#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA12	26154	genome.wustl.edu	37	2	215865498	215865498	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:215865498G>T	ENST00000272895.7	-	22	3329	c.3110C>A	c.(3109-3111)aCt>aAt	p.T1037N	ABCA12_ENST00000389661.4_Missense_Mutation_p.T719N	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1037					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTTCCTTCCAGTTTGCAATTC	0.423																																					Ovarian(66;664 1488 5121 34295)												0													126.0	131.0	129.0					2																	215865498		2203	4300	6503	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.3110C>A	2.37:g.215865498G>T	ENSP00000272895:p.Thr1037Asn		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T1037N	ENST00000272895.7	37	c.3110	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716503	0.68844	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.95756	-3.8;-3.8	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000001	D	0.97854	0.9295	M	0.80746	2.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.989;0.996	D	0.98154	1.0443	10	0.72032	D	0.01	.	19.9082	0.97015	0.0:0.0:1.0:0.0	.	1037;719	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	1037;719	ENSP00000272895:T1037N;ENSP00000374312:T719N	ENSP00000272895:T1037N	T	-	2	0	ABCA12	215573743	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.488000	0.73637	2.705000	0.92388	0.555000	0.69702	ACT	ABCA12	-	NULL	ENSG00000144452		0.423	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1		0.00	32	0	G	NM_173076		215865498	-1			no_errors	ENST00000272895	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
ABCB1	5243	genome.wustl.edu	37	7	87150134	87150134	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:87150134T>G	ENST00000265724.3	-	23	3161	c.2744A>C	c.(2743-2745)aAg>aCg	p.K915T	ABCB1_ENST00000543898.1_Missense_Mutation_p.K851T|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	915	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	ATGTTCAAACTTCTGCTCCTG	0.413																																																	0													132.0	122.0	126.0					7																	87150134		2203	4300	6503	SO:0001583	missense	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2744A>C	7.37:g.87150134T>G	ENSP00000265724:p.Lys915Thr		A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.K915T	ENST00000265724.3	37	c.2744	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	T	10.83	1.460035	0.26248	.	.	ENSG00000085563	ENST00000543174;ENST00000265724;ENST00000543898	D;D	0.90069	-2.61;-2.61	5.28	4.13	0.48395	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.045379	0.85682	D	0.000000	D	0.88396	0.6425	L	0.35593	1.075	0.51012	D	0.999907	B;D	0.53885	0.003;0.963	B;D	0.75020	0.077;0.985	D	0.83935	0.0308	10	0.24483	T	0.36	-16.6982	5.1519	0.15015	0.1329:0.1469:0.0:0.7202	.	851;915	B5AK60;P08183	.;MDR1_HUMAN	T	696;915;851	ENSP00000265724:K915T;ENSP00000444095:K851T	ENSP00000265724:K915T	K	-	2	0	ABCB1	86988070	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.222000	0.32515	0.849000	0.35215	0.533000	0.62120	AAG	ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000085563		0.413	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	-	0.00	45	0	T	NM_000927		87150134	-1	tier1	-	no_errors	ENST00000265724	ensembl	human	known	74_37	missense	15.62	54	10	SNP	1.000	G
ACCSL	390110	genome.wustl.edu	37	11	44074968	44074968	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:44074968C>T	ENST00000378832.1	+	8	1017	c.961C>T	c.(961-963)Cga>Tga	p.R321*		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	321					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GAAAAAGGTCCGAGGCCTTGT	0.433																																																	0													106.0	99.0	101.0					11																	44074968		1842	4085	5927	SO:0001587	stop_gained	0				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.961C>T	11.37:g.44074968C>T	ENSP00000368109:p.Arg321*			Nonsense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R321*	ENST00000378832.1	37	c.961	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	C	16.05	3.012959	0.54468	.	.	ENSG00000205126	ENST00000378832	.	.	.	4.45	0.668	0.17912	.	0.408973	0.27677	N	0.018317	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-0.7774	11.1125	0.48241	0.5148:0.4852:0.0:0.0	.	.	.	.	X	321	.	ENSP00000368109:R321X	R	+	1	2	ACCSL	44031544	1.000000	0.71417	0.152000	0.22495	0.001000	0.01503	2.164000	0.42387	0.012000	0.14892	-0.262000	0.10625	CGA	ACCSL	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000205126		0.433	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	-	0.00	37	0	C	NM_001031854		44074968	+1	tier1	-	no_errors	ENST00000378832	ensembl	human	known	74_37	nonsense	25.40	46	16	SNP	0.943	T
ADAM32	203102	genome.wustl.edu	37	8	39018479	39018479	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:39018479A>C	ENST00000379907.4	+	7	716	c.589A>C	c.(589-591)Act>Cct	p.T197P	ADAM32_ENST00000519315.1_Missense_Mutation_p.T197P|ADAM32_ENST00000437682.2_Missense_Mutation_p.T204P	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	197	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.					integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			GGTGGACAAAACTTTGGTATG	0.318																																																	0													154.0	131.0	138.0					8																	39018479		1830	4079	5909	SO:0001583	missense	0			BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.589A>C	8.37:g.39018479A>C	ENSP00000369238:p.Thr197Pro		Q8TC42	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.T197P	ENST00000379907.4	37	c.589	CCDS47846.1	8	.	.	.	.	.	.	.	.	.	.	A	7.422	0.636862	0.14386	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907;ENST00000399826	T;T;T	0.63744	-0.06;-0.06;2.95	5.6	-1.43	0.08884	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.969230	0.03547	N	0.224847	T	0.54159	0.1841	L	0.39898	1.24	0.09310	N	0.999999	B;B;B	0.26258	0.145;0.087;0.083	B;B;B	0.38156	0.266;0.18;0.18	T	0.35475	-0.9787	9	.	.	.	.	1.3312	0.02135	0.3622:0.1666:0.3425:0.1286	.	204;197;197	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	P	204;197;197;198	ENSP00000405978:T204P;ENSP00000429422:T197P;ENSP00000369238:T197P	.	T	+	1	0	ADAM32	39137636	0.178000	0.23122	0.418000	0.26571	0.301000	0.27625	-0.002000	0.12924	-0.316000	0.08690	-0.859000	0.03014	ACT	ADAM32	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000197140		0.318	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM32	HGNC	protein_coding	OTTHUMT00000377089.1	-	0.00	136	0	A	NM_145004		39018479	+1	tier1	-	no_errors	ENST00000379907	ensembl	human	known	74_37	missense	28.40	121	48	SNP	0.487	C
ADAM2	2515	genome.wustl.edu	37	8	39695677	39695677	+	Missense_Mutation	SNP	C	C	T	rs34800519	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:39695677C>T	ENST00000265708.4	-	1	131	c.28G>A	c.(28-30)Ggg>Agg	p.G10R	ADAM2_ENST00000523181.1_5'UTR|ADAM2_ENST00000379853.2_Missense_Mutation_p.G10R|ADAM2_ENST00000521880.1_Missense_Mutation_p.G10R|ADAM2_ENST00000347580.4_Missense_Mutation_p.G10R	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	10			G -> W (in dbSNP:rs34800519).		adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CCGCCGAGCCCGCTGAGCAGA	0.572																																																	0													80.0	80.0	80.0					8																	39695677		2203	4300	6503	SO:0001583	missense	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.28G>A	8.37:g.39695677C>T	ENSP00000265708:p.Gly10Arg		P78326|Q9UQQ8	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G10R	ENST00000265708.4	37	c.28	CCDS34884.1	8	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142789	0.57044	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	T;T;T;T	0.02121	5.07;4.44;5.31;5.27	3.26	3.26	0.37387	.	.	.	.	.	T	0.10078	0.0247	M	0.71581	2.175	0.18873	N	0.999985	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	P;D;D;D	0.77557	0.808;0.99;0.936;0.935	T	0.04976	-1.0914	8	.	.	.	.	10.2854	0.43564	0.0:1.0:0.0:0.0	.	10;10;10;10	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	R	10	ENSP00000343854:G10R;ENSP00000369182:G10R;ENSP00000265708:G10R;ENSP00000429352:G10R	.	G	-	1	0	ADAM2	39814834	0.048000	0.20356	0.275000	0.24674	0.128000	0.20619	1.104000	0.31074	2.114000	0.64651	0.460000	0.39030	GGG	ADAM2	-	NULL	ENSG00000104755		0.572	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	-	0.00	61	0	C	NM_001464		39695677	-1	tier1	-	no_errors	ENST00000265708	ensembl	human	known	74_37	missense	8.54	75	7	SNP	0.295	T
ADAMTS20	80070	genome.wustl.edu	37	12	43944806	43944806	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:43944806T>G	ENST00000389420.3	-	2	358	c.359A>C	c.(358-360)gAc>gCc	p.D120A	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.D120A	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	120					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GGGCCCTGCGTCGCTCTCCCA	0.657																																																	0													24.0	27.0	26.0					12																	43944806		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.359A>C	12.37:g.43944806T>G	ENSP00000374071:p.Asp120Ala		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D120A	ENST00000389420.3	37	c.359	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	T	0.604	-0.827993	0.02734	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.05717	3.4;3.4	3.22	0.166	0.14999	Peptidase M12B, propeptide (1);	1.175710	0.06479	N	0.732518	T	0.02119	0.0066	N	0.02539	-0.55	0.09310	N	1	B	0.20671	0.047	B	0.19666	0.026	T	0.45963	-0.9225	10	0.10377	T	0.69	.	1.3529	0.02177	0.1473:0.42:0.145:0.2877	.	120	P59510	ATS20_HUMAN	A	120	ENSP00000374071:D120A;ENSP00000448341:D120A	ENSP00000374068:D120A	D	-	2	0	ADAMTS20	42231073	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.510000	0.22723	0.057000	0.16193	-1.039000	0.02377	GAC	ADAMTS20	-	pfam_Peptidase_M12B_N	ENSG00000173157		0.657	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1		0.00	61	0	T	NM_025003		43944806	-1			no_errors	ENST00000389420	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.000	G
AZIN2	113451	genome.wustl.edu	37	1	33547001	33547001	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:33547001C>T	ENST00000294517.6	+	0	195				ADC_ENST00000373440.1_5'Flank|ADC_ENST00000373443.3_5'UTR|ADC_ENST00000358680.3_5'UTR|ADC_ENST00000398167.1_5'UTR|ADC_ENST00000373441.1_5'Flank	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN							agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	GAGGCCTCGGCTCCGCAACTG	0.706																																																	0																																										SO:0001623	5_prime_UTR_variant	0																														ENST00000294517.6:c.-393C>T	1.37:g.33547001C>T			B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	RNA	SNP	-	NULL	ENST00000294517.6	37	NULL	CCDS375.1	1																																																																																			ADC	-	-	ENSG00000142920		0.706	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADC	HGNC	protein_coding	OTTHUMT00000011867.1	-	0.00	87	0	C			33547001	+1	tier1	-	no_errors	ENST00000462920	ensembl	human	known	74_37	rna	47.06	45	40	SNP	1.000	T
ADCY2	108	genome.wustl.edu	37	5	7727305	7727305	+	Missense_Mutation	SNP	A	A	C	rs529971476		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:7727305A>C	ENST00000338316.4	+	14	1891	c.1802A>C	c.(1801-1803)aAg>aCg	p.K601T	ADCY2_ENST00000537121.1_Missense_Mutation_p.K421T|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	601					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCAGCGTTCAAGTATTATGTG	0.502													A|||	1	0.000199681	0.0	0.0	5008	,	,		21743	0.0		0.0	False		,,,				2504	0.001																0													199.0	175.0	183.0					5																	7727305		2203	4300	6503	SO:0001583	missense	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1802A>C	5.37:g.7727305A>C	ENSP00000342952:p.Lys601Thr		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K601T	ENST00000338316.4	37	c.1802	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	A	22.9	4.349753	0.82132	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;D	0.82893	-1.2;-1.66	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	D	0.89332	0.6685	M	0.75264	2.295	0.50813	D	0.999899	D;P	0.64830	0.994;0.628	D;P	0.64687	0.928;0.469	D	0.90086	0.4174	10	0.59425	D	0.04	.	12.642	0.56714	1.0:0.0:0.0:0.0	.	421;601	B7Z2C1;Q08462	.;ADCY2_HUMAN	T	601;434;421	ENSP00000342952:K601T;ENSP00000444803:K421T	ENSP00000342952:K601T	K	+	2	0	ADCY2	7780305	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	8.337000	0.90036	1.971000	0.57363	0.528000	0.53228	AAG	ADCY2	-	NULL	ENSG00000078295		0.502	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	-	0.00	87	0	A	NM_020546		7727305	+1	tier1	-	no_errors	ENST00000338316	ensembl	human	known	74_37	missense	40.17	70	47	SNP	1.000	C
ADD1	118	genome.wustl.edu	37	4	2930143	2930143	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:2930143G>A	ENST00000398129.1	+	14	2127	c.2107G>A	c.(2107-2109)Gcg>Acg	p.A703T	ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000446856.1_Missense_Mutation_p.A703T|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000264758.7_Missense_Mutation_p.A734T|ADD1_ENST00000513328.2_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)	703					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGGGGCCGCCGCGGACCCTGG	0.647																																					Esophageal Squamous(71;505 1201 20414 34538 37449)												0													43.0	57.0	52.0					4																	2930143		2198	4292	6490	SO:0001583	missense	0			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2107G>A	4.37:g.2930143G>A	ENSP00000381197:p.Ala703Thr		A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.A734T	ENST00000398129.1	37	c.2200	CCDS43205.1	4	.	.	.	.	.	.	.	.	.	.	G	8.893	0.954430	0.18431	.	.	ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398129	T;T;T	0.04917	3.53;3.54;3.54	5.08	2.38	0.29361	.	1.010250	0.07960	N	0.982250	T	0.05044	0.0135	N	0.19112	0.55	0.09310	N	1	B;B	0.17268	0.012;0.021	B;B	0.16722	0.007;0.016	T	0.48801	-0.9003	10	0.18276	T	0.48	-0.1272	9.6069	0.39639	0.2253:0.0:0.7747:0.0	.	703;734	P35611;P35611-3	ADDA_HUMAN;.	T	734;703;703	ENSP00000264758:A734T;ENSP00000399828:A703T;ENSP00000381197:A703T	ENSP00000264758:A734T	A	+	1	0	ADD1	2899941	0.293000	0.24371	0.001000	0.08648	0.080000	0.17528	3.262000	0.51538	0.161000	0.19458	-0.140000	0.14226	GCG	ADD1	-	NULL	ENSG00000087274		0.647	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	HGNC	protein_coding	OTTHUMT00000242840.1	-	0.00	42	0	G	NM_014189		2930143	+1	tier1	-	no_errors	ENST00000264758	ensembl	human	known	74_37	missense	51.72	14	15	SNP	0.002	A
ADD1	118	genome.wustl.edu	37	4	2931593	2931593	+	3'UTR	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:2931593T>C	ENST00000398129.1	+	0	3577				ADD1_ENST00000538860.1_3'UTR|ADD1_ENST00000446856.1_3'UTR|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000264758.7_3'UTR			P35611	ADDA_HUMAN	adducin 1 (alpha)						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GAAAAGTCCTTAACCGTGGAC	0.463																																					Esophageal Squamous(71;505 1201 20414 34538 37449)												0																																										SO:0001624	3_prime_UTR_variant	0			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.*1343T>C	4.37:g.2931593T>C			A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	RNA	SNP	-	NULL	ENST00000398129.1	37	NULL	CCDS43205.1	4																																																																																			ADD1	-	-	ENSG00000087274		0.463	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	HGNC	protein_coding	OTTHUMT00000242840.1	-	0.00	41	0	T	NM_014189		2931593	+1	tier1	-	no_errors	ENST00000538860	ensembl	human	known	74_37	rna	51.06	23	24	SNP	0.003	C
ADD3	120	genome.wustl.edu	37	10	111879026	111879026	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:111879026G>A	ENST00000356080.4	+	7	1142	c.775G>A	c.(775-777)Gat>Aat	p.D259N	ADD3_ENST00000277900.8_Missense_Mutation_p.D259N|ADD3_ENST00000360162.3_Missense_Mutation_p.D259N	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	259						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		TCTTCTGGGAGATGTTGCCTA	0.423																																																	0													87.0	82.0	84.0					10																	111879026		2203	4300	6503	SO:0001583	missense	0			U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.775G>A	10.37:g.111879026G>A	ENSP00000348381:p.Asp259Asn		D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.D259N	ENST00000356080.4	37	c.775	CCDS7561.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.795531	0.96952	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.23147	1.92;1.92;1.92	6.17	6.17	0.99709	Class II aldolase/adducin, N-terminal (3);	0.124545	0.64402	D	0.000001	T	0.47967	0.1474	M	0.62154	1.92	0.80722	D	1	P;D	0.58620	0.886;0.983	P;P	0.58266	0.744;0.836	T	0.19943	-1.0290	10	0.54805	T	0.06	-14.8643	20.8794	0.99867	0.0:0.0:1.0:0.0	.	259;259	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	N	259	ENSP00000353286:D259N;ENSP00000348381:D259N;ENSP00000277900:D259N	ENSP00000277900:D259N	D	+	1	0	ADD3	111869016	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GAT	ADD3	-	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	ENSG00000148700		0.423	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD3	HGNC	protein_coding	OTTHUMT00000050289.1		0.00	39	0	G	NM_019903		111879026	+1			no_errors	ENST00000356080	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	A
ADPRH	141	genome.wustl.edu	37	3	119306346	119306346	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:119306346A>C	ENST00000478399.1	+	4	2100	c.695A>C	c.(694-696)aAa>aCa	p.K232T	ADPRH_ENST00000357003.3_Missense_Mutation_p.K232T|ADPRH_ENST00000471850.1_3'UTR|ADPRH_ENST00000465513.1_Missense_Mutation_p.K232T|ADPRH_ENST00000478927.1_Missense_Mutation_p.K232T			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	232					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		AATTACCTAAAACTTAGAGGG	0.408																																					GBM(133;579 1804 5989 9967 40052)												0													66.0	64.0	64.0					3																	119306346		2203	4300	6503	SO:0001583	missense	0			L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.695A>C	3.37:g.119306346A>C	ENSP00000420200:p.Lys232Thr		B2R8H1|D3DN83	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.K232T	ENST00000478399.1	37	c.695	CCDS2990.1	3	.	.	.	.	.	.	.	.	.	.	A	15.23	2.773206	0.49680	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.93	5.93	0.95920	.	0.213104	0.48767	D	0.000165	T	0.26738	0.0654	L	0.46157	1.445	0.35770	D	0.82081	B	0.14012	0.009	B	0.15484	0.013	T	0.24476	-1.0159	10	0.28530	T	0.3	-21.4181	10.4033	0.44241	0.8362:0.1638:0.0:0.0	.	232	P54922	ADPRH_HUMAN	T	232	ENSP00000420200:K232T;ENSP00000417528:K232T;ENSP00000349496:K232T;ENSP00000417430:K232T	ENSP00000349496:K232T	K	+	2	0	ADPRH	120789036	0.546000	0.26457	1.000000	0.80357	0.993000	0.82548	1.478000	0.35442	2.281000	0.76405	0.533000	0.62120	AAA	ADPRH	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000144843		0.408	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRH	HGNC	protein_coding	OTTHUMT00000355199.1	-	0.00	54	0	A	NM_001125		119306346	+1	tier1	-	no_errors	ENST00000357003	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	C
ADPRH	141	genome.wustl.edu	37	3	119306349	119306349	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:119306349T>G	ENST00000478399.1	+	4	2103	c.698T>G	c.(697-699)cTt>cGt	p.L233R	ADPRH_ENST00000357003.3_Missense_Mutation_p.L233R|ADPRH_ENST00000471850.1_3'UTR|ADPRH_ENST00000465513.1_Missense_Mutation_p.L233R|ADPRH_ENST00000478927.1_Missense_Mutation_p.L233R			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	233					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		TACCTAAAACTTAGAGGGATT	0.408																																					GBM(133;579 1804 5989 9967 40052)												0													68.0	66.0	66.0					3																	119306349		2203	4300	6503	SO:0001583	missense	0			L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.698T>G	3.37:g.119306349T>G	ENSP00000420200:p.Leu233Arg		B2R8H1|D3DN83	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.L233R	ENST00000478399.1	37	c.698	CCDS2990.1	3	.	.	.	.	.	.	.	.	.	.	T	12.87	2.066989	0.36470	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	5.93	4.79	0.61399	.	0.359455	0.27455	N	0.019295	T	0.31009	0.0783	M	0.76574	2.34	0.47905	D	0.999545	B	0.28082	0.2	B	0.28305	0.088	T	0.06881	-1.0802	10	0.16420	T	0.52	-10.4777	9.5399	0.39246	0.0:0.0812:0.0:0.9188	.	233	P54922	ADPRH_HUMAN	R	233	ENSP00000420200:L233R;ENSP00000417528:L233R;ENSP00000349496:L233R;ENSP00000417430:L233R	ENSP00000349496:L233R	L	+	2	0	ADPRH	120789039	0.171000	0.23029	1.000000	0.80357	0.985000	0.73830	0.523000	0.22925	2.281000	0.76405	0.533000	0.62120	CTT	ADPRH	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	ENSG00000144843		0.408	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRH	HGNC	protein_coding	OTTHUMT00000355199.1	-	0.00	56	0	T	NM_001125		119306349	+1	tier1	-	no_errors	ENST00000357003	ensembl	human	known	74_37	missense	19.61	41	10	SNP	0.995	G
AGAP7P	653268	genome.wustl.edu	37	10	51465248	51465248	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:51465248G>A	ENST00000374095.5	-	7	1333	c.1208C>T	c.(1207-1209)aCg>aTg	p.T403M		NM_001077685.1	NP_001071153.1	Q5VUJ5	AGAP7_HUMAN		403	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	11						CTCATATGTCGTGGCTTCAAA	0.512																																																	0													18.0	24.0	22.0					10																	51465248		2154	4215	6369	SO:0001583	missense	0																														ENST00000374095.5:c.1208C>T	10.37:g.51465248G>A	ENSP00000363208:p.Thr403Met		A6NGH4	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.T403M	ENST00000374095.5	37	c.1208	CCDS41524.1	10	.	.	.	.	.	.	.	.	.	.	.	8.561	0.877698	0.17395	.	.	ENSG00000204169	ENST00000374095	T	0.76448	-1.02	.	.	.	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.168254	0.51477	N	0.000092	T	0.65059	0.2655	L	0.50333	1.59	0.25821	N	0.984282	B	0.21821	0.061	B	0.26202	0.067	T	0.51647	-0.8679	9	0.51188	T	0.08	.	4.7132	0.12882	0.3524:0.0:0.6476:0.0	.	403	Q5VUJ5	AGAP7_HUMAN	M	403	ENSP00000363208:T403M	ENSP00000363208:T403M	T	-	2	0	AGAP7	51135254	0.009000	0.17119	0.189000	0.23252	0.192000	0.23643	1.586000	0.36611	-1.498000	0.01824	-1.514000	0.00941	ACG	AGAP7	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000204169		0.512	AGAP7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	AGAP7	HGNC	protein_coding	OTTHUMT00000048033.1	-	0.00	245	0	G			51465248	-1	tier1	-	no_errors	ENST00000374095	ensembl	human	known	74_37	missense	14.21	169	28	SNP	0.504	A
AJAP1	55966	genome.wustl.edu	37	1	4772742	4772742	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:4772742T>G	ENST00000378191.4	+	2	1193	c.812T>G	c.(811-813)aTt>aGt	p.I271S	AJAP1_ENST00000378190.3_Missense_Mutation_p.I271S	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1	271					cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		CCCCCAAGGATTCTGGGGGAG	0.597																																																	0													66.0	74.0	71.0					1																	4772742		2203	4300	6503	SO:0001583	missense	0			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.812T>G	1.37:g.4772742T>G	ENSP00000367433:p.Ile271Ser		Q9Y229	Missense_Mutation	SNP	NULL	p.I271S	ENST00000378191.4	37	c.812	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	T	18.47	3.630331	0.67015	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	T;T	0.45276	0.9;0.9	5.14	4.02	0.46733	.	0.306880	0.29424	N	0.012182	T	0.28896	0.0717	L	0.27053	0.805	0.39473	D	0.967767	B	0.26809	0.16	B	0.31337	0.128	T	0.15896	-1.0421	10	0.42905	T	0.14	-6.5247	6.8311	0.23911	0.0:0.1033:0.0:0.8967	.	271	Q9UKB5	AJAP1_HUMAN	S	271	ENSP00000367432:I271S;ENSP00000367433:I271S	ENSP00000367432:I271S	I	+	2	0	AJAP1	4672602	0.993000	0.37304	0.991000	0.47740	0.943000	0.58893	2.333000	0.43912	1.926000	0.55796	0.383000	0.25322	ATT	AJAP1	-	NULL	ENSG00000196581		0.597	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	AJAP1	HGNC	protein_coding	OTTHUMT00000001542.3	-	0.00	80	0	T	NM_018836		4772742	+1	tier1	-	no_errors	ENST00000378190	ensembl	human	known	74_37	missense	61.64	28	45	SNP	0.995	G
ALS2CR12	130540	genome.wustl.edu	37	2	202213001	202213001	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:202213001T>G	ENST00000286190.5	-	3	256	c.210A>C	c.(208-210)caA>caC	p.Q70H	ALS2CR12_ENST00000439709.1_Missense_Mutation_p.Q70H|ALS2CR12_ENST00000405148.2_Missense_Mutation_p.Q70H|ALS2CR12_ENST00000448967.1_5'UTR|ALS2CR12_ENST00000392257.3_Missense_Mutation_p.Q70H			Q96Q35	AL2SB_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12	70					regulation of GTPase activity (GO:0043087)	outer dense fiber (GO:0001520)|sperm fibrous sheath (GO:0035686)|sperm flagellum (GO:0036126)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)	21						TAGTCTCTTCTTGCCTTGCTG	0.433																																																	0													94.0	89.0	90.0					2																	202213001		2203	4300	6503	SO:0001583	missense	0			AB053314	CCDS2346.1, CCDS46488.1	2q33.1	2009-10-06			ENSG00000155749	ENSG00000155749			14439	protein-coding gene	gene with protein product							Standard	XM_006712272		Approved		uc002uya.4	Q96Q35	OTTHUMG00000132824	ENST00000286190.5:c.210A>C	2.37:g.202213001T>G	ENSP00000286190:p.Gln70His		G5E9S3|Q53TT6|Q8N1B6	Missense_Mutation	SNP	superfamily_t-SNARE	p.Q70H	ENST00000286190.5	37	c.210	CCDS2346.1	2	.	.	.	.	.	.	.	.	.	.	T	12.77	2.037288	0.35893	.	.	ENSG00000155749	ENST00000286190;ENST00000405148;ENST00000392257;ENST00000439709;ENST00000425488	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	3.83	1.39	0.22231	.	0.944712	0.08786	N	0.893905	T	0.40791	0.1131	L	0.60455	1.87	0.09310	N	1	P;P	0.43094	0.799;0.799	P;P	0.44946	0.465;0.465	T	0.28202	-1.0051	10	0.42905	T	0.14	0.5473	3.6855	0.08327	0.0:0.119:0.2271:0.6539	.	70;70	Q96Q35;G5E9S3	AL2SB_HUMAN;.	H	70;70;70;70;8	ENSP00000286190:Q70H;ENSP00000385098:Q70H;ENSP00000376086:Q70H;ENSP00000412073:Q70H	ENSP00000286190:Q70H	Q	-	3	2	ALS2CR12	201921246	0.060000	0.20803	0.007000	0.13788	0.023000	0.10783	0.200000	0.17257	0.307000	0.22880	0.482000	0.46254	CAA	ALS2CR12	-	NULL	ENSG00000155749		0.433	ALS2CR12-001	KNOWN	basic|CCDS	protein_coding	ALS2CR12	HGNC	protein_coding	OTTHUMT00000256286.1	-	0.00	26	0	T	NM_139163		202213001	-1	tier1	-	no_errors	ENST00000286190	ensembl	human	known	74_37	missense	12.90	26	4	SNP	0.009	G
ANAPC4	29945	genome.wustl.edu	37	4	25419982	25419982	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:25419982T>G	ENST00000315368.3	+	29	2547	c.2405T>G	c.(2404-2406)cTt>cGt	p.L802R	ANAPC4_ENST00000510092.1_Missense_Mutation_p.L803R	NM_013367.2	NP_037499.2	Q9UJX5	APC4_HUMAN	anaphase promoting complex subunit 4	802					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	27		Breast(46;0.0503)				GTGGAAAAACTTGACCCTGAG	0.433																																																	0													56.0	58.0	57.0					4																	25419982		2203	4300	6503	SO:0001583	missense	0			AF191338	CCDS3434.1, CCDS68684.1	4p15.31	2011-06-15			ENSG00000053900	ENSG00000053900		"""Anaphase promoting complex subunits"""	19990	protein-coding gene	gene with protein product		606947				6180011	Standard	NM_013367		Approved	APC4	uc003gro.3	Q9UJX5	OTTHUMG00000097753	ENST00000315368.3:c.2405T>G	4.37:g.25419982T>G	ENSP00000318775:p.Leu802Arg		A8K8H1|E9PCR4|Q6PCC6|Q9NSH6	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,pirsf_APC4_metazoa	p.L803R	ENST00000315368.3	37	c.2408	CCDS3434.1	4	.	.	.	.	.	.	.	.	.	.	T	18.35	3.604877	0.66445	.	.	ENSG00000053900	ENST00000315368;ENST00000510092	T;T	0.41065	1.01;1.01	5.74	1.97	0.26223	.	0.982303	0.08375	N	0.955450	T	0.24236	0.0587	N	0.14661	0.345	0.09310	N	0.999992	B	0.23650	0.089	B	0.22152	0.038	T	0.23904	-1.0175	10	0.62326	D	0.03	-3.5343	3.4967	0.07657	0.2476:0.179:0.0:0.5733	.	802	Q9UJX5	APC4_HUMAN	R	802;803	ENSP00000318775:L802R;ENSP00000426654:L803R	ENSP00000318775:L802R	L	+	2	0	ANAPC4	25029080	0.027000	0.19231	0.266000	0.24541	0.993000	0.82548	0.459000	0.21908	1.113000	0.41760	0.523000	0.50628	CTT	ANAPC4	-	pirsf_APC4_metazoa	ENSG00000053900		0.433	ANAPC4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANAPC4	HGNC	protein_coding	OTTHUMT00000214986.1	-	0.00	39	0	T	NM_013367		25419982	+1	tier1	-	no_errors	ENST00000510092	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.336	G
ANHX	647589	genome.wustl.edu	37	12	133804486	133804486	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:133804486T>G	ENST00000545940.1	-	3	2163	c.425A>C	c.(424-426)aAc>aCc	p.N142T	ANHX_ENST00000419717.1_Missense_Mutation_p.N142T			E9PGG2	ANHX_HUMAN	anomalous homeobox	142					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										TCTGGGGAAGTTCCGGCTCTT	0.582																																																	0																																										SO:0001583	missense	0				CCDS53855.1	12q24.33	2012-05-18			ENSG00000227059	ENSG00000227059			40024	protein-coding gene	gene with protein product							Standard	NM_001191054		Approved		uc010tci.2	E9PGG2	OTTHUMG00000167949	ENST00000545940.1:c.425A>C	12.37:g.133804486T>G	ENSP00000439513:p.Asn142Thr		Q96MC1	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.N142T	ENST00000545940.1	37	c.425	CCDS53855.1	12	.	.	.	.	.	.	.	.	.	.	.	11.81	1.748257	0.30955	.	.	ENSG00000227059	ENST00000545940;ENST00000419717	D;D	0.95137	-3.62;-3.62	3.98	3.98	0.46160	.	.	.	.	.	D	0.90926	0.7148	L	0.49455	1.56	0.27026	N	0.96435	P	0.38729	0.644	B	0.35813	0.211	D	0.84437	0.0580	8	.	.	.	.	9.5461	0.39282	0.0:0.0:0.0:1.0	.	142	E9PGG2	.	T	142	ENSP00000439513:N142T;ENSP00000409950:N142T	.	N	-	2	0	AC226150.2	.	0.997000	0.39634	0.992000	0.48379	0.975000	0.68041	1.396000	0.34531	1.570000	0.49709	0.379000	0.24179	AAC	ANHX	-	superfamily_Homeodomain-like,smart_Homeobox_dom	ENSG00000227059		0.582	ANHX-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ANHX	HGNC	protein_coding	OTTHUMT00000397203.1	-	0.00	32	0	T			133804486	-1	tier1	-	no_errors	ENST00000419717	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.990	G
AOC2	314	genome.wustl.edu	37	17	40997484	40997484	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:40997484G>T	ENST00000253799.3	+	1	868	c.841G>T	c.(841-843)Gaa>Taa	p.E281*	AOC2_ENST00000452774.2_Nonsense_Mutation_p.E281*	NM_009590.2	NP_033720.2	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 (retina-specific)	281					amine metabolic process (GO:0009308)|catecholamine metabolic process (GO:0006584)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(14)|ovary(4)|skin(2)	30		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGGCCGGTTGGAAGTGGTTAG	0.577																																																	0													84.0	85.0	84.0					17																	40997484		2203	4300	6503	SO:0001587	stop_gained	0			AF081363	CCDS11443.1, CCDS45690.1	17q21	2012-07-13				ENSG00000131480	1.4.3.21		549	protein-coding gene	gene with protein product		602268				9119395, 9722954	Standard	NM_001158		Approved	RAO, DAO2	uc002ibu.3	O75106		ENST00000253799.3:c.841G>T	17.37:g.40997484G>T	ENSP00000253799:p.Glu281*		A5PKW2|O00120|O75105|Q4TTW5|Q9UNY0	Nonsense_Mutation	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N3,pfam_Cu_amine_oxidase_N2,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.E281*	ENST00000253799.3	37	c.841	CCDS11443.1	17	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854186	0.71719	.	.	ENSG00000131480	ENST00000253799;ENST00000452774	.	.	.	5.75	3.74	0.42951	.	0.531595	0.20702	N	0.087259	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-34.5347	4.5183	0.11947	0.2692:0.1686:0.5623:0.0	.	.	.	.	X	281	.	ENSP00000253799:E281X	E	+	1	0	AOC2	38251010	0.999000	0.42202	0.871000	0.34182	0.741000	0.42261	1.138000	0.31491	0.766000	0.33244	-0.305000	0.09177	GAA	AOC2	-	superfamily_Cu_amine_oxidase_N-reg	ENSG00000131480		0.577	AOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC2	HGNC	protein_coding	OTTHUMT00000452442.1	-	0.00	56	0	G	NM_009590, NM_001158		40997484	+1	tier1	-	no_errors	ENST00000253799	ensembl	human	known	74_37	nonsense	8.06	57	5	SNP	0.332	T
APOB	338	genome.wustl.edu	37	2	21231710	21231710	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:21231710T>G	ENST00000233242.1	-	26	8157	c.8030A>C	c.(8029-8031)gAc>gCc	p.D2677A		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2677					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCATCTGGTCAATGGTTCT	0.443																																																	0													152.0	157.0	156.0					2																	21231710		2203	4300	6503	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8030A>C	2.37:g.21231710T>G	ENSP00000233242:p.Asp2677Ala		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D2677A	ENST00000233242.1	37	c.8030	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	T	18.43	3.622562	0.66787	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01197	5.19	5.33	5.33	0.75918	.	0.000000	0.64402	D	0.000014	T	0.06781	0.0173	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.03608	-1.1020	10	0.72032	D	0.01	.	15.3081	0.74008	0.0:0.0:0.0:1.0	.	2677	P04114	APOB_HUMAN	A	2677	ENSP00000233242:D2677A	ENSP00000233242:D2677A	D	-	2	0	APOB	21085215	1.000000	0.71417	0.996000	0.52242	0.716000	0.41182	7.989000	0.88205	2.020000	0.59435	0.459000	0.35465	GAC	APOB	-	NULL	ENSG00000084674		0.443	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	-	0.00	47	0	T			21231710	-1	tier1	-	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.999	G
ARHGAP23	57636	genome.wustl.edu	37	17	36622834	36622834	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:36622834C>T	ENST00000431231.2	+	7	978	c.910C>T	c.(910-912)Cgg>Tgg	p.R304W	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.R304W|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.R210W	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	304					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GGGGGAGAGACGGTGCCCAGC	0.741																																																	0													3.0	4.0	4.0					17																	36622834		582	1431	2013	SO:0001583	missense	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.910C>T	17.37:g.36622834C>T	ENSP00000393539:p.Arg304Trp			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R304W	ENST00000431231.2	37	c.910	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	C	16.14	3.038208	0.54896	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.23147	1.92;2.32;2.33	4.09	4.09	0.47781	.	.	.	.	.	T	0.33702	0.0872	N	0.22421	0.69	0.28938	N	0.891137	D;D	0.89917	0.999;1.0	D;D	0.67725	0.93;0.953	T	0.09552	-1.0669	9	0.72032	D	0.01	.	10.5969	0.45343	0.1929:0.8071:0.0:0.0	.	304;304	Q9P227;Q9P227-2	RHG23_HUMAN;.	W	304;304;210	ENSP00000394153:R304W;ENSP00000393539:R304W;ENSP00000407333:R210W	ENSP00000393539:R304W	R	+	1	2	ARHGAP23	33876360	0.049000	0.20398	1.000000	0.80357	0.995000	0.86356	0.232000	0.17891	2.130000	0.65690	0.555000	0.69702	CGG	ARHGAP23	-	NULL	ENSG00000225485		0.741	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	-	0.00	19	0	C	XM_290799		36622834	+1	tier1	-	no_errors	ENST00000431231	ensembl	human	known	74_37	missense	33.33	10	5	SNP	1.000	T
ARL15	54622	genome.wustl.edu	37	5	53409096	53409096	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:53409096C>T	ENST00000504924.1	-	4	491	c.398G>A	c.(397-399)tGc>tAc	p.C133Y	ARL15_ENST00000507646.2_Missense_Mutation_p.C133Y|ARL15_ENST00000510591.2_5'UTR|ARL15_ENST00000502271.1_5'UTR	NM_019087.2	NP_061960.1	Q9NXU5	ARL15_HUMAN	ADP-ribosylation factor-like 15	133					small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		Lung NSC(810;0.000779)				GGGTAAAGTGCATAACTGTGG	0.423																																																	0													89.0	91.0	90.0					5																	53409096		1947	4152	6099	SO:0001583	missense	0			BC026093	CCDS54850.1	5p15.2	2014-05-09	2005-11-03	2005-11-03		ENSG00000185305		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25945	protein-coding gene	gene with protein product			"""ADP-ribosylation factor related protein 2"""	ARFRP2		12477932	Standard	NM_019087		Approved	FLJ20051	uc003jpg.1	Q9NXU5		ENST00000504924.1:c.398G>A	5.37:g.53409096C>T	ENSP00000433427:p.Cys133Tyr		Q6IAD0	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	p.C133Y	ENST00000504924.1	37	c.398	CCDS54850.1	5	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904307	0.92035	.	.	ENSG00000185305	ENST00000504924;ENST00000507646	T;T	0.62639	0.01;0.01	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.71888	0.3393	L	0.34521	1.04	0.80722	D	1	D	0.67145	0.996	D	0.66196	0.942	T	0.73135	-0.4078	10	0.72032	D	0.01	-13.9925	20.2723	0.98479	0.0:1.0:0.0:0.0	.	133	Q9NXU5	ARL15_HUMAN	Y	133	ENSP00000433427:C133Y;ENSP00000432680:C133Y	ENSP00000433427:C133Y	C	-	2	0	ARL15	53444853	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.793000	0.96121	0.563000	0.77884	TGC	ARL15	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1	ENSG00000185305		0.423	ARL15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL15	HGNC	protein_coding	OTTHUMT00000368432.2	-	0.00	22	0	C	NM_019087		53409096	-1	tier1	-	no_errors	ENST00000504924	ensembl	human	known	74_37	missense	26.32	14	5	SNP	1.000	T
ASB1	51665	genome.wustl.edu	37	2	239355133	239355133	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:239355133A>C	ENST00000264607.4	+	5	1236	c.989A>C	c.(988-990)aAg>aCg	p.K330T	ASB1_ENST00000409297.1_Missense_Mutation_p.K229T	NM_001040445.1	NP_001035535.1	Q9Y576	ASB1_HUMAN	ankyrin repeat and SOCS box containing 1	330	SOCS box. {ECO:0000255|PROSITE- ProRule:PRU00194}.				intracellular signal transduction (GO:0035556)|male genitalia development (GO:0030539)|negative regulation of cytokine biosynthetic process (GO:0042036)|protein ubiquitination (GO:0016567)	intracellular (GO:0005622)				breast(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		all_epithelial(40;2.65e-14)|Breast(86;7.61e-05)|Renal(207;0.00183)|all_lung(227;0.0283)|Ovarian(221;0.0365)|Lung NSC(271;0.0941)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;2.04e-26)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.88e-05)|Lung(119;0.000383)|LUSC - Lung squamous cell carcinoma(224;0.00644)		CCCATAAAGAAGTTTCTACTC	0.542																																																	0													96.0	93.0	94.0					2																	239355133		2203	4300	6503	SO:0001583	missense	0			AF156777	CCDS33416.1	2q37	2013-01-10	2011-01-25		ENSG00000065802	ENSG00000065802		"""Ankyrin repeat domain containing"""	16011	protein-coding gene	gene with protein product		605758	"""ankyrin repeat and SOCS box-containing 1"""				Standard	XR_241235		Approved	ASB-1	uc002vyg.3	Q9Y576	OTTHUMG00000152866	ENST00000264607.4:c.989A>C	2.37:g.239355133A>C	ENSP00000264607:p.Lys330Thr		A6NL50|Q4ZG29|Q9ULS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C,prints_Ankyrin_rpt	p.K330T	ENST00000264607.4	37	c.989	CCDS33416.1	2	.	.	.	.	.	.	.	.	.	.	A	9.150	1.016033	0.19355	.	.	ENSG00000065802	ENST00000264607;ENST00000409297	T;T	0.44482	0.92;0.92	5.63	1.99	0.26369	SOCS protein, C-terminal (3);	0.587116	0.19093	N	0.122906	T	0.18800	0.0451	N	0.13043	0.29	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.14144	-1.0483	10	0.20519	T	0.43	-17.8858	1.6313	0.02733	0.5384:0.1295:0.2073:0.1247	.	330	Q9Y576	ASB1_HUMAN	T	330;229	ENSP00000264607:K330T;ENSP00000387025:K229T	ENSP00000264607:K330T	K	+	2	0	ASB1	239019872	0.996000	0.38824	0.171000	0.22900	0.847000	0.48162	1.265000	0.33027	0.103000	0.17682	0.533000	0.62120	AAG	ASB1	-	pfam_SOCS_C,smart_SOCS_C,pfscan_SOCS_C	ENSG00000065802		0.542	ASB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB1	HGNC	protein_coding	OTTHUMT00000328294.1	-	0.00	33	0	A	NM_001040445		239355133	+1	tier1	-	no_errors	ENST00000264607	ensembl	human	known	74_37	missense	18.64	48	11	SNP	0.168	C
ASTN2	23245	genome.wustl.edu	37	9	119738455	119738455	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:119738455G>T	ENST00000313400.4	-	9	1789	c.1689C>A	c.(1687-1689)taC>taA	p.Y563*	ASTN2_ENST00000361209.2_Nonsense_Mutation_p.Y512*|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Nonsense_Mutation_p.Y563*			O75129	ASTN2_HUMAN	astrotactin 2	563					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						CAAGTGTCGTGTAGGGCCAAG	0.493																																																	0													84.0	77.0	79.0					9																	119738455		2203	4300	6503	SO:0001587	stop_gained	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1689C>A	9.37:g.119738455G>T	ENSP00000314038:p.Tyr563*		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Nonsense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.Y563*	ENST00000313400.4	37	c.1689		9	.	.	.	.	.	.	.	.	.	.	G	38	6.866407	0.97897	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	.	.	.	5.64	1.73	0.24493	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.7238	9.3025	0.37853	0.4283:0.0:0.5717:0.0	.	.	.	.	X	563;563;290;512	.	.	Y	-	3	2	ASTN2	118778276	1.000000	0.71417	0.994000	0.49952	0.910000	0.53928	0.595000	0.24029	0.333000	0.23563	-0.136000	0.14681	TAC	ASTN2	-	NULL	ENSG00000148219		0.493	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		-	0.00	20	0	G	NM_014010		119738455	-1	tier1	-	no_errors	ENST00000313400	ensembl	human	known	74_37	nonsense	28.57	25	10	SNP	1.000	T
ATP10D	57205	genome.wustl.edu	37	4	47570977	47570977	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:47570977T>G	ENST00000273859.3	+	16	3246	c.2977T>G	c.(2977-2979)Tta>Gta	p.L993V		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	993					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GGACTCAGGGTTACGAGCTGG	0.478																																																	0													72.0	79.0	77.0					4																	47570977		2203	4300	6503	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2977T>G	4.37:g.47570977T>G	ENSP00000273859:p.Leu993Val		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L993V	ENST00000273859.3	37	c.2977	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	T	4.619	0.115030	0.08831	.	.	ENSG00000145246	ENST00000273859	D	0.87256	-2.23	4.89	3.12	0.35913	HAD-like domain (1);	0.687303	0.14997	N	0.286323	T	0.77039	0.4072	N	0.20881	0.62	0.09310	N	0.999997	B	0.27264	0.173	B	0.32022	0.139	T	0.64188	-0.6466	10	0.33940	T	0.23	-0.0728	5.0625	0.14564	0.1698:0.6378:0.0:0.1924	.	993	Q9P241	AT10D_HUMAN	V	993	ENSP00000273859:L993V	ENSP00000273859:L993V	L	+	1	2	ATP10D	47265734	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.300000	0.19156	0.629000	0.30376	-1.293000	0.01348	TTA	ATP10D	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000145246		0.478	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	51	0	T	NM_020453		47570977	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	14.00	43	7	SNP	0.001	G
ATP6V1H	51606	genome.wustl.edu	37	8	54742095	54742096	+	Splice_Site	INS	-	-	A	rs373096406		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:54742095_54742096insA	ENST00000359530.2	-	4	480		c.e4-2		ATP6V1H_ENST00000355221.3_Splice_Site|ATP6V1H_ENST00000520188.1_Splice_Site|ATP6V1H_ENST00000396774.2_Splice_Site	NM_015941.3	NP_057025.2	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1 subunit H						ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|endocytosis (GO:0006897)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|regulation of catalytic activity (GO:0050790)|regulation of defense response to virus by virus (GO:0050690)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V1 domain (GO:0000221)	enzyme regulator activity (GO:0030234)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)	p.?(1)		endometrium(3)|large_intestine(5)|lung(8)|ovary(1)|urinary_tract(1)	18		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			TTTAGCACACTAAAAAAAAAAA	0.292																																																	1	Unknown(1)	ovary(1)																																								SO:0001630	splice_region_variant	0			AF132945	CCDS6153.1, CCDS6154.1	8q11.2	2011-05-24	2002-08-29		ENSG00000047249	ENSG00000047249		"""ATPases / V-type"""	18303	protein-coding gene	gene with protein product	"""vacuolar ATP synthase subunit H"""	608861	"""ATPase, H+ transporting, lysosomal 50/57kD, V1 subunit H"""			9620685, 10810093	Standard	NM_015941		Approved	CGI-11, SFD, VMA13, SFDalpha, SFDbeta	uc003xrm.4	Q9UI12	OTTHUMG00000164231	ENST00000359530.2:c.217-2->T	8.37:g.54742106_54742106dupA			B3KMR0|Q6PK44|Q9H3E3|Q9Y300	Splice_Site	INS	-	e3-2	ENST00000359530.2	37	c.217-3_217-2	CCDS6153.1	8																																																																																			ATP6V1H	-	-	ENSG00000047249		0.292	ATP6V1H-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1H	HGNC	protein_coding	OTTHUMT00000377865.1		0.00	30	0	-	NM_015941	Intron	54742096	-1	tier1		no_errors	ENST00000359530	ensembl	human	known	74_37	splice_site_ins	12.00	22	3	INS	0.998:0.112	A
AXIN2	8313	genome.wustl.edu	37	17	63531788	63531788	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:63531788C>A	ENST00000375702.5	-	7	2106	c.1998G>T	c.(1996-1998)caG>caT	p.Q666H	AXIN2_ENST00000307078.5_Missense_Mutation_p.Q731H			Q9Y2T1	AXIN2_HUMAN	axin 2	731					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TGGCTCCCGTCTGAACAGTGG	0.532									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								0													97.0	75.0	82.0					17																	63531788		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1998G>T	17.37:g.63531788C>A	ENSP00000364854:p.Gln666His		Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	pfam_DIX,pfam_RGS_dom,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.Q731H	ENST00000375702.5	37	c.2193		17	.	.	.	.	.	.	.	.	.	.	C	4.971	0.180407	0.09443	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	T;T	0.66099	-0.19;-0.16	5.28	1.78	0.24846	.	0.626629	0.16924	N	0.193970	T	0.41926	0.1180	L	0.29908	0.895	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.14144	-1.0483	10	0.34782	T	0.22	-12.8966	2.9895	0.05979	0.1918:0.5288:0.1211:0.1583	.	731;666	Q9Y2T1;E7ES00	AXIN2_HUMAN;.	H	731;666	ENSP00000302625:Q731H;ENSP00000364854:Q666H	ENSP00000302625:Q731H	Q	-	3	2	AXIN2	60962250	0.008000	0.16893	0.453000	0.27007	0.156000	0.22039	0.044000	0.13992	1.234000	0.43709	0.655000	0.94253	CAG	AXIN2	-	NULL	ENSG00000168646		0.532	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	-	0.00	25	0	C	NM_004655		63531788	-1	tier1	-	no_errors	ENST00000307078	ensembl	human	known	74_37	missense	29.63	19	8	SNP	0.009	A
BCL2L11	10018	genome.wustl.edu	37	2	111881326	111881326	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:111881326G>T	ENST00000393256.3	+	2	277	c.4G>T	c.(4-6)Gca>Tca	p.A2S	BCL2L11_ENST00000393253.2_Missense_Mutation_p.A2S|BCL2L11_ENST00000405953.1_Missense_Mutation_p.A2S|BCL2L11_ENST00000337565.5_Missense_Mutation_p.A2S|BCL2L11_ENST00000308659.8_Missense_Mutation_p.A2S|BCL2L11_ENST00000357757.2_Missense_Mutation_p.A2S	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	2					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						AGACCAAATGGCAAAGCAACC	0.413																																																	0													40.0	43.0	42.0					2																	111881326		2203	4300	6503	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.4G>T	2.37:g.111881326G>T	ENSP00000376943:p.Ala2Ser		A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting_BH3_dom,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.A2S	ENST00000393256.3	37	c.4	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161315	0.78226	.	.	ENSG00000153094	ENST00000432179;ENST00000308659;ENST00000357757;ENST00000393253;ENST00000337565;ENST00000393256;ENST00000393252;ENST00000405953	.	.	.	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000008	T	0.64616	0.2614	N	0.24115	0.695	0.44085	D	0.996842	D;D;D;D;D;D	0.76494	0.988;0.996;0.999;0.993;0.996;0.996	D;D;D;D;D;D	0.79108	0.931;0.986;0.992;0.968;0.987;0.99	T	0.69217	-0.5203	9	0.87932	D	0	-11.4857	16.3881	0.83523	0.0:0.0:1.0:0.0	.	2;2;2;2;2;2	O43521-15;O43521-11;O43521-3;O43521;O43521-2;O43521-17	.;.;.;B2L11_HUMAN;.;.	S	2	.	ENSP00000309226:A2S	A	+	1	0	BCL2L11	111597797	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	4.294000	0.59043	2.553000	0.86117	0.313000	0.20887	GCA	BCL2L11	-	pirsf_Bcl-2-like_11	ENSG00000153094		0.413	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3		0.00	26	0	G			111881326	+1			no_errors	ENST00000393256	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
BCL9L	283149	genome.wustl.edu	37	11	118770650	118770650	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:118770650G>C	ENST00000334801.3	-	7	4346	c.3382C>G	c.(3382-3384)Cca>Gca	p.P1128A	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1128	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TGCGGTGGTGGTGGGGGGGGC	0.711																																																	0													34.0	35.0	34.0					11																	118770650		2199	4292	6491	SO:0001583	missense	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3382C>G	11.37:g.118770650G>C	ENSP00000335320:p.Pro1128Ala		A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Missense_Mutation	SNP	pfam_BCL9_beta-catenin-bd_dom	p.P1128A	ENST00000334801.3	37	c.3382	CCDS8403.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.673|6.673	0.492662|0.492662	0.12702|0.12702	.|.	.|.	ENSG00000186174|ENSG00000186174	ENST00000530293|ENST00000334801;ENST00000526143;ENST00000525300;ENST00000392849;ENST00000431085	.|T	.|0.62232	.|0.04	3.55|3.55	2.62|2.62	0.31277|0.31277	.|.	.|0.413103	.|0.18016	.|N	.|0.154396	T|T	0.33847|0.33847	0.0877|0.0877	N|N	0.08118|0.08118	0|0	0.24979|0.24979	N|N	0.991618|0.991618	.|B;B	.|0.10296	.|0.003;0.002	.|B;B	.|0.06405	.|0.002;0.001	T|T	0.19811|0.19811	-1.0294|-1.0294	5|10	.|0.02654	.|T	.|1	-1.2375|-1.2375	9.8966|9.8966	0.41322|0.41322	0.0:0.4085:0.5915:0.0|0.0:0.4085:0.5915:0.0	.|.	.|1123;1128	.|Q86UU0-2;Q86UU0	.|.;BCL9L_HUMAN	Q|A	147|1128;1091;421;1128;1128	.|ENSP00000335320:P1128A	.|ENSP00000335320:P1128A	H|P	-|-	3|1	2|0	BCL9L|BCL9L	118275860|118275860	0.997000|0.997000	0.39634|0.39634	0.828000|0.828000	0.32881|0.32881	0.553000|0.553000	0.35397|0.35397	2.963000|2.963000	0.49184|0.49184	1.048000|1.048000	0.40298|0.40298	0.655000|0.655000	0.94253|0.94253	CAC|CCA	BCL9L	-	NULL	ENSG00000186174		0.711	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1	-	0.00	94	0	G	NM_182557		118770650	-1	tier1	-	no_errors	ENST00000334801	ensembl	human	known	74_37	missense	8.64	74	7	SNP	1.000	C
C19orf54	284325	genome.wustl.edu	37	19	41255500	41255500	+	Missense_Mutation	SNP	C	C	T	rs2254343	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:41255500C>T	ENST00000378313.2	-	1	328	c.209G>A	c.(208-210)cGt>cAt	p.R70H	C19orf54_ENST00000339153.3_5'UTR|C19orf54_ENST00000598729.1_5'UTR|C19orf54_ENST00000470681.1_5'UTR|SNRPA_ENST00000243563.3_5'Flank|C19orf54_ENST00000598485.2_5'UTR	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	70				R -> P (in Ref. 3; BC020262). {ECO:0000305}.						breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GAAGACATGACGGGGAGCAGG	0.617																																																	0													22.0	29.0	27.0					19																	41255500		692	1591	2283	SO:0001583	missense	0			AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.209G>A	19.37:g.41255500C>T	ENSP00000367564:p.Arg70His		A8MSZ5|B4DNU7	Missense_Mutation	SNP	NULL	p.R70H	ENST00000378313.2	37	c.209	CCDS12564.2	19	.	.	.	.	.	.	.	.	.	.	G	36	5.611658	0.96637	.	.	ENSG00000188493	ENST00000378313	.	.	.	4.59	4.59	0.56863	.	0.770143	0.10066	U	0.720321	T	0.29652	0.0740	N	0.08118	0	0.09310	P	0.9999999999999999	B	0.24368	0.102	B	0.08055	0.003	T	0.30880	-0.9963	8	0.72032	D	0.01	-3.7994	10.7158	0.46011	0.0:0.1929:0.8071:0.0	.	70	Q5BKX5	CS054_HUMAN	H	70	.	ENSP00000367564:R70H	R	-	2	0	C19orf54	45947340	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	2.689000	0.46993	1.160000	0.42584	-0.120000	0.15030	CGT	C19orf54	-	NULL	ENSG00000188493		0.617	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf54	HGNC	protein_coding	OTTHUMT00000316701.1	-	0.00	48	0	C	NM_198476		41255500	-1	tier1	-	no_errors	ENST00000378313	ensembl	human	known	74_37	missense	30.77	19	28	SNP	1.000	T
C1QTNF7	114905	genome.wustl.edu	37	4	15444285	15444285	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:15444285A>C	ENST00000444304.2	+	3	1058	c.732A>C	c.(730-732)gaA>gaC	p.E244D	C1QTNF7_ENST00000429690.1_Missense_Mutation_p.E244D|C1QTNF7_ENST00000295297.4_Missense_Mutation_p.E251D			Q9BXJ2	C1QT7_HUMAN	C1q and tumor necrosis factor related protein 7	244	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				endometrium(5)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	16						CAGAAGATGAAGTCTGGCTGG	0.498																																																	0													80.0	86.0	84.0					4																	15444285		2203	4300	6503	SO:0001583	missense	0			AF329839	CCDS3414.1, CCDS47025.1	4p15.3	2008-08-29			ENSG00000163145	ENSG00000163145			14342	protein-coding gene	gene with protein product							Standard	NM_001135170		Approved	CTRP7	uc003gnp.3	Q9BXJ2	OTTHUMG00000097095	ENST00000444304.2:c.732A>C	4.37:g.15444285A>C	ENSP00000388914:p.Glu244Asp		B2RBT3|J3KPW3	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.E244D	ENST00000444304.2	37	c.732	CCDS3414.1	4	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049804	0.75846	.	.	ENSG00000163145	ENST00000295297;ENST00000429690;ENST00000444304	T;T;T	0.77358	-1.09;-1.09;-1.09	6.02	-0.408	0.12381	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.87386	0.6164	M	0.90309	3.105	0.47245	D	0.999369	D	0.69078	0.997	D	0.76071	0.987	D	0.85604	0.1254	9	.	.	.	.	9.86	0.41109	0.6623:0.0:0.3377:0.0	.	244	Q9BXJ2	C1QT7_HUMAN	D	251;244;244	ENSP00000295297:E251D;ENSP00000410722:E244D;ENSP00000388914:E244D	.	E	+	3	2	C1QTNF7	15053383	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	1.376000	0.34306	-0.251000	0.09542	0.533000	0.62120	GAA	C1QTNF7	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000163145		0.498	C1QTNF7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	C1QTNF7	HGNC	protein_coding	OTTHUMT00000250891.2	-	0.00	41	0	A			15444285	+1	tier1	-	no_errors	ENST00000429690	ensembl	human	known	74_37	missense	21.43	22	6	SNP	1.000	C
C1orf94	84970	genome.wustl.edu	37	1	34662990	34662990	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:34662990T>C	ENST00000488417.1	+	2	605	c.485T>C	c.(484-486)cTt>cCt	p.L162P	C1orf94_ENST00000373374.3_5'UTR	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	162										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CCCTGCATTCTTGCCCCTCCT	0.597																																																	0													24.0	27.0	26.0					1																	34662990		692	1591	2283	SO:0001583	missense	0			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.485T>C	1.37:g.34662990T>C	ENSP00000435634:p.Leu162Pro		B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	NULL	p.L162P	ENST00000488417.1	37	c.485	CCDS44108.1	1	.	.	.	.	.	.	.	.	.	.	T	4.691	0.128545	0.08981	.	.	ENSG00000142698	ENST00000488417	T	0.28454	1.61	5.35	1.61	0.23674	.	.	.	.	.	T	0.23926	0.0579	L	0.44542	1.39	0.09310	N	0.999993	B	0.11235	0.004	B	0.09377	0.004	T	0.23655	-1.0182	9	0.59425	D	0.04	-22.0279	5.98	0.19401	0.0:0.456:0.0:0.544	.	162	Q6P1W5	CA094_HUMAN	P	162	ENSP00000435634:L162P	ENSP00000435634:L162P	L	+	2	0	C1orf94	34435577	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.410000	0.21098	0.326000	0.23384	0.533000	0.62120	CTT	C1orf94	-	NULL	ENSG00000142698		0.597	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	-	0.00	42	0	T	NM_032884		34662990	+1	tier1	-	no_errors	ENST00000488417	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.000	C
C1orf106	55765	genome.wustl.edu	37	1	200878069	200878069	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:200878069G>T	ENST00000367342.4	+	7	1240		c.e7+1		C1orf106_ENST00000413687.2_Splice_Site	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106											endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						GCGAGTCCAGGTCAGGATCAG	0.612																																																	0													17.0	18.0	18.0					1																	200878069		2193	4288	6481	SO:0001630	splice_region_variant	0			AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1040+1G>T	1.37:g.200878069G>T			B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Splice_Site	SNP	-	e7+1	ENST00000367342.4	37	c.1040+1		1	.	.	.	.	.	.	.	.	.	.	G	12.22	1.871973	0.33069	.	.	ENSG00000163362	ENST00000367342;ENST00000413687	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5868	0.76489	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf106	199144692	1.000000	0.71417	0.998000	0.56505	0.309000	0.27889	6.928000	0.75846	2.399000	0.81585	0.563000	0.77884	.	C1orf106	-	-	ENSG00000163362		0.612	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	HGNC	protein_coding	OTTHUMT00000087057.2	-	0.00	53	0	G	NM_018265	Intron	200878069	+1	tier1	-	no_errors	ENST00000367342	ensembl	human	known	74_37	splice_site	60.87	18	28	SNP	1.000	T
C5orf27	202299	genome.wustl.edu	37	5	95194594	95194594	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:95194594A>C	ENST00000436592.1	+	4	809	c.161A>C	c.(160-162)gAa>gCa	p.E54A	AC008592.5_ENST00000503091.1_RNA|C5orf27_ENST00000357880.3_Missense_Mutation_p.E54A					chromosome 5 open reading frame 27																		CCATCGCATGAATTCCAGCAG	0.622											OREG0016708	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													46.0	39.0	42.0					5																	95194594		692	1591	2283	SO:0001583	missense	0			AY168789		5q15	2014-04-16			ENSG00000236882	ENSG00000236882			24687	other	unknown							Standard	NR_026936		Approved	FLJ38821, FIS	uc003klp.3	Q52M75	OTTHUMG00000122084	ENST00000436592.1:c.161A>C	5.37:g.95194594A>C	ENSP00000423049:p.Glu54Ala	1311		Missense_Mutation	SNP	NULL	p.E54A	ENST00000436592.1	37	c.161		5	.	.	.	.	.	.	.	.	.	.	A	7.305	0.613732	0.14066	.	.	ENSG00000236882	ENST00000357880;ENST00000436592	T;T	0.54866	0.55;0.55	3.63	-3.46	0.04767	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46345	-0.9198	6	0.87932	D	0	.	2.281	0.04114	0.2006:0.4249:0.2305:0.144	.	.	.	.	A	54	ENSP00000427188:E54A;ENSP00000423049:E54A	ENSP00000427188:E54A	E	+	2	0	C5orf27	95220350	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.145000	0.10265	-0.828000	0.04273	-0.242000	0.12053	GAA	C5orf27	-	NULL	ENSG00000236882		0.622	C5orf27-001	KNOWN	basic|appris_principal	protein_coding	C5orf27	HGNC	protein_coding	OTTHUMT00000242845.3	-	0.00	45	0	A	NM_175616		95194594	+1	tier1	-	no_errors	ENST00000357880	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.000	C
CFAP69	79846	genome.wustl.edu	37	7	89894658	89894658	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:89894658G>A	ENST00000389297.4	+	5	651	c.400G>A	c.(400-402)Gct>Act	p.A134T	C7orf63_ENST00000463311.1_3'UTR|AC002064.4_ENST00000420245.1_RNA|C7orf63_ENST00000497910.1_Missense_Mutation_p.A134T|C7orf63_ENST00000316089.8_Missense_Mutation_p.A134T	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		134										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						AATAACTTATGCTGAAGATAC	0.328																																																	0													151.0	148.0	149.0					7																	89894658		1827	4094	5921	SO:0001583	missense	0																														ENST00000389297.4:c.400G>A	7.37:g.89894658G>A	ENSP00000373948:p.Ala134Thr		A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A134T	ENST00000389297.4	37	c.400	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337738	0.81911	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.29	4.39	0.52855	.	0.135474	0.47852	N	0.000201	T	0.16896	0.0406	L	0.48362	1.52	0.30781	N	0.741975	B;B;P	0.35656	0.088;0.01;0.514	B;B;B	0.31614	0.089;0.018;0.133	T	0.10823	-1.0613	10	0.39692	T	0.17	-6.7542	9.0308	0.36258	0.0812:0.0:0.7628:0.156	.	134;134;132	A5D8W1-5;A5D8W1;A5D8W1-4	.;CG063_HUMAN;.	T	134;134;134;74	ENSP00000373948:A134T;ENSP00000321753:A134T;ENSP00000419549:A134T;ENSP00000392365:A74T	ENSP00000321753:A134T	A	+	1	0	C7orf63	89732594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.574000	0.46016	1.184000	0.42957	0.591000	0.81541	GCT	C7orf63	-	NULL	ENSG00000105792		0.328	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	-	0.00	42	0	G			89894658	+1	tier1	-	no_errors	ENST00000389297	ensembl	human	known	74_37	missense	30.51	41	18	SNP	1.000	A
CACNA1A	773	genome.wustl.edu	37	19	13325067	13325067	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:13325067G>T	ENST00000360228.5	-	40	5919	c.5920C>A	c.(5920-5922)Cag>Aag	p.Q1974K	CACNA1A_ENST00000573710.2_Missense_Mutation_p.Q1975K	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1975					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CGCATGGCCTGCAGCTTCTTG	0.612																																																	0													35.0	39.0	37.0					19																	13325067		2182	4278	6460	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.5920C>A	19.37:g.13325067G>T	ENSP00000353362:p.Gln1974Lys		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.Q1974K	ENST00000360228.5	37	c.5920	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889126	0.52014	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.64991	-0.13	4.72	4.72	0.59763	Voltage-dependent calcium channel, alpha-1 subunit, IQ domain (1);	0.000000	0.64402	D	0.000001	T	0.72137	0.3423	L	0.40543	1.245	0.53688	D	0.999971	B;B;D;B	0.53885	0.387;0.175;0.963;0.21	B;B;D;B	0.71414	0.345;0.234;0.973;0.345	T	0.75473	-0.3305	10	0.72032	D	0.01	.	16.4549	0.84009	0.0:0.0:1.0:0.0	.	1975;1980;1974;1975	O00555;E9PD31;Q9NS88;E7EVF2	CAC1A_HUMAN;.;.;.	K	1974;1980;1975;1975	ENSP00000353362:Q1974K	ENSP00000317661:Q1975K	Q	-	1	0	CACNA1A	13186067	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	9.326000	0.96389	2.184000	0.69523	0.491000	0.48974	CAG	CACNA1A	-	pfam_VDCC_a1su_IQ	ENSG00000141837		0.612	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	43	0	G	NM_000068		13325067	-1			no_errors	ENST00000360228	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
CACNA2D3	55799	genome.wustl.edu	37	3	55002516	55002516	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:55002516A>C	ENST00000474759.1	+	28	2537	c.2489A>C	c.(2488-2490)aAg>aCg	p.K830T	CACNA2D3_ENST00000415676.2_Missense_Mutation_p.K830T|LRTM1_ENST00000493075.1_5'Flank|CACNA2D3_ENST00000490478.1_Missense_Mutation_p.K736T|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.K830T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	830						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TTCCAAAGGAAGTTCTGGACT	0.383																																																	0													69.0	66.0	67.0					3																	55002516		1833	4084	5917	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2489A>C	3.37:g.55002516A>C	ENSP00000419101:p.Lys830Thr		B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.K830T	ENST00000474759.1	37	c.2489	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	A	12.97	2.097422	0.37048	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.69387	0.3105	L	0.42686	1.345	0.43036	D	0.99461	B	0.20780	0.048	B	0.17098	0.017	T	0.64630	-0.6362	10	0.13470	T	0.59	.	14.3652	0.66801	1.0:0.0:0.0:0.0	.	830	Q8IZS8	CA2D3_HUMAN	T	830;830;830;736;736	ENSP00000389506:K830T;ENSP00000419101:K830T;ENSP00000288197:K830T;ENSP00000417279:K736T	ENSP00000288197:K830T	K	+	2	0	CACNA2D3	54977556	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.611000	0.82962	2.207000	0.71202	0.533000	0.62120	AAG	CACNA2D3	-	NULL	ENSG00000157445		0.383	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	52	0	A			55002516	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	36.17	30	17	SNP	1.000	C
CACNA2D3	55799	genome.wustl.edu	37	3	55052344	55052344	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:55052344A>C	ENST00000474759.1	+	35	3035	c.2987A>C	c.(2986-2988)aAg>aCg	p.K996T	CACNA2D3_ENST00000415676.2_Splice_Site_p.K996T|CACNA2D3_ENST00000490478.1_Splice_Site_p.K902T|CACNA2D3_ENST00000288197.5_Splice_Site_p.K996T|CACNA2D3_ENST00000478261.1_3'UTR	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	996						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GACTGCTCCAAGTAAGCCATC	0.502																																																	0													71.0	70.0	70.0					3																	55052344		1963	4158	6121	SO:0001630	splice_region_variant	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.2987+1A>C	3.37:g.55052344A>C			B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.K996T	ENST00000474759.1	37	c.2987	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	A	19.23	3.787779	0.70337	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.4	4.25	0.50352	.	0.103713	0.64402	D	0.000004	T	0.64735	0.2625	M	0.64997	1.995	0.39777	D	0.972247	D	0.67145	0.996	D	0.63703	0.917	T	0.67480	-0.5660	10	0.72032	D	0.01	-1.8211	9.6397	0.39831	0.9206:0.0:0.0794:0.0	.	996	Q8IZS8	CA2D3_HUMAN	T	996;996;996;902;902	ENSP00000389506:K996T;ENSP00000419101:K996T;ENSP00000288197:K996T;ENSP00000417279:K902T	ENSP00000288197:K996T	K	+	2	0	CACNA2D3	55027384	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.923000	0.75817	0.891000	0.36235	0.460000	0.39030	AAG	CACNA2D3	-	NULL	ENSG00000157445		0.502	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	47	0	A		Missense_Mutation	55052344	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	missense	40.62	38	26	SNP	1.000	C
CADM2	253559	genome.wustl.edu	37	3	85961683	85961683	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:85961683A>G	ENST00000407528.2	+	5	725	c.663A>G	c.(661-663)ctA>ctG	p.L221L	CADM2_ENST00000383699.3_Silent_p.L230L|CADM2_ENST00000405615.2_Silent_p.L223L	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	221					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGCAGGTGCTAGAAATACACT	0.463																																																	0													102.0	90.0	94.0					3																	85961683		2203	4300	6503	SO:0001819	synonymous_variant	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.663A>G	3.37:g.85961683A>G			G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.L223	ENST00000407528.2	37	c.669	CCDS54614.1	3																																																																																			CADM2	-	NULL	ENSG00000175161		0.463	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	-	0.00	19	0	A	NM_153184		85961683	+1	tier1	-	no_errors	ENST00000405615	ensembl	human	known	74_37	silent	16.00	21	4	SNP	1.000	G
CBLN1	869	genome.wustl.edu	37	16	49315182	49315182	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:49315182A>G	ENST00000219197.6	-	1	560	c.195T>C	c.(193-195)tcT>tcC	p.S65S	CBLN1_ENST00000536749.1_Silent_p.S65S	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	65	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				TCCTGATGGCAGAGAAAGCCA	0.622																																																	0													60.0	61.0	60.0					16																	49315182		2200	4300	6500	SO:0001819	synonymous_variant	0			M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.195T>C	16.37:g.49315182A>G			B2RAN9|P02682|Q52M09	Silent	SNP	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.S65	ENST00000219197.6	37	c.195	CCDS10736.1	16																																																																																			CBLN1	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q	ENSG00000102924		0.622	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN1	HGNC	protein_coding	OTTHUMT00000256845.4	-	0.00	101	0	A	NM_004352		49315182	-1	tier1	-	no_errors	ENST00000219197	ensembl	human	known	74_37	silent	38.81	41	26	SNP	0.992	G
CCDC150	284992	genome.wustl.edu	37	2	197511190	197511190	+	Silent	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:197511190G>T	ENST00000389175.4	+	2	273	c.138G>T	c.(136-138)ctG>ctT	p.L46L	CCDC150_ENST00000423093.2_5'UTR|CCDC150_ENST00000472405.2_Intron|CCDC150_ENST00000272831.7_5'UTR	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	46										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						CCAGTTCACTGAGGGATGACC	0.398																																																	0													119.0	109.0	112.0					2																	197511190		1885	4115	6000	SO:0001819	synonymous_variant	0				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.138G>T	2.37:g.197511190G>T			Q6P5U6|Q6P663|Q8N8V5	Silent	SNP	NULL	p.L46	ENST00000389175.4	37	c.138	CCDS46478.1	2																																																																																			CCDC150	-	NULL	ENSG00000144395		0.398	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	-	0.00	53	0	G	NM_001080539		197511190	+1	tier1	-	no_errors	ENST00000389175	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.994	T
CCDC155	147872	genome.wustl.edu	37	19	49912535	49912535	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:49912535C>T	ENST00000447857.3	+	14	1346	c.1141C>T	c.(1141-1143)Cga>Tga	p.R381*		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	381						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CGAGGCCATTCGACAGGTGGG	0.597																																																	0													41.0	45.0	44.0					19																	49912535		2001	4176	6177	SO:0001587	stop_gained	0				CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.1141C>T	19.37:g.49912535C>T	ENSP00000404220:p.Arg381*		Q96MC3	Nonsense_Mutation	SNP	NULL	p.R381*	ENST00000447857.3	37	c.1141	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.388162	0.97529	.	.	ENSG00000161609	ENST00000447857	.	.	.	5.38	3.26	0.37387	.	1.415760	0.04622	N	0.402211	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-19.2538	8.7002	0.34320	0.0:0.8369:0.0:0.1631	.	.	.	.	X	381	.	ENSP00000404220:R381X	R	+	1	2	CCDC155	54604347	0.360000	0.24964	0.064000	0.19789	0.696000	0.40369	0.813000	0.27225	0.780000	0.33566	0.585000	0.79938	CGA	CCDC155	-	NULL	ENSG00000161609		0.597	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	-	0.00	40	0	C	NM_144688		49912535	+1	tier1	-	no_errors	ENST00000447857	ensembl	human	known	74_37	nonsense	34.09	29	15	SNP	0.139	T
CCDC178	374864	genome.wustl.edu	37	18	30928927	30928927	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:30928927A>G	ENST00000383096.3	-	8	566	c.384T>C	c.(382-384)tcT>tcC	p.S128S	CCDC178_ENST00000406524.2_Silent_p.S128S|CCDC178_ENST00000300227.8_Silent_p.S128S|CCDC178_ENST00000579947.1_Silent_p.S128S|CCDC178_ENST00000579916.1_Intron|CCDC178_ENST00000583930.1_Silent_p.S128S|CCDC178_ENST00000403303.1_Silent_p.S128S|CCDC178_ENST00000402325.1_Silent_p.S128S			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	128																	CTTTTGTGGAAGAAGTTCTGC	0.343																																																	0													129.0	111.0	117.0					18																	30928927		2202	4300	6502	SO:0001819	synonymous_variant	0			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.384T>C	18.37:g.30928927A>G			A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	NULL	p.S128	ENST00000383096.3	37	c.384	CCDS42424.1	18																																																																																			CCDC178	-	NULL	ENSG00000166960		0.343	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	-	0.00	35	0	A	NM_198995		30928927	-1	tier1	-	no_errors	ENST00000406524	ensembl	human	known	74_37	silent	16.22	31	6	SNP	0.028	G
CCDC61	729440	genome.wustl.edu	37	19	46511520	46511520	+	Missense_Mutation	SNP	G	G	A	rs373065477		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:46511520G>A	ENST00000595358.1	+	5	561	c.512G>A	c.(511-513)cGg>cAg	p.R171Q	CCDC61_ENST00000536603.1_Missense_Mutation_p.R171Q|CCDC61_ENST00000594087.1_Missense_Mutation_p.R171Q|CCDC61_ENST00000263284.2_Missense_Mutation_p.R228Q	NM_001267723.1	NP_001254652.1	Q9Y6R9	CCD61_HUMAN	coiled-coil domain containing 61	171						centrosome (GO:0005813)				endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00221)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.164)		CAGAACACTCGGGACACCCGG	0.667																																																	0								G	GLN/ARG	0,3772		0,0,1886	24.0	27.0	26.0		683	1.9	0.7	19		26	1,8221		0,1,4110	no	missense	CCDC61	NM_001080402.1	43	0,1,5996	AA,AG,GG		0.0122,0.0,0.0083	benign	228/532	46511520	1,11993	1886	4111	5997	SO:0001583	missense	0				CCDS46120.1, CCDS46120.2	19q13.32	2014-09-04			ENSG00000104983	ENSG00000104983			33629	protein-coding gene	gene with protein product							Standard	NM_001267723		Approved		uc031rlj.1	Q9Y6R9	OTTHUMG00000182488	ENST00000595358.1:c.512G>A	19.37:g.46511520G>A	ENSP00000471454:p.Arg171Gln		C8CAP4|Q9HDB6	Missense_Mutation	SNP	NULL	p.R228Q	ENST00000595358.1	37	c.683	CCDS46120.2	19	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519922	0.27211	0.0	1.22E-4	ENSG00000104983	ENST00000263284;ENST00000536603	.	.	.	4.06	1.88	0.25563	.	0.547315	0.19774	N	0.106369	T	0.21962	0.0529	N	0.22421	0.69	0.22710	N	0.998821	B	0.17268	0.021	B	0.10450	0.005	T	0.20874	-1.0262	9	0.10902	T	0.67	-10.2806	5.8324	0.18588	0.3483:0.0:0.6517:0.0	.	171	Q9Y6R9	CCD61_HUMAN	Q	228;171	.	ENSP00000263284:R228Q	R	+	2	0	CCDC61	51203360	1.000000	0.71417	0.703000	0.30354	0.663000	0.39108	2.805000	0.47939	0.472000	0.27344	-0.300000	0.09419	CGG	CCDC61	-	NULL	ENSG00000104983		0.667	CCDC61-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CCDC61	HGNC	protein_coding	OTTHUMT00000461689.1	-	0.00	62	0	G	NM_001080402		46511520	+1	tier1	-	no_errors	ENST00000263284	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.518	A
CECR2	27443	genome.wustl.edu	37	22	18022577	18022577	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr22:18022577delT	ENST00000400585.2	+	16	2694	c.2256delT	c.(2254-2256)cctfs	p.P752fs	CECR2_ENST00000400573.5_Frame_Shift_Del_p.P893fs|CECR2_ENST00000262608.8_Frame_Shift_Del_p.P894fs			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	935					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		TACCTGGCCCTTTTCCGCAGG	0.637																																																	0													86.0	91.0	89.0					22																	18022577		2016	4165	6181	SO:0001589	frameshift_variant	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.2256delT	22.37:g.18022577delT	ENSP00000383428:p.Pro752fs		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Frame_Shift_Del	DEL	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P895fs	ENST00000400585.2	37	c.2679		22																																																																																			CECR2	-	NULL	ENSG00000099954		0.637	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2		0.00	44	0	T	NM_031413		18022577	+1	tier1		no_errors	ENST00000400573	ensembl	human	novel	74_37	frame_shift_del	6.67	28	2	DEL	0.995	-
CFHR2	3080	genome.wustl.edu	37	1	196884098	196884098	+	Intron	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:196884098A>C	ENST00000367421.3	+	2	135				CFHR4_ENST00000367418.2_Missense_Mutation_p.K210T|CFHR4_ENST00000251424.4_Missense_Mutation_p.K210T|CFHR4_ENST00000367416.2_Missense_Mutation_p.K456T|CFHR4_ENST00000608469.1_Missense_Mutation_p.K80T			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TCTTCAGAAAAGTGTGGGCCT	0.363																																																	0													38.0	39.0	38.0					1																	196884098		2194	4277	6471	SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-34487A>C	1.37:g.196884098A>C			Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.K456T	ENST00000367421.3	37	c.1367		1	.	.	.	.	.	.	.	.	.	.	A	10.38	1.334920	0.24253	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	T;T;T	0.65178	-0.14;-0.14;-0.14	3.16	0.489	0.16854	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	T	0.42944	0.1225	L	0.33189	0.99	0.09310	N	1	B;P;B	0.44478	0.23;0.836;0.146	B;B;B	0.40982	0.082;0.345;0.057	T	0.23013	-1.0200	9	0.20046	T	0.44	.	2.9606	0.05891	0.6411:0.0:0.141:0.2179	.	456;457;210	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	T	456;210;210;210	ENSP00000356386:K456T;ENSP00000356388:K210T;ENSP00000251424:K210T	ENSP00000251424:K210T	K	+	2	0	CFHR4	195150721	0.000000	0.05858	0.010000	0.14722	0.464000	0.32679	0.180000	0.16860	0.205000	0.20568	0.166000	0.16787	AAG	CFHR4	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000134365		0.363	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding		-	0.00	49	0	A	NM_005666		196884098	+1	tier1	-	no_errors	ENST00000367416	ensembl	human	known	74_37	missense	17.02	39	8	SNP	0.018	C
CHRNA4	1137	genome.wustl.edu	37	20	61987723	61987723	+	Splice_Site	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:61987723C>A	ENST00000370263.4	-	3	494	c.273G>T	c.(271-273)caG>caT	p.Q91H	CHRNA4_ENST00000463705.1_Intron	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	91					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TCCCACTCACCTGCTTCACCC	0.667																																																	0													63.0	44.0	50.0					20																	61987723		2195	4290	6485	SO:0001630	splice_region_variant	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.273+1G>T	20.37:g.61987723C>A			Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.Q91H	ENST00000370263.4	37	c.273	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	c	16.73	3.204004	0.58234	.	.	ENSG00000101204	ENST00000370263	T	0.79653	-1.29	4.32	3.36	0.38483	Neurotransmitter-gated ion-channel ligand-binding (3);	0.237559	0.36519	N	0.002551	D	0.82430	0.5035	L	0.53249	1.67	0.52099	D	0.999947	P	0.50156	0.932	P	0.57425	0.82	T	0.79417	-0.1812	9	.	.	.	.	8.7007	0.34323	0.0:0.761:0.1538:0.0852	.	91	P43681	ACHA4_HUMAN	H	91	ENSP00000359285:Q91H	.	Q	-	3	2	CHRNA4	61458167	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.729000	0.38115	0.767000	0.33267	0.443000	0.29094	CAG	CHRNA4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000101204		0.667	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3		0.00	41	0	C		Missense_Mutation	61987723	-1			no_errors	ENST00000370263	ensembl	human	known	74_37	missense	25.00	30	10	SNP	1.000	A
CLIC4	25932	genome.wustl.edu	37	1	25166462	25166462	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:25166462G>A	ENST00000374379.4	+	5	724	c.527G>A	c.(526-528)cGt>cAt	p.R176H		NM_013943.2	NP_039234.1	Q9Y696	CLIC4_HUMAN	chloride intracellular channel 4	176	GST C-terminal.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cell differentiation (GO:0030154)|cellular response to calcium ion (GO:0071277)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|endothelial cell morphogenesis (GO:0001886)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|fertilization (GO:0009566)|keratinocyte differentiation (GO:0030216)|multicellular organism growth (GO:0035264)|negative regulation of cell migration (GO:0030336)|regulation of cytoskeleton organization (GO:0051493)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|vacuolar acidification (GO:0007035)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|microvillus (GO:0005902)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			large_intestine(3)|lung(2)|skin(1)	6		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000778)|all_lung(284;0.00106)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0479)|OV - Ovarian serous cystadenocarcinoma(117;1.06e-24)|Colorectal(126;1.03e-07)|COAD - Colon adenocarcinoma(152;4.93e-06)|STAD - Stomach adenocarcinoma(196;0.000418)|GBM - Glioblastoma multiforme(114;0.000451)|BRCA - Breast invasive adenocarcinoma(304;0.00215)|KIRC - Kidney renal clear cell carcinoma(1967;0.00216)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.18)		TTTTCTACACGTAAATTTCTG	0.418																																																	0													93.0	84.0	87.0					1																	25166462		2203	4300	6503	SO:0001583	missense	0			AF097330	CCDS256.1	1p	2012-09-26			ENSG00000169504	ENSG00000169504		"""Ion channels / Chloride channels : Intracellular"""	13518	protein-coding gene	gene with protein product		606536				9139710, 10070163	Standard	NM_013943		Approved	DKFZP566G223, CLIC4L, P64H1, H1, huH1, p64H1	uc001bjo.2	Q9Y696	OTTHUMG00000003327	ENST00000374379.4:c.527G>A	1.37:g.25166462G>A	ENSP00000363500:p.Arg176His		Q9UFW9|Q9UQJ6	Missense_Mutation	SNP	superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	p.R176H	ENST00000374379.4	37	c.527	CCDS256.1	1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.502558	0.85176	.	.	ENSG00000169504	ENST00000374379;ENST00000444041	D	0.94613	-3.47	5.63	5.63	0.86233	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98204	0.9406	H	0.94620	3.56	0.52099	D	0.999946	D;P	0.89917	1.0;0.845	D;B	0.91635	0.999;0.103	D	0.98837	1.0753	10	0.72032	D	0.01	-8.5128	19.6864	0.95981	0.0:0.0:1.0:0.0	.	156;176	B3KTR3;Q9Y696	.;CLIC4_HUMAN	H	176	ENSP00000363500:R176H	ENSP00000363500:R176H	R	+	2	0	CLIC4	25039049	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.669000	0.90835	0.585000	0.79938	CGT	CLIC4	-	superfamily_Glutathione-S-Trfase_C-like,prints_Int_Cl_channel,tigrfam_Int_Cl_channel	ENSG00000169504		0.418	CLIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIC4	HGNC	protein_coding	OTTHUMT00000009332.1	-	0.00	40	0	G	NM_013943		25166462	+1	tier1	-	no_errors	ENST00000374379	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
CNTN3	5067	genome.wustl.edu	37	3	74347112	74347112	+	Missense_Mutation	SNP	T	T	G	rs202118462		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:74347112T>G	ENST00000263665.6	-	17	2424	c.2397A>C	c.(2395-2397)gaA>gaC	p.E799D		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	799	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.E799D(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CCATACCTTCTTCTGCAGAGA	0.358																																																	1	Substitution - Missense(1)	large_intestine(1)											118.0	116.0	117.0					3																	74347112		2203	4300	6503	SO:0001583	missense	0			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2397A>C	3.37:g.74347112T>G	ENSP00000263665:p.Glu799Asp		B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E799D	ENST00000263665.6	37	c.2397	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	T	15.08	2.728644	0.48833	.	.	ENSG00000113805	ENST00000263665	T	0.56103	0.48	5.82	-0.829	0.10796	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.56587	0.1995	M	0.86805	2.84	0.47374	D	0.999404	B	0.25521	0.128	B	0.29524	0.103	T	0.61422	-0.7066	10	0.66056	D	0.02	.	12.8491	0.57848	0.0:0.509:0.0:0.491	.	799	Q9P232	CNTN3_HUMAN	D	799	ENSP00000263665:E799D	ENSP00000263665:E799D	E	-	3	2	CNTN3	74429802	0.997000	0.39634	0.998000	0.56505	0.998000	0.95712	0.305000	0.19254	-0.093000	0.12396	0.533000	0.62120	GAA	CNTN3	-	superfamily_Fibronectin_type3	ENSG00000113805		0.358	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	-	0.00	34	0	T	NM_020872		74347112	-1	tier1	-	no_errors	ENST00000263665	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.975	G
CNTRL	11064	genome.wustl.edu	37	9	123929934	123929934	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:123929934C>T	ENST00000373855.1	+	37	6083	c.5823C>T	c.(5821-5823)ctC>ctT	p.L1941L	CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Silent_p.L1389L|CNTRL_ENST00000238341.5_Silent_p.L1941L			Q7Z7A1	CNTRL_HUMAN	centriolin	1941					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AAAACAAGCTCAAACTAGTCC	0.373																																																	0													62.0	58.0	59.0					9																	123929934		2203	4300	6503	SO:0001819	synonymous_variant	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5823C>T	9.37:g.123929934C>T			A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.L1941	ENST00000373855.1	37	c.5823	CCDS35118.1	9																																																																																			CNTRL	-	NULL	ENSG00000119397		0.373	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1		0.00	33	0	C	NM_007018		123929934	+1			no_errors	ENST00000238341	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.000	T
COL12A1	1303	genome.wustl.edu	37	6	75822931	75822931	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:75822931T>G	ENST00000322507.8	-	51	8248	c.7939A>C	c.(7939-7941)Agt>Cgt	p.S2647R	COL12A1_ENST00000483888.2_Missense_Mutation_p.S2647R|COL12A1_ENST00000416123.2_Missense_Mutation_p.S2647R|COL12A1_ENST00000345356.6_Missense_Mutation_p.S1483R	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2647	Laminin G-like.|Nonhelical region (NC3).			SF -> RK (in Ref. 5; AAB23937). {ECO:0000305}.	cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TTGTGAAAACTTCCATAAAAT	0.279																																																	0													72.0	65.0	67.0					6																	75822931		1794	4047	5841	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.7939A>C	6.37:g.75822931T>G	ENSP00000325146:p.Ser2647Arg		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S2647R	ENST00000322507.8	37	c.7939	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	24.9	4.576700	0.86645	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888;ENST00000493109	T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	M	0.65975	2.015	0.54753	D	0.999987	D;P	0.56287	0.975;0.822	P;B	0.56700	0.804;0.227	T	0.21042	-1.0257	10	0.87932	D	0	.	16.0755	0.80965	0.0:0.0:0.0:1.0	.	1483;2647	Q99715-2;Q99715	.;COCA1_HUMAN	R	2647;285;2647;1483;2647;2647;201	ENSP00000325146:S2647R;ENSP00000399812:S285R;ENSP00000305147:S1483R;ENSP00000412864:S2647R;ENSP00000421216:S2647R;ENSP00000423423:S201R	ENSP00000325146:S2647R	S	-	1	0	COL12A1	75879651	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.697000	0.84279	2.182000	0.69389	0.528000	0.53228	AGT	COL12A1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000111799		0.279	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	-	0.00	32	0	T	NM_004370		75822931	-1	tier1	-	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	30.56	25	11	SNP	1.000	G
COL14A1	7373	genome.wustl.edu	37	8	121238870	121238870	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:121238870A>C	ENST00000297848.3	+	16	2139	c.1869A>C	c.(1867-1869)gaA>gaC	p.E623D	COL14A1_ENST00000309791.4_Missense_Mutation_p.E623D|COL14A1_ENST00000247781.3_Missense_Mutation_p.E528D|COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TTACAGAGGAAGTTCCAGCCC	0.468																																																	0													76.0	71.0	73.0					8																	121238870		2203	4300	6503	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1869A>C	8.37:g.121238870A>C	ENSP00000297848:p.Glu623Asp			Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.E623D	ENST00000297848.3	37	c.1869	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	A	10.04	1.241705	0.22711	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.63	3.18	0.36537	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.656387	0.16113	N	0.228974	T	0.24774	0.0601	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.03673	-1.1014	10	0.27082	T	0.32	.	7.6698	0.28453	0.7311:0.1941:0.0748:0.0	.	623;623	Q05707-2;Q05707	.;COEA1_HUMAN	D	623;623;528;436	ENSP00000311809:E623D;ENSP00000297848:E623D;ENSP00000247781:E528D;ENSP00000409461:E436D	ENSP00000247781:E528D	E	+	3	2	COL14A1	121308051	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	0.687000	0.25407	0.393000	0.25203	0.455000	0.32223	GAA	COL14A1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187955		0.468	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	-	0.00	40	0	A	NM_021110		121238870	+1	tier1	-	no_errors	ENST00000297848	ensembl	human	known	74_37	missense	30.16	44	19	SNP	1.000	C
COL23A1	91522	genome.wustl.edu	37	5	177689227	177689227	+	Silent	SNP	G	G	A	rs140937912		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:177689227G>A	ENST00000390654.3	-	10	1023	c.666C>T	c.(664-666)gaC>gaT	p.D222D	COL23A1_ENST00000407622.1_Silent_p.D186D	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	222	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.D222E(1)		breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		CCATCTCGCCGTCTTGTCCGG	0.597																																																	1	Substitution - Missense(1)	skin(1)						G		1,3939		0,1,1969	54.0	58.0	57.0		666	-5.7	0.0	5	dbSNP_134	57	0,8310		0,0,4155	no	coding-synonymous	COL23A1	NM_173465.3		0,1,6124	AA,AG,GG		0.0,0.0254,0.0082		222/541	177689227	1,12249	1970	4155	6125	SO:0001819	synonymous_variant	0			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.666C>T	5.37:g.177689227G>A			Q8IVR4|Q9NT93	Silent	SNP	pfam_Collagen	p.D222	ENST00000390654.3	37	c.666	CCDS4436.1	5																																																																																			COL23A1	-	pfam_Collagen	ENSG00000050767		0.597	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	HGNC	protein_coding	OTTHUMT00000253475.1	-	0.00	11	0	G	NM_173465		177689227	-1	tier1	-	no_errors	ENST00000390654	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.001	A
CPO	130749	genome.wustl.edu	37	2	207814372	207814372	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:207814372G>A	ENST00000272852.3	+	2	146	c.100G>A	c.(100-102)Gac>Aac	p.D34N		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	34						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		AGAGATTGTGGACAAGTCAGT	0.498																																																	0													139.0	121.0	127.0					2																	207814372		2203	4300	6503	SO:0001583	missense	0				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.100G>A	2.37:g.207814372G>A	ENSP00000272852:p.Asp34Asn		Q2M277|Q7RTW7	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	p.D34N	ENST00000272852.3	37	c.100	CCDS2372.1	2	.	.	.	.	.	.	.	.	.	.	G	5.554	0.287080	0.10513	.	.	ENSG00000144410	ENST00000272852	T	0.14893	2.47	3.48	3.48	0.39840	.	0.653848	0.14206	N	0.334400	T	0.10294	0.0252	N	0.12182	0.205	0.09310	N	1	B	0.15141	0.012	B	0.09377	0.004	T	0.19451	-1.0305	10	0.30078	T	0.28	.	12.8408	0.57802	0.0:0.0:1.0:0.0	.	34	Q8IVL8	CBPO_HUMAN	N	34	ENSP00000272852:D34N	ENSP00000272852:D34N	D	+	1	0	CPO	207522617	1.000000	0.71417	0.104000	0.21259	0.433000	0.31745	4.685000	0.61693	1.958000	0.56883	0.455000	0.32223	GAC	CPO	-	NULL	ENSG00000144410		0.498	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	HGNC	protein_coding	OTTHUMT00000202040.2	-	0.00	63	0	G	NM_173077		207814372	+1	tier1	-	no_errors	ENST00000272852	ensembl	human	known	74_37	missense	19.23	42	10	SNP	0.211	A
COL6A3	1293	genome.wustl.edu	37	2	238275437	238275437	+	Missense_Mutation	SNP	C	C	T	rs371441617		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:238275437C>T	ENST00000295550.4	-	11	5845	c.5393G>A	c.(5392-5394)cGc>cAc	p.R1798H	COL6A3_ENST00000409809.1_Missense_Mutation_p.R1592H|COL6A3_ENST00000353578.4_Missense_Mutation_p.R1592H|COL6A3_ENST00000472056.1_Missense_Mutation_p.R1191H|COL6A3_ENST00000346358.4_Missense_Mutation_p.R1598H|COL6A3_ENST00000347401.3_Missense_Mutation_p.R1597H	NM_004369.3	NP_004360.2	P12111	CO6A3_HUMAN	collagen, type VI, alpha 3	1798	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|response to glucose (GO:0009749)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.R1798H(1)		breast(6)|central_nervous_system(7)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(64)|lung(62)|ovary(14)|pancreas(2)|prostate(11)|skin(14)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	217		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)		GTTGCCCACGCGGAACGCTGT	0.547																																																	1	Substitution - Missense(1)	large_intestine(1)											97.0	89.0	92.0					2																	238275437		2203	4300	6503	SO:0001583	missense	0			X52022	CCDS33409.1, CCDS33410.1, CCDS33411.1, CCDS33412.1, CCDS33410.2, CCDS33411.2, CCDS54439.1	2q37	2014-09-17			ENSG00000163359	ENSG00000163359		"""Collagens"""	2213	protein-coding gene	gene with protein product		120250				1339440, 11992252	Standard	NM_004369		Approved		uc002vwl.2	P12111	OTTHUMG00000150020	ENST00000295550.4:c.5393G>A	2.37:g.238275437C>T	ENSP00000295550:p.Arg1798His		A8MT30|B4E3U5|B7ZMJ7|E9PFQ6|E9PGQ9|Q16501|Q53QF4|Q53QF6	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R1798H	ENST00000295550.4	37	c.5393	CCDS33412.1	2	.	.	.	.	.	.	.	.	.	.	C	11.30	1.597341	0.28445	.	.	ENSG00000163359	ENST00000295550;ENST00000347401;ENST00000353578;ENST00000472056;ENST00000409809;ENST00000346358	D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.51	3.69	0.42338	von Willebrand factor, type A (3);	0.000000	0.48286	D	0.000191	D	0.86351	0.5912	N	0.26130	0.795	0.43088	D	0.994755	D;D;D	0.89917	1.0;1.0;0.996	D;D;P	0.97110	1.0;0.999;0.845	T	0.83021	-0.0167	10	0.23302	T	0.38	.	14.8057	0.69952	0.263:0.737:0.0:0.0	.	1191;1592;1798	E9PFQ6;P12111-2;P12111	.;.;CO6A3_HUMAN	H	1798;1597;1592;1191;1592;1598	ENSP00000295550:R1798H;ENSP00000315609:R1597H;ENSP00000315873:R1592H;ENSP00000418285:R1191H;ENSP00000386844:R1592H;ENSP00000295546:R1598H	ENSP00000295550:R1798H	R	-	2	0	COL6A3	237940176	1.000000	0.71417	0.506000	0.27664	0.147000	0.21601	4.669000	0.61575	0.663000	0.31027	0.650000	0.86243	CGC	COL6A3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000163359		0.547	COL6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A3	HGNC	protein_coding	OTTHUMT00000315790.2	-	0.00	26	0	C	NM_004369		238275437	-1	tier1	-	no_errors	ENST00000295550	ensembl	human	known	74_37	missense	38.18	34	21	SNP	0.822	T
CPXM2	119587	genome.wustl.edu	37	10	125521388	125521388	+	Splice_Site	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:125521388T>G	ENST00000241305.3	-	11	1931	c.1777A>C	c.(1777-1779)Agt>Cgt	p.S593R	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	593					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		GGAGGCTTACTTCCAGCGACG	0.652																																																	0													25.0	24.0	25.0					10																	125521388		2203	4300	6503	SO:0001630	splice_region_variant	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1777+1A>C	10.37:g.125521388T>G			B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.S593R	ENST00000241305.3	37	c.1777	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	T	20.4	3.976277	0.74360	.	.	ENSG00000121898	ENST00000368854;ENST00000241305;ENST00000540123;ENST00000418782	T	0.12039	2.72	5.36	5.36	0.76844	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.31295	0.0792	M	0.89904	3.07	0.80722	D	1	B	0.27450	0.179	B	0.37451	0.25	T	0.11767	-1.0574	9	.	.	.	-21.0538	15.5188	0.75846	0.0:0.0:0.0:1.0	.	593	Q8N436	CPXM2_HUMAN	R	89;593;426;568	ENSP00000241305:S593R	.	S	-	1	0	CPXM2	125511378	1.000000	0.71417	1.000000	0.80357	0.196000	0.23810	7.848000	0.86902	2.251000	0.74343	0.496000	0.49642	AGT	CPXM2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000121898		0.652	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	-	0.00	50	0	T	NM_198148	Missense_Mutation	125521388	-1	tier1	-	no_errors	ENST00000241305	ensembl	human	known	74_37	missense	23.73	45	14	SNP	1.000	G
CRCT1	54544	genome.wustl.edu	37	1	152488000	152488000	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:152488000C>T	ENST00000368790.3	+	2	214	c.141C>T	c.(139-141)tgC>tgT	p.C47C		NM_019060.2	NP_061933.1	Q9UGL9	CRCT1_HUMAN	cysteine-rich C-terminal 1	47	Cys-rich.									lung(1)|ovary(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGGCTGCTGCGGCGACTCAG	0.751																																																	0													5.0	7.0	6.0					1																	152488000		1807	3830	5637	SO:0001819	synonymous_variant	0			AJ243662	CCDS1012.1	1q21	2008-02-05	2006-12-18	2006-12-18	ENSG00000169509	ENSG00000169509			29875	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 42"""	C1orf42		11230159	Standard	NM_019060		Approved	NICE-1	uc001ezz.3	Q9UGL9	OTTHUMG00000012391	ENST00000368790.3:c.141C>T	1.37:g.152488000C>T			A4QN00|Q6IAD7	Silent	SNP	NULL	p.C47	ENST00000368790.3	37	c.141	CCDS1012.1	1																																																																																			CRCT1	-	NULL	ENSG00000169509		0.751	CRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRCT1	HGNC	protein_coding	OTTHUMT00000034511.1	-	0.00	19	0	C	NM_019060		152488000	+1	tier1	-	no_errors	ENST00000368790	ensembl	human	known	74_37	silent	52.63	9	10	SNP	0.229	T
CRB1	23418	genome.wustl.edu	37	1	197404057	197404057	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:197404057A>C	ENST00000367400.3	+	9	3199	c.3064A>C	c.(3064-3066)Agt>Cgt	p.S1022R	CRB1_ENST00000367397.1_Missense_Mutation_p.S403R|CRB1_ENST00000367399.2_Missense_Mutation_p.S910R|CRB1_ENST00000544212.1_Missense_Mutation_p.S503R|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000535699.1_Missense_Mutation_p.S998R	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1022	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTATATGCTAAGTCTGACAAG	0.413																																																	0													72.0	75.0	74.0					1																	197404057		2203	4300	6503	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3064A>C	1.37:g.197404057A>C	ENSP00000356370:p.Ser1022Arg		A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.S1022R	ENST00000367400.3	37	c.3064	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	A	8.537	0.872266	0.17322	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	5.44	3.16	0.36331	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.75838	0.3904	L	0.58428	1.81	0.37434	D	0.914168	P;P;B;P	0.47106	0.617;0.617;0.016;0.89	B;B;B;P	0.47299	0.173;0.173;0.026;0.543	T	0.72846	-0.4169	9	0.18710	T	0.47	.	12.3318	0.55043	0.682:0.318:0.0:0.0	.	998;910;671;1022	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	R	998;1022;910;503;403;671	ENSP00000438786:S998R;ENSP00000356370:S1022R;ENSP00000356369:S910R;ENSP00000444556:S503R;ENSP00000356367:S403R	ENSP00000356367:S403R	S	+	1	0	CRB1	195670680	1.000000	0.71417	0.114000	0.21550	0.004000	0.04260	4.794000	0.62482	0.394000	0.25230	-0.313000	0.08912	AGT	CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000134376		0.413	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	40	0	A	NM_201253		197404057	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	missense	18.60	35	8	SNP	1.000	C
CRNKL1	51340	genome.wustl.edu	37	20	20033128	20033128	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:20033128A>C	ENST00000377340.2	-	2	373	c.342T>G	c.(340-342)ggT>ggG	p.G114G	C20orf26_ENST00000377309.2_5'Flank|C20orf26_ENST00000377306.1_5'Flank|CRNKL1_ENST00000377327.4_Silent_p.G102G|C20orf26_ENST00000389656.3_5'Flank|C20orf26_ENST00000245957.5_5'Flank|CRNKL1_ENST00000536226.1_5'Flank	NM_001278628.1|NM_016652.4	NP_001265557.1|NP_057736.4	Q9BZJ0	CRNL1_HUMAN	crooked neck pre-mRNA splicing factor 1	114					mRNA splicing, via spliceosome (GO:0000398)|spliceosomal complex assembly (GO:0000245)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|cervix(2)|endometrium(7)|large_intestine(11)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(6)	45						CTGACCTTTGACCTCTCGCTT	0.597																																																	0													81.0	78.0	79.0					20																	20033128		2203	4300	6503	SO:0001819	synonymous_variant	0			AF255443	CCDS33446.1, CCDS63238.1, CCDS63239.1	20p11.2	2013-10-03	2013-10-03		ENSG00000101343	ENSG00000101343			15762	protein-coding gene	gene with protein product	"""SYF3 pre-mRNA-splicing factor"""	610952	"""crooked neck (Drosophila Crn homolog)-like 1"", ""Crn, crooked neck-like 1 (Drosophila)"", ""crooked neck pre-mRNA splicing factor-like 1 (Drosophila)"""				Standard	NM_016652		Approved	CRN, CLF, SYF3, Clf1	uc002wrs.3	Q9BZJ0	OTTHUMG00000032000	ENST00000377340.2:c.342T>G	20.37:g.20033128A>C			A8K9T4|Q5JY64|Q8WYI5|Q9BZI9|Q9BZJ1|Q9BZJ2|Q9GZW7|Q9H8F8|Q9NQH5|Q9NYD8	Missense_Mutation	SNP	NULL	p.V71G	ENST00000377340.2	37	c.212	CCDS33446.1	20																																																																																			CRNKL1	-	NULL	ENSG00000101343		0.597	CRNKL1-002	KNOWN	basic|CCDS	protein_coding	CRNKL1	HGNC	protein_coding	OTTHUMT00000127787.1	-	0.00	116	0	A			20033128	-1	tier1	-	no_errors	ENST00000496549	ensembl	human	known	74_37	missense	16.41	107	21	SNP	0.879	C
CTR9	9646	genome.wustl.edu	37	11	10786207	10786207	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:10786207C>T	ENST00000361367.2	+	12	1952	c.1526C>T	c.(1525-1527)gCg>gTg	p.A509V		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	509					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)		p.A509V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		CTATATGAGGCGATGTGTGAA	0.398																																																	1	Substitution - Missense(1)	lung(1)											86.0	76.0	79.0					11																	10786207		2201	4294	6495	SO:0001583	missense	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.1526C>T	11.37:g.10786207C>T	ENSP00000355013:p.Ala509Val		D3DQV8|Q15015	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A509V	ENST00000361367.2	37	c.1526	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	C	14.39	2.521035	0.44866	.	.	ENSG00000198730	ENST00000361367	T	0.17854	2.25	5.88	4.0	0.46444	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.047019	0.85682	D	0.000000	T	0.12603	0.0306	L	0.59912	1.85	0.58432	D	0.999993	P	0.43314	0.803	B	0.31614	0.133	T	0.10200	-1.0640	10	0.29301	T	0.29	-8.7212	6.9186	0.24374	0.1315:0.6749:0.1266:0.0669	.	509	Q6PD62	CTR9_HUMAN	V	509	ENSP00000355013:A509V	ENSP00000355013:A509V	A	+	2	0	CTR9	10742783	1.000000	0.71417	0.655000	0.29622	0.388000	0.30384	6.005000	0.70716	0.812000	0.34326	-0.181000	0.13052	GCG	CTR9	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000198730		0.398	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1	-	0.00	30	0	C	NM_014633		10786207	+1	tier1	-	no_errors	ENST00000361367	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.990	T
CUBN	8029	genome.wustl.edu	37	10	16970293	16970293	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:16970293T>G	ENST00000377833.4	-	41	6199	c.6134A>C	c.(6133-6135)aAc>aCc	p.N2045T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2045	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTGGGCCAAGTTATTATCTCC	0.468																																																	0													58.0	55.0	56.0					10																	16970293		2203	4300	6503	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6134A>C	10.37:g.16970293T>G	ENSP00000367064:p.Asn2045Thr		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.N2045T	ENST00000377833.4	37	c.6134	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	T	7.897	0.733542	0.15574	.	.	ENSG00000107611	ENST00000377833	T	0.17854	2.25	5.7	-1.02	0.10135	CUB (5);	0.899723	0.09233	N	0.830339	T	0.08537	0.0212	L	0.27053	0.805	0.09310	N	1	P	0.35468	0.503	B	0.31101	0.124	T	0.35968	-0.9767	10	0.12430	T	0.62	.	5.5778	0.17233	0.2179:0.3852:0.0:0.3969	.	2045	O60494	CUBN_HUMAN	T	2045	ENSP00000367064:N2045T	ENSP00000367064:N2045T	N	-	2	0	CUBN	17010299	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	0.008000	0.13197	-0.420000	0.07427	0.528000	0.53228	AAC	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000107611		0.468	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1		0.00	22	0	T	NM_001081		16970293	-1			no_errors	ENST00000377833	ensembl	human	known	74_37	missense	16.67	20	4	SNP	0.000	G
CXCR4	7852	genome.wustl.edu	37	2	136872220	136872220	+	3'UTR	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:136872220A>C	ENST00000241393.3	-	0	1382				CXCR4_ENST00000409817.1_3'UTR|CXCR4_ENST00000466288.1_5'UTR	NM_003467.2	NP_003458.1	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4						activation of MAPK activity (GO:0000187)|ameboidal cell migration (GO:0001667)|apoptotic process (GO:0006915)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular response to cytokine stimulus (GO:0071345)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|entry into host cell (GO:0030260)|G-protein coupled receptor signaling pathway (GO:0007186)|germ cell development (GO:0007281)|germ cell migration (GO:0008354)|inflammatory response (GO:0006954)|motor neuron axon guidance (GO:0008045)|myelin maintenance (GO:0043217)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|neutrophil activation (GO:0042119)|patterning of blood vessels (GO:0001569)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of chemotaxis (GO:0050920)|response to hypoxia (GO:0001666)|response to virus (GO:0009615)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|G-protein coupled receptor activity (GO:0004930)|myosin light chain binding (GO:0032027)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|virus receptor activity (GO:0001618)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)|Plerixafor(DB06809)	ACAGCAACTAAGAACTTGGCC	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF005058	CCDS33295.1, CCDS46420.1	2q21	2014-09-17	2002-08-22		ENSG00000121966	ENSG00000121966		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	2561	protein-coding gene	gene with protein product		162643	"""chemokine (C-X-C motif), receptor 4 (fusin)"""			9599023, 9379028	Standard	NM_001008540		Approved	LESTR, NPY3R, HM89, NPYY3R, D2S201E, fusin, HSY3RR, NPYR, CD184	uc002tuz.3	P61073	OTTHUMG00000153583	ENST00000241393.3:c.*219T>G	2.37:g.136872220A>C			B2R5N0|O60835|P30991|P56438|Q53S69|Q9BXA0|Q9UKN2	RNA	SNP	-	NULL	ENST00000241393.3	37	NULL	CCDS46420.1	2																																																																																			CXCR4	-	-	ENSG00000121966		0.368	CXCR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXCR4	HGNC	protein_coding	OTTHUMT00000331732.1	-	0.00	36	0	A			136872220	-1	tier1	-	no_errors	ENST00000466288	ensembl	human	known	74_37	rna	18.42	31	7	SNP	0.038	C
CYP2W1	54905	genome.wustl.edu	37	7	1024894	1024894	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:1024894G>A	ENST00000308919.7	+	4	593	c.580G>A	c.(580-582)Gtg>Atg	p.V194M	CYP2W1_ENST00000340150.6_Missense_Mutation_p.V138M	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	194					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCGGGACCCCGTGTTTGTGTC	0.662																																																	0													47.0	34.0	39.0					7																	1024894		2134	4217	6351	SO:0001583	missense	0			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.580G>A	7.37:g.1024894G>A	ENSP00000310149:p.Val194Met			Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.V194M	ENST00000308919.7	37	c.580	CCDS5319.2	7	.	.	.	.	.	.	.	.	.	.	G	9.957	1.221752	0.22457	.	.	ENSG00000073067	ENST00000308919;ENST00000340150	T;T	0.68181	-0.31;-0.31	5.06	0.533	0.17121	.	0.737237	0.12925	N	0.427874	T	0.46288	0.1385	N	0.26042	0.785	0.09310	N	1	B;P	0.34629	0.29;0.46	B;B	0.32805	0.153;0.108	T	0.33904	-0.9850	10	0.49607	T	0.09	.	3.9097	0.09197	0.4998:0.2405:0.2597:0.0	.	138;194	A6NJ10;Q8TAV3	.;CP2W1_HUMAN	M	194;138	ENSP00000310149:V194M;ENSP00000344178:V138M	ENSP00000310149:V194M	V	+	1	0	CYP2W1	991420	0.000000	0.05858	0.270000	0.24601	0.654000	0.38779	0.772000	0.26647	0.168000	0.19655	0.491000	0.48974	GTG	CYP2W1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000073067		0.662	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2W1	HGNC	protein_coding	OTTHUMT00000157249.1	-	0.00	63	0	G	NM_017781		1024894	+1	tier1	-	no_errors	ENST00000308919	ensembl	human	known	74_37	missense	26.58	58	21	SNP	0.000	A
DCDC1	341019	genome.wustl.edu	37	11	30930511	30930511	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:30930511T>G	ENST00000597505.1	-	27	3899	c.3900A>C	c.(3898-3900)gaA>gaC	p.E1300D	DCDC1_ENST00000406071.2_Missense_Mutation_p.E35D|DCDC1_ENST00000339794.5_Missense_Mutation_p.E379D			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)			p.E379E(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CAATGTTTTCTTCTTTAATCA	0.323																																																	1	Substitution - coding silent(1)	lung(1)											96.0	92.0	93.0					11																	30930511		2202	4299	6501	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.3900A>C	11.37:g.30930511T>G	ENSP00000472625:p.Glu1300Asp		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.E379D	ENST00000597505.1	37	c.1137		11	.	.	.	.	.	.	.	.	.	.	T	0.876	-0.730452	0.03135	.	.	ENSG00000170959	ENST00000406071;ENST00000339794	T	0.42513	0.97	5.16	-9.93	0.00452	.	0.998169	0.08107	N	0.996773	T	0.19208	0.0461	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.21109	-1.0255	10	0.12430	T	0.62	.	1.3064	0.02089	0.1715:0.2874:0.173:0.368	.	379	Q6ZRR9	DCDC5_HUMAN	D	35;379	ENSP00000341700:E379D	ENSP00000341700:E379D	E	-	3	2	DCDC5	30887087	0.105000	0.21958	0.001000	0.08648	0.299000	0.27559	-0.413000	0.07123	-1.735000	0.01353	-1.139000	0.01908	GAA	DCDC1	-	NULL	ENSG00000170959		0.323	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	46	0	T	NM_181807		30930511	-1	tier1	-	no_errors	ENST00000339794	ensembl	human	known	74_37	missense	19.70	53	13	SNP	0.000	G
DCLK1	9201	genome.wustl.edu	37	13	36348801	36348801	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:36348801T>C	ENST00000360631.3	-	17	2305	c.2094A>G	c.(2092-2094)cgA>cgG	p.R698R	DCLK1_ENST00000255448.4_Missense_Mutation_p.D723G|DCLK1_ENST00000379893.1_Silent_p.R391R			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	698	Poly-Arg.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TGCGTCTTCGTCGGAAAACCT	0.532																																																	0													51.0	44.0	46.0					13																	36348801		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.2094A>G	13.37:g.36348801T>C			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.D723G	ENST00000360631.3	37	c.2168		13	.	.	.	.	.	.	.	.	.	.	T	23.8	4.454849	0.84209	.	.	ENSG00000133083	ENST00000399319;ENST00000255448	T	0.67523	-0.27	5.95	5.95	0.96441	.	.	.	.	.	T	0.73923	0.3649	.	.	.	0.80722	D	1	D;D	0.54207	0.965;0.965	P;B	0.50270	0.636;0.418	T	0.77411	-0.2598	8	0.72032	D	0.01	.	16.4159	0.83738	0.0:0.0:0.0:1.0	.	723;416	O15075-2;O15075-3	.;.	G	415;723	ENSP00000255448:D723G	ENSP00000255448:D723G	D	-	2	0	DCLK1	35246801	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.409000	0.80053	2.279000	0.76181	0.533000	0.62120	GAC	DCLK1	-	NULL	ENSG00000133083		0.532	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	26	0	T	NM_004734		36348801	-1	tier1	-	no_errors	ENST00000255448	ensembl	human	known	74_37	missense	13.89	31	5	SNP	1.000	C
DCLK2	166614	genome.wustl.edu	37	4	151168808	151168808	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:151168808A>G	ENST00000296550.7	+	13	2586	c.1832A>G	c.(1831-1833)gAg>gGg	p.E611G	DCLK2_ENST00000302176.8_Missense_Mutation_p.E628G|DCLK2_ENST00000506325.1_Missense_Mutation_p.E610G	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	611	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					GGGAAGCTGGAGTTTCCGGCC	0.507																																					GBM(195;186 2215 13375 16801 37459)												0													76.0	79.0	78.0					4																	151168808		2203	4300	6503	SO:0001583	missense	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1832A>G	4.37:g.151168808A>G	ENSP00000296550:p.Glu611Gly		C9J5Q9|Q59GC8|Q8N399	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.E628G	ENST00000296550.7	37	c.1883	CCDS34076.1	4	.	.	.	.	.	.	.	.	.	.	A	26.3	4.720205	0.89205	.	.	ENSG00000170390	ENST00000296550;ENST00000506325;ENST00000302176	T;T;T	0.67523	-0.27;-0.27;-0.27	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.096018	0.64402	D	0.000001	T	0.58991	0.2161	N	0.16201	0.385	0.58432	D	0.999998	B;P;B	0.49559	0.065;0.925;0.04	B;P;B	0.47162	0.044;0.54;0.081	T	0.65389	-0.6180	10	0.62326	D	0.03	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	628;610;611	Q8N568-3;Q8N568-2;Q8N568	.;.;DCLK2_HUMAN	G	611;610;628	ENSP00000296550:E611G;ENSP00000427235:E610G;ENSP00000303887:E628G	ENSP00000296550:E611G	E	+	2	0	DCLK2	151388258	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GAG	DCLK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000170390		0.507	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	-	0.00	80	0	A	NM_001040260		151168808	+1	tier1	-	no_errors	ENST00000302176	ensembl	human	known	74_37	missense	18.18	36	8	SNP	1.000	G
DCUN1D1	54165	genome.wustl.edu	37	3	182683508	182683508	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:182683508G>T	ENST00000292782.4	-	2	190	c.37C>A	c.(37-39)Cgt>Agt	p.R13S	DCUN1D1_ENST00000469954.1_5'UTR	NM_020640.2	NP_065691.2	Q96GG9	DCNL1_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 1	13	UBA-like.					ubiquitin ligase complex (GO:0000151)		p.R13C(1)		endometrium(2)|large_intestine(4)|lung(8)|ovary(1)	15	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;2.54e-44)|Epithelial(37;4.71e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			ATAAACTGACGAACTTTATCC	0.308																																																	1	Substitution - Missense(1)	large_intestine(1)											105.0	108.0	107.0					3																	182683508		2203	4299	6502	SO:0001583	missense	0			AF292100, AK056335	CCDS3240.1	3q26.3	2013-06-10	2013-06-10		ENSG00000043093	ENSG00000043093			18184	protein-coding gene	gene with protein product	"""squamous cell carcinoma related oncogene"""	605905	"""DCN1, defective in cullin neddylation 1, domain containing 1 (S. cerevisiae)"""			10777668, 15988528	Standard	NM_020640		Approved	RP42, SCRO, DCUN1L1, Tes3, SCCRO	uc003fld.1	Q96GG9	OTTHUMG00000158314	ENST00000292782.4:c.37C>A	3.37:g.182683508G>T	ENSP00000292782:p.Arg13Ser		B2RB37|Q7L3G9|Q8TEX7|Q9H6M1|Q9HCT3	Missense_Mutation	SNP	pfam_PONY_dom,superfamily_UBA-like	p.R13S	ENST00000292782.4	37	c.37	CCDS3240.1	3	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941998	0.92526	.	.	ENSG00000043093	ENST00000292782;ENST00000458486	.	.	.	5.84	5.84	0.93424	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.57475	0.2056	L	0.45422	1.42	0.80722	D	1	P	0.42871	0.792	B	0.43575	0.424	T	0.53027	-0.8496	9	0.33940	T	0.23	-6.3724	20.1294	0.97995	0.0:0.0:1.0:0.0	.	13	Q96GG9	DCNL1_HUMAN	S	13	.	ENSP00000292782:R13S	R	-	1	0	DCUN1D1	184166202	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.758000	0.94735	0.591000	0.81541	CGT	DCUN1D1	-	superfamily_UBA-like	ENSG00000043093		0.308	DCUN1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D1	HGNC	protein_coding	OTTHUMT00000350658.1		0.00	19	0	G	NM_020640		182683508	-1			no_errors	ENST00000292782	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13729594	13729594	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:13729594A>T	ENST00000265104.4	-	69	11941	c.11837T>A	c.(11836-11838)tTg>tAg	p.L3946*		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3946					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTTCCACCAAATTCAGCCA	0.378									Kartagener syndrome																																								0													162.0	136.0	144.0					5																	13729594		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11837T>A	5.37:g.13729594A>T	ENSP00000265104:p.Leu3946*		Q92860|Q96L74|Q9H5S7|Q9HCG9	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3946*	ENST00000265104.4	37	c.11837	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	54	22.645768	0.99949	.	.	ENSG00000039139	ENST00000265104	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.35	0.83199	1.0:0.0:0.0:0.0	.	.	.	.	X	3946	.	ENSP00000265104:L3946X	L	-	2	0	DNAH5	13782594	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.215000	0.95146	2.270000	0.75569	0.528000	0.53228	TTG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	68	0	A	NM_001369		13729594	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	nonsense	13.33	78	12	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13752275	13752275	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:13752275T>C	ENST00000265104.4	-	64	11100	c.10996A>G	c.(10996-10998)Aga>Gga	p.R3666G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3666	AAA 5. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATGAAGTTTCTTTCCAAAACA	0.413									Kartagener syndrome																																								0													133.0	122.0	126.0					5																	13752275		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.10996A>G	5.37:g.13752275T>C	ENSP00000265104:p.Arg3666Gly		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R3666G	ENST00000265104.4	37	c.10996	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	19.92	3.915624	0.73098	.	.	ENSG00000039139	ENST00000265104	T	0.33216	1.42	5.71	5.71	0.89125	.	0.096845	0.85682	D	0.000000	T	0.46171	0.1379	M	0.76433	2.335	0.47276	D	0.999372	B	0.26041	0.14	B	0.39339	0.297	T	0.48269	-0.9050	10	0.87932	D	0	.	16.2826	0.82703	0.0:0.0:0.0:1.0	.	3666	Q8TE73	DYH5_HUMAN	G	3666	ENSP00000265104:R3666G	ENSP00000265104:R3666G	R	-	1	2	DNAH5	13805275	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.514000	0.81750	2.307000	0.77673	0.528000	0.53228	AGA	DNAH5	-	NULL	ENSG00000039139		0.413	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	40	0	T	NM_001369		13752275	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	42.86	28	21	SNP	1.000	C
DNAH5	1767	genome.wustl.edu	37	5	13769697	13769697	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:13769697T>G	ENST00000265104.4	-	57	9737	c.9633A>C	c.(9631-9633)aaA>aaC	p.K3211N	DNAH5_ENST00000504001.3_5'UTR	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3211	Stalk. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTGAAGCTTCTTTGAGCTTTT	0.433									Kartagener syndrome																																								0													178.0	166.0	170.0					5																	13769697		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.9633A>C	5.37:g.13769697T>G	ENSP00000265104:p.Lys3211Asn		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K3211N	ENST00000265104.4	37	c.9633	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	12.15	1.852388	0.32699	.	.	ENSG00000039139	ENST00000265104	T	0.74947	-0.89	5.77	5.77	0.91146	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	T	0.65123	0.2661	L	0.31065	0.9	0.80722	D	1	B	0.22346	0.068	B	0.28553	0.091	T	0.59984	-0.7351	10	0.15066	T	0.55	.	16.3818	0.83467	0.0:0.0:0.0:1.0	.	3211	Q8TE73	DYH5_HUMAN	N	3211	ENSP00000265104:K3211N	ENSP00000265104:K3211N	K	-	3	2	DNAH5	13822697	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	1.132000	0.31418	2.330000	0.79161	0.528000	0.53228	AAA	DNAH5	-	NULL	ENSG00000039139		0.433	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	68	0	T	NM_001369		13769697	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	12.50	77	11	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196753009	196753009	+	Silent	SNP	C	C	T	rs201987961		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:196753009C>T	ENST00000312428.6	-	33	5479	c.5379G>A	c.(5377-5379)tcG>tcA	p.S1793S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1793	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TAAATTCAACCGAAACAGGGA	0.328																																																	0								C		0,3622		0,0,1811	57.0	52.0	53.0		5379	0.8	0.7	2		53	8,8138		0,8,4065	no	coding-synonymous	DNAH7	NM_018897.2		0,8,5876	TT,TC,CC		0.0982,0.0,0.068		1793/4025	196753009	8,11760	1811	4073	5884	SO:0001819	synonymous_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5379G>A	2.37:g.196753009C>T			B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.S1793	ENST00000312428.6	37	c.5379	CCDS42794.1	2																																																																																			DNAH7	-	NULL	ENSG00000118997		0.328	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	19	0	C	NM_018897		196753009	-1	tier1	rs201987961	no_errors	ENST00000312428	ensembl	human	known	74_37	silent	25.00	11	4	SNP	0.435	T
DOCK3	1795	genome.wustl.edu	37	3	51266099	51266099	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:51266099A>C	ENST00000266037.9	+	18	1678	c.1655A>C	c.(1654-1656)gAg>gCg	p.E552A		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	552	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAGTGTGATGAGAATAGCACG	0.463																																																	0													107.0	108.0	108.0					3																	51266099		1935	4146	6081	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1655A>C	3.37:g.51266099A>C	ENSP00000266037:p.Glu552Ala		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.E552A	ENST00000266037.9	37	c.1655	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583390	0.86748	.	.	ENSG00000088538	ENST00000266037	T	0.14766	2.48	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.35740	0.0942	M	0.67625	2.065	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.07520	-1.0768	10	0.52906	T	0.07	.	15.0018	0.71479	1.0:0.0:0.0:0.0	.	552	Q8IZD9	DOCK3_HUMAN	A	552	ENSP00000266037:E552A	ENSP00000266037:E552A	E	+	2	0	DOCK3	51241139	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.339000	0.96797	2.006000	0.58801	0.460000	0.39030	GAG	DOCK3	-	NULL	ENSG00000088538		0.463	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	126	0	A	NM_004947		51266099	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	25.19	101	34	SNP	1.000	C
DPY19L2P1	554236	genome.wustl.edu	37	7	35121268	35121268	+	IGR	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:35121268T>G								DPY19L1 (43615 upstream) : DPY19L2P1 (8187 downstream)																							GCCTGGCATCTTTGAGCAGGA	0.448																																																	0																																										SO:0001628	intergenic_variant	0																															7.37:g.35121268T>G				RNA	SNP	-	NULL		37	NULL		7																																																																																			DPY19L2P1	-	-	ENSG00000189212	0	0.448					DPY19L2P1	HGNC			-	0.00	91	0	T			35121268	-1	tier1	-	no_errors	ENST00000458672	ensembl	human	known	74_37	rna	17.76	88	19	SNP	0.999	G
DPYSL4	10570	genome.wustl.edu	37	10	134015592	134015592	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:134015592A>C	ENST00000338492.4	+	11	1417	c.1253A>C	c.(1252-1254)aAg>aCg	p.K418T	DPYSL4_ENST00000368629.1_Missense_Mutation_p.K318T|DPYSL4_ENST00000368627.1_Missense_Mutation_p.K318T	NM_006426.2	NP_006417.2	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	418					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)	cytosol (GO:0005829)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		AAGGCCACCAAGATCATCTCT	0.557																																																	0													97.0	94.0	95.0					10																	134015592		2203	4300	6503	SO:0001583	missense	0			AB006713	CCDS7665.1	10q25.2-q26	2008-05-14			ENSG00000151640	ENSG00000151640			3016	protein-coding gene	gene with protein product		608407				8973361, 9652388	Standard	NM_006426		Approved	ULIP4, DRP-4	uc009ybb.3	O14531	OTTHUMG00000019283	ENST00000338492.4:c.1253A>C	10.37:g.134015592A>C	ENSP00000339850:p.Lys418Thr		B2RMQ1|D3DRG5|O00240|Q5T0Q7	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.K418T	ENST00000338492.4	37	c.1253	CCDS7665.1	10	.	.	.	.	.	.	.	.	.	.	A	11.92	1.781423	0.31502	.	.	ENSG00000151640	ENST00000338492;ENST00000368629;ENST00000368627	T;D;D	0.89552	-0.77;-2.53;-2.53	4.58	-5.71	0.02413	Metal-dependent hydrolase, composite domain (1);	0.635134	0.15801	N	0.243950	T	0.82075	0.4958	L	0.43152	1.355	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.62835	-0.6770	10	0.87932	D	0	-30.9036	13.2277	0.59924	0.4757:0.0:0.5243:0.0	.	418	O14531	DPYL4_HUMAN	T	418;318;318	ENSP00000339850:K418T;ENSP00000357618:K318T;ENSP00000357616:K318T	ENSP00000339850:K418T	K	+	2	0	DPYSL4	133865582	0.000000	0.05858	0.000000	0.03702	0.914000	0.54420	0.052000	0.14163	-1.590000	0.01623	-1.437000	0.01076	AAG	DPYSL4	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000151640		0.557	DPYSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL4	HGNC	protein_coding	OTTHUMT00000051050.2	-	0.00	64	0	A			134015592	+1	tier1	-	no_errors	ENST00000338492	ensembl	human	known	74_37	missense	29.41	36	15	SNP	0.000	C
DYNC2H1	79659	genome.wustl.edu	37	11	103106512	103106512	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:103106512G>T	ENST00000375735.2	+	62	9823	c.9679G>T	c.(9679-9681)Gaa>Taa	p.E3227*	DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.E3227*|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3227					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AACCTGTTTGGAAGAATGGAC	0.348																																																	0													91.0	86.0	88.0					11																	103106512		1830	4100	5930	SO:0001587	stop_gained	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9679G>T	11.37:g.103106512G>T	ENSP00000364887:p.Glu3227*		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3227*	ENST00000375735.2	37	c.9679	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	51	18.264782	0.99902	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	5.59	5.59	0.84812	.	0.280991	0.39759	N	0.001275	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.6495	0.95795	0.0:0.0:1.0:0.0	.	.	.	.	X	3227	.	ENSP00000364887:E3227X	E	+	1	0	DYNC2H1	102611722	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	6.892000	0.75644	2.643000	0.89663	0.579000	0.79373	GAA	DYNC2H1	-	NULL	ENSG00000187240		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1		0.00	25	0	G	XM_370652		103106512	+1			no_errors	ENST00000398093	ensembl	human	known	74_37	nonsense	6.25	45	3	SNP	1.000	T
EBF3	253738	genome.wustl.edu	37	10	131676100	131676100	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:131676100A>C	ENST00000355311.5	-	7	640	c.568T>G	c.(568-570)Ttt>Gtt	p.F190V	EBF3_ENST00000368648.3_Missense_Mutation_p.F190V			Q9H4W6	COE3_HUMAN	early B-cell factor 3	190					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		TTGAGGAAAAACTTTAGAAAG	0.378																																																	0													69.0	64.0	66.0					10																	131676100		2203	4300	6503	SO:0001583	missense	0				CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.568T>G	10.37:g.131676100A>C	ENSP00000347463:p.Phe190Val		A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.F190V	ENST00000355311.5	37	c.568		10	.	.	.	.	.	.	.	.	.	.	A	19.94	3.919791	0.73098	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.50001	0.76;0.84	5.39	4.26	0.50523	.	0.047642	0.85682	D	0.000000	T	0.60495	0.2273	M	0.62723	1.935	0.80722	D	1	P	0.43938	0.822	P	0.58577	0.841	T	0.58758	-0.7580	10	0.46703	T	0.11	-7.6331	11.0634	0.47961	0.9274:0.0:0.0726:0.0	.	190	Q9H4W6-2	.	V	190	ENSP00000347463:F190V;ENSP00000357637:F190V	ENSP00000347463:F190V	F	-	1	0	EBF3	131566090	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.335000	0.96500	0.885000	0.36088	0.460000	0.39030	TTT	EBF3	-	NULL	ENSG00000108001		0.378	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	HGNC	protein_coding	OTTHUMT00000051015.2		0.00	20	0	A	NM_001005463		131676100	-1			no_errors	ENST00000355311	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	C
EML6	400954	genome.wustl.edu	37	2	55074658	55074658	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:55074658G>A	ENST00000356458.6	+	8	1605	c.1085G>A	c.(1084-1086)cGc>cAc	p.R362H	RNU7-81P_ENST00000516698.1_RNA	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	362						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						TTGATCGCCCGCTGTAACATG	0.552																																																	0													68.0	55.0	59.0					2																	55074658		692	1591	2283	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1085G>A	2.37:g.55074658G>A	ENSP00000348842:p.Arg362His		A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R362H	ENST00000356458.6	37	c.1085	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.109512	0.77096	.	.	ENSG00000214595	ENST00000356458	T	0.05258	3.47	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.28031	U	0.016877	T	0.24547	0.0595	M	0.81341	2.54	0.58432	D	0.999999	D	0.76494	0.999	P	0.62184	0.899	T	0.05209	-1.0899	10	0.14656	T	0.56	.	20.0694	0.97716	0.0:0.0:1.0:0.0	.	362	Q6ZMW3	EMAL6_HUMAN	H	362	ENSP00000348842:R362H	ENSP00000348842:R362H	R	+	2	0	EML6	54928162	1.000000	0.71417	1.000000	0.80357	0.134000	0.20937	9.476000	0.97823	2.761000	0.94854	0.585000	0.79938	CGC	EML6	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000214595		0.552	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	-	0.00	58	0	G	XM_001725002		55074658	+1	tier1	-	no_errors	ENST00000356458	ensembl	human	novel	74_37	missense	40.68	35	24	SNP	1.000	A
ENO4	387712	genome.wustl.edu	37	10	118620630	118620630	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:118620630T>A	ENST00000369207.2	+	3	336	c.160T>A	c.(160-162)Tca>Aca	p.S54T	ENO4_ENST00000409522.1_Intron|ENO4_ENST00000341276.5_Missense_Mutation_p.S290T			A6NNW6	ENO4_HUMAN	enolase family member 4	290					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						CTGTGGGAAGTCATCATCTGG	0.398																																																	0																																										SO:0001583	missense	0				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000369207.2:c.160T>A	10.37:g.118620630T>A	ENSP00000358208:p.Ser54Thr		B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.S290T	ENST00000369207.2	37	c.868		10	.	.	.	.	.	.	.	.	.	.	T	11.66	1.704005	0.30232	.	.	ENSG00000188316	ENST00000341276;ENST00000369207	T;T	0.58358	0.34;0.72	6.04	4.9	0.64082	.	0.340783	0.27210	N	0.020404	T	0.59362	0.2188	M	0.64997	1.995	0.28729	N	0.902625	.	.	.	.	.	.	T	0.59273	-0.7485	8	0.56958	D	0.05	-6.4087	11.4118	0.49929	0.0:0.0:0.1512:0.8488	.	.	.	.	T	290;54	ENSP00000345555:S290T;ENSP00000358208:S54T	ENSP00000345555:S290T	S	+	1	0	ENO4	118610620	0.759000	0.28416	1.000000	0.80357	0.995000	0.86356	0.513000	0.22770	1.087000	0.41251	0.460000	0.39030	TCA	ENO4	-	NULL	ENSG00000188316		0.398	ENO4-001	PUTATIVE	basic	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000050552.2	-	0.00	33	0	T	NM_001242699		118620630	+1	tier1	-	no_errors	ENST00000341276	ensembl	human	known	74_37	missense	40.91	13	9	SNP	1.000	A
AC109351.1	0	genome.wustl.edu	37	4	29751865	29751865	+	RNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:29751865A>C	ENST00000390756.1	+	0	48																											AGAAGGAAAAAAAAAATGTTT	0.303																																																	0																																												0																															4.37:g.29751865A>C				RNA	SNP	-	NULL	ENST00000390756.1	37	NULL		4																																																																																			AC109351.1	-	-	ENSG00000212045		0.303	AC109351.1-201	NOVEL	basic	miRNA	ENSG00000212045	Clone_based_ensembl_gene	miRNA		-	0.00	41	0	A			29751865	+1	tier1	-	no_errors	ENST00000390756	ensembl	human	novel	74_37	rna	21.95	32	9	SNP	0.991	C
Unknown	0	genome.wustl.edu	37	GL000212.1	65394	65394	+	IGR	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrGL000212.1:65394G>A								None (None upstream) : None (None downstream)																							CGGCATCGCTGACGAGGACAC	0.682																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65394G>A				Silent	SNP	NULL	p.L381		37	c.1143		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.682					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	60	0	G			65394	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	silent	18.60	34	8	SNP	NULL	A
ZNF971P	100419895	genome.wustl.edu	37	16	34681389	34681389	+	RNA	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:34681389G>T	ENST00000568619.1	-	0	1090																											AAAATCTGAAGGTTTTACCAC	0.328																																																	0																																												0																															16.37:g.34681389G>T				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16																																																																																			RP11-80F22.10	-	-	ENSG00000214581		0.328	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	69	0	G			34681389	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	39.02	25	16	SNP	0.108	T
GS1-124K5.2	0	genome.wustl.edu	37	7	65915083	65915083	+	RNA	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:65915083C>T	ENST00000442578.1	-	0	495																											CCCTGGAAGACGTACTGAAGA	0.468																																																	0																																												0																															7.37:g.65915083C>T				RNA	SNP	-	NULL	ENST00000442578.1	37	NULL		7																																																																																			GS1-124K5.2	-	-	ENSG00000230189		0.468	GS1-124K5.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000230189	Clone_based_vega_gene	pseudogene	OTTHUMT00000344730.1	-	0.00	98	0	C			65915083	-1	tier1	-	no_errors	ENST00000442578	ensembl	human	known	74_37	rna	11.76	120	16	SNP	0.984	T
LOC102723335	102723335	genome.wustl.edu	37	15	101098983	101098983	+	RNA	SNP	C	C	T	rs374060136		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:101098983C>T	ENST00000559349.1	+	0	102				RNU6-181P_ENST00000363225.1_RNA|RP11-526I2.1_ENST00000557839.1_RNA																							CCCGCCCGAACGTCCCAGTGC	0.662													c|||	1	0.000199681	0.0	0.0014	5008	,	,		14367	0.0		0.0	False		,,,				2504	0.0																0																																												0																															15.37:g.101098983C>T				RNA	SNP	-	NULL	ENST00000559349.1	37	NULL		15																																																																																			RP11-526I2.1	-	-	ENSG00000259540		0.662	RP11-526I2.1-001	KNOWN	basic	antisense	ENSG00000259540	Clone_based_vega_gene	antisense	OTTHUMT00000418034.1	-	0.00	40	0	C			101098983	+1	tier1	-	no_errors	ENST00000557839	ensembl	human	known	74_37	rna	48.72	20	19	SNP	0.938	T
RP11-652G5.1	0	genome.wustl.edu	37	16	32611641	32611641	+	RNA	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:32611641A>G	ENST00000562976.1	+	0	22																											ctgatgatgtaggtcttgcct	0.433																																																	0																																												0																															16.37:g.32611641A>G				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.433	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	87	0	A			32611641	+1	tier1	-	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	25.58	64	22	SNP	0.000	G
FEM1A	55527	genome.wustl.edu	37	19	4794549	4794549	+	3'UTR	DEL	T	T	-	rs35934634|rs397743608	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:4794549delT	ENST00000269856.3	+	0	2822				AC005523.2_ENST00000596170.1_RNA|AC005523.2_ENST00000601192.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)						negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		TTTTACTGCCTTTTTTTTTTT	0.423													|||unknown(HR)	2043	0.407947	0.2708	0.4352	5008	,	,		17748	0.5536		0.4056	False		,,,				2504	0.4264																0																																										SO:0001624	3_prime_UTR_variant	0			BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.*673T>-	19.37:g.4794549delT			B2RDI3|Q711P8|Q9NPN7|Q9NPW8	RNA	DEL	-	NULL	ENST00000269856.3	37	NULL	CCDS12135.1	19																																																																																			AC005523.2	-	-	ENSG00000269604		0.423	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269604	Clone_based_vega_gene	protein_coding	OTTHUMT00000459000.1		0.00	27	0	T			4794549	-1	tier1		no_errors	ENST00000601192	ensembl	human	known	74_37	rna	10.34	26	3	DEL	0.006	-
GRID1	2894	genome.wustl.edu	37	10	87406943	87406943	+	Intron	SNP	G	G	A	rs556394573	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:87406943G>A	ENST00000327946.7	-	13	2279				GRID1_ENST00000536331.1_Intron|RP11-93H12.4_ENST00000474115.2_RNA|RN7SKP238_ENST00000516483.1_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GTGCCCAAGCGCCAGCTCCTG	0.617										Multiple Myeloma(13;0.14)			G|||	2	0.000399361	0.0	0.0	5008	,	,		18354	0.0		0.002	False		,,,				2504	0.0																0													168.0	156.0	160.0					10																	87406943		2203	4300	6503	SO:0001627	intron_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2193+15C>T	10.37:g.87406943G>A			B3KXD5|B7Z7L0|Q8IXT3	RNA	SNP	-	NULL	ENST00000327946.7	37	NULL	CCDS31236.1	10																																																																																			RP11-93H12.4	-	-	ENSG00000270002		0.617	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000270002	Clone_based_vega_gene	protein_coding	OTTHUMT00000049148.3	-	0.00	47	0	G	XM_043613		87406943	+1	tier1	-	no_errors	ENST00000474115	ensembl	human	known	74_37	rna	23.81	32	10	SNP	0.000	A
RP11-638I8.1	0	genome.wustl.edu	37	7	45854290	45854290	+	lincRNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:45854290A>C	ENST00000609439.1	+	0	90																											TGCAGGCCTAAGTTGTCCTCA	0.657																																																	0																																												0																															7.37:g.45854290A>C				RNA	SNP	-	NULL	ENST00000609439.1	37	NULL		7																																																																																			RP11-638I8.1	-	-	ENSG00000272556		0.657	RP11-638I8.1-001	KNOWN	basic	lincRNA	ENSG00000272556	Clone_based_vega_gene	lincRNA	OTTHUMT00000472497.1	-	0.00	193	0	A			45854290	+1	tier1	-	no_errors	ENST00000609439	ensembl	human	known	74_37	rna	11.43	186	24	SNP	0.006	C
EPAS1	2034	genome.wustl.edu	37	2	46609651	46609651	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:46609651G>A	ENST00000263734.3	+	15	2885	c.2375G>A	c.(2374-2376)gGg>gAg	p.G792E		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	792					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			ATCAGTCCCGGGGAGAACAGC	0.602																																																	0													93.0	94.0	94.0					2																	46609651		2203	4300	6503	SO:0001583	missense	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.2375G>A	2.37:g.46609651G>A	ENSP00000263734:p.Gly792Glu		Q86VA2|Q99630	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.G792E	ENST00000263734.3	37	c.2375	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	G	6.911	0.537616	0.13188	.	.	ENSG00000116016	ENST00000263734	T	0.47528	0.84	5.49	3.69	0.42338	.	1.793260	0.02794	N	0.122402	T	0.32102	0.0818	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26608	-1.0098	10	0.72032	D	0.01	.	6.6929	0.23183	0.1595:0.1462:0.6944:0.0	.	792	Q99814	EPAS1_HUMAN	E	792	ENSP00000263734:G792E	ENSP00000263734:G792E	G	+	2	0	EPAS1	46463155	0.249000	0.23941	0.041000	0.18516	0.001000	0.01503	1.403000	0.34612	0.688000	0.31529	0.655000	0.94253	GGG	EPAS1	-	NULL	ENSG00000116016		0.602	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	-	0.00	34	0	G	NM_001430		46609651	+1	tier1	-	no_errors	ENST00000263734	ensembl	human	known	74_37	missense	22.22	21	6	SNP	0.019	A
EPHB1	2047	genome.wustl.edu	37	3	134920329	134920329	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:134920329A>G	ENST00000398015.3	+	12	2514	c.2144A>G	c.(2143-2145)cAg>cGg	p.Q715R	EPHB1_ENST00000493838.1_Missense_Mutation_p.Q276R	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	715	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						AATGACGGGCAGTTCACCGTG	0.527																																																	0													195.0	194.0	194.0					3																	134920329		2200	4300	6500	SO:0001583	missense	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.2144A>G	3.37:g.134920329A>G	ENSP00000381097:p.Gln715Arg		A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.Q715R	ENST00000398015.3	37	c.2144	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940328	0.52972	.	.	ENSG00000154928	ENST00000398015;ENST00000493838	D;D	0.82344	-1.6;-1.6	5.52	5.52	0.82312	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82282	0.5003	N	0.10707	0.03	0.80722	D	1	D	0.63880	0.993	D	0.77557	0.99	D	0.85213	0.1022	10	0.46703	T	0.11	.	15.6001	0.76616	1.0:0.0:0.0:0.0	.	715	P54762	EPHB1_HUMAN	R	715;276	ENSP00000381097:Q715R;ENSP00000419574:Q276R	ENSP00000381097:Q715R	Q	+	2	0	EPHB1	136403019	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	9.263000	0.95617	2.224000	0.72417	0.460000	0.39030	CAG	EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000154928		0.527	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	-	0.00	44	0	A	NM_004441		134920329	+1	tier1	-	no_errors	ENST00000398015	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	G
ERBB4	2066	genome.wustl.edu	37	2	212251663	212251663	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:212251663delG	ENST00000342788.4	-	27	3706	c.3396delC	c.(3394-3396)cccfs	p.P1132fs	ERBB4_ENST00000402597.1_Frame_Shift_Del_p.P1122fs|ERBB4_ENST00000436443.1_Frame_Shift_Del_p.P1116fs	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1132					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CAAACACGGTGGGGTCAGCAC	0.527										TSP Lung(8;0.080)																																							0													153.0	137.0	142.0					2																	212251663		2203	4300	6503	SO:0001589	frameshift_variant	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3396delC	2.37:g.212251663delG	ENSP00000342235:p.Pro1132fs		B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T1133fs	ENST00000342788.4	37	c.3396	CCDS2394.1	2																																																																																			ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000178568		0.527	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1		0.00	150	0	G	NM_001042599		212251663	-1			no_errors	ENST00000342788	ensembl	human	known	74_37	frame_shift_del	6.67	140	10	DEL	1.000	0
EVC	2121	genome.wustl.edu	37	4	5812093	5812093	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:5812093A>C	ENST00000264956.6	+	20	2994	c.2810A>C	c.(2809-2811)aAg>aCg	p.K937T	EVC_ENST00000382674.2_Missense_Mutation_p.K937T	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	937					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				AAAAGGAAGAAGCCCCTGCCC	0.577																																																	0													42.0	47.0	45.0					4																	5812093		2203	4300	6503	SO:0001583	missense	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2810A>C	4.37:g.5812093A>C	ENSP00000264956:p.Lys937Thr			Missense_Mutation	SNP	NULL	p.K937T	ENST00000264956.6	37	c.2810	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	A	13.24	2.177404	0.38413	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.58060	0.36;0.36	4.91	3.74	0.42951	.	0.395100	0.22285	N	0.062074	T	0.57330	0.2046	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.56117	-0.8032	10	0.59425	D	0.04	.	7.0191	0.24904	0.8962:0.0:0.1038:0.0	.	937	P57679	EVC_HUMAN	T	937	ENSP00000264956:K937T;ENSP00000372120:K937T	ENSP00000264956:K937T	K	+	2	0	EVC	5862994	0.975000	0.34042	0.978000	0.43139	0.088000	0.18126	2.524000	0.45589	0.739000	0.32628	0.528000	0.53228	AAG	EVC	-	NULL	ENSG00000072840		0.577	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	-	0.00	31	0	A			5812093	+1	tier1	-	no_errors	ENST00000264956	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.974	C
FAM155A	728215	genome.wustl.edu	37	13	108518858	108518858	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:108518858G>T	ENST00000375915.2	-	1	225	c.87C>A	c.(85-87)ttC>ttA	p.F29L		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	29						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CGGAATCGATGAACGGTTTCT	0.527																																																	0													164.0	173.0	170.0					13																	108518858		2203	4300	6503	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.87C>A	13.37:g.108518858G>T	ENSP00000365080:p.Phe29Leu		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.F29L	ENST00000375915.2	37	c.87	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250078	0.39797	.	.	ENSG00000204442	ENST00000375915	.	.	.	5.13	5.13	0.70059	.	0.057989	0.64402	D	0.000002	T	0.57504	0.2058	L	0.36672	1.1	0.35459	D	0.796364	D	0.54047	0.964	P	0.61477	0.889	T	0.64241	-0.6454	9	0.37606	T	0.19	.	11.1145	0.48252	0.0845:0.0:0.9155:0.0	.	29	B1AL88	F155A_HUMAN	L	29	.	ENSP00000365080:F29L	F	-	3	2	FAM155A	107316859	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.588000	0.46137	2.390000	0.81377	0.650000	0.86243	TTC	FAM155A	-	NULL	ENSG00000204442		0.527	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	42	0	G	NM_001080396		108518858	-1	tier1	-	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	31.58	26	12	SNP	1.000	T
FAM171B	165215	genome.wustl.edu	37	2	187559026	187559026	+	Silent	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:187559026C>A	ENST00000304698.5	+	1	329	c.126C>A	c.(124-126)atC>atA	p.I42I	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	42				I -> IQ (in Ref. 1; BAC03660). {ECO:0000305}.|I -> IQQ (in Ref. 3; AAH60872 and 4; AAL57220). {ECO:0000305}.		integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TCAGCCTCATCcaacagcagc	0.647																																																	0													17.0	19.0	19.0					2																	187559026		2201	4298	6499	SO:0001819	synonymous_variant	0			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.126C>A	2.37:g.187559026C>A			Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Silent	SNP	pfam_Uncharacterised_FAM171	p.I42	ENST00000304698.5	37	c.126	CCDS33347.1	2																																																																																			FAM171B	-	NULL	ENSG00000144369		0.647	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1		0.00	54	0	C	NM_177454		187559026	+1			no_errors	ENST00000304698	ensembl	human	known	74_37	silent	6.56	56	4	SNP	1.000	A
FAM178A	55719	genome.wustl.edu	37	10	102677018	102677018	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:102677018G>T	ENST00000238961.4	+	3	1418	c.876G>T	c.(874-876)caG>caT	p.Q292H	FAM178A_ENST00000370271.3_Missense_Mutation_p.Q292H|FAM178A_ENST00000370269.3_Missense_Mutation_p.Q292H	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	292						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)		p.Q292Q(1)									AAAGGAAACAGAATGACATCA	0.318																																																	1	Substitution - coding silent(1)	lung(1)											51.0	56.0	54.0					10																	102677018		2203	4300	6503	SO:0001583	missense	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.876G>T	10.37:g.102677018G>T	ENSP00000238961:p.Gln292His		A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.Q292H	ENST00000238961.4	37	c.876	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	G	2.117	-0.402420	0.04865	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.47177	0.85;1.48;1.47	5.18	1.16	0.20824	.	0.199195	0.29253	N	0.012698	T	0.21881	0.0527	N	0.12182	0.205	0.24589	N	0.993836	B;B;B	0.11235	0.0;0.001;0.004	B;B;B	0.11329	0.003;0.003;0.006	T	0.08186	-1.0734	10	0.29301	T	0.29	-1.4154	2.0308	0.03529	0.1756:0.1613:0.5077:0.1554	.	292;292;292	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	H	292	ENSP00000359294:Q292H;ENSP00000238961:Q292H;ENSP00000359292:Q292H	ENSP00000238961:Q292H	Q	+	3	2	FAM178A	102667008	1.000000	0.71417	0.994000	0.49952	0.040000	0.13550	0.346000	0.19997	0.056000	0.16144	-0.198000	0.12761	CAG	FAM178A	-	NULL	ENSG00000119906		0.318	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3		0.00	32	0	G			102677018	+1			no_errors	ENST00000370269	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.995	T
FAM196A	642938	genome.wustl.edu	37	10	128974387	128974387	+	Silent	SNP	G	G	A	rs374772780		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:128974387G>A	ENST00000522781.1	-	4	828	c.273C>T	c.(271-273)ccC>ccT	p.P91P	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Silent_p.P91P	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	91										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						ACCTGCGTGCGGGCACTGTCA	0.617																																																	0								G	,	0,4406		0,0,2203	120.0	103.0	109.0		273,	-5.2	0.8	10		109	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,intron	DOCK1,FAM196A	NM_001039762.2,NM_001380.3	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	91/480,	128974387	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.273C>T	10.37:g.128974387G>A			B2RNT4|B7ZME7	Silent	SNP	NULL	p.P91	ENST00000522781.1	37	c.273	CCDS31312.1	10																																																																																			FAM196A	-	NULL	ENSG00000188916		0.617	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196A	HGNC	protein_coding	OTTHUMT00000050978.2	-	0.00	114	0	G	NM_001039762		128974387	-1	tier1	-	no_errors	ENST00000522781	ensembl	human	known	74_37	silent	19.46	120	29	SNP	0.349	A
FAM95B1	100133036	genome.wustl.edu	37	9	42472162	42472162	+	Intron	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:42472162C>T	ENST00000421686.2	+	11	1457				FAM95B1_ENST00000592873.1_RNA																							acccttgcagcgcaggcagga	0.572																																																	0																																										SO:0001627	intron_variant	0																														ENST00000421686.2:c.224-1774C>T	9.37:g.42472162C>T				RNA	SNP	-	NULL	ENST00000421686.2	37	NULL		9																																																																																			FAM95B1	-	-	ENSG00000223839		0.572	RP11-146D12.2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	FAM95B1	HGNC	protein_coding	OTTHUMT00000129789.5	-	0.00	34	0	C			42472162	+1	tier1	-	no_errors	ENST00000592873	ensembl	human	known	74_37	rna	11.11	40	5	SNP	0.057	T
FAT4	79633	genome.wustl.edu	37	4	126242658	126242658	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:126242658C>T	ENST00000394329.3	+	1	5105	c.5092C>T	c.(5092-5094)Cgg>Tgg	p.R1698W		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1698	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CATTCTGGACCGGGAGCAAGG	0.418																																																	0													96.0	92.0	93.0					4																	126242658		1896	4121	6017	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5092C>T	4.37:g.126242658C>T	ENSP00000377862:p.Arg1698Trp		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R1698W	ENST00000394329.3	37	c.5092	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	17.84	3.488639	0.64074	.	.	ENSG00000196159	ENST00000394329	T	0.50277	0.75	5.27	2.33	0.28932	Cadherin (3);Cadherin-like (1);	0.000000	0.31438	U	0.007644	T	0.72518	0.3470	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.63381	0.914	T	0.76219	-0.3039	10	0.66056	D	0.02	.	9.148	0.36944	0.2277:0.5534:0.219:0.0	.	1698	Q6V0I7	FAT4_HUMAN	W	1698	ENSP00000377862:R1698W	ENSP00000377862:R1698W	R	+	1	2	FAT4	126462108	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.286000	0.33273	0.564000	0.29238	0.655000	0.94253	CGG	FAT4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.418	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	59	0	C	NM_024582		126242658	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126370822	126370822	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:126370822T>G	ENST00000394329.3	+	9	8664	c.8651T>G	c.(8650-8652)cTt>cGt	p.L2884R	FAT4_ENST00000335110.5_Missense_Mutation_p.L1182R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2884	Cadherin 28. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGCCCTGAACTTACTGAGATT	0.373																																																	0													91.0	92.0	92.0					4																	126370822		2203	4299	6502	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8651T>G	4.37:g.126370822T>G	ENSP00000377862:p.Leu2884Arg		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L2884R	ENST00000394329.3	37	c.8651	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	T	15.97	2.988368	0.53934	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.58652	0.32;0.32	5.51	5.51	0.81932	Cadherin (3);Cadherin-like (1);	0.000000	0.31415	U	0.007695	T	0.63861	0.2547	L	0.43152	1.355	0.54753	D	0.999986	D;D;D	0.89917	0.96;0.998;1.0	P;D;D	0.91635	0.663;0.971;0.999	T	0.59080	-0.7521	10	0.12103	T	0.63	.	10.3035	0.43667	0.0:0.0736:0.0:0.9264	.	1182;2884;2884	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	2884;1182	ENSP00000377862:L2884R;ENSP00000335169:L1182R	ENSP00000335169:L1182R	L	+	2	0	FAT4	126590272	1.000000	0.71417	0.967000	0.41034	0.956000	0.61745	4.980000	0.63812	2.217000	0.71921	0.533000	0.62120	CTT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.373	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	24	0	T	NM_024582		126370822	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	38.89	11	7	SNP	0.989	G
FCRL1	115350	genome.wustl.edu	37	1	157765845	157765845	+	3'UTR	SNP	T	T	G	rs185507674	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:157765845T>G	ENST00000368176.3	-	0	1401				FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_3'UTR|FCRL1_ENST00000358292.3_3'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGCCTGAGGCTTGGGGTCATG	0.443																																					GBM(54;482 1003 11223 30131 35730)												0													113.0	100.0	104.0					1																	157765845		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.*44A>C	1.37:g.157765845T>G			B2RE05|Q8N759|Q8NDI0|Q96PJ6	RNA	SNP	-	NULL	ENST00000368176.3	37	NULL	CCDS1170.1	1																																																																																			FCRL1	-	-	ENSG00000163534		0.443	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	-	0.00	37	0	T	NM_052938		157765845	-1	tier1	-	no_errors	ENST00000368175	ensembl	human	known	74_37	rna	26.92	19	7	SNP	0.000	G
FGD4	121512	genome.wustl.edu	37	12	32729381	32729381	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:32729381C>T	ENST00000427716.2	+	3	514	c.90C>T	c.(88-90)ggC>ggT	p.G30G	FGD4_ENST00000473513.1_3'UTR|FGD4_ENST00000525053.1_Silent_p.G142G|FGD4_ENST00000472289.1_Silent_p.G30G|FGD4_ENST00000546442.1_Intron|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000534526.2_Silent_p.G167G|FGD4_ENST00000531134.1_Silent_p.G115G	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	30	Actin filament-binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					TTGAAGGAGGCAGGTAAGAGC	0.373																																																	0													87.0	84.0	85.0					12																	32729381		2203	4300	6503	SO:0001819	synonymous_variant	0			AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.90C>T	12.37:g.32729381C>T			Q6ULS2|Q8TCP6	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.G30	ENST00000427716.2	37	c.90	CCDS8727.1	12																																																																																			FGD4	-	NULL	ENSG00000139132		0.373	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD4	HGNC	protein_coding	OTTHUMT00000268017.1	-	0.00	25	0	C	NM_139241		32729381	+1	tier1	-	no_errors	ENST00000427716	ensembl	human	known	74_37	silent	61.54	10	16	SNP	1.000	T
FGF13	2258	genome.wustl.edu	37	X	137785181	137785181	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:137785181A>C	ENST00000315930.6	-	3	1028	c.367T>G	c.(367-369)Ttg>Gtg	p.L123V	FGF13_ENST00000541469.1_Missense_Mutation_p.L77V|FGF13_ENST00000441825.2_Missense_Mutation_p.L104V|FGF13_ENST00000305414.4_Missense_Mutation_p.L70V|FGF13_ENST00000370603.3_Missense_Mutation_p.L133V	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	123	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					TTCATTGCCAAGTACAGCTTG	0.398																																																	0													131.0	108.0	116.0					X																	137785181		2203	4300	6503	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.367T>G	X.37:g.137785181A>C	ENSP00000322390:p.Leu123Val		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.L133V	ENST00000315930.6	37	c.397	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	A	12.29	1.892173	0.33442	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469;ENST00000436198;ENST00000455663	T;T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.68	2.99	0.34606	.	0.000000	0.85682	D	0.000000	T	0.54464	0.1860	N	0.13371	0.34	0.50039	D	0.999847	B;B;B;B	0.14805	0.011;0.009;0.009;0.001	B;B;B;B	0.24269	0.009;0.052;0.005;0.009	T	0.42327	-0.9458	10	0.31617	T	0.26	.	7.3504	0.26686	0.7295:0.0:0.2705:0.0	.	77;133;70;123	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	V	123;70;104;133;77;133;139	ENSP00000322390:L123V;ENSP00000303391:L70V;ENSP00000409276:L104V;ENSP00000359635:L133V;ENSP00000437903:L77V;ENSP00000396198:L133V;ENSP00000406916:L139V	ENSP00000303391:L70V	L	-	1	2	FGF13	137612847	0.992000	0.36948	1.000000	0.80357	0.997000	0.91878	2.229000	0.42990	0.783000	0.33636	0.481000	0.45027	TTG	FGF13	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	ENSG00000129682		0.398	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	HGNC	protein_coding	OTTHUMT00000058534.2	-	0.00	12	0	A	NM_004114		137785181	-1	tier1	-	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	63.64	4	7	SNP	0.999	C
FGFR4	2264	genome.wustl.edu	37	5	176519424	176519424	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:176519424C>A	ENST00000292408.4	+	7	1075	c.830C>A	c.(829-831)gCc>gAc	p.A277D	FGFR4_ENST00000393648.2_Missense_Mutation_p.A277D|FGFR4_ENST00000393637.1_Missense_Mutation_p.A277D|FGFR4_ENST00000292410.3_Missense_Mutation_p.A277D|FGFR4_ENST00000502906.1_Missense_Mutation_p.A277D	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	277	Ig-like C2-type 3.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	TACAGCGATGCCCAGCCCCAC	0.637										TSP Lung(9;0.080)																																							0													40.0	40.0	40.0					5																	176519424		2202	4300	6502	SO:0001583	missense	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.830C>A	5.37:g.176519424C>A	ENSP00000292408:p.Ala277Asp		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A277D	ENST00000292408.4	37	c.830	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.190212	0.94923	.	.	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.95980	-3.87;-3.87;-3.87;-3.87;-3.87	4.7	4.7	0.59300	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.96393	0.8823	L	0.41492	1.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.998;1.0	D	0.96739	0.9545	10	0.52906	T	0.07	.	17.6479	0.88153	0.0:1.0:0.0:0.0	.	277;277;277;277	B5A965;B4DVP5;P22455-2;P22455	.;.;.;FGFR4_HUMAN	D	277;277;277;277;277;389	ENSP00000292408:A277D;ENSP00000377259:A277D;ENSP00000424960:A277D;ENSP00000292410:A277D;ENSP00000377254:A277D	ENSP00000292408:A277D	A	+	2	0	FGFR4	176452030	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.776000	0.85560	2.322000	0.78497	0.561000	0.74099	GCC	FGFR4	-	pirsf_FGF_rcpt_fam,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000160867		0.637	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	-	0.00	66	0	C			176519424	+1	tier1	-	no_errors	ENST00000292408	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
FLG2	388698	genome.wustl.edu	37	1	152325410	152325410	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:152325410C>T	ENST00000388718.5	-	3	4924	c.4852G>A	c.(4852-4854)Gga>Aga	p.G1618R	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1618					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1618*(2)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTAGTTCCGTGTCTCTCA	0.522																																																	2	Substitution - Nonsense(2)	lung(2)											390.0	341.0	358.0					1																	152325410		2203	4300	6503	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4852G>A	1.37:g.152325410C>T	ENSP00000373370:p.Gly1618Arg		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.G1618R	ENST00000388718.5	37	c.4852	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	9.862	1.196506	0.22037	.	.	ENSG00000143520	ENST00000388718	T	0.13538	2.58	3.65	-0.676	0.11361	.	.	.	.	.	T	0.06142	0.0159	M	0.78456	2.415	0.09310	N	1	B	0.18310	0.027	B	0.08055	0.003	T	0.34079	-0.9843	9	0.59425	D	0.04	-0.8044	7.0478	0.25055	0.0:0.5837:0.0:0.4163	.	1618	Q5D862	FILA2_HUMAN	R	1618	ENSP00000373370:G1618R	ENSP00000373370:G1618R	G	-	1	0	FLG2	150592034	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.395000	0.01053	-0.412000	0.07519	-0.734000	0.03567	GGA	FLG2	-	NULL	ENSG00000143520		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	201	0	C	NM_001014342		152325410	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	65.98	99	192	SNP	0.000	T
FLG2	388698	genome.wustl.edu	37	1	152330122	152330122	+	Splice_Site	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:152330122T>G	ENST00000388718.5	-	3	212	c.140A>C	c.(139-141)aAc>aCc	p.N47T	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	47	S-100-like. {ECO:0000250}.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ATCATCTGGGTTCTGTATATG	0.408																																																	0													82.0	76.0	78.0					1																	152330122		2203	4300	6503	SO:0001630	splice_region_variant	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.139-1A>C	1.37:g.152330122T>G			Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.N47T	ENST00000388718.5	37	c.140	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.808926	0.50421	.	.	ENSG00000143520	ENST00000388718	T	0.11385	2.78	5.75	5.75	0.90469	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	.	.	.	.	T	0.18841	0.0452	L	0.61387	1.9	0.33990	D	0.649013	D	0.76494	0.999	D	0.75020	0.985	T	0.02603	-1.1135	9	0.52906	T	0.07	-8.5975	12.4552	0.55700	0.0:0.0:0.0:1.0	.	47	Q5D862	FILA2_HUMAN	T	47	ENSP00000373370:N47T	ENSP00000373370:N47T	N	-	2	0	FLG2	150596746	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	2.168000	0.42424	2.202000	0.70862	0.528000	0.53228	AAC	FLG2	-	pfam_S100_Ca-bd_sub	ENSG00000143520		0.408	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	35	0	T	NM_001014342	Missense_Mutation	152330122	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	25.64	29	10	SNP	1.000	G
FNDC3A	22862	genome.wustl.edu	37	13	49710555	49710555	+	Missense_Mutation	SNP	G	G	T	rs369583924		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:49710555G>T	ENST00000492622.2	+	6	883	c.578G>T	c.(577-579)cGc>cTc	p.R193L	FNDC3A_ENST00000541916.1_Missense_Mutation_p.R193L|FNDC3A_ENST00000398316.3_Missense_Mutation_p.R137L	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	193					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		TTGAAGGATCGCCAAGGAACA	0.388																																																	0													100.0	97.0	98.0					13																	49710555		2203	4300	6503	SO:0001583	missense	0			AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.578G>T	13.37:g.49710555G>T	ENSP00000417257:p.Arg193Leu		B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R193L	ENST00000492622.2	37	c.578	CCDS41886.1	13	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810264	0.90707	.	.	ENSG00000102531	ENST00000492622;ENST00000337156;ENST00000541916;ENST00000398316	T;T;T	0.37411	1.2;1.2;1.2	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000005	T	0.60932	0.2307	M	0.68317	2.08	0.51767	D	0.999932	D;D;D	0.89917	1.0;1.0;0.975	D;D;P	0.87578	0.997;0.998;0.762	T	0.61922	-0.6963	10	0.66056	D	0.02	-6.4611	18.6226	0.91326	0.0:0.0:1.0:0.0	.	137;193;193	Q9Y2H6-2;G5E9X3;Q9Y2H6	.;.;FND3A_HUMAN	L	193;129;193;137	ENSP00000417257:R193L;ENSP00000441831:R193L;ENSP00000381362:R137L	ENSP00000338579:R129L	R	+	2	0	FNDC3A	48608556	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.526000	0.81920	2.638000	0.89438	0.563000	0.77884	CGC	FNDC3A	-	NULL	ENSG00000102531		0.388	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3A	HGNC	protein_coding	OTTHUMT00000354845.2		0.00	44	0	G	NM_014923		49710555	+1			no_errors	ENST00000492622	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14857575	14857575	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:14857575A>G	ENST00000380880.3	-	5	1587	c.804T>C	c.(802-804)gaT>gaC	p.D268D	FREM1_ENST00000422223.2_Silent_p.D268D|FREM1_ENST00000380881.4_Silent_p.D268D			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	268					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TGCTCCTGGTATCTGTGAGGT	0.493																																																	0													182.0	174.0	177.0					9																	14857575		1913	4131	6044	SO:0001819	synonymous_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.804T>C	9.37:g.14857575A>G			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.D268	ENST00000380880.3	37	c.804	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.493	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	-	0.00	78	0	A	NM_144966		14857575	-1	tier1	-	no_errors	ENST00000380881	ensembl	human	known	74_37	silent	32.94	57	28	SNP	0.953	G
FRG2B	441581	genome.wustl.edu	37	10	135438753	135438753	+	Silent	SNP	G	G	A	rs375000694		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:135438753G>A	ENST00000425520.1	-	4	739	c.687C>T	c.(685-687)acC>acT	p.T229T	FRG2B_ENST00000443774.1_Silent_p.T230T	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	229						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAGCTGCCTGGGTGGCCATGG	0.597																																																	0													3.0	4.0	4.0					10																	135438753		1467	3364	4831	SO:0001819	synonymous_variant	0			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.687C>T	10.37:g.135438753G>A			Q5VSQ1	Silent	SNP	NULL	p.T229	ENST00000425520.1	37	c.687	CCDS44502.1	10																																																																																			FRG2B	-	NULL	ENSG00000225899		0.597	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	-	0.00	17	0	G	NM_001080998		135438753	-1	tier1	-	no_errors	ENST00000425520	ensembl	human	known	74_37	silent	30.00	14	6	SNP	0.707	A
FRMPD4	9758	genome.wustl.edu	37	X	12734450	12734450	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:12734450T>C	ENST00000380682.1	+	15	2378	c.1872T>C	c.(1870-1872)agT>agC	p.S624S		NM_014728.3	NP_055543.2	Q14CM0	FRPD4_HUMAN	FERM and PDZ domain containing 4	624					positive regulation of synapse structural plasticity (GO:0051835)	cytoskeleton (GO:0005856)|dendritic spine (GO:0043197)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			breast(1)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)	22						ACTACAGAAGTCTAGCTCAGC	0.517																																																	0													83.0	83.0	83.0					X																	12734450		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002314	CCDS35201.1	Xp22.31	2006-02-09	2006-02-09	2006-02-09	ENSG00000169933	ENSG00000169933			29007	protein-coding gene	gene with protein product		300838	"""PDZ domain containing 10"""	PDZK10, PDZD10		9205841	Standard	NM_014728		Approved	KIAA0316	uc004cuz.2	Q14CM0	OTTHUMG00000021138	ENST00000380682.1:c.1872T>C	X.37:g.12734450T>C			A8K0X9|O15032	Silent	SNP	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ,pfscan_WW_dom	p.S624	ENST00000380682.1	37	c.1872	CCDS35201.1	X																																																																																			FRMPD4	-	NULL	ENSG00000169933		0.517	FRMPD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD4	HGNC	protein_coding	OTTHUMT00000055771.1		0.00	10	0	T	XM_045712		12734450	+1			no_errors	ENST00000380682	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.071	C
FSHR	2492	genome.wustl.edu	37	2	49191062	49191062	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:49191062C>A	ENST00000406846.2	-	10	1017	c.898G>T	c.(898-900)Gaa>Taa	p.E300*	FSHR_ENST00000541117.1_Nonsense_Mutation_p.E36*|FSHR_ENST00000346173.3_Nonsense_Mutation_p.E238*|FSHR_ENST00000304421.4_Nonsense_Mutation_p.E274*	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	300					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TAATCAACTTCTTGCCTTAAA	0.388									Gonadal Dysgenesis, 46 XX																																								0													142.0	136.0	138.0					2																	49191062		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.898G>T	2.37:g.49191062C>A	ENSP00000384708:p.Glu300*		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.E300*	ENST00000406846.2	37	c.898	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	C	21.9	4.216520	0.79352	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000541117;ENST00000454032	.	.	.	5.53	4.66	0.58398	.	0.415931	0.26210	N	0.025699	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8388	0.52342	0.0:0.9204:0.0:0.0796	.	.	.	.	X	300;238;274;36;238	.	.	E	-	1	0	FSHR	49044566	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.599000	0.61076	1.584000	0.49913	0.655000	0.94253	GAA	FSHR	-	pfam_GnHR_TM,prints_FSH_rcpt	ENSG00000170820		0.388	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	28	0	C			49191062	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	nonsense	17.14	29	6	SNP	1.000	A
FSHR	2492	genome.wustl.edu	37	2	49210248	49210248	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:49210248T>A	ENST00000406846.2	-	7	701	c.582A>T	c.(580-582)caA>caT	p.Q194H	FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000346173.3_Missense_Mutation_p.Q194H|FSHR_ENST00000304421.4_Missense_Mutation_p.Q168H	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	194					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	GCTCATCTAGTTGGGTTCCAT	0.368									Gonadal Dysgenesis, 46 XX																																								0													104.0	102.0	103.0					2																	49210248		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.582A>T	2.37:g.49210248T>A	ENSP00000384708:p.Gln194His		A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.Q194H	ENST00000406846.2	37	c.582	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424061	0.62733	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;D;T;D	0.83673	0.43;-1.75;0.43;-1.75	5.53	4.27	0.50696	.	0.197854	0.45361	D	0.000361	T	0.78799	0.4340	N	0.16656	0.425	0.80722	D	1	B;D;B	0.76494	0.016;0.999;0.009	B;D;B	0.77004	0.016;0.989;0.012	T	0.75614	-0.3257	9	.	.	.	.	1.2283	0.01938	0.1577:0.1214:0.1874:0.5335	.	168;194;194	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	H	194;194;168;194	ENSP00000384708:Q194H;ENSP00000333908:Q194H;ENSP00000306780:Q168H;ENSP00000415504:Q194H	.	Q	-	3	2	FSHR	49063752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.960000	0.29253	0.963000	0.38082	0.533000	0.62120	CAA	FSHR	-	prints_FSH_rcpt,prints_TSH_rcpt	ENSG00000170820		0.368	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	33	0	T			49210248	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	missense	34.15	27	14	SNP	1.000	A
GHR	2690	genome.wustl.edu	37	5	42700005	42700005	+	Silent	SNP	G	G	T	rs45477803	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:42700005G>T	ENST00000230882.4	+	6	709	c.519G>T	c.(517-519)gtG>gtT	p.V173V	GHR_ENST00000537449.1_5'UTR|GHR_ENST00000357703.3_Silent_p.V151V	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	173	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.		V -> G (in LARS; almost completely abolishes GH-binding at cell surface: 26% binding to membrane fractions). {ECO:0000269|PubMed:9851797}.		2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	ATATCCAAGTGAGATGGGAAG	0.418																																																	0													138.0	118.0	125.0					5																	42700005		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.519G>T	5.37:g.42700005G>T			Q9HCX2	Silent	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.V173	ENST00000230882.4	37	c.519	CCDS3940.1	5																																																																																			GHR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000112964		0.418	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHR	HGNC	protein_coding	OTTHUMT00000211605.2	-	0.00	29	0	G	NM_000163		42700005	+1	tier1	-	no_errors	ENST00000230882	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.960	T
GIMAP8	155038	genome.wustl.edu	37	7	150174550	150174550	+	Silent	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:150174550G>A	ENST00000307271.3	+	5	2254	c.1680G>A	c.(1678-1680)gcG>gcA	p.A560A		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	560	AIG1-type G 3.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CGAAATACGCGATTATGCTGT	0.473																																																	0													90.0	91.0	91.0					7																	150174550		2203	4300	6503	SO:0001819	synonymous_variant	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1680G>A	7.37:g.150174550G>A				Silent	SNP	pfam_AIG1,superfamily_P-loop_NTPase	p.A560	ENST00000307271.3	37	c.1680	CCDS34777.1	7																																																																																			GIMAP8	-	pfam_AIG1,superfamily_P-loop_NTPase	ENSG00000171115		0.473	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	-	0.00	31	0	G	NM_175571		150174550	+1	tier1	-	no_errors	ENST00000307271	ensembl	human	known	74_37	silent	41.94	18	13	SNP	0.000	A
GNAS	2778	genome.wustl.edu	37	20	57428581	57428581	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:57428581A>C	ENST00000371100.4	+	1	813	c.261A>C	c.(259-261)gaA>gaC	p.E87D	GNAS_ENST00000306120.3_Missense_Mutation_p.K24T|GNAS_ENST00000371102.4_Missense_Mutation_p.E87D|GNAS_ENST00000313949.7_Intron|GNAS-AS1_ENST00000598163.1_RNA|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.E87D|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371098.2_Intron	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CATTCAGGGAAGCTGGAGCCC	0.612			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													27.0	30.0	29.0					20																	57428581		1933	4141	6074	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.261A>C	20.37:g.57428581A>C	ENSP00000360141:p.Glu87Asp		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.E87D	ENST00000371100.4	37	c.261	CCDS46622.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.20|11.20	1.569389|1.569389	0.28003|0.28003	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102|ENST00000306120	D;D|.	0.91686|.	-2.89;-2.87|.	4.55|4.55	4.55|4.55	0.56014|0.56014	.|.	.|.	.|.	.|.	.|.	T|T	0.66645|0.66645	0.2810|0.2810	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	P|.	0.51057|.	0.941|.	B|.	0.36335|.	0.222|.	T|T	0.69277|0.69277	-0.5187|-0.5187	9|6	0.29301|0.59425	T|D	0.29|0.04	.|.	10.8288|10.8288	0.46649|0.46649	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	87|.	Q5JWF2|.	GNAS1_HUMAN|.	D|T	87|24	ENSP00000360141:E87D;ENSP00000360143:E87D|.	ENSP00000360140:E87D|ENSP00000302237:K24T	E|K	+|+	3|2	2|0	GNAS|GNAS	56861976|56861976	0.780000|0.780000	0.28664|0.28664	0.737000|0.737000	0.30932|0.30932	0.054000|0.054000	0.15201|0.15201	0.875000|0.875000	0.28079|0.28079	1.993000|1.993000	0.58246|0.58246	0.455000|0.455000	0.32223|0.32223	GAA|AAG	GNAS	-	NULL	ENSG00000087460		0.612	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	-	0.00	38	0	A	NM_000516		57428581	+1	tier1	-	no_errors	ENST00000371100	ensembl	human	putative	74_37	missense	15.28	61	11	SNP	0.878	C
GNPTAB	79158	genome.wustl.edu	37	12	102173983	102173983	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:102173983T>C	ENST00000299314.7	-	7	980	c.718A>G	c.(718-720)Aca>Gca	p.T240A	GNPTAB_ENST00000549940.1_Missense_Mutation_p.T240A|RNA5SP368_ENST00000364298.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	240					carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						AGTTGATTTGTTTCCTTGAAT	0.353																																																	0													160.0	158.0	159.0					12																	102173983		2203	4300	6503	SO:0001583	missense	0			AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.718A>G	12.37:g.102173983T>C	ENSP00000299314:p.Thr240Ala		A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Missense_Mutation	SNP	pfam_DMAP1-bd,pfam_Notch_dom,pfam_DUF3184,superfamily_Notch_dom,smart_Notch_dom,pfscan_EF_hand_dom,pfscan_Notch_dom	p.T240A	ENST00000299314.7	37	c.718	CCDS9088.1	12	.	.	.	.	.	.	.	.	.	.	T	25.9	4.682758	0.88542	.	.	ENSG00000111670	ENST00000299314;ENST00000549940;ENST00000552681	D;D;T	0.97161	-3.99;-4.27;-1.25	6.04	6.04	0.98038	.	0.046419	0.85682	D	0.000000	D	0.97967	0.9331	M	0.65975	2.015	0.80722	D	1	P;D	0.76494	0.952;0.999	P;D	0.68039	0.547;0.955	D	0.98323	1.0529	10	0.51188	T	0.08	-20.6792	16.5763	0.84648	0.0:0.0:0.0:1.0	.	240;240	Q3T906-2;Q3T906	.;GNPTA_HUMAN	A	240;240;118	ENSP00000299314:T240A;ENSP00000449150:T240A;ENSP00000449217:T118A	ENSP00000299314:T240A	T	-	1	0	GNPTAB	100698114	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.969000	0.70422	2.317000	0.78254	0.459000	0.35465	ACA	GNPTAB	-	NULL	ENSG00000111670		0.353	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNPTAB	HGNC	protein_coding	OTTHUMT00000409182.1	-	0.00	59	0	T			102173983	-1	tier1	-	no_errors	ENST00000299314	ensembl	human	known	74_37	missense	8.75	73	7	SNP	1.000	C
GPR137C	283554	genome.wustl.edu	37	14	53066829	53066829	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:53066829A>C	ENST00000321662.6	+	3	488		c.e3-1			NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C							integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					TTTTTCTTTCAGAATTCTACT	0.333																																																	0													107.0	95.0	99.0					14																	53066829		1807	4070	5877	SO:0001630	splice_region_variant	0			BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.489-1A>C	14.37:g.53066829A>C			Q86SM2	Splice_Site	SNP	-	e3-2	ENST00000321662.6	37	c.489-2	CCDS45106.1	14	.	.	.	.	.	.	.	.	.	.	A	20.5	3.993442	0.74703	.	.	ENSG00000180998	ENST00000321662;ENST00000542169;ENST00000555622	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7054	0.77577	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR137C	52136579	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.660000	0.74417	2.164000	0.68074	0.477000	0.44152	.	GPR137C	-	-	ENSG00000180998		0.333	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137C	HGNC	protein_coding	OTTHUMT00000411685.1	-	0.00	55	0	A	XM_290615	Intron	53066829	+1	tier1	-	no_errors	ENST00000321662	ensembl	human	known	74_37	splice_site	39.58	29	19	SNP	1.000	C
GRID2IP	392862	genome.wustl.edu	37	7	6548003	6548003	+	Silent	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:6548003G>A	ENST00000457091.2	-	13	2156	c.2157C>T	c.(2155-2157)ttC>ttT	p.F719F	GRID2IP_ENST00000452113.1_Silent_p.F528F|GRID2IP_ENST00000435185.1_Silent_p.F535F	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	719					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						CATTGGTTACGAAGCTGCCCT	0.602																																																	0													16.0	15.0	15.0					7																	6548003		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2157C>T	7.37:g.6548003G>A				Silent	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.F719	ENST00000457091.2	37	c.2157	CCDS47537.1	7																																																																																			GRID2IP	-	NULL	ENSG00000215045		0.602	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	-	0.00	50	0	G	XM_294249		6548003	-1	tier1	-	no_errors	ENST00000457091	ensembl	human	putative	74_37	silent	30.86	56	25	SNP	0.016	A
GVINP1	387751	genome.wustl.edu	37	11	6741449	6741449	+	RNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:6741449A>C	ENST00000526769.3	-	0	1755					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										AAGTGTCATAACTTTTTAGTT	0.299																																																	0																																												0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6741449A>C			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.299	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	-	0.00	17	0	A	NR_003945		6741449	-1	tier1	-	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	42.31	15	11	SNP	0.001	C
HAND2-AS1	79804	genome.wustl.edu	37	4	174459710	174459710	+	RNA	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:174459710T>G	ENST00000504429.1	+	0	1498				HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000502896.1_RNA					HAND2 antisense RNA 1 (head to head)																		AGGCCTCCGCTTCCCTCCTGA	0.557																																																	0																																												0					4q34.1	2013-07-16			ENSG00000237125	ENSG00000237125		"""Long non-coding RNAs"""	48872	non-coding RNA	RNA, long non-coding	"""neuroblastoma transcript 301"", ""differentially expressed in neuroblastoma"""					18171985, 19348682	Standard	NR_003679		Approved	DEIN, NBLA00301, FLJ11539			OTTHUMG00000160783		4.37:g.174459710T>G				RNA	SNP	-	NULL	ENST00000504429.1	37	NULL		4																																																																																			HAND2-AS1	-	-	ENSG00000237125		0.557	HAND2-AS1-029	KNOWN	basic|exp_conf	antisense	HAND2-AS1	HGNC	antisense	OTTHUMT00000364287.1		0.00	11	0	T			174459710	+1			no_errors	ENST00000502334	ensembl	human	known	74_37	rna	50.00	2	2	SNP	0.978	G
HCN4	10021	genome.wustl.edu	37	15	73617465	73617465	+	Silent	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:73617465G>A	ENST00000261917.3	-	6	2802	c.1809C>T	c.(1807-1809)ttC>ttT	p.F603F		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	603					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		TGGACGTCACGAAGTTGGGGT	0.562																																																	0													142.0	123.0	129.0					15																	73617465		2198	4297	6495	SO:0001819	synonymous_variant	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.1809C>T	15.37:g.73617465G>A			Q9UMQ7	Silent	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.F603	ENST00000261917.3	37	c.1809	CCDS10248.1	15																																																																																			HCN4	-	superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000138622		0.562	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	-	0.00	72	0	G	NM_005477		73617465	-1	tier1	-	no_errors	ENST00000261917	ensembl	human	known	74_37	silent	31.58	52	24	SNP	0.941	A
HEATR6	63897	genome.wustl.edu	37	17	58124698	58124698	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:58124698G>T	ENST00000184956.6	-	18	2757	c.2741C>A	c.(2740-2742)gCt>gAt	p.A914D	HEATR6_ENST00000585976.1_Missense_Mutation_p.A802D	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	914							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			TGCTTCTATAGCTGATCGTAA	0.428																																																	0													275.0	222.0	240.0					17																	58124698		2203	4300	6503	SO:0001583	missense	0			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.2741C>A	17.37:g.58124698G>T	ENSP00000184956:p.Ala914Asp		B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A914D	ENST00000184956.6	37	c.2741	CCDS11623.1	17	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000202	0.93227	.	.	ENSG00000068097	ENST00000184956;ENST00000393017	T	0.65916	-0.18	5.16	5.16	0.70880	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80308	0.4599	M	0.80616	2.505	0.49213	D	0.999766	D;D	0.89917	0.995;1.0	D;D	0.74023	0.981;0.982	T	0.81684	-0.0821	10	0.52906	T	0.07	-13.1774	18.0898	0.89471	0.0:0.0:1.0:0.0	.	649;914	E7ESB9;Q6AI08	.;HEAT6_HUMAN	D	914;649	ENSP00000184956:A914D	ENSP00000184956:A914D	A	-	2	0	HEATR6	55479480	1.000000	0.71417	0.976000	0.42696	0.989000	0.77384	9.242000	0.95408	2.588000	0.87417	0.579000	0.79373	GCT	HEATR6	-	superfamily_ARM-type_fold	ENSG00000068097		0.428	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	-	0.00	81	0	G	NM_022070		58124698	-1	tier1	-	no_errors	ENST00000184956	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112622687	112622687	+	Silent	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:112622687G>T	ENST00000430131.2	-	60	9962	c.8817C>A	c.(8815-8817)ctC>ctA	p.L2939L	HECTD4_ENST00000377560.5_Silent_p.L3189L|HECTD4_ENST00000550722.1_Silent_p.L3215L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2939					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGAGGATGATGAGCAGGGTGA	0.692																																																	0													61.0	72.0	68.0					12																	112622687		2199	4292	6491	SO:0001819	synonymous_variant	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.8817C>A	12.37:g.112622687G>T			L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Silent	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L3189	ENST00000430131.2	37	c.9567		12																																																																																			HECTD4	-	NULL	ENSG00000173064		0.692	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		-	0.00	123	0	G	NM_173813		112622687	-1	tier1	-	no_errors	ENST00000377560	ensembl	human	known	74_37	silent	30.89	85	38	SNP	1.000	T
HHEX	3087	genome.wustl.edu	37	10	94454489	94454489	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:94454489C>T	ENST00000282728.5	+	4	2576	c.777C>T	c.(775-777)gaC>gaT	p.D259D	HHEX_ENST00000472590.2_Silent_p.D87D|HHEX_ENST00000492654.2_Silent_p.D87D	NM_002729.4	NP_002720.1	Q03014	HHEX_HUMAN	hematopoietically expressed homeobox	259					anterior/posterior pattern specification (GO:0009952)|B cell differentiation (GO:0030183)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|DNA conformation change (GO:0071103)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|forebrain morphogenesis (GO:0048853)|gall bladder development (GO:0061010)|hepatic duct development (GO:0061011)|hepatoblast differentiation (GO:0061017)|hepatocyte differentiation (GO:0070365)|in utero embryonic development (GO:0001701)|interkinetic nuclear migration (GO:0022027)|mRNA export from nucleus (GO:0006406)|multicellular organism growth (GO:0035264)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|pancreas development (GO:0031016)|poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|primary lung bud formation (GO:0060431)|primitive streak formation (GO:0090009)|protein localization to nucleus (GO:0034504)|regulation of cell proliferation (GO:0042127)|response to peptide hormone (GO:0043434)|response to wounding (GO:0009611)|thyroid gland development (GO:0030878)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|eukaryotic initiation factor 4E binding (GO:0008190)|protein homodimerization activity (GO:0042803)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(2)|lung(5)|ovary(1)	10						AGGAAGTGGACATTGAGGGCG	0.428																																																	0													80.0	80.0	80.0					10																	94454489		2203	4300	6503	SO:0001819	synonymous_variant	0			Z21533	CCDS7423.1	10q23.33	2011-06-20	2007-02-15		ENSG00000152804	ENSG00000152804		"""Homeoboxes / ANTP class : NKL subclass"""	4901	protein-coding gene	gene with protein product		604420		PRHX		8096636, 8103988	Standard	NM_002729		Approved	HEX, HOX11L-PEN	uc001kid.3	Q03014	OTTHUMG00000018762	ENST00000282728.5:c.777C>T	10.37:g.94454489C>T			B1AQ17|Q96CE9	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_Homeobox_metazoa,pfscan_Homeobox_dom	p.D259	ENST00000282728.5	37	c.777	CCDS7423.1	10																																																																																			HHEX	-	NULL	ENSG00000152804		0.428	HHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHEX	HGNC	protein_coding	OTTHUMT00000049402.2		0.00	44	0	C			94454489	+1			no_errors	ENST00000282728	ensembl	human	known	74_37	silent	6.06	31	2	SNP	1.000	T
HTR2A	3356	genome.wustl.edu	37	13	47409370	47409370	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:47409370A>C	ENST00000378688.4	-	3	1149	c.1018T>G	c.(1018-1020)Ttc>Gtc	p.F340V	HTR2A_ENST00000543956.1_Missense_Mutation_p.F256V|HTR2A_ENST00000542664.1_Missense_Mutation_p.F340V			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	340	Agonist binding. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TTTGTGATGAAGAAAGGGCAC	0.498																																																	0													163.0	132.0	143.0					13																	47409370		2203	4300	6503	SO:0001583	missense	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.1018T>G	13.37:g.47409370A>C	ENSP00000367959:p.Phe340Val		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.F340V	ENST00000378688.4	37	c.1018	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	A	22.9	4.343707	0.82022	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.38240	1.15;1.15;1.15	5.86	5.86	0.93980	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.74831	0.3768	H	0.97896	4.1	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.84711	0.0734	10	0.87932	D	0	.	15.7408	0.77894	1.0:0.0:0.0:0.0	.	256;340	F5GWE8;P28223	.;5HT2A_HUMAN	V	340;256;340	ENSP00000367959:F340V;ENSP00000441861:F256V;ENSP00000437737:F340V	ENSP00000367959:F340V	F	-	1	0	HTR2A	46307371	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.287000	0.95975	2.367000	0.80283	0.528000	0.53228	TTC	HTR2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT_rcpt	ENSG00000102468		0.498	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	-	0.00	39	0	A	NM_000621		47409370	-1	tier1	-	no_errors	ENST00000378688	ensembl	human	known	74_37	missense	20.41	39	10	SNP	1.000	C
IFI16	3428	genome.wustl.edu	37	1	159019232	159019232	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:159019232A>G	ENST00000295809.7	+	9	1763	c.1508A>G	c.(1507-1509)gAc>gGc	p.D503G	IFI16_ENST00000430894.2_Missense_Mutation_p.D451G|IFI16_ENST00000340979.6_Intron|IFI16_ENST00000368132.3_Missense_Mutation_p.D447G|IFI16_ENST00000368131.4_Intron|IFI16_ENST00000359709.3_Missense_Mutation_p.D447G|IFI16_ENST00000448393.2_Intron			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	503					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					AAAAGTGAAGACACAATCTCC	0.358																																																	0													15.0	12.0	13.0					1																	159019232		691	1567	2258	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1508A>G	1.37:g.159019232A>G	ENSP00000295809:p.Asp503Gly		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.D503G	ENST00000295809.7	37	c.1508		1	.	.	.	.	.	.	.	.	.	.	A	6.735	0.504404	0.12822	.	.	ENSG00000163565	ENST00000295809;ENST00000368132;ENST00000430894	T;T;T	0.05925	3.37;3.45;3.37	2.4	1.27	0.21489	.	.	.	.	.	T	0.01870	0.0059	L	0.29908	0.895	0.09310	N	1	B;P	0.52316	0.369;0.952	B;P	0.47528	0.078;0.549	T	0.43245	-0.9403	9	0.24483	T	0.36	.	4.2124	0.10517	0.8312:0.0:0.1688:0.0	.	451;447	E7EPR3;Q16666-2	.;.	G	503;447;451	ENSP00000295809:D503G;ENSP00000357114:D447G;ENSP00000394935:D451G	ENSP00000295809:D503G	D	+	2	0	IFI16	157285856	0.000000	0.05858	0.003000	0.11579	0.018000	0.09664	-0.205000	0.09411	0.361000	0.24292	-0.379000	0.06801	GAC	IFI16	-	NULL	ENSG00000163565		0.358	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	24	0	A	NM_005531		159019232	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	20.69	23	6	SNP	0.003	G
IGF2R	3482	genome.wustl.edu	37	6	160505029	160505029	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:160505029G>T	ENST00000356956.1	+	40	6029	c.5881G>T	c.(5881-5883)Gag>Tag	p.E1961*		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1961					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.E1961K(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	TGATGAAGATGAGGACATTGG	0.468																																																	1	Substitution - Missense(1)	lung(1)											133.0	118.0	123.0					6																	160505029		2203	4300	6503	SO:0001587	stop_gained	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.5881G>T	6.37:g.160505029G>T	ENSP00000349437:p.Glu1961*		Q7Z7G9|Q96PT5	Nonsense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.E1961*	ENST00000356956.1	37	c.5881	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	G	46	12.816412	0.99698	.	.	ENSG00000197081	ENST00000356956	.	.	.	5.25	4.38	0.52667	.	0.386402	0.29113	N	0.013108	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-11.4236	14.7933	0.69860	0.0726:0.0:0.9274:0.0	.	.	.	.	X	1961	.	ENSP00000349437:E1961X	E	+	1	0	IGF2R	160425019	0.991000	0.36638	0.001000	0.08648	0.861000	0.49209	6.008000	0.70739	2.894000	0.99253	0.655000	0.94253	GAG	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.468	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1		0.00	24	0	G	NM_000876		160505029	+1			no_errors	ENST00000356956	ensembl	human	known	74_37	nonsense	6.67	28	2	SNP	0.279	T
IL19	29949	genome.wustl.edu	37	1	207014366	207014366	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:207014366T>C	ENST00000270218.6	+	6	1320	c.381T>C	c.(379-381)tgT>tgC	p.C127C	IL19_ENST00000340758.2_Silent_p.C165C	NM_013371.3	NP_037503.2	Q9UHD0	IL19_HUMAN	interleukin 19	127					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			AGAGGCAGTGTCACTGCAGGC	0.517																																																	0													120.0	92.0	102.0					1																	207014366		2203	4300	6503	SO:0001819	synonymous_variant	0			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000270218.6:c.381T>C	1.37:g.207014366T>C			B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Silent	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core,prints_IL-19,prints_IL-24	p.C165	ENST00000270218.6	37	c.495	CCDS1469.1	1																																																																																			IL19	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core	ENSG00000142224		0.517	IL19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL19	HGNC	protein_coding	OTTHUMT00000088567.2	-	0.00	58	0	T	NM_153758		207014366	+1	tier1	-	no_errors	ENST00000340758	ensembl	human	known	74_37	silent	26.58	58	21	SNP	0.997	C
IL6ST	3572	genome.wustl.edu	37	5	55265471	55265471	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:55265471C>T	ENST00000381298.2	-	4	589	c.277G>A	c.(277-279)Gat>Aat	p.D93N	IL6ST_ENST00000396816.1_Intron|IL6ST_ENST00000336909.5_Missense_Mutation_p.D93N|IL6ST_ENST00000577363.1_Intron|IL6ST_ENST00000502326.3_Missense_Mutation_p.D93N|IL6ST_ENST00000381294.3_Missense_Mutation_p.D93N|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000522633.2_Missense_Mutation_p.D93N|IL6ST_ENST00000381287.4_Missense_Mutation_p.D93N|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000536319.1_Missense_Mutation_p.D93N	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	93	Ig-like C2-type.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				GAAGCTATATCTGTAAAGGTG	0.333			O		hepatocellular ca																																			Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													109.0	99.0	102.0					5																	55265471		2203	4299	6502	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.277G>A	5.37:g.55265471C>T	ENSP00000370698:p.Asp93Asn		A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL-6_rcpt_alpha-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D93N	ENST00000381298.2	37	c.277	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	C	10.92	1.488403	0.26686	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294;ENST00000381287;ENST00000536319;ENST00000522633;ENST00000542298	T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94;-0.94	5.86	-9.62	0.00547	Fibronectin, type III (1);Immunoglobulin C2-set-like, ligand-binding (1);Immunoglobulin-like fold (1);	1.064340	0.07146	N	0.848156	T	0.46328	0.1387	N	0.04746	-0.17	0.31424	N	0.673961	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.12156	0.005;0.004;0.007	T	0.46359	-0.9197	10	0.08381	T	0.77	.	14.3793	0.66900	0.0:0.6608:0.102:0.2372	.	93;93;93	Q5FC04;P40189-2;P40189	.;.;IL6RB_HUMAN	N	93	ENSP00000370698:D93N;ENSP00000338799:D93N;ENSP00000370694:D93N;ENSP00000370687:D93N;ENSP00000444456:D93N;ENSP00000435399:D93N	ENSP00000338799:D93N	D	-	1	0	IL6ST	55301228	0.003000	0.15002	0.053000	0.19242	0.931000	0.56810	-0.640000	0.05440	-1.407000	0.02043	-0.225000	0.12378	GAT	IL6ST	-	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3	ENSG00000134352		0.333	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	-	0.00	96	0	C	NM_002184		55265471	-1	tier1	-	no_errors	ENST00000336909	ensembl	human	known	74_37	missense	16.18	57	11	SNP	0.040	T
IRF4	3662	genome.wustl.edu	37	6	405041	405041	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:405041G>A	ENST00000380956.4	+	8	1249	c.1123G>A	c.(1123-1125)Ggc>Agc	p.G375S		NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	375					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		TGCTCACCACGGCCGCTCCCT	0.517			T	IGH@	MM																																			Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	0													75.0	74.0	74.0					6																	405041		2203	4300	6503	SO:0001583	missense	0			U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.1123G>A	6.37:g.405041G>A	ENSP00000370343:p.Gly375Ser		Q5VUI7|Q99660	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.G375S	ENST00000380956.4	37	c.1123	CCDS4469.1	6	.	.	.	.	.	.	.	.	.	.	G	14.17	2.456310	0.43634	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.93953	-3.32	5.72	1.82	0.25136	SMAD domain-like (1);SMAD/FHA domain (1);Interferon regulatory factor-3 (1);	0.197869	0.53938	N	0.000055	T	0.79753	0.4500	L	0.54323	1.7	0.58432	D	0.999998	B;B	0.14012	0.007;0.009	B;B	0.20184	0.028;0.02	T	0.68934	-0.5278	10	0.08179	T	0.78	-21.8324	6.7445	0.23454	0.2541:0.1177:0.6283:0.0	.	374;375	Q15306-2;Q15306	.;IRF4_HUMAN	S	375;404	ENSP00000370343:G375S	ENSP00000370343:G375S	G	+	1	0	IRF4	350041	1.000000	0.71417	0.592000	0.28758	0.735000	0.41995	4.485000	0.60279	0.040000	0.15660	-0.302000	0.09304	GGC	IRF4	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain	ENSG00000137265		0.517	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF4	HGNC	protein_coding	OTTHUMT00000043638.1	-	0.00	48	0	G			405041	+1	tier1	-	no_errors	ENST00000380956	ensembl	human	known	74_37	missense	24.59	46	15	SNP	0.968	A
IRX6	79190	genome.wustl.edu	37	16	55363013	55363013	+	Missense_Mutation	SNP	A	A	C	rs546661838		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:55363013A>C	ENST00000290552.7	+	5	2455	c.1123A>C	c.(1123-1125)Agt>Cgt	p.S375R	RP11-26L20.3_ENST00000558730.2_RNA	NM_024335.2	NP_077311.2	P78412	IRX6_HUMAN	iroquois homeobox 6	375					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(2)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	33						TAGGCCACGAAGTCCTGAGTG	0.637																																																	0													67.0	62.0	63.0					16																	55363013		2198	4300	6498	SO:0001583	missense	0			AF319966	CCDS32449.1	16q12.2	2011-06-20	2007-07-13	2003-01-10		ENSG00000159387		"""Homeoboxes / TALE class"""	14675	protein-coding gene	gene with protein product		606196	"""iroquois homeobox protein 7"", ""iroquois homeobox protein 6"""	IRX7			Standard	NM_024335		Approved	IRX-3	uc002ehy.3	P78412		ENST00000290552.7:c.1123A>C	16.37:g.55363013A>C	ENSP00000290552:p.Ser375Arg		B2RN06|Q7Z2K0	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.S375R	ENST00000290552.7	37	c.1123	CCDS32449.1	16	.	.	.	.	.	.	.	.	.	.	A	17.84	3.486903	0.63962	.	.	ENSG00000159387	ENST00000290552	D	0.90004	-2.6	5.36	4.27	0.50696	.	1.155260	0.06148	N	0.673553	D	0.89798	0.6819	L	0.27053	0.805	0.32391	N	0.553266	D	0.69078	0.997	D	0.63597	0.916	D	0.83742	0.0204	10	0.52906	T	0.07	-0.8435	8.3681	0.32399	0.91:0.0:0.09:0.0	.	375	P78412	IRX6_HUMAN	R	375	ENSP00000290552:S375R	ENSP00000290552:S375R	S	+	1	0	IRX6	53920514	0.932000	0.31603	0.986000	0.45419	0.538000	0.34931	1.958000	0.40402	2.016000	0.59253	0.459000	0.35465	AGT	IRX6	-	NULL	ENSG00000159387		0.637	IRX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX6	HGNC	protein_coding	OTTHUMT00000417445.4	-	0.00	71	0	A	NM_024335		55363013	+1	tier1	-	no_errors	ENST00000290552	ensembl	human	known	74_37	missense	42.37	34	25	SNP	0.968	C
ITGA5	3678	genome.wustl.edu	37	12	54799668	54799668	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:54799668A>C	ENST00000293379.4	-	10	1210	c.949T>G	c.(949-951)Ttc>Gtc	p.F317V	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	317					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						TCCCCTGAGAAGTTGTAGAGG	0.527																																																	0													127.0	119.0	122.0					12																	54799668		2203	4300	6503	SO:0001583	missense	0				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.949T>G	12.37:g.54799668A>C	ENSP00000293379:p.Phe317Val		Q96HA5	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.F317V	ENST00000293379.4	37	c.949	CCDS8880.1	12	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682707	0.47991	.	.	ENSG00000161638	ENST00000293379	T	0.22336	1.96	4.82	3.66	0.41972	.	0.216238	0.37437	N	0.002090	T	0.20455	0.0492	L	0.52905	1.665	0.44309	D	0.997185	B	0.09022	0.002	B	0.06405	0.002	T	0.03750	-1.1007	10	0.56958	D	0.05	.	9.8971	0.41324	0.8205:0.1795:0.0:0.0	.	317	P08648	ITA5_HUMAN	V	317	ENSP00000293379:F317V	ENSP00000293379:F317V	F	-	1	0	ITGA5	53085935	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.537000	0.53590	0.962000	0.38057	0.459000	0.35465	TTC	ITGA5	-	smart_Int_alpha_beta-p	ENSG00000161638		0.527	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA5	HGNC	protein_coding	OTTHUMT00000406174.1	-	0.00	80	0	A			54799668	-1	tier1	-	no_errors	ENST00000293379	ensembl	human	known	74_37	missense	28.12	46	18	SNP	1.000	C
IVL	3713	genome.wustl.edu	37	1	152883271	152883271	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:152883271T>A	ENST00000368764.3	+	2	1062	c.998T>A	c.(997-999)cTg>cAg	p.L333Q	IVL_ENST00000392667.2_Missense_Mutation_p.L187Q			P07476	INVO_HUMAN	involucrin	333	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gaggggcaactggagcagctg	0.662																																																	0													17.0	16.0	17.0					1																	152883271		2116	4166	6282	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.998T>A	1.37:g.152883271T>A	ENSP00000357753:p.Leu333Gln		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.L333Q	ENST00000368764.3	37	c.998	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	T	2.906	-0.226388	0.06022	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.19532	2.56;2.14	3.82	-7.63	0.01290	.	.	.	.	.	T	0.02533	0.0077	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.38693	-0.9649	9	0.13108	T	0.6	.	6.5008	0.22168	0.2461:0.205:0.0:0.5489	.	333	P07476	INVO_HUMAN	Q	333;187	ENSP00000357753:L333Q;ENSP00000376435:L187Q	ENSP00000357753:L333Q	L	+	2	0	IVL	151149895	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.992000	0.03724	-2.425000	0.00561	-1.573000	0.00871	CTG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.662	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	102	0	T	NM_005547		152883271	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	22.14	109	31	SNP	0.001	A
JAKMIP1	152789	genome.wustl.edu	37	4	6087238	6087238	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:6087238A>C	ENST00000282924.5	-	4	1228	c.743T>G	c.(742-744)gTt>gGt	p.V248G	JAKMIP1_ENST00000409021.3_Missense_Mutation_p.V248G|JAKMIP1_ENST00000409371.3_Missense_Mutation_p.V83G|JAKMIP1_ENST00000457227.2_5'UTR|JAKMIP1_ENST00000409831.1_Missense_Mutation_p.V248G|JAKMIP1_ENST00000410077.2_Missense_Mutation_p.V83G	NM_144720.3	NP_653321.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	248	Mediates association with microtubules.				cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTTGACCTGAACCAGCTGCTC	0.607																																																	0													103.0	104.0	103.0					4																	6087238		2203	4300	6503	SO:0001583	missense	0			AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000282924.5:c.743T>G	4.37:g.6087238A>C	ENSP00000282924:p.Val248Gly		A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	NULL	p.V248G	ENST00000282924.5	37	c.743	CCDS3385.1	4	.	.	.	.	.	.	.	.	.	.	A	10.23	1.293893	0.23564	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000418227;ENST00000425341;ENST00000429819;ENST00000282924;ENST00000409831;ENST00000410077	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	4.1	2.89	0.33648	.	0.108216	0.39020	N	0.001500	T	0.23886	0.0578	L	0.31294	0.92	0.58432	D	0.999993	B;B;B;B;B	0.12013	0.005;0.002;0.002;0.002;0.002	B;B;B;B;B	0.09377	0.001;0.004;0.002;0.001;0.004	T	0.04781	-1.0927	10	0.25106	T	0.35	.	9.9299	0.41517	0.8283:0.1716:0.0:0.0	.	83;248;83;248;248	B4DHZ8;F2Z2K5;Q96N16-5;Q96N16-2;Q96N16	.;.;.;.;JKIP1_HUMAN	G	248;83;248;248;140;248;248;83	ENSP00000386711:V248G;ENSP00000387042:V83G;ENSP00000282924:V248G;ENSP00000386925:V248G;ENSP00000386745:V83G	ENSP00000282924:V248G	V	-	2	0	JAKMIP1	6138139	1.000000	0.71417	0.993000	0.49108	0.932000	0.56968	4.577000	0.60922	0.624000	0.30286	-0.313000	0.08912	GTT	JAKMIP1	-	NULL	ENSG00000152969		0.607	JAKMIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAKMIP1	HGNC	protein_coding	OTTHUMT00000246816.2	-	0.00	44	0	A	NM_144720		6087238	-1	tier1	-	no_errors	ENST00000409021	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.998	C
KAT2B	8850	genome.wustl.edu	37	3	20169040	20169040	+	Splice_Site	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:20169040A>G	ENST00000263754.4	+	11	2203	c.1748A>G	c.(1747-1749)aAg>aGg	p.K583R		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	583	Acetyl-CoA binding. {ECO:0000269|PubMed:10393169}.|N-acetyltransferase. {ECO:0000250|UniProtKB:Q92830, ECO:0000255|PROSITE-ProRule:PRU00532}.				cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						GAGCAAGTCAAGGTAAGGGTA	0.468																																																	0													153.0	135.0	141.0					3																	20169040		2203	4300	6503	SO:0001630	splice_region_variant	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1749+1A>G	3.37:g.20169040A>G			Q6NSK1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom	p.K583R	ENST00000263754.4	37	c.1748	CCDS2634.1	3	.	.	.	.	.	.	.	.	.	.	A	34	5.404672	0.96051	.	.	ENSG00000114166	ENST00000263754	T	0.28069	1.63	6.04	6.04	0.98038	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	M	0.62209	1.925	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.56098	-0.8035	10	0.87932	D	0	-25.9809	16.5763	0.84648	1.0:0.0:0.0:0.0	.	583	Q92831	KAT2B_HUMAN	R	583	ENSP00000263754:K583R	ENSP00000263754:K583R	K	+	2	0	KAT2B	20144044	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.317000	0.78254	0.459000	0.35465	AAG	KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000114166		0.468	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1		0.00	61	0	A	NM_003884	Missense_Mutation	20169040	+1			no_errors	ENST00000263754	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	G
KCNH1	3756	genome.wustl.edu	37	1	210977488	210977488	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:210977488A>G	ENST00000271751.4	-	8	1510	c.1483T>C	c.(1483-1485)Ttc>Ctc	p.F495L	KCNH1_ENST00000367007.4_Missense_Mutation_p.F468L			O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 1	495					myoblast fusion (GO:0007520)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|phosphorelay sensor kinase activity (GO:0000155)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|lung(35)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		ACATTCCCGAAGATGGTGGCA	0.483																																																	0													108.0	97.0	101.0					1																	210977488		2203	4300	6503	SO:0001583	missense	0			AJ001366	CCDS1496.1, CCDS31015.1	1q32.2	2012-07-05			ENSG00000143473	ENSG00000143473		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6250	protein-coding gene	gene with protein product		603305				9738473, 16382104	Standard	NM_172362		Approved	Kv10.1, eag, h-eag, eag1	uc001hib.2	O95259	OTTHUMG00000036309	ENST00000271751.4:c.1483T>C	1.37:g.210977488A>G	ENSP00000271751:p.Phe495Leu		B1AQ26|O76035|Q14CL3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,tigrfam_PAS	p.F495L	ENST00000271751.4	37	c.1483	CCDS1496.1	1	.	.	.	.	.	.	.	.	.	.	A	29.5	5.007660	0.93287	.	.	ENSG00000143473	ENST00000271751;ENST00000367007	D;D	0.97994	-4.65;-4.65	5.66	5.66	0.87406	Ion transport (1);	0.102140	0.64402	D	0.000001	D	0.98002	0.9342	L	0.55017	1.72	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.64237	0.923;0.923	D	0.99063	1.0831	10	0.72032	D	0.01	.	15.9002	0.79369	1.0:0.0:0.0:0.0	.	468;495	Q14CL3;O95259	.;KCNH1_HUMAN	L	495;468	ENSP00000271751:F495L;ENSP00000355974:F468L	ENSP00000271751:F495L	F	-	1	0	KCNH1	209044111	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	8.999000	0.93557	2.164000	0.68074	0.459000	0.35465	TTC	KCNH1	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000143473		0.483	KCNH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH1	HGNC	protein_coding	OTTHUMT00000088332.1	-	0.00	96	0	A	NM_002238		210977488	-1	tier1	-	no_errors	ENST00000271751	ensembl	human	known	74_37	missense	13.85	111	18	SNP	1.000	G
KCNMA1	3778	genome.wustl.edu	37	10	78771794	78771794	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:78771794A>C	ENST00000286628.8	-	18	2022	c.2023T>G	c.(2023-2025)Ttt>Gtt	p.F675V	KCNMA1_ENST00000286627.5_Missense_Mutation_p.F675V|KCNMA1_ENST00000372440.1_Missense_Mutation_p.F675V|KCNMA1_ENST00000372443.1_Missense_Mutation_p.F675V|KCNMA1_ENST00000404857.1_Missense_Mutation_p.F675V|KCNMA1_ENST00000354353.5_Missense_Mutation_p.F675V|KCNMA1_ENST00000406533.3_Missense_Mutation_p.F679V|KCNMA1_ENST00000404771.3_Missense_Mutation_p.F675V	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	675					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TTGCAGTAAAAAAATGCCCTG	0.433																																																	0													113.0	110.0	111.0					10																	78771794		2203	4300	6503	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2023T>G	10.37:g.78771794A>C	ENSP00000286628:p.Phe675Val		F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.F679V	ENST00000286628.8	37	c.2035		10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	17.34|17.34|17.34	3.365667|3.365667|3.365667	0.61513|0.61513|0.61513	.|.|.	.|.|.	ENSG00000156113|ENSG00000156113|ENSG00000156113	ENST00000372421;ENST00000434208;ENST00000450795|ENST00000372403|ENST00000372440;ENST00000372408;ENST00000372437;ENST00000457953;ENST00000404771;ENST00000372443;ENST00000286627;ENST00000286628;ENST00000406533;ENST00000354353;ENST00000404857;ENST00000412708	T|D|D;D;D;D;D;D;D;D;D	0.19669|0.83914|0.85013	2.13|-1.78|-1.84;-1.83;-1.88;-1.91;-1.87;-1.84;-1.92;-1.93;-1.89	5.69|5.69|5.69	5.69|5.69|5.69	0.88448|0.88448|0.88448	.|.|.	0.049908|0.049908|0.049908	0.85682|0.85682|0.85682	D|D|D	0.000000|0.000000|0.000000	D|D|D	0.83885|0.83885|0.83885	0.5351|0.5351|0.5351	L|L|L	0.48642|0.48642|0.48642	1.525|1.525|1.525	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|B;B;B;B;B;B;B;B	.|.|0.32302	.|.|0.001;0.017;0.03;0.004;0.017;0.026;0.363;0.004	.|.|B;B;B;B;B;B;B;B	.|.|0.37989	.|.|0.012;0.134;0.262;0.024;0.059;0.168;0.262;0.027	D|D|D	0.83708|0.83708|0.83708	0.0186|0.0186|0.0186	8|8|10	0.72032|0.26408|0.56958	D|T|D	0.01|0.33|0.05	-11.0932|-11.0932|-11.0932	15.9394|15.9394|15.9394	0.79743|0.79743|0.79743	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	.|.|675;675;675;675;675;457;675;675	.|.|Q12791-4;B7ZMF5;Q12791-2;Q12791;Q12791-5;C9JFZ9;F8WA96;Q5SVJ7	.|.|.;.;.;KCMA1_HUMAN;.;.;.;.	C|L|V	663;353;167|625|675;612;610;649;612;675;675;649;679;675;675;457	ENSP00000402150:F353C|ENSP00000361480:F625L|ENSP00000361517:F675V;ENSP00000361485:F612V;ENSP00000361514:F610V;ENSP00000396608:F649V;ENSP00000361520:F675V;ENSP00000286627:F675V;ENSP00000385552:F679V;ENSP00000346321:F675V;ENSP00000385806:F675V	ENSP00000361498:F663C|ENSP00000361480:F625L|ENSP00000286627:F675V	F|F|F	-|-|-	2|3|1	0|2|0	KCNMA1|KCNMA1|KCNMA1	78441800|78441800|78441800	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	9.339000|9.339000|9.339000	0.96797|0.96797|0.96797	2.162000|2.162000|2.162000	0.67917|0.67917|0.67917	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TTT|TTT|TTT	KCNMA1	-	NULL	ENSG00000156113		0.433	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	-	0.00	27	0	A	NM_002247		78771794	-1	tier1	-	no_errors	ENST00000406533	ensembl	human	known	74_37	missense	16.13	26	5	SNP	1.000	C
KCNQ5	56479	genome.wustl.edu	37	6	73830211	73830211	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:73830211T>C	ENST00000370398.1	+	8	1240	c.1131T>C	c.(1129-1131)gtT>gtC	p.V377V	KCNQ5_ENST00000342056.2_Silent_p.V377V|KCNQ5_ENST00000370392.1_Silent_p.V377V|KCNQ5_ENST00000403813.2_Silent_p.V377V|KCNQ5_ENST00000402622.2_Silent_p.V377V|KCNQ5_ENST00000355635.3_Silent_p.V377V|KCNQ5_ENST00000355194.4_Silent_p.V377V|KCNQ5_ENST00000414165.2_Silent_p.V377V	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	377					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TGCAGTGTGTTTGGCGTAGTT	0.418																																					GBM(142;1375 1859 14391 23261 44706)												0													81.0	65.0	70.0					6																	73830211		2203	4300	6503	SO:0001819	synonymous_variant	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1131T>C	6.37:g.73830211T>C			A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.V377	ENST00000370398.1	37	c.1131	CCDS4976.1	6																																																																																			KCNQ5	-	NULL	ENSG00000185760		0.418	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	-	0.00	16	0	T	NM_019842		73830211	+1	tier1	-	no_errors	ENST00000402622	ensembl	human	known	74_37	silent	20.00	20	5	SNP	1.000	C
KCNT1	57582	genome.wustl.edu	37	9	138656941	138656941	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:138656941G>A	ENST00000263604.3	+	12	1043	c.1043G>A	c.(1042-1044)cGt>cAt	p.R348H	KCNT1_ENST00000490355.2_Missense_Mutation_p.R348H|KCNT1_ENST00000491806.2_Missense_Mutation_p.R334H|KCNT1_ENST00000487664.1_Missense_Mutation_p.R322H|KCNT1_ENST00000298480.5_Missense_Mutation_p.R367H|KCNT1_ENST00000371757.2_Missense_Mutation_p.R367H|KCNT1_ENST00000488444.2_Missense_Mutation_p.R348H|KCNT1_ENST00000486577.2_Missense_Mutation_p.R328H			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	348					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AGCCGCCACCGTGCGCAGACG	0.612																																																	0													156.0	136.0	142.0					9																	138656941		2202	4299	6501	SO:0001583	missense	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1043G>A	9.37:g.138656941G>A	ENSP00000263604:p.Arg348His		B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.R367H	ENST00000263604.3	37	c.1100		9	.	.	.	.	.	.	.	.	.	.	G	19.71	3.879246	0.72294	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	4.35	4.35	0.52113	.	0.000000	0.64402	U	0.000002	T	0.40909	0.1136	M	0.68952	2.095	0.80722	D	1	P;D;P;P	0.56746	0.809;0.977;0.609;0.562	B;P;B;B	0.52343	0.248;0.696;0.333;0.119	T	0.44982	-0.9292	10	0.72032	D	0.01	-32.9882	16.0187	0.80464	0.0:0.0:1.0:0.0	.	334;367;322;348	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	H	322;367;367;328;334;348;348;348	ENSP00000417851:R322H;ENSP00000298480:R367H;ENSP00000360822:R367H;ENSP00000263604:R348H	ENSP00000263604:R348H	R	+	2	0	KCNT1	137796762	1.000000	0.71417	0.997000	0.53966	0.833000	0.47200	9.285000	0.95894	2.241000	0.73720	0.462000	0.41574	CGT	KCNT1	-	NULL	ENSG00000107147		0.612	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		-	0.00	35	0	G	NM_020822		138656941	+1	tier1	-	no_errors	ENST00000298480	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	A
KIF19	124602	genome.wustl.edu	37	17	72349029	72349029	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:72349029A>C	ENST00000389916.4	+	15	2188	c.2050A>C	c.(2050-2052)Aag>Cag	p.K684Q	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	684					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GGAGAGTGTGAAGACATTGAG	0.617																																																	0													102.0	110.0	107.0					17																	72349029		2020	4190	6210	SO:0001583	missense	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2050A>C	17.37:g.72349029A>C	ENSP00000374566:p.Lys684Gln		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.K684Q	ENST00000389916.4	37	c.2050	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	A	12.65	2.002414	0.35320	.	.	ENSG00000196169	ENST00000389916	T	0.72835	-0.69	5.08	5.08	0.68730	.	.	.	.	.	T	0.67636	0.2914	L	0.53249	1.67	0.27139	N	0.961697	B	0.18863	0.031	B	0.19148	0.024	T	0.61535	-0.7043	9	0.49607	T	0.09	.	14.1689	0.65495	1.0:0.0:0.0:0.0	.	684	Q2TAC6	KIF19_HUMAN	Q	684	ENSP00000374566:K684Q	ENSP00000374566:K684Q	K	+	1	0	KIF19	69860624	1.000000	0.71417	0.993000	0.49108	0.281000	0.26958	2.781000	0.47750	2.044000	0.60594	0.374000	0.22700	AAG	KIF19	-	NULL	ENSG00000196169		0.617	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	-	0.00	37	0	A	NM_153209		72349029	+1	tier1	-	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	27.50	29	11	SNP	1.000	C
KIF19	124602	genome.wustl.edu	37	17	72349038	72349038	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:72349038A>C	ENST00000389916.4	+	15	2197	c.2059A>C	c.(2059-2061)Agc>Cgc	p.S687R	AC103809.2_ENST00000599136.1_5'Flank	NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	687					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GAAGACATTGAGCTCTGATGC	0.627																																																	0													96.0	103.0	101.0					17																	72349038		2018	4189	6207	SO:0001583	missense	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2059A>C	17.37:g.72349038A>C	ENSP00000374566:p.Ser687Arg		A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.S687R	ENST00000389916.4	37	c.2059	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	A	11.94	1.790035	0.31685	.	.	ENSG00000196169	ENST00000389916	T	0.70869	-0.52	4.55	1.07	0.20283	.	.	.	.	.	T	0.54481	0.1861	L	0.46157	1.445	0.09310	N	1	B	0.23735	0.09	B	0.18263	0.021	T	0.33111	-0.9881	9	0.14656	T	0.56	.	3.3662	0.07204	0.4474:0.2137:0.3389:0.0	.	687	Q2TAC6	KIF19_HUMAN	R	687	ENSP00000374566:S687R	ENSP00000374566:S687R	S	+	1	0	KIF19	69860633	0.015000	0.18098	0.000000	0.03702	0.029000	0.11900	0.930000	0.28858	0.336000	0.23639	-0.475000	0.04921	AGC	KIF19	-	NULL	ENSG00000196169		0.627	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	-	0.00	33	0	A	NM_153209		72349038	+1	tier1	-	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.119	C
KIF1B	23095	genome.wustl.edu	37	1	10397523	10397523	+	Silent	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:10397523T>A	ENST00000377086.1	+	31	3556	c.3354T>A	c.(3352-3354)acT>acA	p.T1118T	KIF1B_ENST00000263934.6_Silent_p.T1072T|KIF1B_ENST00000377081.1_Silent_p.T1118T			O60333	KIF1B_HUMAN	kinesin family member 1B	1118					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GTGCCTTCACTTTCCGAGTAA	0.478																																																	0													177.0	169.0	172.0					1																	10397523		2203	4300	6503	SO:0001819	synonymous_variant	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.3354T>A	1.37:g.10397523T>A			A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Silent	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.T1072	ENST00000377086.1	37	c.3216		1																																																																																			KIF1B	-	NULL	ENSG00000054523		0.478	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	-	0.00	73	0	T			10397523	+1	tier1	-	no_errors	ENST00000263934	ensembl	human	known	74_37	silent	16.95	49	10	SNP	0.951	A
KIF5C	3800	genome.wustl.edu	37	2	149803484	149803485	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:149803484_149803485insC	ENST00000435030.1	+	8	1029_1030	c.661_662insC	c.(661-663)gaafs	p.E221fs	KIF5C_ENST00000414838.2_Frame_Shift_Ins_p.E126fs|KIF5C_ENST00000397413.1_5'Flank			O60282	KIF5C_HUMAN	kinesin family member 5C	221	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		TGTAGAGACTGAAAAAAAACTC	0.322																																																	0																																										SO:0001589	frameshift_variant	0			AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	Exception_encountered	2.37:g.149803484_149803485insC	ENSP00000393379:p.Glu221fs		O95079|Q2YDC5	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.E221fs	ENST00000435030.1	37	c.661_662		2																																																																																			KIF5C	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000168280		0.322	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	KIF5C	HGNC	protein_coding	OTTHUMT00000332562.3		0.00	77	0	-	NM_004522		149803485	+1	tier1		no_errors	ENST00000435030	ensembl	human	known	74_37	frame_shift_ins	27.54	50	19	INS	1.000:1.000	C
KLHL41	10324	genome.wustl.edu	37	2	170366496	170366496	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:170366496delA	ENST00000284669.1	+	1	285	c.208delA	c.(208-210)aaafs	p.K72fs	BBS5_ENST00000554017.1_Intron|RP11-724O16.1_ENST00000513963.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	72	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											TGATGAGGCGAAAAAAAAGGA	0.388																																																	0													145.0	144.0	145.0					2																	170366496		2203	4300	6503	SO:0001589	frameshift_variant	0			AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.208delA	2.37:g.170366496delA	ENSP00000284669:p.Lys72fs		Q53R42	Frame_Shift_Del	DEL	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.K72fs	ENST00000284669.1	37	c.208	CCDS2234.1	2																																																																																			KLHL41	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000239474		0.388	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL41	HGNC	protein_coding	OTTHUMT00000255263.1		0.00	31	0	A	NM_006063		170366496	+1	tier1		no_errors	ENST00000284669	ensembl	human	known	74_37	frame_shift_del	9.68	28	3	DEL	1.000	-
KRT16P3	644945	genome.wustl.edu	37	17	20405866	20405866	+	RNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:20405866A>C	ENST00000580113.1	-	0	997									keratin 16 pseudogene 3																		ATTACTGGTGACTTGGGGGCT	0.552																																																	0																																												0			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20405866A>C				RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-	ENSG00000214822		0.552	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	-	0.00	79	0	A	NR_029393		20405866	-1	tier1	-	no_errors	ENST00000580113	ensembl	human	known	74_37	rna	56.25	14	18	SNP	0.001	C
KRTAP19-3	337970	genome.wustl.edu	37	21	31864263	31864263	+	Missense_Mutation	SNP	C	C	T	rs75692404	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr21:31864263C>T	ENST00000334063.4	-	1	12	c.13G>A	c.(13-15)Ggc>Agc	p.G5S		NM_181609.3	NP_853640.1	Q7Z4W3	KR193_HUMAN	keratin associated protein 19-3	5						intermediate filament (GO:0005882)				large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)	9						TAGTAGCTGCCGTAGTAGCTC	0.552																																																	0													140.0	129.0	133.0					21																	31864263		2203	4300	6503	SO:0001583	missense	0			AP001708	CCDS13596.1	21q22.1	2011-02-10			ENSG00000244025	ENSG00000244025		"""Keratin associated proteins"""	18938	protein-coding gene	gene with protein product						12359730	Standard	NM_181609		Approved	KAP19.3	uc002yog.1	Q7Z4W3	OTTHUMG00000057782	ENST00000334063.4:c.13G>A	21.37:g.31864263C>T	ENSP00000386376:p.Gly5Ser			Missense_Mutation	SNP	pfam_KRTAP_type6/8/16/19/20	p.G5S	ENST00000334063.4	37	c.13	CCDS13596.1	21	.	.	.	.	.	.	.	.	.	.	C	6.243	0.413003	0.11812	.	.	ENSG00000244025	ENST00000334063	T	0.08720	3.06	5.7	-1.59	0.08453	.	0.000000	0.39985	U	0.001216	T	0.04092	0.0114	.	.	.	0.09310	N	1	P	0.48162	0.906	B	0.35353	0.201	T	0.38866	-0.9641	9	0.87932	D	0	.	1.8742	0.03215	0.1223:0.4295:0.1356:0.3125	.	5	Q7Z4W3	KR193_HUMAN	S	5	ENSP00000386376:G5S	ENSP00000386376:G5S	G	-	1	0	KRTAP19-3	30786134	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-0.469000	0.06648	-0.537000	0.06290	0.655000	0.94253	GGC	KRTAP19-3	-	pfam_KRTAP_type6/8/16/19/20	ENSG00000244025		0.552	KRTAP19-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-3	HGNC	protein_coding	OTTHUMT00000128234.2	-	0.00	115	0	C			31864263	-1	tier1	-	no_errors	ENST00000334063	ensembl	human	known	74_37	missense	45.56	49	41	SNP	0.001	T
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240571	39240571	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:39240571C>A	ENST00000391417.4	+	1	113	c.113C>A	c.(112-114)aCc>aAc	p.T38N		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	38	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						TGCAGGACCACCTGCTACCGC	0.647																																																	0													14.0	23.0	20.0					17																	39240571		691	1590	2281	SO:0001583	missense	0			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.113C>A	17.37:g.39240571C>A	ENSP00000375236:p.Thr38Asn		A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.T38N	ENST00000391417.4	37	c.113	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	4.725	0.134798	0.09032	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.01446	4.88	3.39	-1.21	0.09524	.	1.350010	0.06254	U	0.692626	T	0.01800	0.0057	.	.	.	0.24012	N	0.996179	B	0.20550	0.046	B	0.22880	0.042	T	0.48536	-0.9027	9	0.44086	T	0.13	.	7.8467	0.29428	0.1591:0.4608:0.3801:0.0	.	38	Q9BYR0	KRA47_HUMAN	N	38	ENSP00000375236:T38N	ENSP00000375236:T38N	T	+	2	0	KRTAP4-9;KRTAP4-7	36494097	0.155000	0.22806	0.048000	0.18961	0.030000	0.12068	-0.818000	0.04467	-0.524000	0.06400	0.195000	0.17529	ACC	KRTAP4-7	-	pfam_Keratin-assoc	ENSG00000240871		0.647	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	-	0.00	222	0	C			39240571	+1	tier1	-	no_errors	ENST00000391417	ensembl	human	known	74_37	missense	28.68	184	74	SNP	0.613	A
KSR2	283455	genome.wustl.edu	37	12	117993038	117993038	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:117993038T>G	ENST00000339824.5	-	9	2181	c.1454A>C	c.(1453-1455)aAg>aCg	p.K485T	KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000425217.1_Missense_Mutation_p.K456T|KSR2_ENST00000302438.5_Missense_Mutation_p.K182T			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	485					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCGAGGTGGCTTCCGTAGAGG	0.512																																																	0													144.0	151.0	149.0					12																	117993038		1984	4157	6141	SO:0001583	missense	0			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1454A>C	12.37:g.117993038T>G	ENSP00000339952:p.Lys485Thr		A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.K485T	ENST00000339824.5	37	c.1454		12	.	.	.	.	.	.	.	.	.	.	T	13.28	2.191171	0.38707	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;D	0.86164	-1.27;-1.27;-2.08	4.97	4.97	0.65823	.	0.180731	0.39687	N	0.001281	T	0.78997	0.4372	N	0.12182	0.205	0.49915	D	0.999832	P	0.38395	0.629	B	0.40901	0.343	T	0.80155	-0.1500	10	0.40728	T	0.16	.	14.3329	0.66569	0.0:0.0:0.0:1.0	.	485	Q6VAB6	KSR2_HUMAN	T	456;485;182;157	ENSP00000389715:K456T;ENSP00000339952:K485T;ENSP00000305466:K182T	ENSP00000305466:K182T	K	-	2	0	KSR2	116477421	1.000000	0.71417	0.999000	0.59377	0.572000	0.35998	3.524000	0.53495	1.857000	0.53885	0.460000	0.39030	AAG	KSR2	-	NULL	ENSG00000171435		0.512	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	-	0.00	125	0	T	NM_173598		117993038	-1	tier1	-	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	67.54	37	77	SNP	1.000	G
L3MBTL4	91133	genome.wustl.edu	37	18	6171916	6171916	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:6171916T>G	ENST00000284898.6	-	13	1207	c.1007A>C	c.(1006-1008)aAg>aCg	p.K336T	L3MBTL4_ENST00000535782.1_Missense_Mutation_p.K149T|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.K336T|L3MBTL4_ENST00000400104.3_Missense_Mutation_p.K336T|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.K336T	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	336					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				GTAGTCATACTTATGGTCCCA	0.418																																					Esophageal Squamous(41;748 902 17366 28959 43175)												0													82.0	65.0	71.0					18																	6171916		2197	4286	6483	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1007A>C	18.37:g.6171916T>G	ENSP00000284898:p.Lys336Thr		A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.K336T	ENST00000284898.6	37	c.1007	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	T	12.83	2.054891	0.36277	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782;ENST00000400104	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.4	3.01	0.34805	.	0.077917	0.52532	D	0.000080	T	0.19046	0.0457	L	0.32530	0.975	0.36388	D	0.862313	B;B	0.30973	0.302;0.028	B;B	0.30401	0.115;0.07	T	0.15665	-1.0429	10	0.15952	T	0.53	.	7.0507	0.25071	0.0:0.1797:0.0:0.8203	.	336;336	Q8NA19;F8W9S8	LMBL4_HUMAN;.	T	336;336;336;149;336	ENSP00000382976:K336T;ENSP00000318543:K336T;ENSP00000284898:K336T;ENSP00000444774:K149T;ENSP00000382975:K336T	ENSP00000284898:K336T	K	-	2	0	L3MBTL4	6161916	0.932000	0.31603	0.619000	0.29118	0.891000	0.51852	1.449000	0.35123	0.369000	0.24510	0.528000	0.53228	AAG	L3MBTL4	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000154655		0.418	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	-	0.00	42	0	T	NM_173464		6171916	-1	tier1	-	no_errors	ENST00000284898	ensembl	human	known	74_37	missense	23.81	32	10	SNP	0.999	G
LINC00302	388699	genome.wustl.edu	37	1	152629124	152629124	+	lincRNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:152629124A>C	ENST00000444515.1	+	0	146									long intergenic non-protein coding RNA 302																		CATACCTTCAAGAGCTCTTGC	0.507																																																	0																																												0			AF005082		1q21.3	2012-10-12	2011-08-10	2011-08-10	ENSG00000176075	ENSG00000176075		"""Long non-coding RNAs"""	31825	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 46"", ""non-protein coding RNA 302"""	C1orf46, NCRNA00302		9344646	Standard			Approved	XP33			OTTHUMG00000012386		1.37:g.152629124A>C				RNA	SNP	-	NULL	ENST00000444515.1	37	NULL		1																																																																																			LINC00302	-	-	ENSG00000176075		0.507	LINC00302-001	KNOWN	non_canonical_conserved|basic	lincRNA	LINC00302	HGNC	lincRNA	OTTHUMT00000034506.2	-	0.00	41	0	A			152629124	+1	tier1	-	no_errors	ENST00000444515	ensembl	human	known	74_37	rna	14.04	49	8	SNP	0.000	C
LINC00839	84856	genome.wustl.edu	37	10	42982519	42982519	+	lincRNA	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:42982519A>T	ENST00000429940.2	+	0	613					NR_026827.1				long intergenic non-protein coding RNA 839																		tgctggagcgacggagaacgt	0.557																																																	0																																												0					10q11.21	2012-12-20			ENSG00000185904	ENSG00000185904		"""Long non-coding RNAs"""	28269	protein-coding gene	gene with protein product						12477932	Standard	NR_026827		Approved		uc001izy.3		OTTHUMG00000018010		10.37:g.42982519A>T				RNA	SNP	-	NULL	ENST00000429940.2	37	NULL		10																																																																																			LINC00839	-	-	ENSG00000185904		0.557	LINC00839-001	KNOWN	basic	lincRNA	LINC00839	HGNC	lincRNA	OTTHUMT00000047672.2	-	0.00	27	0	A	NR_026827		42982519	+1	tier1	-	no_errors	ENST00000424751	ensembl	human	known	74_37	rna	44.44	10	8	SNP	0.019	T
MAD1L1	8379	genome.wustl.edu	37	7	1887222	1887222	+	Intron	SNP	C	C	T	rs545877002		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:1887222C>T	ENST00000406869.1	-	19	2556				AC110781.3_ENST00000402221.1_Missense_Mutation_p.P156L|AC110781.3_ENST00000480694.1_3'UTR|MAD1L1_ENST00000399654.2_Intron|MAD1L1_ENST00000402746.1_Intron|AC110781.3_ENST00000318959.3_Missense_Mutation_p.P155L|MAD1L1_ENST00000265854.7_Intron			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GTTCTGAAACCGGGATGCACA	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		18852	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493	ENST00000406869.1:c.1999-31358G>A	7.37:g.1887222C>T			B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Missense_Mutation	SNP	NULL	p.P155L	ENST00000406869.1	37	c.464	CCDS43539.1	7	.	.	.	.	.	.	.	.	.	.	C	7.397	0.632039	0.14322	.	.	ENSG00000176349	ENST00000402221;ENST00000318959	.	.	.	1.55	-0.548	0.11833	.	.	.	.	.	T	0.34513	0.0900	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38243	-0.9670	5	0.87932	D	0	.	2.7048	0.05159	0.0:0.4758:0.311:0.2132	.	.	.	.	L	156;155	.	ENSP00000320221:P155L	P	+	2	0	AC110781.3	1853748	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.113000	0.03296	-0.157000	0.11059	0.556000	0.70494	CCG	AC110781.3	-	NULL	ENSG00000176349		0.647	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100128374	Clone_based_vega_gene	protein_coding	OTTHUMT00000322871.1	-	0.00	36	0	C	NM_003550		1887222	+1	tier1	-	no_errors	ENST00000318959	ensembl	human	known	74_37	missense	24.59	46	15	SNP	0.000	T
LOC100130331	100130331	genome.wustl.edu	37	1	238090970	238090970	+	RNA	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:238090970T>C	ENST00000450451.1	+	0	2476					NR_027247.2																						CAGAAAGTTCTTATGCTCACA	0.378																																																	0																																												0																															1.37:g.238090970T>C				RNA	SNP	-	NULL	ENST00000450451.1	37	NULL		1																																																																																			RP11-193H5.1	-	-	ENSG00000237250		0.378	RP11-193H5.1-001	KNOWN	basic	antisense	LOC100130331	Clone_based_vega_gene	antisense	OTTHUMT00000095477.1	-	0.00	21	0	T			238090970	+1	tier1	-	no_errors	ENST00000450451	ensembl	human	known	74_37	rna	68.42	6	13	SNP	0.000	C
SMG1P7	100506060	genome.wustl.edu	37	16	70253607	70253607	+	RNA	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:70253607C>T	ENST00000581050.1	-	0	1767					NR_033959.1																						tggggtaagacggtgttctgt	0.398																																																	0																																												0																															16.37:g.70253607C>T				RNA	SNP	-	NULL	ENST00000581050.1	37	NULL		16																																																																																			RP11-296I10.6	-	-	ENSG00000261556		0.398	RP11-296I10.6-006	KNOWN	basic	processed_transcript	LOC100506060	Clone_based_vega_gene	pseudogene	OTTHUMT00000441629.1	-	0.00	26	0	C			70253607	-1	tier1	-	no_errors	ENST00000573141	ensembl	human	known	74_37	rna	38.10	13	8	SNP	0.001	T
POTEG	404785	genome.wustl.edu	37	14	19563638	19563638	+	Intron	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:19563638A>C	ENST00000409832.3	+	5	1107				RNU6-1239P_ENST00000391310.1_RNA|CTD-2311B13.5_ENST00000548748.1_lincRNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						GTCATAGTTCAGTTCAGGTAG	0.373																																																	0																																										SO:0001627	intron_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1055+97A>C	14.37:g.19563638A>C			A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			CTD-2311B13.5	-	-	ENSG00000258252		0.373	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929948	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	-	0.00	30	0	A	NM_001005356		19563638	-1	tier1	-	no_errors	ENST00000548748	ensembl	human	known	74_37	rna	34.78	30	16	SNP	0.001	C
PKD1P1	339044	genome.wustl.edu	37	16	16418617	16418617	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:16418617C>T	ENST00000537112.1	+	0	717					NR_036447.1																						GGGCGTGCTGCGGGACGGCGA	0.692																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000537112.1:c.*714C>T	16.37:g.16418617C>T				RNA	SNP	-	NULL	ENST00000537112.1	37	NULL		16																																																																																			AC138969.4	-	-	ENSG00000183889		0.692	AC138969.4-005	KNOWN	non_canonical_other|basic	processed_transcript	LOC101930008	Clone_based_vega_gene	protein_coding	OTTHUMT00000399242.1	-	0.00	59	0	C			16418617	+1	tier1	-	no_errors	ENST00000536260	ensembl	human	known	74_37	rna	30.77	18	8	SNP	0.720	T
UPK3B	80761	genome.wustl.edu	37	7	76532091	76532091	+	Intron	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:76532091G>A	ENST00000419923.2	+	6	1408				UPK3B_ENST00000443097.2_Intron|AC007003.1_ENST00000472463.1_RNA			Q9BT76	UPK3B_HUMAN	uroplakin 3B						negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				TTGCTTGCACGGGCAGGTAGA	0.413																																																	0																																										SO:0001627	intron_variant	0			BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000419923.2:c.961-116050G>A	7.37:g.76532091G>A			A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	RNA	SNP	-	NULL	ENST00000419923.2	37	NULL	CCDS5588.1	7																																																																																			AC007003.1	-	-	ENSG00000231183		0.413	UPK3B-201	KNOWN	basic|CCDS	protein_coding	LOC101930181	Clone_based_vega_gene	protein_coding		-	0.00	29	0	G	NM_030570		76532091	+1	tier1	-	no_errors	ENST00000472463	ensembl	human	known	74_37	rna	34.38	21	11	SNP	0.000	A
ACTG1P17	283693	genome.wustl.edu	37	15	83395159	83395159	+	RNA	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:83395159C>T	ENST00000560958.1	-	0	1127				AC105339.2_ENST00000577648.1_RNA	NR_036446.1																						CAGGATGGAGCTGCTGATCCA	0.542																																																	0																																												0																															15.37:g.83395159C>T				RNA	SNP	-	NULL	ENST00000560958.1	37	NULL		15																																																																																			RP11-752G15.9	-	-	ENSG00000259315		0.542	RP11-752G15.9-002	KNOWN	basic	processed_transcript	LOC283693	Clone_based_vega_gene	pseudogene	OTTHUMT00000418414.1	-	0.00	100	0	C			83395159	-1	tier1	-	no_errors	ENST00000560958	ensembl	human	known	74_37	rna	21.69	65	18	SNP	1.000	T
LOC285556	285556	genome.wustl.edu	37	4	100575168	100575168	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:100575168A>C	ENST00000511828.1	-	1	637	c.638T>G	c.(637-639)cTt>cGt	p.L213R																								CCCCAGGGTAAGTTTCATGGT	0.572																																																	0																																										SO:0001583	missense	0																														ENST00000511828.1:c.638T>G	4.37:g.100575168A>C	ENSP00000427555:p.Leu213Arg			Missense_Mutation	SNP	NULL	p.L213R	ENST00000511828.1	37	c.638		4	.	.	.	.	.	.	.	.	.	.	A	11.25	1.582173	0.28180	.	.	ENSG00000248713	ENST00000511828	D	0.97620	-4.46	4.85	2.37	0.29283	.	.	.	.	.	D	0.91630	0.7355	N	0.08118	0	.	.	.	.	.	.	.	.	.	D	0.89952	0.4080	6	0.87932	D	0	.	6.4418	0.21854	0.7616:0.1571:0.0813:0.0	.	.	.	.	R	213	ENSP00000427555:L213R	ENSP00000427555:L213R	L	-	2	0	RP11-766F14.2	100794191	0.037000	0.19845	0.008000	0.14137	0.025000	0.11179	2.501000	0.45389	0.343000	0.23821	-0.313000	0.08912	CTT	RP11-766F14.2	-	NULL	ENSG00000248713		0.572	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	-	0.00	35	0	A			100575168	-1	tier1	-	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	15.15	28	5	SNP	0.005	C
LOC388942	388942	genome.wustl.edu	37	2	42119872	42119872	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:42119872C>T	ENST00000398796.2	+	0	496					NR_033996.1																						AGAGAGGTGGCGACGAGCTGC	0.542																																																	0																																												0																															2.37:g.42119872C>T				RNA	SNP	-	NULL	ENST00000398796.2	37	NULL		2																																																																																			AC104654.1	-	-	ENSG00000214691		0.542	AC104654.1-001	KNOWN	basic	lincRNA	LOC388942	Clone_based_vega_gene	lincRNA	OTTHUMT00000325742.2	-	0.00	38	0	C			42119872	+1	tier1	-	no_errors	ENST00000398796	ensembl	human	known	74_37	rna	21.95	32	9	SNP	0.000	T
LINC01116	375295	genome.wustl.edu	37	2	177502238	177502238	+	lincRNA	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:177502238G>T	ENST00000295549.4	-	0	421				AC017048.4_ENST00000443670.1_lincRNA	NR_040001.1																						GGTGGGAGCTGCTCGTCTTCA	0.577																																																	0																																												0																															2.37:g.177502238G>T				RNA	SNP	-	NULL	ENST00000295549.4	37	NULL		2																																																																																			AC017048.3	-	-	ENSG00000163364		0.577	AC017048.3-001	KNOWN	basic|exp_conf	lincRNA	LOC375295	Clone_based_vega_gene	lincRNA	OTTHUMT00000334153.2	-	0.00	95	0	G			177502238	-1	tier1	-	no_errors	ENST00000295549	ensembl	human	known	74_37	rna	26.00	74	26	SNP	0.307	T
LOC441666	441666	genome.wustl.edu	37	10	42833305	42833305	+	RNA	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:42833305T>G	ENST00000609841.1	-	0	598					NR_024380.1																						TGCCACATTCTTCATGTTGGT	0.373																																																	0																																												0																															10.37:g.42833305T>G				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.373	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	121	0	T			42833305	-1	tier1	-	no_errors	ENST00000609034	ensembl	human	known	74_37	rna	20.21	75	19	SNP	0.000	G
LONP2	83752	genome.wustl.edu	37	16	48382140	48382140	+	Missense_Mutation	SNP	G	G	T	rs199759503		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:48382140G>T	ENST00000285737.4	+	14	2369	c.2276G>T	c.(2275-2277)cGg>cTg	p.R759L	LONP2_ENST00000535754.1_Missense_Mutation_p.R715L|LONP2_ENST00000564259.1_3'UTR	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						TTTAGTGGGCGGCTGGTACGT	0.423																																																	0													141.0	140.0	140.0					16																	48382140		2200	4300	6500	SO:0001583	missense	0			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2276G>T	16.37:g.48382140G>T	ENSP00000285737:p.Arg759Leu			Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_P-loop_NTPase,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Lon_bac/euk-typ	p.R759L	ENST00000285737.4	37	c.2276	CCDS10734.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.545880	0.96488	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754	T;T	0.28255	1.62;1.62	6.17	6.17	0.99709	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51244	0.1663	M	0.71036	2.16	0.80722	D	1	P;P	0.48503	0.911;0.911	P;P	0.53809	0.665;0.735	T	0.31308	-0.9948	10	0.41790	T	0.15	-23.1121	20.8794	0.99867	0.0:0.0:1.0:0.0	.	715;759	B7ZKL7;Q86WA8	.;LONP2_HUMAN	L	759;488;715	ENSP00000285737:R759L;ENSP00000445426:R715L	ENSP00000285737:R759L	R	+	2	0	LONP2	46939641	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.933000	0.87642	2.941000	0.99782	0.655000	0.94253	CGG	LONP2	-	pfam_Pept_S16_C,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_Lon_bac/euk-typ	ENSG00000102910		0.423	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP2	HGNC	protein_coding	OTTHUMT00000256839.2	-	0.00	56	0	G	NM_031490		48382140	+1	tier1	-	no_errors	ENST00000285737	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44122779	44122779	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:44122779T>G	ENST00000398722.4	-	17	2824	c.2825A>C	c.(2824-2826)aAg>aCg	p.K942T	LOXHD1_ENST00000441893.2_Missense_Mutation_p.K153T|LOXHD1_ENST00000441551.2_Missense_Mutation_p.K1014T|LOXHD1_ENST00000300591.6_Missense_Mutation_p.K109T|LOXHD1_ENST00000582408.1_Missense_Mutation_p.K109T|LOXHD1_ENST00000579038.1_Missense_Mutation_p.K13T|LOXHD1_ENST00000536736.1_Missense_Mutation_p.K1220T			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	942	PLAT 7. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CCTCTCAAACTTATCGCTGTT	0.537																																																	0													103.0	98.0	100.0					18																	44122779		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2825A>C	18.37:g.44122779T>G	ENSP00000381707:p.Lys942Thr		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.K1220T	ENST00000398722.4	37	c.3659		18	.	.	.	.	.	.	.	.	.	.	T	13.56	2.274253	0.40194	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097	T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53	5.53	4.35	0.52113	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.193964	0.53938	D	0.000048	T	0.46521	0.1397	L	0.52759	1.655	0.29539	N	0.852208	D;D;D;D	0.65815	0.995;0.992;0.987;0.994	D;P;P;D	0.67231	0.937;0.893;0.835;0.95	T	0.45086	-0.9285	10	0.49607	T	0.09	.	12.3853	0.55328	0.0:0.0:0.141:0.859	.	1220;153;942;942	F5GZB4;F8WA52;Q8IVV2-2;Q8IVV2	.;.;.;LOXH1_HUMAN	T	109;942;1220;153;942;122;122	ENSP00000300591:K109T;ENSP00000381707:K942T;ENSP00000444586:K1220T;ENSP00000409062:K153T;ENSP00000440060:K122T	ENSP00000300591:K109T	K	-	2	0	LOXHD1	42376777	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.510000	0.67018	0.901000	0.36495	0.379000	0.24179	AAG	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000167210		0.537	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	55	0	T	NM_144612		44122779	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	G
PLPPR5	163404	genome.wustl.edu	37	1	99470211	99470211	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:99470211G>A	ENST00000263177.4	-	1	238	c.17C>T	c.(16-18)gCg>gTg	p.A6V	LPPR5_ENST00000534652.1_5'Flank|RP5-896L10.1_ENST00000425113.1_RNA|LPPR5_ENST00000370188.3_Missense_Mutation_p.A6V	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		6						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)										GGTGAGCGCCGCGGGCAGCAG	0.692																																																	0													57.0	49.0	52.0					1																	99470211		2202	4300	6502	SO:0001583	missense	0																														ENST00000263177.4:c.17C>T	1.37:g.99470211G>A	ENSP00000263177:p.Ala6Val		A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A6V	ENST00000263177.4	37	c.17	CCDS30778.1	1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449785	0.43531	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	T;T	0.31247	1.5;1.5	3.32	1.22	0.21188	.	5.928410	0.00873	U	0.002044	T	0.04724	0.0128	N	0.08118	0	0.24748	N	0.992995	B;B	0.23591	0.088;0.053	B;B	0.10450	0.005;0.002	T	0.17319	-1.0373	10	0.23302	T	0.38	.	4.8568	0.13563	0.1302:0.2181:0.6517:0.0	.	6;6	Q32ZL2-2;Q32ZL2	.;LPPR5_HUMAN	V	6	ENSP00000359207:A6V;ENSP00000263177:A6V	ENSP00000263177:A6V	A	-	2	0	AL161744.1	99242799	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	1.112000	0.31172	0.162000	0.19483	0.555000	0.69702	GCG	LPPR5	-	NULL	ENSG00000117598		0.692	LPPR5-002	KNOWN	basic|CCDS	protein_coding	LPPR5	Uniprot_gn	protein_coding	OTTHUMT00000393221.1	-	0.00	75	0	G			99470211	-1	tier1	-	no_errors	ENST00000263177	ensembl	human	known	74_37	missense	59.18	20	29	SNP	1.000	A
LRP12	29967	genome.wustl.edu	37	8	105503755	105503755	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:105503755C>T	ENST00000276654.5	-	7	1834	c.1726G>A	c.(1726-1728)Gaa>Aaa	p.E576K	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Missense_Mutation_p.E557K	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	576					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTCAGATTTTCCAAAACAGAA	0.343																																																	0													41.0	44.0	43.0					8																	105503755		2202	4300	6502	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1726G>A	8.37:g.105503755C>T	ENSP00000276654:p.Glu576Lys		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.E557K	ENST00000276654.5	37	c.1669	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	28.7	4.940688	0.92526	.	.	ENSG00000147650	ENST00000424843;ENST00000276654;ENST00000523007	D;D;D	0.93488	-1.83;-1.76;-3.23	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.93582	0.7951	N	0.14661	0.345	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76071	0.987;0.971	D	0.93517	0.6858	10	0.39692	T	0.17	-31.5759	20.0966	0.97849	0.0:1.0:0.0:0.0	.	557;576	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	K	557;576;165	ENSP00000399148:E557K;ENSP00000276654:E576K;ENSP00000429305:E165K	ENSP00000276654:E576K	E	-	1	0	LRP12	105572931	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.263000	0.78421	2.751000	0.94390	0.650000	0.86243	GAA	LRP12	-	NULL	ENSG00000147650		0.343	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	12	0	C	NM_013437		105503755	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	64.29	5	9	SNP	1.000	T
LRP12	29967	genome.wustl.edu	37	8	105509626	105509626	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:105509626T>G	ENST00000276654.5	-	5	1262	c.1154A>C	c.(1153-1155)aAc>aCc	p.N385T	LRP12_ENST00000518375.1_5'Flank|LRP12_ENST00000424843.2_Missense_Mutation_p.N366T	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	385	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			ACACCCCCAGTTACCTCCACA	0.443																																																	0													110.0	107.0	108.0					8																	105509626		2203	4300	6503	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1154A>C	8.37:g.105509626T>G	ENSP00000276654:p.Asn385Thr		A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.N366T	ENST00000276654.5	37	c.1097	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	T	19.48	3.835347	0.71373	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.60299	0.2;0.2	5.66	5.66	0.87406	.	0.082516	0.85682	D	0.000000	T	0.61739	0.2371	N	0.14661	0.345	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.76071	0.987;0.971	T	0.67321	-0.5700	10	0.54805	T	0.06	-23.4068	15.8985	0.79353	0.0:0.0:0.0:1.0	.	366;385	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	T	366;385	ENSP00000399148:N366T;ENSP00000276654:N385T	ENSP00000276654:N385T	N	-	2	0	LRP12	105578802	1.000000	0.71417	0.995000	0.50966	0.869000	0.49853	7.665000	0.83852	2.169000	0.68431	0.374000	0.22700	AAC	LRP12	-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000147650		0.443	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	-	0.00	32	0	T	NM_013437		105509626	-1	tier1	-	no_errors	ENST00000424843	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	G
LRP1B	53353	genome.wustl.edu	37	2	141004684	141004684	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:141004684T>C	ENST00000389484.3	-	87	14266	c.13295A>G	c.(13294-13296)aAg>aGg	p.K4432R		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4432					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTGCTGCTCTTTGGGGCTGG	0.383										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													112.0	105.0	107.0					2																	141004684		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13295A>G	2.37:g.141004684T>C	ENSP00000374135:p.Lys4432Arg		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.K4432R	ENST00000389484.3	37	c.13295	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	16.26|16.26	3.072706|3.072706	0.55646|0.55646	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977;ENST00000442974	D|.	0.90197|.	-2.63|.	5.8|5.8	4.65|4.65	0.58169|0.58169	.|.	0.128699|.	0.50627|.	N|.	0.000118|.	T|T	0.45776|0.45776	0.1359|0.1359	L|L	0.28192|0.28192	0.835|0.835	0.35847|0.35847	D|D	0.826502|0.826502	D|.	0.69078|.	0.997|.	D|.	0.73380|.	0.98|.	T|T	0.52019|0.52019	-0.8631|-0.8631	10|5	0.20519|.	T|.	0.43|.	.|.	11.9884|11.9884	0.53161|0.53161	0.0:0.0674:0.0:0.9326|0.0:0.0674:0.0:0.9326	.|.	4432|.	Q9NZR2|.	LRP1B_HUMAN|.	R|G	4432;4370|664;202	ENSP00000374135:K4432R|.	ENSP00000374135:K4432R|.	K|R	-|-	2|1	0|2	LRP1B|LRP1B	140721154|140721154	1.000000|1.000000	0.71417|0.71417	0.956000|0.956000	0.39512|0.39512	0.844000|0.844000	0.47949|0.47949	4.364000|4.364000	0.59479|0.59479	1.026000|1.026000	0.39733|0.39733	-0.266000|-0.266000	0.10368|0.10368	AAG|AGA	LRP1B	-	NULL	ENSG00000168702		0.383	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	33	0	T	NM_018557		141004684	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	C
LRRC31	79782	genome.wustl.edu	37	3	169574569	169574569	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:169574569C>A	ENST00000316428.5	-	4	636	c.579G>T	c.(577-579)aaG>aaT	p.K193N	LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Missense_Mutation_p.K193N|LRRC31_ENST00000264676.5_Missense_Mutation_p.K137N	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	193										cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			CTTTTTGGAACTTCTGAAGGA	0.403																																																	0													108.0	99.0	102.0					3																	169574569		1836	4093	5929	SO:0001583	missense	0			AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.579G>T	3.37:g.169574569C>A	ENSP00000325978:p.Lys193Asn		B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.K193N	ENST00000316428.5	37	c.579	CCDS43167.1	3	.	.	.	.	.	.	.	.	.	.	C	2.927	-0.221958	0.06061	.	.	ENSG00000114248	ENST00000316428;ENST00000264676;ENST00000523069	T;T;T	0.52057	0.68;0.68;0.68	4.71	-4.51	0.03483	.	1.198120	0.05740	N	0.601204	T	0.24509	0.0594	N	0.16266	0.395	0.09310	N	1	B;B	0.17038	0.007;0.02	B;B	0.14578	0.011;0.01	T	0.13415	-1.0510	10	0.27082	T	0.32	-21.8508	2.5123	0.04659	0.1163:0.1515:0.2306:0.5016	.	137;193	Q6UY01-2;Q6UY01	.;LRC31_HUMAN	N	193;137;193	ENSP00000325978:K193N;ENSP00000264676:K137N;ENSP00000429145:K193N	ENSP00000264676:K137N	K	-	3	2	LRRC31	171057263	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.094000	0.03359	-0.459000	0.07013	0.650000	0.86243	AAG	LRRC31	-	NULL	ENSG00000114248		0.403	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC31	HGNC	protein_coding	OTTHUMT00000378699.1	-	0.00	34	0	C	NM_024727		169574569	-1	tier1	-	no_errors	ENST00000316428	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.000	A
MAGEE2	139599	genome.wustl.edu	37	X	75004141	75004141	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:75004141A>C	ENST00000373359.2	-	1	938	c.746T>G	c.(745-747)tTt>tGt	p.F249C		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	249	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.									autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CAAGAACTCAAACTCAAGGGG	0.502																																																	0													65.0	59.0	61.0					X																	75004141		2203	4300	6503	SO:0001583	missense	0			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.746T>G	X.37:g.75004141A>C	ENSP00000362457:p.Phe249Cys		Q5JSI5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.F249C	ENST00000373359.2	37	c.746	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	A	11.59	1.683073	0.29872	.	.	ENSG00000186675	ENST00000373359	T	0.04706	3.57	3.1	-0.988	0.10245	.	.	.	.	.	T	0.07234	0.0183	L	0.31578	0.945	0.09310	N	1	D	0.61080	0.989	P	0.59948	0.866	T	0.30238	-0.9985	9	0.66056	D	0.02	.	2.3893	0.04374	0.4129:0.0:0.1403:0.4468	.	249	Q8TD90	MAGE2_HUMAN	C	249	ENSP00000362457:F249C	ENSP00000362457:F249C	F	-	2	0	MAGEE2	74920866	0.998000	0.40836	0.002000	0.10522	0.918000	0.54935	0.377000	0.20552	-0.312000	0.08741	0.345000	0.21793	TTT	MAGEE2	-	pfam_MAGE,pfscan_MAGE	ENSG00000186675		0.502	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	HGNC	protein_coding	OTTHUMT00000057288.1	-	0.00	23	0	A	NM_138703		75004141	-1	tier1	-	no_errors	ENST00000373359	ensembl	human	known	74_37	missense	93.33	1	14	SNP	0.003	C
MAP2	4133	genome.wustl.edu	37	2	210574896	210574896	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:210574896A>C	ENST00000360351.4	+	12	5497	c.4991A>C	c.(4990-4992)aAc>aCc	p.N1664T	MAP2_ENST00000199940.6_Missense_Mutation_p.N365T|MAP2_ENST00000361559.4_Missense_Mutation_p.N308T|MAP2_ENST00000447185.1_Missense_Mutation_p.N1660T|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Missense_Mutation_p.N308T	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1664					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	CGGCTTATTAACCAACCACTG	0.488																																					Pancreas(27;423 979 28787 29963)												0													71.0	61.0	64.0					2																	210574896		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4991A>C	2.37:g.210574896A>C	ENSP00000353508:p.Asn1664Thr		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.N1664T	ENST00000360351.4	37	c.4991	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	18.51	3.639104	0.67244	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	D;D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39;-3.39	5.6	5.6	0.85130	.	0.000000	0.64402	D	0.000008	D	0.94870	0.8342	L	0.51422	1.61	0.80722	D	1	D;D;P;D;P	0.76494	0.999;0.961;0.946;0.998;0.953	D;P;P;D;P	0.74023	0.969;0.756;0.671;0.982;0.852	D	0.93029	0.6447	10	0.17832	T	0.49	-23.2208	15.7792	0.78246	1.0:0.0:0.0:0.0	.	1660;308;309;1664;365	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	T	365;1664;308;308;1660	ENSP00000199940:N365T;ENSP00000353508:N1664T;ENSP00000355290:N308T;ENSP00000376032:N308T;ENSP00000392164:N1660T	ENSP00000199940:N365T	N	+	2	0	MAP2	210283141	1.000000	0.71417	1.000000	0.80357	0.349000	0.29174	9.057000	0.93889	2.129000	0.65627	0.383000	0.25322	AAC	MAP2	-	pfam_MAP_tubulin-bd_rpt	ENSG00000078018		0.488	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	21	0	A	NM_001039538		210574896	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	47.06	9	8	SNP	1.000	C
MARCH1	55016	genome.wustl.edu	37	4	164533668	164533668	+	Intron	SNP	C	C	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:164533668C>G	ENST00000503008.1	-	5	1219				MARCH1_ENST00000514618.1_Missense_Mutation_p.K255N|MARCH1_ENST00000339875.5_Intron|MARCH1_ENST00000274056.7_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TTGAGGATCTCTTAATTTCAG	0.398																																																	0																																										SO:0001627	intron_variant	0			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+797G>C	4.37:g.164533668C>G			D3DP29|Q9NWR0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.K255N	ENST00000503008.1	37	c.765	CCDS54814.1	4	.	.	.	.	.	.	.	.	.	.	C	4.461	0.085375	0.08583	.	.	ENSG00000145416	ENST00000514618	T	0.34667	1.35	5.7	1.0	0.19881	.	.	.	.	.	T	0.30198	0.0757	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24512	-1.0158	6	0.45353	T	0.12	.	5.0856	0.14680	0.1291:0.5314:0.0:0.3395	.	.	.	.	N	255	ENSP00000421322:K255N	ENSP00000421322:K255N	K	-	3	2	MARCH1	164753118	0.646000	0.27295	0.001000	0.08648	0.042000	0.13812	0.608000	0.24223	0.057000	0.16193	-0.143000	0.13931	AAG	MARCH1	-	NULL	ENSG00000145416		0.398	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	-	0.00	44	0	C	NM_017923		164533668	-1	tier1	-	no_errors	ENST00000514618	ensembl	human	novel	74_37	missense	36.11	23	13	SNP	0.008	G
MARCH1	55016	genome.wustl.edu	37	4	164534102	164534102	+	Intron	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:164534102T>G	ENST00000503008.1	-	5	1219				MARCH1_ENST00000514618.1_Missense_Mutation_p.K111Q|MARCH1_ENST00000339875.5_Intron|MARCH1_ENST00000274056.7_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				ACTGATTTCTTACCAGACTCC	0.443																																																	0																																										SO:0001627	intron_variant	0			AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+363A>C	4.37:g.164534102T>G			D3DP29|Q9NWR0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.K111Q	ENST00000503008.1	37	c.331	CCDS54814.1	4	.	.	.	.	.	.	.	.	.	.	T	16.57	3.159704	0.57368	.	.	ENSG00000145416	ENST00000514618	T	0.37752	1.18	6.06	3.63	0.41609	.	.	.	.	.	T	0.46983	0.1421	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41052	-0.9530	6	0.72032	D	0.01	.	8.8775	0.35354	0.0:0.065:0.1281:0.8069	.	.	.	.	Q	111	ENSP00000421322:K111Q	ENSP00000421322:K111Q	K	-	1	0	MARCH1	164753552	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	1.393000	0.34497	0.526000	0.28541	0.533000	0.62120	AAG	MARCH1	-	NULL	ENSG00000145416		0.443	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	HGNC	protein_coding	OTTHUMT00000364493.2	-	0.00	13	0	T	NM_017923		164534102	-1	tier1	-	no_errors	ENST00000514618	ensembl	human	novel	74_37	missense	22.22	14	4	SNP	1.000	G
MBL1P	8512	genome.wustl.edu	37	10	81680656	81680656	+	RNA	SNP	A	A	G	rs567381624	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:81680656A>G	ENST00000480805.1	+	0	723					NR_002724.2				mannose-binding lectin (protein A) 1, pseudogene																		GCTTTTGGGGAAAAAAAAAAG	0.542													A|||	2	0.000399361	0.0008	0.0	5008	,	,		16782	0.0		0.001	False		,,,				2504	0.0																0																																												0			AF019382		10q22.3	2012-11-02	2009-12-02	2009-12-02	ENSG00000242600	ENSG00000242600		"""Collectins"""	6921	pseudogene	pseudogene			"""mannose-binding lectin (protein A) 1, pseudogene 1"""	MBL1P1		9501312	Standard	NR_002724		Approved	COLEC3P	uc001kbg.1		OTTHUMG00000018595		10.37:g.81680656A>G				RNA	SNP	-	NULL	ENST00000480805.1	37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600		0.542	MBL1P-001	KNOWN	basic	processed_transcript	MBL1P	HGNC	pseudogene	OTTHUMT00000049017.1	-	0.00	56	0	A			81680656	+1	tier1	-	no_errors	ENST00000480805	ensembl	human	known	74_37	rna	45.35	44	39	SNP	0.001	G
MEG3	55384	genome.wustl.edu	37	14	101302245	101302245	+	RNA	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:101302245T>A	ENST00000554041.1	-	0	143																											TGCCTTTGCCTCCGCCGTGGC	0.677																																																	0																																												0																															14.37:g.101302245T>A				RNA	SNP	-	NULL	ENST00000554041.1	37	NULL		14																																																																																			MEG3	-	-	ENSG00000214548		0.677	RP11-123M6.2-001	KNOWN	basic	antisense	MEG3	HGNC	antisense	OTTHUMT00000414687.1	-	0.00	32	0	T			101302245	+1	tier1	-	no_errors	ENST00000455531	ensembl	human	known	74_37	rna	46.67	16	14	SNP	0.000	A
MIR892A	100126342	genome.wustl.edu	37	X	145078203	145078203	+	RNA	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:145078203A>G	ENST00000401124.1	-	0	58				MIR892B_ENST00000401279.1_RNA|MIR888_ENST00000401186.1_RNA|MIR890_ENST00000401256.1_RNA	NR_030584.1				microRNA 892a																		TACTCTACGCAGAAAGGACAC	0.517																																																	0													211.0	174.0	185.0					X																	145078203		1568	3582	5150			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000215943	ENSG00000215943		"""ncRNAs / Micro RNAs"""	33639	non-coding RNA	RNA, micro				MIRN892A			Standard	NR_030584		Approved	hsa-mir-892a	uc022cfq.1				X.37:g.145078203A>G				RNA	SNP	-	NULL	ENST00000401124.1	37	NULL		X																																																																																			MIR892A	-	-	ENSG00000215943		0.517	MIR892A-201	KNOWN	basic	miRNA	MIR892A	HGNC	miRNA		-	0.00	26	0	A	NR_030584		145078203	-1	tier1	-	no_errors	ENST00000401124	ensembl	human	known	74_37	rna	67.31	17	35	SNP	0.000	G
MRPL28	10573	genome.wustl.edu	37	16	418610	418610	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:418610T>G	ENST00000199706.8	-	4	502	c.467A>C	c.(466-468)aAg>aCg	p.K156T	MRPL28_ENST00000429738.1_Intron|MRPL28_ENST00000389675.2_Missense_Mutation_p.K156T	NM_006428.4	NP_006419.2	Q13084	RM28_HUMAN	mitochondrial ribosomal protein L28	156					translation (GO:0006412)	cytoplasm (GO:0005737)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)	5		Hepatocellular(16;0.000105)|Lung NSC(18;0.0324)|all_lung(18;0.064)				CATCCCAAACTTGGAGCACAG	0.682																																																	0													60.0	64.0	63.0					16																	418610		2203	4299	6502	SO:0001583	missense	0			U19796	CCDS32349.1	16p13.12	2012-09-26	2002-11-13		ENSG00000086504	ENSG00000086504		"""Mitochondrial ribosomal proteins / large subunits"""	14484	protein-coding gene	gene with protein product		604853	"""melanoma-associated antigen recognised by cytotoxic T lymphocytes"""	MAAT1		11551941, 19753307	Standard	NM_006428		Approved	p15	uc002cgs.2	Q13084	OTTHUMG00000047994	ENST00000199706.8:c.467A>C	16.37:g.418610T>G	ENSP00000199706:p.Lys156Thr		B2RCM4|D3DU46|Q4TT39|Q96S26|Q9BQD8|Q9BR04	Missense_Mutation	SNP	NULL	p.K156T	ENST00000199706.8	37	c.467	CCDS32349.1	16	.	.	.	.	.	.	.	.	.	.	T	16.13	3.036881	0.54896	.	.	ENSG00000086504	ENST00000397735;ENST00000199706;ENST00000397734;ENST00000389675;ENST00000441883;ENST00000447696;ENST00000450882	T;T;T;T;T	0.33865	1.82;1.82;1.83;1.41;1.39	3.64	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.58047	0.2095	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.71414	0.973;0.973;0.973	T	0.60203	-0.7309	10	0.36615	T	0.2	-32.1218	12.4384	0.55612	0.0:0.0:0.0:1.0	.	156;156;156	A2IDC6;Q13084;Q4TT38	.;RM28_HUMAN;.	T	156	ENSP00000199706:K156T;ENSP00000374326:K156T;ENSP00000398684:K156T;ENSP00000390399:K156T;ENSP00000395305:K156T	ENSP00000199706:K156T	K	-	2	0	MRPL28	358611	1.000000	0.71417	1.000000	0.80357	0.262000	0.26303	5.728000	0.68531	1.513000	0.48852	0.460000	0.39030	AAG	MRPL28	-	NULL	ENSG00000086504		0.682	MRPL28-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL28	HGNC	protein_coding	OTTHUMT00000139285.2	-	0.00	110	0	T			418610	-1	tier1	-	no_errors	ENST00000199706	ensembl	human	known	74_37	missense	30.30	69	30	SNP	1.000	G
MSS51	118490	genome.wustl.edu	37	10	75185808	75185808	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:75185808A>C	ENST00000372912.1	-	4	832	c.830T>G	c.(829-831)cTt>cGt	p.L277R	MSS51_ENST00000299432.2_Missense_Mutation_p.L277R|AL353731.1_ENST00000584907.1_RNA			Q4VC12	MSS51_HUMAN	MSS51 mitochondrial translational activator	277					social behavior (GO:0035176)		metal ion binding (GO:0046872)										TGGGCGAGTAAGAAATGTCTC	0.522																																																	0													80.0	77.0	78.0					10																	75185808		2203	4300	6503	SO:0001583	missense	0			AK096884	CCDS31221.1	10q22.3	2013-01-10	2013-01-10	2012-02-24	ENSG00000166343	ENSG00000166343		"""Zinc fingers, MYND-type"""	21000	protein-coding gene	gene with protein product		614773	"""zinc finger, MYND-type containing 17"", ""MSS51 mitochondrial translational activator homolog (S. cerevisiae)"""	ZMYND17		19710419	Standard	NM_001024593		Approved	FLJ39565	uc001jud.3	Q4VC12	OTTHUMG00000018464	ENST00000372912.1:c.830T>G	10.37:g.75185808A>C	ENSP00000362003:p.Leu277Arg		A6NGH6|Q2VP95|Q5F2H5|Q7Z3M9|Q8N8G0	Missense_Mutation	SNP	pfam_Znf_MYND,pfscan_Znf_MYND	p.L277R	ENST00000372912.1	37	c.830	CCDS31221.1	10	.	.	.	.	.	.	.	.	.	.	A	17.86	3.493554	0.64186	.	.	ENSG00000166343	ENST00000299432;ENST00000372912	T;T	0.49720	0.77;0.77	5.45	5.45	0.79879	.	0.338684	0.31210	N	0.008047	T	0.38348	0.1037	L	0.51422	1.61	0.30959	N	0.723863	P	0.46395	0.877	B	0.38562	0.276	T	0.52290	-0.8595	9	.	.	.	-14.1453	8.7897	0.34843	0.8324:0.0:0.0:0.1676	.	277	Q4VC12	ZMY17_HUMAN	R	277	ENSP00000299432:L277R;ENSP00000362003:L277R	.	L	-	2	0	ZMYND17	74855814	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.280000	0.51677	2.288000	0.76882	0.528000	0.53228	CTT	MSS51	-	NULL	ENSG00000166343		0.522	MSS51-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MSS51	HGNC	protein_coding	OTTHUMT00000048652.3	-	0.00	40	0	A	NM_178451		75185808	-1	tier1	-	no_errors	ENST00000299432	ensembl	human	known	74_37	missense	58.82	7	10	SNP	0.925	C
MUC12	10071	genome.wustl.edu	37	7	100635349	100635349	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:100635349C>A	ENST00000379442.3	+	5	1934	c.1934C>A	c.(1933-1935)tCa>tAa	p.S645*	MUC12_ENST00000536621.1_Nonsense_Mutation_p.S502*			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	645	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGCCCCAGATCACCAGACACA	0.532																																																	0													140.0	165.0	157.0					7																	100635349		692	1591	2283	SO:0001587	stop_gained	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.1934C>A	7.37:g.100635349C>A	ENSP00000368755:p.Ser645*		A6ND38|F5GWV9|Q9UKN0	Nonsense_Mutation	SNP	pfam_SEA_dom	p.S502*	ENST00000379442.3	37	c.1505		7	.	.	.	.	.	.	.	.	.	.	C	17.04	3.286903	0.59867	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	.	.	.	0.695	0.695	0.18070	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.2528	0.26158	0.0:0.9999:0.0:1.0E-4	.	.	.	.	X	645;502	.	ENSP00000368755:S645X	S	+	2	0	MUC12	100422069	0.003000	0.15002	0.006000	0.13384	0.043000	0.13939	1.990000	0.40717	0.662000	0.31006	0.162000	0.16502	TCA	MUC12	-	NULL	ENSG00000205277		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	-	0.00	93	0	C	XM_379904		100635349	+1	tier1	-	no_errors	ENST00000536621	ensembl	human	known	74_37	nonsense	14.13	158	26	SNP	0.063	A
MUC16	94025	genome.wustl.edu	37	19	9059054	9059054	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:9059054A>C	ENST00000397910.4	-	3	28595	c.28392T>G	c.(28390-28392)acT>acG	p.T9464T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9466	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGAAAAGAGAAGTGACAGGGA	0.483																																																	0													109.0	107.0	108.0					19																	9059054		2006	4187	6193	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28392T>G	19.37:g.9059054A>C			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T9464	ENST00000397910.4	37	c.28392	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	84	0	A	NM_024690		9059054	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	8.42	87	8	SNP	0.000	C
MUC16	94025	genome.wustl.edu	37	19	9085711	9085711	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:9085711A>C	ENST00000397910.4	-	1	6307	c.6104T>G	c.(6103-6105)cTt>cGt	p.L2035R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2035	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAAGGATTCAAGTGAGGCTGA	0.483																																																	0													137.0	131.0	133.0					19																	9085711		1996	4172	6168	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6104T>G	19.37:g.9085711A>C	ENSP00000381008:p.Leu2035Arg		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L2035R	ENST00000397910.4	37	c.6104	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	0.510	-0.867004	0.02590	.	.	ENSG00000181143	ENST00000397910	T	0.03212	4.01	0.235	0.235	0.15431	.	.	.	.	.	T	0.05273	0.0140	N	0.08118	0	.	.	.	D	0.62365	0.991	D	0.68039	0.955	T	0.41466	-0.9507	7	0.87932	D	0	.	.	.	.	.	2035	B5ME49	.	R	2035	ENSP00000381008:L2035R	ENSP00000381008:L2035R	L	-	2	0	MUC16	8946711	0.001000	0.12720	0.029000	0.17559	0.030000	0.12068	-0.661000	0.05311	0.263000	0.21812	0.260000	0.18958	CTT	MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	85	0	A	NM_024690		9085711	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	19.23	63	15	SNP	0.036	C
MUC16	94025	genome.wustl.edu	37	19	9086530	9086530	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:9086530A>C	ENST00000397910.4	-	1	5488	c.5285T>G	c.(5284-5286)tTc>tGc	p.F1762C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1762	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCCCCCTATGAATTCCACATC	0.507																																																	0													113.0	106.0	108.0					19																	9086530		1963	4145	6108	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5285T>G	19.37:g.9086530A>C	ENSP00000381008:p.Phe1762Cys		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.F1762C	ENST00000397910.4	37	c.5285	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	0.813	-0.751411	0.03041	.	.	ENSG00000181143	ENST00000397910	T	0.02890	4.12	1.07	-0.0832	0.13695	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	D	0.53462	0.96	B	0.41299	0.353	T	0.46735	-0.9170	8	0.87932	D	0	.	3.0076	0.06033	0.6907:0.0:0.3093:0.0	.	1762	B5ME49	.	C	1762	ENSP00000381008:F1762C	ENSP00000381008:F1762C	F	-	2	0	MUC16	8947530	0.000000	0.05858	0.000000	0.03702	0.060000	0.15804	-0.441000	0.06879	-0.092000	0.12417	0.260000	0.18958	TTC	MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	36	0	A	NM_024690		9086530	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	12.50	49	7	SNP	0.000	C
MUC4	4585	genome.wustl.edu	37	3	195506521	195506521	+	Missense_Mutation	SNP	G	G	A	rs199874579	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:195506521G>A	ENST00000463781.3	-	2	12389	c.11930C>T	c.(11929-11931)gCa>gTa	p.A3977V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.A3977V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAACG	0.582													.|||	217	0.0433307	0.0454	0.036	5008	,	,		8073	0.0129		0.0726	False		,,,				2504	0.047																0													11.0	8.0	9.0					3																	195506521		463	837	1300	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11930C>T	3.37:g.195506521G>A	ENSP00000417498:p.Ala3977Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.A3977V	ENST00000463781.3	37	c.11930	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	6.967	0.548315	0.13312	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30981	1.51;1.51	.	.	.	.	.	.	.	.	T	0.11452	0.0279	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.27468	-1.0073	7	.	.	.	.	5.2122	0.15322	0.274:0.0:0.726:0.0	.	3849	E7ESK3	.	V	3977	ENSP00000417498:A3977V;ENSP00000420243:A3977V	.	A	-	2	0	MUC4	196991300	0.000000	0.05858	0.004000	0.12327	0.011000	0.07611	-0.018000	0.12568	-1.711000	0.01395	-2.092000	0.00371	GCA	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	18	0	G	NM_018406		195506521	-1	tier1	rs199874579	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	23.81	16	5	SNP	0.013	A
MUC7	4589	genome.wustl.edu	37	4	71347210	71347210	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:71347210C>T	ENST00000304887.5	+	3	939	c.749C>T	c.(748-750)tCt>tTt	p.S250F	MUC7_ENST00000456088.1_Missense_Mutation_p.S250F|MUC7_ENST00000413702.1_Missense_Mutation_p.S250F	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	250	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			GCTCCACTATCTTCCTCAGCT	0.587																																																	0													503.0	413.0	443.0					4																	71347210		2203	4300	6503	SO:0001583	missense	0			BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.749C>T	4.37:g.71347210C>T	ENSP00000302021:p.Ser250Phe		Q9UCD7|Q9UCD8	Missense_Mutation	SNP	NULL	p.S250F	ENST00000304887.5	37	c.749	CCDS3541.1	4	.	.	.	.	.	.	.	.	.	.	C	8.086	0.773433	0.16051	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.54866	0.55;0.55;0.55	1.06	0.0161	0.14106	.	.	.	.	.	T	0.27313	0.0670	N	0.08118	0	0.09310	N	1	P	0.39782	0.688	B	0.38616	0.277	T	0.13415	-1.0510	8	.	.	.	.	5.8433	0.18645	0.3111:0.6888:0.0:0.0	.	250	Q8TAX7	MUC7_HUMAN	F	250	ENSP00000407422:S250F;ENSP00000400585:S250F;ENSP00000302021:S250F	.	S	+	2	0	MUC7	71381799	0.011000	0.17503	0.009000	0.14445	0.088000	0.18126	1.734000	0.38166	-0.025000	0.13918	0.467000	0.42956	TCT	MUC7	-	NULL	ENSG00000171195		0.587	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	HGNC	protein_coding	OTTHUMT00000252168.2	-	0.00	102	0	C	NM_152291		71347210	+1	tier1	-	no_errors	ENST00000304887	ensembl	human	known	74_37	missense	66.00	34	66	SNP	0.082	T
MYT1	4661	genome.wustl.edu	37	20	62837012	62837012	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:62837012G>A	ENST00000328439.1	+	6	620	c.256G>A	c.(256-258)Ggc>Agc	p.G86S	MYT1_ENST00000360149.4_Missense_Mutation_p.G86S|MYT1_ENST00000536311.1_Missense_Mutation_p.G86S	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					TCTGGACGAGGGCTATGGTGT	0.622																																					GBM(59;481 1041 20555 21139 33705)												0													79.0	69.0	73.0					20																	62837012		2203	4300	6503	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.256G>A	20.37:g.62837012G>A	ENSP00000327465:p.Gly86Ser		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.G86S	ENST00000328439.1	37	c.256	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919096	0.73098	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.47869	0.83;1.6;1.6	5.58	4.64	0.57946	.	0.111822	0.64402	D	0.000013	T	0.61949	0.2388	M	0.63843	1.955	0.29109	N	0.881001	B;D	0.76494	0.006;0.999	B;D	0.76071	0.011;0.987	T	0.58470	-0.7631	10	0.12766	T	0.61	-26.2635	14.3203	0.66482	0.0712:0.0:0.9287:0.0	.	86;86	Q01538;Q6P6D5	MYT1_HUMAN;.	S	86	ENSP00000353269:G86S;ENSP00000327465:G86S;ENSP00000442412:G86S	ENSP00000327465:G86S	G	+	1	0	MYT1	62307456	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.684000	0.84104	1.370000	0.46153	0.655000	0.94253	GGC	MYT1	-	NULL	ENSG00000196132		0.622	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	-	0.00	51	0	G	NM_004535		62837012	+1	tier1	-	no_errors	ENST00000536311	ensembl	human	known	74_37	missense	37.50	45	27	SNP	1.000	A
NAA11	84779	genome.wustl.edu	37	4	80246448	80246448	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:80246448T>G	ENST00000286794.4	-	1	756	c.584A>C	c.(583-585)aAg>aCg	p.K195T	NAA11_ENST00000513733.1_5'UTR	NM_032693.2	NP_116082.1	Q9BSU3	NAA11_HUMAN	N(alpha)-acetyltransferase 11, NatA catalytic subunit	195					N-terminal protein amino acid acetylation (GO:0006474)	NatA complex (GO:0031415)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|skin(2)	23						AGCCGGGTTCTTTTGCTGACA	0.557																																																	0													48.0	51.0	50.0					4																	80246448		1991	4181	6172	SO:0001583	missense	0				CCDS47084.1	4q21.23	2010-05-07	2010-01-14	2010-01-14		ENSG00000156269	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	28125	protein-coding gene	gene with protein product			"""ARD1 homolog B (S. cerevisiae)"""	ARD1B		16638120, 19660095	Standard	NM_032693		Approved	ARD2, hARD2	uc003hlt.4	Q9BSU3		ENST00000286794.4:c.584A>C	4.37:g.80246448T>G	ENSP00000286794:p.Lys195Thr		Q66K19|Q6P479	Missense_Mutation	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.K195T	ENST00000286794.4	37	c.584	CCDS47084.1	4	.	.	.	.	.	.	.	.	.	.	T	12.00	1.807685	0.31961	.	.	ENSG00000156269	ENST00000286794	T	0.56611	0.45	5.17	-2.35	0.06684	.	0.706517	0.14009	U	0.347619	T	0.26991	0.0661	N	0.24115	0.695	0.09310	N	1	P	0.37914	0.611	B	0.33750	0.169	T	0.12682	-1.0538	10	0.32370	T	0.25	-2.5945	2.8218	0.05473	0.1205:0.153:0.4445:0.282	.	195	Q9BSU3	NAA11_HUMAN	T	195	ENSP00000286794:K195T	ENSP00000286794:K195T	K	-	2	0	NAA11	80465472	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.048000	0.14078	-0.421000	0.07416	-0.264000	0.10439	AAG	NAA11	-	NULL	ENSG00000156269		0.557	NAA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA11	HGNC	protein_coding	OTTHUMT00000362922.1	-	0.00	56	0	T			80246448	-1	tier1	-	no_errors	ENST00000286794	ensembl	human	known	74_37	missense	63.33	22	38	SNP	0.000	G
NALCN	259232	genome.wustl.edu	37	13	101833582	101833582	+	Intron	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:101833582A>C	ENST00000251127.6	-	15	1846				NALCN_ENST00000376196.3_Missense_Mutation_p.L624R|NALCN_ENST00000470333.1_5'UTR	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective						calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTGGTGAGTAAGTCTGGCCAG	0.562																																																	0													141.0	132.0	135.0					13																	101833582		876	1991	2867	SO:0001627	intron_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1765-4857T>G	13.37:g.101833582A>C			Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L624R	ENST00000251127.6	37	c.1871	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	5.332	0.246653	0.10130	.	.	ENSG00000102452	ENST00000376196	D	0.98792	-5.14	3.01	-2.54	0.06307	.	.	.	.	.	D	0.95421	0.8513	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.89377	0.3679	8	0.87932	D	0	.	3.8532	0.08963	0.3298:0.4053:0.2648:0.0	.	624	F2Z323	.	R	624	ENSP00000365367:L624R	ENSP00000365367:L624R	L	-	2	0	NALCN	100631583	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.224000	0.09164	-0.517000	0.06461	0.460000	0.39030	CTT	NALCN	-	NULL	ENSG00000102452		0.562	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	-	0.00	104	0	A	NM_052867		101833582	-1	tier1	-	no_errors	ENST00000376196	ensembl	human	known	74_37	missense	9.76	74	8	SNP	0.000	C
NAV3	89795	genome.wustl.edu	37	12	78444899	78444899	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:78444899A>C	ENST00000397909.2	+	11	2661	c.2488A>C	c.(2488-2490)Agt>Cgt	p.S830R	NAV3_ENST00000266692.7_Missense_Mutation_p.S830R|RP11-136F16.1_ENST00000549103.1_RNA|NAV3_ENST00000536525.2_Missense_Mutation_p.S830R|NAV3_ENST00000228327.6_Missense_Mutation_p.S830R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	830						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CCTTGGGAAAAGTCTCAGGAC	0.453										HNSCC(70;0.22)																																							0													71.0	70.0	70.0					12																	78444899		2056	4208	6264	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2488A>C	12.37:g.78444899A>C	ENSP00000381007:p.Ser830Arg		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.S830R	ENST00000397909.2	37	c.2488		12	.	.	.	.	.	.	.	.	.	.	A	26.5	4.742911	0.89573	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.29397	1.67;1.67;1.67;1.57	5.79	5.79	0.91817	.	0.000000	0.47093	U	0.000241	T	0.34600	0.0903	L	0.50333	1.59	0.80722	D	1	P;P;P	0.41848	0.655;0.543;0.763	B;B;B	0.41619	0.231;0.096;0.361	T	0.16364	-1.0405	10	0.87932	D	0	-14.916	16.1249	0.81386	1.0:0.0:0.0:0.0	.	830;830;830	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	R	830	ENSP00000446132:S830R;ENSP00000381007:S830R;ENSP00000228327:S830R;ENSP00000266692:S830R	ENSP00000228327:S830R	S	+	1	0	NAV3	76969030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.864000	0.92294	2.208000	0.71279	0.533000	0.62120	AGT	NAV3	-	NULL	ENSG00000067798		0.453	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	-	0.00	69	0	A	NM_001024383		78444899	+1	tier1	-	no_errors	ENST00000397909	ensembl	human	known	74_37	missense	70.87	30	73	SNP	1.000	C
NKX2-5	1482	genome.wustl.edu	37	5	172659657	172659657	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:172659657A>T	ENST00000329198.4	-	2	1163	c.890T>A	c.(889-891)gTc>gAc	p.V297D		NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	297					adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CAAGTCCCCGACGCCGAAGTT	0.662																																					Esophageal Squamous(72;810 1219 2387 13420 44943)												0													31.0	33.0	32.0					5																	172659657		2203	4299	6502	SO:0001583	missense	0			AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.890T>A	5.37:g.172659657A>T	ENSP00000327758:p.Val297Asp		A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.V297D	ENST00000329198.4	37	c.890	CCDS4387.1	5	.	.	.	.	.	.	.	.	.	.	A	19.70	3.875663	0.72180	.	.	ENSG00000183072	ENST00000329198	D	0.91180	-2.8	4.26	4.26	0.50523	.	0.382752	0.19150	N	0.121473	D	0.93458	0.7913	L	0.60455	1.87	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.92309	0.5856	10	0.36615	T	0.2	.	13.5655	0.61815	1.0:0.0:0.0:0.0	.	297	P52952	NKX25_HUMAN	D	297	ENSP00000327758:V297D	ENSP00000327758:V297D	V	-	2	0	NKX2-5	172592263	0.998000	0.40836	1.000000	0.80357	0.880000	0.50808	4.814000	0.62627	1.792000	0.52537	0.443000	0.29094	GTC	NKX2-5	-	NULL	ENSG00000183072		0.662	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-5	HGNC	protein_coding	OTTHUMT00000252942.2	-	0.00	41	0	A			172659657	-1	tier1	-	no_errors	ENST00000329198	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	T
NLRP14	338323	genome.wustl.edu	37	11	7064119	7064119	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:7064119C>G	ENST00000299481.4	+	4	1208	c.862C>G	c.(862-864)Ctc>Gtc	p.L288V		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	288	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		AGTGTCCTTCCTCATGAGTAG	0.433																																																	0													82.0	77.0	78.0					11																	7064119		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.862C>G	11.37:g.7064119C>G	ENSP00000299481:p.Leu288Val		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L288V	ENST00000299481.4	37	c.862	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065046	0.55432	.	.	ENSG00000158077	ENST00000299481	D	0.85629	-2.01	4.57	4.57	0.56435	NACHT nucleoside triphosphatase (1);	0.000000	0.41823	D	0.000803	D	0.88526	0.6460	L	0.49126	1.545	0.34534	D	0.709512	D	0.89917	1.0	D	0.81914	0.995	D	0.90402	0.4403	10	0.48119	T	0.1	.	10.3261	0.43793	0.1963:0.8037:0.0:0.0	.	288	Q86W24	NAL14_HUMAN	V	288	ENSP00000299481:L288V	ENSP00000299481:L288V	L	+	1	0	NLRP14	7020695	0.832000	0.29368	1.000000	0.80357	0.998000	0.95712	2.104000	0.41815	2.554000	0.86153	0.655000	0.94253	CTC	NLRP14	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000158077		0.433	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1	-	0.00	56	0	C	NM_176822		7064119	+1	tier1	-	no_errors	ENST00000299481	ensembl	human	known	74_37	missense	19.61	41	10	SNP	1.000	G
NLRP5	126206	genome.wustl.edu	37	19	56539475	56539475	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:56539475T>G	ENST00000390649.3	+	7	1876	c.1876T>G	c.(1876-1878)Ttc>Gtc	p.F626V		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	626					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		ACAGGCAGGCTTCCATATCCA	0.552																																																	0													66.0	68.0	67.0					19																	56539475		1966	4140	6106	SO:0001583	missense	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1876T>G	19.37:g.56539475T>G	ENSP00000375063:p.Phe626Val		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.F626V	ENST00000390649.3	37	c.1876	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	T	0.348	-0.946627	0.02304	.	.	ENSG00000171487	ENST00000390649	T	0.72051	-0.62	2.69	-5.35	0.02697	.	.	.	.	.	T	0.44456	0.1294	L	0.36672	1.1	0.09310	N	1	B	0.31581	0.329	B	0.22386	0.039	T	0.40194	-0.9576	9	0.12103	T	0.63	.	0.719	0.00937	0.435:0.221:0.1471:0.1969	.	626	P59047	NALP5_HUMAN	V	626	ENSP00000375063:F626V	ENSP00000375063:F626V	F	+	1	0	NLRP5	61231287	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.982000	0.01489	-1.757000	0.01316	0.459000	0.35465	TTC	NLRP5	-	NULL	ENSG00000171487		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1		0.00	50	0	T	NM_153447		56539475	+1			no_errors	ENST00000390649	ensembl	human	known	74_37	missense	12.50	35	5	SNP	0.000	G
NNT	23530	genome.wustl.edu	37	5	43653170	43653170	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:43653170C>T	ENST00000264663.5	+	14	2135	c.1914C>T	c.(1912-1914)ctC>ctT	p.L638L	NNT_ENST00000512996.2_Silent_p.L507L|NNT_ENST00000344920.4_Silent_p.L638L	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	638					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TGGCTGGCCTCTCCACCCAGG	0.522																																																	0													93.0	85.0	88.0					5																	43653170		2203	4300	6503	SO:0001819	synonymous_variant	0			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1914C>T	5.37:g.43653170C>T			Q16796|Q2TB60|Q8N3V4	Silent	SNP	pfam_NADH_DH_b,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N,tigrfam_NADP_transhyd_a	p.L638	ENST00000264663.5	37	c.1914	CCDS3949.1	5																																																																																			NNT	-	pfam_NADH_DH_b	ENSG00000112992		0.522	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	HGNC	protein_coding	OTTHUMT00000214026.1	-	0.00	69	0	C	NM_182977		43653170	+1	tier1	-	no_errors	ENST00000264663	ensembl	human	known	74_37	silent	12.46	288	41	SNP	0.972	T
NOL4	8715	genome.wustl.edu	37	18	31537451	31537451	+	Missense_Mutation	SNP	A	A	T	rs267605178		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:31537451A>T	ENST00000261592.5	-	8	1564	c.1267T>A	c.(1267-1269)Ttg>Atg	p.L423M	NOL4_ENST00000535475.1_Intron|NOL4_ENST00000269185.4_Intron|NOL4_ENST00000589544.1_Intron|NOL4_ENST00000538587.1_Missense_Mutation_p.L349M|NOL4_ENST00000535384.1_Missense_Mutation_p.L138M	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	423						nucleolus (GO:0005730)	RNA binding (GO:0003723)	p.L423L(1)		NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						ATTCGGTCCAAGTTTTCATCT	0.493																																																	1	Substitution - coding silent(1)	lung(1)											83.0	69.0	74.0					18																	31537451		2203	4300	6503	SO:0001583	missense	0			AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1267T>A	18.37:g.31537451A>T	ENSP00000261592:p.Leu423Met		B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	NULL	p.L423M	ENST00000261592.5	37	c.1267	CCDS11907.2	18	.	.	.	.	.	.	.	.	.	.	A	16.54	3.150510	0.57151	.	.	ENSG00000101746	ENST00000261592;ENST00000535384;ENST00000538587	T;T	0.80304	-1.36;-1.36	6.01	6.01	0.97437	.	0.000000	0.64402	D	0.000009	D	0.89210	0.6650	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	D	0.90043	0.4143	10	0.72032	D	0.01	-8.6425	16.5149	0.84297	1.0:0.0:0.0:0.0	.	349;423	B4DSQ0;O94818	.;NOL4_HUMAN	M	423;138;349	ENSP00000445733:L138M;ENSP00000443472:L349M	ENSP00000261592:L423M	L	-	1	2	NOL4	29791449	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.940000	0.63533	2.302000	0.77476	0.477000	0.44152	TTG	NOL4	-	NULL	ENSG00000101746		0.493	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL4	HGNC	protein_coding	OTTHUMT00000255386.1	-	0.00	47	0	A	NM_003787		31537451	-1	tier1	-	no_errors	ENST00000261592	ensembl	human	known	74_37	missense	57.69	22	30	SNP	1.000	T
NOX4	50507	genome.wustl.edu	37	11	89060012	89060012	+	Missense_Mutation	SNP	T	T	A	rs568835447		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:89060012T>A	ENST00000263317.4	-	18	1887	c.1649A>T	c.(1648-1650)aAt>aTt	p.N550I	NOX4_ENST00000527956.1_Missense_Mutation_p.N526I|NOX4_ENST00000375979.3_Missense_Mutation_p.N243I|NOX4_ENST00000424319.1_Missense_Mutation_p.N526I|NOX4_ENST00000525196.1_Missense_Mutation_p.N314I|NOX4_ENST00000532825.1_Missense_Mutation_p.N486I|NOX4_ENST00000343727.5_Missense_Mutation_p.N526I|NOX4_ENST00000528341.1_Missense_Mutation_p.N525I|NOX4_ENST00000542487.1_Missense_Mutation_p.N526I|NOX4_ENST00000535633.1_Missense_Mutation_p.N526I|NOX4_ENST00000534731.1_Missense_Mutation_p.N510I|NOX4_ENST00000413594.2_Missense_Mutation_p.N571I|NOX4_ENST00000531342.1_Missense_Mutation_p.N203I|NOX4_ENST00000527626.1_Missense_Mutation_p.N363I			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	550	Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				GGATAGTGAATTGGGTCCACA	0.363																																																	0													86.0	85.0	86.0					11																	89060012		2201	4299	6500	SO:0001583	missense	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1649A>T	11.37:g.89060012T>A	ENSP00000263317:p.Asn550Ile		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.N571I	ENST00000263317.4	37	c.1712	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309209	0.23821	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000534731;ENST00000525196;ENST00000263317;ENST00000532825;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000531342;ENST00000375979	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.95035	-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59;-3.59	4.4	-5.6	0.02497	Ferric reductase, NAD binding (1);	0.732696	0.13267	N	0.400837	D	0.92811	0.7714	L	0.28400	0.85	0.21984	N	0.999433	B;B;B;D;B;P;B;B	0.61697	0.001;0.096;0.332;0.99;0.018;0.477;0.077;0.047	B;B;B;P;B;B;B;B	0.59115	0.051;0.251;0.262;0.852;0.018;0.19;0.039;0.167	D	0.87145	0.2205	9	.	.	.	0.1043	16.3649	0.83317	0.0:0.6229:0.0:0.3771	.	486;363;525;314;203;243;510;550	E9PMY6;E9PR43;E9PPP2;E9PI95;Q9NPH5-3;Q9NPH5-4;Q9NPH5-6;Q9NPH5	.;.;.;.;.;.;.;NOX4_HUMAN	I	526;526;526;510;314;550;486;526;526;363;525;571;203;243	ENSP00000412446:N526I;ENSP00000440172:N526I;ENSP00000344747:N526I;ENSP00000436892:N510I;ENSP00000436716:N314I;ENSP00000263317:N550I;ENSP00000434924:N486I;ENSP00000433797:N526I;ENSP00000439373:N526I;ENSP00000436093:N363I;ENSP00000436970:N525I;ENSP00000405705:N571I;ENSP00000435039:N203I;ENSP00000365146:N243I	.	N	-	2	0	NOX4	88699660	0.409000	0.25368	0.815000	0.32552	0.464000	0.32679	-0.369000	0.07533	-1.094000	0.03054	-0.456000	0.05471	AAT	NOX4	-	pfam_Fe_red_NAD-bd_6	ENSG00000086991		0.363	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1		0.00	48	0	T	NM_016931		89060012	-1			no_errors	ENST00000413594	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.440	A
NPIPB1P	729602	genome.wustl.edu	37	18	11625664	11625664	+	RNA	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:11625664T>G	ENST00000547442.1	-	0	531									nuclear pore complex interacting protein family, member B1, pseudogene																		TAGCTCTAACTTTTGTTTCCA	0.393																																																	0																																												0					18p11.21	2013-06-11			ENSG00000257513	ENSG00000257513			37452	pseudogene	pseudogene							Standard	NG_023368		Approved				OTTHUMG00000170512		18.37:g.11625664T>G				RNA	SNP	-	NULL	ENST00000547442.1	37	NULL		18	.	.	.	.	.	.	.	.	.	.	t	11.05	1.524229	0.27299	.	.	ENSG00000257513	ENST00000547442	.	.	.	1.1	1.1	0.20463	.	.	.	.	.	T	0.44644	0.1303	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.54214	-0.8327	4	0.72032	D	0.01	.	4.5261	0.11981	0.0:0.0:0.0:1.0	.	.	.	.	N	152	.	ENSP00000448589:K152N	K	-	3	2	RP11-677O4.1	11615664	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.017000	0.12590	0.790000	0.33803	0.055000	0.15244	AAA	NPIPB1P	-	-	ENSG00000257513		0.393	NPIPB1P-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NPIPB1P	HGNC	pseudogene	OTTHUMT00000409451.1	-	0.00	286	0	T	NG_023368		11625664	-1	tier1	-	no_errors	ENST00000547442	ensembl	human	known	74_37	rna	22.45	335	97	SNP	0.004	G
NR2C2	7182	genome.wustl.edu	37	3	15073950	15073950	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:15073950G>A	ENST00000425241.1	+	10	1537	c.1175G>A	c.(1174-1176)cGt>cAt	p.R392H	NR2C2_ENST00000393102.3_Missense_Mutation_p.R392H|NR2C2_ENST00000323373.6_Missense_Mutation_p.R411H|NR2C2_ENST00000478572.1_3'UTR|NR2C2_ENST00000406272.2_Missense_Mutation_p.R392H			P49116	NR2C2_HUMAN	nuclear receptor subfamily 2, group C, member 2	392	Ligand-binding. {ECO:0000250}.				cell differentiation (GO:0030154)|gene expression (GO:0010467)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TCTGCATCCCGTCTGCTTTTC	0.547																																																	0													294.0	231.0	252.0					3																	15073950		2203	4300	6503	SO:0001583	missense	0			L27586	CCDS2621.1, CCDS74905.1	3p25	2013-01-16			ENSG00000177463	ENSG00000177463		"""Nuclear hormone receptors"""	7972	protein-coding gene	gene with protein product		601426		TR4		8661150, 8016112	Standard	XM_005265428		Approved	TAK1, TR2R1, hTAK1	uc003bzi.3	P49116	OTTHUMG00000129839	ENST00000425241.1:c.1175G>A	3.37:g.15073950G>A	ENSP00000388387:p.Arg392His		A8K3H5|B6ZGT8|P55092	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.R411H	ENST00000425241.1	37	c.1232		3	.	.	.	.	.	.	.	.	.	.	G	35	5.430923	0.96150	.	.	ENSG00000177463	ENST00000425241;ENST00000323373;ENST00000393102;ENST00000406272;ENST00000439011	D;D;D;D;D	0.97138	-4.26;-4.26;-4.26;-4.26;-4.26	5.68	5.68	0.88126	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.89030	3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	D	0.99406	1.0929	10	0.72032	D	0.01	.	19.8045	0.96525	0.0:0.0:1.0:0.0	.	392;411	P49116;F2YGU2	NR2C2_HUMAN;.	H	392;411;392;392;6	ENSP00000388387:R392H;ENSP00000320447:R411H;ENSP00000376814:R392H;ENSP00000384463:R392H;ENSP00000412473:R6H	ENSP00000320447:R411H	R	+	2	0	NR2C2	15048954	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.863000	0.99569	2.694000	0.91930	0.585000	0.79938	CGT	NR2C2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt	ENSG00000177463		0.547	NR2C2-002	NOVEL	basic|appris_principal	protein_coding	NR2C2	HGNC	protein_coding	OTTHUMT00000340729.1	-	0.00	93	0	G	NM_003298		15073950	+1	tier1	-	no_errors	ENST00000323373	ensembl	human	known	74_37	missense	28.70	77	31	SNP	1.000	A
NRG1	3084	genome.wustl.edu	37	8	32621602	32621602	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:32621602A>G	ENST00000405005.3	+	12	1605	c.1605A>G	c.(1603-1605)caA>caG	p.Q535Q	NRG1_ENST00000338921.4_Silent_p.Q543Q|NRG1_ENST00000287842.3_Silent_p.Q532Q|NRG1_ENST00000287845.5_Silent_p.Q506Q|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000519301.1_Silent_p.Q485Q|NRG1_ENST00000356819.4_Silent_p.Q540Q|NRG1_ENST00000539990.1_Silent_p.Q378Q|NRG1_ENST00000341377.5_3'UTR			Q02297	NRG1_HUMAN	neuregulin 1	535				Q -> R (in Ref. 2; AAA19951). {ECO:0000305}.	activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AGCCAGCCCAAGAGCCTGTTA	0.547																																																	0													53.0	51.0	52.0					8																	32621602		2203	4300	6503	SO:0001819	synonymous_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1605A>G	8.37:g.32621602A>G			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.Q543	ENST00000405005.3	37	c.1629	CCDS6085.1	8																																																																																			NRG1	-	pfam_Neuregulin_1_C	ENSG00000157168		0.547	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	44	0	A			32621602	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	silent	14.81	46	8	SNP	0.740	G
NRG1	3084	genome.wustl.edu	37	8	32621613	32621613	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:32621613A>G	ENST00000405005.3	+	12	1616	c.1616A>G	c.(1615-1617)aAg>aGg	p.K539R	NRG1_ENST00000338921.4_Missense_Mutation_p.K547R|NRG1_ENST00000287842.3_Missense_Mutation_p.K536R|NRG1_ENST00000287845.5_Missense_Mutation_p.K510R|RP11-1002K11.1_ENST00000607314.1_lincRNA|NRG1_ENST00000519301.1_Missense_Mutation_p.K489R|NRG1_ENST00000356819.4_Missense_Mutation_p.K544R|NRG1_ENST00000539990.1_Missense_Mutation_p.K382R|NRG1_ENST00000341377.5_3'UTR			Q02297	NRG1_HUMAN	neuregulin 1	539					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GAGCCTGTTAAGAAACTCGCC	0.537																																																	0													53.0	52.0	53.0					8																	32621613		2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.1616A>G	8.37:g.32621613A>G	ENSP00000384620:p.Lys539Arg		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.K547R	ENST00000405005.3	37	c.1640	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	15.78	2.935045	0.52866	.	.	ENSG00000157168	ENST00000519301;ENST00000523534;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000287842;ENST00000405005;ENST00000539990	T;T;T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12;0.12	5.75	5.75	0.90469	Neuregulin 1-related, C-terminal (1);	0.208186	0.43416	D	0.000575	T	0.69287	0.3094	L	0.42686	1.345	0.52501	D	0.999958	D;D;D;P;D;D;D	0.76494	0.997;0.992;0.994;0.705;0.992;0.999;0.992	D;D;D;B;D;D;D	0.87578	0.994;0.94;0.973;0.359;0.94;0.998;0.954	T	0.67593	-0.5631	9	.	.	.	0.1095	16.0488	0.80740	1.0:0.0:0.0:0.0	.	382;510;544;547;536;539;544	B7Z1E3;F8W9E3;Q7RTW4;Q02297-2;Q02297-7;Q02297;Q02297-6	.;.;.;.;.;NRG1_HUMAN;.	R	489;612;547;544;539;510;536;539;382	ENSP00000429582:K489R;ENSP00000429067:K612R;ENSP00000343395:K547R;ENSP00000349275:K544R;ENSP00000287840:K539R;ENSP00000287845:K510R;ENSP00000287842:K536R;ENSP00000384620:K539R;ENSP00000439276:K382R	.	K	+	2	0	NRG1	32741155	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	6.772000	0.75001	2.199000	0.70637	0.374000	0.22700	AAG	NRG1	-	pfam_Neuregulin_1_C	ENSG00000157168		0.537	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	45	0	A			32621613	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	17.31	43	9	SNP	1.000	G
NRG3	10718	genome.wustl.edu	37	10	84745121	84745121	+	Silent	SNP	C	C	T	rs148300013		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:84745121C>T	ENST00000404547.1	+	10	1923	c.1923C>T	c.(1921-1923)agC>agT	p.S641S	NRG3_ENST00000556918.1_Silent_p.S447S|NRG3_ENST00000372141.2_Silent_p.S617S|NRG3_ENST00000537893.1_Silent_p.S267S|NRG3_ENST00000404576.2_Silent_p.S421S|NRG3_ENST00000545131.1_Silent_p.S267S|NRG3_ENST00000372142.2_Silent_p.S420S			P56975	NRG3_HUMAN	neuregulin 3	641					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)	p.S617R(1)|p.S420R(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TTCCAGTCAGCGATTGTCTTA	0.433																																																	2	Substitution - Missense(2)	large_intestine(2)						C	,,	1,4405	2.1+/-5.4	0,1,2202	82.0	80.0	81.0		1851,1848,1260	3.0	1.0	10	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	NRG3	NM_001010848.3,NM_001165972.1,NM_001165973.1	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	617/697,616/696,420/500	84745121	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1923C>T	10.37:g.84745121C>T			A4D7U1|Q0PEH2|Q5VYH3	Silent	SNP	pfscan_EG-like_dom	p.S641	ENST00000404547.1	37	c.1923	CCDS31233.1	10																																																																																			NRG3	-	NULL	ENSG00000185737		0.433	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1		0.00	27	0	C	XM_166086		84745121	+1			no_errors	ENST00000404547	ensembl	human	known	74_37	silent	10.00	18	2	SNP	1.000	T
NTRK1	4914	genome.wustl.edu	37	1	156843699	156843699	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:156843699G>A	ENST00000524377.1	+	8	1166	c.1125G>A	c.(1123-1125)atG>atA	p.M375I	NTRK1_ENST00000392302.2_Missense_Mutation_p.M345I|NTRK1_ENST00000358660.3_Missense_Mutation_p.M375I|NTRK1_ENST00000368196.3_Missense_Mutation_p.M375I	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	375					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.M375I(1)		breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	CCTCCATCATGGCTGCCTTCA	0.657			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																														Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	1	Substitution - Missense(1)	lung(1)											57.0	38.0	45.0					1																	156843699		2195	4295	6490	SO:0001583	missense	0			Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1125G>A	1.37:g.156843699G>A	ENSP00000431418:p.Met375Ile		B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Nonsense_Mutation	SNP	smart_Cys-rich_flank_reg_C	p.W301*	ENST00000524377.1	37	c.902	CCDS1161.1	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211467	0.79240	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.95	2.87	0.33458	Immunoglobulin-like fold (1);	0.464740	0.22245	N	0.062623	T	0.10035	0.0246	L	0.51422	1.61	0.28624	N	0.908027	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.06405	0.0;0.001;0.002;0.002	T	0.13229	-1.0517	9	.	.	.	.	6.0861	0.19968	0.223:0.139:0.6381:0.0	.	375;375;375;345	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	I	345;375;375;375	ENSP00000376120:M345I;ENSP00000357179:M375I;ENSP00000431418:M375I;ENSP00000351486:M375I	.	M	+	3	0	NTRK1	155110323	0.000000	0.05858	0.942000	0.38095	0.457000	0.32468	-0.441000	0.06879	1.531000	0.49152	0.655000	0.94253	ATG	NTRK1	-	NULL	ENSG00000198400		0.657	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	HGNC	protein_coding	OTTHUMT00000392279.1	-	0.00	53	0	G	NM_002529		156843699	+1	tier1	-	no_errors	ENST00000497019	ensembl	human	known	74_37	nonsense	74.63	17	50	SNP	0.617	A
NTRK3	4916	genome.wustl.edu	37	15	88522553	88522553	+	Intron	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:88522553A>C	ENST00000360948.2	-	14	1747				NTRK3_ENST00000542733.2_Intron|NTRK3_ENST00000317501.3_3'UTR|NTRK3_ENST00000355254.2_Intron|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000540489.2_3'UTR|NTRK3_ENST00000357724.2_Intron|NTRK3_ENST00000394480.2_Intron|NTRK3_ENST00000558676.1_Intron|NTRK3_ENST00000557856.1_Intron	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGACATCAAAACAAGGAGGCT	0.448			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													87.0	86.0	86.0					15																	88522553		2201	4299	6500	SO:0001627	intron_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1586-38569T>G	15.37:g.88522553A>C			B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	RNA	SNP	-	NULL	ENST00000360948.2	37	NULL	CCDS32322.1	15																																																																																			NTRK3	-	-	ENSG00000140538		0.448	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	40	0	A			88522553	-1	tier1	-	no_errors	ENST00000558306	ensembl	human	putative	74_37	rna	27.27	32	12	SNP	0.996	C
OPRK1	4986	genome.wustl.edu	37	8	54147611	54147611	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:54147611A>C	ENST00000265572.3	-	3	615	c.318T>G	c.(316-318)gcT>gcG	p.A106A	RP11-162D9.3_ENST00000524425.1_RNA|OPRK1_ENST00000520287.1_Silent_p.A106A|OPRK1_ENST00000524278.1_Silent_p.A17A	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	106					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TAGTAACTAAAGCATCTGCCA	0.378																																																	0													169.0	167.0	168.0					8																	54147611		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.318T>G	8.37:g.54147611A>C			E5RHC9|Q499G4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Kappa_opi_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.A106	ENST00000265572.3	37	c.318	CCDS6152.1	8																																																																																			OPRK1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000082556		0.378	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	HGNC	protein_coding	OTTHUMT00000378048.1	-	0.00	31	0	A			54147611	-1	tier1	-	no_errors	ENST00000265572	ensembl	human	known	74_37	silent	12.00	44	6	SNP	0.010	C
OR10J1	26476	genome.wustl.edu	37	1	159410360	159410360	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:159410360A>C	ENST00000423932.3	+	1	849	c.812A>C	c.(811-813)aAg>aCg	p.K271T	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	271					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					GCCTACCTCAAGCCCAAGTCA	0.522																																																	0													160.0	131.0	141.0					1																	159410360		2203	4300	6503	SO:0001583	missense	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.812A>C	1.37:g.159410360A>C	ENSP00000399078:p.Lys271Thr		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K271T	ENST00000423932.3	37	c.812	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	A	16.59	3.166983	0.57476	.	.	ENSG00000196184	ENST00000423932	T	0.37058	1.22	4.42	4.42	0.53409	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43416	D	0.000563	T	0.31702	0.0805	L	0.38649	1.16	0.29392	N	0.862574	D	0.76494	0.999	D	0.78314	0.991	T	0.16158	-1.0412	10	0.87932	D	0	.	6.7268	0.23361	0.8957:0.0:0.1042:0.0	.	271	P30954	O10J1_HUMAN	T	271	ENSP00000399078:K271T	ENSP00000399078:K271T	K	+	2	0	OR10J1	157676984	0.009000	0.17119	1.000000	0.80357	0.986000	0.74619	0.167000	0.16602	1.962000	0.57031	0.528000	0.53228	AAG	OR10J1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196184		0.522	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	-	0.00	75	0	A	NM_012351		159410360	+1	tier1	-	no_errors	ENST00000423932	ensembl	human	known	74_37	missense	57.95	37	51	SNP	1.000	C
OR10J1	26476	genome.wustl.edu	37	1	159410501	159410501	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:159410501A>C	ENST00000423932.3	+	1	990	c.953A>C	c.(952-954)aAg>aCg	p.K318T	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	318					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					GTTGGTGGGAAGTTTTCCTGA	0.488																																																	0													66.0	67.0	67.0					1																	159410501		2203	4300	6503	SO:0001583	missense	0			X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.953A>C	1.37:g.159410501A>C	ENSP00000399078:p.Lys318Thr		Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K318T	ENST00000423932.3	37	c.953	CCDS1185.1	1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.292906	0.40594	.	.	ENSG00000196184	ENST00000423932	T	0.39229	1.09	4.48	2.14	0.27477	.	0.508381	0.16299	N	0.220532	T	0.20414	0.0491	L	0.28192	0.835	0.09310	N	1	D	0.58268	0.982	P	0.52598	0.703	T	0.03922	-1.0992	10	0.66056	D	0.02	.	6.0089	0.19562	0.7901:0.0:0.2099:0.0	.	318	P30954	O10J1_HUMAN	T	318	ENSP00000399078:K318T	ENSP00000399078:K318T	K	+	2	0	OR10J1	157677125	0.578000	0.26717	0.005000	0.12908	0.018000	0.09664	3.609000	0.54117	0.327000	0.23409	-0.361000	0.07541	AAG	OR10J1	-	NULL	ENSG00000196184		0.488	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J1	HGNC	protein_coding	OTTHUMT00000059020.1	-	0.00	69	0	A	NM_012351		159410501	+1	tier1	-	no_errors	ENST00000423932	ensembl	human	known	74_37	missense	27.52	79	30	SNP	0.034	C
OR10R2	343406	genome.wustl.edu	37	1	158450533	158450533	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:158450533A>C	ENST00000368152.1	+	1	866	c.866A>C	c.(865-867)aAc>aCc	p.N289T	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	289						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					TATGTGTCCAACAAAGACAGG	0.458																																																	0													176.0	148.0	158.0					1																	158450533		2203	4300	6503	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.866A>C	1.37:g.158450533A>C	ENSP00000357134:p.Asn289Thr		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N289T	ENST00000368152.1	37	c.866	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	a	8.050	0.765784	0.15983	.	.	ENSG00000198965	ENST00000368152	T	0.00084	8.75	4.23	1.69	0.24217	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.10685	0.025	0.09310	N	1	B	0.22800	0.075	B	0.29524	0.103	T	0.04373	-1.0956	9	0.46703	T	0.11	.	7.2253	0.26012	0.7811:0.0:0.2189:0.0	.	289	Q8NGX6	O10R2_HUMAN	T	289	ENSP00000357134:N289T	ENSP00000357134:N289T	N	+	2	0	OR10R2	156717157	0.000000	0.05858	0.224000	0.23877	0.712000	0.41017	-0.100000	0.10990	0.118000	0.18165	0.533000	0.62120	AAC	OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198965		0.458	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	-	0.00	81	0	A	NM_001004472		158450533	+1	tier1	-	no_errors	ENST00000368152	ensembl	human	known	74_37	missense	69.72	33	76	SNP	0.166	C
OR10J5	127385	genome.wustl.edu	37	1	159505746	159505746	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:159505746A>G	ENST00000334857.2	-	1	96	c.52T>C	c.(52-54)Tct>Cct	p.S18P		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S18P(1)		kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					CCAAAGCTAGAAAATCCCAAG	0.368																																																	1	Substitution - Missense(1)	prostate(1)											77.0	76.0	76.0					1																	159505746		2203	4300	6503	SO:0001583	missense	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.52T>C	1.37:g.159505746A>G	ENSP00000334441:p.Ser18Pro		B9EH35|Q6IFH2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S18P	ENST00000334857.2	37	c.52	CCDS30910.1	1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.141749	0.37825	.	.	ENSG00000184155	ENST00000334857	T	0.00495	6.99	4.43	4.43	0.53597	.	.	.	.	.	T	0.00666	0.0022	M	0.65498	2.005	0.30113	N	0.80638	D	0.67145	0.996	D	0.68039	0.955	T	0.49133	-0.8971	9	0.72032	D	0.01	.	11.95	0.52950	1.0:0.0:0.0:0.0	.	18	Q8NHC4	O10J5_HUMAN	P	18	ENSP00000334441:S18P	ENSP00000334441:S18P	S	-	1	0	OR10J5	157772370	0.000000	0.05858	0.593000	0.28771	0.326000	0.28443	0.543000	0.23237	1.974000	0.57490	0.455000	0.32223	TCT	OR10J5	-	NULL	ENSG00000184155		0.368	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1		0.00	19	0	A	NM_001004469		159505746	-1			no_errors	ENST00000334857	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.935	G
OR2C3	81472	genome.wustl.edu	37	1	247695585	247695585	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:247695585T>C	ENST00000366487.3	-	2	590	c.229A>G	c.(229-231)Agc>Ggc	p.S77G	GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000366489.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	77						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			GGGACAATGCTCGTGGTGAAG	0.527																																																	0													123.0	112.0	116.0					1																	247695585		2203	4300	6503	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.229A>G	1.37:g.247695585T>C	ENSP00000355443:p.Ser77Gly		Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S77G	ENST00000366487.3	37	c.229	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	T	9.755	1.168404	0.21621	.	.	ENSG00000196242	ENST00000366487	T	0.01933	4.55	4.04	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.168416	0.27856	U	0.017580	T	0.08891	0.0220	M	0.92367	3.3	0.09310	N	1	P	0.52842	0.956	P	0.47528	0.549	T	0.14309	-1.0477	10	0.56958	D	0.05	.	11.2847	0.49216	0.0:0.0:0.0:1.0	.	77	Q8N628	OR2C3_HUMAN	G	77	ENSP00000355443:S77G	ENSP00000355443:S77G	S	-	1	0	OR2C3	245762208	0.000000	0.05858	0.834000	0.33040	0.048000	0.14542	-0.647000	0.05397	1.826000	0.53198	0.528000	0.53228	AGC	OR2C3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000196242		0.527	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2	-	0.00	69	0	T	NM_198074		247695585	-1	tier1	-	no_errors	ENST00000366487	ensembl	human	known	74_37	missense	27.72	73	28	SNP	0.030	C
OR2J1	442185	genome.wustl.edu	37	6	29069413	29069413	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:29069413A>C	ENST00000377171.3	+	1	1028	c.694A>C	c.(694-696)Acc>Ccc	p.T232P				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						CATGCAATCAACCACTGGGCT	0.483																																																	0																																										SO:0001583	missense	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.694A>C	6.37:g.29069413A>C	ENSP00000366376:p.Thr232Pro		A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.T232P	ENST00000377171.3	37	c.694		6	.	.	.	.	.	.	.	.	.	.	A	6.502	0.460810	0.12342	.	.	ENSG00000204702	ENST00000377171	T	0.00152	8.66	2.55	1.34	0.21922	.	.	.	.	.	T	0.00073	0.0002	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.00601	-1.1650	6	0.87932	D	0	.	5.9662	0.19326	0.6276:0.0:0.3724:0.0	.	.	.	.	P	232	ENSP00000366376:T232P	ENSP00000366376:T232P	T	+	1	0	OR2J1	29177392	0.002000	0.14202	0.105000	0.21289	0.048000	0.14542	1.254000	0.32897	0.220000	0.20860	0.482000	0.46254	ACC	OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204702		0.483	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	133	0	A	NG_004683		29069413	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	15.00	136	24	SNP	0.000	C
OR2L8	391190	genome.wustl.edu	37	1	248112220	248112220	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:248112220A>C	ENST00000357191.3	+	1	61	c.61A>C	c.(61-63)Aga>Cga	p.R21R	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TCCACCATCAAGAATTGACCT	0.393																																																	0													192.0	177.0	182.0					1																	248112220		2203	4300	6503	SO:0001819	synonymous_variant	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.61A>C	1.37:g.248112220A>C			Q6IF03	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R21	ENST00000357191.3	37	c.61	CCDS31101.1	1																																																																																			OR2L8	-	NULL	ENSG00000196936		0.393	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	-	0.00	187	0	A			248112220	+1	tier1	-	no_errors	ENST00000357191	ensembl	human	known	74_37	silent	22.62	130	38	SNP	0.074	C
OR2M7	391196	genome.wustl.edu	37	1	248487287	248487287	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:248487287A>T	ENST00000317965.2	-	1	612	c.584T>A	c.(583-585)tTt>tAt	p.F195Y		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	195						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AACCTCTTCAAATATTGATGT	0.428																																																	0													231.0	227.0	228.0					1																	248487287		2203	4297	6500	SO:0001583	missense	0			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.584T>A	1.37:g.248487287A>T	ENSP00000324557:p.Phe195Tyr		B2RNL0|Q6IEX6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F195Y	ENST00000317965.2	37	c.584	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	A	0.427	-0.905120	0.02453	.	.	ENSG00000177186	ENST00000317965	T	0.00063	8.78	1.55	1.55	0.23275	GPCR, rhodopsin-like superfamily (1);	0.000000	0.33161	U	0.005203	T	0.00073	0.0002	N	0.04297	-0.235	0.09310	N	1	B	0.25105	0.118	B	0.29785	0.107	T	0.22312	-1.0220	10	0.02654	T	1	.	7.9733	0.30140	1.0:0.0:0.0:0.0	.	195	Q8NG81	OR2M7_HUMAN	Y	195	ENSP00000324557:F195Y	ENSP00000324557:F195Y	F	-	2	0	OR2M7	246553910	0.000000	0.05858	0.166000	0.22797	0.214000	0.24535	-0.095000	0.11077	0.708000	0.31955	0.163000	0.16589	TTT	OR2M7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000177186		0.428	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1	-	0.00	155	0	A	NM_001004691		248487287	-1	tier1	-	no_errors	ENST00000317965	ensembl	human	known	74_37	missense	11.98	169	23	SNP	0.002	T
OR4C15	81309	genome.wustl.edu	37	11	55322161	55322161	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:55322161T>C	ENST00000314644.2	+	1	379	c.379T>C	c.(379-381)Tca>Cca	p.S127P		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	73						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TGCGTGCTTCTCATCTGTCAT	0.458										HNSCC(20;0.049)																																							0													189.0	156.0	167.0					11																	55322161		2201	4296	6497	SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.379T>C	11.37:g.55322161T>C	ENSP00000324958:p.Ser127Pro		Q6IFE2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S127P	ENST00000314644.2	37	c.379	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	T	14.76	2.632128	0.46944	.	.	ENSG00000181939	ENST00000314644	T	0.00832	5.64	5.12	2.62	0.31277	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.05410	0.0143	M	0.88241	2.94	0.09310	N	1	D	0.67145	0.996	D	0.65874	0.939	T	0.11227	-1.0596	9	0.87932	D	0	.	8.3769	0.32449	0.4444:0.0:0.0:0.5556	.	73	Q8NGM1	OR4CF_HUMAN	P	127	ENSP00000324958:S127P	ENSP00000324958:S127P	S	+	1	0	OR4C15	55078737	0.000000	0.05858	0.971000	0.41717	0.653000	0.38743	-0.378000	0.07446	0.945000	0.37605	0.317000	0.21355	TCA	OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181939		0.458	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	-	0.00	89	0	T	NM_001001920		55322161	+1	tier1	-	no_errors	ENST00000314644	ensembl	human	known	74_37	missense	25.23	80	27	SNP	0.040	C
OR51E2	81285	genome.wustl.edu	37	11	4703860	4703860	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:4703860A>C	ENST00000396950.3	-	2	321	c.82T>G	c.(82-84)Ttc>Gtc	p.F28V		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	28					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		AGGAGGGGGAAGCCAACCCAG	0.507																																																	0													78.0	76.0	76.0					11																	4703860		2201	4298	6499	SO:0001583	missense	0			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.82T>G	11.37:g.4703860A>C	ENSP00000380153:p.Phe28Val		B2RA63|Q6IF94	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F28V	ENST00000396950.3	37	c.82	CCDS7751.1	11	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845860	0.32606	.	.	ENSG00000167332	ENST00000396950;ENST00000532598	T;T	0.00309	8.16;8.16	5.0	3.84	0.44239	.	0.000000	0.48767	D	0.000176	T	0.00178	0.0005	N	0.21142	0.635	0.37386	D	0.912252	P	0.39326	0.668	B	0.37943	0.261	D	0.86411	0.1748	10	0.54805	T	0.06	.	10.0647	0.42297	0.8494:0.0:0.0:0.1506	.	28	Q9H255	O51E2_HUMAN	V	28	ENSP00000380153:F28V;ENSP00000432644:F28V	ENSP00000380153:F28V	F	-	1	0	OR51E2	4660436	0.007000	0.16637	0.992000	0.48379	0.677000	0.39632	0.087000	0.14958	0.892000	0.36259	0.533000	0.62120	TTC	OR51E2	-	prints_GPCR_Rhodpsn	ENSG00000167332		0.507	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51E2	HGNC	protein_coding	OTTHUMT00000257198.1	-	0.00	24	0	A	NM_030774		4703860	-1	tier1	-	no_errors	ENST00000396950	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.829	C
OR51A7	119687	genome.wustl.edu	37	11	4929263	4929263	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:4929263A>T	ENST00000359350.4	+	1	664	c.664A>T	c.(664-666)Aag>Tag	p.K222*	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	222						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCTGATCTTGAAGACTATACT	0.453																																																	0													243.0	197.0	212.0					11																	4929263		2201	4298	6499	SO:0001587	stop_gained	0			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.664A>T	11.37:g.4929263A>T	ENSP00000352305:p.Lys222*		Q6IFH8	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K222*	ENST00000359350.4	37	c.664	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	A	18.47	3.631972	0.67015	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	.	.	.	5.02	5.02	0.67125	.	0.271350	0.26086	N	0.026426	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	.	13.7057	0.62636	1.0:0.0:0.0:0.0	.	.	.	.	X	222;222;211	.	ENSP00000352305:K222X	K	+	1	0	OR51A7	4885839	0.000000	0.05858	0.989000	0.46669	0.665000	0.39181	-0.030000	0.12308	2.098000	0.63641	0.533000	0.62120	AAG	OR51A7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176895		0.453	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	HGNC	protein_coding	OTTHUMT00000142175.1	-	0.00	94	0	A	NM_001004749		4929263	+1	tier1	-	no_errors	ENST00000359350	ensembl	human	known	74_37	nonsense	29.07	59	25	SNP	0.831	T
OR51I1	390063	genome.wustl.edu	37	11	5461803	5461803	+	Silent	SNP	G	G	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:5461803G>C	ENST00000380211.1	-	1	941	c.942C>G	c.(940-942)gcC>gcG	p.A314A	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	314					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCTTCCTCAGGCCTGGGATT	0.468																																																	0													66.0	65.0	65.0					11																	5461803		2201	4297	6498	SO:0001819	synonymous_variant	0			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.942C>G	11.37:g.5461803G>C			B9EKW2|Q6IF33	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A314	ENST00000380211.1	37	c.942	CCDS31382.1	11																																																																																			OR51I1	-	NULL	ENSG00000167359		0.468	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I1	HGNC	protein_coding	OTTHUMT00000143399.1	-	0.00	65	0	G	NM_001005288		5461803	-1	tier1	-	no_errors	ENST00000380211	ensembl	human	known	74_37	silent	14.52	53	9	SNP	0.090	C
OR52N1	79473	genome.wustl.edu	37	11	5809914	5809914	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:5809914A>C	ENST00000317078.1	-	1	132	c.133T>G	c.(133-135)Ttc>Gtc	p.F45V	TRIM5_ENST00000380027.1_Intron	NM_001001913.1	NP_001001913.1	Q8NH53	O52N1_HUMAN	olfactory receptor, family 52, subfamily N, member 1	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(15)|prostate(2)|skin(3)	31		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.05e-11)|LUSC - Lung squamous cell carcinoma(625;0.112)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.195)		ATAAGGCCGAAGTTCCCTGTA	0.463																																																	0													132.0	109.0	116.0					11																	5809914		2201	4296	6497	SO:0001583	missense	0			AB065538	CCDS31398.1	11p15.4	2012-08-09			ENSG00000181001	ENSG00000181001		"""GPCR / Class A : Olfactory receptors"""	14853	protein-coding gene	gene with protein product							Standard	NM_001001913		Approved		uc010qzo.2	Q8NH53	OTTHUMG00000168800	ENST00000317078.1:c.133T>G	11.37:g.5809914A>C	ENSP00000322823:p.Phe45Val		Q6IFF6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.F45V	ENST00000317078.1	37	c.133	CCDS31398.1	11	.	.	.	.	.	.	.	.	.	.	A	3.009	-0.204264	0.06180	.	.	ENSG00000181001	ENST00000317078	T	0.02837	4.14	4.58	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.419954	0.20302	N	0.095011	T	0.01454	0.0047	N	0.02315	-0.6	0.09310	N	0.999996	B	0.19706	0.038	B	0.20184	0.028	T	0.49204	-0.8964	10	0.24483	T	0.36	.	10.4742	0.44655	0.8364:0.1636:0.0:0.0	.	45	Q8NH53	O52N1_HUMAN	V	45	ENSP00000322823:F45V	ENSP00000322823:F45V	F	-	1	0	OR52N1	5766490	0.000000	0.05858	0.368000	0.25939	0.448000	0.32197	-1.035000	0.03564	0.838000	0.34948	0.491000	0.48974	TTC	OR52N1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181001		0.463	OR52N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52N1	HGNC	protein_coding	OTTHUMT00000401142.1	-	0.00	51	0	A	NM_001001913		5809914	-1	tier1	-	no_errors	ENST00000317078	ensembl	human	known	74_37	missense	12.50	42	6	SNP	0.442	C
OR4D5	219875	genome.wustl.edu	37	11	123810724	123810724	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:123810724T>G	ENST00000307033.2	+	1	475	c.401T>G	c.(400-402)cTc>cGc	p.L134R		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	134						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CACTACACGCTCATTATGAAT	0.512																																																	0													122.0	105.0	111.0					11																	123810724		2202	4299	6501	SO:0001583	missense	0			BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.401T>G	11.37:g.123810724T>G	ENSP00000305970:p.Leu134Arg		B9EGZ4|Q6IFE6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L134R	ENST00000307033.2	37	c.401	CCDS31699.1	11	.	.	.	.	.	.	.	.	.	.	T	9.726	1.160852	0.21538	.	.	ENSG00000171014	ENST00000307033	T	0.00561	6.59	5.5	5.5	0.81552	GPCR, rhodopsin-like superfamily (1);	0.766524	0.11100	N	0.599807	T	0.00608	0.0020	L	0.37750	1.13	0.19775	N	0.999959	B	0.22480	0.07	B	0.29716	0.106	T	0.50800	-0.8785	10	0.87932	D	0	-1.9943	6.2655	0.20924	0.0:0.2031:0.0:0.7969	.	134	Q8NGN0	OR4D5_HUMAN	R	134	ENSP00000305970:L134R	ENSP00000305970:L134R	L	+	2	0	OR4D5	123315934	0.000000	0.05858	0.016000	0.15963	0.159000	0.22180	0.039000	0.13884	2.082000	0.62665	0.533000	0.62120	CTC	OR4D5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000171014		0.512	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D5	HGNC	protein_coding	OTTHUMT00000387263.1	-	0.00	55	0	T	NM_001001965		123810724	+1	tier1	-	no_errors	ENST00000307033	ensembl	human	known	74_37	missense	15.71	59	11	SNP	0.328	G
OR5H1	26341	genome.wustl.edu	37	3	97851669	97851669	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:97851669T>G	ENST00000354565.2	+	1	128	c.128T>G	c.(127-129)cTt>cGt	p.L43R	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005338.1	NP_001005338.1	A6NKK0	OR5H1_HUMAN	olfactory receptor, family 5, subfamily H, member 1	43						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|kidney(8)|large_intestine(3)|lung(13)|ovary(1)|skin(1)	34						ATGGGGAATCTTGGTCTGATT	0.413																																																	0													47.0	51.0	50.0					3																	97851669		2183	4265	6448	SO:0001583	missense	0			X64988	CCDS33797.1	3q12.1	2012-08-09			ENSG00000231192	ENSG00000231192		"""GPCR / Class A : Olfactory receptors"""	8346	protein-coding gene	gene with protein product						1370859	Standard	NM_001005338		Approved	HTPCRX14, HSHTPCRX14	uc011bgt.2	A6NKK0	OTTHUMG00000160070	ENST00000354565.2:c.128T>G	3.37:g.97851669T>G	ENSP00000346575:p.Leu43Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L43R	ENST00000354565.2	37	c.128	CCDS33797.1	3	.	.	.	.	.	.	.	.	.	.	T	10.71	1.427586	0.25726	.	.	ENSG00000231192	ENST00000354565	T	0.00433	7.43	3.63	2.44	0.29823	GPCR, rhodopsin-like superfamily (1);	0.187684	0.26149	N	0.026046	T	0.01287	0.0042	M	0.93594	3.435	0.23430	N	0.997695	D	0.56287	0.975	P	0.62491	0.903	T	0.22103	-1.0226	10	0.87932	D	0	.	8.2757	0.31871	0.0:0.0:0.2009:0.7991	.	43	A6NKK0	OR5H1_HUMAN	R	43	ENSP00000346575:L43R	ENSP00000346575:L43R	L	+	2	0	OR5H1	99334359	0.000000	0.05858	0.234000	0.24042	0.143000	0.21401	0.814000	0.27239	0.447000	0.26695	0.164000	0.16699	CTT	OR5H1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000231192		0.413	OR5H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H1	HGNC	protein_coding	OTTHUMT00000359100.2	-	0.00	100	0	T	NM_001005338		97851669	+1	tier1	-	no_errors	ENST00000354565	ensembl	human	known	74_37	missense	14.71	87	15	SNP	0.888	G
OR5H6	79295	genome.wustl.edu	37	3	97983369	97983369	+	Missense_Mutation	SNP	A	A	G	rs113781156		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:97983369A>G	ENST00000383696.2	+	1	282	c.241A>G	c.(241-243)Agt>Ggt	p.S81G	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	81						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						ATTCCTTGGGAGTTTAGCCTT	0.408																																																	0													208.0	215.0	212.0					3																	97983369		2203	4300	6503	SO:0001583	missense	0			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.241A>G	3.37:g.97983369A>G	ENSP00000373196:p.Ser81Gly		Q6IF88	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S81G	ENST00000383696.2	37	c.241	CCDS33800.1	3	.	.	.	.	.	.	.	.	.	.	-	10.68	1.418703	0.25552	.	.	ENSG00000230301	ENST00000383696	T	0.03004	4.08	2.19	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.994378	0.08158	N	0.988998	T	0.05502	0.0145	L	0.50333	1.59	0.09310	N	1	B	0.31174	0.311	B	0.32677	0.15	T	0.38134	-0.9675	10	0.62326	D	0.03	.	7.9658	0.30098	1.0:0.0:0.0:0.0	.	81	Q8NGV6	OR5H6_HUMAN	G	81	ENSP00000373196:S81G	ENSP00000373196:S81G	S	+	1	0	OR5H6	99466059	0.000000	0.05858	0.094000	0.20943	0.006000	0.05464	0.193000	0.17116	1.006000	0.39211	0.163000	0.16589	AGT	OR5H6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000230301		0.408	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H6	HGNC	protein_coding	OTTHUMT00000359111.2	-	0.00	154	0	A			97983369	+1	tier1	rs113781156	no_errors	ENST00000383696	ensembl	human	known	74_37	missense	10.71	124	15	SNP	0.100	G
OR5L1	219437	genome.wustl.edu	37	11	55579353	55579353	+	Silent	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:55579353T>G	ENST00000333973.2	+	1	500	c.411T>G	c.(409-411)tcT>tcG	p.S137S		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	137						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				TCACCATGTCTTGGAAGGTGC	0.502																																																	0													209.0	169.0	182.0					11																	55579353		2200	4296	6496	SO:0001819	synonymous_variant	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.411T>G	11.37:g.55579353T>G			B2RNK6|Q6IFD0	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S137	ENST00000333973.2	37	c.411	CCDS31509.1	11																																																																																			OR5L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000186117		0.502	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	-	0.00	95	0	T	NM_001004738		55579353	+1	tier1	-	no_errors	ENST00000333973	ensembl	human	known	74_37	silent	28.00	72	28	SNP	0.053	G
OR5T2	219464	genome.wustl.edu	37	11	55999981	55999981	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:55999981A>C	ENST00000313264.4	-	1	756	c.681T>G	c.(679-681)tcT>tcG	p.S227S		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TGTCAGAATAAGAAATAGCAA	0.423																																																	0													140.0	130.0	133.0					11																	55999981		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.681T>G	11.37:g.55999981A>C			B9EGX5|Q6IFC8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S227	ENST00000313264.4	37	c.681	CCDS31523.1	11																																																																																			OR5T2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181718		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	-	0.00	93	0	A	NM_001004746		55999981	-1	tier1	-	no_errors	ENST00000313264	ensembl	human	known	74_37	silent	49.32	37	36	SNP	0.001	C
OR6K6	128371	genome.wustl.edu	37	1	158725609	158725609	+	Missense_Mutation	SNP	A	A	G	rs559439148		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:158725609A>G	ENST00000368144.2	+	1	1100	c.1004A>G	c.(1003-1005)cAg>cGg	p.Q335R		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TTCCACTATCAGAAGAGGGCT	0.418													A|||	1	0.000199681	0.0	0.0	5008	,	,		19386	0.0		0.0	False		,,,				2504	0.001																0													83.0	87.0	86.0					1																	158725609		2203	4300	6503	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.1004A>G	1.37:g.158725609A>G	ENSP00000357126:p.Gln335Arg		B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q335R	ENST00000368144.2	37	c.1004	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	A	7.484	0.649280	0.14516	.	.	ENSG00000180433	ENST00000368144	T	0.35048	1.33	5.26	2.92	0.33932	.	0.634090	0.12974	N	0.423879	T	0.05502	0.0145	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41288	-0.9517	10	0.27082	T	0.32	-1.0501	7.7691	0.28997	0.8182:0.0:0.1818:0.0	.	335	Q8NGW6	OR6K6_HUMAN	R	335	ENSP00000357126:Q335R	ENSP00000357126:Q335R	Q	+	2	0	OR6K6	156992233	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	1.190000	0.32126	0.440000	0.26502	-0.274000	0.10170	CAG	OR6K6	-	NULL	ENSG00000180433		0.418	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	-	0.00	38	0	A	NM_001005184		158725609	+1	tier1	-	no_errors	ENST00000368144	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.000	G
OR8D2	283160	genome.wustl.edu	37	11	124189450	124189450	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:124189450A>C	ENST00000357438.2	-	1	734	c.644T>G	c.(643-645)cTt>cGt	p.L215R		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	215						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		ATAAGAGATAAGGACCGCCAG	0.453																																																	0													87.0	88.0	88.0					11																	124189450		2201	4299	6500	SO:0001583	missense	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.644T>G	11.37:g.124189450A>C	ENSP00000350022:p.Leu215Arg		B9EH49|Q6IFR0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L215R	ENST00000357438.2	37	c.644	CCDS31707.1	11	.	.	.	.	.	.	.	.	.	.	a	13.47	2.246586	0.39697	.	.	ENSG00000197263	ENST00000357438	T	0.00277	8.34	3.11	-0.749	0.11084	GPCR, rhodopsin-like superfamily (1);	0.512841	0.16294	N	0.220783	T	0.00468	0.0015	H	0.94925	3.6	0.09310	N	1	P	0.39022	0.655	P	0.46629	0.522	T	0.29640	-1.0005	10	0.87932	D	0	.	5.0419	0.14463	0.6637:0.1545:0.1818:0.0	.	215	Q9GZM6	OR8D2_HUMAN	R	215	ENSP00000350022:L215R	ENSP00000350022:L215R	L	-	2	0	OR8D2	123694660	0.020000	0.18652	0.000000	0.03702	0.091000	0.18340	2.935000	0.48963	-0.123000	0.11745	0.432000	0.28606	CTT	OR8D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197263		0.453	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1	-	0.00	38	0	A	NM_001002918		124189450	-1	tier1	-	no_errors	ENST00000357438	ensembl	human	known	74_37	missense	17.65	28	6	SNP	0.000	C
OR8D2	283160	genome.wustl.edu	37	11	124189480	124189480	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:124189480A>C	ENST00000357438.2	-	1	704	c.614T>G	c.(613-615)gTt>gGt	p.V205G		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	205						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		TAAGGTATTAACTCCTCCAAT	0.413																																																	0													95.0	92.0	93.0					11																	124189480		2201	4299	6500	SO:0001583	missense	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.614T>G	11.37:g.124189480A>C	ENSP00000350022:p.Val205Gly		B9EH49|Q6IFR0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V205G	ENST00000357438.2	37	c.614	CCDS31707.1	11	.	.	.	.	.	.	.	.	.	.	a	17.27	3.347324	0.61183	.	.	ENSG00000197263	ENST00000357438	T	0.39229	1.09	3.55	2.4	0.29515	GPCR, rhodopsin-like superfamily (1);	0.548879	0.14998	N	0.286284	T	0.31389	0.0795	N	0.20685	0.6	0.20764	N	0.999851	P	0.39157	0.662	P	0.45377	0.478	T	0.14811	-1.0459	10	0.87932	D	0	.	4.9443	0.13982	0.7446:0.0:0.0934:0.162	.	205	Q9GZM6	OR8D2_HUMAN	G	205	ENSP00000350022:V205G	ENSP00000350022:V205G	V	-	2	0	OR8D2	123694690	0.002000	0.14202	0.003000	0.11579	0.977000	0.68977	0.976000	0.29462	0.739000	0.32628	0.432000	0.28606	GTT	OR8D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000197263		0.413	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1	-	0.00	37	0	A	NM_001002918		124189480	-1	tier1	-	no_errors	ENST00000357438	ensembl	human	known	74_37	missense	24.39	31	10	SNP	0.011	C
OR9G1	390174	genome.wustl.edu	37	11	56468458	56468458	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:56468458T>C	ENST00000312153.1	+	1	595	c.595T>C	c.(595-597)Tac>Cac	p.Y199H		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	199						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						AATTATGATGTACTTCCTGCT	0.502																																																	0													132.0	132.0	132.0					11																	56468458		2201	4296	6497	SO:0001583	missense	0			AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.595T>C	11.37:g.56468458T>C	ENSP00000309012:p.Tyr199His		Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y199H	ENST00000312153.1	37	c.595	CCDS31536.1	11	.	.	.	.	.	.	.	.	.	.	T	7.077	0.569419	0.13560	.	.	ENSG00000174914	ENST00000312153	T	0.00158	8.65	4.52	4.52	0.55395	GPCR, rhodopsin-like superfamily (1);	0.280944	0.25759	N	0.028483	T	0.00144	0.0004	L	0.32530	0.975	0.09310	N	1	B	0.20887	0.049	B	0.33799	0.17	T	0.30794	-0.9966	10	0.87932	D	0	-21.7199	7.1397	0.25548	0.0:0.1716:0.0:0.8284	.	199	Q8NH87	OR9G1_HUMAN	H	199	ENSP00000309012:Y199H	ENSP00000309012:Y199H	Y	+	1	0	OR9G1	56225034	0.000000	0.05858	0.478000	0.27316	0.176000	0.22953	0.000000	0.12993	2.006000	0.58801	0.467000	0.42956	TAC	OR9G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000174914		0.502	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G1	HGNC	protein_coding	OTTHUMT00000393253.1	-	0.00	149	0	T	NM_001005213		56468458	+1	tier1	-	no_errors	ENST00000312153	ensembl	human	known	74_37	missense	17.80	97	21	SNP	0.273	C
OR8D2	283160	genome.wustl.edu	37	11	124190008	124190008	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:124190008A>G	ENST00000357438.2	-	1	176	c.86T>C	c.(85-87)cTc>cCc	p.L29P		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AAGGAACAGGAGGAAGAGTGG	0.448																																																	0													86.0	84.0	85.0					11																	124190008		2201	4299	6500	SO:0001583	missense	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.86T>C	11.37:g.124190008A>G	ENSP00000350022:p.Leu29Pro		B9EH49|Q6IFR0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L29P	ENST00000357438.2	37	c.86	CCDS31707.1	11	.	.	.	.	.	.	.	.	.	.	a	12.95	2.092797	0.36952	.	.	ENSG00000197263	ENST00000357438	T	0.00458	7.28	3.42	3.42	0.39159	.	0.369536	0.19376	N	0.115781	T	0.00875	0.0029	M	0.70108	2.13	0.22127	N	0.999346	D	0.57257	0.979	P	0.54401	0.751	T	0.47535	-0.9110	10	0.72032	D	0.01	.	11.9154	0.52763	1.0:0.0:0.0:0.0	.	29	Q9GZM6	OR8D2_HUMAN	P	29	ENSP00000350022:L29P	ENSP00000350022:L29P	L	-	2	0	OR8D2	123695218	0.021000	0.18746	0.015000	0.15790	0.516000	0.34256	2.949000	0.49074	1.808000	0.52836	0.324000	0.21423	CTC	OR8D2	-	prints_GPCR_Rhodpsn	ENSG00000197263		0.448	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1	-	0.00	52	0	A	NM_001002918		124190008	-1	tier1	-	no_errors	ENST00000357438	ensembl	human	known	74_37	missense	37.88	41	25	SNP	0.027	G
PMCH	5367	genome.wustl.edu	37	12	102590397	102590397	+	3'UTR	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:102590397T>G	ENST00000329406.4	-	0	605				PARPBP_ENST00000535811.1_3'UTR|PARPBP_ENST00000378128.3_3'UTR|PARPBP_ENST00000327680.2_3'UTR|PARPBP_ENST00000541394.1_3'UTR	NM_002674.2	NP_002665.2	P20382	MCH_HUMAN	pro-melanin-concentrating hormone						cell differentiation (GO:0030154)|feeding behavior (GO:0007631)|multicellular organismal development (GO:0007275)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|nucleus (GO:0005634)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	6						TGCTTTTATTTTCTTCTGAAA	0.383																																																	0													116.0	120.0	119.0					12																	102590397		2202	4299	6501	SO:0001624	3_prime_UTR_variant	0			M57703	CCDS31885.1	12q23.2	2013-02-26			ENSG00000183395	ENSG00000183395		"""Endogenous ligands"""	9109	protein-coding gene	gene with protein product		176795				2149166	Standard	NM_002674		Approved	MCH	uc001tjl.3	P20382	OTTHUMG00000170479	ENST00000329406.4:c.*33A>C	12.37:g.102590397T>G			Q16044|Q8WVG0	RNA	SNP	-	NULL	ENST00000329406.4	37	NULL	CCDS31885.1	12																																																																																			PARPBP	-	-	ENSG00000185480		0.383	PMCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARPBP	HGNC	protein_coding	OTTHUMT00000409337.1	-	0.00	39	0	T	NM_002674		102590397	+1	tier1	-	no_errors	ENST00000535811	ensembl	human	known	74_37	rna	67.50	13	27	SNP	0.986	G
PCDH19	57526	genome.wustl.edu	37	X	99663101	99663101	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:99663101A>C	ENST00000373034.4	-	1	2170	c.495T>G	c.(493-495)acT>acG	p.T165T	PCDH19_ENST00000255531.7_Silent_p.T165T|PCDH19_ENST00000420881.2_Silent_p.T165T	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	165	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						TGAGCTCGTAAGTCTGCACGC	0.637																																																	0													53.0	54.0	54.0					X																	99663101		2112	4192	6304	SO:0001819	synonymous_variant	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.495T>G	X.37:g.99663101A>C			B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T165	ENST00000373034.4	37	c.495	CCDS55462.1	X																																																																																			PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.637	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	-	0.00	18	0	A	NM_020766		99663101	-1	tier1	-	no_errors	ENST00000373034	ensembl	human	known	74_37	silent	51.72	14	15	SNP	0.019	C
PCDH20	64881	genome.wustl.edu	37	13	61987441	61987441	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:61987441T>C	ENST00000409186.1	-	5	2896	c.791A>G	c.(790-792)gAg>gGg	p.E264G	PCDH20_ENST00000409204.4_Missense_Mutation_p.E264G			Q8N6Y1	PCD20_HUMAN	protocadherin 20	264	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CTCCCCATTCTCATTCTCCTC	0.527																																																	0													99.0	86.0	90.0					13																	61987441		2203	4300	6503	SO:0001583	missense	0			AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.791A>G	13.37:g.61987441T>C	ENSP00000386653:p.Glu264Gly		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E264G	ENST00000409186.1	37	c.791	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	T	15.64	2.893809	0.52121	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.54071	0.59;0.59	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000003	T	0.52108	0.1714	N	0.12443	0.215	0.80722	D	1	D	0.61080	0.989	P	0.57911	0.829	T	0.59690	-0.7407	10	0.59425	D	0.04	.	16.3436	0.83110	0.0:0.0:0.0:1.0	.	264	A8K1K9	.	G	264;264;10	ENSP00000387250:E264G;ENSP00000386653:E264G	ENSP00000351500:E10G	E	-	2	0	PCDH20	60885442	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	4.916000	0.63362	2.269000	0.75478	0.533000	0.62120	GAG	PCDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197991		0.527	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	-	0.00	46	0	T	NM_022843		61987441	-1	tier1	-	no_errors	ENST00000409186	ensembl	human	known	74_37	missense	13.04	60	9	SNP	1.000	C
PCDHA3	56145	genome.wustl.edu	37	5	140182594	140182594	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:140182594C>T	ENST00000522353.2	+	1	1812	c.1812C>T	c.(1810-1812)aaC>aaT	p.N604N	PCDHA3_ENST00000532566.2_Silent_p.N604N|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	604	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGCTACAACGCGTGGCTTT	0.677																																																	0													101.0	98.0	99.0					5																	140182594		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1812C>T	5.37:g.140182594C>T			O75286	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N604	ENST00000522353.2	37	c.1812	CCDS54915.1	5																																																																																			PCDHA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000255408		0.677	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	-	0.00	193	0	C	NM_018906		140182594	+1	tier1	-	no_errors	ENST00000522353	ensembl	human	known	74_37	silent	35.54	107	59	SNP	1.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140263526	140263526	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:140263526A>T	ENST00000289272.2	+	1	1673	c.1673A>T	c.(1672-1674)gAg>gTg	p.E558V	PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.E558V|PCDHA1_ENST00000394633.3_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGCTGGACGAGAACGACAAC	0.697																																					Melanoma(147;1739 1852 5500 27947 37288)												0													63.0	70.0	68.0					5																	140263526		2203	4297	6500	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1673A>T	5.37:g.140263526A>T	ENSP00000289272:p.Glu558Val		O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E558V	ENST00000289272.2	37	c.1673	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	A	6.683	0.494626	0.12702	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.58060	0.36;0.36	4.08	4.08	0.47627	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	T	0.38348	0.1037	N	0.04162	-0.26	0.24200	N	0.995519	P;P;P	0.43788	0.817;0.627;0.73	B;B;P	0.49502	0.186;0.158;0.613	T	0.14364	-1.0475	9	0.59425	D	0.04	.	7.763	0.28963	0.6849:0.0:0.0:0.3151	.	558;558;558	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	V	558	ENSP00000386821:E558V;ENSP00000289272:E558V	ENSP00000289272:E558V	E	+	2	0	PCDHA13	140243710	0.811000	0.29063	0.997000	0.53966	0.114000	0.19823	1.688000	0.37690	1.686000	0.51046	0.459000	0.35465	GAG	PCDHA13	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000239389		0.697	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	-	0.00	140	0	A	NM_018904		140263526	+1	tier1	-	no_errors	ENST00000289272	ensembl	human	known	74_37	missense	36.49	47	27	SNP	0.999	T
PCDHB12	56124	genome.wustl.edu	37	5	140589472	140589472	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:140589472T>C	ENST00000239450.2	+	1	1182	c.993T>C	c.(991-993)tcT>tcC	p.S331S	PCDHB12_ENST00000541609.1_5'UTR	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	331	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTGGAAAATCTACAGTCAGAA	0.418																																																	0													77.0	78.0	78.0					5																	140589472		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.993T>C	5.37:g.140589472T>C			B4DDU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S331	ENST00000239450.2	37	c.993	CCDS4254.1	5																																																																																			PCDHB12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120328		0.418	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	-	0.00	36	0	T	NM_018932		140589472	+1	tier1	-	no_errors	ENST00000239450	ensembl	human	known	74_37	silent	20.00	24	6	SNP	0.001	C
PCDHB18	54660	genome.wustl.edu	37	5	140615402	140615402	+	RNA	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:140615402T>G	ENST00000526308.1	+	0	1465					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						CGTGACCGACTTGGGGACACC	0.507																																																	0																																												0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615402T>G			B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.507	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	-	0.00	107	0	T			140615402	+1	tier1	-	no_errors	ENST00000526308	ensembl	human	known	74_37	rna	13.89	92	15	SNP	0.011	G
PCLO	27445	genome.wustl.edu	37	7	82545548	82545548	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:82545548T>G	ENST00000333891.9	-	7	12091	c.11754A>C	c.(11752-11754)caA>caC	p.Q3918H	PCLO_ENST00000423517.2_Missense_Mutation_p.Q3918H|PCLO_ENST00000437081.1_Missense_Mutation_p.Q638H	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AAGGTGAAACTTGCTGATGGT	0.463																																																	0													404.0	400.0	401.0					7																	82545548		2027	4176	6203	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11754A>C	7.37:g.82545548T>G	ENSP00000334319:p.Gln3918His			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.Q3918H	ENST00000333891.9	37	c.11754	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	8.375	0.836313	0.16891	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.18174	2.23;2.23	5.51	1.49	0.22878	.	.	.	.	.	T	0.23330	0.0564	L	0.44542	1.39	0.42839	D	0.994048	P;P;D	0.61697	0.61;0.937;0.99	P;P;P	0.56960	0.525;0.74;0.81	T	0.02546	-1.1143	9	0.87932	D	0	.	7.2526	0.26158	0.0:0.4738:0.0:0.5262	.	3849;3918;3918	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	H	3918;3918;638	ENSP00000334319:Q3918H;ENSP00000388393:Q3918H	ENSP00000334319:Q3918H	Q	-	3	2	PCLO	82383484	0.999000	0.42202	1.000000	0.80357	0.985000	0.73830	0.568000	0.23623	0.415000	0.25817	0.460000	0.39030	CAA	PCLO	-	NULL	ENSG00000186472		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	153	0	T	NM_014510		82545548	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	24.89	175	58	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82585782	82585782	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:82585782T>G	ENST00000333891.9	-	5	4824	c.4487A>C	c.(4486-4488)aAg>aCg	p.K1496T	PCLO_ENST00000423517.2_Missense_Mutation_p.K1496T	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AAACTCAGACTTCTCTTTATG	0.368																																																	0													119.0	108.0	111.0					7																	82585782		1851	4090	5941	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.4487A>C	7.37:g.82585782T>G	ENSP00000334319:p.Lys1496Thr			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.K1496T	ENST00000333891.9	37	c.4487	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	4.823	0.153075	0.09185	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.17054	2.3;2.3	5.47	0.388	0.16264	.	.	.	.	.	T	0.11324	0.0276	L	0.36672	1.1	0.09310	N	1	B;B	0.29301	0.241;0.241	B;B	0.21917	0.037;0.037	T	0.26710	-1.0095	9	0.87932	D	0	.	4.2029	0.10475	0.1388:0.2275:0.0:0.6336	.	1496;1496	Q9Y6V0-5;Q9Y6V0-6	.;.	T	1427;1496;1496	ENSP00000334319:K1496T;ENSP00000388393:K1496T	ENSP00000334319:K1496T	K	-	2	0	PCLO	82423718	0.000000	0.05858	0.000000	0.03702	0.617000	0.37484	0.314000	0.19432	0.046000	0.15833	-0.256000	0.11100	AAG	PCLO	-	NULL	ENSG00000186472		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	59	0	T	NM_014510		82585782	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	7.84	94	8	SNP	0.000	G
PEG3	5178	genome.wustl.edu	37	19	57325574	57325574	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:57325574T>G	ENST00000326441.9	-	10	4599	c.4236A>C	c.(4234-4236)gaA>gaC	p.E1412D	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.E1288D|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.E1286D|PEG3_ENST00000423103.2_Missense_Mutation_p.E1412D|ZIM2_ENST00000221722.5_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1412	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGCCTCCACTTCTGGCTCAG	0.587																																																	0													44.0	47.0	46.0					19																	57325574		2202	4294	6496	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4236A>C	19.37:g.57325574T>G	ENSP00000326581:p.Glu1412Asp		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E1412D	ENST00000326441.9	37	c.4236	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	5.760	0.324543	0.10900	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02631	4.22;4.22	4.04	-8.08	0.01094	.	0.734362	0.12167	N	0.493449	T	0.01320	0.0043	N	0.14661	0.345	.	.	.	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.37033	-0.9723	9	0.28530	T	0.3	-3.3935	3.2737	0.06891	0.0913:0.1888:0.2592:0.4607	.	1288;1412;1347	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	D	1412	ENSP00000326581:E1412D;ENSP00000403051:E1412D	ENSP00000326581:E1412D	E	-	3	2	ZIM2	62017386	0.000000	0.05858	0.000000	0.03702	0.316000	0.28119	-0.468000	0.06656	-3.438000	0.00163	-0.789000	0.03336	GAA	PEG3	-	NULL	ENSG00000198300		0.587	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	76	0	T			57325574	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	20.00	64	16	SNP	0.000	G
PEG3	5178	genome.wustl.edu	37	19	57325616	57325616	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:57325616T>A	ENST00000326441.9	-	10	4557	c.4194A>T	c.(4192-4194)gaA>gaT	p.E1398D	ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.E1274D|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.E1272D|PEG3_ENST00000423103.2_Missense_Mutation_p.E1398D|ZIM2_ENST00000221722.5_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1398	3 X 7 AA repeat of P-E-V-E-A-A-E.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGCCTCCACTTCTGGCTCAG	0.582																																																	0													42.0	44.0	43.0					19																	57325616		2199	4275	6474	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4194A>T	19.37:g.57325616T>A	ENSP00000326581:p.Glu1398Asp		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E1398D	ENST00000326441.9	37	c.4194	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	15.69	2.909474	0.52439	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02763	4.17;4.17	3.7	-2.63	0.06133	.	0.000000	0.40469	N	0.001100	T	0.02304	0.0071	L	0.32530	0.975	.	.	.	P;P;P	0.51791	0.948;0.948;0.948	P;P;P	0.46975	0.533;0.533;0.533	T	0.47459	-0.9116	9	0.18710	T	0.47	-22.4314	4.6562	0.12618	0.1611:0.2924:0.0:0.5466	.	1274;1398;1333	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	D	1398	ENSP00000326581:E1398D;ENSP00000403051:E1398D	ENSP00000326581:E1398D	E	-	3	2	ZIM2	62017428	0.000000	0.05858	0.454000	0.27019	0.795000	0.44927	-0.431000	0.06965	-0.346000	0.08312	-0.177000	0.13119	GAA	PEG3	-	NULL	ENSG00000198300		0.582	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	62	0	T			57325616	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	27.27	56	21	SNP	0.010	A
GATB	5188	genome.wustl.edu	37	4	152601042	152601042	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:152601042G>T	ENST00000515812.1	-	10	1226	c.1210C>A	c.(1210-1212)Cct>Act	p.P404T	RP11-164P12.3_ENST00000514269.1_RNA|PET112_ENST00000507592.1_5'UTR|PET112_ENST00000263985.6_Splice_Site_p.P445T																breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	23						GGTGTGACAGGACTGGTGGCC	0.502																																																	0													154.0	156.0	155.0					4																	152601042		2203	4300	6503	SO:0001630	splice_region_variant	0																														ENST00000515812.1:c.1209-1C>A	4.37:g.152601042G>T				Missense_Mutation	SNP	pfam_Asn/Gln-tRNA_Trfase_suB/E_cat,pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu	p.P445T	ENST00000515812.1	37	c.1333		4	.	.	.	.	.	.	.	.	.	.	G	19.48	3.836303	0.71373	.	.	ENSG00000059691	ENST00000263985;ENST00000515812	T;T	0.46451	0.87;0.87	5.69	5.69	0.88448	Asn/Gln amidotransferase (2);Aspartyl/glutamyl-tRNA amidotransferase subunit B-related (1);	0.000000	0.85682	D	0.000000	T	0.68851	0.3046	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72852	-0.4167	10	0.87932	D	0	-12.1049	17.5788	0.87958	0.0:0.0:1.0:0.0	.	445	O75879	GATB_HUMAN	T	445;404	ENSP00000263985:P445T;ENSP00000426859:P404T	ENSP00000263985:P445T	P	-	1	0	PET112	152820492	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	5.951000	0.70273	2.677000	0.91161	0.650000	0.86243	CCT	PET112	-	pfam_Asn/Gln_amidotransferase,superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Asn/Gln_amidotransferase,tigrfam_Apn/Gln-ADT_bsu	ENSG00000059691		0.502	PET112-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	PET112	HGNC	protein_coding	OTTHUMT00000365672.1	-	0.00	43	0	G		Missense_Mutation	152601042	-1	tier1	-	no_errors	ENST00000263985	ensembl	human	known	74_37	missense	45.83	26	22	SNP	1.000	T
PGAP1	80055	genome.wustl.edu	37	2	197705997	197705997	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:197705997G>T	ENST00000354764.4	-	27	2844	c.2730C>A	c.(2728-2730)ttC>ttA	p.F910L		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	910					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						AAAGAGGAATGAAGACAAAGC	0.378																																																	0													107.0	100.0	103.0					2																	197705997		2203	4300	6503	SO:0001583	missense	0				CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2730C>A	2.37:g.197705997G>T	ENSP00000346809:p.Phe910Leu		Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	pfam_PGAP1-like	p.F910L	ENST00000354764.4	37	c.2730	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	G	7.623	0.677135	0.14841	.	.	ENSG00000197121	ENST00000354764;ENST00000422444	.	.	.	4.89	4.0	0.46444	.	0.606015	0.17091	N	0.187386	T	0.23492	0.0568	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07214	-1.0784	9	0.08381	T	0.77	-2.1212	7.1762	0.25747	0.1494:0.1451:0.7056:0.0	.	736;910	Q75T13-2;Q75T13	.;PGAP1_HUMAN	L	910;147	.	ENSP00000346809:F910L	F	-	3	2	PGAP1	197414242	0.935000	0.31712	1.000000	0.80357	0.764000	0.43329	1.233000	0.32648	1.274000	0.44362	-0.291000	0.09656	TTC	PGAP1	-	NULL	ENSG00000197121		0.378	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5		0.00	36	0	G	NM_024989		197705997	-1			no_errors	ENST00000354764	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.998	T
PIKFYVE	200576	genome.wustl.edu	37	2	209212734	209212734	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:209212734C>T	ENST00000264380.4	+	35	5519	c.5361C>T	c.(5359-5361)ggC>ggT	p.G1787G		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1787	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						AGAATCAAGGCGTTGAGCCTC	0.428																																																	0													110.0	107.0	108.0					2																	209212734		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5361C>T	2.37:g.209212734C>T			Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.G1787	ENST00000264380.4	37	c.5361	CCDS2382.1	2																																																																																			PIKFYVE	-	NULL	ENSG00000115020		0.428	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2		0.00	36	0	C	NM_015040		209212734	+1			no_errors	ENST00000264380	ensembl	human	known	74_37	silent	21.82	43	12	SNP	0.748	T
PLCG1	5335	genome.wustl.edu	37	20	39802094	39802094	+	Missense_Mutation	SNP	G	G	A	rs186053167		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:39802094G>A	ENST00000373271.1	+	28	3719	c.3314G>A	c.(3313-3315)cGa>cAa	p.R1105Q	PLCG1_ENST00000608689.1_3'UTR|PLCG1_ENST00000373272.2_Missense_Mutation_p.R1105Q|PLCG1_ENST00000244007.3_Missense_Mutation_p.R1105Q	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	1105	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				AAGAATGGCCGAGGCATTGTG	0.562											OREG0025953	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													112.0	99.0	104.0					20																	39802094		2203	4300	6503	SO:0001583	missense	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.3314G>A	20.37:g.39802094G>A	ENSP00000362368:p.Arg1105Gln	888	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.R1105Q	ENST00000373271.1	37	c.3314	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.185024	0.94885	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.68765	-0.35;-0.35;-0.35	5.2	5.2	0.72013	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.78214	0.4248	L	0.47190	1.495	0.80722	D	1	D;D;D	0.89917	0.994;1.0;0.995	P;D;P	0.78314	0.803;0.991;0.875	T	0.80082	-0.1531	10	0.72032	D	0.01	.	18.7322	0.91739	0.0:0.0:1.0:0.0	.	1105;1105;1105	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	Q	1105	ENSP00000244007:R1105Q;ENSP00000362368:R1105Q;ENSP00000362369:R1105Q	ENSP00000244007:R1105Q	R	+	2	0	PLCG1	39235508	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.869000	0.99810	2.430000	0.82344	0.455000	0.32223	CGA	PLCG1	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_PLC-gamma,pfscan_C2_dom	ENSG00000124181		0.562	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	-	0.00	91	0	G	NM_182811		39802094	+1	tier1	-	no_errors	ENST00000244007	ensembl	human	known	74_37	missense	47.65	78	71	SNP	1.000	A
PLCXD3	345557	genome.wustl.edu	37	5	41382172	41382172	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:41382172G>C	ENST00000377801.3	-	2	642	c.568C>G	c.(568-570)Caa>Gaa	p.Q190E	PLCXD3_ENST00000328457.3_Missense_Mutation_p.Q190E			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	190	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						ACCAGCACTTGATAGTCCTTC	0.498																																																	0													81.0	77.0	79.0					5																	41382172		2203	4300	6503	SO:0001583	missense	0				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.568C>G	5.37:g.41382172G>C	ENSP00000367032:p.Gln190Glu		A6NL04	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.Q190E	ENST00000377801.3	37	c.568	CCDS34150.1	5	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546108	0.86022	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	5.81	5.81	0.92471	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	D	0.84790	0.5550	M	0.90082	3.085	0.80722	D	1	P	0.44776	0.843	P	0.58928	0.848	D	0.85468	0.1171	9	0.52906	T	0.07	-13.5782	20.0784	0.97758	0.0:0.0:1.0:0.0	.	190	Q63HM9	PLCX3_HUMAN	E	190	.	ENSP00000333751:Q190E	Q	-	1	0	PLCXD3	41417929	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.473000	0.97714	2.736000	0.93811	0.655000	0.94253	CAA	PLCXD3	-	superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom	ENSG00000182836		0.498	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	HGNC	protein_coding	OTTHUMT00000367109.1	-	0.00	41	0	G	XM_293875		41382172	-1	tier1	-	no_errors	ENST00000328457	ensembl	human	known	74_37	missense	10.04	205	23	SNP	1.000	C
PLEKHA6	22874	genome.wustl.edu	37	1	204214812	204214812	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:204214812T>A	ENST00000272203.3	-	14	2279	c.1963A>T	c.(1963-1965)Atc>Ttc	p.I655F	PLEKHA6_ENST00000414478.1_Missense_Mutation_p.I675F	NM_014935.4	NP_055750.2	Q9Y2H5	PKHA6_HUMAN	pleckstrin homology domain containing, family A member 6	655										breast(2)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(3)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_cancers(21;0.0222)|Breast(84;0.179)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.0833)|Kidney(21;0.0934)|Epithelial(59;0.229)			ACGTCCTGGATCCTCCAGATC	0.587																																																	0													138.0	116.0	123.0					1																	204214812		2203	4300	6503	SO:0001583	missense	0			AB023186	CCDS1444.1	1q32	2013-01-10			ENSG00000143850	ENSG00000143850		"""Pleckstrin homology (PH) domain containing"""	17053	protein-coding gene	gene with protein product		607771				11001876	Standard	NM_014935		Approved	PEPP3, KIAA0969	uc001hau.4	Q9Y2H5	OTTHUMG00000036057	ENST00000272203.3:c.1963A>T	1.37:g.204214812T>A	ENSP00000272203:p.Ile655Phe		A7MD51|Q5VTI6	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.I655F	ENST00000272203.3	37	c.1963	CCDS1444.1	1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.034613	0.54896	.	.	ENSG00000143850	ENST00000272203;ENST00000414478	T;T	0.81330	-1.48;-1.48	5.13	2.82	0.32997	.	0.189510	0.46442	D	0.000299	T	0.75568	0.3867	M	0.69358	2.11	0.42232	D	0.991899	B	0.27559	0.181	B	0.22880	0.042	T	0.71108	-0.4688	10	0.87932	D	0	-8.9405	8.6284	0.33904	0.0:0.1606:0.0:0.8394	.	655	Q9Y2H5	PKHA6_HUMAN	F	655;675	ENSP00000272203:I655F;ENSP00000402046:I675F	ENSP00000272203:I655F	I	-	1	0	PLEKHA6	202481435	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	3.472000	0.53114	0.311000	0.23014	-0.376000	0.06991	ATC	PLEKHA6	-	NULL	ENSG00000143850		0.587	PLEKHA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA6	HGNC	protein_coding	OTTHUMT00000087889.3	-	0.00	67	0	T	NM_014935		204214812	-1	tier1	-	no_errors	ENST00000272203	ensembl	human	known	74_37	missense	8.45	65	6	SNP	1.000	A
PLG	5340	genome.wustl.edu	37	6	161134281	161134281	+	Intron	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:161134281A>C	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	CTCGGAAAGAAGCAAAACCCC	0.413																																																	0																																										SO:0001627	intron_variant	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+124A>C	6.37:g.161134281A>C			Q15146|Q5TEH4|Q6PA00	RNA	SNP	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			PLG	-	-	ENSG00000122194		0.413	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	-	0.00	32	0	A	NM_000301		161134281	+1	tier1	-	no_errors	ENST00000462918	ensembl	human	known	74_37	rna	32.00	17	8	SNP	0.000	C
PLG	5340	genome.wustl.edu	37	6	161173176	161173176	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:161173176G>T	ENST00000308192.9	+	18	2218	c.2155G>T	c.(2155-2157)Gcc>Tcc	p.A719S		NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	719	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	TCTCAAGGAAGCCCAGCTCCC	0.468																																																	0													59.0	59.0	59.0					6																	161173176		2203	4300	6503	SO:0001583	missense	0			M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.2155G>T	6.37:g.161173176G>T	ENSP00000308938:p.Ala719Ser		Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	pirsf_Pept_S1A_plasmin,pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1	p.A719S	ENST00000308192.9	37	c.2155	CCDS5279.1	6	.	.	.	.	.	.	.	.	.	.	.	14.51	2.555485	0.45487	.	.	ENSG00000122194	ENST00000308192;ENST00000316325	D	0.83250	-1.7	3.38	3.38	0.38709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.187720	0.25634	U	0.029336	D	0.82277	0.5002	M	0.67569	2.06	0.44036	D	0.996761	P	0.40250	0.709	P	0.54460	0.753	D	0.83935	0.0308	10	0.66056	D	0.02	.	7.8074	0.29211	0.182:0.0:0.818:0.0	.	719	P00747	PLMN_HUMAN	S	719;119	ENSP00000308938:A719S	ENSP00000308938:A719S	A	+	1	0	PLG	161093166	1.000000	0.71417	0.896000	0.35187	0.330000	0.28571	3.207000	0.51106	1.582000	0.49881	0.411000	0.27672	GCC	PLG	-	pirsf_Pept_S1A_plasmin,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000122194		0.468	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	HGNC	protein_coding	OTTHUMT00000042959.2	-	0.00	70	0	G	NM_000301		161173176	+1	tier1	-	no_errors	ENST00000308192	ensembl	human	known	74_37	missense	31.65	54	25	SNP	0.992	T
POLE	5426	genome.wustl.edu	37	12	133257759	133257759	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:133257759C>G	ENST00000320574.5	-	2	212	c.169G>C	c.(169-171)Ggt>Cgt	p.G57R	POLE_ENST00000535270.1_Missense_Mutation_p.G57R	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	57					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GTCTTCTCACCAGGCTCCTTC	0.547								DNA polymerases (catalytic subunits)																																									0													131.0	121.0	124.0					12																	133257759		2203	4300	6503	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.169G>C	12.37:g.133257759C>G	ENSP00000322570:p.Gly57Arg		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.G57R	ENST00000320574.5	37	c.169	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612429	0.28712	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.02737	4.21;4.2;4.18	4.93	4.93	0.64822	.	0.116455	0.56097	D	0.000022	T	0.02571	0.0078	L	0.33189	0.99	0.47698	D	0.999492	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.001	T	0.51818	-0.8657	10	0.16896	T	0.51	.	8.4427	0.32824	0.1558:0.7619:0.0:0.0823	.	57;57	F5H1D6;Q07864	.;DPOE1_HUMAN	R	57;68;57	ENSP00000322570:G57R;ENSP00000406383:G68R;ENSP00000445753:G57R	ENSP00000322570:G57R	G	-	1	0	POLE	131767832	0.999000	0.42202	1.000000	0.80357	0.883000	0.51084	4.526000	0.60566	2.442000	0.82660	0.561000	0.74099	GGT	POLE	-	NULL	ENSG00000177084		0.547	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	40	0	C	NM_006231		133257759	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	25.58	32	11	SNP	1.000	G
POTEC	388468	genome.wustl.edu	37	18	14537832	14537832	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:14537832A>G	ENST00000358970.5	-	3	777	c.778T>C	c.(778-780)Tta>Cta	p.L260L	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	260										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GCACCATATAAGAGCAGTGCT	0.358																																																	0													177.0	141.0	152.0					18																	14537832		692	1591	2283	SO:0001819	synonymous_variant	0			BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.778T>C	18.37:g.14537832A>G				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L260	ENST00000358970.5	37	c.778	CCDS45835.1	18																																																																																			POTEC	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000183206		0.358	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	-	0.00	235	0	A	XM_496269		14537832	-1	tier1	-	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	20.07	243	61	SNP	0.041	G
POU6F1	5463	genome.wustl.edu	37	12	51589790	51589790	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:51589790C>T	ENST00000389243.4	-	8	1151	c.212G>A	c.(211-213)cGg>cAg	p.R71Q	POU6F1_ENST00000333640.10_Missense_Mutation_p.R71Q|POU6F1_ENST00000550824.1_Missense_Mutation_p.R71Q			Q14863	PO6F1_HUMAN	POU class 6 homeobox 1	71	Gln/Pro-rich.				brain development (GO:0007420)|heart development (GO:0007507)|muscle organ development (GO:0007517)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	11						GCTTGGCTTCCGGACAGCCAC	0.677																																																	0													15.0	16.0	15.0					12																	51589790		2196	4288	6484	SO:0001583	missense	0			AL832881	CCDS31803.1	12q13.13	2011-06-20	2007-07-13			ENSG00000184271		"""Homeoboxes / POU class"""	9224	protein-coding gene	gene with protein product			"""POU domain, class 6, transcription factor 1"""			7908264	Standard	NM_002702		Approved	BRN5, MPOU, TCFB1	uc001rxz.3	Q14863		ENST00000389243.4:c.212G>A	12.37:g.51589790C>T	ENSP00000373895:p.Arg71Gln		Q15944|Q6DK47|Q7Z7P6	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.R71Q	ENST00000389243.4	37	c.212	CCDS31803.1	12	.	.	.	.	.	.	.	.	.	.	C	12.08	1.829533	0.32329	.	.	ENSG00000184271	ENST00000389243;ENST00000333640;ENST00000550824	D;D;D	0.84298	-1.83;-1.83;-1.83	5.62	5.62	0.85841	.	2.480030	0.01770	N	0.031157	T	0.78672	0.4320	N	0.21142	0.635	0.36642	D	0.876921	B	0.31817	0.341	B	0.21546	0.035	T	0.56481	-0.7972	10	0.05959	T	0.93	.	18.4778	0.90799	0.0:1.0:0.0:0.0	.	71	Q14863	PO6F1_HUMAN	Q	71	ENSP00000373895:R71Q;ENSP00000330190:R71Q;ENSP00000448389:R71Q	ENSP00000330190:R71Q	R	-	2	0	POU6F1	49876057	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.857000	0.27831	2.667000	0.90743	0.638000	0.83543	CGG	POU6F1	-	NULL	ENSG00000184271		0.677	POU6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU6F1	HGNC	protein_coding	OTTHUMT00000405126.1		0.00	23	0	C	NM_002702		51589790	-1			no_errors	ENST00000333640	ensembl	human	known	74_37	missense	20.69	23	6	SNP	1.000	T
PRAMEF17	391004	genome.wustl.edu	37	1	13717112	13717112	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:13717112A>C	ENST00000376098.4	+	2	625	c.599A>C	c.(598-600)aAa>aCa	p.K200T		NM_001099851.1	NP_001093321.1	Q5VTA0	PRA17_HUMAN	PRAME family member 17	200					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|lung(2)	3	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;9.86e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|COAD - Colon adenocarcinoma(227;0.000502)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AATTTATTGAAAAGGGTATAC	0.418																																																	0													4.0	4.0	4.0					1																	13717112		1361	3045	4406	SO:0001583	missense	0				CCDS41264.1	1p36.21	2013-01-17			ENSG00000204479	ENSG00000204479		"""-"""	29485	protein-coding gene	gene with protein product							Standard	NM_001099851		Approved	OTTHUMG00000007909	uc009vnz.1	Q5VTA0	OTTHUMG00000007909	ENST00000376098.4:c.599A>C	1.37:g.13717112A>C	ENSP00000365266:p.Lys200Thr		B2RUU4	Missense_Mutation	SNP	NULL	p.K200T	ENST00000376098.4	37	c.599	CCDS41264.1	1	.	.	.	.	.	.	.	.	.	.	A	6.629	0.484465	0.12641	.	.	ENSG00000204479	ENST00000376098	T	0.14516	2.5	1.09	-2.11	0.07187	.	1.883650	0.02349	N	0.075732	T	0.24005	0.0581	M	0.82823	2.61	0.09310	N	1	B	0.32526	0.374	B	0.41510	0.359	T	0.33240	-0.9876	10	0.66056	D	0.02	.	1.4867	0.02448	0.3738:0.0:0.276:0.3502	.	200	Q5VTA0	PRA17_HUMAN	T	200	ENSP00000365266:K200T	ENSP00000365266:K200T	K	+	2	0	PRAMEF17	13589699	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.814000	0.04486	-0.670000	0.05282	0.373000	0.22412	AAA	PRAMEF17	-	NULL	ENSG00000204479		0.418	PRAMEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF17	HGNC	protein_coding	OTTHUMT00000021780.2	-	0.00	36	0	A	NM_001099851		13717112	+1	tier1	-	no_errors	ENST00000376098	ensembl	human	known	74_37	missense	32.26	21	10	SNP	0.000	C
PREX2	80243	genome.wustl.edu	37	8	69020466	69020466	+	Silent	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:69020466T>G	ENST00000288368.4	+	24	3115	c.2838T>G	c.(2836-2838)tcT>tcG	p.S946S		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	946					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGGAAGTTTCTTATCCCAAAA	0.433																																																	0													125.0	112.0	116.0					8																	69020466		2203	4300	6503	SO:0001819	synonymous_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2838T>G	8.37:g.69020466T>G			B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S946	ENST00000288368.4	37	c.2838	CCDS6201.1	8																																																																																			PREX2	-	NULL	ENSG00000046889		0.433	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	107	0	T	NM_025170		69020466	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	silent	27.87	88	34	SNP	0.991	G
PRRX1	5396	genome.wustl.edu	37	1	170705354	170705354	+	3'UTR	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:170705354A>G	ENST00000239461.6	+	0	1078				PRRX1_ENST00000367760.3_3'UTR|PRRX1_ENST00000476867.2_3'UTR	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1						artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AACAGGCCTAAGAAGAAATCA	0.383																																																	0													43.0	43.0	43.0					1																	170705354		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.*27A>G	1.37:g.170705354A>G			B5BUM7|O60807	RNA	SNP	-	NULL	ENST00000239461.6	37	NULL	CCDS1290.1	1																																																																																			PRRX1	-	-	ENSG00000116132		0.383	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	-	0.00	36	0	A	NM_006902		170705354	+1	tier1	-	no_errors	ENST00000476867	ensembl	human	known	74_37	rna	19.35	25	6	SNP	1.000	G
PTPRB	5787	genome.wustl.edu	37	12	70965008	70965008	+	Silent	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:70965008A>T	ENST00000261266.5	-	11	2543	c.2514T>A	c.(2512-2514)acT>acA	p.T838T	PTPRB_ENST00000550857.1_Silent_p.T748T|PTPRB_ENST00000451516.2_Silent_p.T748T|PTPRB_ENST00000538708.1_Silent_p.T838T|PTPRB_ENST00000551525.1_Silent_p.T1055T|PTPRB_ENST00000334414.6_Silent_p.T1056T|PTPRB_ENST00000550358.1_Silent_p.T968T	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	838	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTCCTGACCAAGTCACATGCA	0.448																																																	0													95.0	89.0	91.0					12																	70965008		1991	4178	6169	SO:0001819	synonymous_variant	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2514T>A	12.37:g.70965008A>T			B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T1056	ENST00000261266.5	37	c.3168	CCDS44944.1	12																																																																																			PTPRB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000127329		0.448	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	-	0.00	27	0	A			70965008	-1	tier1	-	no_errors	ENST00000334414	ensembl	human	known	74_37	silent	52.00	12	13	SNP	0.094	T
PTPRZ1	5803	genome.wustl.edu	37	7	121651971	121651971	+	Silent	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:121651971T>G	ENST00000393386.2	+	12	3282	c.2871T>G	c.(2869-2871)acT>acG	p.T957T	PTPRZ1_ENST00000483028.1_Intron|PTPRZ1_ENST00000449182.1_Intron	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	957					axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						TGGGTGTAACTTATCAGGGTT	0.443																																																	0													146.0	133.0	137.0					7																	121651971		2203	4300	6503	SO:0001819	synonymous_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.2871T>G	7.37:g.121651971T>G			A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.T957	ENST00000393386.2	37	c.2871	CCDS34740.1	7																																																																																			PTPRZ1	-	NULL	ENSG00000106278		0.443	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	-	0.00	66	0	T	NM_002851		121651971	+1	tier1	-	no_errors	ENST00000393386	ensembl	human	known	74_37	silent	14.29	60	10	SNP	0.693	G
PVR	5817	genome.wustl.edu	37	19	45162124	45162124	+	Missense_Mutation	SNP	A	A	G	rs149458939	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:45162124A>G	ENST00000425690.3	+	6	1405	c.1106A>G	c.(1105-1107)aAa>aGa	p.K369R	PVR_ENST00000406449.4_Missense_Mutation_p.K369R|CTB-171A8.1_ENST00000590796.1_RNA|PVR_ENST00000403059.4_Intron|PVR_ENST00000344956.4_Intron	NM_006505.3	NP_006496.3	P15151	PVR_HUMAN	poliovirus receptor	369	DYNLT1 binding.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|regulation of immune response (GO:0050776)|susceptibility to natural killer cell mediated cytotoxicity (GO:0042271)|susceptibility to T cell mediated cytotoxicity (GO:0060370)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|receptor activity (GO:0004872)			large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	6	Lung NSC(12;0.00608)|all_lung(12;0.0148)	Medulloblastoma(540;0.0425)|Ovarian(192;0.0728)|Prostate(69;0.081)|all_neural(266;0.112)		Epithelial(262;0.000601)		TATTGGTCCAAATGTTCCCGT	0.517																																																	0								A	,,ARG/LYS,ARG/LYS	1,4405	2.1+/-5.4	0,1,2202	178.0	165.0	170.0		,,1106,1106	-4.0	0.0	19	dbSNP_134	170	5,8595	4.3+/-15.6	0,5,4295	yes	intron,intron,missense,missense	PVR	NM_001135768.1,NM_001135769.1,NM_001135770.1,NM_006505.3	,,26,26	0,6,6497	GG,GA,AA		0.0581,0.0227,0.0461	,,benign,benign	,,369/393,369/418	45162124	6,13000	2203	4300	6503	SO:0001583	missense	0			BC015542	CCDS12640.1, CCDS46105.1, CCDS46106.1, CCDS46107.1	19q13.2	2013-01-29			ENSG00000073008	ENSG00000073008		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9705	protein-coding gene	gene with protein product	"""nectin-like 5"""	173850		PVS		2170108	Standard	XM_005259120		Approved	CD155, HVED, Necl-5, NECL5, Tage4	uc002ozm.3	P15151	OTTHUMG00000151527	ENST00000425690.3:c.1106A>G	19.37:g.45162124A>G	ENSP00000402060:p.Lys369Arg		B4DTS9|P15152|Q15267|Q15268|Q96BJ1	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.K369R	ENST00000425690.3	37	c.1106	CCDS12640.1	19	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.759518	0.00657	2.27E-4	5.81E-4	ENSG00000073008	ENST00000425690;ENST00000406449	D;D	0.88046	-2.22;-2.33	2.65	-3.96	0.04106	.	10.338700	0.00702	N	0.000784	T	0.61937	0.2387	N	0.00801	-1.175	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.66344	-0.5947	10	0.06757	T	0.87	.	7.9494	0.30006	0.6606:0.0:0.3394:0.0	.	369;369	P15151-4;P15151	.;PVR_HUMAN	R	369	ENSP00000402060:K369R;ENSP00000383907:K369R	ENSP00000383907:K369R	K	+	2	0	PVR	49853964	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.511000	0.06321	-0.818000	0.04329	-1.033000	0.02402	AAA	PVR	-	NULL	ENSG00000073008		0.517	PVR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PVR	HGNC	protein_coding	OTTHUMT00000323017.2	-	0.00	69	0	A	NM_006505		45162124	+1	tier1	rs149458939	no_errors	ENST00000425690	ensembl	human	known	74_37	missense	29.23	46	19	SNP	0.000	G
PXDNL	137902	genome.wustl.edu	37	8	52233397	52233397	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:52233397T>C	ENST00000356297.4	-	22	4307	c.4207A>G	c.(4207-4209)Agg>Ggg	p.R1403G	PXDNL_ENST00000543296.1_3'UTR|RP11-401H2.1_ENST00000521294.1_RNA	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1403	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCGGCCTTCCTTGGAACCCCT	0.512																																																	0													153.0	166.0	161.0					8																	52233397		1949	4143	6092	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.4207A>G	8.37:g.52233397T>C	ENSP00000348645:p.Arg1403Gly		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.R1403G	ENST00000356297.4	37	c.4207	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	T	11.40	1.628808	0.28978	.	.	ENSG00000147485	ENST00000356297	T	0.72394	-0.65	4.49	1.79	0.24919	von Willebrand factor, type C (3);	.	.	.	.	T	0.78515	0.4295	M	0.72894	2.215	0.09310	N	1	P	0.52316	0.952	P	0.60949	0.881	T	0.64846	-0.6311	9	0.66056	D	0.02	.	8.2279	0.31579	0.0:0.0:0.3193:0.6807	.	1403	A1KZ92	PXDNL_HUMAN	G	1403	ENSP00000348645:R1403G	ENSP00000348645:R1403G	R	-	1	2	PXDNL	52395950	0.015000	0.18098	0.038000	0.18304	0.019000	0.09904	0.835000	0.27531	1.656000	0.50722	0.533000	0.62120	AGG	PXDNL	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	ENSG00000147485		0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	-	0.00	57	0	T	NM_144651		52233397	-1	tier1	-	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	54.72	24	29	SNP	0.012	C
RALGAPB	57148	genome.wustl.edu	37	20	37121752	37121752	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:37121752C>T	ENST00000262879.6	+	3	650	c.366C>T	c.(364-366)caC>caT	p.H122H	RALGAPB_ENST00000397038.1_5'UTR|RALGAPB_ENST00000397040.1_Silent_p.H122H|RALGAPB_ENST00000397042.3_Silent_p.H122H|RALGAPB_ENST00000537204.1_Silent_p.H122H			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	122					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TACTAAAACACCTACAGAATC	0.338																																																	0													95.0	93.0	94.0					20																	37121752		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.366C>T	20.37:g.37121752C>T			A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Silent	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP_dom	p.H122	ENST00000262879.6	37	c.366	CCDS13305.1	20																																																																																			RALGAPB	-	NULL	ENSG00000170471		0.338	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	-	0.00	51	0	C	NM_020336		37121752	+1	tier1	-	no_errors	ENST00000262879	ensembl	human	known	74_37	silent	29.07	61	25	SNP	0.998	T
RB1CC1	9821	genome.wustl.edu	37	8	53568895	53568895	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:53568895G>T	ENST00000025008.5	-	15	4017	c.3494C>A	c.(3493-3495)gCa>gAa	p.A1165E	RB1CC1_ENST00000539297.1_Missense_Mutation_p.A1165E|RB1CC1_ENST00000435644.2_Missense_Mutation_p.A1165E|RB1CC1_ENST00000521611.1_Intron	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1165					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TATTTCAAATGCTTGGTTATG	0.279																																					GBM(180;1701 2102 13475 42023 52570)												0													67.0	67.0	67.0					8																	53568895		2203	4298	6501	SO:0001583	missense	0			AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.3494C>A	8.37:g.53568895G>T	ENSP00000025008:p.Ala1165Glu		Q86YR4|Q8WVU9|Q92601	Missense_Mutation	SNP	pfam_Autophagy-rel_p11	p.A1165E	ENST00000025008.5	37	c.3494	CCDS34892.1	8	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282438	0.23392	.	.	ENSG00000023287	ENST00000025008;ENST00000435644;ENST00000539297	T;T;T	0.18174	2.23;2.23;2.23	5.14	5.14	0.70334	.	0.172294	0.49916	D	0.000140	T	0.14570	0.0352	L	0.29908	0.895	0.41007	D	0.984974	P;P	0.46512	0.879;0.808	B;B	0.41988	0.372;0.206	T	0.06752	-1.0809	10	0.09338	T	0.73	-18.3096	18.9627	0.92682	0.0:0.0:1.0:0.0	.	1165;1165	Q8TDY2-2;Q8TDY2	.;RBCC1_HUMAN	E	1165	ENSP00000025008:A1165E;ENSP00000396067:A1165E;ENSP00000445960:A1165E	ENSP00000025008:A1165E	A	-	2	0	RB1CC1	53731448	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.795000	0.55499	2.556000	0.86216	0.650000	0.86243	GCA	RB1CC1	-	NULL	ENSG00000023287		0.279	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RB1CC1	HGNC	protein_coding	OTTHUMT00000378011.1		0.00	41	0	G	NM_014781		53568895	-1			no_errors	ENST00000025008	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114424314	114424314	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:114424314C>A	ENST00000424776.3	+	1	352	c.310C>A	c.(310-312)Cgc>Agc	p.R104S	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	104							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CAGCGGCAGTCGCTCAAGGTT	0.652																																																	0													10.0	12.0	12.0					X																	114424314		691	1588	2279	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.310C>A	X.37:g.114424314C>A	ENSP00000417451:p.Arg104Ser		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R104S	ENST00000424776.3	37	c.310	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	C	8.859	0.946560	0.18356	.	.	ENSG00000175718	ENST00000424776	T	0.74421	-0.84	0.616	-0.371	0.12525	.	.	.	.	.	T	0.56775	0.2008	L	0.27053	0.805	0.09310	N	1	B	0.24920	0.114	B	0.19391	0.025	T	0.48068	-0.9067	8	0.87932	D	0	.	.	.	.	.	104	Q8N7X1	RMXL3_HUMAN	S	104	ENSP00000417451:R104S	ENSP00000417451:R104S	R	+	1	0	RBMXL3	114330570	0.021000	0.18746	0.000000	0.03702	0.000000	0.00434	0.212000	0.17497	-0.246000	0.09611	-0.563000	0.04171	CGC	RBMXL3	-	NULL	ENSG00000175718		0.652	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3		0.00	8	0	C	NM_001145346		114424314	+1			no_errors	ENST00000424776	ensembl	human	known	74_37	missense	50.00	2	2	SNP	0.035	A
RBMY1F	159163	genome.wustl.edu	37	Y	24327013	24327013	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrY:24327013G>T	ENST00000303766.7	-	2	221	c.104C>A	c.(103-105)tCa>tAa	p.S35*	RBMY1F_ENST00000454978.2_Nonsense_Mutation_p.S35*|RBMY1F_ENST00000481858.1_5'UTR	NM_152585.1	NP_689798.1	Q15415	RBY1F_HUMAN	RNA binding motif protein, Y-linked, family 1, member F	35	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)										GTTACCTTCTGATATGGGACC	0.383																																																	0																																										SO:0001587	stop_gained	0			BC030018	CCDS35483.1	Yq11.223	2013-02-12			ENSG00000169800	ENSG00000169800		"""RNA binding motif (RRM) containing"""	23974	protein-coding gene	gene with protein product						12815422	Standard	NM_152585		Approved	MGC33094	uc004fvd.3	Q15415	OTTHUMG00000043593	ENST00000303766.7:c.104C>A	Y.37:g.24327013G>T	ENSP00000307155:p.Ser35*		B2R916	Nonsense_Mutation	SNP	pfam_RBM1CTR,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S35*	ENST00000303766.7	37	c.104	CCDS35483.1	Y																																																																																			RBMY1F	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000169800		0.383	RBMY1F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBMY1F	HGNC	protein_coding	OTTHUMT00000101935.1	-	0.00	31	0	G	NM_152585		24327013	-1	tier1	-	no_errors	ENST00000303766	ensembl	human	known	74_37	nonsense	18.18	18	4	SNP	0.322	T
RELN	5649	genome.wustl.edu	37	7	103322622	103322622	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:103322622A>G	ENST00000428762.1	-	11	1389	c.1230T>C	c.(1228-1230)gaT>gaC	p.D410D	RELN_ENST00000424685.2_Silent_p.D410D|RELN_ENST00000343529.5_Silent_p.D410D	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	410					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CTGTGGAAAGATCTACATCCC	0.433																																					NSCLC(146;835 1944 15585 22231 52158)												0													168.0	153.0	158.0					7																	103322622		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.1230T>C	7.37:g.103322622A>G			A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.D410	ENST00000428762.1	37	c.1230	CCDS47680.1	7																																																																																			RELN	-	NULL	ENSG00000189056		0.433	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	-	0.00	37	0	A	NM_005045		103322622	-1	tier1	-	no_errors	ENST00000424685	ensembl	human	known	74_37	silent	16.88	64	13	SNP	1.000	G
RET	5979	genome.wustl.edu	37	10	43608346	43608346	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:43608346G>T	ENST00000355710.3	+	9	1926	c.1694G>T	c.(1693-1695)tGc>tTc	p.C565F	RET_ENST00000340058.5_Missense_Mutation_p.C565F	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	565					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	ACCAAGACCTGCCCCGACGGC	0.602		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													107.0	79.0	88.0					10																	43608346		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1694G>T	10.37:g.43608346G>T	ENSP00000347942:p.Cys565Phe		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.C565F	ENST00000355710.3	37	c.1694	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	G	18.14	3.558497	0.65538	.	.	ENSG00000165731	ENST00000355710;ENST00000498820;ENST00000340058	D;D;D	0.99841	-3.23;-7.09;-3.03	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.99802	0.9915	M	0.85859	2.78	0.80722	D	1	P;D;D	0.65815	0.956;0.991;0.995	P;P;P	0.62014	0.643;0.87;0.897	D	0.97054	0.9766	10	0.87932	D	0	.	18.8569	0.92255	0.0:0.0:1.0:0.0	.	311;565;565	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	F	565;82;565	ENSP00000347942:C565F;ENSP00000419080:C82F;ENSP00000344798:C565F	ENSP00000344798:C565F	C	+	2	0	RET	42928352	1.000000	0.71417	0.998000	0.56505	0.337000	0.28794	9.187000	0.94912	2.460000	0.83146	0.462000	0.41574	TGC	RET	-	pirsf_Tyr_kinase_Ret_rcpt	ENSG00000165731		0.602	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	-	0.00	44	0	G	NM_020975		43608346	+1	tier1	-	no_errors	ENST00000355710	ensembl	human	known	74_37	missense	10.71	50	6	SNP	1.000	T
RFX5	5993	genome.wustl.edu	37	1	151316714	151316714	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:151316714T>C	ENST00000290524.4	-	8	692	c.514A>G	c.(514-516)Atg>Gtg	p.M172V	RP11-126K1.8_ENST00000422153.1_RNA|RFX5_ENST00000452513.2_Missense_Mutation_p.M132V|RP11-126K1.6_ENST00000455503.1_RNA|RFX5_ENST00000478564.1_5'Flank|RFX5_ENST00000452671.2_Missense_Mutation_p.M172V|RFX5_ENST00000368870.2_Missense_Mutation_p.M172V	NM_000449.3|NM_001025603.1	NP_000440.1|NP_001020774.1	P48382	RFX5_HUMAN	regulatory factor X, 5 (influences HLA class II expression)	172					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	20	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AGGGGTGGCATAGACACCAAG	0.483																																																	0													106.0	100.0	102.0					1																	151316714		2203	4300	6503	SO:0001583	missense	0				CCDS994.1	1q21	2014-09-17			ENSG00000143390	ENSG00000143390			9986	protein-coding gene	gene with protein product		601863				9401005	Standard	XM_005245405		Approved		uc001exw.1	P48382	OTTHUMG00000012495	ENST00000290524.4:c.514A>G	1.37:g.151316714T>C	ENSP00000290524:p.Met172Val		B7Z848|D3DV19|E9PFU4|Q5VWC3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.M172V	ENST00000290524.4	37	c.514	CCDS994.1	1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.291231	0.40494	.	.	ENSG00000143390	ENST00000290524;ENST00000368870;ENST00000436637;ENST00000452671;ENST00000452513;ENST00000392746;ENST00000422595;ENST00000450506	T;T;T;T;T;T;T;D	0.82619	0.22;0.22;-0.69;0.22;0.2;0.23;-0.65;-1.63	5.97	5.97	0.96955	.	0.079988	0.85682	D	0.000000	T	0.81711	0.4880	M	0.75264	2.295	0.49582	D	0.999807	P;P	0.45078	0.493;0.85	B;P	0.47346	0.066;0.544	D	0.84419	0.0570	10	0.56958	D	0.05	-16.1175	12.8526	0.57867	0.0:0.0:0.0:1.0	.	132;172	B7Z848;P48382	.;RFX5_HUMAN	V	172;172;64;172;132;172;172;172	ENSP00000290524:M172V;ENSP00000357864:M172V;ENSP00000390769:M64V;ENSP00000389130:M172V;ENSP00000398388:M132V;ENSP00000376502:M172V;ENSP00000399095:M172V;ENSP00000398666:M172V	ENSP00000290524:M172V	M	-	1	0	RFX5	149583338	1.000000	0.71417	0.950000	0.38849	0.190000	0.23558	4.596000	0.61055	2.288000	0.76882	0.533000	0.62120	ATG	RFX5	-	NULL	ENSG00000143390		0.483	RFX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX5	HGNC	protein_coding	OTTHUMT00000034892.6	-	0.00	35	0	T	NM_000449		151316714	-1	tier1	-	no_errors	ENST00000290524	ensembl	human	known	74_37	missense	64.29	15	27	SNP	0.998	C
RFX6	222546	genome.wustl.edu	37	6	117240321	117240321	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:117240321T>G	ENST00000332958.2	+	11	1060	c.1044T>G	c.(1042-1044)aaT>aaG	p.N348K		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	348					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						ACATAAGAAATTTTGCTAAAA	0.313																																																	0													88.0	89.0	89.0					6																	117240321		2203	4300	6503	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.1044T>G	6.37:g.117240321T>G	ENSP00000332208:p.Asn348Lys		Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.N348K	ENST00000332958.2	37	c.1044	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	T	13.84	2.357404	0.41801	.	.	ENSG00000185002	ENST00000332958	T	0.59083	0.29	6.08	3.74	0.42951	.	0.090781	0.85682	D	0.000000	T	0.19644	0.0472	L	0.32530	0.975	0.49915	D	0.999836	B	0.31318	0.319	B	0.24006	0.05	T	0.06320	-1.0833	10	0.13853	T	0.58	-30.0351	7.7046	0.28642	0.0:0.2417:0.0:0.7583	.	348	Q8HWS3	RFX6_HUMAN	K	348	ENSP00000332208:N348K	ENSP00000332208:N348K	N	+	3	2	RFX6	117347014	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.744000	0.38268	0.554000	0.29061	0.482000	0.46254	AAT	RFX6	-	NULL	ENSG00000185002		0.313	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	-	0.00	65	0	T	NM_173560		117240321	+1	tier1	-	no_errors	ENST00000332958	ensembl	human	known	74_37	missense	12.00	44	6	SNP	1.000	G
RGS7BP	401190	genome.wustl.edu	37	5	63802430	63802430	+	5'UTR	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:63802430T>C	ENST00000334025.2	+	0	305				RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein						G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		ACCAGCGGCTTCGGCTTGGTG	0.697																																																	0													13.0	17.0	15.0					5																	63802430		2166	4243	6409	SO:0001623	5_prime_UTR_variant	0			BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.-22T>C	5.37:g.63802430T>C			B7Z3X1	RNA	SNP	-	NULL	ENST00000334025.2	37	NULL	CCDS34170.1	5																																																																																			RGS7BP	-	-	ENSG00000186479		0.697	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS7BP	HGNC	protein_coding	OTTHUMT00000368464.1	-	0.00	21	0	T	NM_001029875		63802430	+1	tier1	-	no_errors	ENST00000508162	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.993	C
RIMS2	9699	genome.wustl.edu	37	8	104898096	104898096	+	Silent	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:104898096T>G	ENST00000436393.2	+	2	844	c.603T>G	c.(601-603)tcT>tcG	p.S201S	RIMS2_ENST00000507740.1_Silent_p.S231S|RIMS2_ENST00000262231.10_Silent_p.S231S|RIMS2_ENST00000406091.3_Silent_p.S423S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S231S(3)|p.S459S(2)|p.S201S(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCAAGTTCTTATGCACAAA	0.478										HNSCC(12;0.0054)																																							7	Substitution - coding silent(7)	large_intestine(7)											85.0	80.0	81.0					8																	104898096		1935	4137	6072	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.603T>G	8.37:g.104898096T>G			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.S423	ENST00000436393.2	37	c.1269		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	27	0	T	NM_001100117		104898096	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	20.69	23	6	SNP	0.998	G
RIMS2	9699	genome.wustl.edu	37	8	104924382	104924382	+	Silent	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:104924382A>T	ENST00000436393.2	+	4	1369	c.1128A>T	c.(1126-1128)ggA>ggT	p.G376G	RIMS2_ENST00000507740.1_Silent_p.G406G|RIMS2_ENST00000262231.10_Silent_p.G453G|RIMS2_ENST00000406091.3_Silent_p.G598G			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	676					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GAGATTCAGGAGCAATGCTTG	0.373										HNSCC(12;0.0054)																																							0													108.0	106.0	106.0					8																	104924382		1849	4093	5942	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.1128A>T	8.37:g.104924382A>T			B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.G598	ENST00000436393.2	37	c.1794		8																																																																																			RIMS2	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000176406		0.373	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	28	0	A	NM_001100117		104924382	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	silent	15.00	34	6	SNP	1.000	T
CTC-457E21.6	0	genome.wustl.edu	37	19	22784354	22784354	+	RNA	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:22784354A>C	ENST00000599738.1	+	0	0				AC011467.1_ENST00000408863.1_RNA|RN7SL860P_ENST00000473738.2_RNA|CTC-457E21.3_ENST00000600260.1_RNA																							ttctgcgttaagttcggcatc	0.557																																																	0																																												0																															19.37:g.22784354A>C				RNA	SNP	-	NULL	ENST00000599738.1	37	NULL		19																																																																																			RN7SL860P	-	-	ENSG00000240713		0.557	CTC-457E21.6-001	KNOWN	basic|readthrough_transcript	processed_transcript	RN7SL860P	HGNC	processed_transcript	OTTHUMT00000464575.1	-	0.00	32	0	A			22784354	+1	tier1	-	no_errors	ENST00000473738	ensembl	human	known	74_37	rna	32.61	31	15	SNP	0.046	C
RNF17	56163	genome.wustl.edu	37	13	25348977	25348977	+	Missense_Mutation	SNP	A	A	C	rs201698876		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr13:25348977A>C	ENST00000255324.5	+	3	304	c.252A>C	c.(250-252)caA>caC	p.Q84H	RNF17_ENST00000381921.1_Missense_Mutation_p.Q84H|RNF17_ENST00000255326.4_3'UTR|RNF17_ENST00000255325.6_Missense_Mutation_p.Q84H	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	84					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATACTAGACAACGCTACTACC	0.348																																																	0													100.0	97.0	98.0					13																	25348977		2203	4300	6503	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.252A>C	13.37:g.25348977A>C	ENSP00000255324:p.Gln84His		Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.Q84H	ENST00000255324.5	37	c.252	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550408	0.27739	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000255325;ENST00000255326	D;D;D	0.85702	-2.02;-2.02;-2.02	4.49	3.3	0.37823	.	0.142424	0.32563	N	0.005938	D	0.85265	0.5657	L	0.32530	0.975	0.25155	N	0.990396	D;D;D	0.89917	0.976;0.976;1.0	P;P;D	0.69479	0.564;0.459;0.964	T	0.75528	-0.3286	10	0.87932	D	0	.	6.6529	0.22971	0.8915:0.0:0.1085:0.0	.	84;84;84	B7Z7S1;Q9BXT8;Q9BXT8-2	.;RNF17_HUMAN;.	H	84	ENSP00000255324:Q84H;ENSP00000371346:Q84H;ENSP00000255325:Q84H	ENSP00000255324:Q84H	Q	+	3	2	RNF17	24246977	0.751000	0.28327	0.446000	0.26920	0.042000	0.13812	1.159000	0.31749	0.859000	0.35456	0.402000	0.26972	CAA	RNF17	-	NULL	ENSG00000132972		0.348	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	-	0.00	54	0	A	NM_031994		25348977	+1	tier1	-	no_errors	ENST00000255324	ensembl	human	known	74_37	missense	18.18	63	14	SNP	0.818	C
RPLP0P2	113157	genome.wustl.edu	37	11	61405192	61405192	+	RNA	SNP	G	G	A	rs201678804		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:61405192G>A	ENST00000496593.1	+	0	1796					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		aaaaaaaaaagaaaagaaaaa	0.303																																																	0																																												0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405192G>A				RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.303	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1		0.00	34	0	G	NR_002775		61405192	+1			no_errors	ENST00000496593	ensembl	human	known	74_37	rna	15.62	27	5	SNP	0.196	A
RPS4XP5	100271132	genome.wustl.edu	37	2	63870743	63870743	+	RNA	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:63870743G>T	ENST00000449995.1	-	0	179									ribosomal protein S4X pseudogene 5																		GTAGTGGATAGTGTGAACATC	0.398																																																	0																																												0					2p15	2013-09-05		2010-02-04	ENSG00000229920	ENSG00000229920			36670	pseudogene	pseudogene				RPS4P5		19123937	Standard	NG_010143		Approved				OTTHUMG00000152611		2.37:g.63870743G>T				RNA	SNP	-	NULL	ENST00000449995.1	37	NULL		2																																																																																			RPS4XP5	-	-	ENSG00000229920		0.398	RPS4XP5-002	KNOWN	basic	processed_transcript	RPS4XP5	HGNC	pseudogene	OTTHUMT00000327000.1	-	0.00	21	0	G	NG_010143		63870743	-1	tier1	-	no_errors	ENST00000449995	ensembl	human	known	74_37	rna	33.33	16	8	SNP	1.000	T
RYR3	6263	genome.wustl.edu	37	15	33922237	33922237	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:33922237A>C	ENST00000389232.4	+	22	2846	c.2776A>C	c.(2776-2778)Acc>Ccc	p.T926P	RYR3_ENST00000415757.3_Missense_Mutation_p.T926P	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	926	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTCAACTGAAACCTTAAAGTG	0.343																																																	0													78.0	72.0	74.0					15																	33922237		1834	4082	5916	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2776A>C	15.37:g.33922237A>C	ENSP00000373884:p.Thr926Pro		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T926P	ENST00000389232.4	37	c.2776	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339699	0.81911	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.92199	-2.99;-2.99	5.35	5.35	0.76521	Ryanodine receptor Ryr (1);	0.000000	0.85682	D	0.000000	D	0.96796	0.8954	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	D	0.97609	1.0128	10	0.72032	D	0.01	.	15.503	0.75716	1.0:0.0:0.0:0.0	.	926;926	Q15413-2;Q15413	.;RYR3_HUMAN	P	926	ENSP00000373884:T926P;ENSP00000399610:T926P	ENSP00000354735:T926P	T	+	1	0	RYR3	31709529	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.651000	0.91078	2.236000	0.73375	0.528000	0.53228	ACC	RYR3	-	pfam_Ryanodine_rcpt	ENSG00000198838		0.343	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	34	0	A			33922237	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	51.72	14	15	SNP	1.000	C
SALL1	6299	genome.wustl.edu	37	16	51174296	51174296	+	Missense_Mutation	SNP	C	C	T	rs554062425		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr16:51174296C>T	ENST00000251020.4	-	2	1870	c.1837G>A	c.(1837-1839)Gaa>Aaa	p.E613K	SALL1_ENST00000440970.1_Missense_Mutation_p.E516K|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	613					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GTGGACCCTTCGGCTTCCTCT	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16348	0.0		0.0	False		,,,				2504	0.0				GBM(103;1352 1446 1855 4775 8890)												0													28.0	31.0	30.0					16																	51174296		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1837G>A	16.37:g.51174296C>T	ENSP00000251020:p.Glu613Lys		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E613K	ENST00000251020.4	37	c.1837	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017495	0.75161	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07114	3.22;3.22	5.22	5.22	0.72569	.	0.046330	0.85682	D	0.000000	T	0.12050	0.0293	M	0.71581	2.175	0.80722	D	1	P	0.44090	0.826	B	0.31869	0.137	T	0.06499	-1.0823	10	0.66056	D	0.02	.	18.7797	0.91926	0.0:1.0:0.0:0.0	.	613	Q9NSC2	SALL1_HUMAN	K	613;516;577	ENSP00000251020:E613K;ENSP00000407914:E516K	ENSP00000251020:E613K	E	-	1	0	SALL1	49731797	1.000000	0.71417	0.377000	0.26055	0.962000	0.63368	7.802000	0.85969	2.428000	0.82296	0.557000	0.71058	GAA	SALL1	-	NULL	ENSG00000103449		0.622	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	16	0	C	NM_002968		51174296	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	57.69	11	15	SNP	1.000	T
SCAMP3	10067	genome.wustl.edu	37	1	155227351	155227351	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:155227351C>T	ENST00000302631.3	-	6	722	c.615G>A	c.(613-615)tgG>tgA	p.W205*	FAM189B_ENST00000368368.3_5'Flank|FAM189B_ENST00000472550.1_5'Flank|SCAMP3_ENST00000355379.3_Nonsense_Mutation_p.W179*|FAM189B_ENST00000361361.2_5'Flank|FAM189B_ENST00000350210.2_5'Flank|SCAMP3_ENST00000472397.1_5'UTR	NM_005698.3	NP_005689.2	O14828	SCAM3_HUMAN	secretory carrier membrane protein 3	205					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|response to retinoic acid (GO:0032526)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|large_intestine(3)|lung(7)|ovary(4)|urinary_tract(1)	19	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AAAGGAGGACCCAGAGGATAG	0.557																																																	0													75.0	76.0	76.0					1																	155227351		2203	4300	6503	SO:0001587	stop_gained	0			AF005039	CCDS1105.1, CCDS1106.1	1q21	2013-02-21			ENSG00000116521	ENSG00000116521		"""Secretory carrier membrane proteins"""	10565	protein-coding gene	gene with protein product	"""Propin 1"""	606913		C1orf3		9331372, 9658162	Standard	NM_005698		Approved		uc001fjs.3	O14828	OTTHUMG00000035874	ENST00000302631.3:c.615G>A	1.37:g.155227351C>T	ENSP00000307275:p.Trp205*		A9Z1W6|B1AVS6|O15128|Q96FR8|Q9BPY0	Nonsense_Mutation	SNP	pfam_SCAMP	p.W205*	ENST00000302631.3	37	c.615	CCDS1105.1	1	.	.	.	.	.	.	.	.	.	.	.	25.2	4.613168	0.87359	.	.	ENSG00000116521	ENST00000302631;ENST00000355379	.	.	.	4.92	3.98	0.46160	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.7119	13.8313	0.63382	0.0:0.8455:0.1545:0.0	.	.	.	.	X	205;179	.	ENSP00000307275:W205X	W	-	3	0	SCAMP3	153493975	1.000000	0.71417	0.959000	0.39883	0.927000	0.56198	7.651000	0.83577	1.236000	0.43740	0.561000	0.74099	TGG	SCAMP3	-	pfam_SCAMP	ENSG00000116521		0.557	SCAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAMP3	HGNC	protein_coding	OTTHUMT00000087399.1	-	0.00	55	0	C	NM_005698		155227351	-1	tier1	-	no_errors	ENST00000302631	ensembl	human	known	74_37	nonsense	65.45	19	36	SNP	1.000	T
ZBED9	114821	genome.wustl.edu	37	6	28541180	28541180	+	Missense_Mutation	SNP	G	G	A	rs142639079		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:28541180G>A	ENST00000452236.2	-	4	3103	c.2486C>T	c.(2485-2487)cCg>cTg	p.P829L	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.P829L(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						cttggcaaccggaagtgctac	0.403																																																	1	Substitution - Missense(1)	central_nervous_system(1)						G	LEU/PRO	0,4406		0,0,2203	135.0	129.0	131.0		2486	2.3	0.9	6	dbSNP_134	131	1,8599	1.2+/-3.3	0,1,4299	no	missense	SCAND3	NM_052923.1	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	829/1326	28541180	1,13005	2203	4300	6503	SO:0001583	missense	0																														ENST00000452236.2:c.2486C>T	6.37:g.28541180G>A	ENSP00000395259:p.Pro829Leu			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.P829L	ENST00000452236.2	37	c.2486	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	G	11.79	1.744465	0.30865	0.0	1.16E-4	ENSG00000232040	ENST00000452236	T	0.01221	5.15	2.27	2.27	0.28462	.	0.849511	0.09671	N	0.771044	T	0.00784	0.0026	N	0.02751	-0.505	0.38694	D	0.952832	D	0.89917	1.0	D	0.81914	0.995	T	0.70494	-0.4856	10	0.17369	T	0.5	.	8.144	0.31100	0.0:0.0:1.0:0.0	.	829	Q6R2W3	SCND3_HUMAN	L	829	ENSP00000395259:P829L	ENSP00000395259:P829L	P	-	2	0	SCAND3	28649159	0.922000	0.31269	0.888000	0.34837	0.921000	0.55340	2.268000	0.43338	1.581000	0.49865	0.655000	0.94253	CCG	SCAND3	-	NULL	ENSG00000232040		0.403	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	-	0.00	68	0	G			28541180	-1	tier1	rs142639079	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	33.85	43	22	SNP	0.905	A
SCG3	29106	genome.wustl.edu	37	15	51975284	51975284	+	Silent	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:51975284A>G	ENST00000220478.3	+	3	547	c.144A>G	c.(142-144)gaA>gaG	p.E48E	SCG3_ENST00000542355.2_5'UTR	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	48					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		AGATTGCTGAAGCAGAAGAAG	0.323																																																	0													70.0	78.0	75.0					15																	51975284		2195	4293	6488	SO:0001819	synonymous_variant	0			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.144A>G	15.37:g.51975284A>G			A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Silent	SNP	NULL	p.E48	ENST00000220478.3	37	c.144	CCDS10142.1	15																																																																																			SCG3	-	NULL	ENSG00000104112		0.323	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG3	HGNC	protein_coding	OTTHUMT00000254670.2	-	0.00	50	0	A	NM_013243		51975284	+1	tier1	-	no_errors	ENST00000220478	ensembl	human	known	74_37	silent	58.33	20	28	SNP	1.000	G
SCIN	85477	genome.wustl.edu	37	7	12668813	12668813	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:12668813T>G	ENST00000297029.5	+	9	1386	c.1285T>G	c.(1285-1287)Tac>Gac	p.Y429D	SCIN_ENST00000519209.1_Missense_Mutation_p.Y182D|SCIN_ENST00000445618.2_Missense_Mutation_p.Y182D	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin	429	Ca(2+)-dependent actin binding.				actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CATCATACTCTACACCTATCC	0.418																																																	0													162.0	154.0	157.0					7																	12668813		1902	4128	6030	SO:0001583	missense	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.1285T>G	7.37:g.12668813T>G	ENSP00000297029:p.Tyr429Asp		A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Missense_Mutation	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.Y429D	ENST00000297029.5	37	c.1285	CCDS47545.1	7	.	.	.	.	.	.	.	.	.	.	T	21.0	4.089681	0.76756	.	.	ENSG00000006747	ENST00000297029;ENST00000519209;ENST00000445618	T;T;T	0.33865	1.39;1.39;1.39	5.1	5.1	0.69264	Gelsolin domain (1);	0.062472	0.64402	D	0.000003	T	0.67088	0.2856	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75560	-0.3275	10	0.87932	D	0	-13.919	15.1772	0.72924	0.0:0.0:0.0:1.0	.	429	Q9Y6U3	ADSV_HUMAN	D	429;182;182	ENSP00000297029:Y429D;ENSP00000430997:Y182D;ENSP00000390189:Y182D	ENSP00000297029:Y429D	Y	+	1	0	SCIN	12635338	1.000000	0.71417	0.997000	0.53966	0.721000	0.41392	7.655000	0.83696	2.037000	0.60232	0.379000	0.24179	TAC	SCIN	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	ENSG00000006747		0.418	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	HGNC	protein_coding	OTTHUMT00000326041.1	-	0.00	26	0	T	NM_033128		12668813	+1	tier1	-	no_errors	ENST00000297029	ensembl	human	known	74_37	missense	46.81	25	22	SNP	0.998	G
SCN9A	6335	genome.wustl.edu	37	2	167085273	167085273	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:167085273T>G	ENST00000409435.1	-	21	4133	c.4134A>C	c.(4132-4134)caA>caC	p.Q1378H	SCN9A_ENST00000375387.4_Missense_Mutation_p.Q1379H|SCN9A_ENST00000409672.1_Missense_Mutation_p.Q1367H|SCN9A_ENST00000303354.6_Missense_Mutation_p.Q1379H|AC010127.3_ENST00000447809.2_RNA			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	1378					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATCGCACATTTTGACTAACAT	0.413																																																	0													212.0	210.0	210.0					2																	167085273		1916	4155	6071	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.4134A>C	2.37:g.167085273T>G	ENSP00000386330:p.Gln1378His		A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.Q1379H	ENST00000409435.1	37	c.4137	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	T	12.10	1.835970	0.32421	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38	5.23	-8.19	0.01049	.	1.221540	0.05763	N	0.605217	D	0.91294	0.7255	N	0.25789	0.76	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.81477	-0.0915	10	0.54805	T	0.06	.	5.0496	0.14501	0.3762:0.2686:0.0:0.3552	.	1367	E7EUN6	.	H	1367;1379;1379;1378	ENSP00000386306:Q1367H;ENSP00000364536:Q1379H;ENSP00000304748:Q1379H;ENSP00000386330:Q1378H	ENSP00000304748:Q1379H	Q	-	3	2	SCN9A	166793519	0.000000	0.05858	0.008000	0.14137	0.969000	0.65631	-2.106000	0.01338	-1.042000	0.03262	-0.410000	0.06199	CAA	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.413	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	-	0.00	59	0	T	NM_002977		167085273	-1	tier1	-	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	16.90	59	12	SNP	0.000	G
SCN7A	6332	genome.wustl.edu	37	2	167327161	167327161	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:167327161T>G	ENST00000409855.1	-	6	754	c.628A>C	c.(628-630)Act>Cct	p.T210P		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	210					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	ATTCTCAAAGTTCTTGCAGTT	0.299																																																	0													37.0	38.0	38.0					2																	167327161		1802	4060	5862	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.628A>C	2.37:g.167327161T>G	ENSP00000386796:p.Thr210Pro			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.T210P	ENST00000409855.1	37	c.628	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	T	26.3	4.720646	0.89205	.	.	ENSG00000136546	ENST00000409855;ENST00000259060;ENST00000419992;ENST00000441411	D;D;D	0.98617	-5.03;-5.03;-5.03	4.62	2.28	0.28536	Ion transport (1);	0.478571	0.19535	N	0.111945	D	0.97281	0.9111	L	0.40543	1.245	0.26372	N	0.97687	P	0.50819	0.939	P	0.54815	0.761	D	0.93276	0.6656	10	0.87932	D	0	.	5.1517	0.15013	0.0:0.3623:0.0:0.6376	.	210	Q01118	SCN7A_HUMAN	P	210	ENSP00000386796:T210P;ENSP00000413699:T210P;ENSP00000403846:T210P	ENSP00000259060:T210P	T	-	1	0	SCN7A	167035407	1.000000	0.71417	0.926000	0.36857	0.903000	0.53119	4.116000	0.57871	0.905000	0.36596	0.460000	0.39030	ACT	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.299	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	-	0.00	46	0	T			167327161	-1	tier1	-	no_errors	ENST00000409855	ensembl	human	known	74_37	missense	15.79	48	9	SNP	0.763	G
SDR16C6P	442388	genome.wustl.edu	37	8	57287365	57287365	+	RNA	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:57287365C>T	ENST00000517787.1	-	0	445					NR_103832.1				short chain dehydrogenase/reductase family 16C, member 6, pseudogene																		TTTTTGGCCACATACTCCTGC	0.318																																																	0													90.0	79.0	82.0					8																	57287365		692	1588	2280			0					8q12.1	2011-09-20	2010-12-20	2010-12-20	ENSG00000253542	ENSG00000253542		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	35413	pseudogene	pseudogene			"""short chain dehydrogenase/reductase family 16C, member 6"""	SDR16C6		19027726	Standard	NR_103832		Approved				OTTHUMG00000164408		8.37:g.57287365C>T				RNA	SNP	-	NULL	ENST00000517787.1	37	NULL		8																																																																																			SDR16C6P	-	-	ENSG00000253542		0.318	SDR16C6P-001	KNOWN	basic	processed_transcript	SDR16C6P	HGNC	pseudogene	OTTHUMT00000378641.3	-	0.00	55	0	C			57287365	-1	tier1	-	no_errors	ENST00000517787	ensembl	human	known	74_37	rna	49.02	26	25	SNP	0.874	T
SEC31B	25956	genome.wustl.edu	37	10	102255158	102255158	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:102255158G>T	ENST00000370345.3	-	19	2553	c.2456C>A	c.(2455-2457)tCc>tAc	p.S819Y	SEC31B_ENST00000494350.1_5'Flank	NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	819					protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		AGAAGGCTGGGATCCCAATCT	0.478																																																	0													64.0	56.0	59.0					10																	102255158		2203	4300	6503	SO:0001583	missense	0			AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2456C>A	10.37:g.102255158G>T	ENSP00000359370:p.Ser819Tyr		B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S819Y	ENST00000370345.3	37	c.2456	CCDS7495.1	10	.	.	.	.	.	.	.	.	.	.	G	13.16	2.155678	0.38021	.	.	ENSG00000075826	ENST00000370345	T	0.52057	0.68	5.94	1.24	0.21308	.	1.186920	0.05558	N	0.568684	T	0.25306	0.0615	N	0.08118	0	0.09310	N	1	P;B	0.36199	0.543;0.068	B;B	0.36378	0.223;0.025	T	0.14615	-1.0466	10	0.12766	T	0.61	0.0021	5.4179	0.16384	0.6211:0.1538:0.2251:0.0	.	818;819	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	Y	819	ENSP00000359370:S819Y	ENSP00000359370:S819Y	S	-	2	0	SEC31B	102245148	0.027000	0.19231	0.007000	0.13788	0.971000	0.66376	0.325000	0.19628	-0.011000	0.14247	0.561000	0.74099	TCC	SEC31B	-	NULL	ENSG00000075826		0.478	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC31B	HGNC	protein_coding	OTTHUMT00000051198.1		0.00	35	0	G	NM_015490		102255158	-1			no_errors	ENST00000370345	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.004	T
SEH1L	81929	genome.wustl.edu	37	18	12955489	12955489	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:12955489A>C	ENST00000262124.11	+	3	317	c.190A>C	c.(190-192)Aca>Cca	p.T64P	SEH1L_ENST00000399892.2_Missense_Mutation_p.T64P	NM_031216.3	NP_112493.2	Q96EE3	SEH1_HUMAN	SEH1-like (S. cerevisiae)	64					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|carbohydrate metabolic process (GO:0005975)|cytokine production involved in inflammatory response (GO:0002534)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-positive bacterium (GO:0050830)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore organization (GO:0006999)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	11						ATGGCGTGTGACATGGGCCCA	0.398																																																	0													179.0	158.0	165.0					18																	12955489		2203	4300	6503	SO:0001583	missense	0			BC012430	CCDS32791.1, CCDS45832.1	18p11.21	2013-01-10				ENSG00000085415		"""WD repeat domain containing"""	30379	protein-coding gene	gene with protein product	"""sec13 like protein"", ""nucleoporin Seh1"""	609263				12196509, 14517296	Standard	XM_005258152		Approved	SEH1A, SEH1B, Seh1, SEC13L	uc002krq.3	Q96EE3		ENST00000262124.11:c.190A>C	18.37:g.12955489A>C	ENSP00000262124:p.Thr64Pro		A8K5B1|Q8NFU6|Q96MH3|Q9C069	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T64P	ENST00000262124.11	37	c.190	CCDS45832.1	18	.	.	.	.	.	.	.	.	.	.	A	27.1	4.801517	0.90538	.	.	ENSG00000085415	ENST00000399892;ENST00000262124	T;T	0.60672	0.17;0.17	5.6	5.6	0.85130	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.72366	0.3451	L	0.60904	1.88	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.71184	0.972;0.964	T	0.74922	-0.3499	10	0.66056	D	0.02	-16.5674	15.7802	0.78255	1.0:0.0:0.0:0.0	.	64;64	Q96EE3;Q96EE3-1	SEH1_HUMAN;.	P	64	ENSP00000382779:T64P;ENSP00000262124:T64P	ENSP00000262124:T64P	T	+	1	0	SEH1L	12945489	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.876000	0.92379	2.125000	0.65367	0.482000	0.46254	ACA	SEH1L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000085415		0.398	SEH1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEH1L	HGNC	protein_coding	OTTHUMT00000458254.1	-	0.00	61	0	A	NM_031216		12955489	+1	tier1	-	no_errors	ENST00000399892	ensembl	human	known	74_37	missense	44.57	51	41	SNP	1.000	C
SEMA3F	6405	genome.wustl.edu	37	3	50220414	50220414	+	Silent	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:50220414G>A	ENST00000002829.3	+	10	1465	c.981G>A	c.(979-981)ccG>ccA	p.P327P	SEMA3F_ENST00000413852.1_Silent_p.P228P|SEMA3F_ENST00000434342.1_Silent_p.P296P	NM_004186.3	NP_004177.3	Q13275	SEM3F_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F	327	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|negative regulation of axon extension involved in axon guidance (GO:0048843)|nerve development (GO:0021675)|neural crest cell migration (GO:0001755)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	extracellular space (GO:0005615)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|receptor activity (GO:0004872)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	17				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		GCTCTGTCCCGGGCGAGGATG	0.622																																																	0													59.0	58.0	58.0					3																	50220414		2203	4300	6503	SO:0001819	synonymous_variant	0			U33920	CCDS2811.1	3p21.3	2013-01-11			ENSG00000001617	ENSG00000001617		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10728	protein-coding gene	gene with protein product	"""sema IV"""	601124				8786119, 8649831	Standard	NM_004186		Approved	SEMAK, Sema4	uc003cyj.3	Q13275	OTTHUMG00000156806	ENST00000002829.3:c.981G>A	3.37:g.50220414G>A			C9JQ85|Q13274|Q13372|Q15704|Q6GTR4	Silent	SNP	pfam_Semap_dom,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.P327	ENST00000002829.3	37	c.981	CCDS2811.1	3																																																																																			SEMA3F	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000001617		0.622	SEMA3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3F	HGNC	protein_coding	OTTHUMT00000345929.1	-	0.00	62	0	G	NM_004186		50220414	+1	tier1	-	no_errors	ENST00000002829	ensembl	human	known	74_37	silent	26.83	30	11	SNP	0.043	A
SERPINB6	5269	genome.wustl.edu	37	6	2948893	2948893	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:2948893G>A	ENST00000380520.1	-	6	2764	c.770C>T	c.(769-771)aCg>aTg	p.T257M	SERPINB6_ENST00000380546.3_Missense_Mutation_p.T257M|SERPINB6_ENST00000335686.5_Missense_Mutation_p.T257M|SERPINB6_ENST00000380529.1_Missense_Mutation_p.T257M|SERPINB6_ENST00000380524.1_Missense_Mutation_p.T257M|SERPINB6_ENST00000380539.1_Missense_Mutation_p.T257M			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	257					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	GTCCAGCCTCGTCCATTCTAC	0.542																																																	0													222.0	218.0	220.0					6																	2948893		2203	4300	6503	SO:0001583	missense	0			Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.770C>T	6.37:g.2948893G>A	ENSP00000369891:p.Thr257Met		B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.T257M	ENST00000380520.1	37	c.770	CCDS4479.1	6	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241150	0.58995	.	.	ENSG00000124570	ENST00000380524;ENST00000380520;ENST00000335686;ENST00000380529;ENST00000380539;ENST00000380546	D;D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91;-1.91	4.88	4.0	0.46444	Serpin domain (3);	0.185865	0.56097	D	0.000030	D	0.88145	0.6358	L	0.60904	1.88	0.54753	D	0.999985	D	0.89917	1.0	D	0.87578	0.998	D	0.89720	0.3918	10	0.72032	D	0.01	.	14.1101	0.65115	0.0:0.0:0.848:0.152	.	257	P35237	SPB6_HUMAN	M	257	ENSP00000369896:T257M;ENSP00000369891:T257M;ENSP00000338358:T257M;ENSP00000369901:T257M;ENSP00000369912:T257M;ENSP00000369919:T257M	ENSP00000338358:T257M	T	-	2	0	SERPINB6	2893892	1.000000	0.71417	0.826000	0.32828	0.282000	0.26991	3.240000	0.51368	1.378000	0.46305	0.456000	0.33151	ACG	SERPINB6	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000124570		0.542	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB6	HGNC	protein_coding	OTTHUMT00000043422.1	-	0.00	61	0	G			2948893	-1	tier1	-	no_errors	ENST00000335686	ensembl	human	known	74_37	missense	32.26	42	20	SNP	0.998	A
SETBP1	26040	genome.wustl.edu	37	18	42618501	42618501	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr18:42618501A>C	ENST00000282030.5	+	5	4348	c.4052A>C	c.(4051-4053)aAc>aCc	p.N1351T		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1351						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CATAGTAAGAACGAAGGCTCA	0.483									Schinzel-Giedion syndrome																																								0													190.0	151.0	164.0					18																	42618501		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4052A>C	18.37:g.42618501A>C	ENSP00000282030:p.Asn1351Thr		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.N1351T	ENST00000282030.5	37	c.4052	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	A	10.71	1.427955	0.25726	.	.	ENSG00000152217	ENST00000282030	T	0.68479	-0.33	5.84	0.16	0.14972	.	0.486041	0.23714	N	0.045292	T	0.44222	0.1283	N	0.19112	0.55	0.24306	N	0.995104	B	0.17038	0.02	B	0.21360	0.034	T	0.20075	-1.0286	10	0.26408	T	0.33	.	6.3652	0.21451	0.4545:0.0:0.4142:0.1313	.	1351	Q9Y6X0	SETBP_HUMAN	T	1351	ENSP00000282030:N1351T	ENSP00000282030:N1351T	N	+	2	0	SETBP1	40872499	0.001000	0.12720	0.995000	0.50966	0.381000	0.30169	-0.300000	0.08243	-0.179000	0.10654	0.528000	0.53228	AAC	SETBP1	-	NULL	ENSG00000152217		0.483	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4	-	0.00	73	0	A	NM_001130110		42618501	+1	tier1	-	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	34.62	34	18	SNP	0.985	C
SFI1	9814	genome.wustl.edu	37	22	32009640	32009641	+	Frame_Shift_Del	DEL	AG	AG	-	rs553539195	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr22:32009640_32009641delAG	ENST00000400288.2	+	27	2900_2901	c.2795_2796delAG	c.(2794-2796)cagfs	p.Q932fs	SFI1_ENST00000540643.1_Frame_Shift_Del_p.Q877fs|SFI1_ENST00000414585.1_Frame_Shift_Del_p.Q779fs|SFI1_ENST00000443011.1_Frame_Shift_Del_p.Q779fs|SFI1_ENST00000400289.1_Frame_Shift_Del_p.Q850fs|SFI1_ENST00000443326.1_Frame_Shift_Del_p.Q850fs|SFI1_ENST00000432498.1_Frame_Shift_Del_p.Q901fs	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	932					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						CTCTGGAAACAGAAAGTGCTGG	0.644														3	0.000599042	0.0008	0.0	5008	,	,		18601	0.0		0.0	False		,,,				2504	0.002																0									,	6,3894		3,0,1947					,	1.7	0.9			20	11,7977		3,5,3986	no	frameshift,frameshift	SFI1	NM_014775.2,NM_001007467.1	,	6,5,5933	A1A1,A1R,RR		0.1377,0.1538,0.143	,	,		17,11871				SO:0001589	frameshift_variant	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.2795_2796delAG	22.37:g.32009640_32009641delAG	ENSP00000383145:p.Gln932fs		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Frame_Shift_Del	DEL	superfamily_Cyclin-like	p.K933fs	ENST00000400288.2	37	c.2795_2796	CCDS43004.1	22																																																																																			SFI1	-	NULL	ENSG00000198089		0.644	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3		0.00	157	0	AG	NM_014775		32009641	+1	tier1		no_errors	ENST00000400288	ensembl	human	known	74_37	frame_shift_del	47.57	54	49	DEL	1.000:1.000	-
SGCD	6444	genome.wustl.edu	37	5	155771519	155771519	+	Silent	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:155771519T>A	ENST00000435422.3	+	2	508	c.21T>A	c.(19-21)acT>acA	p.T7T	SGCD_ENST00000517913.1_Silent_p.T8T|SGCD_ENST00000337851.4_Silent_p.T8T|SGCD_ENST00000447401.1_Silent_p.T8T	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	7					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AGCAGTACACTCACCACCGGA	0.473																																																	0													109.0	109.0	109.0					5																	155771519		1952	4160	6112	SO:0001819	synonymous_variant	0			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.21T>A	5.37:g.155771519T>A			A8K9S9|Q53XA5|Q99644	Silent	SNP	pfam_Sarcoglycan	p.T8	ENST00000435422.3	37	c.24	CCDS47327.1	5																																																																																			SGCD	-	NULL	ENSG00000170624		0.473	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3	-	0.00	98	0	T			155771519	+1	tier1	-	no_errors	ENST00000337851	ensembl	human	known	74_37	silent	12.35	71	10	SNP	0.803	A
SGCD	6444	genome.wustl.edu	37	5	156016259	156016259	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:156016259A>C	ENST00000435422.3	+	4	797	c.310A>C	c.(310-312)Aag>Cag	p.K104Q	SGCD_ENST00000517913.1_Missense_Mutation_p.K105Q|SGCD_ENST00000337851.4_Missense_Mutation_p.K105Q|SGCD_ENST00000447401.1_Missense_Mutation_p.K105Q	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	104					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCTGTACTTCAAGTCTGCCAG	0.378																																																	0													72.0	63.0	66.0					5																	156016259		1855	4093	5948	SO:0001583	missense	0			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.310A>C	5.37:g.156016259A>C	ENSP00000403003:p.Lys104Gln		A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	pfam_Sarcoglycan	p.K105Q	ENST00000435422.3	37	c.313	CCDS47327.1	5	.	.	.	.	.	.	.	.	.	.	A	3.562	-0.089518	0.07053	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.94280	-3.39;-3.39;-3.39;-3.39	4.67	4.67	0.58626	.	0.115913	0.64402	D	0.000017	T	0.67970	0.2950	N	0.00068	-2.285	0.32008	N	0.602453	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.002;0.001;0.003	T	0.69518	-0.5124	10	0.05959	T	0.93	-0.9131	10.132	0.42685	0.675:0.325:0.0:0.0	.	104;105;105	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	Q	105;104;105;105	ENSP00000429378:K105Q;ENSP00000403003:K104Q;ENSP00000338343:K105Q;ENSP00000408324:K105Q	ENSP00000338343:K105Q	K	+	1	0	SGCD	155948837	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.556000	0.60775	1.749000	0.51849	0.459000	0.35465	AAG	SGCD	-	pfam_Sarcoglycan	ENSG00000170624		0.378	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3	-	0.00	62	0	A			156016259	+1	tier1	-	no_errors	ENST00000337851	ensembl	human	known	74_37	missense	18.31	58	13	SNP	1.000	C
C7orf76	401388	genome.wustl.edu	37	7	96113146	96113146	+	3'UTR	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:96113146T>G	ENST00000356686.1	-	0	498				SHFM1_ENST00000493858.1_5'UTR	NM_001201450.1	NP_001188379.1	Q6ZVN7	CG076_HUMAN	chromosome 7 open reading frame 76																		ATGACCAGACTTCCATCTCTG	0.468																																																	0													36.0	32.0	34.0					7																	96113146		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AK124274	CCDS75638.1	7q21.3	2012-12-12			ENSG00000197851				33815	protein-coding gene	gene with protein product							Standard	NM_001201450		Approved	FLJ42280	uc003uoh.1	Q6ZVN7		ENST00000356686.1:c.*25A>C	7.37:g.96113146T>G				RNA	SNP	-	NULL	ENST00000356686.1	37	NULL	CCDS56495.1	7																																																																																			SHFM1	-	-	ENSG00000127922		0.468	C7orf76-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SHFM1	HGNC	protein_coding		-	0.00	51	0	T	NM_001201450		96113146	-1	tier1	-	no_errors	ENST00000493858	ensembl	human	known	74_37	rna	22.09	67	19	SNP	0.001	G
SI	6476	genome.wustl.edu	37	3	164710181	164710181	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:164710181A>T	ENST00000264382.3	-	42	4908	c.4846T>A	c.(4846-4848)Ttt>Att	p.F1616I		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1616	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTTTCATCAAAGAACCTCGAC	0.318										HNSCC(35;0.089)																																							0													38.0	39.0	38.0					3																	164710181		2203	4299	6502	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4846T>A	3.37:g.164710181A>T	ENSP00000264382:p.Phe1616Ile		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.F1616I	ENST00000264382.3	37	c.4846	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	4.956	0.177673	0.09443	.	.	ENSG00000090402	ENST00000264382	D	0.91180	-2.8	4.88	4.88	0.63580	.	0.638987	0.16906	N	0.194705	T	0.79405	0.4440	N	0.25144	0.715	0.21105	N	0.999783	B	0.12630	0.006	B	0.15870	0.014	T	0.60994	-0.7152	10	0.15066	T	0.55	.	2.1835	0.03880	0.5934:0.164:0.0855:0.1571	.	1616	P14410	SUIS_HUMAN	I	1616	ENSP00000264382:F1616I	ENSP00000264382:F1616I	F	-	1	0	SI	166192875	0.926000	0.31397	0.882000	0.34594	0.646000	0.38490	1.090000	0.30902	2.169000	0.68431	0.528000	0.53228	TTT	SI	-	pfam_Glyco_hydro_31	ENSG00000090402		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	32	0	A	NM_001041		164710181	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.290	T
SLC22A18	5002	genome.wustl.edu	37	11	2924611	2924611	+	Silent	SNP	G	G	A	rs533027622		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:2924611G>A	ENST00000380574.1	+	2	467	c.36G>A	c.(34-36)cgG>cgA	p.R12R	SLC22A18_ENST00000312221.5_Silent_p.R12R|SLC22A18_ENST00000347936.2_Silent_p.R12R|SLC22A18AS_ENST00000533594.1_Intron|SLC22A18AS_ENST00000455942.2_Intron|SLC22A18_ENST00000449793.2_Silent_p.R12R			Q96BI1	S22AI_HUMAN	solute carrier family 22, member 18	12			R -> Q (in dbSNP:rs1048047). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9520460, ECO:0000269|PubMed:9570947, ECO:0000269|Ref.6}.		drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|excretion (GO:0007588)|organic cation transport (GO:0015695)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|symporter activity (GO:0015293)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.00256)|LUSC - Lung squamous cell carcinoma(625;0.192)		ACCAGGGCCGGTCCCCCGGCA	0.657													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17081	0.0		0.0	False		,,,				2504	0.0																0													58.0	58.0	58.0					11																	2924611		2202	4299	6501	SO:0001819	synonymous_variant	0			AF028738	CCDS7740.1	11p15.5	2013-05-22	2008-01-11	2004-01-21	ENSG00000110628	ENSG00000110628		"""Solute carriers"""	10964	protein-coding gene	gene with protein product		602631	"""solute carrier family 22 (organic cation transporter), member 1-like"""	ORCTL2, BWSCR1A, IMPT1, SLC22A1L		9499412, 9520460	Standard	NM_183233		Approved	BWR1A, TSSC5, ITM	uc001lwx.3	Q96BI1	OTTHUMG00000010037	ENST00000380574.1:c.36G>A	11.37:g.2924611G>A			O14906|O43562|O60485|O60680|Q7LDS5|Q7LGF7	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Tet-R_TetA/multi-R_MdtG	p.R12	ENST00000380574.1	37	c.36	CCDS7740.1	11																																																																																			SLC22A18	-	NULL	ENSG00000110628		0.657	SLC22A18-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC22A18	HGNC	protein_coding	OTTHUMT00000027770.1	-	0.00	39	0	G	NM_183233		2924611	+1	tier1	-	no_errors	ENST00000312221	ensembl	human	known	74_37	silent	31.15	42	19	SNP	0.002	A
SLC25A26	115286	genome.wustl.edu	37	3	66419918	66419918	+	Silent	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:66419918A>C	ENST00000413054.1	+	6	395	c.321A>C	c.(319-321)gcA>gcC	p.A107A	SLC25A26_ENST00000484768.1_3'UTR|SLC25A26_ENST00000536651.1_3'UTR|SLC25A26_ENST00000354883.6_Silent_p.A195A|SLC25A26_ENST00000336733.6_Silent_p.A107A			Q70HW3	SAMC_HUMAN	solute carrier family 25 (S-adenosylmethionine carrier), member 26	195					S-adenosyl-L-methionine transmembrane transport (GO:1901962)|S-adenosyl-L-methionine transport (GO:0015805)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	S-adenosyl-L-methionine transmembrane transporter activity (GO:0000095)			endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)|stomach(2)|urinary_tract(1)	8		Lung NSC(201;0.00774)		BRCA - Breast invasive adenocarcinoma(55;0.00046)|KIRC - Kidney renal clear cell carcinoma(15;0.0515)|Kidney(15;0.0648)		TTGCCGCTGCAGTCACCACCC	0.408																																																	0													98.0	90.0	93.0					3																	66419918		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ580932	CCDS54604.1, CCDS2905.2	3p14.2	2013-05-22	2012-03-29		ENSG00000144741	ENSG00000144741		"""Solute carriers"""	20661	protein-coding gene	gene with protein product		611037	"""solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26"""			14674884	Standard	NM_173471		Approved		uc011bfq.2	Q70HW3	OTTHUMG00000149917	ENST00000413054.1:c.321A>C	3.37:g.66419918A>C			A8K758|B3KRZ7|Q7Z786|Q96E68	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.A195	ENST00000413054.1	37	c.585		3	.	.	.	.	.	.	.	.	.	.	A	3.237	-0.156092	0.06544	.	.	ENSG00000144741	ENST00000413054	.	.	.	4.85	-6.07	0.02158	.	.	.	.	.	T	0.27559	0.0677	.	.	.	0.33442	D	0.582564	.	.	.	.	.	.	T	0.33369	-0.9871	4	.	.	.	-25.5346	1.5462	0.02566	0.3142:0.1185:0.3378:0.2295	.	.	.	.	P	132	.	.	Q	+	2	0	SLC25A26	66502608	0.001000	0.12720	0.164000	0.22755	0.389000	0.30415	-0.430000	0.06973	-1.417000	0.02017	-0.313000	0.08912	CAG	SLC25A26	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000144741		0.408	SLC25A26-002	PUTATIVE	basic|exp_conf	protein_coding	SLC25A26	HGNC	protein_coding	OTTHUMT00000313895.2	-	0.00	70	0	A	NM_173471		66419918	+1	tier1	-	no_errors	ENST00000354883	ensembl	human	known	74_37	silent	40.54	22	15	SNP	0.053	C
SLC25A3P1	163742	genome.wustl.edu	37	1	53905508	53905508	+	RNA	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:53905508T>A	ENST00000566100.1	-	0	0									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		GGCTGCCTAATCCTCTACAAA	0.552																																																	0																																												0					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53905508T>A				RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-	ENSG00000236253		0.552	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	-	0.00	16	0	T	NM_178501		53905508	-1	tier1	-	no_errors	ENST00000563752	ensembl	human	known	74_37	rna	24.24	25	8	SNP	0.020	A
SLC26A3	1811	genome.wustl.edu	37	7	107423731	107423731	+	Silent	SNP	G	G	A	rs373747349|rs386833445		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:107423731G>A	ENST00000340010.5	-	9	1222	c.1038C>T	c.(1036-1038)atC>atT	p.I346I	SLC26A3_ENST00000422236.2_Silent_p.I311I	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	346			FGIAMV -> DA (in DIAR1). {ECO:0000269|PubMed:21394828}.		anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						CAACCATTGCGATGCCGAAGC	0.433																																																	0								G		0,4406		0,0,2203	97.0	94.0	95.0		1038	0.8	0.9	7		95	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC26A3	NM_000111.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		346/765	107423731	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.1038C>T	7.37:g.107423731G>A				Silent	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.I346	ENST00000340010.5	37	c.1038	CCDS5748.1	7																																																																																			SLC26A3	-	pfam_Sulph_transpt,tigrfam_SulP_transpt	ENSG00000091138		0.433	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1		0.00	43	0	G	NM_000111		107423731	-1			no_errors	ENST00000340010	ensembl	human	known	74_37	silent	6.25	45	3	SNP	0.999	A
SLC30A8	169026	genome.wustl.edu	37	8	118174052	118174052	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:118174052T>C	ENST00000456015.2	+	5	648	c.648T>C	c.(646-648)gcT>gcC	p.A216A	RN7SL826P_ENST00000479724.2_RNA|SLC30A8_ENST00000519688.1_Silent_p.A167A|SLC30A8_ENST00000427715.2_Silent_p.A167A|SLC30A8_ENST00000521243.1_Silent_p.A167A	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	216					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GCGTCAGAGCTGCTTTTGTGC	0.433																																					Ovarian(162;1202 1922 6011 16223 52092)												0													206.0	169.0	182.0					8																	118174052		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.648T>C	8.37:g.118174052T>C			A0AVP9|A5YM39|B4DPE0|Q8TCL3	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A216	ENST00000456015.2	37	c.648	CCDS6322.1	8																																																																																			SLC30A8	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000164756		0.433	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1	-	0.00	92	0	T	NM_173851		118174052	+1	tier1	-	no_errors	ENST00000456015	ensembl	human	known	74_37	silent	13.45	103	16	SNP	0.902	C
SLC4A2	6522	genome.wustl.edu	37	7	150767861	150767861	+	Missense_Mutation	SNP	C	C	T	rs146252856		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:150767861C>T	ENST00000485713.1	+	12	2652	c.1612C>T	c.(1612-1614)Cgg>Tgg	p.R538W	SLC4A2_ENST00000461735.1_Missense_Mutation_p.R524W|SLC4A2_ENST00000310317.5_Missense_Mutation_p.R456W|SLC4A2_ENST00000392826.2_Missense_Mutation_p.R529W|SLC4A2_ENST00000413384.2_Missense_Mutation_p.R538W	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	538					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGTGCGGCTCCGGGAGGCTGT	0.647																																																	0								C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	93.0	88.0	90.0		1612,1585,1570,1612	4.3	1.0	7	dbSNP_134	90	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SLC4A2	NM_001199692.1,NM_001199693.1,NM_001199694.1,NM_003040.3	101,101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	538/1242,529/1233,524/1228,538/1242	150767861	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.1612C>T	7.37:g.150767861C>T	ENSP00000419412:p.Arg538Trp		B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.R538W	ENST00000485713.1	37	c.1612	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	C	17.44	3.389745	0.61956	0.0	1.16E-4	ENSG00000164889	ENST00000485713;ENST00000413384;ENST00000310317;ENST00000392826;ENST00000461735	T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36	5.27	4.34	0.51931	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.139590	0.49916	D	0.000140	D	0.85327	0.5671	L	0.60455	1.87	0.34743	D	0.730937	D;D;D	0.69078	0.993;0.997;0.997	P;P;P	0.61658	0.827;0.827;0.892	D	0.89970	0.4093	10	0.87932	D	0	.	12.9717	0.58515	0.0:0.709:0.291:0.0	.	529;524;538	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	W	538;538;456;529;524	ENSP00000419412:R538W;ENSP00000405600:R538W;ENSP00000311402:R456W;ENSP00000376571:R529W;ENSP00000419164:R524W	ENSP00000311402:R456W	R	+	1	2	SLC4A2	150398794	0.686000	0.27661	1.000000	0.80357	0.816000	0.46133	0.569000	0.23638	2.474000	0.83562	0.650000	0.86243	CGG	SLC4A2	-	pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,tigrfam_HCO3_transpt_euk	ENSG00000164889		0.647	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	-	0.00	85	0	C	NM_003040		150767861	+1	tier1	rs146252856	no_errors	ENST00000413384	ensembl	human	known	74_37	missense	33.33	52	26	SNP	0.992	T
SLC6A17	388662	genome.wustl.edu	37	1	110740222	110740222	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:110740222G>A	ENST00000331565.4	+	11	2300		c.e11+1			NM_001010898.2	NP_001010898.1	Q9H1V8	S6A17_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 17						alanine transport (GO:0032328)|glycine transport (GO:0015816)|leucine transport (GO:0015820)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37		all_cancers(81;9.9e-06)|all_epithelial(167;3.24e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0282)|Epithelial(280;0.0372)|all cancers(265;0.0378)|Colorectal(144;0.0438)|LUSC - Lung squamous cell carcinoma(189;0.151)|COAD - Colon adenocarcinoma(174;0.151)		CAAGGAGGAGGTGAGGGGTGG	0.587											OREG0013652	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													23.0	25.0	25.0					1																	110740222		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS30799.1	1p13.2	2013-07-19	2013-07-19		ENSG00000197106	ENSG00000197106		"""Solute carriers"""	31399	protein-coding gene	gene with protein product		610299	"""solute carrier family 6 (neurotransmitter transporter), member 17"", ""solute carrier family 6, member 17"""				Standard	NM_001010898		Approved		uc009wfq.3	Q9H1V8	OTTHUMG00000011761	ENST00000331565.4:c.1815+1G>A	1.37:g.110740222G>A		1429	A6NEA8|A8K1R7|B9EIR5|Q5T5Q9	Splice_Site	SNP	-	e10+1	ENST00000331565.4	37	c.1815+1	CCDS30799.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182151	0.78677	.	.	ENSG00000197106	ENST00000331565;ENST00000450985	.	.	.	5.03	5.03	0.67393	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.957	0.89072	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC6A17	110541745	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	7.646000	0.83445	2.326000	0.78906	0.557000	0.71058	.	SLC6A17	-	-	ENSG00000197106		0.587	SLC6A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A17	HGNC	protein_coding	OTTHUMT00000032550.2	-	0.00	36	0	G	XM_371280	Intron	110740222	+1	tier1	-	no_errors	ENST00000331565	ensembl	human	known	74_37	splice_site	65.62	11	21	SNP	1.000	A
SLC6A19	340024	genome.wustl.edu	37	5	1201910	1201911	+	In_Frame_Ins	INS	-	-	GAA			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:1201910_1201911insGAA	ENST00000304460.10	+	1	201_202	c.145_146insGAA	c.(145-147)tgc>tGAAgc	p.49_49C>*S		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	49					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCTGGGCTTCTGCGTGGGCCTC	0.698																																																	0																																										SO:0001652	inframe_insertion	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	Exception_encountered	5.37:g.1201910_1201911insGAA	ENSP00000305302:p.Cys49delins*Ser		A8K446	In_Frame_Ins	INS	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.CVGL49in_frame_ins*	ENST00000304460.10	37	c.145_146	CCDS34130.1	5																																																																																			SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000174358		0.698	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1		0.00	100	0	-	XM_291120		1201911	+1	tier1		no_errors	ENST00000304460	ensembl	human	known	74_37	in_frame_ins	38.35	82	51	INS	1.000:1.000	GAA
SLC9A2	6549	genome.wustl.edu	37	2	103321003	103321003	+	Splice_Site	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:103321003A>T	ENST00000233969.2	+	10	1988	c.1846A>T	c.(1846-1848)Act>Tct	p.T616S		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	616					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TTCATTCCAGACTTTATCCTA	0.413																																																	0													63.0	62.0	62.0					2																	103321003		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1846-1A>T	2.37:g.103321003A>T			B2RMS2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.T616S	ENST00000233969.2	37	c.1846	CCDS2062.1	2	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314459	0.60524	.	.	ENSG00000115616	ENST00000233969	T	0.41758	0.99	5.25	5.25	0.73442	.	0.153261	0.64402	D	0.000015	T	0.42154	0.1190	M	0.69358	2.11	0.43761	D	0.996271	P	0.48089	0.905	B	0.39152	0.292	T	0.45702	-0.9243	9	.	.	.	.	15.4496	0.75262	1.0:0.0:0.0:0.0	.	616	Q9UBY0	SL9A2_HUMAN	S	616	ENSP00000233969:T616S	.	T	+	1	0	SLC9A2	102687435	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	6.769000	0.74985	2.097000	0.63578	0.533000	0.62120	ACT	SLC9A2	-	tigrfam_NaH_exchanger	ENSG00000115616		0.413	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	-	0.00	23	0	A		Missense_Mutation	103321003	+1	tier1	-	no_errors	ENST00000233969	ensembl	human	known	74_37	missense	50.00	10	10	SNP	1.000	T
SLIT3	6586	genome.wustl.edu	37	5	168098212	168098212	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:168098212A>G	ENST00000519560.1	-	34	4537	c.4118T>C	c.(4117-4119)cTc>cCc	p.L1373P	SLIT3_ENST00000404867.3_Missense_Mutation_p.L1373P|SLIT3_ENST00000332966.8_Missense_Mutation_p.L1380P	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	1373	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTGTGGCCGAGGCAGGGGTC	0.672																																					Ovarian(29;311 847 10864 17279 24903)												0													21.0	23.0	23.0					5																	168098212		2182	4278	6460	SO:0001583	missense	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.4118T>C	5.37:g.168098212A>G	ENSP00000430333:p.Leu1373Pro		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L1373P	ENST00000519560.1	37	c.4118	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	A	14.01	2.407360	0.42715	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	D;D;D	0.92299	-3.01;-3.01;-3.01	5.43	5.43	0.79202	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.298857	0.32785	N	0.005659	D	0.93514	0.7930	L	0.58302	1.8	0.80722	D	1	P	0.48230	0.907	P	0.54026	0.74	D	0.93640	0.6964	10	0.52906	T	0.07	.	15.4948	0.75641	1.0:0.0:0.0:0.0	.	1373	O75094	SLIT3_HUMAN	P	1373;1380;1373	ENSP00000430333:L1373P;ENSP00000332164:L1380P;ENSP00000384890:L1373P	ENSP00000332164:L1380P	L	-	2	0	SLIT3	168030790	0.999000	0.42202	0.910000	0.35882	0.211000	0.24417	3.882000	0.56160	2.059000	0.61396	0.379000	0.24179	CTC	SLIT3	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000184347		0.672	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4		0.00	63	0	A	NM_003062		168098212	-1			no_errors	ENST00000519560	ensembl	human	known	74_37	missense	7.94	58	5	SNP	0.992	G
SNAP25	6616	genome.wustl.edu	37	20	10287451	10287452	+	3'UTR	DEL	AC	AC	-	rs145069282	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:10287451_10287452delAC	ENST00000254976.2	+	0	1438_1439				SNAP25_ENST00000304886.2_3'UTR|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000495883.1_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa						energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	TGATGAGACAACACACACACAC	0.347														16	0.00319489	0.0053	0.0029	5008	,	,		20483	0.002		0.004	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.*607AC>-	20.37:g.10287461_10287462delAC			B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	RNA	DEL	-	NULL	ENST00000254976.2	37	NULL	CCDS13110.1	20																																																																																			SNAP25	-	-	ENSG00000132639		0.347	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNAP25	HGNC	protein_coding	OTTHUMT00000077976.3		0.00	38	0	AC	NM_130811		10287452	+1	tier1		no_errors	ENST00000495883	ensembl	human	known	74_37	rna	9.80	46	5	DEL	0.884:0.856	-
SNORD3C	780853	genome.wustl.edu	37	17	19091431	19091431	+	lincRNA	SNP	C	C	T	rs566845934	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:19091431C>T	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		agcgttttctcctgagcgtga	0.493													c|||	27	0.00539137	0.0174	0.0014	5008	,	,		51708	0.0		0.003	False		,,,				2504	0.0																0													35.0	20.0	24.0					17																	19091431		874	1977	2851			0					17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091431C>T				RNA	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			SNORD3A	-	-	ENSG00000263934		0.493	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	HGNC	lincRNA		-	0.00	335	0	C	NR_006881		19091431	+1	tier1	-	no_errors	ENST00000365494	ensembl	human	known	74_37	rna	12.05	219	30	SNP	0.785	T
SNTG2	54221	genome.wustl.edu	37	2	1271190	1271190	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:1271190A>C	ENST00000308624.5	+	14	1260	c.1131A>C	c.(1129-1131)caA>caC	p.Q377H	SNTG2_ENST00000407292.1_Missense_Mutation_p.Q250H	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	377	PH.				central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGGGTCTTCAAGATTTTGACT	0.522																																																	0													66.0	62.0	63.0					2																	1271190		1920	4133	6053	SO:0001583	missense	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1131A>C	2.37:g.1271190A>C	ENSP00000311837:p.Gln377His		Q05AH5	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q377H	ENST00000308624.5	37	c.1131	CCDS46220.1	2	.	.	.	.	.	.	.	.	.	.	A	5.759	0.324458	0.10900	.	.	ENSG00000172554	ENST00000308624;ENST00000407292	T;T	0.69806	1.58;-0.43	4.61	-9.23	0.00672	Pleckstrin homology domain (1);	0.258099	0.32416	U	0.006128	T	0.44008	0.1273	L	0.43152	1.355	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.11329	0.006;0.002	T	0.14531	-1.0469	10	0.62326	D	0.03	.	3.2109	0.06682	0.2732:0.2668:0.3693:0.0907	.	250;377	Q9NY99-2;Q9NY99	.;SNTG2_HUMAN	H	377;250	ENSP00000311837:Q377H;ENSP00000385020:Q250H	ENSP00000311837:Q377H	Q	+	3	2	SNTG2	1253771	0.486000	0.25980	0.000000	0.03702	0.051000	0.14879	0.189000	0.17037	-2.168000	0.00778	-1.106000	0.02097	CAA	SNTG2	-	NULL	ENSG00000172554		0.522	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	86	0	A	NM_018968		1271190	+1	tier1	-	no_errors	ENST00000308624	ensembl	human	known	74_37	missense	36.49	47	27	SNP	0.000	C
SNTG2	54221	genome.wustl.edu	37	2	1371290	1371290	+	3'UTR	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:1371290A>G	ENST00000308624.5	+	0	1793				SNTG2_ENST00000407292.1_3'UTR	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TATTTTCGTAAGAAATGATTC	0.373																																																	0													32.0	32.0	32.0					2																	1371290		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.*44A>G	2.37:g.1371290A>G			Q05AH5	RNA	SNP	-	NULL	ENST00000308624.5	37	NULL	CCDS46220.1	2																																																																																			SNTG2	-	-	ENSG00000172554		0.373	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	-	0.00	46	0	A	NM_018968		1371290	+1	tier1	-	no_errors	ENST00000472606	ensembl	human	known	74_37	rna	14.63	35	6	SNP	1.000	G
SORCS3	22986	genome.wustl.edu	37	10	106982910	106982910	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:106982910T>G	ENST00000369701.3	+	20	2998	c.2771T>G	c.(2770-2772)gTt>gGt	p.V924G	SORCS3_ENST00000369699.4_3'UTR	NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	924					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GTTCCATTTGTTGCCATAAGA	0.448																																					NSCLC(116;1497 1690 7108 13108 14106)												0													161.0	153.0	156.0					10																	106982910		2203	4300	6503	SO:0001583	missense	0			AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.2771T>G	10.37:g.106982910T>G	ENSP00000358715:p.Val924Gly		Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.V924G	ENST00000369701.3	37	c.2771	CCDS7558.1	10	.	.	.	.	.	.	.	.	.	.	T	23.4	4.408434	0.83340	.	.	ENSG00000156395	ENST00000369701	T	0.16897	2.31	5.06	5.06	0.68205	PKD domain (1);	0.000000	0.85682	D	0.000000	T	0.45256	0.1333	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.48927	-0.8991	9	.	.	.	.	15.0972	0.72244	0.0:0.0:0.0:1.0	.	924	Q9UPU3	SORC3_HUMAN	G	924	ENSP00000358715:V924G	.	V	+	2	0	SORCS3	106972900	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	7.404000	0.79996	2.035000	0.60131	0.460000	0.39030	GTT	SORCS3	-	superfamily_PKD_dom	ENSG00000156395		0.448	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS3	HGNC	protein_coding	OTTHUMT00000050221.1	-	0.00	67	0	T	NM_014978		106982910	+1	tier1	-	no_errors	ENST00000369701	ensembl	human	known	74_37	missense	16.07	47	9	SNP	1.000	G
SRSF5	6430	genome.wustl.edu	37	14	70235812	70235812	+	Intron	SNP	A	A	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:70235812A>T	ENST00000553521.1	+	6	1749				SRSF5_ENST00000556587.1_3'UTR|SRSF5_ENST00000394366.2_Intron|SRSF5_ENST00000553635.1_Intron|SRSF5_ENST00000554021.1_Intron|SRSF5_ENST00000451983.2_Intron|SRSF5_ENST00000555349.1_Intron|SRSF5_ENST00000553548.1_Intron|SRSF5_ENST00000557154.1_Intron			Q13243	SRSF5_HUMAN	serine/arginine-rich splicing factor 5						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of cell cycle (GO:0051726)|response to wounding (GO:0009611)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(1)|liver(1)	2						ATGGCTTGTGATATCTGATGG	0.393																																																	0																																										SO:0001627	intron_variant	0			AF020307	CCDS32109.1	14q24	2013-02-12	2010-06-22	2010-06-22	ENSG00000100650	ENSG00000100650		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10787	protein-coding gene	gene with protein product	"""SR splicing factor 5"""	600914	"""splicing factor, arginine/serine-rich 5"""	SFRS5		7686911, 20516191	Standard	XM_005267998		Approved	SRP40, HRS	uc001xlp.3	Q13243		ENST00000553521.1:c.297-87A>T	14.37:g.70235812A>T			O14797|Q16662|Q49AD6|Q6FGE0	RNA	SNP	-	NULL	ENST00000553521.1	37	NULL	CCDS32109.1	14																																																																																			SRSF5	-	-	ENSG00000100650		0.393	SRSF5-003	NOVEL	basic|appris_principal|CCDS	protein_coding	SRSF5	HGNC	protein_coding	OTTHUMT00000412456.1	-	0.00	15	0	A	NM_001039465		70235812	+1	tier1	-	no_errors	ENST00000556587	ensembl	human	known	74_37	rna	21.74	18	5	SNP	0.000	T
SSBP3	23648	genome.wustl.edu	37	1	54692681	54692682	+	3'UTR	INS	-	-	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:54692681_54692682insG	ENST00000371320.3	-	0	1699_1700				SSBP3_ENST00000357475.4_3'UTR|SSBP3_ENST00000417664.2_3'UTR|SSBP3_ENST00000371319.3_3'UTR|SSBP3_ENST00000326956.7_5'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3						head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GGGAGGGGGTTGAGGGGAGCAG	0.495																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264	ENST00000371320.3:c.*123->C	1.37:g.54692682_54692682dupG			A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	RNA	INS	-	NULL	ENST00000371320.3	37	NULL	CCDS591.1	1																																																																																			SSBP3	-	-	ENSG00000157216		0.495	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP3	HGNC	protein_coding	OTTHUMT00000022721.1		0.00	9	0	-	NM_018070		54692682	-1	tier1		no_errors	ENST00000326956	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.002:0.019	G
STK32B	55351	genome.wustl.edu	37	4	5468497	5468497	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr4:5468497A>G	ENST00000282908.5	+	10	1399	c.977A>G	c.(976-978)cAc>cGc	p.H326R	STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000510398.1_Missense_Mutation_p.H279R|STK32B_ENST00000512636.1_Missense_Mutation_p.H249R	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						AAGCCACTTCACAAAAAGAAG	0.483																																																	0													75.0	73.0	74.0					4																	5468497		2203	4300	6503	SO:0001583	missense	0			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.977A>G	4.37:g.5468497A>G	ENSP00000282908:p.His326Arg			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H326R	ENST00000282908.5	37	c.977	CCDS3380.1	4	.	.	.	.	.	.	.	.	.	.	A	20.8	4.044390	0.75732	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.23552	1.9;1.9;1.9	4.95	4.95	0.65309	.	0.000000	0.43416	U	0.000575	T	0.48429	0.1499	M	0.69185	2.1	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.48703	-0.9012	10	0.54805	T	0.06	.	13.4591	0.61217	1.0:0.0:0.0:0.0	.	326	Q9NY57	ST32B_HUMAN	R	326;249;279	ENSP00000282908:H326R;ENSP00000423209:H249R;ENSP00000420984:H279R	ENSP00000282908:H326R	H	+	2	0	STK32B	5519398	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.867000	0.87062	1.862000	0.54008	0.472000	0.43445	CAC	STK32B	-	NULL	ENSG00000152953		0.483	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	HGNC	protein_coding	OTTHUMT00000206854.4	-	0.00	23	0	A	NM_018401		5468497	+1	tier1	-	no_errors	ENST00000282908	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152470788	152470788	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:152470788T>G	ENST00000367255.5	-	136	25067	c.24466A>C	c.(24466-24468)Att>Ctt	p.I8156L	SYNE1_ENST00000356820.4_Missense_Mutation_p.I2680L|SYNE1_ENST00000448038.1_Missense_Mutation_p.I8085L|SYNE1_ENST00000354674.4_Missense_Mutation_p.I311L|SYNE1_ENST00000539504.1_Missense_Mutation_p.I311L|SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000341594.5_Missense_Mutation_p.I7768L|SYNE1_ENST00000265368.4_Missense_Mutation_p.I8156L|SYNE1_ENST00000423061.1_Missense_Mutation_p.I8085L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8156					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCAGTGAAATTTCCTGCTGG	0.388										HNSCC(10;0.0054)																																							0													94.0	94.0	94.0					6																	152470788		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24466A>C	6.37:g.152470788T>G	ENSP00000356224:p.Ile8156Leu		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.I8156L	ENST00000367255.5	37	c.24466	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325741	0.81580	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91	5.86	5.86	0.93980	.	0.000000	0.64402	D	0.000014	T	0.55242	0.1908	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.968	D;D;D;D;D	0.87578	0.998;0.998;0.997;0.998;0.91	T	0.55425	-0.8143	10	0.42905	T	0.14	.	16.2453	0.82441	0.0:0.0:0.0:1.0	.	8156;8156;8085;8085;358	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	L	8156;311;802;8085;8156;8085;7768;2680;318;313;1078;311	ENSP00000356224:I8156L;ENSP00000441052:I311L;ENSP00000356226:I802L;ENSP00000396024:I8085L;ENSP00000265368:I8156L;ENSP00000390975:I8085L;ENSP00000341887:I7768L;ENSP00000349276:I2680L;ENSP00000356220:I1078L;ENSP00000346701:I311L	ENSP00000265368:I8156L	I	-	1	0	SYNE1	152512481	1.000000	0.71417	0.951000	0.38953	0.441000	0.31987	7.841000	0.86834	2.241000	0.73720	0.533000	0.62120	ATT	SYNE1	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.388	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	77	0	T	NM_182961		152470788	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	26.60	69	25	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152683425	152683425	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:152683425A>C	ENST00000367255.5	-	64	10780	c.10179T>G	c.(10177-10179)agT>agG	p.S3393R	SYNE1_ENST00000448038.1_Missense_Mutation_p.S3400R|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.S3393R|SYNE1_ENST00000423061.1_Missense_Mutation_p.S3400R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3393					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATCCTGATAACTTGTCCACT	0.453										HNSCC(10;0.0054)																																							0													120.0	110.0	114.0					6																	152683425		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.10179T>G	6.37:g.152683425A>C	ENSP00000356224:p.Ser3393Arg		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S3393R	ENST00000367255.5	37	c.10179	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	12.19	1.863510	0.32884	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.32988	1.43;1.43;1.43;1.43	5.28	0.195	0.15151	.	0.084158	0.51477	D	0.000089	T	0.29524	0.0736	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.63880	0.989;0.989;0.989;0.993	P;P;P;D	0.65140	0.814;0.814;0.814;0.932	T	0.22661	-1.0210	10	0.17369	T	0.5	.	9.313	0.37917	0.7266:0.0:0.2734:0.0	.	3393;3393;3393;3400	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	R	3393;3400;3393;3400	ENSP00000356224:S3393R;ENSP00000396024:S3400R;ENSP00000265368:S3393R;ENSP00000390975:S3400R	ENSP00000265368:S3393R	S	-	3	2	SYNE1	152725118	0.988000	0.35896	0.953000	0.39169	0.127000	0.20565	0.518000	0.22847	-0.127000	0.11661	-0.274000	0.10170	AGT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	31	0	A	NM_182961		152683425	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152774796	152774796	+	Missense_Mutation	SNP	T	T	G	rs185885715		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:152774796T>G	ENST00000367255.5	-	25	3553	c.2952A>C	c.(2950-2952)gaA>gaC	p.E984D	SYNE1_ENST00000367253.4_Missense_Mutation_p.E984D|SYNE1_ENST00000448038.1_Missense_Mutation_p.E991D|SYNE1_ENST00000495090.2_Missense_Mutation_p.E551D|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1050D|SYNE1_ENST00000367248.3_Missense_Mutation_p.E974D|SYNE1_ENST00000265368.4_Missense_Mutation_p.E984D|SYNE1_ENST00000423061.1_Missense_Mutation_p.E991D|SYNE1_ENST00000413186.2_Missense_Mutation_p.E984D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	984					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGTCGGTGAGTTCATCACAAG	0.522										HNSCC(10;0.0054)																																							0													130.0	118.0	122.0					6																	152774796		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.2952A>C	6.37:g.152774796T>G	ENSP00000356224:p.Glu984Asp		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E984D	ENST00000367255.5	37	c.2952	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	12.39	1.923344	0.33908	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000495090	T;T;T;T;T;T;T;T;T	0.35605	1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3;1.3	5.99	-1.52	0.08637	.	0.197575	0.34906	N	0.003596	T	0.23886	0.0578	L	0.55834	1.745	0.80722	D	1	B;P;B;B;B;P;P	0.48089	0.012;0.846;0.048;0.048;0.082;0.846;0.905	B;P;B;B;B;P;P	0.53988	0.016;0.553;0.054;0.046;0.117;0.553;0.739	T	0.11567	-1.0582	10	0.25751	T	0.34	.	7.5914	0.28023	0.0:0.3989:0.113:0.4881	.	967;984;551;974;984;984;991	B3W695;Q8NF91;F5H422;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.;.	D	984;991;984;991;1050;984;974;984;551	ENSP00000356224:E984D;ENSP00000396024:E991D;ENSP00000265368:E984D;ENSP00000390975:E991D;ENSP00000341887:E1050D;ENSP00000356222:E984D;ENSP00000356217:E974D;ENSP00000414510:E984D;ENSP00000438508:E551D	ENSP00000265368:E984D	E	-	3	2	SYNE1	152816489	0.933000	0.31639	0.897000	0.35233	0.804000	0.45430	0.044000	0.13992	-0.121000	0.11787	-0.290000	0.09829	GAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.522	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	64	0	T	NM_182961		152774796	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	27.87	43	17	SNP	0.987	G
SYNE1	23345	genome.wustl.edu	37	6	152831487	152831487	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:152831487T>G	ENST00000367255.5	-	8	1023	c.422A>C	c.(421-423)aAc>aCc	p.N141T	SYNE1_ENST00000367253.4_Missense_Mutation_p.N141T|SYNE1_ENST00000448038.1_Missense_Mutation_p.N148T|SYNE1_ENST00000466159.2_Missense_Mutation_p.N141T|SYNE1_ENST00000341594.5_Missense_Mutation_p.N141T|SYNE1_ENST00000367248.3_Missense_Mutation_p.N148T|SYNE1_ENST00000265368.4_Missense_Mutation_p.N141T|SYNE1_ENST00000423061.1_Missense_Mutation_p.N148T|SYNE1_ENST00000413186.2_Missense_Mutation_p.N141T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	141	Actin-binding.				cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGGGGCAGGTTGCTGGTCAA	0.463										HNSCC(10;0.0054)																																							0													86.0	75.0	79.0					6																	152831487		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.422A>C	6.37:g.152831487T>G	ENSP00000356224:p.Asn141Thr		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.N141T	ENST00000367255.5	37	c.422	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	15.18	2.756883	0.49362	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	D;D;D;D;D;D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82;-3.82	5.66	5.66	0.87406	Calponin homology domain (1);	0.000000	0.64402	D	0.000003	D	0.95683	0.8596	L	0.42529	1.33	0.80722	D	1	D;D;P;D;D	0.76494	0.995;0.999;0.939;0.999;0.997	P;D;P;D;D	0.69142	0.852;0.962;0.625;0.962;0.929	D	0.96169	0.9121	10	0.54805	T	0.06	.	15.8952	0.79329	0.0:0.0:0.0:1.0	.	141;141;141;141;148	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	T	141;148;141;148;141;141;148;141;141;141	ENSP00000356224:N141T;ENSP00000396024:N148T;ENSP00000265368:N141T;ENSP00000390975:N148T;ENSP00000341887:N141T;ENSP00000356222:N141T;ENSP00000356217:N148T;ENSP00000414510:N141T;ENSP00000446021:N141T;ENSP00000441264:N141T	ENSP00000265368:N141T	N	-	2	0	SYNE1	152873180	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.281000	0.72632	2.166000	0.68216	0.519000	0.50382	AAC	SYNE1	-	superfamily_CH-domain	ENSG00000131018		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	62	0	T	NM_182961		152831487	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	10.94	57	7	SNP	1.000	G
SYT16	83851	genome.wustl.edu	37	14	62550917	62550917	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:62550917G>A	ENST00000430451.2	+	5	1635	c.1438G>A	c.(1438-1440)Gga>Aga	p.G480R		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	480					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		CCTCCAGAGTGGAGGGTCTCC	0.522																																																	0													99.0	95.0	96.0					14																	62550917		1964	4149	6113	SO:0001583	missense	0			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1438G>A	14.37:g.62550917G>A	ENSP00000394700:p.Gly480Arg		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.G480R	ENST00000430451.2	37	c.1438	CCDS45121.1	14	.	.	.	.	.	.	.	.	.	.	G	14.89	2.671346	0.47781	.	.	ENSG00000139973	ENST00000430451	T	0.04119	3.7	5.44	4.54	0.55810	.	0.363944	0.28114	N	0.016554	T	0.08714	0.0216	L	0.50333	1.59	0.80722	D	1	P	0.37985	0.613	B	0.41466	0.358	T	0.20273	-1.0280	10	0.37606	T	0.19	-3.599	16.2773	0.82651	0.0:0.1325:0.8675:0.0	.	480	Q17RD7	SYT16_HUMAN	R	480	ENSP00000394700:G480R	ENSP00000394700:G480R	G	+	1	0	SYT16	61620670	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.763000	0.47605	1.491000	0.48482	0.643000	0.83706	GGA	SYT16	-	NULL	ENSG00000139973		0.522	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1		0.00	44	0	G	NM_031914		62550917	+1			no_errors	ENST00000430451	ensembl	human	novel	74_37	missense	5.26	36	2	SNP	1.000	A
TECTA	7007	genome.wustl.edu	37	11	121028665	121028665	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:121028665A>C	ENST00000392793.1	+	14	4692	c.4421A>C	c.(4420-4422)aAc>aCc	p.N1474T	TECTA_ENST00000264037.2_Missense_Mutation_p.N1474T			O75443	TECTA_HUMAN	tectorin alpha	1474					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)		p.N1474S(1)	TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GCGCTGCGCAACGGGGTGCGC	0.682																																																	1	Substitution - Missense(1)	endometrium(1)											41.0	39.0	39.0					11																	121028665		2203	4298	6501	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.4421A>C	11.37:g.121028665A>C	ENSP00000376543:p.Asn1474Thr			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.N1474T	ENST00000392793.1	37	c.4421	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	A	13.93	2.384079	0.42308	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.06687	3.27;3.27	5.55	2.02	0.26589	VWC out (1);	0.467140	0.23093	N	0.052008	T	0.07143	0.0181	L	0.41824	1.3	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.30090	-0.9990	10	0.37606	T	0.19	.	8.4324	0.32766	0.7712:0.0:0.2288:0.0	.	1474	O75443	TECTA_HUMAN	T	1474	ENSP00000376543:N1474T;ENSP00000264037:N1474T	ENSP00000264037:N1474T	N	+	2	0	TECTA	120533875	0.732000	0.28121	0.768000	0.31515	0.966000	0.64601	3.348000	0.52209	0.400000	0.25396	0.379000	0.24179	AAC	TECTA	-	smart_VWC_out	ENSG00000109927		0.682	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	-	0.00	18	0	A	NM_005422		121028665	+1	tier1	-	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.300	C
TESPA1	9840	genome.wustl.edu	37	12	55356740	55356740	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:55356740T>G	ENST00000449076.1	-	9	1074	c.942A>C	c.(940-942)caA>caC	p.Q314H	TESPA1_ENST00000524622.1_Missense_Mutation_p.Q176H|TESPA1_ENST00000532804.1_Missense_Mutation_p.Q176H|TESPA1_ENST00000531122.1_Missense_Mutation_p.Q176H|TESPA1_ENST00000316577.8_Missense_Mutation_p.Q314H|TESPA1_ENST00000524959.1_5'Flank	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	314					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											CCAACACAACTTGGTCCAAAC	0.532																																																	0													73.0	75.0	74.0					12																	55356740		1952	4131	6083	SO:0001583	missense	0			AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.942A>C	12.37:g.55356740T>G	ENSP00000400892:p.Gln314His		B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	NULL	p.Q314H	ENST00000449076.1	37	c.942	CCDS44913.1	12	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629612	0.46944	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.49	2.84	0.33178	.	0.176947	0.37715	N	0.001962	T	0.55577	0.1929	L	0.32530	0.975	0.31633	N	0.6488	P	0.40875	0.731	P	0.49752	0.621	T	0.60326	-0.7285	10	0.52906	T	0.07	-7.7409	5.068	0.14592	0.0:0.1001:0.1791:0.7209	.	314	A2RU30	K0748_HUMAN	H	176;176;314;314;176	ENSP00000435622:Q176H;ENSP00000432030:Q176H;ENSP00000400892:Q314H;ENSP00000312679:Q314H;ENSP00000433098:Q176H	ENSP00000312679:Q314H	Q	-	3	2	KIAA0748	53643007	0.662000	0.27439	1.000000	0.80357	0.370000	0.29829	-0.088000	0.11198	0.947000	0.37659	0.533000	0.62120	CAA	TESPA1	-	NULL	ENSG00000135426		0.532	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TESPA1	HGNC	protein_coding	OTTHUMT00000383822.1	-	0.00	81	0	T	NM_001098815		55356740	-1	tier1	-	no_errors	ENST00000316577	ensembl	human	known	74_37	missense	29.13	73	30	SNP	1.000	G
TEX9	374618	genome.wustl.edu	37	15	56686979	56686979	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:56686979G>T	ENST00000352903.2	+	9	799	c.775G>T	c.(775-777)Gaa>Taa	p.E259*	TEX9_ENST00000558083.2_Nonsense_Mutation_p.E184*|TEX9_ENST00000561221.2_Nonsense_Mutation_p.E259*|TEX9_ENST00000537232.1_Nonsense_Mutation_p.E184*|RP11-48G14.2_ENST00000564401.1_lincRNA|TEX9_ENST00000560582.1_Nonsense_Mutation_p.E15*	NM_198524.1	NP_940926.1	Q8N6V9	TEX9_HUMAN	testis expressed 9	259										cervix(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	14				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		TCTTTTCGAAGAAGCAAACAA	0.308																																																	0													50.0	55.0	53.0					15																	56686979		2192	4282	6474	SO:0001587	stop_gained	0			BC028119	CCDS10157.1, CCDS66776.1	15q21.3	2007-03-13	2007-03-13		ENSG00000151575	ENSG00000151575			29585	protein-coding gene	gene with protein product			"""testis expressed sequence 9"""				Standard	XM_005254361		Approved		uc002adp.3	Q8N6V9	OTTHUMG00000132035	ENST00000352903.2:c.775G>T	15.37:g.56686979G>T	ENSP00000342169:p.Glu259*		B4DH73	Nonsense_Mutation	SNP	NULL	p.E259*	ENST00000352903.2	37	c.775	CCDS10157.1	15	.	.	.	.	.	.	.	.	.	.	G	38	7.176081	0.98114	.	.	ENSG00000151575	ENST00000352903;ENST00000537232	.	.	.	5.25	5.25	0.73442	.	0.095855	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-28.4931	17.4112	0.87486	0.0:0.0:1.0:0.0	.	.	.	.	X	259;184	.	ENSP00000342169:E259X	E	+	1	0	TEX9	54474271	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	7.535000	0.82014	2.453000	0.82957	0.591000	0.81541	GAA	TEX9	-	NULL	ENSG00000151575		0.308	TEX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX9	HGNC	protein_coding	OTTHUMT00000255048.2	-	0.00	31	0	G	NM_198524		56686979	+1	tier1	-	no_errors	ENST00000352903	ensembl	human	known	74_37	nonsense	40.00	15	10	SNP	1.000	T
TFPI2	7980	genome.wustl.edu	37	7	93519623	93519623	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:93519623C>T	ENST00000222543.5	-	2	409	c.97G>A	c.(97-99)Gcg>Acg	p.A33T	AC002076.10_ENST00000435257.1_RNA|TFPI2_ENST00000545378.1_Missense_Mutation_p.A33T|GNGT1_ENST00000455502.1_Intron	NM_001271003.1|NM_001271004.1|NM_006528.3	NP_001257932.1|NP_001257933.1|NP_006519.1	P48307	TFPI2_HUMAN	tissue factor pathway inhibitor 2	33					blood coagulation (GO:0007596)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(5)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	all_cancers(62;4.45e-10)|all_epithelial(64;2.92e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			CAGATCTCCGCGTTATTTCCT	0.567																																																	0													35.0	38.0	37.0					7																	93519623		2203	4300	6503	SO:0001583	missense	0			L27624	CCDS5632.1	7q	2008-07-18			ENSG00000105825	ENSG00000105825			11761	protein-coding gene	gene with protein product		600033				7896752, 8945635	Standard	NM_006528		Approved	PP5, TFPI-2, REF1	uc003umy.2	P48307	OTTHUMG00000022963	ENST00000222543.5:c.97G>A	7.37:g.93519623C>T	ENSP00000222543:p.Ala33Thr		Q66ME8|Q8NAK6|Q9UC86	Missense_Mutation	SNP	pirsf_Prot_inhib_I2_TFPI,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.A33T	ENST00000222543.5	37	c.97	CCDS5632.1	7	.	.	.	.	.	.	.	.	.	.	C	9.391	1.075567	0.20227	.	.	ENSG00000105825	ENST00000222543;ENST00000545378	T;T	0.58060	0.36;0.36	5.07	-0.325	0.12702	Proteinase inhibitor I2, Kunitz metazoa (3);	1.281220	0.05315	N	0.525576	T	0.20981	0.0505	N	0.08118	0	0.09310	N	1	B;P;B	0.36974	0.44;0.576;0.44	B;B;B	0.23716	0.022;0.048;0.022	T	0.10683	-1.0619	10	0.14252	T	0.57	.	0.757	0.01000	0.1752:0.2448:0.1608:0.4192	.	4;33;33	A4ZVU7;F5H3J8;P48307	.;.;TFPI2_HUMAN	T	33	ENSP00000222543:A33T;ENSP00000438861:A33T	ENSP00000222543:A33T	A	-	1	0	TFPI2	93357559	0.000000	0.05858	0.001000	0.08648	0.462000	0.32619	-0.203000	0.09438	0.225000	0.20959	0.313000	0.20887	GCG	TFPI2	-	pirsf_Prot_inhib_I2_TFPI,superfamily_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	ENSG00000105825		0.567	TFPI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPI2	HGNC	protein_coding	OTTHUMT00000254720.2	-	0.00	52	0	C	NM_006528		93519623	-1	tier1	-	no_errors	ENST00000222543	ensembl	human	known	74_37	missense	21.43	55	15	SNP	0.000	T
TFEC	22797	genome.wustl.edu	37	7	115580835	115580835	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:115580835T>C	ENST00000265440.7	-	8	994	c.814A>G	c.(814-816)Agc>Ggc	p.S272G	TFEC_ENST00000320239.7_Missense_Mutation_p.S243G|TFEC_ENST00000457268.1_Missense_Mutation_p.S205G|TFEC_ENST00000393485.1_3'UTR	NM_012252.3	NP_036384.1	O14948	TFEC_HUMAN	transcription factor EC	272	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			AGCTCAGGGCTTGGCCCCTGA	0.448																																																	0													165.0	161.0	162.0					7																	115580835		2203	4300	6503	SO:0001583	missense	0			D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000265440.7:c.814A>G	7.37:g.115580835T>C	ENSP00000265440:p.Ser272Gly		B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S272G	ENST00000265440.7	37	c.814	CCDS5762.1	7	.	.	.	.	.	.	.	.	.	.	T	3.005	-0.205076	0.06180	.	.	ENSG00000105967	ENST00000265440;ENST00000457268;ENST00000320239	T;T;T	0.63913	-0.07;-0.07;-0.07	5.34	5.34	0.76211	.	0.630013	0.18282	N	0.145984	T	0.60470	0.2271	L	0.58101	1.795	0.09310	N	1	B;B	0.30236	0.274;0.112	B;B	0.33960	0.173;0.119	T	0.58002	-0.7713	10	0.51188	T	0.08	-6.3945	11.9055	0.52708	0.0:0.0:0.1455:0.8545	.	243;272	O14948-2;O14948	.;TFEC_HUMAN	G	272;205;243	ENSP00000265440:S272G;ENSP00000387650:S205G;ENSP00000318676:S243G	ENSP00000265440:S272G	S	-	1	0	TFEC	115368071	0.526000	0.26298	0.139000	0.22197	0.080000	0.17528	1.488000	0.35551	2.012000	0.59069	0.528000	0.53228	AGC	TFEC	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000105967		0.448	TFEC-001	KNOWN	basic|CCDS	protein_coding	TFEC	HGNC	protein_coding	OTTHUMT00000059839.4	-	0.00	54	0	T	NM_012252		115580835	-1	tier1	-	no_errors	ENST00000265440	ensembl	human	known	74_37	missense	16.22	62	12	SNP	0.004	C
TGFB3	7043	genome.wustl.edu	37	14	76431997	76431997	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr14:76431997G>T	ENST00000238682.3	-	4	985	c.688C>A	c.(688-690)Cac>Aac	p.H230N	TGFB3_ENST00000556285.1_Missense_Mutation_p.H230N	NM_003239.2	NP_003230.1	P10600	TGFB3_HUMAN	transforming growth factor, beta 3	230					activation of MAPK activity (GO:0000187)|aging (GO:0007568)|blood coagulation (GO:0007596)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|detection of hypoxia (GO:0070483)|digestive tract development (GO:0048565)|embryonic neurocranium morphogenesis (GO:0048702)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|lung alveolus development (GO:0048286)|mammary gland development (GO:0030879)|menstrual cycle phase (GO:0022601)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|odontogenesis (GO:0042476)|ossification involved in bone remodeling (GO:0043932)|palate development (GO:0060021)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell division (GO:0051781)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|salivary gland morphogenesis (GO:0007435)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|T-tubule (GO:0030315)	identical protein binding (GO:0042802)|transforming growth factor beta binding (GO:0050431)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			NS(1)|breast(1)|endometrium(4)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.0169)		TGAAAGGTGTGACATGGACAG	0.423																																																	0													261.0	241.0	248.0					14																	76431997		2203	4300	6503	SO:0001583	missense	0				CCDS9846.1	14q24	2014-09-17				ENSG00000119699		"""Endogenous ligands"""	11769	protein-coding gene	gene with protein product	"""prepro-transforming growth factor beta-3"""	190230	"""arrhythmogenic right ventricular dysplasia 1"""	ARVD1, ARVD		16549496, 15639475	Standard	XM_005268028		Approved		uc001xsc.2	P10600		ENST00000238682.3:c.688C>A	14.37:g.76431997G>T	ENSP00000238682:p.His230Asn		Q8WV88	Missense_Mutation	SNP	pirsf_TGF-beta,pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Transform_grow_fac_b3,prints_TGF-beta	p.H230N	ENST00000238682.3	37	c.688	CCDS9846.1	14	.	.	.	.	.	.	.	.	.	.	G	2.197	-0.383964	0.04966	.	.	ENSG00000119699	ENST00000238682;ENST00000556285	T;T	0.75938	-0.98;-0.24	5.31	5.31	0.75309	.	0.053821	0.85682	D	0.000000	T	0.57814	0.2079	L	0.36672	1.1	0.39796	D	0.972504	B	0.11235	0.004	B	0.11329	0.006	T	0.51156	-0.8741	10	0.02654	T	1	-10.2328	8.5736	0.33585	0.0764:0.0:0.7704:0.1531	.	230	P10600	TGFB3_HUMAN	N	230	ENSP00000238682:H230N;ENSP00000451110:H230N	ENSP00000238682:H230N	H	-	1	0	TGFB3	75501750	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.477000	0.60223	2.625000	0.88918	0.650000	0.86243	CAC	TGFB3	-	pirsf_TGF-beta	ENSG00000119699		0.423	TGFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFB3	HGNC	protein_coding	OTTHUMT00000413685.1	-	0.00	51	0	G	NM_003239		76431997	-1	tier1	-	no_errors	ENST00000238682	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
TIMD4	91937	genome.wustl.edu	37	5	156390172	156390172	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr5:156390172T>G	ENST00000274532.2	-	1	94	c.38A>C	c.(37-39)gAg>gCg	p.E13A	TIMD4_ENST00000407087.3_Missense_Mutation_p.E13A	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	13						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCACCAAAACTCAATCATCAG	0.448																																																	0													127.0	121.0	124.0					5																	156390172		2203	4300	6503	SO:0001583	missense	0			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.38A>C	5.37:g.156390172T>G	ENSP00000274532:p.Glu13Ala		B5MCL9	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E13A	ENST00000274532.2	37	c.38	CCDS4332.1	5	.	.	.	.	.	.	.	.	.	.	T	10.08	1.253512	0.22965	.	.	ENSG00000145850	ENST00000274532;ENST00000407087	T;T	0.19250	2.16;2.17	5.18	1.37	0.22104	.	0.774326	0.11636	N	0.544320	T	0.12646	0.0307	L	0.34521	1.04	0.09310	N	1	P;P	0.47762	0.9;0.9	B;B	0.41135	0.348;0.348	T	0.14337	-1.0476	10	0.22109	T	0.4	-5.6473	2.9046	0.05716	0.1825:0.2089:0.0:0.6086	.	13;13	B5MCL9;Q96H15	.;TIMD4_HUMAN	A	13	ENSP00000274532:E13A;ENSP00000385973:E13A	ENSP00000274532:E13A	E	-	2	0	TIMD4	156322750	0.078000	0.21339	0.001000	0.08648	0.009000	0.06853	1.188000	0.32102	0.081000	0.16988	0.533000	0.62120	GAG	TIMD4	-	NULL	ENSG00000145850		0.448	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMD4	HGNC	protein_coding	OTTHUMT00000252568.1	-	0.00	51	0	T	NM_138379		156390172	-1	tier1	-	no_errors	ENST00000274532	ensembl	human	known	74_37	missense	28.07	41	16	SNP	0.002	G
TMEM200A	114801	genome.wustl.edu	37	6	130762765	130762765	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr6:130762765T>G	ENST00000296978.3	+	3	2069	c.1198T>G	c.(1198-1200)Tta>Gta	p.L400V	TMEM200A_ENST00000392429.1_Missense_Mutation_p.L400V|TMEM200A_ENST00000545622.1_Missense_Mutation_p.L400V	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	400						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GTCCTTGGACTTAGACCGGGG	0.512																																																	0													88.0	82.0	84.0					6																	130762765		2203	4300	6503	SO:0001583	missense	0			AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.1198T>G	6.37:g.130762765T>G	ENSP00000296978:p.Leu400Val		Q96PX5	Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.L400V	ENST00000296978.3	37	c.1198	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	T	15.60	2.880458	0.51801	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	6.07	4.92	0.64577	.	0.000000	0.64402	D	0.000001	T	0.53433	0.1796	L	0.29908	0.895	0.58432	D	0.999992	D	0.76494	0.999	D	0.78314	0.991	T	0.60105	-0.7328	9	0.52906	T	0.07	-14.3384	12.1353	0.53968	0.0:0.0664:0.0:0.9336	.	400	Q86VY9	T200A_HUMAN	V	400	.	ENSP00000296978:L400V	L	+	1	2	TMEM200A	130804458	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.379000	0.52440	1.124000	0.41980	-0.250000	0.11733	TTA	TMEM200A	-	NULL	ENSG00000164484		0.512	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	HGNC	protein_coding	OTTHUMT00000042201.1	-	0.00	21	0	T	NM_052913		130762765	+1	tier1	-	no_errors	ENST00000296978	ensembl	human	known	74_37	missense	33.33	22	11	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	77	0	C	NM_000546		7577538	-1	tier1	rs11540652	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	49.18	31	30	SNP	1.000	T
TPTE	7179	genome.wustl.edu	37	21	10908859	10908859	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr21:10908859A>C	ENST00000361285.4	-	23	1815	c.1486T>G	c.(1486-1488)Ttc>Gtc	p.F496V	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.F478V|TPTE_ENST00000342420.5_Missense_Mutation_p.F458V	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	496	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGCAACCAGAAGTAAAATGAG	0.289																																																	0													129.0	121.0	124.0					21																	10908859		2202	4297	6499	SO:0001583	missense	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1486T>G	21.37:g.10908859A>C	ENSP00000355208:p.Phe496Val		B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.F496V	ENST00000361285.4	37	c.1486	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	11.08	1.533107	0.27387	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.84370	-1.84;-1.84;-1.84	2.18	2.18	0.27775	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.91536	0.7327	M	0.88640	2.97	0.53005	D	0.999968	D;D;P	0.89917	1.0;1.0;0.94	D;D;P	0.97110	1.0;0.993;0.896	D	0.90246	0.4290	10	0.46703	T	0.11	-17.6206	8.305	0.32036	1.0:0.0:0.0:0.0	.	458;478;496	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	V	478;496;458	ENSP00000298232:F478V;ENSP00000355208:F496V;ENSP00000344441:F458V	ENSP00000298232:F478V	F	-	1	0	TPTE	9930730	1.000000	0.71417	0.974000	0.42286	0.017000	0.09413	5.525000	0.67110	1.246000	0.43901	0.155000	0.16302	TTC	TPTE	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000166157		0.289	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	181	0	A			10908859	-1	tier1	-	no_errors	ENST00000361285	ensembl	human	known	74_37	missense	16.13	104	20	SNP	0.999	C
TRIM49B	283116	genome.wustl.edu	37	11	49055825	49055825	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:49055825T>C	ENST00000332682.7	+	4	663	c.635T>C	c.(634-636)cTt>cCt	p.L212P		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	212						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						TTTCATCGACTTCATTTAAGT	0.378																																																	0																																										SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.635T>C	11.37:g.49055825T>C	ENSP00000330216:p.Leu212Pro			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L212P	ENST00000332682.7	37	c.635	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	T	9.157	1.017719	0.19355	.	.	ENSG00000182053	ENST00000332682	T	0.11930	2.73	0.689	0.689	0.18033	.	.	.	.	.	T	0.33644	0.0870	M	0.92026	3.265	0.09310	N	0.999998	.	.	.	.	.	.	T	0.13072	-1.0523	6	0.87932	D	0	.	.	.	.	.	.	.	.	P	212	ENSP00000330216:L212P	ENSP00000330216:L212P	L	+	2	0	AC084851.1	49012401	0.000000	0.05858	0.010000	0.14722	0.002000	0.02628	-0.234000	0.09028	0.539000	0.28788	0.155000	0.16302	CTT	TRIM49B	-	NULL	ENSG00000182053		0.378	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		-	0.00	336	0	T			49055825	+1	tier1	-	no_errors	ENST00000332682	ensembl	human	known	74_37	missense	13.17	290	44	SNP	0.013	C
TRIM49	57093	genome.wustl.edu	37	11	89531678	89531678	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:89531678T>G	ENST00000329758.1	-	8	1307	c.979A>C	c.(979-981)Agt>Cgt	p.S327R	TRIM49_ENST00000532501.2_Missense_Mutation_p.S250R	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCAAGAAAACTTCTAGGTGTT	0.418																																																	0													13.0	16.0	15.0					11																	89531678		2019	4186	6205	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.979A>C	11.37:g.89531678T>G	ENSP00000327604:p.Ser327Arg		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327R	ENST00000329758.1	37	c.979	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	T	1.569	-0.534586	0.04082	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.08546	3.08	0.539	-1.08	0.09936	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05823	0.0152	L	0.37850	1.14	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.42666	-0.9438	7	.	.	.	.	.	.	.	.	327	P0CI25	TRI49_HUMAN	R	327;250	ENSP00000327604:S327R	.	S	-	1	0	TRIM49	89171326	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.057000	0.11768	-0.399000	0.07668	-1.394000	0.01149	AGT	TRIM49	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000168930		0.418	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1		0.00	124	0	T	NM_020358		89531678	-1			no_errors	ENST00000329758	ensembl	human	known	74_37	missense	7.33	139	11	SNP	0.000	G
TRIM64C	646754	genome.wustl.edu	37	11	49075336	49075336	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:49075336A>C	ENST00000530230.1	-	7	1273	c.1274T>G	c.(1273-1275)cTt>cGt	p.L425R		NM_001206631.1	NP_001193560.1	A6NLI5	TR64C_HUMAN	tripartite motif containing 64C	425	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ACCATAGATAAGAGAACCTTT	0.403																																																	0																																										SO:0001583	missense	0				CCDS73287.1	11p11.12	2014-04-02	2011-01-25		ENSG00000214891	ENSG00000214891		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37148	protein-coding gene	gene with protein product			"""tripartite motif-containing 64C"""				Standard	NM_001206631		Approved		uc021qiy.1	A6NLI5	OTTHUMG00000166752	ENST00000530230.1:c.1274T>G	11.37:g.49075336A>C	ENSP00000431987:p.Leu425Arg			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L425R	ENST00000530230.1	37	c.1274		11	.	.	.	.	.	.	.	.	.	.	A	14.52	2.558900	0.45590	.	.	ENSG00000214891	ENST00000530230	T	0.66099	-0.19	1.55	1.55	0.23275	.	.	.	.	.	T	0.70815	0.3267	M	0.86573	2.825	0.09310	N	0.999997	.	.	.	.	.	.	T	0.62483	-0.6845	7	0.62326	D	0.03	.	5.2593	0.15563	1.0:0.0:0.0:0.0	.	.	.	.	R	425	ENSP00000431987:L425R	ENSP00000431987:L425R	L	-	2	0	TRIM64C	49031912	0.002000	0.14202	0.091000	0.20842	0.698000	0.40448	-0.199000	0.09491	0.994000	0.38892	0.155000	0.16302	CTT	TRIM64C	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000214891		0.403	TRIM64C-001	KNOWN	basic|appris_principal	protein_coding	TRIM64C	HGNC	protein_coding	OTTHUMT00000391366.1	-	0.00	152	0	A			49075336	-1	tier1	-	no_errors	ENST00000530230	ensembl	human	known	74_37	missense	28.24	94	37	SNP	0.426	C
TRIM49C	642612	genome.wustl.edu	37	11	89774338	89774338	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:89774338A>C	ENST00000448984.1	+	8	1308	c.979A>C	c.(979-981)Agt>Cgt	p.S327R	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	327	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AACACCTAGAAGTTTTCTTGC	0.423																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.979A>C	11.37:g.89774338A>C	ENSP00000388299:p.Ser327Arg		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.S327R	ENST00000448984.1	37	c.979	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	A	5.198	0.221998	0.09863	.	.	ENSG00000204449	ENST00000448984	T	0.08546	3.08	0.823	-0.7	0.11273	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05593	0.0147	L	0.36672	1.1	0.09310	N	1	B	0.22211	0.066	B	0.20184	0.028	T	0.43163	-0.9408	8	.	.	.	.	2.82	0.05468	0.4537:0.0:0.0:0.5463	.	327	P0CI26	T49L2_HUMAN	R	327	ENSP00000388299:S327R	.	S	+	1	0	TRIM49L2	89413986	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	0.039000	0.13884	-0.248000	0.09583	0.254000	0.18369	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000204449		0.423	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	-	0.00	55	0	A	NM_001195234		89774338	+1	tier1	-	no_errors	ENST00000448984	ensembl	human	known	74_37	missense	29.69	45	19	SNP	0.001	C
TTC28	23331	genome.wustl.edu	37	22	28503055	28503055	+	Silent	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr22:28503055T>C	ENST00000397906.2	-	7	2919	c.2778A>G	c.(2776-2778)ggA>ggG	p.G926G		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	926					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						TTTACCTGTGTCCATTTCCCA	0.433																																																	0													47.0	41.0	43.0					22																	28503055		692	1591	2283	SO:0001819	synonymous_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.2778A>G	22.37:g.28503055T>C			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G926	ENST00000397906.2	37	c.2778	CCDS46678.1	22																																																																																			TTC28	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100154		0.433	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	27	0	T	XM_929318		28503055	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	silent	64.00	9	16	SNP	1.000	C
TTC3	7267	genome.wustl.edu	37	21	38537881	38537881	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr21:38537881G>T	ENST00000399017.2	+	33	6112	c.3365G>T	c.(3364-3366)gGt>gTt	p.G1122V	TTC3_ENST00000354749.2_Missense_Mutation_p.G1122V|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.G1122V	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1122					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				GAGGAACATGGTCCCTTGGAC	0.333																																					Ovarian(38;194 1649 35661)												0													112.0	122.0	118.0					21																	38537881		2202	4298	6500	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3365G>T	21.37:g.38537881G>T	ENSP00000381981:p.Gly1122Val		A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.G1122V	ENST00000399017.2	37	c.3365	CCDS13651.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.16|19.16	3.774119|3.774119	0.69992|0.69992	.|.	.|.	ENSG00000182670|ENSG00000182670	ENST00000418766;ENST00000438055;ENST00000355666;ENST00000399017;ENST00000354749|ENST00000411496	T;T;T;T;T|.	0.63580|.	-0.01;0.08;-0.05;-0.05;-0.05|.	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	0.186168|.	0.37219|.	N|.	0.002200|.	T|T	0.72653|0.72653	0.3487|0.3487	M|M	0.68952|0.68952	2.095|2.095	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;0.999|.	T|T	0.72988|0.72988	-0.4124|-0.4124	10|5	0.87932|.	D|.	0|.	-17.6425|-17.6425	15.9535|15.9535	0.79861|0.79861	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	180;1122|.	Q5GIT6;P53804|.	.;TTC3_HUMAN|.	V|F	1122;1104;1122;1122;1122|278	ENSP00000403943:G1122V;ENSP00000391891:G1104V;ENSP00000347889:G1122V;ENSP00000381981:G1122V;ENSP00000346791:G1122V|.	ENSP00000346791:G1122V|.	G|V	+|+	2|1	0|0	TTC3|TTC3	37459751|37459751	1.000000|1.000000	0.71417|0.71417	0.988000|0.988000	0.46212|0.46212	0.975000|0.975000	0.68041|0.68041	5.676000|5.676000	0.68131|0.68131	2.282000|2.282000	0.76494|0.76494	0.491000|0.491000	0.48974|0.48974	GGT|GTC	TTC3	-	NULL	ENSG00000182670		0.333	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	-	0.00	48	0	G			38537881	+1	tier1	-	no_errors	ENST00000354749	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179457000	179457000	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:179457000T>G	ENST00000591111.1	-	252	54932	c.54708A>C	c.(54706-54708)aaA>aaC	p.K18236N	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K10812N|TTN_ENST00000359218.5_Missense_Mutation_p.K10937N|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K11004N|TTN_ENST00000342992.6_Missense_Mutation_p.K17309N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K19877N|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18236					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTGGCCCAGGTTTATCTAAAA	0.313																																																	0													43.0	40.0	41.0					2																	179457000		1827	4076	5903	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.54708A>C	2.37:g.179457000T>G	ENSP00000465570:p.Lys18236Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K17309N	ENST00000591111.1	37	c.51927		2	.	.	.	.	.	.	.	.	.	.	T	8.258	0.810502	0.16537	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	6.03	3.84	0.44239	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.62563	0.2438	M	0.83483	2.645	0.51233	D	0.999918	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.87578	0.994;0.998;0.998;0.994	T	0.62914	-0.6753	9	0.87932	D	0	.	6.9437	0.24506	0.0:0.452:0.0:0.548	.	10812;10937;11004;18236	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	17309;10812;11004;10937;10810	ENSP00000343764:K17309N;ENSP00000434586:K10812N;ENSP00000340554:K11004N;ENSP00000352154:K10937N	ENSP00000340554:K11004N	K	-	3	2	TTN	179165246	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.745000	0.26259	0.650000	0.30769	0.455000	0.32223	AAA	TTN	-	superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom	ENSG00000155657		0.313	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	21	0	T	NM_133378		179457000	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179459328	179459328	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:179459328T>G	ENST00000591111.1	-	246	53194	c.52970A>C	c.(52969-52971)aAa>aCa	p.K17657T	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.K10233T|TTN_ENST00000359218.5_Missense_Mutation_p.K10358T|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.K10425T|TTN_ENST00000342992.6_Missense_Mutation_p.K16730T|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K19298T|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17657	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACAGTATTTTTAGTAACTTC	0.378																																																	0													94.0	89.0	91.0					2																	179459328		1824	4092	5916	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.52970A>C	2.37:g.179459328T>G	ENSP00000465570:p.Lys17657Thr		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K16730T	ENST00000591111.1	37	c.50189		2	.	.	.	.	.	.	.	.	.	.	T	15.31	2.796784	0.50208	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	6.03	6.03	0.97812	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63450	0.2512	M	0.62154	1.92	0.58432	D	0.999998	P;P;P;P	0.47253	0.892;0.892;0.892;0.892	P;P;P;P	0.51055	0.657;0.657;0.657;0.657	T	0.66767	-0.5840	9	0.87932	D	0	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	10233;10358;10425;17657	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	T	16730;10233;10425;10358;10231	ENSP00000343764:K16730T;ENSP00000434586:K10233T;ENSP00000340554:K10425T;ENSP00000352154:K10358T	ENSP00000340554:K10425T	K	-	2	0	TTN	179167574	1.000000	0.71417	0.992000	0.48379	0.909000	0.53808	7.980000	0.88113	2.302000	0.77476	0.533000	0.62120	AAA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	36	0	T	NM_133378		179459328	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179586627	179586627	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:179586627T>A	ENST00000591111.1	-	76	22036	c.21812A>T	c.(21811-21813)cAa>cTa	p.Q7271L	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.Q6344L|TTN_ENST00000589042.1_Missense_Mutation_p.Q7588L			Q8WZ42	TITIN_HUMAN	titin	12839	Ig-like 54.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGGTTGCTTGGCAAGTATA	0.403																																																	0													233.0	221.0	225.0					2																	179586627		1913	4128	6041	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.21812A>T	2.37:g.179586627T>A	ENSP00000465570:p.Gln7271Leu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Q6344L	ENST00000591111.1	37	c.19031		2	.	.	.	.	.	.	.	.	.	.	T	11.53	1.665251	0.29604	.	.	ENSG00000155657	ENST00000342992	T	0.68624	-0.34	6.16	4.95	0.65309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47875	0.1469	N	0.13352	0.335	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.49062	-0.8978	9	0.87932	D	0	.	8.485	0.33065	0.1294:0.0:0.1353:0.7353	.	7271	Q8WZ42	TITIN_HUMAN	L	6344	ENSP00000343764:Q6344L	ENSP00000343764:Q6344L	Q	-	2	0	TTN	179294872	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.292000	0.51772	2.367000	0.80283	0.528000	0.53228	CAA	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	33	0	T	NM_133378		179586627	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	38.30	29	18	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179623798	179623798	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:179623798C>G	ENST00000591111.1	-	44	10440	c.10216G>C	c.(10216-10218)Gct>Cct	p.A3406P	TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A3360P|TTN_ENST00000359218.5_Missense_Mutation_p.A3360P|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.A3406P|TTN_ENST00000342175.6_Missense_Mutation_p.A3360P|TTN_ENST00000342992.6_Missense_Mutation_p.A3406P|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A3406P			Q8WZ42	TITIN_HUMAN	titin	13722	Ig-like 20.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGATAAGCTTCGGCAATT	0.403																																																	0													141.0	125.0	130.0					2																	179623798		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10216G>C	2.37:g.179623798C>G	ENSP00000465570:p.Ala3406Pro		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A3406P	ENST00000591111.1	37	c.10216		2	.	.	.	.	.	.	.	.	.	.	C	17.98	3.521295	0.64747	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870;ENST00000446208	T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54	5.92	5.92	0.95590	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82962	0.5151	L	0.59912	1.85	0.44073	D	0.996825	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.998;1.0	D;D;D;D;D	0.74674	0.972;0.972;0.972;0.958;0.984	T	0.83212	-0.0073	9	0.87932	D	0	.	20.3214	0.98679	0.0:1.0:0.0:0.0	.	3360;3360;3360;3406;3406	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	P	3406;3360;3360;3360;3360;3406;11	ENSP00000343764:A3406P;ENSP00000434586:A3360P;ENSP00000340554:A3360P;ENSP00000352154:A3360P;ENSP00000354117:A3406P	ENSP00000340554:A3360P	A	-	1	0	TTN	179332043	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.786000	0.85741	2.804000	0.96469	0.655000	0.94253	GCT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	49	0	C	NM_133378		179623798	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	31.58	39	18	SNP	1.000	G
TTPA	7274	genome.wustl.edu	37	8	63976810	63976810	+	Silent	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr8:63976810G>T	ENST00000260116.4	-	4	649	c.618C>A	c.(616-618)gtC>gtA	p.V206V	TTPA_ENST00000521138.1_Intron	NM_000370.3	NP_000361.1	P49638	TTPA_HUMAN	tocopherol (alpha) transfer protein	206	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				embryonic placenta development (GO:0001892)|intermembrane transport (GO:0046909)|intracellular pH reduction (GO:0051452)|lipid metabolic process (GO:0006629)|negative regulation of cell death (GO:0060548)|negative regulation of establishment of blood-brain barrier (GO:0090212)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|response to toxic substance (GO:0009636)|transport (GO:0006810)|vitamin E metabolic process (GO:0042360)|vitamin transport (GO:0051180)	cytosol (GO:0005829)|late endosome (GO:0005770)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|transporter activity (GO:0005215)|vitamin E binding (GO:0008431)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)	15	Breast(64;0.0716)	all_cancers(86;0.145)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.123)			Vitamin E(DB00163)	TCATGGAAAAGACAGCATGGA	0.323																																																	0													85.0	84.0	84.0					8																	63976810		2203	4300	6503	SO:0001819	synonymous_variant	0			BC058000	CCDS6178.1	8q12.3	2007-07-18	2007-07-16			ENSG00000137561			12404	protein-coding gene	gene with protein product		600415	"""ataxia (Friedreich-like) with vitamin E deficiency"""	AVED		7719340, 7887897	Standard	NM_000370		Approved		uc003xux.2	P49638		ENST00000260116.4:c.618C>A	8.37:g.63976810G>T			Q71V64	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.V206	ENST00000260116.4	37	c.618	CCDS6178.1	8																																																																																			TTPA	-	pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000137561		0.323	TTPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTPA	HGNC	protein_coding	OTTHUMT00000378460.1	-	0.00	43	0	G	NM_000370		63976810	-1	tier1	-	no_errors	ENST00000260116	ensembl	human	known	74_37	silent	14.29	36	6	SNP	1.000	T
TXNRD3NB	645840	genome.wustl.edu	37	3	126291232	126291232	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:126291232T>C	ENST00000404489.2	-	1	247	c.155A>G	c.(154-156)aAg>aGg	p.K52R	TXNRD3NB_ENST00000383572.2_Missense_Mutation_p.K52R			Q6F5E7	TR3N_HUMAN	thioredoxin reductase 3 neighbor	52										endometrium(1)|large_intestine(2)|skin(2)	5						TCCAAAAACCTTGTCTCCATG	0.572																																																	0													63.0	68.0	66.0					3																	126291232		2203	4300	6503	SO:0001583	missense	0			BC130546	CCDS33846.1	3q21.3	2011-04-13	2011-04-13	2011-04-13	ENSG00000206483	ENSG00000206483			33870	protein-coding gene	gene with protein product	"""thioredoxin reductase 3 new transcript 1"""		"""thioredoxin reductase 3 intronic transcript 1"""	TXNRD3IT1		15674732	Standard	NM_001039783		Approved	TR2IT1, TXNRD3NT1	uc003ejc.3	Q6F5E7	OTTHUMG00000162732	ENST00000404489.2:c.155A>G	3.37:g.126291232T>C	ENSP00000384071:p.Lys52Arg			Missense_Mutation	SNP	NULL	p.K52R	ENST00000404489.2	37	c.155	CCDS33846.1	3	.	.	.	.	.	.	.	.	.	.	T	1.455	-0.563958	0.03939	.	.	ENSG00000206483	ENST00000383572;ENST00000404489	.	.	.	0.661	-0.769	0.11009	.	.	.	.	.	T	0.30603	0.0770	N	0.08118	0	0.09310	N	1	D	0.60575	0.988	P	0.62885	0.908	T	0.20207	-1.0282	7	0.87932	D	0	.	.	.	.	.	52	Q6F5E7	TR3N_HUMAN	R	52	.	ENSP00000373066:K52R	K	-	2	0	TXNRD3NB	127773922	0.009000	0.17119	0.002000	0.10522	0.001000	0.01503	0.782000	0.26788	-0.310000	0.08766	-0.456000	0.05471	AAG	TXNRD3NB	-	NULL	ENSG00000206483		0.572	TXNRD3NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNRD3NB	HGNC	protein_coding	OTTHUMT00000370233.2	-	0.00	32	0	T	NM_001039783		126291232	-1	tier1	-	no_errors	ENST00000383572	ensembl	human	known	74_37	missense	15.69	43	8	SNP	0.003	C
UBE2V1	7335	genome.wustl.edu	37	20	48698186	48698186	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr20:48698186C>T	ENST00000371674.3	-	0	1607				UBE2V1_ENST00000371657.5_3'UTR|UBE2V1_ENST00000415862.2_3'UTR|TMEM189-UBE2V1_ENST00000341698.2_3'UTR|UBE2V1_ENST00000420027.2_3'UTR|TMEM189_ENST00000557021.1_3'UTR|UBE2V1_ENST00000340309.3_3'UTR|UBE2V1_ENST00000396059.3_5'UTR|UBE2V1_ENST00000371677.3_3'UTR	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1						cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			CAAATGAAAGCCCTGTTTAAA	0.398																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.*1119G>A	20.37:g.48698186C>T			E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	RNA	SNP	-	NULL	ENST00000371674.3	37	NULL	CCDS33483.1	20																																																																																			UBE2V1	-	-	ENSG00000244687		0.398	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	UBE2V1	HGNC	protein_coding	OTTHUMT00000080530.1	-	0.00	9	0	C	NM_021988		48698186	-1	tier1	-	no_errors	ENST00000396059	ensembl	human	known	74_37	rna	53.85	6	7	SNP	0.035	T
UBQLNL	143630	genome.wustl.edu	37	11	5537319	5537319	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:5537319G>A	ENST00000380184.1	-	1	616	c.353C>T	c.(352-354)aCg>aTg	p.T118M	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	118										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GGGATCATTCGTTGGCAGGTC	0.547																																																	0													175.0	168.0	171.0					11																	5537319		2201	4297	6498	SO:0001583	missense	0			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.353C>T	11.37:g.5537319G>A	ENSP00000369531:p.Thr118Met		Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.T118M	ENST00000380184.1	37	c.353	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	G	9.591	1.126202	0.20959	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.56776	0.44	5.14	2.22	0.28083	.	0.918070	0.09055	N	0.855142	T	0.58949	0.2158	M	0.63428	1.95	0.09310	N	1	D	0.71674	0.998	P	0.52514	0.701	T	0.47129	-0.9141	10	0.72032	D	0.01	.	7.6787	0.28500	0.2772:0.0:0.7228:0.0	.	118	Q8IYU4	UBQLN_HUMAN	M	118	ENSP00000369531:T118M	ENSP00000369531:T118M	T	-	2	0	UBQLNL	5493895	0.000000	0.05858	0.006000	0.13384	0.039000	0.13416	0.048000	0.14078	0.559000	0.29153	0.585000	0.79938	ACG	UBQLNL	-	NULL	ENSG00000175518		0.547	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	HGNC	protein_coding	OTTHUMT00000143386.1	-	0.00	26	0	G	NM_145053		5537319	-1	tier1	-	no_errors	ENST00000380184	ensembl	human	putative	74_37	missense	27.66	34	13	SNP	0.000	A
UHRF1BP1L	23074	genome.wustl.edu	37	12	100452004	100452004	+	Silent	SNP	C	C	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:100452004C>T	ENST00000279907.7	-	14	3263	c.3051G>A	c.(3049-3051)tcG>tcA	p.S1017S	UHRF1BP1L_ENST00000545232.2_Silent_p.S667S	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	1017										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						AAAGTATATTCGAATCTTCTC	0.308																																																	0													65.0	70.0	68.0					12																	100452004		2202	4297	6499	SO:0001819	synonymous_variant	0				CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.3051G>A	12.37:g.100452004C>T			A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Silent	SNP	NULL	p.S1017	ENST00000279907.7	37	c.3051	CCDS31882.1	12																																																																																			UHRF1BP1L	-	NULL	ENSG00000111647		0.308	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1L	HGNC	protein_coding	OTTHUMT00000407875.1	-	0.00	53	0	C	NM_001006947		100452004	-1	tier1	-	no_errors	ENST00000279907	ensembl	human	known	74_37	silent	42.86	24	18	SNP	0.001	T
UNC13C	440279	genome.wustl.edu	37	15	54860049	54860049	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:54860049A>C	ENST00000260323.11	+	29	6010	c.6010A>C	c.(6010-6012)Agc>Cgc	p.S2004R	UNC13C_ENST00000545554.1_Missense_Mutation_p.S2004R|UNC13C_ENST00000537900.1_Missense_Mutation_p.S2002R	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2004	MHD2. {ECO:0000255|PROSITE- ProRule:PRU00588}.				exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTTGGAGAAAAGCCCAGATCT	0.368																																																	0													66.0	63.0	64.0					15																	54860049		1798	4070	5868	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6010A>C	15.37:g.54860049A>C	ENSP00000260323:p.Ser2004Arg		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.S2004R	ENST00000260323.11	37	c.6010	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	A	26.6	4.753846	0.89843	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.76968	-1.06;-1.06;-1.06	5.91	5.91	0.95273	Mammalian uncoordinated homology 13, domain 2 (1);Mammalian uncoordinated homology 13, subgroup, domain 2 (1);	0.081891	0.85682	D	0.000000	D	0.89511	0.6736	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91197	0.4988	10	0.87932	D	0	.	15.5243	0.75890	1.0:0.0:0.0:0.0	.	2004	Q8NB66	UN13C_HUMAN	R	2004;2004;2002	ENSP00000260323:S2004R;ENSP00000438156:S2004R;ENSP00000442569:S2002R	ENSP00000260323:S2004R	S	+	1	0	UNC13C	52647341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.273000	0.95719	2.263000	0.75096	0.377000	0.23210	AGC	UNC13C	-	pfam_Munc13_subgr_dom-2	ENSG00000137766		0.368	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	56	0	A	NM_173166		54860049	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	46.34	22	19	SNP	1.000	C
UPF1	5976	genome.wustl.edu	37	19	18972934	18972934	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:18972934G>T	ENST00000599848.1	+	18	2815	c.2606G>T	c.(2605-2607)cGt>cTt	p.R869L	UPF1_ENST00000262803.5_Missense_Mutation_p.R858L			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	869					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						GACCCCAGGCGTCTGAACGTG	0.597																																																	0													92.0	81.0	85.0					19																	18972934		2203	4300	6503	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2606G>T	19.37:g.18972934G>T	ENSP00000470142:p.Arg869Leu		O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase	p.R869L	ENST00000599848.1	37	c.2606		19	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648802	0.67358	.	.	ENSG00000005007	ENST00000262803	D	0.95853	-3.83	5.06	5.06	0.68205	.	0.111999	0.64402	D	0.000008	D	0.98858	0.9614	H	0.99726	4.73	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.70487	0.969;0.948	D	0.99136	1.0854	10	0.87932	D	0	-26.204	15.5613	0.76249	0.0:0.0:1.0:0.0	.	869;858	Q92900;Q92900-2	RENT1_HUMAN;.	L	858	ENSP00000262803:R858L	ENSP00000262803:R858L	R	+	2	0	UPF1	18833934	1.000000	0.71417	0.544000	0.28141	0.063000	0.16089	9.396000	0.97270	2.341000	0.79615	0.563000	0.77884	CGT	UPF1	-	superfamily_P-loop_NTPase	ENSG00000005007		0.597	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1		0.00	33	0	G	NM_002911		18972934	+1			no_errors	ENST00000599848	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216251460	216251460	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr1:216251460T>G	ENST00000307340.3	-	27	5929	c.5543A>C	c.(5542-5544)aAc>aCc	p.N1848T	USH2A_ENST00000366943.2_Missense_Mutation_p.N1848T|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1848	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.N1848T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTGATAAGAGTTCAGCAGTTC	0.463										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	large_intestine(1)											80.0	84.0	83.0					1																	216251460		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5543A>C	1.37:g.216251460T>G	ENSP00000305941:p.Asn1848Thr		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.N1848T	ENST00000307340.3	37	c.5543	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	13.63	2.294179	0.40594	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77489	-1.1;-1.1	5.01	-0.455	0.12193	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.681568	0.12407	N	0.471618	T	0.62036	0.2395	L	0.43152	1.355	0.09310	N	1	B	0.27625	0.183	B	0.31495	0.131	T	0.46148	-0.9212	10	0.10111	T	0.7	.	2.1855	0.03885	0.1149:0.2055:0.119:0.5606	.	1848	O75445	USH2A_HUMAN	T	1848	ENSP00000305941:N1848T;ENSP00000355910:N1848T	ENSP00000305941:N1848T	N	-	2	0	USH2A	214318083	0.001000	0.12720	0.000000	0.03702	0.411000	0.31082	1.045000	0.30341	-0.368000	0.08040	-0.297000	0.09499	AAC	USH2A	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G	ENSG00000042781		0.463	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	48	0	T	NM_007123		216251460	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	19.67	48	12	SNP	0.000	G
VIM	7431	genome.wustl.edu	37	10	17277328	17277328	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:17277328A>C	ENST00000224237.5	+	6	1314	c.1169A>C	c.(1168-1170)aAg>aCg	p.K390T	VIM_ENST00000544301.1_Missense_Mutation_p.K390T|RP11-124N14.3_ENST00000456355.1_RNA			P08670	VIME_HUMAN	vimentin	390	Coil 2.|Rod.				apoptotic process (GO:0006915)|astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular component movement (GO:0006928)|intermediate filament organization (GO:0045109)|lens fiber cell development (GO:0070307)|muscle filament sliding (GO:0030049)|negative regulation of neuron projection development (GO:0010977)|positive regulation of gene expression (GO:0010628)|viral process (GO:0016032)	cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|neuron projection (GO:0043005)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	double-stranded RNA binding (GO:0003725)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CTCAATGTTAAGATGGCCCTT	0.498																																																	0													138.0	125.0	129.0					10																	17277328		2203	4300	6503	SO:0001583	missense	0			M14144	CCDS7120.1	10p13	2013-01-16			ENSG00000026025	ENSG00000026025		"""Intermediate filaments type III"""	12692	protein-coding gene	gene with protein product		193060					Standard	NM_003380		Approved		uc001iou.2	P08670	OTTHUMG00000017744	ENST00000224237.5:c.1169A>C	10.37:g.17277328A>C	ENSP00000224237:p.Lys390Thr		B0YJC2|D3DRU4|Q15867|Q15868|Q15869|Q548L2|Q6LER9|Q8N850|Q96ML2|Q9NTM3	Missense_Mutation	SNP	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin	p.K390T	ENST00000224237.5	37	c.1169	CCDS7120.1	10	.	.	.	.	.	.	.	.	.	.	A	31	5.095577	0.94197	.	.	ENSG00000026025	ENST00000544301;ENST00000224237;ENST00000545533	D;D	0.94862	-3.54;-3.54	5.87	5.87	0.94306	Filament (1);	0.420938	0.19650	N	0.109243	D	0.98485	0.9495	H	0.98314	4.2	0.80722	D	1	D;D;D;D	0.67145	0.986;0.996;0.996;0.986	D;D;D;D	0.74348	0.961;0.961;0.983;0.961	D	0.99851	1.1072	10	0.87932	D	0	.	16.3222	0.82954	1.0:0.0:0.0:0.0	.	390;377;390;390	Q53HU8;F5H288;B0YJC4;P08670	.;.;.;VIME_HUMAN	T	390;390;377	ENSP00000446007:K390T;ENSP00000224237:K390T	ENSP00000224237:K390T	K	+	2	0	VIM	17317334	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	9.331000	0.96430	2.246000	0.74042	0.519000	0.50382	AAG	VIM	-	pfam_IF	ENSG00000026025		0.498	VIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIM	HGNC	protein_coding	OTTHUMT00000047015.1	-	0.00	49	0	A	NM_003380		17277328	+1	tier1	-	no_errors	ENST00000224237	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	C
VAX1	11023	genome.wustl.edu	37	10	118896157	118896157	+	Silent	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr10:118896157G>T	ENST00000369206.5	-	2	254	c.255C>A	c.(253-255)tcC>tcA	p.S85S	VAX1_ENST00000277905.2_Silent_p.S85S	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	85					axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		TCTCTCGGATGGACCCCTTGG	0.642																																																	0													46.0	39.0	41.0					10																	118896157		2202	4298	6500	SO:0001819	synonymous_variant	0			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.255C>A	10.37:g.118896157G>T			B1AVW5|Q6ZSX0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.S85	ENST00000369206.5	37	c.255	CCDS44483.1	10																																																																																			VAX1	-	superfamily_Homeodomain-like	ENSG00000148704		0.642	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	HGNC	protein_coding	OTTHUMT00000050559.3	-	0.00	106	0	G	XM_301242		118896157	-1	tier1	-	no_errors	ENST00000369206	ensembl	human	known	74_37	silent	38.14	60	37	SNP	0.999	T
VN1R4	317703	genome.wustl.edu	37	19	53770563	53770563	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:53770563A>C	ENST00000311170.4	-	1	409	c.356T>G	c.(355-357)cTt>cGt	p.L119R	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	119					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		TTTCTCTTTAAGTTTTGCCCA	0.507										HNSCC(26;0.072)																																							0													60.0	46.0	51.0					19																	53770563		2203	4300	6503	SO:0001583	missense	0			AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.356T>G	19.37:g.53770563A>C	ENSP00000310856:p.Leu119Arg		Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.L119R	ENST00000311170.4	37	c.356	CCDS33099.1	19	.	.	.	.	.	.	.	.	.	.	A	8.374	0.835983	0.16891	.	.	ENSG00000228567	ENST00000311170	T	0.10668	2.85	2.28	2.28	0.28536	GPCR, rhodopsin-like superfamily (1);	0.000000	0.27659	N	0.018382	T	0.36552	0.0971	M	0.92784	3.345	0.09310	N	1	D	0.89917	1.0	D	0.77004	0.989	T	0.10894	-1.0610	10	0.87932	D	0	.	8.5532	0.33465	1.0:0.0:0.0:0.0	.	119	Q7Z5H5	VN1R4_HUMAN	R	119	ENSP00000310856:L119R	ENSP00000310856:L119R	L	-	2	0	VN1R4	58462375	0.174000	0.23070	0.012000	0.15200	0.012000	0.07955	2.107000	0.41844	1.312000	0.45043	0.445000	0.29226	CTT	VN1R4	-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	ENSG00000228567		0.507	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R4	HGNC	protein_coding	OTTHUMT00000464287.1	-	0.00	274	0	A	NM_173857		53770563	-1	tier1	-	no_errors	ENST00000311170	ensembl	human	known	74_37	missense	21.82	215	60	SNP	0.153	C
WIF1	11197	genome.wustl.edu	37	12	65445161	65445161	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr12:65445161G>A	ENST00000286574.4	-	10	1482	c.1108C>T	c.(1108-1110)Cgg>Tgg	p.R370W		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	370					multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		GGTGGATCCCGCCGCTCCTCG	0.498			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0													69.0	69.0	69.0					12																	65445161		2203	4300	6503	SO:0001583	missense	0			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.1108C>T	12.37:g.65445161G>A	ENSP00000286574:p.Arg370Trp		Q6UXI1|Q8WVG4	Missense_Mutation	SNP	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.R370W	ENST00000286574.4	37	c.1108	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	G	14.32	2.498790	0.44455	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;T	0.89050	-2.46;-0.98	5.43	3.52	0.40303	.	0.830172	0.10982	N	0.612632	T	0.77164	0.4090	N	0.14661	0.345	0.26931	N	0.966456	P	0.44260	0.83	B	0.29942	0.109	T	0.62760	-0.6786	9	.	.	.	.	14.8701	0.70450	0.0:0.0:0.7301:0.2699	.	370	Q9Y5W5	WIF1_HUMAN	W	370;119	ENSP00000286574:R370W;ENSP00000439024:R119W	.	R	-	1	2	WIF1	63731428	1.000000	0.71417	0.140000	0.22221	0.928000	0.56348	4.925000	0.63425	0.864000	0.35578	0.643000	0.83706	CGG	WIF1	-	NULL	ENSG00000156076		0.498	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	HGNC	protein_coding	OTTHUMT00000401258.2		0.00	18	0	G			65445161	-1			no_errors	ENST00000286574	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.893	A
WNK3	65267	genome.wustl.edu	37	X	54259372	54259372	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chrX:54259372T>A	ENST00000375159.2	-	20	4709	c.4710A>T	c.(4708-4710)aaA>aaT	p.K1570N	WNK3_ENST00000375169.3_Missense_Mutation_p.K1523N|WNK3_ENST00000354646.2_Missense_Mutation_p.K1570N			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1570					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TTTTGCTATCTTTAATTGACC	0.458																																																	0													152.0	137.0	142.0					X																	54259372		2203	4300	6503	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4710A>T	X.37:g.54259372T>A	ENSP00000364301:p.Lys1570Asn		B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K1570N	ENST00000375159.2	37	c.4710	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	T	16.91	3.252260	0.59212	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.73152	-0.72;-0.69;-0.69	5.69	5.69	0.88448	.	0.101750	0.43260	D	0.000582	T	0.60779	0.2295	L	0.44542	1.39	0.40111	D	0.976482	P;P	0.46512	0.879;0.808	B;B	0.39840	0.311;0.164	T	0.66905	-0.5805	10	0.72032	D	0.01	-12.656	8.5423	0.33399	0.0:0.0885:0.0:0.9115	.	1523;1570	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	N	1523;1570;1570	ENSP00000364312:K1523N;ENSP00000346667:K1570N;ENSP00000364301:K1570N	ENSP00000346667:K1570N	K	-	3	2	WNK3	54276097	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.084000	0.50143	1.904000	0.55121	0.481000	0.45027	AAA	WNK3	-	NULL	ENSG00000196632		0.458	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	-	0.00	40	0	T	NM_020922		54259372	-1	tier1	-	no_errors	ENST00000354646	ensembl	human	known	74_37	missense	61.29	24	38	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168100949	168100949	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:168100949G>T	ENST00000409195.1	+	9	3136	c.3047G>T	c.(3046-3048)aGc>aTc	p.S1016I	XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S1016I|XIRP2_ENST00000409273.1_Missense_Mutation_p.S794I|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	841					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GATGTAAGAAGCTGTAGGTGG	0.378																																																	0													67.0	62.0	63.0					2																	168100949		1860	4105	5965	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3047G>T	2.37:g.168100949G>T	ENSP00000386840:p.Ser1016Ile		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.S1016I	ENST00000409195.1	37	c.3047	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	12.87	2.068238	0.36470	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.35789	1.29;1.29;1.29	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.55800	0.1943	L	0.57536	1.79	0.54753	D	0.999989	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.75484	0.986;0.976;0.976	T	0.55418	-0.8144	10	0.87932	D	0	-12.3507	13.3977	0.60863	0.075:0.0:0.925:0.0	.	841;841;794	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	I	1016;1016;794	ENSP00000386840:S1016I;ENSP00000295237:S1016I;ENSP00000387255:S794I	ENSP00000295237:S1016I	S	+	2	0	XIRP2	167809195	0.992000	0.36948	0.991000	0.47740	0.578000	0.36192	2.242000	0.43106	2.894000	0.99253	0.655000	0.94253	AGC	XIRP2	-	pfam_Actin-binding_Xin_repeat	ENSG00000163092		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1		0.00	27	0	G	NM_152381		168100949	+1			no_errors	ENST00000295237	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.971	T
ZBTB16	7704	genome.wustl.edu	37	11	114112974	114112974	+	Silent	SNP	G	G	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr11:114112974G>A	ENST00000335953.4	+	5	1919	c.1539G>A	c.(1537-1539)gcG>gcA	p.A513A	ZBTB16_ENST00000392996.2_Silent_p.A513A|RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000535379.1_3'UTR	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	513					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		AGGTCCACGCGGGCGTGCGCA	0.627																																																	0													73.0	56.0	62.0					11																	114112974		2201	4296	6497	SO:0001819	synonymous_variant	0			Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1539G>A	11.37:g.114112974G>A			Q8TAL4	Silent	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A513	ENST00000335953.4	37	c.1539	CCDS8367.1	11																																																																																			ZBTB16	-	pfscan_Znf_C2H2	ENSG00000109906		0.627	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB16	HGNC	protein_coding	OTTHUMT00000398940.1		0.00	22	0	G	NM_006006		114112974	+1			no_errors	ENST00000335953	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.850	A
ZIC4	84107	genome.wustl.edu	37	3	147105640	147105640	+	3'UTR	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr3:147105640T>G	ENST00000383075.3	-	0	2523				ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000525172.2_3'UTR|ZIC4_ENST00000425731.3_3'UTR|ZIC4_ENST00000472749.2_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GGTGGCTCCCTTCCCCCCAAG	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*1006A>C	3.37:g.147105640T>G			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.498	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	9	0	T			147105640	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	80.00	1	4	SNP	0.000	G
ZNF208	7757	genome.wustl.edu	37	19	22157155	22157155	+	Missense_Mutation	SNP	T	T	A	rs61748342	byFrequency	TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:22157155T>A	ENST00000397126.4	-	4	829	c.681A>T	c.(679-681)aaA>aaT	p.K227N	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATCTGTAGGGTTTCTCTCCAG	0.363																																																	0													52.0	57.0	55.0					19																	22157155		2097	4235	6332	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.681A>T	19.37:g.22157155T>A	ENSP00000380315:p.Lys227Asn			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K227N	ENST00000397126.4	37	c.681	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	13.16	2.154999	0.38021	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.26067	1.76	2.93	-2.37	0.06643	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17831	0.0428	.	.	.	0.09310	N	1	B	0.29909	0.261	B	0.32090	0.14	T	0.31971	-0.9924	8	0.87932	D	0	.	5.191	0.15209	0.0:0.5176:0.1803:0.3021	.	227	O43345	ZN208_HUMAN	N	227	ENSP00000380315:K227N	ENSP00000380315:K227N	K	-	3	2	ZNF208	21948995	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.341000	0.07811	-0.369000	0.08028	-0.736000	0.03550	AAA	ZNF208	-	pfscan_Znf_C2H2	ENSG00000160321		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	37	0	T	NM_007153		22157155	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	29.41	36	15	SNP	0.030	A
ZNF296	162979	genome.wustl.edu	37	19	45575374	45575374	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:45575374C>G	ENST00000303809.2	-	3	1127	c.913G>C	c.(913-915)Gag>Cag	p.E305Q		NM_145288.1	NP_660331.1	Q8WUU4	ZN296_HUMAN	zinc finger protein 296	305					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|lung(3)|prostate(1)|urinary_tract(2)	7						ACAGCCGGCTCCGGAGGGGCT	0.711																																																	0													23.0	30.0	28.0					19																	45575374		2176	4272	6448	SO:0001583	missense	0			BC019352	CCDS12653.1	19q13.32	2013-01-08	2008-06-24	2008-06-24		ENSG00000170684		"""Zinc fingers, C2H2-type"""	15981	protein-coding gene	gene with protein product		613226	"""zinc finger protein 342"""	ZNF342		11063263, 14633674	Standard	NM_145288		Approved		uc002pao.3	Q8WUU4		ENST00000303809.2:c.913G>C	19.37:g.45575374C>G	ENSP00000302770:p.Glu305Gln			Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E305Q	ENST00000303809.2	37	c.913	CCDS12653.1	19	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960046	0.34565	.	.	ENSG00000170684	ENST00000303809;ENST00000545481	T	0.04758	3.56	5.87	3.75	0.43078	.	0.481200	0.18473	N	0.140147	T	0.08935	0.0221	L	0.29908	0.895	0.24841	N	0.992461	D	0.64830	0.994	P	0.56278	0.795	T	0.10291	-1.0636	10	0.87932	D	0	-16.9039	10.5994	0.45358	0.0:0.8434:0.0:0.1566	.	305	Q8WUU4	ZN296_HUMAN	Q	305;281	ENSP00000302770:E305Q	ENSP00000302770:E305Q	E	-	1	0	ZNF296	50267214	0.001000	0.12720	0.565000	0.28409	0.107000	0.19398	1.391000	0.34475	0.822000	0.34565	0.563000	0.77884	GAG	ZNF296	-	NULL	ENSG00000170684		0.711	ZNF296-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF296	HGNC	protein_coding	OTTHUMT00000457529.1	-	0.00	31	0	C	NM_145288		45575374	-1	tier1	-	no_errors	ENST00000303809	ensembl	human	known	74_37	missense	25.00	21	7	SNP	0.851	G
ZNF385B	151126	genome.wustl.edu	37	2	180308086	180308086	+	Missense_Mutation	SNP	C	C	T	rs530550928		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr2:180308086C>T	ENST00000410066.1	-	10	1910	c.1307G>A	c.(1306-1308)cGg>cAg	p.R436Q	ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000409692.1_Missense_Mutation_p.R334Q|ZNF385B_ENST00000336917.5_Missense_Mutation_p.R334Q|ZNF385B_ENST00000409343.1_Missense_Mutation_p.R360Q	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	436	Interaction with p53/TP53.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			GGCAGAGGGCCGGGGTGGGAG	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		15195	0.001		0.0	False		,,,				2504	0.0				Colon(155;204 2491 32774 51842)												0													25.0	33.0	31.0					2																	180308086		2202	4300	6502	SO:0001583	missense	0			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.1307G>A	2.37:g.180308086C>T	ENSP00000386845:p.Arg436Gln		Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.R436Q	ENST00000410066.1	37	c.1307	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	C	12.12	1.842259	0.32513	.	.	ENSG00000144331	ENST00000410066;ENST00000336917;ENST00000409343;ENST00000409692	T;T;T;T	0.30448	1.53;1.54;1.54;1.54	5.39	5.39	0.77823	.	0.263941	0.38381	N	0.001719	T	0.40815	0.1132	L	0.29908	0.895	0.46203	D	0.998921	P;D	0.67145	0.918;0.996	B;P	0.56788	0.194;0.806	T	0.22521	-1.0214	10	0.54805	T	0.06	-19.0496	19.1606	0.93529	0.0:1.0:0.0:0.0	.	436;360	Q569K4;Q569K4-2	Z385B_HUMAN;.	Q	436;334;360;334	ENSP00000386845:R436Q;ENSP00000338225:R334Q;ENSP00000386379:R360Q;ENSP00000386507:R334Q	ENSP00000338225:R334Q	R	-	2	0	ZNF385B	180016331	1.000000	0.71417	0.924000	0.36721	0.023000	0.10783	5.703000	0.68340	2.518000	0.84900	0.561000	0.74099	CGG	ZNF385B	-	NULL	ENSG00000144331		0.637	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	-	0.00	108	0	C	NM_152520		180308086	-1	tier1	-	no_errors	ENST00000410066	ensembl	human	known	74_37	missense	32.00	85	40	SNP	1.000	T
ZNF43	7594	genome.wustl.edu	37	19	21991811	21991811	+	Missense_Mutation	SNP	G	G	T	rs149679417		TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:21991811G>T	ENST00000354959.4	-	4	1197	c.1028C>A	c.(1027-1029)aCa>aAa	p.T343K	ZNF43_ENST00000594012.1_Missense_Mutation_p.T337K|ZNF43_ENST00000598381.1_Missense_Mutation_p.T337K|ZNF43_ENST00000595461.1_Missense_Mutation_p.T337K	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TTCTTCACATGTGTAGGGTTT	0.383																																																	0																																										SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.1028C>A	19.37:g.21991811G>T	ENSP00000347045:p.Thr343Lys		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T343K	ENST00000354959.4	37	c.1028	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.412760	0.00191	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.35973	1.28	1.76	-2.18	0.07037	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09423	0.0232	N	0.01122	-1.005	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34625	-0.9821	9	0.02654	T	1	.	8.658	0.34075	0.0:0.0:0.6228:0.3772	.	343	P17038	ZNF43_HUMAN	K	342;343	ENSP00000347045:T343K	ENSP00000347045:T343K	T	-	2	0	ZNF43	21783651	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-2.438000	0.01017	-0.689000	0.05149	-0.856000	0.03024	ACA	ZNF43	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198521		0.383	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2		0.00	54	0	G	NM_003423		21991811	-1			no_errors	ENST00000354959	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	T
ZNF536	9745	genome.wustl.edu	37	19	31040352	31040352	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:31040352T>A	ENST00000355537.3	+	4	3973	c.3826T>A	c.(3826-3828)Tta>Ata	p.L1276I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	1276					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TTCTGATGGCTTAGCAGCCTT	0.542																																																	0													43.0	42.0	42.0					19																	31040352		2187	4278	6465	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.3826T>A	19.37:g.31040352T>A	ENSP00000347730:p.Leu1276Ile		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1276I	ENST00000355537.3	37	c.3826	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	T	14.36	2.511126	0.44660	.	.	ENSG00000198597	ENST00000355537	T	0.18016	2.24	5.01	2.91	0.33838	.	0.000000	0.64402	D	0.000001	T	0.11879	0.0289	L	0.32530	0.975	0.40673	D	0.982233	P;P	0.48294	0.908;0.908	B;B	0.41860	0.368;0.368	T	0.08953	-1.0697	10	0.66056	D	0.02	-8.1493	4.6929	0.12790	0.1389:0.1522:0.0:0.7089	.	1276;1276	A7E228;O15090	.;ZN536_HUMAN	I	1276	ENSP00000347730:L1276I	ENSP00000347730:L1276I	L	+	1	2	ZNF536	35732192	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	2.187000	0.42602	0.246000	0.21394	-0.297000	0.09499	TTA	ZNF536	-	NULL	ENSG00000198597		0.542	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	19	0	T	NM_014717		31040352	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	41.18	10	7	SNP	1.000	A
ZNF568	374900	genome.wustl.edu	37	19	37440578	37440578	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:37440578T>G	ENST00000333987.7	+	7	1029	c.523T>G	c.(523-525)Ttc>Gtc	p.F175V	ZNF568_ENST00000427117.1_Intron|ZNF568_ENST00000415168.1_Missense_Mutation_p.F111V|ZNF568_ENST00000455427.2_Intron	NM_001204835.1|NM_198539.3	NP_001191764.1|NP_940941.2	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	175					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAGACAAAGCTTCTATGACTG	0.338																																																	0													98.0	90.0	93.0					19																	37440578		1849	4096	5945	SO:0001583	missense	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000333987.7:c.523T>G	19.37:g.37440578T>G	ENSP00000334685:p.Phe175Val		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F175V	ENST00000333987.7	37	c.523	CCDS42558.1	19	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.862372	0.00552	.	.	ENSG00000198453	ENST00000333987;ENST00000415168	T;T	0.06933	3.24;3.24	4.25	0.926	0.19430	.	0.412447	0.18033	N	0.153853	T	0.04227	0.0117	N	0.20986	0.625	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43556	-0.9384	10	0.17369	T	0.5	.	2.9966	0.06000	0.1904:0.3236:0.0:0.4859	.	175	Q3ZCX4	ZN568_HUMAN	V	175;111	ENSP00000334685:F175V;ENSP00000394514:F111V	ENSP00000334685:F175V	F	+	1	0	ZNF568	42132418	0.001000	0.12720	0.001000	0.08648	0.007000	0.05969	0.113000	0.15499	-0.006000	0.14370	-0.333000	0.08304	TTC	ZNF568	-	NULL	ENSG00000198453		0.338	ZNF568-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000109572.2	-	0.00	48	0	T	NM_198539		37440578	+1	tier1	-	no_errors	ENST00000333987	ensembl	human	known	74_37	missense	12.20	36	5	SNP	0.002	G
ZNF582	147948	genome.wustl.edu	37	19	56896406	56896406	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:56896406T>C	ENST00000301310.4	-	5	538	c.380A>G	c.(379-381)cAg>cGg	p.Q127R	AC006116.12_ENST00000589671.1_RNA|ZNF582_ENST00000586929.1_Missense_Mutation_p.Q127R	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	127					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TCTGTCAAACTGGTTTCTGCA	0.413																																					Ovarian(183;1887 2032 4349 30507 51343)												0													177.0	171.0	173.0					19																	56896406		2203	4300	6503	SO:0001583	missense	0			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.380A>G	19.37:g.56896406T>C	ENSP00000301310:p.Gln127Arg		B4DQZ9|B7Z9R3|Q6PJT6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q127R	ENST00000301310.4	37	c.380	CCDS33121.1	19	.	.	.	.	.	.	.	.	.	.	T	6.678	0.493662	0.12702	.	.	ENSG00000018869	ENST00000301310	T	0.05513	3.43	5.31	-10.6	0.00265	.	0.313555	0.18495	N	0.139527	T	0.02230	0.0069	L	0.29908	0.895	0.09310	N	1	B;B	0.29432	0.244;0.244	B;B	0.23574	0.047;0.047	T	0.31503	-0.9941	10	0.12103	T	0.63	.	3.1416	0.06457	0.1947:0.4397:0.159:0.2066	.	127;158	Q96NG8;B4DQZ9	ZN582_HUMAN;.	R	127	ENSP00000301310:Q127R	ENSP00000301310:Q127R	Q	-	2	0	ZNF582	61588218	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-7.570000	0.00034	-2.596000	0.00453	-0.438000	0.05819	CAG	ZNF582	-	NULL	ENSG00000018869		0.413	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	-	0.00	98	0	T	NM_144690		56896406	-1	tier1	-	no_errors	ENST00000301310	ensembl	human	known	74_37	missense	9.20	79	8	SNP	0.000	C
ZNF592	9640	genome.wustl.edu	37	15	85334024	85334024	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr15:85334024G>T	ENST00000560079.2	+	5	2597	c.2309G>T	c.(2308-2310)tGc>tTc	p.C770F	ZNF592_ENST00000299927.3_Missense_Mutation_p.C770F	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	770					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCTACTGCTGCCCGGAGTGT	0.582																																																	0													126.0	109.0	114.0					15																	85334024		2203	4299	6502	SO:0001583	missense	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.2309G>T	15.37:g.85334024G>T	ENSP00000452877:p.Cys770Phe		Q2M1T2|Q504Y9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C770F	ENST00000560079.2	37	c.2309	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671357	0.88348	.	.	ENSG00000166716	ENST00000299927	T	0.58940	0.3	5.61	5.61	0.85477	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.82990	0.5157	H	0.94462	3.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.87487	0.2424	10	0.87932	D	0	-13.8176	17.145	0.86764	0.0:0.0:1.0:0.0	.	770	Q92610	ZN592_HUMAN	F	770	ENSP00000299927:C770F	ENSP00000299927:C770F	C	+	2	0	ZNF592	83135028	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.753000	0.98904	2.646000	0.89796	0.563000	0.77884	TGC	ZNF592	-	smart_Znf_C2H2-like	ENSG00000166716		0.582	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	-	0.00	67	0	G	NM_014630		85334024	+1	tier1	-	no_errors	ENST00000299927	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ZNF667	63934	genome.wustl.edu	37	19	56973713	56973713	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:56973713T>G	ENST00000504904.3	-	4	746	c.27A>C	c.(25-27)aaA>aaC	p.K9N	ZNF667_ENST00000342634.3_Missense_Mutation_p.K102N|ZNF667_ENST00000591790.1_Missense_Mutation_p.K9N|ZNF667_ENST00000292069.6_Missense_Mutation_p.K9N			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TTACCTTGGATTTGGATTTCC	0.532																																																	0													252.0	204.0	220.0					19																	56973713		2203	4300	6503	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.27A>C	19.37:g.56973713T>G	ENSP00000439402:p.Lys9Asn		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K102N	ENST00000504904.3	37	c.306	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	T	11.56	1.674570	0.29693	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069	T;T;T	0.05649	3.41;3.46;3.46	4.21	-2.16	0.07080	Krueppel-associated box (1);	0.410133	0.17850	N	0.159882	T	0.02767	0.0083	N	0.17474	0.49	0.09310	N	1	P	0.41313	0.745	B	0.34301	0.179	T	0.49551	-0.8928	10	0.17832	T	0.49	-4.369	8.7472	0.34594	0.0:0.5148:0.0:0.4852	.	9	Q5HYK9	ZN667_HUMAN	N	102;9;9	ENSP00000344699:K102N;ENSP00000439402:K9N;ENSP00000292069:K9N	ENSP00000292069:K9N	K	-	3	2	ZNF667	61665525	0.000000	0.05858	0.002000	0.10522	0.300000	0.27592	-1.115000	0.03289	-0.529000	0.06358	0.383000	0.25322	AAA	ZNF667	-	superfamily_Krueppel-associated_box	ENSG00000198046		0.532	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	79	0	T	NM_022103		56973713	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	8.16	90	8	SNP	0.004	G
ZNF680	340252	genome.wustl.edu	37	7	63982586	63982586	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr7:63982586G>C	ENST00000309683.6	-	4	697	c.546C>G	c.(544-546)ttC>ttG	p.F182L	ZNF680_ENST00000476563.1_5'UTR	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	182					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				CTTTACATTTGAAAACCTTCT	0.303																																																	0													49.0	46.0	47.0					7																	63982586		2201	4299	6500	SO:0001583	missense	0			AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.546C>G	7.37:g.63982586G>C	ENSP00000309330:p.Phe182Leu		B3KVJ4|Q6ZNF3|Q8NC79	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F182L	ENST00000309683.6	37	c.546	CCDS34644.1	7	.	.	.	.	.	.	.	.	.	.	g	9.177	1.022500	0.19433	.	.	ENSG00000173041	ENST00000309683	T	0.58060	0.36	1.36	-0.584	0.11702	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48352	0.1495	M	0.62154	1.92	0.31648	N	0.647126	P	0.48407	0.91	P	0.46685	0.524	T	0.54715	-0.8252	9	0.59425	D	0.04	.	3.4423	0.07468	0.5821:0.0:0.4179:0.0	.	182	Q8NEM1	ZN680_HUMAN	L	182	ENSP00000309330:F182L	ENSP00000309330:F182L	F	-	3	2	ZNF680	63620021	0.000000	0.05858	0.010000	0.14722	0.178000	0.23041	-0.200000	0.09478	-0.178000	0.10672	0.491000	0.48974	TTC	ZNF680	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173041		0.303	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF680	HGNC	protein_coding	OTTHUMT00000344568.1	-	0.00	76	0	G	NM_178558		63982586	-1	tier1	-	no_errors	ENST00000309683	ensembl	human	known	74_37	missense	47.13	46	41	SNP	0.241	C
ZNF83	55769	genome.wustl.edu	37	19	53157444	53157444	+	5'UTR	SNP	A	A	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:53157444A>C	ENST00000600457.1	-	0	475				ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_Intron|CTD-3099C6.9_ENST00000598322.1_RNA|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000598536.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTACCAGTCAACTTTTTGATT	0.393																																																	0																																										SO:0001623	5_prime_UTR_variant	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000600457.1:c.-121T>G	19.37:g.53157444A>C			A8MT75|Q3ZCX0|Q6PI08	RNA	SNP	-	NULL	ENST00000600457.1	37	NULL		19																																																																																			ZNF83	-	-	ENSG00000167766		0.393	ZNF83-013	KNOWN	basic	processed_transcript	ZNF83	HGNC	protein_coding	OTTHUMT00000463711.1	-	0.00	119	0	A	NM_018300		53157444	-1	tier1	-	no_errors	ENST00000600457	ensembl	human	known	74_37	rna	19.42	83	20	SNP	0.000	C
ZNF883	169834	genome.wustl.edu	37	9	115760170	115760171	+	lincRNA	INS	-	-	TT			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr9:115760170_115760171insTT	ENST00000427548.1	-	0	1642_1643							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										CAAGGATAGGGTTTTTCTCCAG	0.376																																																	0																																												0			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760173_115760174dupTT				RNA	INS	-	NULL	ENST00000427548.1	37	NULL		9																																																																																			ZNF883	-	-	ENSG00000228623		0.376	ZNF883-001	KNOWN	basic	lincRNA	ZNF883	HGNC	lincRNA	OTTHUMT00000053704.1		0.00	33	0	-	NM_001101338		115760171	-1	tier1		no_errors	ENST00000427548	ensembl	human	known	74_37	rna	23.81	32	10	INS	1.000:1.000	TT
ZNF99	7652	genome.wustl.edu	37	19	22942052	22942052	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OT-01A-11D-A28B-09	TCGA-L5-A4OT-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	2c72cd7c-a75c-4cec-b906-195a719b282a	eb5fbbea-f23a-43fa-9799-e24846ff415b	g.chr19:22942052T>C	ENST00000596209.1	-	4	749	c.659A>G	c.(658-660)aAg>aGg	p.K220R	ZNF99_ENST00000397104.3_Intron	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATGAATTATCTTATGTTTAAT	0.308																																																	0																																										SO:0001583	missense	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.659A>G	19.37:g.22942052T>C	ENSP00000472969:p.Lys220Arg		M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K220R	ENST00000596209.1	37	c.659	CCDS59369.1	19																																																																																			ZNF99	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.308	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	43	0	T	XM_065124		22942052	-1	tier1	-	no_errors	ENST00000596209	ensembl	human	novel	74_37	missense	21.62	29	8	SNP	0.001	C
