	ENSG00000040608			18601	protein-coding gene	gene with protein product		605566				11201742	Standard	NM_023004		Approved	NOGOR	uc002zrv.3	Q9BZR6	OTTHUMG00000150572	ENST00000043402.7:c.1274C>T	22.37:g.20229382G>A	ENSP00000043402:p.Thr425Ile		D3DX28	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T425I	ENST00000043402.7	37	c.1274	CCDS13777.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.309|8.309	0.821722|0.821722	0.16678|0.16678	.|.	.|.	ENSG00000040608|ENSG00000040608	ENST00000416372;ENST00000425986|ENST00000043402	.|T	.|0.61742	.|0.08	3.35|3.35	3.35|3.35	0.38373|0.38373	.|.	.|.	.|.	.|.	.|.	T|T	0.39708|0.39708	0.1088|0.1088	L|L	0.29908|0.29908	0.895|0.895	0.32325|0.32325	N|N	0.561805|0.561805	.|B	.|0.31125	.|0.309	.|B	.|0.26969	.|0.075	T|T	0.42649|0.42649	-0.9439|-0.9439	5|9	.|0.13470	.|T	.|0.59	.|.	10.3645|10.3645	0.44015|0.44015	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|425	.|Q9BZR6	.|RTN4R_HUMAN	S|I	445;511|425	.|ENSP00000043402:T425I	.|ENSP00000043402:T425I	P|T	-|-	1|2	0|0	RTN4R|RTN4R	18609382|18609382	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.762000|0.762000	0.43233|0.43233	3.671000|3.671000	0.54576|0.54576	1.880000|1.880000	0.54463|0.54463	0.305000|0.305000	0.20034|0.20034	CCC|ACC	RTN4R	-	NULL	ENSG00000040608		0.721	RTN4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTN4R	HGNC	protein_coding	OTTHUMT00000318950.2	-	0.00	24	0	G			20229382	-1	tier1	-	no_errors	ENST00000043402	ensembl	human	known	74_37	missense	38.46	8	5	SNP	0.984	A
SELL	6402	genome.wustl.edu	37	1	169670756	169670756	+	Silent	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:169670756A>G	ENST00000236147.4	-	7	1225	c.1065T>C	c.(1063-1065)gtT>gtC	p.V355V	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	342					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					AGAATGCAGTAACCATGACTG	0.378																																																	0													48.0	45.0	46.0					1																	169670756		1852	4096	5948	SO:0001819	synonymous_variant	0			M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.1065T>C	1.37:g.169670756A>G			B2R6Q8|P15023|Q9UJ43	Silent	SNP	pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_EG-like_dom,smart_Sushi_SCR_CCP,pirsf_L-selectin,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.V355	ENST00000236147.4	37	c.1065	CCDS53427.1	1																																																																																			SELL	-	pirsf_L-selectin	ENSG00000188404		0.378	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELL	HGNC	protein_coding	OTTHUMT00000084233.1	-	0.00	39	0	A	NM_000655		169670756	-1	tier1	-	no_errors	ENST00000236147	ensembl	human	known	74_37	silent	13.64	38	6	SNP	0.076	G
RYR2	6262	genome.wustl.edu	37	1	237777617	237777617	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:237777617C>T	ENST00000366574.2	+	37	5506	c.5189C>T	c.(5188-5190)aCg>aTg	p.T1730M	RYR2_ENST00000360064.6_Missense_Mutation_p.T1728M|RYR2_ENST00000542537.1_Missense_Mutation_p.T1714M	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1730	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.T1728M(2)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTCCCCATGACGGAGGAGACG	0.547																																																	2	Substitution - Missense(2)	large_intestine(1)|lung(1)											62.0	61.0	61.0					1																	237777617		2119	4241	6360	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5189C>T	1.37:g.237777617C>T	ENSP00000355533:p.Thr1730Met		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T1728M	ENST00000366574.2	37	c.5183	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470495	0.84533	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.74737	-0.87;-0.87;-0.87	5.43	5.43	0.79202	.	0.000000	0.64402	D	0.000008	D	0.84356	0.5454	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.66602	0.945	D	0.84547	0.0642	10	0.52906	T	0.07	.	19.2592	0.93961	0.0:1.0:0.0:0.0	.	1730	Q92736	RYR2_HUMAN	M	1730;1728;1714	ENSP00000355533:T1730M;ENSP00000353174:T1728M;ENSP00000443798:T1714M	ENSP00000353174:T1728M	T	+	2	0	RYR2	235844240	1.000000	0.71417	0.957000	0.39632	0.994000	0.84299	7.776000	0.85560	2.563000	0.86464	0.650000	0.86243	ACG	RYR2	-	NULL	ENSG00000198626		0.547	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	69	0	C	NM_001035		237777617	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	23.08	50	15	SNP	1.000	T
SEMA3E	9723	genome.wustl.edu	37	7	83031961	83031961	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:83031961G>T	ENST00000307792.3	-	10	1597	c.1130C>A	c.(1129-1131)cCa>cAa	p.P377Q	SEMA3E_ENST00000427262.1_Missense_Mutation_p.P317Q	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	377	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)	p.P377Q(1)		breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				ACCAGGCCTTGGATAAGGGAC	0.363																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											95.0	85.0	88.0					7																	83031961		2203	4300	6503	SO:0001583	missense	0			AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.1130C>A	7.37:g.83031961G>T	ENSP00000303212:p.Pro377Gln		B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.P377Q	ENST00000307792.3	37	c.1130	CCDS34674.1	7	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606049	0.87157	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.19806	2.12;2.12	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.62804	0.2458	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76113	-0.3078	10	0.87932	D	0	.	19.1853	0.93641	0.0:0.0:1.0:0.0	.	377	O15041	SEM3E_HUMAN	Q	377;317;377	ENSP00000303212:P377Q;ENSP00000405052:P317Q	ENSP00000303212:P377Q	P	-	2	0	SEMA3E	82869897	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.835000	0.99442	2.536000	0.85505	0.585000	0.79938	CCA	SEMA3E	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000170381		0.363	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3E	HGNC	protein_coding	OTTHUMT00000336606.1	-	0.00	76	0	G	NM_012431		83031961	-1	tier1	-	no_errors	ENST00000307792	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
SENP7	57337	genome.wustl.edu	37	3	101059041	101059041	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:101059041G>T	ENST00000394095.2	-	16	2308	c.2255C>A	c.(2254-2256)cCt>cAt	p.P752H	SENP7_ENST00000314261.7_Missense_Mutation_p.P686H|SENP7_ENST00000394091.1_Missense_Mutation_p.P588H|SENP7_ENST00000358203.3_Missense_Mutation_p.P588H|SENP7_ENST00000394094.2_Missense_Mutation_p.P687H|SENP7_ENST00000348610.3_Missense_Mutation_p.P719H	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	752						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						AGGTGGTGGAGGATATACAAT	0.308																																																	0													48.0	45.0	46.0					3																	101059041		2202	4284	6486	SO:0001583	missense	0				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2255C>A	3.37:g.101059041G>T	ENSP00000377655:p.Pro752His		A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.P752H	ENST00000394095.2	37	c.2255	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	G	19.44	3.827282	0.71143	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	5.26	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.55337	0.1914	M	0.73962	2.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.998	T	0.61237	-0.7103	10	0.87932	D	0	-14.3512	14.0862	0.64957	0.0744:0.0:0.9256:0.0	.	588;686;719;752	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	H	752;687;686;588;588;719	ENSP00000377655:P752H;ENSP00000377654:P687H;ENSP00000313624:P686H;ENSP00000377651:P588H;ENSP00000350936:P588H;ENSP00000342159:P719H	ENSP00000313624:P686H	P	-	2	0	SENP7	102541731	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.681000	0.91228	1.344000	0.45657	0.563000	0.77884	CCT	SENP7	-	NULL	ENSG00000138468		0.308	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	HGNC	protein_coding	OTTHUMT00000313957.2		0.00	65	0	G	NM_020654		101059041	-1			no_errors	ENST00000394095	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
SHROOM2	357	genome.wustl.edu	37	X	9900611	9900611	+	Silent	SNP	G	G	A	rs374276560		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrX:9900611G>A	ENST00000380913.3	+	6	3378	c.3288G>A	c.(3286-3288)acG>acA	p.T1096T	SHROOM2_ENST00000493668.1_3'UTR|SHROOM2_ENST00000418909.2_5'UTR	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1096					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CCTTCCCAACGCCATCCCCTG	0.697																																																	0								G		0,3835		0,0,1632,571	42.0	38.0	39.0		3288	-6.9	0.0	X		39	1,6727		0,1,2427,1872	no	coding-synonymous	SHROOM2	NM_001649.2		0,1,4059,2443	AA,AG,GG,G		0.0149,0.0,0.0095		1096/1617	9900611	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3288G>A	X.37:g.9900611G>A			B9EIQ7	Silent	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T1096	ENST00000380913.3	37	c.3288	CCDS14135.1	X																																																																																			SHROOM2	-	NULL	ENSG00000146950		0.697	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	-	0.00	41	0	G	NM_001649		9900611	+1	tier1	-	no_errors	ENST00000380913	ensembl	human	known	74_37	silent	51.02	24	25	SNP	0.000	A
SIDT1	54847	genome.wustl.edu	37	3	113346614	113346614	+	3'UTR	SNP	T	T	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:113346614T>A	ENST00000264852.4	+	0	3269				SIDT1_ENST00000463226.1_3'UTR|SIDT1_ENST00000393830.3_3'UTR	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1						dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						TCACAAAAATTACAGTGACCA	0.507																																																	0													82.0	66.0	71.0					3																	113346614		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.*59T>A	3.37:g.113346614T>A			Q17RR4	RNA	SNP	-	NULL	ENST00000264852.4	37	NULL	CCDS2974.1	3																																																																																			SIDT1	-	-	ENSG00000072858		0.507	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	-	0.00	66	0	T	NM_017699		113346614	+1	tier1	-	no_errors	ENST00000463226	ensembl	human	known	74_37	rna	8.82	62	6	SNP	0.000	A
SLC12A3	6559	genome.wustl.edu	37	16	56918001	56918001	+	Silent	SNP	G	G	A	rs387907471		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:56918001G>A	ENST00000563236.1	+	14	1735	c.1710G>A	c.(1708-1710)gcG>gcA	p.A570A	SLC12A3_ENST00000262502.5_Silent_p.A569A|SLC12A3_ENST00000438926.2_Silent_p.A570A|SLC12A3_ENST00000566786.1_Silent_p.A569A			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	570					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	AGTGGGCGGCGCTGTTTGGGG	0.587																																																	0													194.0	152.0	166.0					16																	56918001		2198	4300	6498	SO:0001819	synonymous_variant	0				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.1710G>A	16.37:g.56918001G>A			A8MSJ2|C9JNN9	Silent	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.A570	ENST00000563236.1	37	c.1710	CCDS58464.1	16																																																																																			SLC12A3	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000070915		0.587	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	-	0.00	64	0	G			56918001	+1	tier1	-	no_errors	ENST00000438926	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.145	A
SLC2A14	144195	genome.wustl.edu	37	12	7981378	7981378	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:7981378T>A	ENST00000543909.1	-	11	1426	c.667A>T	c.(667-669)Agt>Tgt	p.S223C	SLC2A14_ENST00000431042.2_Missense_Mutation_p.S200C|SLC2A14_ENST00000340749.5_Missense_Mutation_p.S200C|SLC2A14_ENST00000535295.1_Missense_Mutation_p.S114C|SLC2A14_ENST00000539924.1_Missense_Mutation_p.S238C|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000542546.1_Missense_Mutation_p.S114C|SLC2A14_ENST00000396589.2_Missense_Mutation_p.S223C			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14	223					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGGGCTGCACTTTGCAGGATA	0.453																																																	0													151.0	137.0	142.0					12																	7981378		2203	4300	6503	SO:0001583	missense	0			AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.667A>T	12.37:g.7981378T>A	ENSP00000440480:p.Ser223Cys		B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.S223C	ENST00000543909.1	37	c.667	CCDS8585.1	12	.	.	.	.	.	.	.	.	.	.	T	4.555	0.103027	0.08731	.	.	ENSG00000173262	ENST00000340749;ENST00000543909;ENST00000431042;ENST00000396589;ENST00000535295;ENST00000542546;ENST00000539924	T;T;T;T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42;-1.42;-1.42;-1.42	3.92	-0.657	0.11432	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.337948	0.38663	N	0.001616	T	0.52581	0.1743	N	0.04508	-0.205	0.20703	N	0.999867	B;B;B;B	0.14012	0.009;0.001;0.002;0.002	B;B;B;B	0.17979	0.02;0.008;0.005;0.008	T	0.38351	-0.9665	10	0.30078	T	0.28	.	3.8883	0.09108	0.572:0.1282:0.0:0.2998	.	238;114;200;223	B7ZAC3;B7Z844;Q8TDB8-2;Q8TDB8	.;.;.;GTR14_HUMAN	C	200;223;200;223;114;114;238	ENSP00000340450:S200C;ENSP00000440480:S223C;ENSP00000407287:S200C;ENSP00000379834:S223C;ENSP00000440492:S114C;ENSP00000443903:S114C;ENSP00000445929:S238C	ENSP00000340450:S200C	S	-	1	0	SLC2A14	7872645	0.741000	0.28217	0.009000	0.14445	0.022000	0.10575	1.887000	0.39698	-0.004000	0.14419	0.377000	0.23210	AGT	SLC2A14	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000173262		0.453	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	HGNC	protein_coding	OTTHUMT00000399836.2	-	0.00	70	0	T	NM_153449		7981378	-1	tier1	-	no_errors	ENST00000396589	ensembl	human	known	74_37	missense	27.27	48	18	SNP	0.325	A
SMAD9	4093	genome.wustl.edu	37	13	37439893	37439893	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr13:37439893A>C	ENST00000399275.2	-	4	923	c.784T>G	c.(784-786)Ttt>Gtt	p.F262V	SMAD9_ENST00000379826.4_Missense_Mutation_p.F262V|SMAD9_ENST00000350148.5_Missense_Mutation_p.F225V			O15198	SMAD9_HUMAN	SMAD family member 9	262					BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		ACTGGTCGAAAGTCTGGAAGA	0.493																																																	0													46.0	41.0	43.0					13																	37439893		2203	4300	6503	SO:0001583	missense	0				CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.784T>G	13.37:g.37439893A>C	ENSP00000382216:p.Phe262Val		A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.F262V	ENST00000399275.2	37	c.784	CCDS45032.1	13	.	.	.	.	.	.	.	.	.	.	A	2.057	-0.416274	0.04766	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	D;D;D	0.96885	-3.24;-4.16;-3.24	5.23	4.03	0.46877	SMAD/FHA domain (1);	0.100359	0.64402	D	0.000001	D	0.83459	0.5259	N	0.00648	-1.295	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.78755	-0.2080	10	0.05620	T	0.96	.	11.8008	0.52126	0.8528:0.1472:0.0:0.0	.	225;262	O15198-2;O15198	.;SMAD9_HUMAN	V	262;225;262	ENSP00000382216:F262V;ENSP00000239885:F225V;ENSP00000369154:F262V	ENSP00000239885:F225V	F	-	1	0	SMAD9	36337893	1.000000	0.71417	0.996000	0.52242	0.610000	0.37248	2.071000	0.41500	0.922000	0.37019	0.533000	0.62120	TTT	SMAD9	-	superfamily_SMAD_FHA_domain	ENSG00000120693		0.493	SMAD9-002	KNOWN	basic|CCDS	protein_coding	SMAD9	HGNC	protein_coding	OTTHUMT00000044525.2	-	0.00	57	0	A	NM_005905		37439893	-1	tier1	-	no_errors	ENST00000379826	ensembl	human	known	74_37	missense	25.68	55	19	SNP	1.000	C
SMC2	10592	genome.wustl.edu	37	9	106857810	106857810	+	Silent	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:106857810C>T	ENST00000286398.7	+	2	433	c.145C>T	c.(145-147)Ctg>Ttg	p.L49L	SMC2_ENST00000374793.3_Silent_p.L49L|SMC2_ENST00000374787.3_Silent_p.L49L|SMC2_ENST00000303219.8_Silent_p.L49L	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	49					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						CTGCTTTTTGCTGGGCATCTC	0.433																																																	0													127.0	105.0	113.0					9																	106857810		2203	4300	6503	SO:0001819	synonymous_variant	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.145C>T	9.37:g.106857810C>T			Q6IEE0|Q9P1P2	Silent	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.L49	ENST00000286398.7	37	c.145	CCDS35086.1	9																																																																																			SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.433	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1	-	0.00	59	0	C			106857810	+1	tier1	-	no_errors	ENST00000286398	ensembl	human	known	74_37	silent	13.70	63	10	SNP	1.000	T
SNURF	8926	genome.wustl.edu	37	15	25227118	25227118	+	3'UTR	SNP	A	A	C	rs538519561		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr15:25227118A>C	ENST00000551312.2	+	0	718				SNHG14_ENST00000551631.2_RNA|SNHG14_ENST00000459433.1_RNA|SNHG14_ENST00000551361.1_RNA			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame							nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		AGAAATAAGCATATATTGCAG	0.363																																																	0													390.0	377.0	381.0					15																	25227118		876	1991	2867	SO:0001624	3_prime_UTR_variant	0				CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000551312.2:c.*487A>C	15.37:g.25227118A>C			A6NCW2	RNA	SNP	-	NULL	ENST00000551312.2	37	NULL	CCDS10016.1	15																																																																																			SNHG14	-	-	ENSG00000224078		0.363	SNURF-002	KNOWN	basic|appris_candidate_longest|readthrough_transcript|CCDS	nonsense_mediated_decay	SNHG14	HGNC	protein_coding	OTTHUMT00000413842.1	-	0.00	15	0	A	NM_005678		25227118	+1	tier1	-	no_errors	ENST00000551631	ensembl	human	known	74_37	rna	20.83	19	5	SNP	0.000	C
SNX11	29916	genome.wustl.edu	37	17	46189952	46189952	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:46189952G>A	ENST00000393405.2	+	4	413	c.59G>A	c.(58-60)cGt>cAt	p.R20H	SNX11_ENST00000439357.2_5'UTR|SNX11_ENST00000582104.1_Missense_Mutation_p.R12H|SNX11_ENST00000452859.2_Intron|SNX11_ENST00000359238.2_Missense_Mutation_p.R20H|SNX11_ENST00000578861.1_3'UTR|SNX11_ENST00000580219.1_Missense_Mutation_p.R12H	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	20	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						ATTACAGTGCGTGTTCAGGAC	0.488																																																	0													217.0	213.0	214.0					17																	46189952		2203	4300	6503	SO:0001583	missense	0			AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.59G>A	17.37:g.46189952G>A	ENSP00000377059:p.Arg20His		B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R20H	ENST00000393405.2	37	c.59	CCDS11526.1	17	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211706	0.58452	.	.	ENSG00000002919	ENST00000393405;ENST00000359238	T;T	0.39229	1.09;1.09	5.22	5.22	0.72569	Phox homologous domain (5);	0.000000	0.85682	D	0.000000	T	0.56277	0.1974	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.46952	-0.9154	10	0.15499	T	0.54	0.1568	15.6958	0.77494	0.0:0.0:1.0:0.0	.	12;20	B4DPY5;Q9Y5W9	.;SNX11_HUMAN	H	20	ENSP00000377059:R20H;ENSP00000352175:R20H	ENSP00000352175:R20H	R	+	2	0	SNX11	43544951	1.000000	0.71417	0.997000	0.53966	0.965000	0.64279	9.122000	0.94380	2.446000	0.82766	0.455000	0.32223	CGT	SNX11	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000002919		0.488	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX11	HGNC	protein_coding	OTTHUMT00000443423.1	-	0.00	61	0	G			46189952	+1	tier1	-	no_errors	ENST00000359238	ensembl	human	known	74_37	missense	17.65	56	12	SNP	1.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43628000	43628000	+	Silent	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr9:43628000C>A	ENST00000332857.6	-	4	715	c.687G>T	c.(685-687)ctG>ctT	p.L229L	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	229					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGGAGTCCCGCAGGGGAGGAG	0.587																																																	0													1.0	1.0	1.0					9																	43628000		22	44	66	SO:0001819	synonymous_variant	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.687G>T	9.37:g.43628000C>A				Silent	SNP	NULL	p.L229	ENST00000332857.6	37	c.687	CCDS47973.1	9																																																																																			SPATA31A6	-	NULL	ENSG00000185775		0.587	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1	-	0.00	34	0	C	NM_001145196		43628000	-1	tier1	-	no_errors	ENST00000332857	ensembl	human	known	74_37	silent	32.26	21	10	SNP	0.000	A
SPTA1	6708	genome.wustl.edu	37	1	158627319	158627319	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:158627319T>G	ENST00000368147.4	-	19	2933	c.2753A>C	c.(2752-2754)aAg>aCg	p.K918T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	918					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AATAGGTTCCTTCTCTCTGAT	0.478																																																	0													152.0	155.0	154.0					1																	158627319		1986	4170	6156	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2753A>C	1.37:g.158627319T>G	ENSP00000357129:p.Lys918Thr		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.K918T	ENST00000368147.4	37	c.2753	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909841	0.72983	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.54279	0.58;0.58	4.68	3.54	0.40534	.	0.000000	0.33691	N	0.004650	T	0.60327	0.2260	M	0.75150	2.29	0.47374	D	0.999401	D	0.89917	1.0	D	0.97110	1.0	T	0.64960	-0.6284	10	0.66056	D	0.02	.	9.6499	0.39890	0.0:0.0847:0.0:0.9153	.	918	P02549	SPTA1_HUMAN	T	918	ENSP00000357130:K918T;ENSP00000357129:K918T	ENSP00000357129:K918T	K	-	2	0	SPTA1	156893943	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.191000	0.65110	0.903000	0.36546	0.533000	0.62120	AAG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.478	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	86	0	T	NM_003126		158627319	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	13.92	68	11	SNP	1.000	G
SPHAR	10638	genome.wustl.edu	37	1	229440935	229440935	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:229440935C>G	ENST00000366688.3	+	1	807	c.54C>G	c.(52-54)tgC>tgG	p.C18W	RAB4A_ENST00000366690.4_3'UTR	NM_006542.3	NP_006533.1	Q15513	SPHAR_HUMAN	S-phase response (cyclin related)	18					DNA replication (GO:0006260)							Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				TTGAGTTTTGCTTTTTTTATG	0.289																																																	0													71.0	71.0	71.0					1																	229440935		2199	4292	6491	SO:0001583	missense	0			BC070287	CCDS1576.1	1q42.13	2009-03-11			ENSG00000213029	ENSG00000213029			16957	protein-coding gene	gene with protein product						7799938	Standard	NM_006542		Approved		uc001htk.4	Q15513	OTTHUMG00000058947	ENST00000366688.3:c.54C>G	1.37:g.229440935C>G	ENSP00000355649:p.Cys18Trp		Q4EW09|Q6NSB9	Missense_Mutation	SNP	NULL	p.C18W	ENST00000366688.3	37	c.54	CCDS1576.1	1	.	.	.	.	.	.	.	.	.	.	C	2.469	-0.322330	0.05350	.	.	ENSG00000213029	ENST00000366688	.	.	.	4.27	-3.63	0.04529	.	.	.	.	.	T	0.29389	0.0732	.	.	.	0.09310	N	1	P	0.42123	0.771	B	0.42653	0.394	T	0.22138	-1.0225	7	0.87932	D	0	.	5.9786	0.19395	0.0:0.271:0.1494:0.5796	.	18	Q15513	SPHAR_HUMAN	W	18	.	ENSP00000355649:C18W	C	+	3	2	SPHAR	227507558	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.969000	0.03813	-1.054000	0.03214	-0.345000	0.07892	TGC	SPHAR	-	NULL	ENSG00000213029		0.289	SPHAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPHAR	HGNC	protein_coding	OTTHUMT00000130347.1	-	0.00	28	0	C	NM_006542		229440935	+1	tier1	-	no_errors	ENST00000366688	ensembl	human	known	74_37	missense	19.44	29	7	SNP	0.000	G
SPZ1	84654	genome.wustl.edu	37	5	79616605	79616605	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:79616605C>T	ENST00000296739.4	+	1	816	c.571C>T	c.(571-573)Cag>Tag	p.Q191*		NM_032567.3	NP_115956.3	Q9BXG8	SPZ1_HUMAN	spermatogenic leucine zipper 1	191	Basic motif. {ECO:0000255}.				transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(5)|large_intestine(4)|lung(12)|ovary(1)|skin(2)	26		Lung NSC(167;0.0393)|all_lung(232;0.0428)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;3.43e-47)|Epithelial(54;2.25e-41)|all cancers(79;4.19e-36)		AAAGAAACAGCAGATGATAAT	0.353																																																	0													80.0	73.0	75.0					5																	79616605		1823	4086	5909	SO:0001587	stop_gained	0				CCDS43336.1	5q14.1	2014-06-13				ENSG00000164299			30721	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 148"""					11165476, 12778315, 15226296, 15829580, 15899793	Standard	NM_032567		Approved	NYD-TSP1, FLJ25709, PPP1R148	uc003kgn.3	Q9BXG8		ENST00000296739.4:c.571C>T	5.37:g.79616605C>T	ENSP00000369611:p.Gln191*		B2RA21|Q8N4P1|Q8N7E9	Nonsense_Mutation	SNP	NULL	p.Q191*	ENST00000296739.4	37	c.571	CCDS43336.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.517392	0.97629	.	.	ENSG00000164299	ENST00000511881;ENST00000296739	.	.	.	3.72	1.88	0.25563	.	0.620126	0.14328	N	0.326540	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-1.396	4.8081	0.13329	0.2072:0.3907:0.4021:0.0	.	.	.	.	X	191	.	ENSP00000369611:Q191X	Q	+	1	0	SPZ1	79652361	0.003000	0.15002	0.011000	0.14972	0.387000	0.30353	0.012000	0.13287	0.186000	0.20125	-0.319000	0.08680	CAG	SPZ1	-	NULL	ENSG00000164299		0.353	SPZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPZ1	HGNC	protein_coding	OTTHUMT00000369322.1		0.00	39	0	C	NM_032567		79616605	+1			no_errors	ENST00000296739	ensembl	human	known	74_37	nonsense	8.89	41	4	SNP	0.045	T
SRPK1	6732	genome.wustl.edu	37	6	35837647	35837647	+	Silent	SNP	C	C	T	rs373060394		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr6:35837647C>T	ENST00000373825.2	-	11	1308	c.1023G>A	c.(1021-1023)acG>acA	p.T341T	SRPK1_ENST00000373822.1_Silent_p.T234T|SRPK1_ENST00000423325.2_Silent_p.T325T					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						GTTCCATAAGCGTTTGATCCT	0.358																																					NSCLC(31;67 978 16289 24856 26454)												0								C		1,3801		0,1,1900	178.0	168.0	171.0		1023	0.8	0.9	6		171	1,8223		0,1,4111	no	coding-synonymous	SRPK1	NM_003137.4		0,2,6011	TT,TC,CC		0.0122,0.0263,0.0166		341/656	35837647	2,12024	1901	4112	6013	SO:0001819	synonymous_variant	0			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.1023G>A	6.37:g.35837647C>T				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T341	ENST00000373825.2	37	c.1023	CCDS47415.1	6																																																																																			SRPK1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000096063		0.358	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	HGNC	protein_coding	OTTHUMT00000040319.3	-	0.00	30	0	C	NM_003137		35837647	-1	tier1	-	no_errors	ENST00000373825	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.030	T
SSH2	85464	genome.wustl.edu	37	17	28088355	28088355	+	Intron	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:28088355C>A	ENST00000269033.3	-	2	259				SSH2_ENST00000540801.1_Intron|SSH2_ENST00000324677.7_5'UTR|RP11-82O19.1_ENST00000577846.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2						actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGGCACGAGGCGCAGGCTGCG	0.741																																																	0																																										SO:0001627	intron_variant	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.107+32556G>T	17.37:g.28088355C>A			Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	RNA	SNP	-	NULL	ENST00000269033.3	37	NULL	CCDS11253.1	17																																																																																			SSH2	-	-	ENSG00000141298		0.741	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	-	0.00	33	0	C	NM_033389		28088355	-1	tier1	-	no_errors	ENST00000324677	ensembl	human	known	74_37	rna	25.93	20	7	SNP	0.001	A
SWT1	54823	genome.wustl.edu	37	1	185143719	185143719	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:185143719G>A	ENST00000367500.4	+	5	605	c.440G>A	c.(439-441)gGa>gAa	p.G147E	SWT1_ENST00000367501.3_Missense_Mutation_p.G147E	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	147										breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						CTTGACCATGGAATTAAAAGC	0.368																																																	0													53.0	53.0	53.0					1																	185143719		2203	4300	6503	SO:0001583	missense	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.440G>A	1.37:g.185143719G>A	ENSP00000356470:p.Gly147Glu		Q8NEK9|Q9BZQ7|Q9NXQ0	Missense_Mutation	SNP	smart_PIN_dom	p.G147E	ENST00000367500.4	37	c.440	CCDS1367.1	1	.	.	.	.	.	.	.	.	.	.	G	0.014	-1.583775	0.00872	.	.	ENSG00000116668	ENST00000367501;ENST00000367500;ENST00000450350	T;T;T	0.52983	0.64;0.64;0.64	5.35	-5.03	0.02973	.	0.656003	0.14223	N	0.333248	T	0.21307	0.0513	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.38628	-0.9652	10	0.02654	T	1	.	8.6034	0.33758	0.6093:0.0:0.2887:0.102	.	147	Q5T5J6	SWT1_HUMAN	E	147	ENSP00000356471:G147E;ENSP00000356470:G147E;ENSP00000401413:G147E	ENSP00000356470:G147E	G	+	2	0	SWT1	183410342	0.974000	0.33945	0.001000	0.08648	0.447000	0.32167	0.141000	0.16076	-0.994000	0.03463	-1.028000	0.02416	GGA	SWT1	-	NULL	ENSG00000116668		0.368	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	-	0.00	42	0	G	NM_017673		185143719	+1	tier1	-	no_errors	ENST00000367500	ensembl	human	known	74_37	missense	9.09	50	5	SNP	0.000	A
SYVN1	84447	genome.wustl.edu	37	11	64900951	64900951	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:64900951G>T	ENST00000377190.3	-	2	216	c.122C>A	c.(121-123)cCc>cAc	p.P41H	SYVN1_ENST00000526121.1_5'Flank|SYVN1_ENST00000294256.8_Missense_Mutation_p.P41H|SYVN1_ENST00000307289.6_Missense_Mutation_p.P41H|SYVN1_ENST00000526060.1_Missense_Mutation_p.P41H	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	41					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TGCCATGCTGGGGCTGGACTT	0.632																																																	0													76.0	73.0	74.0					11																	64900951		2201	4297	6498	SO:0001583	missense	0			AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.122C>A	11.37:g.64900951G>T	ENSP00000366395:p.Pro41His		Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P41H	ENST00000377190.3	37	c.122	CCDS31605.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.201576	0.79015	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000528487	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	4.21	4.21	0.49690	.	0.000000	0.85682	D	0.000000	T	0.56171	0.1967	L	0.58669	1.825	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.74348	0.965;0.983;0.962	T	0.49634	-0.8919	10	0.15499	T	0.54	-21.6323	14.4757	0.67544	0.0:0.0:1.0:0.0	.	41;41;41	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	H	41	ENSP00000366395:P41H;ENSP00000294256:P41H;ENSP00000302035:P41H;ENSP00000436984:P41H;ENSP00000431720:P41H	ENSP00000294256:P41H	P	-	2	0	SYVN1	64657527	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.002000	0.76304	2.338000	0.79540	0.655000	0.94253	CCC	SYVN1	-	NULL	ENSG00000162298		0.632	SYVN1-001	KNOWN	basic|CCDS	protein_coding	SYVN1	HGNC	protein_coding	OTTHUMT00000385274.1		0.00	92	0	G	NM_032431		64900951	-1			no_errors	ENST00000377190	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58085562	58085562	+	lincRNA	SNP	C	C	T	rs539862548	byFrequency	TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr17:58085562C>T	ENST00000407042.3	-	0	1874									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		GGCAGGCTCACGGCGTCGTCA	0.468													N|||	2	0.000399361	0.0015	0.0	5008	,	,		19163	0.0		0.0	False		,,,				2504	0.0																0																																												0					17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58085562C>T				RNA	SNP	-	NULL	ENST00000407042.3	37	NULL		17																																																																																			TBC1D3P1-DHX40P1	-	-	ENSG00000267104		0.468	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	HGNC	lincRNA		-	0.00	26	0	C	NR_002924		58085562	-1	tier1	-	no_errors	ENST00000407042	ensembl	human	known	74_37	rna	26.67	22	8	SNP	0.001	T
TBC1D8	11138	genome.wustl.edu	37	2	101650137	101650137	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:101650137C>T	ENST00000376840.4	-	10	1641	c.1642G>A	c.(1642-1644)Gag>Aag	p.E548K	TBC1D8_ENST00000409318.1_Missense_Mutation_p.E563K			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	548	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TCTATCTCCTCGGTTACCAGG	0.557																																																	0													101.0	114.0	110.0					2																	101650137		2198	4300	6498	SO:0001583	missense	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.1642G>A	2.37:g.101650137C>T	ENSP00000366036:p.Glu548Lys		A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E563K	ENST00000376840.4	37	c.1687	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.521531	0.96416	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.11495	2.77;2.77	5.12	5.12	0.69794	Rab-GAP/TBC domain (4);	0.000000	0.64402	D	0.000002	T	0.27349	0.0671	L	0.41961	1.31	0.58432	D	0.999999	D;D	0.89917	0.992;1.0	D;D	0.77557	0.911;0.99	T	0.00726	-1.1592	10	0.48119	T	0.1	-34.0326	18.5783	0.91163	0.0:1.0:0.0:0.0	.	563;548	B7Z6L4;O95759	.;TBCD8_HUMAN	K	548;563	ENSP00000366036:E548K;ENSP00000386856:E563K	ENSP00000366036:E548K	E	-	1	0	TBC1D8	101016569	1.000000	0.71417	0.941000	0.38009	0.894000	0.52154	7.610000	0.82949	2.377000	0.81083	0.655000	0.94253	GAG	TBC1D8	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000204634		0.557	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	-	0.00	89	0	C	NM_007063		101650137	-1	tier1	-	no_errors	ENST00000409318	ensembl	human	known	74_37	missense	26.51	61	22	SNP	1.000	T
TBL1Y	90665	genome.wustl.edu	37	Y	6939642	6939642	+	Silent	SNP	C	C	T	rs375467650		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrY:6939642C>T	ENST00000383032.1	+	11	1421	c.774C>T	c.(772-774)ttC>ttT	p.F258F	TBL1Y_ENST00000355162.2_Silent_p.F258F|TBL1Y_ENST00000346432.3_Silent_p.F258F	NM_033284.1	NP_150600.1	Q9BQ87	TBL1Y_HUMAN	transducin (beta)-like 1, Y-linked	258					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)|skin(1)	8						ATGATGGTTTCGCAAGAATAT	0.463																																																	0								C	,,	0,571		0,571	78.0	69.0	71.0		774,774,774	1.1	1.0	Y		71	1,1871		1,1871	no	coding-synonymous,coding-synonymous,coding-synonymous	TBL1Y	NM_033284.1,NM_134258.1,NM_134259.1	,,	1,2442	T,C		0.0534,0.0,0.0409	,,	258/523,258/523,258/523	6939642	1,2442	596	1940	2536	SO:0001819	synonymous_variant	0			AF332220	CCDS14779.1	Yp11.2	2013-01-10	2009-12-17		ENSG00000092377	ENSG00000092377		"""WD repeat domain containing"""	18502	protein-coding gene	gene with protein product		400033					Standard	NM_033284		Approved	TBL1	uc004frd.3	Q9BQ87	OTTHUMG00000035299	ENST00000383032.1:c.774C>T	Y.37:g.6939642C>T			A1L4B3	Silent	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.F258	ENST00000383032.1	37	c.774	CCDS14779.1	Y																																																																																			TBL1Y	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000092377		0.463	TBL1Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1Y	HGNC	protein_coding	OTTHUMT00000085360.1	-	0.00	96	0	C	NM_033284		6939642	+1	tier1	-	no_errors	ENST00000346432	ensembl	human	known	74_37	silent	38.61	62	39	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78567195	78567195	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr11:78567195G>C	ENST00000278550.7	-	11	1746	c.1284C>G	c.(1282-1284)gaC>gaG	p.D428E		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	428					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CTATGAAACTGTCCTCTGGAA	0.478																																																	0													70.0	63.0	65.0					11																	78567195		692	1591	2283	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.1284C>G	11.37:g.78567195G>C	ENSP00000278550:p.Asp428Glu		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D428E	ENST00000278550.7	37	c.1284	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591680	0.46214	.	.	ENSG00000149256	ENST00000278550	T	0.21361	2.01	5.04	4.09	0.47781	.	0.053257	0.64402	D	0.000001	T	0.17323	0.0416	L	0.43152	1.355	0.42205	D	0.99178	B	0.06786	0.001	B	0.08055	0.003	T	0.03829	-1.1000	9	.	.	.	.	11.7283	0.51722	0.0:0.1389:0.733:0.1281	.	428	Q6N022	TEN4_HUMAN	E	428	ENSP00000278550:D428E	.	D	-	3	2	ODZ4	78244843	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.769000	0.68865	2.619000	0.88677	0.561000	0.74099	GAC	TENM4	-	NULL	ENSG00000149256		0.478	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	15	0	G			78567195	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	C
TFPI2	7980	genome.wustl.edu	37	7	93519535	93519535	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:93519535C>A	ENST00000222543.5	-	2	497	c.185G>T	c.(184-186)cGc>cTc	p.R62L	AC002076.10_ENST00000435257.1_RNA|GNGT1_ENST00000455502.1_Intron|TFPI2_ENST00000545378.1_Missense_Mutation_p.R62L	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	62	BPTI/Kunitz inhibitor 1. {ECO:0000255|PROSITE-ProRule:PRU00031}.				blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CAGGAACTGGCGGCAGCTCTG	0.582																																																	0													36.0	39.0	38.0					7																	93519535		2203	4300	6503	SO:0001583	missense	0			L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.185G>T	7.37:g.93519535C>A	ENSP00000222543:p.Arg62Leu		Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.R62L	ENST00000222543.5	37	c.185	CCDS5632.1	7	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924317	0.52653	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.57752	0.38;0.38	5.07	-8.49	0.00931	Proteinase inhibitor I2, Kunitz metazoa (6);	1.160040	0.06013	N	0.649780	T	0.30634	0.0771	N	0.20766	0.605	0.22142	N	0.99933	B;B;B;B	0.24576	0.033;0.002;0.106;0.002	B;B;B;B	0.26416	0.069;0.009;0.028;0.009	T	0.24119	-1.0169	10	0.34782	T	0.22	.	6.6248	0.22823	0.457:0.1112:0.0:0.4318	.	33;51;62;62	A4ZVU7;Q8NAK6;F5H3J8;P48307	.;.;.;TFPI2_HUMAN	L	62	ENSP00000222543:R62L;ENSP00000438861:R62L	ENSP00000222543:R62L	R	-	2	0	TFPI2	93357471	0.001000	0.12720	0.000000	0.03702	0.318000	0.28184	-0.410000	0.07151	-1.669000	0.01470	0.313000	0.20887	CGC	TFPI2	-	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000105825		0.582	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI2	HGNC	protein_coding	OTTHUMT00000254720.2	-	0.00	58	0	C	NM_006528		93519535	-1	tier1	-	no_errors	ENST00000222543	ensembl	human	known	74_37	missense	22.73	68	20	SNP	0.000	A
TGFBR2	7048	genome.wustl.edu	37	3	30732996	30732996	+	Missense_Mutation	SNP	C	C	T	rs104893809		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:30732996C>T	ENST00000295754.5	+	7	1991	c.1609C>T	c.(1609-1611)Cgc>Tgc	p.R537C	TGFBR2_ENST00000359013.4_Missense_Mutation_p.R562C	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	537	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		R -> C (in LDS2; has a negative effect on TGF-beta signaling; dbSNP:rs28934869). {ECO:0000269|PubMed:15235604}.		activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)	p.R537C(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						TGTGGCAGAACGCTTCAGTGA	0.577																																																	1	Substitution - Missense(1)	pancreas(1)	GRCh37	CM042122|CM064325	TGFBR2	M	rs104893809						83.0	80.0	81.0					3																	30732996		2203	4300	6503	SO:0001583	missense	0				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.1609C>T	3.37:g.30732996C>T	ENSP00000295754:p.Arg537Cys		B4DTV5|Q15580|Q6DKT6|Q99474	Missense_Mutation	SNP	pirsf_Transform_growth_fac-b_typ-2,pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_TGFB_receptor,pfscan_Prot_kinase_dom	p.R562C	ENST00000295754.5	37	c.1684	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	C	27.9	4.869682	0.91587	.	.	ENSG00000163513	ENST00000295754;ENST00000359013;ENST00000439925	D;D	0.93604	-3.25;-3.25	5.91	5.91	0.95273	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96972	0.9011	M	0.87038	2.855	0.80722	A	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97216	0.9874	9	0.87932	D	0	.	15.0515	0.71877	0.142:0.858:0.0:0.0	rs28934869	537;562	P37173;D2JYI1	TGFR2_HUMAN;.	C	537;562;367	ENSP00000295754:R537C;ENSP00000351905:R562C	ENSP00000295754:R537C	R	+	1	0	TGFBR2	30708000	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	5.930000	0.70104	2.803000	0.96430	0.650000	0.86243	CGC	TGFBR2	-	pirsf_Transform_growth_fac-b_typ-2,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000163513		0.577	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2		0.00	35	0	C			30732996	+1			no_errors	ENST00000359013	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
TGM4	7047	genome.wustl.edu	37	3	44948486	44948486	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:44948486G>T	ENST00000296125.4	+	10	1189	c.1121G>T	c.(1120-1122)gGt>gTt	p.G374V		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	374					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	ATCCGCAAAGGTGACATCTTT	0.552																																																	0													115.0	104.0	107.0					3																	44948486		2203	4300	6503	SO:0001583	missense	0			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.1121G>T	3.37:g.44948486G>T	ENSP00000296125:p.Gly374Val		Q16707|Q96QN4	Missense_Mutation	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G374V	ENST00000296125.4	37	c.1121	CCDS2723.1	3	.	.	.	.	.	.	.	.	.	.	G	20.1	3.932248	0.73442	.	.	ENSG00000163810	ENST00000296125	T	0.23754	1.89	2.03	2.03	0.26663	.	0.000000	0.44483	U	0.000444	T	0.56307	0.1976	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68017	-0.5520	10	0.87932	D	0	.	12.655	0.56782	0.0:0.0:1.0:0.0	.	374	P49221	TGM4_HUMAN	V	374	ENSP00000296125:G374V	ENSP00000296125:G374V	G	+	2	0	TGM4	44923490	1.000000	0.71417	0.003000	0.11579	0.519000	0.34347	7.837000	0.86796	1.039000	0.40074	0.460000	0.39030	GGT	TGM4	-	NULL	ENSG00000163810		0.552	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	HGNC	protein_coding	OTTHUMT00000256755.2	-	0.00	88	0	G	NM_003241		44948486	+1	tier1	-	no_errors	ENST00000296125	ensembl	human	known	74_37	missense	7.69	60	5	SNP	0.934	T
TMEM254	80195	genome.wustl.edu	37	10	81841955	81841955	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr10:81841955G>T	ENST00000372281.3	+	3	276	c.246G>T	c.(244-246)ttG>ttT	p.L82F	TMEM254_ENST00000372275.1_Missense_Mutation_p.L82F|TMEM254_ENST00000467529.1_3'UTR|TMEM254_ENST00000372277.3_Missense_Mutation_p.L82F|TMEM254_ENST00000372274.1_Missense_Mutation_p.L82F	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	82						integral component of membrane (GO:0016021)											CCATAGTATTGTGCAAGTAAG	0.373																																																	0													229.0	203.0	212.0					10																	81841955		2203	4300	6503	SO:0001583	missense	0			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.246G>T	10.37:g.81841955G>T	ENSP00000361355:p.Leu82Phe		D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	NULL	p.L82F	ENST00000372281.3	37	c.246	CCDS7363.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	17.00|17.00|17.00	3.276308|3.276308|3.276308	0.59649|0.59649|0.59649	.|.|.	.|.|.	ENSG00000133678|ENSG00000133678|ENSG00000133678	ENST00000372273|ENST00000372281;ENST00000372277;ENST00000372275;ENST00000372274|ENST00000450179	.|.|.	.|.|.	.|.|.	5.39|5.39|5.39	0.187|0.187|0.187	0.15109|0.15109|0.15109	.|.|.	.|0.063724|.	.|0.64402|.	.|D|.	.|0.000012|.	T|T|T	0.71434|0.71434|0.71434	0.3339|0.3339|0.3339	M|M|M	0.84326|0.84326|0.84326	2.69|2.69|2.69	0.38066|0.38066|0.38066	D|D|D	0.936211|0.936211|0.936211	.|D;D|.	.|0.89917|.	.|1.0;1.0|.	.|D;D|.	.|0.91635|.	.|0.999;0.999|.	T|T|T	0.72080|0.72080|0.72080	-0.4398|-0.4398|-0.4398	5|8|5	.|.|.	.|.|.	.|.|.	-19.6005|-19.6005|-19.6005	9.157|9.157|9.157	0.36998|0.36998|0.36998	0.3914:0.0:0.6086:0.0|0.3914:0.0:0.6086:0.0|0.3914:0.0:0.6086:0.0	.|.|.	.|106;82|.	.|E7ERB9;Q8TBM7|.	.|.;CJ057_HUMAN|.	F|F|L	103|82|60	.|.|.	.|.|.	C|L|V	+|+|+	2|3|1	0|2|0	C10orf57|C10orf57|C10orf57	81831935|81831935|81831935	0.981000|0.981000|0.981000	0.34729|0.34729|0.34729	0.987000|0.987000|0.987000	0.45799|0.45799|0.45799	0.982000|0.982000|0.982000	0.71751|0.71751|0.71751	0.005000|0.005000|0.005000	0.13129|0.13129|0.13129	0.071000|0.071000|0.071000	0.16664|0.16664|0.16664	0.563000|0.563000|0.563000	0.77884|0.77884|0.77884	TGT|TTG|GTG	TMEM254	-	NULL	ENSG00000133678		0.373	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	HGNC	protein_coding	OTTHUMT00000049030.1	-	0.00	129	0	G	NM_025125		81841955	+1	tier1	-	no_errors	ENST00000372281	ensembl	human	known	74_37	missense	6.45	87	6	SNP	0.968	T
TMEM60	85025	genome.wustl.edu	37	7	77423460	77423460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:77423460delT	ENST00000257663.3	-	2	607	c.231delA	c.(229-231)aaafs	p.K77fs		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTACCAGGCTTTTTTTTTAA	0.408																																																	0													142.0	141.0	141.0					7																	77423460		2203	4300	6503	SO:0001589	frameshift_variant	0			AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.231delA	7.37:g.77423460delT	ENSP00000257663:p.Lys77fs		A4D1C3|Q86UM0	Frame_Shift_Del	DEL	pfam_TM_Fragile-X-F-assoc	p.A78fs	ENST00000257663.3	37	c.231	CCDS5593.1	7																																																																																			TMEM60	-	NULL	ENSG00000135211		0.408	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM60	HGNC	protein_coding	OTTHUMT00000253185.2		0.00	89	0	T	NM_032936		77423460	-1			no_errors	ENST00000257663	ensembl	human	known	74_37	frame_shift_del	6.09	108	7	DEL	0.998	0
TMEM70	54968	genome.wustl.edu	37	8	74891072	74891072	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr8:74891072G>T	ENST00000312184.5	+	2	365	c.292G>T	c.(292-294)Ggc>Tgc	p.G98C	Y_RNA_ENST00000365350.1_RNA|TMEM70_ENST00000517439.1_Missense_Mutation_p.G98C	NM_001040613.2|NM_017866.5	NP_001035703.1|NP_060336.3	Q9BUB7	TMM70_HUMAN	transmembrane protein 70	98					mitochondrial proton-transporting ATP synthase complex assembly (GO:0033615)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)				breast(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	8	Breast(64;0.0311)		Epithelial(68;0.0186)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0564)			AATTTATACTGGCAATATGGC	0.358																																																	0													152.0	165.0	161.0					8																	74891072		2203	4300	6503	SO:0001583	missense	0			BC002748	CCDS6215.1, CCDS47876.1	8q21.11	2013-05-23				ENSG00000175606			26050	protein-coding gene	gene with protein product		612418				21945727, 22986587	Standard	NM_017866		Approved	FLJ20533	uc003yab.3	Q9BUB7		ENST00000312184.5:c.292G>T	8.37:g.74891072G>T	ENSP00000312599:p.Gly98Cys		E9PDY9|Q9NWY5	Missense_Mutation	SNP	pfam_DUF1301_TMEM70	p.G98C	ENST00000312184.5	37	c.292	CCDS6215.1	8	.	.	.	.	.	.	.	.	.	.	G	22.9	4.346732	0.82022	.	.	ENSG00000175606	ENST00000517439;ENST00000312184	T;T	0.72942	-0.7;-0.44	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000001	T	0.78259	0.4255	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.989	T	0.80979	-0.1140	10	0.87932	D	0	-11.8337	18.2223	0.89905	0.0:0.0:1.0:0.0	.	98;98	E9PDY9;Q9BUB7	.;TMM70_HUMAN	C	98	ENSP00000429467:G98C;ENSP00000312599:G98C	ENSP00000312599:G98C	G	+	1	0	TMEM70	75053626	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	8.325000	0.90007	2.603000	0.88011	0.651000	0.88453	GGC	TMEM70	-	NULL	ENSG00000175606		0.358	TMEM70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM70	HGNC	protein_coding	OTTHUMT00000379028.1		0.00	71	0	G	NM_017866		74891072	+1			no_errors	ENST00000312184	ensembl	human	known	74_37	missense	6.33	74	5	SNP	1.000	T
TRPC7	57113	genome.wustl.edu	37	5	135610523	135610523	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:135610523G>T	ENST00000513104.1	-	4	1248	c.966C>A	c.(964-966)ttC>ttA	p.F322L	TRPC7_ENST00000426057.2_Intron|TRPC7_ENST00000355180.3_Missense_Mutation_p.F261L	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	322					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GATGAGCAACGAACTGTaaaa	0.413																																																	0													44.0	40.0	42.0					5																	135610523		1914	4139	6053	SO:0001583	missense	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.966C>A	5.37:g.135610523G>T	ENSP00000426070:p.Phe322Leu		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.F322L	ENST00000513104.1	37	c.966	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.35|17.35	3.368446|3.368446	0.61513|0.61513	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000355180;ENST00000513104;ENST00000265193|ENST00000378459	T;T|.	0.72615|.	-0.67;-0.67|.	5.38|5.38	4.5|4.5	0.54988|0.54988	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78033|0.78033	0.4220|0.4220	M|M	0.90814|0.90814	3.15|3.15	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.997;0.999|.	D;D|.	0.72075|.	0.943;0.976|.	T|T	0.80683|0.80683	-0.1273|-0.1273	10|5	0.87932|.	D|.	0|.	-23.8548|-23.8548	8.9356|8.9356	0.35697|0.35697	0.2443:0.0:0.7557:0.0|0.2443:0.0:0.7557:0.0	.|.	261;322|.	F5H5U9;Q9HCX4|.	.;TRPC7_HUMAN|.	L|S	261;322;322|261	ENSP00000347312:F261L;ENSP00000426070:F322L|.	ENSP00000265193:F322L|.	F|R	-|-	3|1	2|0	TRPC7|TRPC7	135638422|135638422	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.718000|3.718000	0.54919|0.54919	2.813000|2.813000	0.96785|0.96785	0.655000|0.655000	0.94253|0.94253	TTC|CGT	TRPC7	-	tigrfam_TRP_channel	ENSG00000069018		0.413	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1		0.00	24	0	G	NM_020389		135610523	-1			no_errors	ENST00000513104	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
TSC22D2	9819	genome.wustl.edu	37	3	150127200	150127200	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:150127200G>T	ENST00000361875.3	+	1	1079	c.63G>T	c.(61-63)caG>caT	p.Q21H	TSC22D2_ENST00000361136.2_Missense_Mutation_p.Q21H	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	21					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCACGGCCCAGGTGGCCACTA	0.617																																																	0													50.0	43.0	45.0					3																	150127200		2203	4300	6503	SO:0001583	missense	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.63G>T	3.37:g.150127200G>T	ENSP00000354543:p.Gln21His		D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.Q21H	ENST00000361875.3	37	c.63	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	g	17.27	3.346946	0.61183	.	.	ENSG00000196428	ENST00000361875;ENST00000361136	T;T	0.24538	1.85;1.85	4.55	4.55	0.56014	.	0.000000	0.49916	D	0.000131	T	0.43634	0.1256	L	0.39245	1.2	0.40457	D	0.980204	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.47368	-0.9123	10	0.87932	D	0	.	16.9644	0.86281	0.0:0.0:1.0:0.0	.	21;21	O75157-2;O75157	.;T22D2_HUMAN	H	21	ENSP00000354543:Q21H;ENSP00000354893:Q21H	ENSP00000354893:Q21H	Q	+	3	2	TSC22D2	151609890	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.019000	0.93662	2.092000	0.63282	0.645000	0.84053	CAG	TSC22D2	-	NULL	ENSG00000196428		0.617	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2		0.00	35	0	G	NM_014779		150127200	+1			no_errors	ENST00000361875	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
TSPAN17	26262	genome.wustl.edu	37	5	176082007	176082007	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr5:176082007G>A	ENST00000503045.1	+	5	554	c.499G>A	c.(499-501)Gtc>Atc	p.V167I	TSPAN17_ENST00000405525.2_Missense_Mutation_p.V190I|TSPAN17_ENST00000515708.1_Missense_Mutation_p.V190I|TSPAN17_ENST00000310032.8_Missense_Mutation_p.V190I|TSPAN17_ENST00000298564.10_Intron|TSPAN17_ENST00000508164.1_Missense_Mutation_p.V190I			Q96FV3	TSN17_HUMAN	tetraspanin 17	190					establishment of protein localization to organelle (GO:0072594)|protein ubiquitination (GO:0016567)	integral component of membrane (GO:0016021)|ubiquitin ligase complex (GO:0000151)	enzyme binding (GO:0019899)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	13	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCTGCTGCGTCAGGGACCC	0.637																																																	0													21.0	22.0	22.0					5																	176082007		2202	4299	6501	SO:0001583	missense	0			AF174603	CCDS34298.1, CCDS47346.1, CCDS47346.2, CCDS54952.1	5q35.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000048140	ENSG00000048140		"""Tetraspanins"""	13594	protein-coding gene	gene with protein product			"""F-box only protein 23, transmembrane 4 superfamily member 17"""	FBXO23, TM4SF17		10531035, 10531037	Standard	NM_012171		Approved	FBX23	uc003met.3	Q96FV3	OTTHUMG00000163230	ENST00000503045.1:c.499G>A	5.37:g.176082007G>A	ENSP00000425212:p.Val167Ile		Q6NXF7|Q96S98|Q9UKB9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V190I	ENST00000503045.1	37	c.568		5	.	.	.	.	.	.	.	.	.	.	G	7.972	0.749198	0.15710	.	.	ENSG00000048140	ENST00000310032;ENST00000405525;ENST00000508164;ENST00000504168;ENST00000503045;ENST00000515708	D;D;D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19;-2.19;-2.19	5.23	3.39	0.38822	Tetraspanin, EC2 domain (1);	0.000000	0.85682	D	0.000000	T	0.68732	0.3033	N	0.10664	0.02	0.37021	D	0.896196	B;B;B;B	0.19200	0.005;0.032;0.034;0.032	B;B;B;B	0.16722	0.004;0.016;0.009;0.016	T	0.61158	-0.7119	10	0.02654	T	1	-19.2806	9.2228	0.37386	0.0849:0.1445:0.7706:0.0	.	190;190;190;190	Q96FV3-3;C9J7R4;Q96FV3-4;Q96FV3	.;.;.;TSN17_HUMAN	I	190;190;190;178;167;190	ENSP00000309036:V190I;ENSP00000385665:V190I;ENSP00000422053:V190I;ENSP00000423957:V178I;ENSP00000425212:V167I;ENSP00000426650:V190I	ENSP00000309036:V190I	V	+	1	0	TSPAN17	176014613	0.885000	0.30320	0.273000	0.24645	0.946000	0.59487	2.014000	0.40951	0.542000	0.28846	-0.467000	0.05162	GTC	TSPAN17	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000048140		0.637	TSPAN17-008	NOVEL	basic|exp_conf	protein_coding	TSPAN17	HGNC	protein_coding	OTTHUMT00000372215.1		0.00	82	0	G			176082007	+1			no_errors	ENST00000310032	ensembl	human	known	74_37	missense	6.67	70	5	SNP	0.993	A
TTC21A	199223	genome.wustl.edu	37	3	39178769	39178769	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:39178769C>A	ENST00000431162.2	+	25	3496	c.3362C>A	c.(3361-3363)tCc>tAc	p.S1121Y	TTC21A_ENST00000493856.1_3'UTR|TTC21A_ENST00000301819.6_Missense_Mutation_p.S1122Y|TTC21A_ENST00000440121.1_Missense_Mutation_p.S1073Y			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	1121										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CATTCAGACTCCAGCCAGACC	0.602																																																	0													26.0	31.0	29.0					3																	39178769		2013	4179	6192	SO:0001583	missense	0			AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.3362C>A	3.37:g.39178769C>A	ENSP00000398211:p.Ser1121Tyr		A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S1122Y	ENST00000431162.2	37	c.3365	CCDS46800.1	3	.	.	.	.	.	.	.	.	.	.	C	7.763	0.705897	0.15172	.	.	ENSG00000168026	ENST00000301819;ENST00000424305;ENST00000431162;ENST00000440121	T;T;T	0.61627	0.09;0.09;0.21	4.27	-4.66	0.03329	.	4.738900	0.00447	N	0.000094	T	0.44519	0.1297	L	0.48642	1.525	0.09310	N	1	P;B;B	0.35242	0.492;0.184;0.116	B;B;B	0.33042	0.157;0.075;0.034	T	0.35699	-0.9778	10	0.62326	D	0.03	11.5699	1.3173	0.02110	0.1988:0.3829:0.1057:0.3127	.	1073;1122;1121	Q8NDW8-6;Q8NDW8-7;Q8NDW8	.;.;TT21A_HUMAN	Y	1122;1104;1121;1073	ENSP00000301819:S1122Y;ENSP00000398211:S1121Y;ENSP00000410882:S1073Y	ENSP00000301819:S1122Y	S	+	2	0	TTC21A	39153773	0.000000	0.05858	0.000000	0.03702	0.206000	0.24218	0.002000	0.13061	-0.699000	0.05077	0.205000	0.17691	TCC	TTC21A	-	NULL	ENSG00000168026		0.602	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	HGNC	protein_coding	OTTHUMT00000377829.1	-	0.00	74	0	C	NM_145755		39178769	+1	tier1	-	no_errors	ENST00000301819	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.000	A
TTC7B	145567	genome.wustl.edu	37	14	91077133	91077133	+	Missense_Mutation	SNP	C	C	T	rs558303116		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr14:91077133C>T	ENST00000328459.6	-	17	2040	c.1919G>A	c.(1918-1920)cGa>cAa	p.R640Q	TTC7B_ENST00000357056.2_Missense_Mutation_p.R640Q|TTC7B_ENST00000554654.1_5'UTR	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	640										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				ATTAAGCTGTCGTCTGTCAGC	0.493																																																	0													182.0	168.0	173.0					14																	91077133		2203	4300	6503	SO:0001583	missense	0			BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.1919G>A	14.37:g.91077133C>T	ENSP00000336127:p.Arg640Gln		Q86U24|Q86VT3	Missense_Mutation	SNP	pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R640Q	ENST00000328459.6	37	c.1919	CCDS32140.1	14	.	.	.	.	.	.	.	.	.	.	C	22.7	4.330388	0.81690	.	.	ENSG00000165914	ENST00000555768;ENST00000357056;ENST00000328459;ENST00000553972;ENST00000555894;ENST00000540938	T;T;T	0.63744	1.89;1.07;-0.06	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.73442	0.3587	L	0.41961	1.31	0.80722	D	1	D;B	0.76494	0.999;0.086	D;B	0.72625	0.978;0.012	T	0.65853	-0.6067	10	0.23302	T	0.38	-5.3336	20.3343	0.98733	0.0:1.0:0.0:0.0	.	640;640	Q86TV6;Q86TV6-2	TTC7B_HUMAN;.	Q	538;640;640;110;49;382	ENSP00000349564:R640Q;ENSP00000336127:R640Q;ENSP00000451440:R110Q	ENSP00000336127:R640Q	R	-	2	0	TTC7B	90146886	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.542000	0.82095	2.822000	0.97130	0.650000	0.86243	CGA	TTC7B	-	NULL	ENSG00000165914		0.493	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC7B	HGNC	protein_coding	OTTHUMT00000411364.2	-	0.00	54	0	C			91077133	-1	tier1	-	no_errors	ENST00000357056	ensembl	human	known	74_37	missense	32.73	36	18	SNP	1.000	T
TTLL10	254173	genome.wustl.edu	37	1	1114645	1114645	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:1114645G>A	ENST00000379290.1	+	4	223	c.50G>A	c.(49-51)cGg>cAg	p.R17Q	TTLL10-AS1_ENST00000379317.1_RNA|TTLL10_ENST00000379289.1_Missense_Mutation_p.R17Q|TTLL10_ENST00000379288.3_5'Flank			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10	17					cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		CCACCCACTCGGACCCGAGCC	0.682																																																	0													29.0	40.0	37.0					1																	1114645		692	1591	2283	SO:0001583	missense	0			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.50G>A	1.37:g.1114645G>A	ENSP00000368592:p.Arg17Gln		B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.R17Q	ENST00000379290.1	37	c.50	CCDS44036.1	1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780257	0.31502	.	.	ENSG00000162571	ENST00000379290;ENST00000379289	T;T	0.08282	3.11;3.11	3.94	2.04	0.26737	.	.	.	.	.	T	0.05135	0.0137	L	0.32530	0.975	0.09310	N	1	P	0.35628	0.513	B	0.17433	0.018	T	0.34875	-0.9811	9	0.54805	T	0.06	.	5.6775	0.17757	0.2432:0.0:0.7568:0.0	.	17	Q6ZVT0	TTL10_HUMAN	Q	17	ENSP00000368592:R17Q;ENSP00000368591:R17Q	ENSP00000368591:R17Q	R	+	2	0	TTLL10	1104508	0.003000	0.15002	0.006000	0.13384	0.021000	0.10359	0.286000	0.18902	1.022000	0.39626	0.306000	0.20318	CGG	TTLL10	-	NULL	ENSG00000162571		0.682	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10	HGNC	protein_coding	OTTHUMT00000002421.3	-	0.00	29	0	G	NM_153254		1114645	+1	tier1	-	no_errors	ENST00000379289	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.001	A
UNC80	285175	genome.wustl.edu	37	2	210640650	210640650	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr2:210640650G>T	ENST00000439458.1	+	3	259	c.179G>T	c.(178-180)gGc>gTc	p.G60V	UNC80_ENST00000272845.6_Missense_Mutation_p.G60V|UNC80_ENST00000478701.1_3'UTR	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	60					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AAGCTGCATGGCCTCTCTCCA	0.448																																																	0													137.0	131.0	133.0					2																	210640650		2203	4300	6503	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.179G>T	2.37:g.210640650G>T	ENSP00000391088:p.Gly60Val		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.G60V	ENST00000439458.1	37	c.179	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	28.1	4.887899	0.91814	.	.	ENSG00000144406	ENST00000439458;ENST00000281753;ENST00000272845	T;T	0.49432	0.78;0.79	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.69691	0.3139	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.71699	-0.4514	10	0.87932	D	0	.	18.7669	0.91876	0.0:0.0:1.0:0.0	.	60;60	Q8N2C7;Q8N2C7-3	UNC80_HUMAN;.	V	60	ENSP00000391088:G60V;ENSP00000272845:G60V	ENSP00000272845:G60V	G	+	2	0	UNC80	210348895	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.330000	0.96422	2.763000	0.94921	0.650000	0.86243	GGC	UNC80	-	NULL	ENSG00000144406		0.448	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding			0.00	32	0	G	NM_182587		210640650	+1			no_errors	ENST00000439458	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
USHBP1	83878	genome.wustl.edu	37	19	17373543	17373543	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:17373543C>T	ENST00000252597.3	-	4	633	c.460G>A	c.(460-462)Gaa>Aaa	p.E154K	USHBP1_ENST00000598570.1_5'UTR|USHBP1_ENST00000431146.2_Missense_Mutation_p.E90K	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						GCTCCCCCTTCGCTTGTGCCT	0.687																																																	0													61.0	60.0	60.0					19																	17373543		2203	4299	6502	SO:0001583	missense	0			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.460G>A	19.37:g.17373543C>T	ENSP00000252597:p.Glu154Lys			Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain	p.E154K	ENST00000252597.3	37	c.460	CCDS12353.1	19	.	.	.	.	.	.	.	.	.	.	C	9.702	1.154796	0.21371	.	.	ENSG00000130307	ENST00000252597;ENST00000431146;ENST00000324554	T;T	0.19806	2.12;2.12	3.85	-4.62	0.03370	.	1.562500	0.04263	N	0.340740	T	0.14442	0.0349	L	0.29908	0.895	0.09310	N	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.04013	0.001;0.0;0.0	T	0.36578	-0.9742	10	0.62326	D	0.03	-0.0481	6.1758	0.20442	0.0:0.3357:0.3861:0.2782	.	90;154;154	B4DUE8;Q8N8Y1;Q8N6Y0	.;.;USBP1_HUMAN	K	154;90;154	ENSP00000252597:E154K;ENSP00000407902:E90K	ENSP00000252597:E154K	E	-	1	0	USHBP1	17234543	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.009000	0.03660	-0.993000	0.03467	-1.595000	0.00837	GAA	USHBP1	-	NULL	ENSG00000130307		0.687	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USHBP1	HGNC	protein_coding	OTTHUMT00000463328.1	-	0.00	121	0	C	NM_031941		17373543	-1	tier1	-	no_errors	ENST00000252597	ensembl	human	known	74_37	missense	37.70	76	46	SNP	0.000	T
WASH6P	653440	genome.wustl.edu	37	X	155254025	155254025	+	RNA	DEL	C	C	-			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chrX:155254025delC	ENST00000461007.1	+	0	2941				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GTGCTTTCTGCCCACCCCCTG	0.682																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254025delC			A6NGF1|Q8N305	RNA	DEL	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			WASH6P	-	-	ENSG00000182484		0.682	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1		0.00	58	0	C	NG_008380		155254025	+1	tier1		no_errors	ENST00000461007	ensembl	human	known	74_37	rna	21.43	44	12	DEL	0.049	-
WBP11	51729	genome.wustl.edu	37	12	14940118	14940118	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr12:14940118C>T	ENST00000261167.2	-	12	2040	c.1807G>A	c.(1807-1809)Gat>Aat	p.D603N		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	603					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						ACAGCAGAATCATCCTCTGAC	0.478																																																	0													107.0	110.0	109.0					12																	14940118		2203	4298	6501	SO:0001583	missense	0			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1807G>A	12.37:g.14940118C>T	ENSP00000261167:p.Asp603Asn		Q96AY8	Missense_Mutation	SNP	pfam_WW_dom-bd_prot_11	p.D603N	ENST00000261167.2	37	c.1807	CCDS8666.1	12	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445592	0.84101	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	.	.	.	5.06	5.06	0.68205	.	0.253956	0.37437	N	0.002092	T	0.61949	0.2388	L	0.45581	1.43	0.41007	D	0.984974	D	0.59357	0.985	P	0.55508	0.777	T	0.55354	-0.8154	9	0.14252	T	0.57	-12.6577	16.0442	0.80707	0.0:1.0:0.0:0.0	.	603	Q9Y2W2	WBP11_HUMAN	N	603;569	.	ENSP00000261167:D603N	D	-	1	0	WBP11	14831385	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.180000	0.65048	2.666000	0.90696	0.650000	0.86243	GAT	WBP11	-	NULL	ENSG00000084463		0.478	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP11	HGNC	protein_coding	OTTHUMT00000400850.1		0.00	59	0	C	NM_016312		14940118	-1			no_errors	ENST00000261167	ensembl	human	known	74_37	missense	5.33	71	4	SNP	1.000	T
XRN1	54464	genome.wustl.edu	37	3	142037736	142037736	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:142037736C>T	ENST00000264951.4	-	38	4528	c.4411G>A	c.(4411-4413)Gtt>Att	p.V1471I	XRN1_ENST00000392981.2_Missense_Mutation_p.V1472I	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	1471					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						ACTTGGCAAACGGTCATTGTC	0.348																																																	0													78.0	76.0	77.0					3																	142037736		2203	4300	6503	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.4411G>A	3.37:g.142037736C>T	ENSP00000264951:p.Val1471Ile		Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.V1471I	ENST00000264951.4	37	c.4411	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	C	10.91	1.485590	0.26686	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.36520	1.25;1.29	4.85	2.04	0.26737	.	0.238496	0.33854	N	0.004489	T	0.15912	0.0383	N	0.12182	0.205	0.80722	D	1	B;B	0.33238	0.403;0.282	B;B	0.19148	0.024;0.011	T	0.08827	-1.0703	10	0.27082	T	0.32	-15.0349	10.3607	0.43991	0.0:0.7871:0.0:0.2129	.	1472;1471	Q8IZH2-2;Q8IZH2	.;XRN1_HUMAN	I	1471;1472	ENSP00000264951:V1471I;ENSP00000376707:V1472I	ENSP00000264951:V1471I	V	-	1	0	XRN1	143520426	0.963000	0.33076	1.000000	0.80357	0.764000	0.43329	0.727000	0.25999	1.021000	0.39600	-0.244000	0.11960	GTT	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.348	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	-	0.00	72	0	C	NM_019001		142037736	-1	tier1	-	no_errors	ENST00000264951	ensembl	human	known	74_37	missense	14.67	64	11	SNP	0.988	T
ZC3H18	124245	genome.wustl.edu	37	16	88694106	88694106	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr16:88694106G>A	ENST00000301011.5	+	14	2385	c.2185G>A	c.(2185-2187)Gag>Aag	p.E729K	ZC3H18_ENST00000452588.2_Missense_Mutation_p.E753K	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	729	Ser-rich.					nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CGTGGACTCGGAGGACATGTA	0.632																																					Ovarian(121;375 2276 20373 38669)												0													104.0	70.0	81.0					16																	88694106		2198	4300	6498	SO:0001583	missense	0			BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.2185G>A	16.37:g.88694106G>A	ENSP00000301011:p.Glu729Lys		Q96DG4|Q96MP7	Missense_Mutation	SNP	smart_Znf_CCCH	p.E729K	ENST00000301011.5	37	c.2185	CCDS10967.1	16	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368562	0.82463	.	.	ENSG00000158545	ENST00000301011;ENST00000452588	T;T	0.35605	1.3;1.4	4.69	4.69	0.59074	.	0.485666	0.23684	N	0.045589	T	0.35740	0.0942	L	0.36672	1.1	0.49798	D	0.999829	B;B	0.29136	0.234;0.234	B;B	0.35240	0.198;0.198	T	0.17837	-1.0356	10	0.39692	T	0.17	-8.7441	17.9725	0.89117	0.0:0.0:1.0:0.0	.	753;729	E7ERS3;Q86VM9	.;ZCH18_HUMAN	K	729;753	ENSP00000301011:E729K;ENSP00000416951:E753K	ENSP00000301011:E729K	E	+	1	0	ZC3H18	87221607	1.000000	0.71417	0.250000	0.24296	0.981000	0.71138	9.436000	0.97532	2.322000	0.78497	0.491000	0.48974	GAG	ZC3H18	-	NULL	ENSG00000158545		0.632	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZC3H18	HGNC	protein_coding	OTTHUMT00000269168.1		0.00	31	0	G	NM_144604		88694106	+1			no_errors	ENST00000301011	ensembl	human	known	74_37	missense	7.69	35	3	SNP	0.996	A
ZIC4	84107	genome.wustl.edu	37	3	147105846	147105846	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr3:147105846C>T	ENST00000383075.3	-	0	2317				ZIC4_ENST00000525172.2_3'UTR|ZIC4_ENST00000472749.2_5'UTR|ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000425731.3_3'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GTGTCCCCTGCGCCAAAGCCT	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*800G>A	3.37:g.147105846C>T			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.512	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	18	0	C			147105846	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	29.63	19	8	SNP	0.000	T
ZMYM6	9204	genome.wustl.edu	37	1	35496350	35496350	+	Intron	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:35496350A>G	ENST00000357182.4	-	2	154				ZMYM6_ENST00000317538.5_Intron|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000487874.1_Intron|ZMYM6_ENST00000373333.1_Intron	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTTTTCTTCAGGCTTATCTA	0.383																																																	0																																										SO:0001627	intron_variant	0			AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.74-36T>C	1.37:g.35496350A>G			B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	RNA	SNP	-	NULL	ENST00000357182.4	37	NULL	CCDS387.2	1																																																																																			ZMYM6	-	-	ENSG00000163867		0.383	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM6	HGNC	protein_coding	OTTHUMT00000011999.1	-	0.00	45	0	A	NM_007167		35496350	-1	tier1	-	no_errors	ENST00000493328	ensembl	human	known	74_37	rna	20.59	27	7	SNP	0.003	G
ZNF677	342926	genome.wustl.edu	37	19	53747130	53747130	+	Silent	SNP	A	A	G			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr19:53747130A>G	ENST00000598513.1	-	4	186	c.36T>C	c.(34-36)gaT>gaC	p.D12D	ZNF677_ENST00000333952.4_Silent_p.D12D|ZNF677_ENST00000598806.1_Silent_p.D12D|CTD-2245F17.6_ENST00000596041.1_RNA|ZNF677_ENST00000599012.1_Silent_p.D12D|ZNF677_ENST00000594681.1_Silent_p.D12D|ZNF677_ENST00000601828.1_Silent_p.D12D|ZNF677_ENST00000601413.1_Silent_p.D12D	NM_182609.2	NP_872415.1	Q86XU0	ZN677_HUMAN	zinc finger protein 677	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(13)|lung(6)|ovary(1)|pancreas(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(134;0.00352)		CTATGGCCACATCCTTGAATG	0.453																																																	0													87.0	82.0	83.0					19																	53747130		2203	4300	6503	SO:0001819	synonymous_variant	0			BC050038	CCDS12861.1	19q13.42	2013-01-08				ENSG00000197928		"""Zinc fingers, C2H2-type"", ""-"""	28730	protein-coding gene	gene with protein product	"""hypothetical protein MGC48625"""					12477932	Standard	NM_182609		Approved	MGC48625	uc002qbg.1	Q86XU0		ENST00000598513.1:c.36T>C	19.37:g.53747130A>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D12	ENST00000598513.1	37	c.36	CCDS12861.1	19																																																																																			ZNF677	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197928		0.453	ZNF677-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF677	HGNC	protein_coding	OTTHUMT00000464189.1	-	0.00	63	0	A	NM_182609		53747130	-1	tier1	-	no_errors	ENST00000333952	ensembl	human	known	74_37	silent	19.23	84	20	SNP	0.994	G
ZNF815P	401303	genome.wustl.edu	37	7	5886611	5886611	+	RNA	SNP	C	C	G	rs308084		TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr7:5886611C>G	ENST00000421890.1	+	0	1021							A8K554	ZN815_HUMAN	zinc finger protein 815, pseudogene																		TGATGTGTAACCTGGACTTCA	0.488																																																	0																																												0			AK096288		7p22.1	2012-10-05	2012-04-20	2012-04-20	ENSG00000235944	ENSG00000235944			22029	pseudogene	pseudogene			"""zinc finger protein 815"""	ZNF815			Standard	NR_023382		Approved	FLJ38969	uc003spc.2	A8K554	OTTHUMG00000155501		7.37:g.5886611C>G				RNA	SNP	-	NULL	ENST00000421890.1	37	NULL		7																																																																																			ZNF815P	-	-	ENSG00000235944		0.488	ZNF815P-002	KNOWN	basic	processed_transcript	ZNF815P	HGNC	pseudogene	OTTHUMT00000340385.1		0.00	26	0	C			5886611	+1			no_errors	ENST00000421890	ensembl	human	known	74_37	rna	11.63	38	5	SNP	0.000	G
ZSWIM5	57643	genome.wustl.edu	37	1	45553566	45553566	+	Silent	SNP	G	G	A			TCGA-L5-A4OO-01A-11D-A27G-09	TCGA-L5-A4OO-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5b1ad04c-dea2-4b4e-a5ec-40572126c885	954881bf-dc65-418e-8862-1d327c701757	g.chr1:45553566G>A	ENST00000359600.5	-	2	1144	c.939C>T	c.(937-939)atC>atT	p.I313I	ZSWIM5_ENST00000464588.1_5'Flank	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	313						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TCACTTGGTTGATTTCTGAGT	0.368																																																	0													125.0	118.0	120.0					1																	45553566		1863	4095	5958	SO:0001819	synonymous_variant	0			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.939C>T	1.37:g.45553566G>A			Q5SXQ9	Silent	SNP	pfscan_Znf_SWIM	p.I313	ENST00000359600.5	37	c.939	CCDS41319.1	1																																																																																			ZSWIM5	-	NULL	ENSG00000162415		0.368	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	HGNC	protein_coding	OTTHUMT00000024823.2	-	0.00	66	0	G	XM_046581		45553566	-1	tier1	-	no_errors	ENST00000359600	ensembl	human	known	74_37	silent	21.92	57	16	SNP	1.000	A
