#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AASDH	132949	genome.wustl.edu	37	4	57220240	57220240	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:57220240G>A	ENST00000205214.6	-	8	1528	c.1348C>T	c.(1348-1350)Cat>Tat	p.H450Y	AASDH_ENST00000513376.1_Missense_Mutation_p.H350Y|AASDH_ENST00000502617.1_Missense_Mutation_p.H450Y|AASDH_ENST00000510762.1_5'Flank|AASDH_ENST00000602986.1_Missense_Mutation_p.H297Y|AASDH_ENST00000434343.2_Intron|AASDH_ENST00000451613.1_Missense_Mutation_p.H450Y	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	450					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				CGTTTGCCATGACGTTTGATC	0.378																																																	0													102.0	95.0	97.0					4																	57220240		2202	4300	6502	SO:0001583	missense	0			AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.1348C>T	4.37:g.57220240G>A	ENSP00000205214:p.His450Tyr		A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl_carrier_prot-like,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Acyl_carrier_prot-like,smart_PQQ_beta_propeller_repeat,pfscan_Acyl_carrier_prot-like	p.H450Y	ENST00000205214.6	37	c.1348	CCDS3504.1	4	.	.	.	.	.	.	.	.	.	.	G	21.3	4.130630	0.77549	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T	0.49432	0.78;0.78;2.85;0.78	6.05	5.21	0.72293	AMP-dependent synthetase/ligase (1);	0.176828	0.64402	N	0.000009	T	0.63426	0.2510	L	0.54323	1.7	0.35845	D	0.826333	P;D;D;D	0.69078	0.675;0.988;0.988;0.997	B;P;P;D	0.68039	0.281;0.838;0.773;0.955	T	0.73723	-0.3893	10	0.72032	D	0.01	-17.7158	15.5206	0.75862	0.0661:0.0:0.9339:0.0	.	297;450;450;450	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	Y	450;350;450;297;450	ENSP00000205214:H450Y;ENSP00000423760:H350Y;ENSP00000409656:H450Y;ENSP00000421171:H450Y	ENSP00000205214:H450Y	H	-	1	0	AASDH	56914997	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.271000	0.51608	1.561000	0.49584	0.650000	0.86243	CAT	AASDH	-	pfam_AMP-dep_Synth/Lig	ENSG00000157426		0.378	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AASDH	HGNC	protein_coding	OTTHUMT00000250780.1	-	0.00	43	0	G	NM_181806		57220240	-1	tier1	-	no_errors	ENST00000205214	ensembl	human	known	74_37	missense	30.95	29	13	SNP	1.000	A
ABCC11	85320	genome.wustl.edu	37	16	48221195	48221195	+	Silent	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:48221195G>T	ENST00000394747.1	-	20	3199	c.2850C>A	c.(2848-2850)gcC>gcA	p.A950A	ABCC11_ENST00000356608.2_Silent_p.A950A|ABCC11_ENST00000353782.5_Silent_p.A950A|ABCC11_ENST00000537808.1_3'UTR|ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000394748.1_Silent_p.A950A	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	950	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)	p.A950A(1)		breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	TCAACAGGACGGCGATCACCA	0.458																																																	1	Substitution - coding silent(1)	endometrium(1)											104.0	88.0	93.0					16																	48221195		2201	4300	6501	SO:0001819	synonymous_variant	0			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.2850C>A	16.37:g.48221195G>T			Q8TDJ0|Q96JA6|Q9BX80	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.A950	ENST00000394747.1	37	c.2850	CCDS10732.1	16																																																																																			ABCC11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000121270		0.458	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1		0.00	57	0	G	NM_032583		48221195	-1			no_errors	ENST00000356608	ensembl	human	known	74_37	silent	5.36	53	3	SNP	0.000	T
ACSS3	79611	genome.wustl.edu	37	12	81528635	81528635	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:81528635A>C	ENST00000548058.1	+	3	1407	c.497A>C	c.(496-498)aAg>aCg	p.K166T	ACSS3_ENST00000261206.3_Missense_Mutation_p.K165T			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	166						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						CATGGCATCAAGAAAGGTGAC	0.428																																																	0													162.0	126.0	139.0					12																	81528635		2203	4300	6503	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.497A>C	12.37:g.81528635A>C	ENSP00000449535:p.Lys166Thr		Q8NC66	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.K166T	ENST00000548058.1	37	c.497	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	A	9.816	1.184473	0.21870	.	.	ENSG00000111058	ENST00000549175;ENST00000548058;ENST00000261206	T;T;T	0.46819	0.86;0.86;0.86	5.83	3.46	0.39613	AMP-dependent synthetase/ligase (1);	0.515963	0.23144	N	0.051437	T	0.40979	0.1139	L	0.58925	1.835	0.45541	D	0.998493	B	0.24043	0.096	B	0.24701	0.055	T	0.16689	-1.0394	10	0.18710	T	0.47	-3.3549	9.9567	0.41671	0.8617:0.0:0.1383:0.0	.	166	Q9H6R3	ACSS3_HUMAN	T	58;166;165	ENSP00000447748:K58T;ENSP00000449535:K166T;ENSP00000261206:K165T	ENSP00000261206:K165T	K	+	2	0	ACSS3	80052766	0.999000	0.42202	0.967000	0.41034	0.923000	0.55619	1.303000	0.33470	0.998000	0.38996	0.460000	0.39030	AAG	ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.428	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	-	0.00	119	0	A	NM_024560		81528635	+1	tier1	-	no_errors	ENST00000548058	ensembl	human	known	74_37	missense	33.33	58	29	SNP	0.990	C
ADH7	131	genome.wustl.edu	37	4	100349278	100349278	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:100349278G>T	ENST00000209665.4	-	4	589	c.349C>A	c.(349-351)Cgc>Agc	p.R117S	ADH7_ENST00000437033.2_Missense_Mutation_p.R105S|ADH7_ENST00000482593.1_Missense_Mutation_p.R48S|ADH7_ENST00000476959.1_Missense_Mutation_p.R125S	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	117					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		TCTGGGTTGCGACAAGCATTG	0.343																																																	0													146.0	146.0	146.0					4																	100349278		2203	4300	6503	SO:0001583	missense	0			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.349C>A	4.37:g.100349278G>T	ENSP00000209665:p.Arg117Ser		A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.R117S	ENST00000209665.4	37	c.349	CCDS34034.1	4	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324623	0.60634	.	.	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000482593;ENST00000476959;ENST00000474027	T;T;T;T;T	0.05025	3.51;3.51;3.51;3.51;3.51	4.91	-4.26	0.03755	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.515963	0.19924	N	0.103003	T	0.05502	0.0145	L	0.41027	1.25	0.09310	N	1	B	0.28605	0.217	B	0.37451	0.25	T	0.32508	-0.9904	10	0.52906	T	0.07	-4.2334	4.6986	0.12816	0.4511:0.0:0.2356:0.3133	.	117	P40394	ADH7_HUMAN	S	105;117;48;125;48	ENSP00000414254:R105S;ENSP00000209665:R117S;ENSP00000420613:R48S;ENSP00000420269:R125S;ENSP00000420300:R48S	ENSP00000209665:R117S	R	-	1	0	ADH7	100568301	0.000000	0.05858	0.000000	0.03702	0.679000	0.39708	-0.998000	0.03701	-0.461000	0.06993	0.655000	0.94253	CGC	ADH7	-	pfam_ADH_GroES-like,superfamily_GroES-like	ENSG00000196344		0.343	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding		-	0.00	36	0	G	NM_000673		100349278	-1	tier1	-	no_errors	ENST00000209665	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.000	T
AGO2	27161	genome.wustl.edu	37	8	141595392	141595392	+	Missense_Mutation	SNP	G	G	A	rs201542441		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:141595392G>A	ENST00000220592.5	-	2	153	c.41C>T	c.(40-42)cCg>cTg	p.P14L	AGO2_ENST00000519980.1_Missense_Mutation_p.P14L|AGO2_ENST00000517293.1_5'UTR	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	14					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)										GGGGGGCGGCGGCGCAGGAGG	0.587																																																	0													49.0	54.0	52.0					8																	141595392		2203	4300	6503	SO:0001583	missense	0			AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.41C>T	8.37:g.141595392G>A	ENSP00000220592:p.Pro14Leu		Q8TCZ5|Q8WV58|Q96ID1	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.P14L	ENST00000220592.5	37	c.41	CCDS6380.1	8	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264574	0.23136	.	.	ENSG00000123908	ENST00000220592;ENST00000519980	T;T	0.04809	3.55;3.55	4.72	3.85	0.44370	.	0.292539	0.38272	N	0.001748	T	0.03608	0.0103	N	0.22421	0.69	0.09310	N	0.999994	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.40997	-0.9533	10	0.31617	T	0.26	-11.3974	8.0287	0.30453	0.2407:0.0:0.7593:0.0	.	14;14	Q9UKV8-2;Q9UKV8	.;AGO2_HUMAN	L	14	ENSP00000220592:P14L;ENSP00000430176:P14L	ENSP00000220592:P14L	P	-	2	0	EIF2C2	141664574	0.912000	0.30974	0.007000	0.13788	0.967000	0.64934	5.196000	0.65136	0.979000	0.38497	0.655000	0.94253	CCG	AGO2	-	NULL	ENSG00000123908		0.587	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO2	HGNC	protein_coding	OTTHUMT00000377866.4	-	0.00	89	0	G			141595392	-1	tier1	rs201542441	no_errors	ENST00000220592	ensembl	human	known	74_37	missense	59.65	46	68	SNP	0.022	A
AHDC1	27245	genome.wustl.edu	37	1	27876274	27876274	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:27876274C>A	ENST00000247087.5	-	5	2949	c.2353G>T	c.(2353-2355)Gga>Tga	p.G785*	AHDC1_ENST00000374011.2_Nonsense_Mutation_p.G785*			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	785	Gly-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CCAGCTTGTCCGCCTGGGTGC	0.682																																																	0													40.0	44.0	43.0					1																	27876274		2203	4299	6502	SO:0001587	stop_gained	0			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.2353G>T	1.37:g.27876274C>A	ENSP00000247087:p.Gly785*		Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Nonsense_Mutation	SNP	NULL	p.G785*	ENST00000247087.5	37	c.2353	CCDS30652.1	1	.	.	.	.	.	.	.	.	.	.	C	43	10.518661	0.99420	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	.	.	.	5.88	4.79	0.61399	.	0.358848	0.22495	N	0.059317	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-12.1139	7.8757	0.29592	0.0:0.7864:0.0:0.2136	.	.	.	.	X	785	.	ENSP00000247087:G785X	G	-	1	0	AHDC1	27748861	0.973000	0.33851	0.973000	0.42090	0.956000	0.61745	2.023000	0.41040	2.782000	0.95742	0.655000	0.94253	GGA	AHDC1	-	NULL	ENSG00000126705		0.682	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	-	0.00	77	0	C			27876274	-1	tier1	-	no_errors	ENST00000247087	ensembl	human	known	74_37	nonsense	30.51	41	18	SNP	0.838	A
AHNAK2	113146	genome.wustl.edu	37	14	105413989	105413989	+	Missense_Mutation	SNP	G	G	A	rs376661887		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:105413989G>A	ENST00000333244.5	-	7	7918	c.7799C>T	c.(7798-7800)gCg>gTg	p.A2600V	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2600						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCACTTCCGCCTTGGGGCC	0.622																																																	0								G	VAL/ALA	0,3734		0,0,1867	124.0	136.0	132.0		7799	-6.8	0.0	14		132	1,8181		0,1,4090	no	missense	AHNAK2	NM_138420.2	64	0,1,5957	AA,AG,GG		0.0122,0.0,0.0084	benign	2600/5796	105413989	1,11915	1867	4091	5958	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7799C>T	14.37:g.105413989G>A	ENSP00000353114:p.Ala2600Val		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A2600V	ENST00000333244.5	37	c.7799	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	0.031	-1.337175	0.01287	0.0	1.22E-4	ENSG00000185567	ENST00000333244	T	0.00902	5.56	3.41	-6.82	0.01698	.	.	.	.	.	T	0.00875	0.0029	L	0.41710	1.295	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40327	-0.9569	9	0.28530	T	0.3	.	7.733	0.28797	0.413:0.2493:0.3378:0.0	.	2600	Q8IVF2	AHNK2_HUMAN	V	2600	ENSP00000353114:A2600V	ENSP00000353114:A2600V	A	-	2	0	AHNAK2	104485034	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.805000	0.04530	-1.779000	0.01280	-1.472000	0.01007	GCG	AHNAK2	-	NULL	ENSG00000185567		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	149	0	G	NM_138420		105413989	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	42.86	88	66	SNP	0.000	A
AKNA	80709	genome.wustl.edu	37	9	117130813	117130813	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:117130813C>A	ENST00000307564.4	-	5	1640	c.1479G>T	c.(1477-1479)caG>caT	p.Q493H	AKNA_ENST00000374088.3_Missense_Mutation_p.Q493H|AKNA_ENST00000223791.3_De_novo_Start_OutOfFrame|AKNA_ENST00000312033.3_Missense_Mutation_p.Q493H|AKNA_ENST00000374075.5_Missense_Mutation_p.Q412H	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	493					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CCTTGGTCCCCTGGGGCACCA	0.662																																																	0													84.0	58.0	66.0					9																	117130813		2203	4300	6503	SO:0001583	missense	0			AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.1479G>T	9.37:g.117130813C>A	ENSP00000303769:p.Gln493His		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.Q493H	ENST00000307564.4	37	c.1479	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	C	11.61	1.691031	0.30052	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000374075;ENST00000312033	T;T;T;T	0.34667	2.6;2.6;2.6;1.35	4.87	0.459	0.16678	.	0.290468	0.28921	N	0.013706	T	0.23846	0.0577	L	0.43152	1.355	0.80722	D	1	P;P	0.41784	0.649;0.762	B;B	0.36464	0.112;0.225	T	0.02676	-1.1125	10	0.33940	T	0.23	-12.0866	7.4912	0.27462	0.1186:0.586:0.0:0.2954	.	493;412	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	H	493;334;493;412;493	ENSP00000303769:Q493H;ENSP00000363201:Q493H;ENSP00000363188:Q412H;ENSP00000309222:Q493H	ENSP00000303769:Q493H	Q	-	3	2	AKNA	116170634	0.087000	0.21565	0.972000	0.41901	0.469000	0.32828	-0.518000	0.06267	0.009000	0.14813	-0.797000	0.03246	CAG	AKNA	-	NULL	ENSG00000106948		0.662	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNA	HGNC	protein_coding	OTTHUMT00000053767.2	-	0.00	35	0	C	NM_030767		117130813	-1	tier1	-	no_errors	ENST00000307564	ensembl	human	known	74_37	missense	38.46	16	10	SNP	0.870	A
ANAPC7	51434	genome.wustl.edu	37	12	110824211	110824211	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:110824211C>T	ENST00000455511.3	-	6	840	c.840G>A	c.(838-840)ctG>ctA	p.L280L	ANAPC7_ENST00000450008.2_Silent_p.L280L|RP11-478C19.2_ENST00000550231.1_RNA	NM_016238.2	NP_057322.2	Q9UJX3	APC7_HUMAN	anaphase promoting complex subunit 7	280					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)			breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)	19						CTCTGAAGTACAGATCTGCCA	0.373																																																	0													237.0	236.0	237.0					12																	110824211		2203	4300	6503	SO:0001819	synonymous_variant	0			AF191340	CCDS9145.2, CCDS44971.1	12q13.12	2013-01-10			ENSG00000196510	ENSG00000196510		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	17380	protein-coding gene	gene with protein product		606949					Standard	NM_016238		Approved	APC7	uc001tqo.2	Q9UJX3	OTTHUMG00000157009	ENST00000455511.3:c.840G>A	12.37:g.110824211C>T			Q96AC4|Q96GF4|Q9BU24|Q9NT16	Silent	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L280	ENST00000455511.3	37	c.840	CCDS9145.2	12																																																																																			ANAPC7	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000196510		0.373	ANAPC7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANAPC7	HGNC	protein_coding	OTTHUMT00000347075.3	-	0.00	75	0	C	NM_016238		110824211	-1	tier1	-	no_errors	ENST00000455511	ensembl	human	known	74_37	silent	16.67	50	10	SNP	1.000	T
ANKRD30BP2	149992	genome.wustl.edu	37	21	14424315	14424315	+	IGR	SNP	A	A	C	rs577966831		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr21:14424315A>C								RNU6-614P (4305 upstream) : AL050302.1 (317615 downstream)																							tcctcatcaaagaacaaatat	0.373																																																	0																																										SO:0001628	intergenic_variant	0																															21.37:g.14424315A>C				RNA	SNP	-	NULL		37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309	0	0.373					ANKRD30BP2	HGNC			-	0.00	99	0	A			14424315	+1	tier1	-	no_errors	ENST00000471407	ensembl	human	known	74_37	rna	15.45	93	17	SNP	0.073	C
ANKRD36	375248	genome.wustl.edu	37	2	97866254	97866254	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:97866254C>G	ENST00000461153.2	+	46	3093	c.2849C>G	c.(2848-2850)tCt>tGt	p.S950C	ANKRD36_ENST00000420699.2_Missense_Mutation_p.S950C			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	950										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GGAGAAATATCTAGGAAAGGT	0.368																																																	0													106.0	111.0	110.0					2																	97866254		692	1591	2283	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2849C>G	2.37:g.97866254C>G	ENSP00000419530:p.Ser950Cys		B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S950C	ENST00000461153.2	37	c.2849	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	8.973	0.973361	0.18736	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.79653	-1.29;-1.29	0.85	-0.149	0.13420	.	.	.	.	.	T	0.73210	0.3558	L	0.29908	0.895	0.09310	N	1	D	0.62365	0.991	P	0.52710	0.707	T	0.61912	-0.6965	9	0.48119	T	0.1	.	3.1025	0.06330	0.0:0.6524:0.0:0.3476	.	950	A6QL64	AN36A_HUMAN	C	950;950;312	ENSP00000419530:S950C;ENSP00000391950:S950C	ENSP00000391950:S950C	S	+	2	0	ANKRD36	97229981	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.299000	0.08254	-0.068000	0.12953	0.162000	0.16502	TCT	ANKRD36	-	NULL	ENSG00000135976		0.368	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	-	0.00	319	0	C			97866254	+1	tier1	-	no_errors	ENST00000420699	ensembl	human	known	74_37	missense	36.34	261	149	SNP	0.002	G
ARHGAP28	79822	genome.wustl.edu	37	18	6894866	6894866	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr18:6894866A>C	ENST00000383472.4	+	15	1985	c.1881A>C	c.(1879-1881)caA>caC	p.Q627H	ARHGAP28_ENST00000314319.3_Missense_Mutation_p.Q468H|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.Q468H|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.Q627H|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.Q468H|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.Q575H|ARHGAP28_ENST00000531294.1_Missense_Mutation_p.Q463H|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.Q450H			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	627					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				AGGTACTGCAAAAATCACCCT	0.383																																																	0													117.0	113.0	114.0					18																	6894866		2203	4300	6503	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.1881A>C	18.37:g.6894866A>C	ENSP00000372964:p.Gln627His		A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q627H	ENST00000383472.4	37	c.1881		18	.	.	.	.	.	.	.	.	.	.	A	14.53	2.561688	0.45590	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.08458	3.25;3.2;3.17;3.16;3.17;3.09	4.82	2.43	0.29744	.	0.125195	0.36740	N	0.002434	T	0.13372	0.0324	L	0.32530	0.975	0.27867	N	0.94018	D;D;D;D	0.61080	0.981;0.981;0.989;0.978	P;P;D;P	0.63597	0.592;0.76;0.916;0.854	T	0.03463	-1.1034	10	0.66056	D	0.02	.	6.1983	0.20561	0.7995:0.0:0.2005:0.0	.	627;459;468;575	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	H	627;575;468;463;468;468;459;450	ENSP00000382963:Q627H;ENSP00000262227:Q575H;ENSP00000392660:Q468H;ENSP00000437262:Q463H;ENSP00000313506:Q468H;ENSP00000406907:Q468H	ENSP00000262227:Q575H	Q	+	3	2	ARHGAP28	6884866	0.997000	0.39634	1.000000	0.80357	0.571000	0.35966	0.130000	0.15850	0.430000	0.26230	0.533000	0.62120	CAA	ARHGAP28	-	NULL	ENSG00000088756		0.383	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	-	0.00	35	0	A	XM_371108		6894866	+1	tier1	-	no_errors	ENST00000400091	ensembl	human	known	74_37	missense	30.00	35	15	SNP	1.000	C
ARID1A	8289	genome.wustl.edu	37	1	27106970	27106971	+	Frame_Shift_Ins	INS	-	-	C	rs138280531		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:27106970_27106971insC	ENST00000324856.7	+	20	6952_6953	c.6581_6582insC	c.(6580-6585)aacctcfs	p.L2195fs	ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.L1812fs|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.L1978fs|ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.L523fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2195					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		AGTATCGGCAACCTCCTGGGCT	0.629			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0																																										SO:0001589	frameshift_variant	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6583dupC	1.37:g.27106972_27106972dupC	ENSP00000320485:p.Leu2195fs		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.L2195fs	ENST00000324856.7	37	c.6581_6582	CCDS285.1	1																																																																																			ARID1A	-	pfam_DUF3518,superfamily_ARM-type_fold	ENSG00000117713		0.629	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2		0.00	42	0	-	NM_139135		27106971	+1	tier1		no_errors	ENST00000324856	ensembl	human	known	74_37	frame_shift_ins	37.14	22	13	INS	1.000:1.000	C
ATP2A2	488	genome.wustl.edu	37	12	110777326	110777326	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:110777326A>T	ENST00000539276.2	+	13	1670	c.1561A>T	c.(1561-1563)Att>Ttt	p.I521F	ATP2A2_ENST00000308664.6_Missense_Mutation_p.I521F|ATP2A2_ENST00000395494.2_Missense_Mutation_p.I494F			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	521					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						TGAAGGTGTCATTGACAGGTG	0.438																																																	0													58.0	55.0	56.0					12																	110777326		2203	4300	6503	SO:0001583	missense	0				CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.1561A>T	12.37:g.110777326A>T	ENSP00000440045:p.Ile521Phe		A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.I521F	ENST00000539276.2	37	c.1561	CCDS9144.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	28.7|28.7	4.943709|4.943709	0.92593|0.92593	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000548169|ENST00000308664;ENST00000395494;ENST00000539276	.|D;D;D	.|0.83250	.|-1.7;-1.7;-1.7	5.85|5.85	5.85|5.85	0.93711|0.93711	.|ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78953|0.78953	0.4365|0.4365	L|L	0.41492|0.41492	1.28|1.28	0.80722|0.80722	D|D	1|1	.|P;B;P	.|0.42010	.|0.717;0.38;0.768	.|B;B;B	.|0.39562	.|0.248;0.142;0.303	T|T	0.81892|0.81892	-0.0724|-0.0724	5|10	.|0.87932	.|D	.|0	.|.	16.2285|16.2285	0.82315|0.82315	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|494;521;521	.|P16615-4;P16615-2;P16615	.|.;.;AT2A2_HUMAN	L|F	411|521;494;521	.|ENSP00000311186:I521F;ENSP00000378872:I494F;ENSP00000440045:I521F	.|ENSP00000311186:I521F	H|I	+|+	2|1	0|0	ATP2A2|ATP2A2	109261709|109261709	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	5.061000|5.061000	0.64319|0.64319	2.235000|2.235000	0.73313|0.73313	0.460000|0.460000	0.39030|0.39030	CAT|ATT	ATP2A2	-	superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Ca-transp_IIA	ENSG00000174437		0.438	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	ATP2A2	HGNC	protein_coding	OTTHUMT00000403539.1	-	0.00	46	0	A	NM_001681		110777326	+1	tier1	-	no_errors	ENST00000539276	ensembl	human	known	74_37	missense	36.00	32	18	SNP	1.000	T
ATP2B2	491	genome.wustl.edu	37	3	10442672	10442672	+	Missense_Mutation	SNP	C	C	T	rs200591536		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:10442672C>T	ENST00000352432.4	-	4	815	c.746G>A	c.(745-747)cGc>cAc	p.R249H	ATP2B2_ENST00000383800.4_Missense_Mutation_p.R249H|ATP2B2_ENST00000360273.2_Missense_Mutation_p.R249H|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R249H|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R249H			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	249					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						CACGGACTTGCGCACCTGGTC	0.597																																					Ovarian(125;1619 1709 15675 19819 38835)												0													147.0	120.0	129.0					3																	10442672		2203	4300	6503	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.746G>A	3.37:g.10442672C>T	ENSP00000324172:p.Arg249His		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.R249H	ENST00000352432.4	37	c.746	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.124649	0.94429	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.6	5.6	0.85130	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.055309	0.64402	D	0.000002	D	0.92309	0.7560	L	0.31157	0.91	0.58432	D	0.999998	D;P;D	0.61697	0.98;0.497;0.99	P;B;D	0.64321	0.765;0.104;0.924	D	0.93200	0.6591	10	0.87932	D	0	-20.274	19.6187	0.95647	0.0:1.0:0.0:0.0	.	249;261;249	Q01814-7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	H	249;249;249;249;249;215;136;249	ENSP00000324172:R249H;ENSP00000373311:R249H;ENSP00000380267:R249H;ENSP00000353414:R249H;ENSP00000344677:R249H;ENSP00000414854:R136H	ENSP00000342954:R249H	R	-	2	0	ATP2B2	10417672	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.088000	0.41663	2.627000	0.88993	0.650000	0.86243	CGC	ATP2B2	-	pfam_ATPase_P-typ_transduc_dom_A,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000157087		0.597	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	108	0	C	NM_001683		10442672	-1	tier1	rs200591536	no_errors	ENST00000352432	ensembl	human	known	74_37	missense	31.19	75	34	SNP	1.000	T
BAGE2	85319	genome.wustl.edu	37	21	11058233	11058233	+	RNA	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr21:11058233C>A	ENST00000470054.1	-	0	414							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAGGTGTCGGCTCCTGCAGCA	0.428																																																	0													89.0	71.0	77.0					21																	11058233		692	1591	2283			0			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11058233C>A			A8K925|Q08ER0	RNA	SNP	-	NULL	ENST00000470054.1	37	NULL		21																																																																																			BAGE2	-	-	ENSG00000187172		0.428	BAGE2-001	KNOWN	basic	processed_transcript	BAGE2	HGNC	pseudogene	OTTHUMT00000157417.3	-	0.00	147	0	C	NM_182482		11058233	-1	tier1	-	no_errors	ENST00000470054	ensembl	human	known	74_37	rna	11.73	143	19	SNP	1.000	A
BCL2L14	79370	genome.wustl.edu	37	12	12232486	12232486	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:12232486G>A	ENST00000308721.5	+	2	453	c.247G>A	c.(247-249)Gcc>Acc	p.A83T	BCL2L14_ENST00000396367.1_Missense_Mutation_p.A83T|BCL2L14_ENST00000266434.4_Missense_Mutation_p.A83T|BCL2L14_ENST00000589718.1_Missense_Mutation_p.A83T|BCL2L14_ENST00000396369.1_Missense_Mutation_p.A83T|BCL2L14_ENST00000586576.1_Missense_Mutation_p.A116T	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	83					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		CAGTGAGAAGGCCATAAACCT	0.493																																																	0													61.0	61.0	61.0					12																	12232486		2203	4300	6503	SO:0001583	missense	0			AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.247G>A	12.37:g.12232486G>A	ENSP00000309132:p.Ala83Thr		A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	pfscan_Bcl2-like	p.A83T	ENST00000308721.5	37	c.247	CCDS8645.1	12	.	.	.	.	.	.	.	.	.	.	G	2.483	-0.319204	0.05386	.	.	ENSG00000121380	ENST00000461264;ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	.	.	.	3.87	-7.75	0.01236	.	1.772080	0.03020	N	0.150591	T	0.17831	0.0428	N	0.19112	0.55	0.09310	N	1	B;B	0.11235	0.003;0.004	B;B	0.13407	0.009;0.002	T	0.14144	-1.0483	8	.	.	.	0.5374	1.738	0.02946	0.3439:0.1849:0.3177:0.1535	.	83;83	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	T	86;83;83;83;83	.	.	A	+	1	0	BCL2L14	12123753	0.000000	0.05858	0.000000	0.03702	0.696000	0.40369	-4.189000	0.00277	-3.688000	0.00121	-0.256000	0.11100	GCC	BCL2L14	-	NULL	ENSG00000121380		0.493	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L14	HGNC	protein_coding	OTTHUMT00000355994.3	-	0.00	34	0	G	NM_030766		12232486	+1	tier1	-	no_errors	ENST00000308721	ensembl	human	known	74_37	missense	47.83	12	11	SNP	0.000	A
BEND5	79656	genome.wustl.edu	37	1	49208310	49208310	+	Silent	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:49208310G>T	ENST00000371833.3	-	4	965	c.879C>A	c.(877-879)atC>atA	p.I293I	AGBL4_ENST00000371839.1_Intron|BEND5_ENST00000476096.1_Intron|AGBL4_ENST00000371838.1_Intron	NM_024603.2	NP_078879.2	Q7L4P6	BEND5_HUMAN	BEN domain containing 5	293						Golgi apparatus (GO:0005794)				large_intestine(5)|lung(2)|skin(1)	8						CATTGTCTAGGATATACTTGT	0.478																																																	0													133.0	122.0	126.0					1																	49208310		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007932	CCDS552.2	1p33	2012-11-22	2008-10-03	2008-10-03	ENSG00000162373	ENSG00000162373		"""BEN domain containing"""	25668	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 165"""	C1orf165		12477932	Standard	NM_024603		Approved	FLJ11588	uc001crx.4	Q7L4P6	OTTHUMG00000008153	ENST00000371833.3:c.879C>A	1.37:g.49208310G>T			D3DQ27|Q96A62|Q9HAI3	Silent	SNP	pfam_BEN_domain	p.I293	ENST00000371833.3	37	c.879	CCDS552.2	1																																																																																			BEND5	-	NULL	ENSG00000162373		0.478	BEND5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND5	HGNC	protein_coding	OTTHUMT00000022323.1	-	0.00	91	0	G	NM_024603		49208310	-1	tier1	-	no_errors	ENST00000371833	ensembl	human	known	74_37	silent	38.36	45	28	SNP	1.000	T
BRINP1	1620	genome.wustl.edu	37	9	121930240	121930240	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:121930240G>A	ENST00000265922.3	-	8	1869	c.1408C>T	c.(1408-1410)Cgg>Tgg	p.R470W	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	470					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											TGCTCGCTCCGCTCCGAGTCC	0.587																																																	0													153.0	124.0	134.0					9																	121930240		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1408C>T	9.37:g.121930240G>A	ENSP00000265922:p.Arg470Trp		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.R470W	ENST00000265922.3	37	c.1408	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590979	0.66219	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.56776	0.44	5.55	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.61009	0.2313	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	P	0.61940	0.896	T	0.64101	-0.6486	10	0.59425	D	0.04	-24.9049	15.5132	0.75802	0.0:0.0:0.8606:0.1394	.	470	O60477	DBC1_HUMAN	W	470	ENSP00000265922:R470W	ENSP00000265922:R470W	R	-	1	2	DBC1	120970061	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.837000	0.55820	1.270000	0.44297	0.655000	0.94253	CGG	BRINP1	-	NULL	ENSG00000078725		0.587	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	36	0	G	NM_014618		121930240	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	56.76	16	21	SNP	1.000	A
HEATR4	399671	genome.wustl.edu	37	14	73959864	73959864	+	Intron	DEL	A	A	-			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:73959864delA	ENST00000553558.1	-	17	3107				HEATR4_ENST00000334988.2_Intron|HEATR4_ENST00000560393.1_Intron|C14orf169_ENST00000531973.1_RNA	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4											breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TTGGAGGTGGAAAAAAAACCC	0.438																																																	0													67.0	64.0	65.0					14																	73959864		2203	4300	6503	SO:0001627	intron_variant	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2786-36T>-	14.37:g.73959864delA			B7Z7V9|E9KL41	RNA	DEL	-	NULL	ENST00000553558.1	37	NULL	CCDS9815.2	14																																																																																			C14orf169	-	-	ENSG00000255242		0.438	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C14orf169	HGNC	protein_coding	OTTHUMT00000414422.2		0.00	49	0	A	NM_203309		73959864	+1	tier1		no_errors	ENST00000531973	ensembl	human	known	74_37	rna	7.69	36	3	DEL	0.000	-
C22orf34	348645	genome.wustl.edu	37	22	50017935	50017935	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr22:50017935G>A	ENST00000444628.1	-	4	1597	c.526C>T	c.(526-528)Cac>Tac	p.H176Y	C22orf34_ENST00000405854.1_Intron|C22orf34_ENST00000400023.1_Intron			Q6ZV56	CV034_HUMAN	chromosome 22 open reading frame 34	150										pancreas(1)	1						TGCTCGGGGTGCTGACCTTTG	0.642																																																	0																																										SO:0001583	missense	0			BC048207		22q13.33	2013-01-15			ENSG00000188511	ENSG00000188511			28010	other	unknown						12477932	Standard	NR_026997		Approved		uc003bit.3	Q6ZV56	OTTHUMG00000030424	ENST00000444628.1:c.526C>T	22.37:g.50017935G>A	ENSP00000395549:p.His176Tyr		Q147Y0|Q5R3D1|Q6ZTN8	Missense_Mutation	SNP	NULL	p.H176Y	ENST00000444628.1	37	c.526		22	.	.	.	.	.	.	.	.	.	.	G	4.442	0.081889	0.08533	.	.	ENSG00000188511	ENST00000444628	.	.	.	0.463	-0.927	0.10451	.	.	.	.	.	T	0.28200	0.0696	.	.	.	0.19775	N	0.999958	.	.	.	.	.	.	T	0.26360	-1.0105	4	.	.	.	.	5.4949	0.16797	1.0E-4:0.3502:0.6497:0.0	.	.	.	.	Y	176	.	.	H	-	1	0	C22orf34	48403939	0.914000	0.31030	0.003000	0.11579	0.373000	0.29922	0.806000	0.27126	-0.689000	0.05149	0.121000	0.15741	CAC	C22orf34	-	NULL	ENSG00000188511		0.642	C22orf34-201	KNOWN	basic|appris_candidate_longest	protein_coding	C22orf34	HGNC	protein_coding		-	0.00	105	0	G	NR_026997		50017935	-1	tier1	-	no_errors	ENST00000444628	ensembl	human	known	74_37	missense	32.74	76	37	SNP	0.987	A
CACNA1E	777	genome.wustl.edu	37	1	181721357	181721357	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:181721357G>C	ENST00000367573.2	+	27	3810	c.3810G>C	c.(3808-3810)aaG>aaC	p.K1270N	CACNA1E_ENST00000360108.3_Missense_Mutation_p.K1251N|CACNA1E_ENST00000357570.5_Missense_Mutation_p.K1221N|CACNA1E_ENST00000367567.4_Missense_Mutation_p.K877N|CACNA1E_ENST00000358338.5_Missense_Mutation_p.K1202N|CACNA1E_ENST00000526775.1_Missense_Mutation_p.K1251N|CACNA1E_ENST00000367570.1_Missense_Mutation_p.K1270N	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1270					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AAACCATCAAGCGCTTGCCCA	0.532																																																	0													119.0	119.0	119.0					1																	181721357		1930	4147	6077	SO:0001583	missense	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3810G>C	1.37:g.181721357G>C	ENSP00000356545:p.Lys1270Asn		B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.K1270N	ENST00000367573.2	37	c.3810	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.045580	0.75846	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98550	-4.99;-4.99;-4.99;-4.99;-4.99;-4.99;-4.99	6.02	5.11	0.69529	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	L	0.31065	0.9	0.80722	D	1	B;D;D	0.89917	0.164;1.0;1.0	B;D;D	0.87578	0.309;0.998;0.996	D	0.98173	1.0453	10	0.87932	D	0	.	10.8198	0.46597	0.1443:0.0:0.8557:0.0	.	1251;1270;1270	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	N	1270;1251;1221;1202;877;1251;1270	ENSP00000356542:K1270N;ENSP00000434814:K1251N;ENSP00000350183:K1221N;ENSP00000351101:K1202N;ENSP00000356539:K877N;ENSP00000353222:K1251N;ENSP00000356545:K1270N	ENSP00000350183:K1221N	K	+	3	2	CACNA1E	179987980	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.745000	0.47459	1.554000	0.49487	0.655000	0.94253	AAG	CACNA1E	-	pfam_Ion_trans_dom	ENSG00000198216		0.532	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2		0.00	45	0	G	NM_000721		181721357	+1			no_errors	ENST00000367573	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	C
CAMK1D	57118	genome.wustl.edu	37	10	12858285	12858285	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr10:12858285C>A	ENST00000378847.3	+	8	1128	c.791C>A	c.(790-792)cCg>cAg	p.P264Q	CAMK1D_ENST00000378845.1_Missense_Mutation_p.P264Q	NM_153498.2	NP_705718.1	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID	264	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				inflammatory response (GO:0006954)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis (GO:0050766)|positive regulation of respiratory burst (GO:0060267)|regulation of dendrite development (GO:0050773)|regulation of granulocyte chemotaxis (GO:0071622)	calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)	16				GBM - Glioblastoma multiforme(1;3.16e-05)		GAGAAGGACCCGAATAAAAGA	0.502																																																	0													84.0	76.0	79.0					10																	12858285		2203	4300	6503	SO:0001583	missense	0			AF286366	CCDS7091.1, CCDS7092.1	10p13	2003-11-05			ENSG00000183049	ENSG00000183049			19341	protein-coding gene	gene with protein product		607957				11050006	Standard	XM_006717481		Approved	CKLiK	uc001ilo.3	Q8IU85	OTTHUMG00000017683	ENST00000378847.3:c.791C>A	10.37:g.12858285C>A	ENSP00000368124:p.Pro264Gln		B0YIY0|Q9HD31	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P264Q	ENST00000378847.3	37	c.791	CCDS7091.1	10	.	.	.	.	.	.	.	.	.	.	C	25.6	4.653996	0.88056	.	.	ENSG00000183049	ENST00000378847;ENST00000378845	T;T	0.56611	0.45;0.45	5.77	5.77	0.91146	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052742	0.85682	D	0.000000	T	0.75510	0.3859	M	0.86573	2.825	0.80722	D	1	D;D	0.61080	0.982;0.989	D;D	0.69654	0.965;0.934	T	0.75280	-0.3373	10	0.35671	T	0.21	-11.1196	17.4922	0.87707	0.0:1.0:0.0:0.0	.	264;264	Q8IU85;Q5SQQ7	KCC1D_HUMAN;.	Q	264	ENSP00000368124:P264Q;ENSP00000368122:P264Q	ENSP00000368122:P264Q	P	+	2	0	CAMK1D	12898291	1.000000	0.71417	0.998000	0.56505	0.820000	0.46376	5.837000	0.69381	2.724000	0.93272	0.561000	0.74099	CCG	CAMK1D	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000183049		0.502	CAMK1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1D	HGNC	protein_coding	OTTHUMT00000046820.1	-	0.00	47	0	C	NM_020397		12858285	+1	tier1	-	no_errors	ENST00000378847	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.999	A
CAPN15	6650	genome.wustl.edu	37	16	597228	597228	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:597228G>A	ENST00000219611.2	+	4	753	c.390G>A	c.(388-390)gaG>gaA	p.E130E	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	130	Glu-rich.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										acgaggaggagaaggaggagc	0.706																																																	0													6.0	7.0	7.0					16																	597228		2102	4165	6267	SO:0001819	synonymous_variant	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.390G>A	16.37:g.597228G>A			B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.E130	ENST00000219611.2	37	c.390	CCDS10410.1	16																																																																																			CAPN15	-	NULL	ENSG00000103326		0.706	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN15	HGNC	protein_coding	OTTHUMT00000239271.1		0.00	11	0	G	NM_005632		597228	+1			no_errors	ENST00000219611	ensembl	human	known	74_37	silent	14.29	12	2	SNP	0.000	A
CD177	57126	genome.wustl.edu	37	19	43857882	43857882	+	RNA	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:43857882C>T	ENST00000607517.1	+	0	72				CD177_ENST00000378009.4_RNA|CD177_ENST00000378012.2_RNA			Q8N6Q3	CD177_HUMAN	CD177 molecule						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Prostate(69;0.00682)				CGCGGTATTACTGCTGGCCCT	0.567																																																	0													83.0	81.0	82.0					19																	43857882		1915	4117	6032			0			AF146747	CCDS62700.1	19q13.31	2013-10-02	2006-03-28		ENSG00000204936	ENSG00000204936		"""CD molecules"""	30072	protein-coding gene	gene with protein product	"""polycythemia rubra vera 1"""	162860	"""CD177 antigen"""			10753836, 5552408	Standard	NM_020406		Approved	PRV1, HNA2A, NB1	uc002owi.3	Q8N6Q3	OTTHUMG00000185320		19.37:g.43857882C>T			Q711Q2|Q8NCV9|Q96QH1|Q9HDA5	Silent	SNP	pfam_LY6_UPAR	p.L6	ENST00000607517.1	37	c.16		19																																																																																			CD177	-	NULL	ENSG00000204936		0.567	CD177-001	KNOWN	basic	polymorphic_pseudogene	CD177	HGNC	polymorphic_pseudogene	OTTHUMT00000470162.1	-	0.00	60	0	C	NM_020406		43857882	+1	tier1	-	no_errors	ENST00000378009	ensembl	human	known	74_37	silent	33.33	50	25	SNP	0.041	T
CDH23	64072	genome.wustl.edu	37	10	73501677	73501677	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr10:73501677C>T	ENST00000224721.6	+	37	4864	c.4859C>T	c.(4858-4860)tCg>tTg	p.S1620L		NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	1615	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.		V -> M (in dbSNP:rs41281330). {ECO:0000269|PubMed:12075507}.		calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CCAACCCTGTCGGTGAGCGAT	0.672																																																	0													12.0	14.0	13.0					10																	73501677		2107	4220	6327	SO:0001630	splice_region_variant	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.4860+1C>T	10.37:g.73501677C>T			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1620L	ENST00000224721.6	37	c.4859		10	.	.	.	.	.	.	.	.	.	.	C	35	5.492715	0.96339	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398792	.	.	.	5.09	5.09	0.68999	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000002	T	0.73992	0.3658	L	0.46947	1.48	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.953	T	0.71087	-0.4694	9	0.31617	T	0.26	.	18.52	0.90948	0.0:1.0:0.0:0.0	.	435;1615	E7ERT0;Q9H251	.;CAD23_HUMAN	L	1620;1615;1618;435	.	ENSP00000224721:S1620L	S	+	2	0	CDH23	73171683	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	7.698000	0.84413	2.378000	0.81104	0.655000	0.94253	TCG	CDH23	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000107736		0.672	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	37	0	C	NM_052836	Missense_Mutation	73501677	+1	tier1	-	no_errors	ENST00000224721	ensembl	human	putative	74_37	missense	37.50	20	12	SNP	1.000	T
CEACAM3	1084	genome.wustl.edu	37	19	42312912	42312912	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:42312912C>T	ENST00000357396.3	+	3	727	c.486C>T	c.(484-486)gtC>gtT	p.V162V	CEACAM3_ENST00000344550.4_Silent_p.V162V|CEACAM3_ENST00000595255.1_3'UTR|CEACAM3_ENST00000221999.4_Silent_p.V162V	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	162						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GGGTCCTGGTCGGAGTGGCGC	0.607																																																	0													132.0	131.0	131.0					19																	42312912		2203	4300	6503	SO:0001819	synonymous_variant	0			E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.486C>T	19.37:g.42312912C>T			G5E978|Q3KPH9	Silent	SNP	pfam_Ig_V-set	p.V162	ENST00000357396.3	37	c.486	CCDS12586.2	19																																																																																			CEACAM3	-	NULL	ENSG00000170956		0.607	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM3	HGNC	protein_coding	OTTHUMT00000316509.2	-	0.00	113	0	C	NM_001815		42312912	+1	tier1	-	no_errors	ENST00000357396	ensembl	human	known	74_37	silent	37.74	66	40	SNP	0.000	T
CELSR2	1952	genome.wustl.edu	37	1	109807186	109807186	+	Frame_Shift_Del	DEL	C	C	-	rs74763583	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:109807186delC	ENST00000271332.3	+	11	5461	c.5400delC	c.(5398-5400)aacfs	p.N1800fs		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1800	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GTGACTCAAACCCGTGTCCTG	0.567																																					NSCLC(158;1285 2011 34800 34852 42084)												0													204.0	187.0	193.0					1																	109807186		2203	4300	6503	SO:0001589	frameshift_variant	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.5400delC	1.37:g.109807186delC	ENSP00000271332:p.Asn1800fs		Q5T2Y7|Q92566	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.P1801fs	ENST00000271332.3	37	c.5400	CCDS796.1	1																																																																																			CELSR2	-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000143126		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1		0.00	27	0	C	NM_001408		109807186	+1	tier1		no_errors	ENST00000271332	ensembl	human	known	74_37	frame_shift_del	9.09	20	2	DEL	0.980	-
CES1	1066	genome.wustl.edu	37	16	55853484	55853484	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:55853484T>C	ENST00000361503.4	-	7	996	c.866A>G	c.(865-867)aAg>aGg	p.K289R	CES1_ENST00000422046.2_Missense_Mutation_p.K289R|CES1_ENST00000566555.1_5'Flank|CES1_ENST00000360526.3_Missense_Mutation_p.K290R			P23141	EST1_HUMAN	carboxylesterase 1	289					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	CTCTTCCGTCTTCTGTCGCAG	0.498																																					NSCLC(162;1801 2756 42904 52896)												0													140.0	140.0	140.0					16																	55853484		2198	4300	6498	SO:0001583	missense	0			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.866A>G	16.37:g.55853484T>C	ENSP00000355193:p.Lys289Arg		A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.K290R	ENST00000361503.4	37	c.869	CCDS45488.1	16	.	.	.	.	.	.	.	.	.	.	.	15.68	2.905397	0.52333	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.70282	-0.47;-0.47;-0.47	3.81	2.71	0.32032	Carboxylesterase, type B (1);	0.485773	0.19288	N	0.117970	T	0.71307	0.3324	M	0.65677	2.01	0.34461	D	0.701751	P;D;P	0.55800	0.51;0.973;0.704	P;P;B	0.51866	0.557;0.682;0.421	T	0.77560	-0.2542	10	0.59425	D	0.04	.	5.1	0.14754	0.0:0.1375:0.0:0.8625	.	289;289;290	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	R	290;289;289;154	ENSP00000353720:K290R;ENSP00000355193:K289R;ENSP00000390492:K289R	ENSP00000353720:K290R	K	-	2	0	CES1	54410985	1.000000	0.71417	0.999000	0.59377	0.503000	0.33858	2.573000	0.46007	1.390000	0.46547	0.374000	0.22700	AAG	CES1	-	pfam_CarbesteraseB	ENSG00000198848		0.498	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES1	HGNC	protein_coding	OTTHUMT00000433285.1	-	0.00	83	0	T	NM_001266		55853484	-1	tier1	-	no_errors	ENST00000360526	ensembl	human	known	74_37	missense	31.40	59	27	SNP	1.000	C
CHD5	26038	genome.wustl.edu	37	1	6209422	6209422	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:6209422A>G	ENST00000262450.3	-	8	1144	c.1045T>C	c.(1045-1047)Tgc>Cgc	p.C349R	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CCCTGCTGGCACACCTCACAG	0.592																																																	0													127.0	90.0	103.0					1																	6209422		2203	4300	6503	SO:0001583	missense	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1045T>C	1.37:g.6209422A>G	ENSP00000262450:p.Cys349Arg		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.C349R	ENST00000262450.3	37	c.1045	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.003070	0.74932	.	.	ENSG00000116254	ENST00000262450	D	0.99907	-7.8	4.03	4.03	0.46877	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	U	0.000000	D	0.99937	0.9972	H	0.99182	4.46	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.96057	0.9036	10	0.87932	D	0	-24.0118	12.4529	0.55686	1.0:0.0:0.0:0.0	.	349	Q8TDI0	CHD5_HUMAN	R	349	ENSP00000262450:C349R	ENSP00000262450:C349R	C	-	1	0	CHD5	6132009	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.998000	0.93550	1.623000	0.50342	0.260000	0.18958	TGC	CHD5	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	ENSG00000116254		0.592	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	-	0.00	80	0	A	NM_015557		6209422	-1	tier1	-	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	18.97	47	11	SNP	1.000	G
CHRNA3	1136	genome.wustl.edu	37	15	78894371	78894371	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:78894371C>T	ENST00000326828.5	-	5	997	c.613G>A	c.(613-615)Ggc>Agc	p.G205S	CHRNA3_ENST00000348639.3_Missense_Mutation_p.G205S	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	205					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	GCCCACTCGCCGCTCTCCCAA	0.517																																																	0													137.0	120.0	126.0					15																	78894371		2196	4293	6489	SO:0001583	missense	0				CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.613G>A	15.37:g.78894371C>T	ENSP00000315602:p.Gly205Ser		Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.G205S	ENST00000326828.5	37	c.613	CCDS10305.1	15	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006453	0.93287	.	.	ENSG00000080644	ENST00000348639;ENST00000326828;ENST00000326858	T;T	0.79749	-1.3;-1.3	6.17	6.17	0.99709	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85767	0.5773	L	0.54863	1.705	0.80722	D	1	P;P	0.51791	0.887;0.948	P;P	0.57911	0.829;0.737	T	0.79631	-0.1723	10	0.17832	T	0.49	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	205;205	P32297;P32297-3	ACHA3_HUMAN;.	S	205;205;69	ENSP00000267951:G205S;ENSP00000315602:G205S	ENSP00000315602:G205S	G	-	1	0	CHRNA3	76681426	1.000000	0.71417	0.888000	0.34837	0.950000	0.60333	6.077000	0.71275	2.941000	0.99782	0.655000	0.94253	GGC	CHRNA3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000080644		0.517	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA3	HGNC	protein_coding	OTTHUMT00000290111.3	-	0.00	87	0	C			78894371	-1	tier1	-	no_errors	ENST00000326828	ensembl	human	known	74_37	missense	41.03	69	48	SNP	1.000	T
PCGF2	7703	genome.wustl.edu	37	17	36890780	36890781	+	3'UTR	INS	-	-	A	rs386386025|rs5820265|rs3066488|rs33995757	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:36890780_36890781insA	ENST00000580830.1	-	0	2431_2432				PCGF2_ENST00000360797.2_3'UTR|RNA5SP440_ENST00000363245.1_RNA|CISD3_ENST00000578573.1_3'UTR|CISD3_ENST00000439660.2_3'UTR|PCGF2_ENST00000581345.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2						anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					ACACACACAGGAAAAAAAAAAA	0.47														1021	0.203874	0.441	0.1037	5008	,	,		20215	0.0704		0.0795	False		,,,				2504	0.2198																0																																										SO:0001624	3_prime_UTR_variant	0			D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.*696->T	17.37:g.36890791_36890791dupA			A6NGD8	RNA	INS	-	NULL	ENST00000580830.1	37	NULL	CCDS32638.1	17																																																																																			CISD3	-	-	ENSG00000230055		0.470	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CISD3	HGNC	protein_coding	OTTHUMT00000442246.2		0.00	19	0	-	NM_007144		36890781	+1	tier1		no_errors	ENST00000578573	ensembl	human	known	74_37	rna	12.50	14	2	INS	0.000:0.000	A
CLEC5A	23601	genome.wustl.edu	37	7	141631584	141631584	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:141631584C>T	ENST00000546910.1	-	6	584	c.388G>A	c.(388-390)Ggc>Agc	p.G130S	CLEC5A_ENST00000439991.1_Missense_Mutation_p.G26S|CLEC5A_ENST00000551012.2_Missense_Mutation_p.G107S|MGAM_ENST00000497554.1_3'UTR|CLEC5A_ENST00000470595.1_5'UTR|CLEC5A_ENST00000438351.1_Missense_Mutation_p.G107S	NM_013252.2	NP_037384.1	Q9NY25	CLC5A_HUMAN	C-type lectin domain family 5, member A	130	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cellular defense response (GO:0006968)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myeloid cell apoptotic process (GO:0033033)|osteoblast development (GO:0002076)|positive regulation of cytokine secretion (GO:0050715)|response to virus (GO:0009615)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|virus receptor activity (GO:0001618)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	10	Melanoma(164;0.0171)					TAAATTAAGCCAATAAAATAC	0.393																																					GBM(154;1592 2613 3360 42983)												0													176.0	161.0	166.0					7																	141631584		2203	4300	6503	SO:0001583	missense	0				CCDS5870.1, CCDS75670.1	7q34	2012-10-03	2005-02-09	2005-02-09	ENSG00000258227	ENSG00000258227		"""C-type lectin domain containing"""	2054	protein-coding gene	gene with protein product		604987	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5"""	CLECSF5		10449773	Standard	NM_013252		Approved	MDL-1	uc003vwv.1	Q9NY25	OTTHUMG00000157173	ENST00000546910.1:c.388G>A	7.37:g.141631584C>T	ENSP00000449999:p.Gly130Ser		Q52M11|Q9UKQ0	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G130S	ENST00000546910.1	37	c.388	CCDS5870.1	7	.	.	.	.	.	.	.	.	.	.	C	22.5	4.292226	0.80914	.	.	ENSG00000258227	ENST00000546910;ENST00000551012;ENST00000439991;ENST00000438351	T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26	5.07	5.07	0.68467	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.64402	D	0.000014	D	0.86489	0.5945	H	0.95780	3.72	0.46586	D	0.999114	D;D;D;D	0.89917	1.0;0.999;0.998;0.999	D;D;D;D	0.97110	1.0;0.987;0.977;0.987	D	0.89673	0.3885	10	0.87932	D	0	-22.2919	14.1385	0.65303	0.0:1.0:0.0:0.0	.	107;107;129;130	C9JPR7;Q14DL9;Q9NY25-2;Q9NY25	.;.;.;CLC5A_HUMAN	S	130;107;26;107	ENSP00000449999:G130S;ENSP00000446890:G107S;ENSP00000395258:G26S;ENSP00000414897:G107S	ENSP00000265306:G130S	G	-	1	0	CLEC5A	141278053	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	3.148000	0.50647	2.789000	0.95967	0.655000	0.94253	GGC	CLEC5A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000258227		0.393	CLEC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC5A	HGNC	protein_coding	OTTHUMT00000347756.1	-	0.00	32	0	C	NM_013252		141631584	-1	tier1	-	no_errors	ENST00000546910	ensembl	human	known	74_37	missense	22.73	17	5	SNP	1.000	T
CNGA4	1262	genome.wustl.edu	37	11	6265529	6265529	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:6265529C>T	ENST00000379936.2	+	6	1733	c.1618C>T	c.(1618-1620)Cca>Tca	p.P540S		NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	540					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCGAGAGTGGCCAATGCCCGA	0.602																																																	0													54.0	56.0	55.0					11																	6265529		2201	4296	6497	SO:0001583	missense	0			AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.1618C>T	11.37:g.6265529C>T	ENSP00000369268:p.Pro540Ser			Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.P540S	ENST00000379936.2	37	c.1618	CCDS31408.1	11	.	.	.	.	.	.	.	.	.	.	C	14.97	2.693481	0.48202	.	.	ENSG00000132259	ENST00000379936	D	0.97303	-4.33	5.28	5.28	0.74379	.	0.272836	0.31392	N	0.007726	D	0.88880	0.6557	N	0.08118	0	0.28507	N	0.913712	P	0.34662	0.462	B	0.28553	0.091	T	0.81805	-0.0764	10	0.09590	T	0.72	.	9.0903	0.36607	0.1633:0.679:0.1576:0.0	.	540	Q8IV77	CNGA4_HUMAN	S	540	ENSP00000369268:P540S	ENSP00000369268:P540S	P	+	1	0	CNGA4	6222105	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.559000	0.45888	2.763000	0.94921	0.632000	0.83419	CCA	CNGA4	-	NULL	ENSG00000132259		0.602	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGA4	HGNC	protein_coding	OTTHUMT00000383765.2	-	0.00	52	0	C	NM_001037329		6265529	+1	tier1	-	no_errors	ENST00000379936	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.995	T
CNTNAP1	8506	genome.wustl.edu	37	17	40841641	40841641	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:40841641C>T	ENST00000264638.4	+	11	1948	c.1731C>T	c.(1729-1731)caC>caT	p.H577H	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	577	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		AGACCTGCCACACACGTAAGC	0.557																																																	0													62.0	46.0	51.0					17																	40841641		2203	4300	6503	SO:0001819	synonymous_variant	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.1731C>T	17.37:g.40841641C>T				Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.H577	ENST00000264638.4	37	c.1731	CCDS11436.1	17																																																																																			CNTNAP1	-	superfamily_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom	ENSG00000108797		0.557	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	-	0.00	41	0	C	NM_003632		40841641	+1	tier1	-	no_errors	ENST00000264638	ensembl	human	known	74_37	silent	28.89	32	13	SNP	0.999	T
CNTD1	124817	genome.wustl.edu	37	17	40956372	40956372	+	Silent	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:40956372G>T	ENST00000588408.1	+	3	651	c.375G>T	c.(373-375)gtG>gtT	p.V125V	CNTD1_ENST00000588527.1_Silent_p.V42V	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1	125	Cyclin N-terminal.									central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TCCGTCTTGTGTCATGTGTTC	0.473																																																	0													147.0	136.0	140.0					17																	40956372		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.375G>T	17.37:g.40956372G>T			Q658Q6|Q8NEP1	Silent	SNP	pfam_Cyclin_N,superfamily_Cyclin-like	p.V125	ENST00000588408.1	37	c.375	CCDS11440.1	17																																																																																			CNTD1	-	pfam_Cyclin_N,superfamily_Cyclin-like	ENSG00000176563		0.473	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD1	HGNC	protein_coding	OTTHUMT00000452398.1	-	0.00	45	0	G	NM_173478		40956372	+1	tier1	-	no_errors	ENST00000588408	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	T
COG7	91949	genome.wustl.edu	37	16	23415147	23415147	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:23415147C>T	ENST00000307149.5	-	13	1856	c.1671G>A	c.(1669-1671)ggG>ggA	p.G557G		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	557					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		GGTTGCTTGACCCTTTTTCCT	0.498																																																	0													71.0	61.0	64.0					16																	23415147		2197	4300	6497	SO:0001819	synonymous_variant	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1671G>A	16.37:g.23415147C>T			Q6UWU7	Silent	SNP	pfam_COG7	p.G557	ENST00000307149.5	37	c.1671	CCDS10610.1	16																																																																																			COG7	-	pfam_COG7	ENSG00000168434		0.498	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1		0.00	34	0	C			23415147	-1			no_errors	ENST00000307149	ensembl	human	known	74_37	silent	24.00	19	6	SNP	0.949	T
COPA	1314	genome.wustl.edu	37	1	160305050	160305050	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:160305050G>A	ENST00000241704.7	-	4	520	c.291C>T	c.(289-291)cgC>cgT	p.R97R	COPA_ENST00000368069.3_Silent_p.R97R	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	97					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AAAACGTGGTGCGAATATAAT	0.383																																																	0													61.0	55.0	57.0					1																	160305050		2203	4300	6503	SO:0001819	synonymous_variant	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.291C>T	1.37:g.160305050G>A			Q5T201|Q8IXZ9	Silent	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R97	ENST00000241704.7	37	c.291	CCDS1202.1	1																																																																																			COPA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000122218		0.383	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	-	0.00	24	0	G	NM_004371		160305050	-1	tier1	-	no_errors	ENST00000368069	ensembl	human	known	74_37	silent	17.31	43	9	SNP	0.966	A
CYP11A1	1583	genome.wustl.edu	37	15	74653823	74653823	+	Intron	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:74653823T>C	ENST00000268053.6	-	1	424				CYP11A1_ENST00000358632.4_Intron|CYP11A1_ENST00000467407.1_5'UTR|CYP11A1_ENST00000541301.1_Intron|CTD-2311M21.2_ENST00000562009.1_RNA|CYP11A1_ENST00000419019.2_Intron	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1						biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	actgaaattgtttaaaATAGT	0.383																																					Esophageal Squamous(87;818 1337 4093 9268 37314)												0																																										SO:0001627	intron_variant	0			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.269+5834A>G	15.37:g.74653823T>C			A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	RNA	SNP	-	NULL	ENST00000268053.6	37	NULL	CCDS32291.1	15																																																																																			CYP11A1	-	-	ENSG00000140459		0.383	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1	-	0.00	23	0	T			74653823	-1	tier1	-	no_errors	ENST00000467407	ensembl	human	known	74_37	rna	36.00	16	9	SNP	0.072	C
DCP1B	196513	genome.wustl.edu	37	12	2062350	2062350	+	Missense_Mutation	SNP	C	C	G	rs570843986	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:2062350C>G	ENST00000280665.6	-	7	835	c.756G>C	c.(754-756)caG>caC	p.Q252H	DCP1B_ENST00000397173.4_Missense_Mutation_p.Q150H|DCP1B_ENST00000540622.1_Missense_Mutation_p.Q126H|DCP1B_ENST00000541700.1_5'UTR	NM_152640.3	NP_689853.3	Q8IZD4	DCP1B_HUMAN	decapping mRNA 1B	252	Poly-Gln.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)	p.Q252H(8)		NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(10)|skin(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00193)			gctgctgctgctgGTGGAGAG	0.552													C|||	2	0.000399361	0.0	0.0	5008	,	,		14619	0.002		0.0	False		,,,				2504	0.0																8	Substitution - Missense(8)	endometrium(5)|lung(2)|large_intestine(1)											35.0	42.0	40.0					12																	2062350		2203	4300	6503	SO:0001583	missense	0			AY146652	CCDS31727.1	12p13.33	2013-05-02	2013-05-02		ENSG00000151065	ENSG00000151065			24451	protein-coding gene	gene with protein product		609843	"""DCP1 decapping enzyme homolog B (S. cerevisiae)"""			12417715, 15067023	Standard	NM_152640		Approved	FLJ31638	uc001qjx.1	Q8IZD4	OTTHUMG00000168113	ENST00000280665.6:c.756G>C	12.37:g.2062350C>G	ENSP00000280665:p.Gln252His		B4DRD1|Q86XH9|Q96BP8|Q96MZ8	Missense_Mutation	SNP	pfam_DCP1	p.Q252H	ENST00000280665.6	37	c.756	CCDS31727.1	12	.	.	.	.	.	.	.	.	.	.	C	0.027	-1.361713	0.01235	.	.	ENSG00000151065	ENST00000280665;ENST00000397173;ENST00000540622	T;T;T	0.19250	2.19;2.17;2.16	4.04	-8.09	0.01090	.	1.568620	0.03045	N	0.153823	T	0.13072	0.0317	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.15694	-1.0428	10	0.17369	T	0.5	.	12.662	0.56820	0.0881:0.1213:0.7178:0.0728	.	150;252	B4DRD1;Q8IZD4	.;DCP1B_HUMAN	H	252;150;126	ENSP00000280665:Q252H;ENSP00000380358:Q150H;ENSP00000444374:Q126H	ENSP00000280665:Q252H	Q	-	3	2	DCP1B	1932611	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.268000	0.02836	-2.090000	0.00859	-2.175000	0.00321	CAG	DCP1B	-	NULL	ENSG00000151065		0.552	DCP1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP1B	HGNC	protein_coding	OTTHUMT00000398244.1	-	0.00	43	0	C	NM_152640		2062350	-1	tier1	-	no_errors	ENST00000280665	ensembl	human	known	74_37	missense	36.11	23	13	SNP	0.000	G
DDX60	55601	genome.wustl.edu	37	4	169143005	169143005	+	Missense_Mutation	SNP	G	G	T	rs367640779		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:169143005G>T	ENST00000393743.3	-	36	5143	c.4852C>A	c.(4852-4854)Cgc>Agc	p.R1618S		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1618					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GCCTGAGAGCGATTGACACCG	0.363																																																	0													93.0	92.0	92.0					4																	169143005		2203	4300	6503	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4852C>A	4.37:g.169143005G>T	ENSP00000377344:p.Arg1618Ser		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R1618S	ENST00000393743.3	37	c.4852	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	G	3.001	-0.206030	0.06180	.	.	ENSG00000137628	ENST00000393743	T	0.16073	2.37	5.01	-3.93	0.04143	.	1.661850	0.03256	N	0.182558	T	0.06781	0.0173	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.0;0.001	T	0.26503	-1.0101	10	0.09590	T	0.72	.	3.8331	0.08882	0.356:0.4208:0.1256:0.0976	.	1618;110	Q8IY21;Q9NT91	DDX60_HUMAN;.	S	1618	ENSP00000377344:R1618S	ENSP00000377344:R1618S	R	-	1	0	DDX60	169379580	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.031000	0.03578	-0.588000	0.05882	-0.300000	0.09419	CGC	DDX60	-	NULL	ENSG00000137628		0.363	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1		0.00	54	0	G	NM_017631		169143005	-1			no_errors	ENST00000393743	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.000	T
DENND2C	163259	genome.wustl.edu	37	1	115142017	115142017	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:115142017G>T	ENST00000393274.1	-	16	2786	c.2161C>A	c.(2161-2163)Cag>Aag	p.Q721K	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393276.3_Missense_Mutation_p.Q664K|DENND2C_ENST00000393277.1_Intron	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	721	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGGTATGCTGCCAGGTGAAC	0.463																																																	0													160.0	130.0	140.0					1																	115142017		2203	4300	6503	SO:0001583	missense	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2161C>A	1.37:g.115142017G>T	ENSP00000376955:p.Gln721Lys		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.Q721K	ENST00000393274.1	37	c.2161	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.027783	0.93518	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540	T;T	0.13901	2.55;2.55	5.81	4.9	0.64082	DENN (3);	0.111108	0.64402	D	0.000006	T	0.39489	0.1080	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.987	T	0.57573	-0.7788	10	0.72032	D	0.01	.	14.9025	0.70689	0.0685:0.0:0.9315:0.0	.	721;664	Q68D51;Q68D51-3	DEN2C_HUMAN;.	K	664;721;721	ENSP00000376957:Q664K;ENSP00000376955:Q721K	ENSP00000358553:Q721K	Q	-	1	0	DENND2C	114943540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.337000	0.96545	1.486000	0.48398	0.644000	0.83932	CAG	DENND2C	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000175984		0.463	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	-	0.00	66	0	G	NM_198459		115142017	-1	tier1	-	no_errors	ENST00000393274	ensembl	human	known	74_37	missense	21.67	47	13	SNP	1.000	T
DIAPH3	81624	genome.wustl.edu	37	13	60554939	60554939	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr13:60554939A>G	ENST00000400324.4	-	14	1755	c.1535T>C	c.(1534-1536)cTt>cCt	p.L512P	DIAPH3_ENST00000400320.1_Missense_Mutation_p.L466P|DIAPH3_ENST00000267215.4_Missense_Mutation_p.L512P|DIAPH3_ENST00000377908.2_Missense_Mutation_p.L501P|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400319.1_Missense_Mutation_p.L442P|DIAPH3_ENST00000400330.1_Missense_Mutation_p.L512P	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	512					actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TTTCTTGTAAAGTTCTGATGC	0.348																																																	0													124.0	119.0	120.0					13																	60554939		1815	4071	5886	SO:0001583	missense	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.1535T>C	13.37:g.60554939A>G	ENSP00000383178:p.Leu512Pro		A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Drf_DAD,superfamily_ARM-type_fold,smart_FH2_Formin	p.L512P	ENST00000400324.4	37	c.1535	CCDS41898.1	13	.	.	.	.	.	.	.	.	.	.	A	16.11	3.030182	0.54790	.	.	ENSG00000139734	ENST00000400324;ENST00000400330;ENST00000400327;ENST00000413168;ENST00000400329;ENST00000377908;ENST00000400319;ENST00000400320;ENST00000267215;ENST00000267214;ENST00000453990	D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.77;-1.75;-1.74;-1.75	5.46	4.25	0.50352	.	0.295609	0.32161	N	0.006495	D	0.89097	0.6618	M	0.81112	2.525	0.41309	D	0.987095	D;D;P	0.55385	0.971;0.967;0.915	P;P;B	0.61800	0.894;0.694;0.314	D	0.89018	0.3433	10	0.66056	D	0.02	.	10.156	0.42823	0.8465:0.0:0.0:0.1535	.	249;249;512	Q9NSV4-2;Q9NSV4-1;Q9NSV4	.;.;DIAP3_HUMAN	P	512;512;501;466;442;501;442;466;512;249;512	ENSP00000383178:L512P;ENSP00000383184:L512P;ENSP00000367141:L501P;ENSP00000383173:L442P;ENSP00000383174:L466P;ENSP00000267215:L512P	ENSP00000267214:L249P	L	-	2	0	DIAPH3	59452940	0.999000	0.42202	0.696000	0.30242	0.751000	0.42716	4.306000	0.59117	0.860000	0.35481	0.383000	0.25322	CTT	DIAPH3	-	NULL	ENSG00000139734		0.348	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	-	0.00	26	0	A	NM_001042517		60554939	-1	tier1	-	no_errors	ENST00000400324	ensembl	human	known	74_37	missense	22.50	31	9	SNP	0.801	G
DNAH5	1767	genome.wustl.edu	37	5	13868096	13868096	+	Silent	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:13868096A>C	ENST00000265104.4	-	25	3944	c.3840T>G	c.(3838-3840)tcT>tcG	p.S1280S	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1280	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCAGGGCATAAGATTCCTAAA	0.378									Kartagener syndrome																																								0													63.0	55.0	58.0					5																	13868096		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3840T>G	5.37:g.13868096A>C			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.S1280	ENST00000265104.4	37	c.3840	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	38	0	A	NM_001369		13868096	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	silent	20.45	35	9	SNP	0.999	C
EDC3	80153	genome.wustl.edu	37	15	74925058	74925058	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:74925058G>C	ENST00000315127.4	-	7	1603	c.1422C>G	c.(1420-1422)atC>atG	p.I474M	EDC3_ENST00000426797.3_Missense_Mutation_p.I474M|EDC3_ENST00000568176.1_Missense_Mutation_p.I474M	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	474	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CGCACAAATAGATACGGCCTG	0.567											OREG0023286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													81.0	74.0	76.0					15																	74925058		2197	4296	6493	SO:0001583	missense	0			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.1422C>G	15.37:g.74925058G>C	ENSP00000320503:p.Ile474Met	1156	B3KPH0|D3DW61|Q9H797	Missense_Mutation	SNP	pfam_YjeF_N_dom,pfam_FDF_dom,superfamily_YjeF_N_dom	p.I474M	ENST00000315127.4	37	c.1422	CCDS10267.1	15	.	.	.	.	.	.	.	.	.	.	G	15.53	2.860398	0.51482	.	.	ENSG00000179151	ENST00000315127;ENST00000426797	T;T	0.46451	0.87;0.87	5.52	4.41	0.53225	YjeF-related protein, N-terminal (3);	0.222750	0.46145	D	0.000304	T	0.36908	0.0984	L	0.46157	1.445	0.30405	N	0.779623	B	0.25235	0.121	B	0.33846	0.171	T	0.41324	-0.9515	10	0.66056	D	0.02	-2.1355	6.6746	0.23087	0.0809:0.1766:0.6251:0.1174	.	474	Q96F86	EDC3_HUMAN	M	474	ENSP00000320503:I474M;ENSP00000401343:I474M	ENSP00000320503:I474M	I	-	3	3	EDC3	72712111	0.996000	0.38824	0.453000	0.27007	0.951000	0.60555	0.415000	0.21181	2.589000	0.87451	0.561000	0.74099	ATC	EDC3	-	superfamily_YjeF_N_dom	ENSG00000179151		0.567	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC3	HGNC	protein_coding	OTTHUMT00000286399.1	-	0.00	59	0	G	NM_025083		74925058	-1	tier1	-	no_errors	ENST00000315127	ensembl	human	known	74_37	missense	40.00	33	22	SNP	0.996	C
EGFLAM	133584	genome.wustl.edu	37	5	38258907	38258907	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:38258907delC	ENST00000354891.3	+	1	397	c.51delC	c.(49-51)agcfs	p.S17fs	EGFLAM_ENST00000322350.5_Frame_Shift_Del_p.S17fs	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	17					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					TGGCTTCCAGCCTCGGACCCG	0.672																																					Colon(62;485 1295 3347 17454)												0													20.0	19.0	19.0					5																	38258907		2202	4294	6496	SO:0001589	frameshift_variant	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.51delC	5.37:g.38258907delC	ENSP00000346964:p.Ser17fs		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Frame_Shift_Del	DEL	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.L18fs	ENST00000354891.3	37	c.51	CCDS56363.1	5																																																																																			EGFLAM	-	NULL	ENSG00000164318		0.672	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1		0.00	36	0	C	NM_152403		38258907	+1	tier1		no_errors	ENST00000354891	ensembl	human	known	74_37	frame_shift_del	61.29	12	19	DEL	0.903	-
NPIPA8	101059953	genome.wustl.edu	37	16	18437147	18437147	+	5'UTR	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:18437147G>A	ENST00000339303.5	-	0	1188				RP11-1212A22.1_ENST00000545152.1_RNA			P0DM63	NPIA8_HUMAN	nuclear pore complex interacting protein family, member A8																		CACTAGCGGTGAGCCCGTGCA	0.662																																																	0																																										SO:0001623	5_prime_UTR_variant	0				CCDS61865.1	16p12.3	2013-06-11			ENSG00000214940	ENSG00000214940			41983	protein-coding gene	gene with protein product	"""morpheus gene family member 9"""					11586358	Standard	NM_001282511		Approved	LCR16a9		P0DM63	OTTHUMG00000166284	ENST00000339303.5:c.-2871C>T	16.37:g.18437147G>A				RNA	SNP	-	NULL	ENST00000339303.5	37	NULL		16																																																																																			RP11-1212A22.1	-	-	ENSG00000205746		0.662	NPIPA8-201	KNOWN	basic|appris_candidate	protein_coding	ENSG00000205746	Clone_based_vega_gene	protein_coding		-	0.00	26	0	G			18437147	-1	tier1	-	no_errors	ENST00000538220	ensembl	human	known	74_37	rna	50.00	11	11	SNP	0.994	A
Unknown	0	genome.wustl.edu	37	GL000212.1	65639	65639	+	IGR	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrGL000212.1:65639C>T								None (None upstream) : None (None downstream)																							GCGTCACTAACGAGGACGCCG	0.672																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65639C>T				Missense_Mutation	SNP	NULL	p.T463M		37	c.1388		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.672					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	160	0	C			65639	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	missense	8.04	103	9	SNP	NULL	T
ZNF971P	100419895	genome.wustl.edu	37	16	34681800	34681800	+	RNA	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:34681800A>C	ENST00000568619.1	-	0	679																											AGTTGGAATAAGTGAAGGCTT	0.353																																																	0																																												0																															16.37:g.34681800A>C				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16																																																																																			RP11-80F22.10	-	-	ENSG00000214581		0.353	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	49	0	A			34681800	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	37.50	35	21	SNP	0.001	C
RP1-241P17.4	0	genome.wustl.edu	37	X	114953387	114953387	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:114953387C>T	ENST00000449327.1	-	1	282	c.163G>A	c.(163-165)Gtg>Atg	p.V55M																								ATCTGCCTCACTGACAATCCC	0.458													C|||	1	0.000264901	0.0008	0.0	3775	,	,		14317	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0																														ENST00000449327.1:c.163G>A	X.37:g.114953387C>T	ENSP00000391266:p.Val55Met			Missense_Mutation	SNP	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.V55M	ENST00000449327.1	37	c.163		X	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.488048	0.01018	.	.	ENSG00000228532	ENST00000449327	T	0.30448	1.53	1.79	0.578	0.17391	.	0.357680	0.22376	N	0.060874	T	0.09335	0.0230	.	.	.	.	.	.	.	.	.	.	.	.	T	0.37384	-0.9708	6	0.02654	T	1	.	4.783	0.13211	0.0:0.1901:0.0:0.8099	.	.	.	.	M	55	ENSP00000391266:V55M	ENSP00000391266:V55M	V	-	1	0	RP1-241P17.4	114859643	1.000000	0.71417	0.987000	0.45799	0.842000	0.47809	1.784000	0.38674	0.127000	0.18452	-0.548000	0.04221	GTG	RP1-241P17.4	-	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000228532		0.458	RP1-241P17.4-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000228532	Clone_based_vega_gene	protein_coding	OTTHUMT00000057980.1	-	0.00	63	0	C			114953387	-1	tier1	-	no_errors	ENST00000449327	ensembl	human	novel	74_37	missense	6.45	115	8	SNP	1.000	T
RP11-146E13.4	0	genome.wustl.edu	37	14	19857011	19857011	+	lincRNA	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:19857011T>C	ENST00000548109.1	+	0	72																											TCATGCGTATTATACTCTCAG	0.383																																																	0																																												0																															14.37:g.19857011T>C				RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-	ENSG00000244306		0.383	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	-	0.00	116	0	T			19857011	-1	tier1	-	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	20.66	96	25	SNP	1.000	C
RP11-469N6.1	0	genome.wustl.edu	37	11	134605739	134605739	+	lincRNA	SNP	C	C	T	rs60987557		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:134605739C>T	ENST00000513405.1	+	0	250																											TGGTGAGCGACGGAGAACTGG	0.642																																																	0																																												0																															11.37:g.134605739C>T				RNA	SNP	-	NULL	ENST00000513405.1	37	NULL		11																																																																																			RP11-469N6.1	-	-	ENSG00000251226		0.642	RP11-469N6.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000251226	Clone_based_vega_gene	lincRNA	OTTHUMT00000382010.2	-	0.00	213	0	C			134605739	+1	tier1	rs60987557	no_errors	ENST00000513405	ensembl	human	known	74_37	rna	36.12	145	82	SNP	0.002	T
RP11-815J4.6	0	genome.wustl.edu	37	18	12076470	12076470	+	RNA	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr18:12076470C>T	ENST00000591780.1	-	0	125																											ACCTTGCCCTCGGCGGCGCCC	0.716																																																	0																																												0																															18.37:g.12076470C>T				RNA	SNP	-	NULL	ENST00000591780.1	37	NULL		18																																																																																			RP11-815J4.6	-	-	ENSG00000256616		0.716	RP11-815J4.6-002	KNOWN	basic	processed_transcript	ENSG00000256616	Clone_based_vega_gene	pseudogene	OTTHUMT00000452539.1	-	0.00	60	0	C			12076470	-1	tier1	-	no_errors	ENST00000591780	ensembl	human	known	74_37	rna	25.49	38	13	SNP	0.127	T
CTXN2	399697	genome.wustl.edu	37	15	48493747	48493747	+	3'UTR	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:48493747T>C	ENST00000417307.2	+	0	622				RP11-605F22.1_ENST00000559875.1_RNA|CTXN2_ENST00000541248.1_3'UTR	NM_001145668.1	NP_001139140.1	P0C2S0	CTXN2_HUMAN	cortexin 2							integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2						CGCGTGAGAGTTCCAGCTATA	0.433																																																	0													216.0	189.0	197.0					15																	48493747		687	1588	2275	SO:0001624	3_prime_UTR_variant	0			BK004876	CCDS45254.1	15q21.1	2013-09-20			ENSG00000233932	ENSG00000233932			31109	protein-coding gene	gene with protein product							Standard	NM_001145668		Approved		uc001zwm.1	P0C2S0	OTTHUMG00000172152	ENST00000417307.2:c.*4T>C	15.37:g.48493747T>C				RNA	SNP	-	NULL	ENST00000417307.2	37	NULL	CCDS45254.1	15																																																																																			RP11-605F22.1	-	-	ENSG00000259385		0.433	CTXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259385	Clone_based_vega_gene	protein_coding	OTTHUMT00000417125.1	-	0.00	47	0	T			48493747	-1	tier1	-	no_errors	ENST00000559875	ensembl	human	known	74_37	rna	35.48	40	22	SNP	0.000	C
CENPBD1	92806	genome.wustl.edu	37	16	90038412	90038412	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:90038412C>T	ENST00000314994.3	-	0	530				RP11-566K11.5_ENST00000565150.1_RNA|CENPBD1_ENST00000567035.1_5'UTR|AFG3L1P_ENST00000437774.1_RNA	NM_145039.3	NP_659476.2	B2RD01	CENP1_HUMAN	CENPB DNA-binding domains containing 1							nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(2)	3						TTGCAGAACTCGGTCAACAGA	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK056131	CCDS45556.1	16q24.3	2009-08-26			ENSG00000177946	ENSG00000177946			28272	protein-coding gene	gene with protein product							Standard	NM_145039		Approved	MGC16385	uc002fpr.3	B2RD01		ENST00000314994.3:c.-82G>A	16.37:g.90038412C>T				RNA	SNP	-	NULL	ENST00000314994.3	37	NULL	CCDS45556.1	16																																																																																			RP11-566K11.5	-	-	ENSG00000261317		0.592	CENPBD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261317	Clone_based_vega_gene	protein_coding	OTTHUMT00000421897.1	-	0.00	30	0	C	NM_145039		90038412	+1	tier1	-	no_errors	ENST00000565150	ensembl	human	known	74_37	rna	37.50	25	15	SNP	0.000	T
UBB	7314	genome.wustl.edu	37	17	16285922	16285922	+	3'UTR	SNP	A	A	G	rs374182250	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:16285922A>G	ENST00000395837.1	+	0	882				UBB_ENST00000302182.3_3'UTR|UBB_ENST00000395839.1_3'UTR|UBB_ENST00000578649.1_3'UTR|UBB_ENST00000535788.1_3'UTR|RP11-138I1.4_ENST00000583934.1_RNA	NM_001281718.1|NM_001281720.1	NP_001268647.1|NP_001268649.1	P0CG47	UBB_HUMAN	ubiquitin B						activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)		TTCTTCAGTCATGGCATTCGC	0.483													T|||	5	0.000998403	0.0038	0.0	5008	,	,		22900	0.0		0.0	False		,,,				2504	0.0				Melanoma(163;1126 3406 34901)												0								T		8,4398		0,8,2195	27.0	25.0	26.0			3.6	0.6	17		26	0,8600		0,0,4300	no	utr-3	UBB	NM_018955.2		0,8,6495	GG,GA,AA		0.0,0.1816,0.0615			16285922	8,12998	2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS11177.1	17p12-p11.2	2010-11-25			ENSG00000170315	ENSG00000170315			12463	protein-coding gene	gene with protein product	"""polyubiquitin B"""	191339				2154095	Standard	NM_018955		Approved	MGC8385, FLJ25987	uc002gpx.3	P0CG47	OTTHUMG00000058987	ENST00000395837.1:c.*11A>G	17.37:g.16285922A>G			P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	RNA	SNP	-	NULL	ENST00000395837.1	37	NULL	CCDS11177.1	17																																																																																			RP11-138I1.4	-	-	ENSG00000265401		0.483	UBB-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000265401	Clone_based_vega_gene	protein_coding	OTTHUMT00000130459.1	-	0.00	77	0	A	NM_018955		16285922	-1	tier1	-	no_errors	ENST00000583934	ensembl	human	known	74_37	rna	40.62	19	13	SNP	0.638	G
RP11-434D2.11	0	genome.wustl.edu	37	17	20459506	20459506	+	RNA	SNP	A	A	G	rs113624258		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:20459506A>G	ENST00000579603.1	-	0	89																											TGCAGAGTCAATGAGGAGAGG	0.473																																																	0																																												0																															17.37:g.20459506A>G				RNA	SNP	-	NULL	ENST00000579603.1	37	NULL		17																																																																																			RP11-434D2.11	-	-	ENSG00000263946		0.473	RP11-434D2.11-002	KNOWN	basic	processed_transcript	ENSG00000263946	Clone_based_vega_gene	pseudogene	OTTHUMT00000448286.1	-	0.00	25	0	A			20459506	-1	tier1	rs113624258	no_errors	ENST00000579603	ensembl	human	known	74_37	rna	20.83	19	5	SNP	0.028	G
ERBB3	2065	genome.wustl.edu	37	12	56491645	56491645	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:56491645G>T	ENST00000267101.3	+	21	2977	c.2537G>T	c.(2536-2538)aGt>aTt	p.S846I	ERBB3_ENST00000553131.1_Missense_Mutation_p.S87I|ERBB3_ENST00000415288.2_Missense_Mutation_p.S787I|ERBB3_ENST00000549832.1_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.S203I	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	846	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)	p.S846I(1)		central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AAGTCACCCAGTCAGGTTCAG	0.502																																																	1	Substitution - Missense(1)	large_intestine(1)											185.0	151.0	163.0					12																	56491645		2203	4300	6503	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.2537G>T	12.37:g.56491645G>T	ENSP00000267101:p.Ser846Ile		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S846I	ENST00000267101.3	37	c.2537	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174093	0.78452	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000553131	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.87	5.87	0.94306	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.064574	0.64402	D	0.000005	T	0.47619	0.1455	N	0.16833	0.445	0.40655	D	0.982077	D	0.54397	0.966	P	0.47346	0.544	T	0.52571	-0.8558	10	0.62326	D	0.03	.	12.6639	0.56830	0.0764:0.0:0.9236:0.0	.	846	P21860	ERBB3_HUMAN	I	846;203;787;87	ENSP00000267101:S846I;ENSP00000399178:S203I;ENSP00000408340:S787I;ENSP00000449129:S87I	ENSP00000267101:S846I	S	+	2	0	ERBB3	54777912	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.509000	0.53386	2.941000	0.99782	0.655000	0.94253	AGT	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000065361		0.502	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	-	0.00	43	0	G			56491645	+1	tier1	-	no_errors	ENST00000267101	ensembl	human	known	74_37	missense	37.50	35	21	SNP	1.000	T
EVC2	132884	genome.wustl.edu	37	4	5570279	5570279	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:5570279G>T	ENST00000344408.5	-	20	3502	c.3449C>A	c.(3448-3450)gCc>gAc	p.A1150D	EVC2_ENST00000344938.1_Missense_Mutation_p.A1150D|EVC2_ENST00000310917.2_Missense_Mutation_p.A1070D	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	1150					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AGGCTGTGAGGCTGTGGGCAG	0.662																																																	0													29.0	30.0	30.0					4																	5570279		2202	4300	6502	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.3449C>A	4.37:g.5570279G>T	ENSP00000342144:p.Ala1150Asp		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.A1150D	ENST00000344408.5	37	c.3449	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	12.54	1.969283	0.34754	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.74947	-0.89;-0.88;-0.89	5.3	4.44	0.53790	.	0.194461	0.45606	N	0.000352	T	0.60728	0.2291	N	0.24115	0.695	0.09310	N	1	P	0.38922	0.651	B	0.38562	0.276	T	0.59799	-0.7386	10	0.59425	D	0.04	-8.3859	10.4731	0.44648	0.0:0.2565:0.7435:0.0	.	1150	Q86UK5	LBN_HUMAN	D	1150;1070;1150	ENSP00000339954:A1150D;ENSP00000311683:A1070D;ENSP00000342144:A1150D	ENSP00000311683:A1070D	A	-	2	0	EVC2	5621180	0.846000	0.29590	0.178000	0.23040	0.018000	0.09664	1.931000	0.40134	2.480000	0.83734	0.511000	0.50034	GCC	EVC2	-	NULL	ENSG00000173040		0.662	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	-	0.00	44	0	G	NM_147127		5570279	-1	tier1	-	no_errors	ENST00000344408	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.066	T
EXPH5	23086	genome.wustl.edu	37	11	108382046	108382046	+	Silent	SNP	A	A	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:108382046A>T	ENST00000265843.4	-	6	4298	c.4188T>A	c.(4186-4188)acT>acA	p.T1396T	EXPH5_ENST00000428840.1_Silent_p.T1320T|EXPH5_ENST00000525344.1_Silent_p.T1389T|EXPH5_ENST00000443411.1_Silent_p.T1208T|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1396					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GCATCAATGAAGTATGCAGGG	0.358																																																	0													84.0	84.0	84.0					11																	108382046		2201	4298	6499	SO:0001819	synonymous_variant	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4188T>A	11.37:g.108382046A>T			Q2KHM1|Q9Y4D6	Silent	SNP	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.T1396	ENST00000265843.4	37	c.4188	CCDS8341.1	11																																																																																			EXPH5	-	NULL	ENSG00000110723		0.358	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1		0.00	19	0	A	NM_015065		108382046	-1			no_errors	ENST00000265843	ensembl	human	known	74_37	silent	16.67	15	3	SNP	0.000	T
F8	2157	genome.wustl.edu	37	X	154158008	154158008	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:154158008C>T	ENST00000360256.4	-	14	4257	c.4057G>A	c.(4057-4059)Gat>Aat	p.D1353N		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1353	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GAGGTGTCATCCACAATTATC	0.428																																																	0													256.0	212.0	227.0					X																	154158008		2203	4300	6503	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.4057G>A	X.37:g.154158008C>T	ENSP00000353393:p.Asp1353Asn		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.D1353N	ENST00000360256.4	37	c.4057	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	0.198	-1.046932	0.01997	.	.	ENSG00000185010	ENST00000360256	D	0.98684	-5.07	4.71	-0.201	0.13212	.	0.535928	0.16889	N	0.195367	D	0.91788	0.7402	N	0.02247	-0.625	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.85151	0.0986	10	0.13108	T	0.6	-2.2887	9.3228	0.37975	0.0:0.1436:0.0:0.8564	.	1353	P00451	FA8_HUMAN	N	1353	ENSP00000353393:D1353N	ENSP00000353393:D1353N	D	-	1	0	F8	153811202	0.007000	0.16637	0.001000	0.08648	0.008000	0.06430	-0.072000	0.11486	-0.354000	0.08212	-0.195000	0.12781	GAT	F8	-	NULL	ENSG00000185010		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	-	0.00	82	0	C			154158008	-1	tier1	-	no_errors	ENST00000360256	ensembl	human	known	74_37	missense	31.40	59	27	SNP	0.001	T
FAM150A	389658	genome.wustl.edu	37	8	53477670	53477670	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:53477670G>A	ENST00000358543.4	-	1	397	c.147C>T	c.(145-147)ccC>ccT	p.P49P	FAM150A_ENST00000523939.1_Silent_p.P49P	NM_207413.3	NP_997296.1	Q6UXT8	F150A_HUMAN	family with sequence similarity 150, member A	49						extracellular region (GO:0005576)				lung(1)	1		Lung NSC(129;0.0919)|all_epithelial(80;0.125)|all_lung(136;0.17)				ccccggccgcggggAGGAAAA	0.736																																																	0													3.0	4.0	4.0					8																	53477670		1553	3142	4695	SO:0001819	synonymous_variant	0				CCDS6150.1	8q11.23	2007-12-18			ENSG00000196711	ENSG00000196711			33775	protein-coding gene	gene with protein product							Standard	NM_207413		Approved	UNQ9433	uc003xrd.3	Q6UXT8	OTTHUMG00000164256	ENST00000358543.4:c.147C>T	8.37:g.53477670G>A			B7ZMG9	Silent	SNP	NULL	p.P49	ENST00000358543.4	37	c.147	CCDS6150.1	8																																																																																			FAM150A	-	NULL	ENSG00000196711		0.736	FAM150A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM150A	HGNC	protein_coding	OTTHUMT00000377959.1	-	0.00	17	0	G	NM_207413		53477670	-1	tier1	-	no_errors	ENST00000358543	ensembl	human	known	74_37	silent	21.05	15	4	SNP	0.000	A
FAM153B	202134	genome.wustl.edu	37	5	175530246	175530246	+	Silent	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:175530246A>C	ENST00000253490.4	+	13	738	c.681A>C	c.(679-681)gtA>gtC	p.V227V	FAM153B_ENST00000515817.1_Silent_p.V150V|FAM153B_ENST00000510151.1_Silent_p.V150V|FAM153B_ENST00000512862.1_Intron			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	227										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		TCAGGGATGTACTTCAGGAGC	0.493																																																	0													213.0	222.0	219.0					5																	175530246		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.681A>C	5.37:g.175530246A>C			A8MTI1	Silent	SNP	prints_FAM153	p.V227	ENST00000253490.4	37	c.681		5																																																																																			FAM153B	-	NULL	ENSG00000182230		0.493	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM153B	HGNC	protein_coding		-	0.00	389	0	A	NM_001079529		175530246	+1	tier1	-	no_errors	ENST00000253490	ensembl	human	known	74_37	silent	14.29	305	51	SNP	0.000	C
FAM153A	285596	genome.wustl.edu	37	5	177161918	177161918	+	Silent	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:177161918T>G	ENST00000440605.3	-	12	733	c.450A>C	c.(448-450)gtA>gtC	p.V150V	FAM153A_ENST00000513554.1_Intron|FAM153A_ENST00000393518.3_Intron|FAM153A_ENST00000510276.1_Silent_p.V150V	NM_173663.3	NP_775934.3	Q9UHL3	F153A_HUMAN	family with sequence similarity 153, member A	150										kidney(6)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	11	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCCTGAAGTACATCCCTGA	0.488																																																	0													18.0	16.0	16.0					5																	177161918		2111	4243	6354	SO:0001819	synonymous_variant	0			AB018295	CCDS34305.1	5q35.3	2010-05-12			ENSG00000170074	ENSG00000170074			29940	protein-coding gene	gene with protein product	"""NY REN 7 antigen"""					10508479, 9872452	Standard	NM_173663		Approved	NY-REN-7	uc003mic.3	Q9UHL3	OTTHUMG00000163394	ENST00000440605.3:c.450A>C	5.37:g.177161918T>G			A8K0F3|O94852	Silent	SNP	prints_FAM153	p.V150	ENST00000440605.3	37	c.450	CCDS34305.1	5																																																																																			FAM153A	-	NULL	ENSG00000170074		0.488	FAM153A-022	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	FAM153A	HGNC	protein_coding	OTTHUMT00000417242.1	-	0.00	68	0	T	NM_173663		177161918	-1	tier1	-	no_errors	ENST00000360669	ensembl	human	known	74_37	silent	26.32	42	15	SNP	0.000	G
FAM46D	169966	genome.wustl.edu	37	X	79698478	79698478	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:79698478T>G	ENST00000308293.5	+	3	679	c.440T>G	c.(439-441)aTc>aGc	p.I147S	FAM46D_ENST00000538312.1_Missense_Mutation_p.I147S	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	147										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						TGGAGTCTTATCTCCCTTTCA	0.368																																																	0													106.0	102.0	103.0					X																	79698478		2203	4299	6502	SO:0001583	missense	0			BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.440T>G	X.37:g.79698478T>G	ENSP00000308575:p.Ile147Ser		B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	pfam_DUF1693	p.I147S	ENST00000308293.5	37	c.440	CCDS14446.1	X	.	.	.	.	.	.	.	.	.	.	T	14.53	2.562946	0.45694	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.26518	1.73;1.73	4.47	4.47	0.54385	Domain of unknown function DUF1693 (1);	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	M	0.87827	2.91	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.62426	-0.6857	10	0.87932	D	0	-11.3509	11.7985	0.52114	0.0:0.0:0.0:1.0	.	147	Q8NEK8	FA46D_HUMAN	S	147	ENSP00000443410:I147S;ENSP00000308575:I147S	ENSP00000308575:I147S	I	+	2	0	FAM46D	79585134	1.000000	0.71417	0.998000	0.56505	0.383000	0.30230	7.534000	0.82004	1.659000	0.50751	0.481000	0.45027	ATC	FAM46D	-	pfam_DUF1693	ENSG00000174016		0.368	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46D	HGNC	protein_coding	OTTHUMT00000057338.1	-	0.00	33	0	T	NM_152630		79698478	+1	tier1	-	no_errors	ENST00000308293	ensembl	human	known	74_37	missense	62.50	18	30	SNP	1.000	G
FAM86B2	653333	genome.wustl.edu	37	8	12286498	12286498	+	Missense_Mutation	SNP	G	G	C	rs552358938	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:12286498G>C	ENST00000262365.4	-	5	467	c.468C>G	c.(466-468)ttC>ttG	p.F156L	FAM86B2_ENST00000393715.3_Nonsense_Mutation_p.S17*|FAM86B2_ENST00000309608.5_Missense_Mutation_p.F122L|FAM86B2_ENST00000351291.4_Missense_Mutation_p.F122L	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	156										endometrium(1)|kidney(2)	3						ACCTGTTAATGAAGGCTGCCG	0.612													g|||	392	0.0782748	0.0295	0.1297	5008	,	,		20523	0.0764		0.0885	False		,,,				2504	0.0992																0													1.0	1.0	1.0					8																	12286498		129	503	632	SO:0001583	missense	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.468C>G	8.37:g.12286498G>C	ENSP00000262365:p.Phe156Leu			Nonsense_Mutation	SNP	NULL	p.S17*	ENST00000262365.4	37	c.50	CCDS59092.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	18.35|18.35	3.603943|3.603943	0.66445|0.66445	.|.	.|.	ENSG00000145002|ENSG00000145002	ENST00000262365;ENST00000351291;ENST00000309608;ENST00000527331;ENST00000532480|ENST00000393715	T;T;T;T;T|.	0.22134|.	2.38;2.38;1.97;2.38;2.05|.	1.16|1.16	0.229|0.229	0.15368|0.15368	.|.	.|.	.|.	.|.	.|.	T|.	0.54711|.	0.1875|.	L|L	0.49640|0.49640	1.575|1.575	0.58432|0.58432	D|D	0.999997|0.999997	D|.	0.55605|.	0.972|.	P|.	0.60415|.	0.874|.	T|.	0.52518|.	-0.8565|.	9|.	0.45353|0.62326	T|D	0.12|0.03	.|.	5.4544|5.4544	0.16582|0.16582	0.216:0.0:0.784:0.0|0.216:0.0:0.784:0.0	.|.	156|.	P0C5J1|.	F86B2_HUMAN|.	L|X	156;122;122;122;122|17	ENSP00000262365:F156L;ENSP00000283479:F122L;ENSP00000311330:F122L;ENSP00000432491:F122L;ENSP00000436338:F122L|.	ENSP00000262365:F156L|ENSP00000377318:S17X	F|S	-|-	3|2	2|0	FAM86B2|FAM86B2	12330869|12330869	0.912000|0.912000	0.30974|0.30974	0.029000|0.029000	0.17559|0.17559	0.125000|0.125000	0.20455|0.20455	1.259000|1.259000	0.32956|0.32956	0.065000|0.065000	0.16485|0.16485	0.162000|0.162000	0.16502|0.16502	TTC|TCA	FAM86B2	-	NULL	ENSG00000145002		0.612	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		-	0.00	20	0	G	XM_928336		12286498	-1	tier1	-	no_errors	ENST00000393715	ensembl	human	known	74_37	nonsense	40.00	3	2	SNP	0.829	C
FAR2	55711	genome.wustl.edu	37	12	29469890	29469890	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:29469890C>T	ENST00000536681.3	+	9	1318	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	RP11-996F15.2_ENST00000553105.1_RNA|FAR2_ENST00000182377.4_Missense_Mutation_p.R358W|FAR2_ENST00000547116.1_Missense_Mutation_p.R261W	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	358					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						GGTCAGCCACCGGGCCCCTGC	0.498																																																	0													132.0	138.0	136.0					12																	29469890		2203	4300	6503	SO:0001583	missense	0			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.1072C>T	12.37:g.29469890C>T	ENSP00000443291:p.Arg358Trp		F8VV73|Q9H0D5|Q9NVW8	Missense_Mutation	SNP	pfam_Male_sterile_NAD-bd,pfam_FAR,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like	p.R358W	ENST00000536681.3	37	c.1072	CCDS8717.1	12	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981825	0.34942	.	.	ENSG00000064763	ENST00000536681;ENST00000182377;ENST00000547116	T;T;T	0.32023	1.88;1.88;1.47	4.44	-0.628	0.11537	.	0.299368	0.30101	N	0.010408	T	0.08626	0.0214	N	0.01576	-0.805	0.36785	D	0.884559	B	0.10296	0.003	B	0.10450	0.005	T	0.09079	-1.0691	10	0.37606	T	0.19	-12.1739	3.6128	0.08066	0.2388:0.4367:0.0:0.3244	.	358	Q96K12	FACR2_HUMAN	W	358;358;261	ENSP00000443291:R358W;ENSP00000182377:R358W;ENSP00000449349:R261W	ENSP00000182377:R358W	R	+	1	2	FAR2	29361157	1.000000	0.71417	0.276000	0.24689	0.957000	0.61999	1.620000	0.36976	0.047000	0.15862	0.467000	0.42956	CGG	FAR2	-	pfam_FAR	ENSG00000064763		0.498	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR2	HGNC	protein_coding	OTTHUMT00000403479.2	-	0.00	45	0	C	NM_018099		29469890	+1	tier1	-	no_errors	ENST00000182377	ensembl	human	known	74_37	missense	33.33	42	21	SNP	0.994	T
FAT4	79633	genome.wustl.edu	37	4	126238008	126238008	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:126238008A>C	ENST00000394329.3	+	1	455	c.442A>C	c.(442-444)Agt>Cgt	p.S148R		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	148	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAAGGAAGACAGTAGCAGCGG	0.607											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													34.0	39.0	37.0					4																	126238008		2051	4213	6264	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.442A>C	4.37:g.126238008A>C	ENSP00000377862:p.Ser148Arg	1548	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S148R	ENST00000394329.3	37	c.442	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	14.36	2.513630	0.44763	.	.	ENSG00000196159	ENST00000394329	T	0.52754	0.65	5.11	5.11	0.69529	Cadherin (3);Cadherin-like (1);	0.253891	0.20449	U	0.092127	T	0.44993	0.1320	L	0.32530	0.975	0.80722	D	1	P	0.37594	0.601	B	0.42959	0.403	T	0.43845	-0.9366	10	0.49607	T	0.09	.	14.9175	0.70810	1.0:0.0:0.0:0.0	.	148	Q6V0I7	FAT4_HUMAN	R	148	ENSP00000377862:S148R	ENSP00000377862:S148R	S	+	1	0	FAT4	126457458	1.000000	0.71417	0.998000	0.56505	0.600000	0.36913	7.261000	0.78400	1.917000	0.55516	0.533000	0.62120	AGT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000196159		0.607	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	44	0	A	NM_024582		126238008	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	C
FBP2	8789	genome.wustl.edu	37	9	97329654	97329654	+	Silent	SNP	G	G	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:97329654G>C	ENST00000375337.3	-	5	669	c.603C>G	c.(601-603)gtC>gtG	p.V201V	PCAT7_ENST00000452148.2_RNA	NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	201					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				TCTTAATCTTGACATCTTTTT	0.438																																																	0													140.0	143.0	142.0					9																	97329654		2203	4300	6503	SO:0001819	synonymous_variant	0			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.603C>G	9.37:g.97329654G>C			Q17R39|Q6FI53	Silent	SNP	pfam_FBPase_class-1/SBPase,pfam_Inositol_monophosphatase,prints_FBPtase,prints_SBPase	p.V201	ENST00000375337.3	37	c.603	CCDS6711.1	9																																																																																			FBP2	-	pfam_FBPase_class-1/SBPase,prints_FBPtase	ENSG00000130957		0.438	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBP2	HGNC	protein_coding	OTTHUMT00000053189.1	-	0.00	99	0	G	NM_003837		97329654	-1	tier1	-	no_errors	ENST00000375337	ensembl	human	known	74_37	silent	30.69	70	31	SNP	1.000	C
FGF9	2254	genome.wustl.edu	37	13	22275850	22275850	+	3'UTR	SNP	G	G	A	rs61706549|rs71093347|rs112896362|rs398037423		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr13:22275850G>A	ENST00000382353.5	+	0	1433				FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9						angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		gtgtgtgtatgtgtgtgtgtg	0.527																																					Melanoma(195;1939 2127 12623 13963 52730)												0																																										SO:0001624	3_prime_UTR_variant	0			D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.*276G>A	13.37:g.22275850G>A			A8K427|Q3SY32	RNA	SNP	-	NULL	ENST00000382353.5	37	NULL	CCDS9298.1	13																																																																																			FGF9	-	-	ENSG00000102678		0.527	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	HGNC	protein_coding	OTTHUMT00000046002.2	-	0.00	22	0	G			22275850	+1	tier1	-	no_errors	ENST00000478546	ensembl	human	known	74_37	rna	13.51	32	5	SNP	0.004	A
FLG2	388698	genome.wustl.edu	37	1	152328611	152328611	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:152328611T>C	ENST00000388718.5	-	3	1723	c.1651A>G	c.(1651-1653)Agt>Ggt	p.S551G	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	551	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GATGATTGACTTGAGCCAGAA	0.488																																																	0													276.0	279.0	278.0					1																	152328611		2203	4300	6503	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1651A>G	1.37:g.152328611T>C	ENSP00000373370:p.Ser551Gly		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S551G	ENST00000388718.5	37	c.1651	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	4.438	0.081113	0.08533	.	.	ENSG00000143520	ENST00000388718	T	0.00902	5.56	3.82	-1.63	0.08345	.	.	.	.	.	T	0.00210	0.0006	N	0.21097	0.63	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.40421	-0.9564	9	0.02654	T	1	.	7.6341	0.28257	0.0:0.4919:0.0:0.5081	.	551	Q5D862	FILA2_HUMAN	G	551	ENSP00000373370:S551G	ENSP00000373370:S551G	S	-	1	0	FLG2	150595235	0.000000	0.05858	0.506000	0.27664	0.576000	0.36127	-1.492000	0.02300	-0.215000	0.10063	0.383000	0.25322	AGT	FLG2	-	NULL	ENSG00000143520		0.488	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	151	0	T	NM_001014342		152328611	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	17.91	165	36	SNP	0.132	C
FPR2	2358	genome.wustl.edu	37	19	52272896	52272896	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:52272896T>G	ENST00000598776.1	+	2	1757	c.985T>G	c.(985-987)Tca>Gca	p.S329A	FPR2_ENST00000598953.1_Missense_Mutation_p.S329A|FPR2_ENST00000340023.6_Missense_Mutation_p.S329A	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	329					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						GTCTGAGGACTCAGCCCCAAC	0.547																																																	0													72.0	68.0	69.0					19																	52272896		2203	4300	6503	SO:0001583	missense	0			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.985T>G	19.37:g.52272896T>G	ENSP00000468897:p.Ser329Ala		A8K3E2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Formyl_pep_rcpt,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_DEZorph_rcpt	p.S329A	ENST00000598776.1	37	c.985	CCDS12840.1	19	.	.	.	.	.	.	.	.	.	.	.	10.86	1.468959	0.26335	.	.	ENSG00000171049	ENST00000340023	T	0.38722	1.12	4.49	-0.639	0.11497	.	1.599620	0.03573	N	0.228876	T	0.42765	0.1217	M	0.79475	2.455	0.09310	N	1	B	0.23806	0.091	B	0.26969	0.075	T	0.32322	-0.9911	10	0.66056	D	0.02	.	0.5849	0.00718	0.2011:0.2828:0.1507:0.3654	.	329	P25090	FPR2_HUMAN	A	329	ENSP00000340191:S329A	ENSP00000340191:S329A	S	+	1	0	FPR2	56964708	0.000000	0.05858	0.001000	0.08648	0.068000	0.16541	-0.448000	0.06820	-0.510000	0.06523	0.397000	0.26171	TCA	FPR2	-	prints_DEZorph_rcpt	ENSG00000171049		0.547	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR2	HGNC	protein_coding	OTTHUMT00000466912.2	-	0.00	39	0	T	NM_001005738		52272896	+1	tier1	-	no_errors	ENST00000340023	ensembl	human	known	74_37	missense	16.00	42	8	SNP	0.001	G
FSCB	84075	genome.wustl.edu	37	14	44974184	44974184	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:44974184T>G	ENST00000340446.4	-	1	2298	c.2007A>C	c.(2005-2007)gaA>gaC	p.E669D	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	669	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		GAGGCTGAACTTCAGCGGGGG	0.622																																																	0													12.0	15.0	14.0					14																	44974184		2185	4291	6476	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2007A>C	14.37:g.44974184T>G	ENSP00000344579:p.Glu669Asp		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.E669D	ENST00000340446.4	37	c.2007	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770428	0.31320	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.14266	2.52	3.57	-2.27	0.06846	.	.	.	.	.	T	0.10337	0.0253	L	0.54323	1.7	0.09310	N	1	P	0.44816	0.844	B	0.42319	0.383	T	0.18967	-1.0320	9	0.21014	T	0.42	-3.5828	1.036	0.01548	0.1544:0.3067:0.1573:0.3816	.	669	Q5H9T9	FSCB_HUMAN	D	669;562	ENSP00000344579:E669D	ENSP00000344579:E669D	E	-	3	2	FSCB	44043934	0.006000	0.16342	0.004000	0.12327	0.352000	0.29268	0.650000	0.24858	-0.417000	0.07461	0.352000	0.21897	GAA	FSCB	-	NULL	ENSG00000189139		0.622	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	-	0.00	141	0	T	NM_032135		44974184	-1	tier1	-	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	41.82	64	46	SNP	0.001	G
GAB4	128954	genome.wustl.edu	37	22	17488926	17488926	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr22:17488926C>T	ENST00000400588.1	-	1	186	c.79G>A	c.(79-81)Gga>Aga	p.G27R	GAB4_ENST00000523144.1_5'Flank	NM_001037814.1	NP_001032903.1	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member 4	27										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(24)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44		all_epithelial(15;0.112)|Lung NSC(13;0.248)				GGGCCACTTCCGGGCCACGAA	0.662																																																	0													15.0	19.0	17.0					22																	17488926		2080	4202	6282	SO:0001583	missense	0			AK057252	CCDS42976.1	22q11.2	2013-01-10			ENSG00000215568	ENSG00000215568		"""Pleckstrin homology (PH) domain containing"""	18325	protein-coding gene	gene with protein product							Standard	NM_001037814		Approved		uc002zlw.3	Q2WGN9	OTTHUMG00000149992	ENST00000400588.1:c.79G>A	22.37:g.17488926C>T	ENSP00000383431:p.Gly27Arg			Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G27R	ENST00000400588.1	37	c.79	CCDS42976.1	22	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668781	0.29604	.	.	ENSG00000215568	ENST00000400588	T	0.11712	2.75	0.637	-0.52	0.11935	.	.	.	.	.	T	0.10078	0.0247	N	0.08118	0	0.09310	N	1	D	0.76494	0.999	D	0.68192	0.956	T	0.31223	-0.9951	8	0.16420	T	0.52	.	.	.	.	.	27	Q2WGN9	GAB4_HUMAN	R	27	ENSP00000383431:G27R	ENSP00000383431:G27R	G	-	1	0	GAB4	15868926	0.013000	0.17824	0.007000	0.13788	0.029000	0.11900	0.023000	0.13533	-0.228000	0.09869	0.313000	0.20887	GGA	GAB4	-	NULL	ENSG00000215568		0.662	GAB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAB4	HGNC	protein_coding	OTTHUMT00000315426.1	-	0.00	79	0	C	XM_372882		17488926	-1	tier1	-	no_errors	ENST00000400588	ensembl	human	known	74_37	missense	31.67	41	19	SNP	0.008	T
GABBR2	9568	genome.wustl.edu	37	9	101340352	101340352	+	Silent	SNP	G	G	A	rs145095054	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:101340352G>A	ENST00000259455.2	-	2	783	c.324C>T	c.(322-324)tgC>tgT	p.C108C		NM_005458.7	NP_005449.5	O75899	GABR2_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 2	108					G-protein coupled receptor signaling pathway (GO:0007186)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled GABA receptor activity (GO:0004965)		NOTCH1_ENST00000277541/GABBR2(2)	breast(4)|endometrium(4)|large_intestine(12)|lung(21)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	49		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	TTGCGTTGTCGCACTGGGAAG	0.463																																																	0										2,4404	4.2+/-10.8	0,2,2201	133.0	120.0	125.0		324	0.9	1.0	9	dbSNP_134	125	0,8600		0,0,4300	no	coding-synonymous	GABBR2	NM_005458.7		0,2,6501	AA,AG,GG		0.0,0.0454,0.0154		108/942	101340352	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF069755	CCDS6736.1	9q22.1-q22.3	2012-08-29	2006-02-16	2006-02-16	ENSG00000136928	ENSG00000136928		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4507	protein-coding gene	gene with protein product		607340	"""G protein-coupled receptor 51"""	GPR51		10087195	Standard	NM_005458		Approved	HG20, GABABR2, GPRC3B	uc004ays.3	O75899	OTTHUMG00000020345	ENST00000259455.2:c.324C>T	9.37:g.101340352G>A			O75974|O75975|Q5VXZ2|Q8WX04|Q9P1R2|Q9UNR1|Q9UNS9	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B2,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,prints_GPCR_3,pfscan_GPCR_3_C	p.C108	ENST00000259455.2	37	c.324	CCDS6736.1	9																																																																																			GABBR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000136928		0.463	GABBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR2	HGNC	protein_coding	OTTHUMT00000053373.1	-	0.00	69	0	G			101340352	-1	tier1	rs145095054	no_errors	ENST00000259455	ensembl	human	known	74_37	silent	20.00	52	13	SNP	1.000	A
GLP1R	2740	genome.wustl.edu	37	6	39047354	39047354	+	Missense_Mutation	SNP	C	C	A	rs199783730		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr6:39047354C>A	ENST00000373256.4	+	11	1101	c.1058C>A	c.(1057-1059)aCg>aAg	p.T353K		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	353					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	GCCAAGTCCACGCTGACACTC	0.572																																																	0													82.0	77.0	79.0					6																	39047354		2203	4300	6503	SO:0001583	missense	0				CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.1058C>A	6.37:g.39047354C>A	ENSP00000362353:p.Thr353Lys		Q2M229|Q99669	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GLP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.T353K	ENST00000373256.4	37	c.1058	CCDS4839.1	6	.	.	.	.	.	.	.	.	.	.	C	31	5.084414	0.94100	.	.	ENSG00000112164	ENST00000373256	T	0.41400	1.0	5.4	5.4	0.78164	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	T	0.71134	0.3304	M	0.93638	3.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79652	-0.1714	10	0.87932	D	0	.	19.1798	0.93619	0.0:1.0:0.0:0.0	.	353	P43220	GLP1R_HUMAN	K	353	ENSP00000362353:T353K	ENSP00000362353:T353K	T	+	2	0	GLP1R	39155332	1.000000	0.71417	0.958000	0.39756	0.929000	0.56500	7.818000	0.86416	2.537000	0.85549	0.561000	0.74099	ACG	GLP1R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000112164		0.572	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP1R	HGNC	protein_coding	OTTHUMT00000040443.1	-	0.00	54	0	C			39047354	+1	tier1	-	no_errors	ENST00000373256	ensembl	human	known	74_37	missense	20.00	52	13	SNP	1.000	A
GOLGA3	2802	genome.wustl.edu	37	12	133398705	133398705	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:133398705C>T	ENST00000450791.2	-	1	193	c.10G>A	c.(10-12)Gcg>Acg	p.A4T	GOLGA3_ENST00000545875.1_Missense_Mutation_p.A4T|GOLGA3_ENST00000204726.3_Missense_Mutation_p.A4T|GOLGA3_ENST00000456883.2_Missense_Mutation_p.A4T|GOLGA3_ENST00000537452.1_Missense_Mutation_p.A4T			Q08378	GOGA3_HUMAN	golgin A3	4					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		TCGGCCGACGCGCCGTCCATG	0.647																																																	0													29.0	31.0	30.0					12																	133398705		2203	4300	6503	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.10G>A	12.37:g.133398705C>T	ENSP00000410378:p.Ala4Thr		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.A4T	ENST00000450791.2	37	c.10	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	15.00	2.701823	0.48307	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.32753	1.88;1.88;1.88;1.44;1.44	5.6	1.27	0.21489	.	0.670329	0.14654	N	0.306394	T	0.20901	0.0503	L	0.44542	1.39	0.09310	N	1	B;B;B	0.25007	0.086;0.116;0.116	B;B;B	0.14023	0.01;0.008;0.008	T	0.17410	-1.0370	10	0.51188	T	0.08	.	4.1388	0.10183	0.2275:0.4976:0.0:0.2749	.	4;4;4	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	T	4	ENSP00000204726:A4T;ENSP00000410378:A4T;ENSP00000409303:A4T;ENSP00000442143:A4T;ENSP00000442603:A4T	ENSP00000204726:A4T	A	-	1	0	GOLGA3	131908778	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.605000	0.05661	0.304000	0.22809	0.561000	0.74099	GCG	GOLGA3	-	NULL	ENSG00000090615		0.647	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	40	0	C	NM_005895		133398705	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	31.25	33	15	SNP	0.000	T
GPR98	84059	genome.wustl.edu	37	5	89938579	89938579	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:89938579A>C	ENST00000405460.2	+	12	2463	c.2367A>C	c.(2365-2367)aaA>aaC	p.K789N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	789	Calx-beta 6. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGTTATAAAAGTAAGTACGA	0.358																																																	0													81.0	86.0	85.0					5																	89938579		1796	4065	5861	SO:0001630	splice_region_variant	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.2367+1A>C	5.37:g.89938579A>C			O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.K789N	ENST00000405460.2	37	c.2367	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	4.378	0.069659	0.08436	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.26518	1.73	5.09	-3.28	0.05033	Na-Ca exchanger/integrin-beta4 (1);	0.253642	0.46758	N	0.000271	T	0.08980	0.0222	N	0.12471	0.22	0.80722	D	1	B	0.11235	0.004	B	0.11329	0.006	T	0.13388	-1.0511	10	0.34782	T	0.22	.	1.2194	0.01921	0.4406:0.1111:0.1432:0.3051	.	789	Q8WXG9	GPR98_HUMAN	N	789	ENSP00000384582:K789N	ENSP00000296619:K789N	K	+	3	2	GPR98	89974335	0.005000	0.15991	0.992000	0.48379	0.049000	0.14656	-1.095000	0.03356	-0.271000	0.09272	-0.545000	0.04230	AAA	GPR98	-	smart_Calx_beta	ENSG00000164199		0.358	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	-	0.00	61	0	A	NM_032119	Missense_Mutation	89938579	+1	tier1	-	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	33.96	35	18	SNP	0.944	C
GSG1L	146395	genome.wustl.edu	37	16	27840194	27840194	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:27840194C>T	ENST00000447459.2	-	5	830	c.746G>A	c.(745-747)cGg>cAg	p.R249Q	GSG1L_ENST00000569166.1_Missense_Mutation_p.R94Q|GSG1L_ENST00000395724.3_Missense_Mutation_p.R198Q|GSG1L_ENST00000380897.3_Missense_Mutation_p.R94Q|GSG1L_ENST00000380898.2_Missense_Mutation_p.R94Q	NM_001109763.1	NP_001103233.1	Q6UXU4	GSG1L_HUMAN	GSG1-like	249					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	asymmetric synapse (GO:0032279)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(4)	17						GCGCTTGTGCCGGAACTCAAT	0.592																																																	0													100.0	74.0	83.0					16																	27840194		2197	4300	6497	SO:0001583	missense	0			AK128775	CCDS10631.1, CCDS45450.1	16p11.2	2014-01-20			ENSG00000169181	ENSG00000169181			28283	protein-coding gene	gene with protein product						22813734	Standard	NM_001109763		Approved	MGC18079, PRO19651, KTSR5831	uc002doz.2	Q6UXU4	OTTHUMG00000131676	ENST00000447459.2:c.746G>A	16.37:g.27840194C>T	ENSP00000394954:p.Arg249Gln		Q7Z6F8|Q8TB81	Missense_Mutation	SNP	pfam_GSG-1,pfam_PMP22/EMP/MP20/Claudin	p.R249Q	ENST00000447459.2	37	c.746	CCDS45450.1	16	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611213	0.87258	.	.	ENSG00000169181	ENST00000447459;ENST00000395724;ENST00000380898;ENST00000380897	T;T	0.34072	1.38;1.38	5.24	5.24	0.73138	.	0.000000	0.64402	D	0.000001	T	0.45034	0.1322	L	0.29908	0.895	0.46927	D	0.999251	D;D;D	0.76494	0.998;0.997;0.999	P;P;D	0.72625	0.808;0.854;0.978	T	0.32052	-0.9921	10	0.45353	T	0.12	0.2963	11.1472	0.48436	0.0:0.9138:0.0:0.0862	.	198;94;249	Q6UXU4-3;Q6UXU4-4;Q6UXU4	.;.;GSG1L_HUMAN	Q	249;198;94;94	ENSP00000394954:R249Q;ENSP00000379074:R198Q	ENSP00000370282:R94Q	R	-	2	0	GSG1L	27747695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.974000	0.63771	2.455000	0.83008	0.650000	0.86243	CGG	GSG1L	-	NULL	ENSG00000169181		0.592	GSG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG1L	HGNC	protein_coding	OTTHUMT00000433832.2	-	0.00	67	0	C	NM_144675		27840194	-1	tier1	-	no_errors	ENST00000447459	ensembl	human	known	74_37	missense	25.00	36	12	SNP	1.000	T
GTF2IRD2P1	401375	genome.wustl.edu	37	7	72664015	72664016	+	RNA	INS	-	-	G	rs202030378|rs372212945	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:72664015_72664016insG	ENST00000425256.1	-	0	884_885									GTF2I repeat domain containing 2 pseudogene 1																		ATACCACCCCCGGGGCATGCCA	0.505													GGGGG|GGGG|GGGGG|deletion	3786	0.75599	0.7247	0.8242	5008	,	,		6539	0.7212		0.8101	False		,,,				2504	0.7301																0																																												0			AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72664019_72664019dupG				RNA	INS	-	NULL	ENST00000425256.1	37	NULL		7																																																																																			GTF2IRD2P1	-	-	ENSG00000214544		0.505	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	GTF2IRD2P1	HGNC	pseudogene	OTTHUMT00000345921.1		0.00	16	0	-	NR_002164		72664016	-1	tier1		no_errors	ENST00000425256	ensembl	human	known	74_37	rna	11.76	15	2	INS	0.912:0.964	G
GYS2	2998	genome.wustl.edu	37	12	21727109	21727109	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:21727109G>T	ENST00000261195.2	-	4	901	c.647C>A	c.(646-648)gCa>gAa	p.A216E		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	216					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						ATCAATATTTGCTGCACAGAG	0.423																																					Colon(149;9 1820 3690 10544 50424)												0													176.0	154.0	161.0					12																	21727109		2203	4300	6503	SO:0001583	missense	0				CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.647C>A	12.37:g.21727109G>T	ENSP00000261195:p.Ala216Glu		A0AVD8	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1	p.A216E	ENST00000261195.2	37	c.647	CCDS8690.1	12	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165863	0.78339	.	.	ENSG00000111713	ENST00000261195	T	0.66815	-0.23	5.19	5.19	0.71726	.	0.057590	0.64402	D	0.000001	T	0.76471	0.3992	L	0.54323	1.7	0.47737	D	0.999505	P	0.42785	0.79	P	0.58820	0.846	T	0.77683	-0.2496	10	0.87932	D	0	-24.6	14.5117	0.67791	0.0:0.1463:0.8537:0.0	.	216	P54840	GYS2_HUMAN	E	216	ENSP00000261195:A216E	ENSP00000261195:A216E	A	-	2	0	GYS2	21618376	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.551000	0.60740	2.709000	0.92574	0.591000	0.81541	GCA	GYS2	-	pfam_Glycogen_synth	ENSG00000111713		0.423	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS2	HGNC	protein_coding	OTTHUMT00000402396.1	-	0.00	66	0	G	NM_021957		21727109	-1	tier1	-	no_errors	ENST00000261195	ensembl	human	known	74_37	missense	36.99	46	27	SNP	1.000	T
HNRNPA1P48	642659	genome.wustl.edu	37	16	51680203	51680203	+	RNA	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:51680203G>A	ENST00000562726.1	+	0	537					NR_002944.2|NR_003277.1				heterogeneous nuclear ribonucleoprotein A1 pseudogene 48																		CCATGACTCCGTGGATAAGAT	0.428																																																	0																																												0					16q12.1	2013-06-13			ENSG00000224578	ENSG00000224578			48778	pseudogene	pseudogene							Standard	NG_005530		Approved				OTTHUMG00000173250		16.37:g.51680203G>A				RNA	SNP	-	NULL	ENST00000562726.1	37	NULL		16																																																																																			HNRNPA1P48	-	-	ENSG00000224578		0.428	HNRNPA1P48-002	KNOWN	basic	processed_transcript	HNRNPA1P48	HGNC	pseudogene	OTTHUMT00000422613.1	-	0.00	37	0	G			51680203	+1	tier1	-	no_errors	ENST00000562726	ensembl	human	known	74_37	rna	12.12	29	4	SNP	0.998	A
IL1RN	3557	genome.wustl.edu	37	2	113890293	113890293	+	Missense_Mutation	SNP	C	C	T	rs148520303	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:113890293C>T	ENST00000409930.3	+	4	443	c.379C>T	c.(379-381)Cgc>Tgc	p.R127C	IL1RN_ENST00000259206.5_Missense_Mutation_p.R130C|IL1RN_ENST00000361779.3_Missense_Mutation_p.R93C|IL1RN_ENST00000409052.1_Missense_Mutation_p.R93C|IL1RN_ENST00000354115.2_Missense_Mutation_p.R109C	NM_173842.2	NP_776214.1	P18510	IL1RA_HUMAN	interleukin 1 receptor antagonist	127					acute-phase response (GO:0006953)|carboxylic acid metabolic process (GO:0019752)|chronic inflammatory response to antigenic stimulus (GO:0002439)|female pregnancy (GO:0007565)|fever generation (GO:0001660)|immune response (GO:0006955)|insulin secretion (GO:0030073)|lipid metabolic process (GO:0006629)|memory (GO:0007613)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of membrane potential (GO:0045837)|positive regulation of JUN kinase activity (GO:0043507)|response to drug (GO:0042493)|response to glucocorticoid (GO:0051384)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	interleukin-1 receptor antagonist activity (GO:0005152)|interleukin-1 receptor binding (GO:0005149)|interleukin-1 Type I receptor antagonist activity (GO:0045352)|interleukin-1 Type II receptor antagonist activity (GO:0045353)|interleukin-1, Type I receptor binding (GO:0005150)|interleukin-1, Type II receptor binding (GO:0005151)			breast(1)|large_intestine(2)|lung(4)|ovary(1)|skin(2)	10					Rilonacept(DB06372)	CGCCTTCATCCGCTCAGACAG	0.577									Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0								C	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	92.0	89.0	90.0		325,388,379,277	3.8	1.0	2	dbSNP_134	90	0,8600		0,0,4300	no	missense,missense,missense,missense	IL1RN	NM_000577.4,NM_173841.2,NM_173842.2,NM_173843.2	180,180,180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging	109/160,130/181,127/178,93/144	113890293	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Lichen Sclerosis, Familial	M55646	CCDS2113.1, CCDS2114.1, CCDS2115.1, CCDS46396.1	2q14.2	2014-09-17			ENSG00000136689	ENSG00000136689		"""Interleukins and interleukin receptors"", ""Endogenous ligands"""	6000	protein-coding gene	gene with protein product	"""interleukin-1 receptor antagonist protein"", ""intracellular interleukin-1 receptor antagonist"""	147679				1386337, 8432529	Standard	NM_000577		Approved	IL1RA, ICIL-1RA, IL1F3, IRAP, IL-1RN, MGC10430	uc002tjb.3	P18510	OTTHUMG00000131341	ENST00000409930.3:c.379C>T	2.37:g.113890293C>T	ENSP00000387173:p.Arg127Cys		A8K4G1|Q14628|Q53SC2|Q7RTZ4|Q96GD6|Q9UPC0	Missense_Mutation	SNP	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36,prints_IL-1	p.R130C	ENST00000409930.3	37	c.388	CCDS46396.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.005013	0.74932	2.27E-4	0.0	ENSG00000136689	ENST00000409052;ENST00000361779;ENST00000259206;ENST00000354115;ENST00000409930	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	5.8	3.85	0.44370	.	0.403092	0.25011	N	0.033831	T	0.43055	0.1230	M	0.81802	2.56	0.47994	D	0.999565	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	T	0.37549	-0.9701	10	0.66056	D	0.02	-13.83	5.9545	0.19265	0.2302:0.6735:0.0:0.0963	.	127;109;130	P18510;P18510-2;Q53SC2	IL1RA_HUMAN;.;.	C	93;93;130;109;127	ENSP00000387210:R93C;ENSP00000354816:R93C;ENSP00000259206:R130C;ENSP00000329072:R109C;ENSP00000387173:R127C	ENSP00000259206:R130C	R	+	1	0	IL1RN	113606764	0.753000	0.28349	0.997000	0.53966	0.908000	0.53690	0.644000	0.24766	1.472000	0.48140	0.655000	0.94253	CGC	IL1RN	-	pfam_IL-1,superfamily_Cytokine_IL1-like,smart_IL-1,prints_IL-1RA/IL-36,prints_IL-1	ENSG00000136689		0.577	IL1RN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL1RN	HGNC	protein_coding	OTTHUMT00000330802.1	-	0.00	56	0	C	NM_173841		113890293	+1	tier1	rs148520303	no_errors	ENST00000259206	ensembl	human	known	74_37	missense	22.67	58	17	SNP	0.993	T
HS6ST1	9394	genome.wustl.edu	37	2	129026419	129026419	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:129026419G>A	ENST00000259241.6	-	2	566	c.553C>T	c.(553-555)Cga>Tga	p.R185*		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	185	3'-phosphate binding. {ECO:0000255}.				angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)	p.R185*(2)		endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		ACGGGGTCTCGTAGCAGGGTG	0.627																																																	2	Substitution - Nonsense(2)	prostate(1)|pancreas(1)																																								SO:0001587	stop_gained	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.553C>T	2.37:g.129026419G>A	ENSP00000259241:p.Arg185*		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Nonsense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.R185*	ENST00000259241.6	37	c.553	CCDS42748.1	2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065652	0.76187	.	.	ENSG00000136720	ENST00000259241	.	.	.	4.85	2.8	0.32819	.	0.051973	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.284	0.49212	0.0:0.0:0.3759:0.6241	.	.	.	.	X	185	.	.	R	-	1	2	HS6ST1	128742889	1.000000	0.71417	0.985000	0.45067	0.971000	0.66376	1.846000	0.39289	1.015000	0.39444	0.462000	0.41574	CGA	HS6ST1	-	pfam_Sulfotransferase,superfamily_P-loop_NTPase	ENSG00000136720		0.627	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1		0.00	77	0	G	NM_004807		129026419	-1			no_errors	ENST00000259241	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	A
ITPR1	3708	genome.wustl.edu	37	3	4712575	4712575	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:4712575G>A	ENST00000443694.2	+	17	2124	c.2124G>A	c.(2122-2124)ggG>ggA	p.G708G	ITPR1_ENST00000456211.2_Silent_p.G708G|ITPR1_ENST00000423119.2_Silent_p.G723G|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Silent_p.G723G|ITPR1_ENST00000302640.8_Silent_p.G708G|ITPR1_ENST00000357086.4_Silent_p.G723G			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	723					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CTAAAGAAGGGCAGAAGGAGG	0.532																																																	0													75.0	76.0	76.0					3																	4712575		2034	4190	6224	SO:0001819	synonymous_variant	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.2124G>A	3.37:g.4712575G>A			E7EPX7|E9PDE9|Q14660|Q99897	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.G708	ENST00000443694.2	37	c.2124	CCDS54551.1	3																																																																																			ITPR1	-	NULL	ENSG00000150995		0.532	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	-	0.00	78	0	G	NM_002222		4712575	+1	tier1	-	no_errors	ENST00000302640	ensembl	human	known	74_37	silent	13.11	53	8	SNP	0.441	A
PLA2G4B	100137049	genome.wustl.edu	37	15	42136011	42136011	+	Splice_Site	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:42136011T>C	ENST00000452633.1	+	12	1231		c.e12+2		JMJD7-PLA2G4B_ENST00000342159.4_Splice_Site|JMJD7-PLA2G4B_ENST00000382448.4_Splice_Site|PLA2G4B_ENST00000458483.1_Splice_Site|PLA2G4B_ENST00000542534.2_Splice_Site			P0C869	PA24B_HUMAN	phospholipase A2, group IVB (cytosolic)						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|arachidonic acid metabolic process (GO:0019369)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|glycerophospholipid biosynthetic process (GO:0046474)|glycerophospholipid catabolic process (GO:0046475)|inflammatory response (GO:0006954)|parturition (GO:0007567)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)						all_cancers(109;1.84e-13)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		all cancers(2;1.08e-30)|Epithelial(2;1.43e-22)|OV - Ovarian serous cystadenocarcinoma(18;1.13e-17)|GBM - Glioblastoma multiforme(94;9.77e-07)|Colorectal(2;0.0129)|COAD - Colon adenocarcinoma(120;0.0371)		GAGGATGAGGTTTGGGGGCTG	0.652																																																	0													33.0	36.0	35.0					15																	42136011		2203	4300	6503	SO:0001630	splice_region_variant	0			AF065215	CCDS45241.1	15q11.2-q21.3	2010-08-17			ENSG00000243708	ENSG00000243708	3.1.1.4		9036	protein-coding gene	gene with protein product		606088				9705332	Standard	NM_001114633		Approved	cPLA2-beta, HsT16992		P0C869	OTTHUMG00000156809	ENST00000452633.1:c.879+2T>C	15.37:g.42136011T>C			B4DRT9|O95712|Q19KD5|Q19KD6|Q59GF9|Q8TB10|Q9UKV7	Splice_Site	SNP	-	e16+2	ENST00000452633.1	37	c.1572+2	CCDS45241.1	15	.	.	.	.	.	.	.	.	.	.	t	10.77	1.442609	0.25987	.	.	ENSG00000168970;ENSG00000168970;ENSG00000168970;ENSG00000243708	ENST00000382448;ENST00000342159;ENST00000458483;ENST00000452633	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8663	0.63590	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	JMJD7-PLA2G4B;PLA2G4B	39923303	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.220000	0.65267	1.987000	0.57996	0.533000	0.62120	.	JMJD7-PLA2G4B	-	-	ENSG00000168970		0.652	PLA2G4B-001	KNOWN	basic|CCDS	protein_coding	JMJD7-PLA2G4B	HGNC	protein_coding	OTTHUMT00000345969.1	-	0.00	96	0	T	NM_001114633	Intron	42136011	+1	tier1	-	no_errors	ENST00000382448	ensembl	human	known	74_37	splice_site	6.67	84	6	SNP	1.000	C
JPH2	57158	genome.wustl.edu	37	20	42788669	42788669	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr20:42788669delA	ENST00000372980.3	-	2	1630	c.758delT	c.(757-759)ctcfs	p.L253fs		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	253					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCCCGAGCTGAGGTCGCTCTT	0.731																																																	0													9.0	11.0	10.0					20																	42788669		2138	4131	6269	SO:0001589	frameshift_variant	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.758delT	20.37:g.42788669delA	ENSP00000362071:p.Leu253fs		E1P5X1|O95913|Q5JY74|Q9UJN4	Frame_Shift_Del	DEL	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.L253fs	ENST00000372980.3	37	c.758	CCDS13325.1	20																																																																																			JPH2	-	pirsf_Junctophilin	ENSG00000149596		0.731	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1		0.00	39	0	A			42788669	-1	tier1		no_errors	ENST00000372980	ensembl	human	known	74_37	frame_shift_del	20.00	8	2	DEL	1.000	-
JPH2	57158	genome.wustl.edu	37	20	42744491	42744491	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr20:42744491C>T	ENST00000372980.3	-	4	2696	c.1824G>A	c.(1822-1824)acG>acA	p.T608T		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	608	Pro-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGCCTCGGAGCGTGGGGGCCT	0.751																																																	0													7.0	9.0	9.0					20																	42744491		2126	4187	6313	SO:0001819	synonymous_variant	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1824G>A	20.37:g.42744491C>T			E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.T608	ENST00000372980.3	37	c.1824	CCDS13325.1	20																																																																																			JPH2	-	pirsf_Junctophilin	ENSG00000149596		0.751	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1		0.00	8	0	C			42744491	-1			no_errors	ENST00000372980	ensembl	human	known	74_37	silent	60.00	2	3	SNP	0.003	T
KCNH8	131096	genome.wustl.edu	37	3	19436748	19436748	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:19436748G>T	ENST00000328405.2	+	7	1388	c.1122G>T	c.(1120-1122)tgG>tgT	p.W374C	KCNH8_ENST00000475063.1_3'UTR|KCNH8_ENST00000537696.1_Missense_Mutation_p.W15C	NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	374					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)	p.W374C(1)		NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CGTGTATCTGGTACGTCATTG	0.433																																					NSCLC(124;1625 1765 8018 24930 42026)												1	Substitution - Missense(1)	lung(1)											157.0	139.0	145.0					3																	19436748		2203	4300	6503	SO:0001583	missense	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.1122G>T	3.37:g.19436748G>T	ENSP00000328813:p.Trp374Cys		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.W374C	ENST00000328405.2	37	c.1122	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629963	0.87660	.	.	ENSG00000183960	ENST00000328405;ENST00000537696	D;T	0.97455	-4.39;1.82	5.79	5.79	0.91817	Ion transport (1);	0.000000	0.30920	U	0.008609	D	0.98852	0.9612	M	0.91140	3.18	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.99184	1.0868	9	.	.	.	.	20.0326	0.97545	0.0:0.0:1.0:0.0	.	15;374;374	B7Z2I7;B7Z398;Q96L42	.;.;KCNH8_HUMAN	C	374;15	ENSP00000328813:W374C;ENSP00000446294:W15C	.	W	+	3	0	KCNH8	19411752	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.869000	0.99810	2.732000	0.93576	0.557000	0.71058	TGG	KCNH8	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	ENSG00000183960		0.433	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	-	0.00	72	0	G	NM_144633		19436748	+1	tier1	-	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
KDM4B	23030	genome.wustl.edu	37	19	5131108	5131108	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:5131108G>A	ENST00000159111.4	+	12	1555	c.1337G>A	c.(1336-1338)cGg>cAg	p.R446Q	KDM4B_ENST00000536461.1_Missense_Mutation_p.R480Q	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	446					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GGCAAGCTGCGGCCAACCAAG	0.667																																																	0													19.0	24.0	22.0					19																	5131108		2179	4287	6466	SO:0001583	missense	0			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.1337G>A	19.37:g.5131108G>A	ENSP00000159111:p.Arg446Gln		B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.R446Q	ENST00000159111.4	37	c.1337	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558662	0.86231	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.18657	2.2;2.2	4.09	4.09	0.47781	.	2.046340	0.02040	N	0.049205	T	0.41719	0.1171	L	0.43152	1.355	0.35688	D	0.814594	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.988	T	0.40608	-0.9554	10	0.11485	T	0.65	-38.7108	14.6691	0.68932	0.0:0.0:1.0:0.0	.	480;446	F5GX28;O94953	.;KDM4B_HUMAN	Q	446;480	ENSP00000159111:R446Q;ENSP00000440495:R480Q	ENSP00000159111:R446Q	R	+	2	0	KDM4B	5082108	0.997000	0.39634	0.976000	0.42696	0.822000	0.46500	4.351000	0.59398	2.114000	0.64651	0.561000	0.74099	CGG	KDM4B	-	NULL	ENSG00000127663		0.667	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	-	0.00	24	0	G	NM_015015		5131108	+1	tier1	-	no_errors	ENST00000159111	ensembl	human	known	74_37	missense	48.15	14	13	SNP	0.954	A
KMT2E	55904	genome.wustl.edu	37	7	104753362	104753362	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:104753362C>T	ENST00000311117.3	+	27	5704	c.5159C>T	c.(5158-5160)cCg>cTg	p.P1720L	KMT2E_ENST00000257745.4_Missense_Mutation_p.P1720L|SRPK2_ENST00000493638.1_Intron|KMT2E_ENST00000334877.4_Missense_Mutation_p.P1678L	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1720	Pro-rich. {ECO:0000255}.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CCACCCCCTCCGCCGCCACCT	0.552																																																	0													124.0	111.0	116.0					7																	104753362		2203	4300	6503	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.5159C>T	7.37:g.104753362C>T	ENSP00000312379:p.Pro1720Leu		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.P1720L	ENST00000311117.3	37	c.5159	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	c	3.216	-0.160589	0.06502	.	.	ENSG00000005483	ENST00000311117;ENST00000334877;ENST00000351043;ENST00000257745	D;D;D	0.95821	-3.69;-3.82;-3.69	3.79	1.7	0.24286	.	0.349959	0.20076	N	0.099750	D	0.88470	0.6445	N	0.19112	0.55	0.31646	N	0.647424	P;P	0.39920	0.695;0.472	B;B	0.33620	0.167;0.089	D	0.87509	0.2438	10	0.87932	D	0	.	9.431	0.38610	0.1622:0.6811:0.1567:0.0	.	1640;1720	F8W6H1;Q8IZD2	.;MLL5_HUMAN	L	1720;1678;1640;1720	ENSP00000312379:P1720L;ENSP00000335599:P1678L;ENSP00000257745:P1720L	ENSP00000257745:P1720L	P	+	2	0	MLL5	104540598	0.723000	0.28027	0.014000	0.15608	0.983000	0.72400	2.253000	0.43205	0.696000	0.31696	0.454000	0.30748	CCG	KMT2E	-	NULL	ENSG00000005483		0.552	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1		0.00	45	0	C			104753362	+1			no_errors	ENST00000257745	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.274	T
KRT37	8688	genome.wustl.edu	37	17	39580086	39580086	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:39580086C>A	ENST00000225550.3	-	2	502	c.503G>T	c.(502-504)aGc>aTc	p.S168I	AC003958.2_ENST00000432258.1_RNA	NM_003770.4	NP_003761.3	O76014	KRT37_HUMAN	keratin 37	168	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(6)|skin(3)	25		Breast(137;0.000496)				CTCAGCCTTGCTGCACAGGAT	0.483																																																	0													124.0	105.0	112.0					17																	39580086		2203	4300	6503	SO:0001583	missense	0			Y16793	CCDS32653.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000108417	ENSG00000108417		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6455	protein-coding gene	gene with protein product		604541	"""keratin, hair, acidic, 7"""	KRTHA7		9756910, 16831889	Standard	NM_003770		Approved		uc002hwp.1	O76014	OTTHUMG00000133606	ENST00000225550.3:c.503G>T	17.37:g.39580086C>A	ENSP00000225550:p.Ser168Ile			Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.S168I	ENST00000225550.3	37	c.503	CCDS32653.1	17	.	.	.	.	.	.	.	.	.	.	.	14.80	2.643218	0.47153	.	.	ENSG00000108417	ENST00000225550	D	0.88201	-2.35	4.86	-3.23	0.05109	Filament (1);	0.477138	0.19441	N	0.114181	T	0.78039	0.4221	N	0.25825	0.765	0.25740	N	0.985172	B	0.14438	0.01	B	0.15052	0.012	T	0.66244	-0.5972	10	0.46703	T	0.11	.	9.2831	0.37740	0.0:0.1944:0.6203:0.1853	.	168	O76014	KRT37_HUMAN	I	168	ENSP00000225550:S168I	ENSP00000225550:S168I	S	-	2	0	KRT37	36833612	0.000000	0.05858	0.996000	0.52242	0.953000	0.61014	-0.929000	0.03976	-0.102000	0.12197	0.655000	0.94253	AGC	KRT37	-	pfam_IF	ENSG00000108417		0.483	KRT37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT37	HGNC	protein_coding	OTTHUMT00000257714.2	-	0.00	54	0	C	NM_003770		39580086	-1	tier1	-	no_errors	ENST00000225550	ensembl	human	known	74_37	missense	5.96	410	26	SNP	0.957	A
KRTAP5-1	387264	genome.wustl.edu	37	11	1605880	1605882	+	In_Frame_Del	DEL	GCC	GCC	-	rs199544345		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	GCC	GCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:1605880_1605882delGCC	ENST00000382171.2	-	1	631_633	c.598_600delGGC	c.(598-600)ggcdel	p.G200del	KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA	NM_001005922.1	NP_001005922.1	Q6L8H4	KRA51_HUMAN	keratin associated protein 5-1	200	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(3)|kidney(1)|lung(9)|skin(2)|upper_aerodigestive_tract(1)	16		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AGCCCCCACAGCCGGAGCCACAA	0.665																																																	0																																										SO:0001651	inframe_deletion	0			AB126070	CCDS31330.1	11p15.5	2008-02-05			ENSG00000205869	ENSG00000205869		"""Keratin associated proteins"""	23596	protein-coding gene	gene with protein product		148022	"""keratin, cuticle, ultrahigh sulphur 1-like"""	KRN1L		15144888	Standard	NM_001005922		Approved	KRTAP5.1	uc001ltu.1	Q6L8H4	OTTHUMG00000057557	ENST00000382171.2:c.598_600delGGC	11.37:g.1605880_1605882delGCC	ENSP00000371606:p.Gly200del			In_Frame_Del	DEL	NULL	p.G200in_frame_del	ENST00000382171.2	37	c.600_598	CCDS31330.1	11																																																																																			KRTAP5-1	-	NULL	ENSG00000205869		0.665	KRTAP5-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-1	HGNC	protein_coding	OTTHUMT00000127922.1		0.00	80	0	GCC	NM_001005922		1605882	-1			no_errors	ENST00000382171	ensembl	human	known	74_37	in_frame_del	7.32	76	6	DEL	0.351:0.343:0.000	0
LAMA1	284217	genome.wustl.edu	37	18	6965355	6965355	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr18:6965355A>C	ENST00000389658.3	-	50	7220	c.7127T>G	c.(7126-7128)cTt>cGt	p.L2376R		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2376	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTCTGTCAAAAGGGTAATGGG	0.463																																																	0													125.0	116.0	119.0					18																	6965355		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7127T>G	18.37:g.6965355A>C	ENSP00000374309:p.Leu2376Arg			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.L2376R	ENST00000389658.3	37	c.7127	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	A	21.1	4.092661	0.76756	.	.	ENSG00000101680	ENST00000389658	T	0.77877	-1.13	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.000000	0.64402	D	0.000001	D	0.90041	0.6890	M	0.91459	3.21	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	D	0.89333	0.3648	10	0.26408	T	0.33	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	2376	P25391	LAMA1_HUMAN	R	2376	ENSP00000374309:L2376R	ENSP00000374309:L2376R	L	-	2	0	LAMA1	6955355	1.000000	0.71417	0.228000	0.23943	0.627000	0.37826	5.161000	0.64935	2.371000	0.80710	0.533000	0.62120	CTT	LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.463	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	51	0	A	NM_005559		6965355	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	32.39	48	23	SNP	0.984	C
MIR670HG	100507261	genome.wustl.edu	37	11	43591340	43591340	+	RNA	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:43591340C>T	ENST00000533531.1	+	0	292																											CAAGAGGAGACCAGATGAGTT	0.458																																																	0																																												0																															11.37:g.43591340C>T				RNA	SNP	-	NULL	ENST00000533531.1	37	NULL		11																																																																																			AC023085.1	-	-	ENSG00000235661		0.458	AC023085.1-002	PUTATIVE	basic	processed_transcript	LOC100507261	Clone_based_vega_gene	pseudogene	OTTHUMT00000390961.1	-	0.00	89	0	C			43591340	+1	tier1	-	no_errors	ENST00000533531	ensembl	human	putative	74_37	rna	35.14	72	39	SNP	1.000	T
RP11-782C8.1	0	genome.wustl.edu	37	1	143230187	143230187	+	lincRNA	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:143230187T>G	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							AACACATTTTTTGAATCAACT	0.338																																																	0																																												0																															1.37:g.143230187T>G				RNA	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			RP11-782C8.5	-	-	ENSG00000225278		0.338	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	-	0.00	29	0	T			143230187	-1	tier1	-	no_errors	ENST00000427309	ensembl	human	known	74_37	rna	26.67	33	12	SNP	0.007	G
LOC728554	728554	genome.wustl.edu	37	5	177309432	177309432	+	RNA	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:177309432A>C	ENST00000506672.1	+	0	764					NR_003615.2																						ATCTGTATCAAGTTTGACCCC	0.502																																																	0																																												0																															5.37:g.177309432A>C				RNA	SNP	-	NULL	ENST00000506672.1	37	NULL		5																																																																																			RP11-423H2.1	-	-	ENSG00000170089		0.502	RP11-423H2.1-002	KNOWN	basic	processed_transcript	LOC728554	Clone_based_vega_gene	pseudogene	OTTHUMT00000373226.1	-	0.00	116	0	A			177309432	+1	tier1	-	no_errors	ENST00000506672	ensembl	human	known	74_37	rna	15.60	92	17	SNP	1.000	C
LPHN1	22859	genome.wustl.edu	37	19	14271034	14271034	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:14271034C>T	ENST00000340736.6	-	9	2002	c.1705G>A	c.(1705-1707)Gac>Aac	p.D569N	CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000591528.1_5'Flank|CTB-55O6.12_ENST00000592086.1_RNA|LPHN1_ENST00000361434.3_Missense_Mutation_p.D564N	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	569					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GAGGAGACGTCCCCCGCGTAG	0.667																																																	0													50.0	61.0	57.0					19																	14271034		2203	4299	6502	SO:0001583	missense	0			AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.1705G>A	19.37:g.14271034C>T	ENSP00000340688:p.Asp569Asn		Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.D569N	ENST00000340736.6	37	c.1705	CCDS32928.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.510241	0.85282	.	.	ENSG00000072071	ENST00000340736;ENST00000361434	T;T	0.37752	1.18;1.18	5.26	4.23	0.50019	Domain of unknown function DUF3497 (1);	0.000000	0.85682	D	0.000000	T	0.60051	0.2239	M	0.83223	2.63	0.54753	D	0.999988	D;D	0.61080	0.989;0.988	D;D	0.66979	0.944;0.948	T	0.66244	-0.5972	10	0.87932	D	0	.	12.0827	0.53680	0.0:0.9153:0.0:0.0847	.	564;569	O94910-2;O94910	.;LPHN1_HUMAN	N	569;564	ENSP00000340688:D569N;ENSP00000355328:D564N	ENSP00000340688:D569N	D	-	1	0	LPHN1	14132034	1.000000	0.71417	0.199000	0.23439	0.772000	0.43724	7.776000	0.85560	1.354000	0.45846	0.561000	0.74099	GAC	LPHN1	-	pfam_DUF3497	ENSG00000072071		0.667	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	LPHN1	HGNC	protein_coding	OTTHUMT00000459696.1	-	0.00	109	0	C	NM_014921		14271034	-1	tier1	-	no_errors	ENST00000340736	ensembl	human	known	74_37	missense	33.33	54	27	SNP	0.989	T
LRTM2	654429	genome.wustl.edu	37	12	1945718	1945718	+	3'UTR	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:1945718C>A	ENST00000543818.1	+	0	3786				CACNA2D4_ENST00000586184.1_Intron|LRTM2_ENST00000299194.1_3'UTR|CACNA2D4_ENST00000587995.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585732.1_Intron|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000382722.5_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			GGACCCCAGGCGGCCCTGGCC	0.632																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.*1831C>A	12.37:g.1945718C>A			A7E2U6	RNA	SNP	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			LRTM2	-	-	ENSG00000166159		0.632	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	HGNC	protein_coding	OTTHUMT00000398055.1	-	0.00	16	0	C			1945718	+1	tier1	-	no_errors	ENST00000543730	ensembl	human	putative	74_37	rna	50.00	7	7	SNP	0.000	A
LUZP2	338645	genome.wustl.edu	37	11	24998138	24998138	+	Splice_Site	SNP	C	C	T	rs572470818		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:24998138C>T	ENST00000336930.6	+	8	590	c.524C>T	c.(523-525)gCg>gTg	p.A175V	LUZP2_ENST00000533227.1_Splice_Site_p.A89V			Q86TE4	LUZP2_HUMAN	leucine zipper protein 2	175	Leucine-zipper.					extracellular region (GO:0005576)		p.A175G(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(11)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	32						ATTTTACAGGCGCAGCAGCTT	0.358																																																	1	Substitution - Missense(1)	ovary(1)											55.0	61.0	59.0					11																	24998138		2202	4299	6501	SO:0001630	splice_region_variant	0			AL832641	CCDS31446.1, CCDS58128.1	11p14.3	2005-09-18			ENSG00000187398	ENSG00000187398			23206	protein-coding gene	gene with protein product		608178				12856284	Standard	NM_001009909		Approved		uc001mqs.3	Q86TE4	OTTHUMG00000166109	ENST00000336930.6:c.523-1C>T	11.37:g.24998138C>T			A2RUB8|E9PN53|Q6UXE7|Q6ZS65	Missense_Mutation	SNP	NULL	p.A175V	ENST00000336930.6	37	c.524	CCDS31446.1	11	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673419	0.67928	.	.	ENSG00000187398	ENST00000336930;ENST00000529015;ENST00000533227	T;T;T	0.26067	1.76;1.97;1.76	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000002	T	0.41465	0.1160	L	0.32530	0.975	0.37226	D	0.905467	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.44636	-0.9315	10	0.66056	D	0.02	-7.9555	16.4555	0.84011	0.0:1.0:0.0:0.0	.	89;175	E9PN53;Q86TE4	.;LUZP2_HUMAN	V	175;133;89	ENSP00000336817:A175V;ENSP00000437032:A133V;ENSP00000432952:A89V	ENSP00000336817:A175V	A	+	2	0	LUZP2	24954714	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	4.066000	0.57520	2.540000	0.85666	0.650000	0.86243	GCG	LUZP2	-	NULL	ENSG00000187398		0.358	LUZP2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP2	HGNC	protein_coding	OTTHUMT00000387861.1	-	0.00	75	0	C	NM_001009909	Missense_Mutation	24998138	+1	tier1	-	no_errors	ENST00000336930	ensembl	human	known	74_37	missense	28.57	50	20	SNP	1.000	T
MAGEB10	139422	genome.wustl.edu	37	X	27840074	27840074	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:27840074T>A	ENST00000356790.2	+	3	896	c.651T>A	c.(649-651)tgT>tgA	p.C217*		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	217	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						ATGGCAATTGTGTCGCTGAGG	0.483																																																	0													66.0	54.0	58.0					X																	27840074		2201	4299	6500	SO:0001587	stop_gained	0				CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.651T>A	X.37:g.27840074T>A	ENSP00000368304:p.Cys217*		Q494Y6|Q494Y7|Q9BZ78	Nonsense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.C217*	ENST00000356790.2	37	c.651	CCDS35221.1	X	.	.	.	.	.	.	.	.	.	.	T	15.91	2.972381	0.53614	.	.	ENSG00000177689	ENST00000356790	.	.	.	2.62	-3.52	0.04682	.	0.623523	0.14376	U	0.323432	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	3.3879	0.07278	0.2102:0.4301:0.0:0.3597	.	.	.	.	X	217	.	ENSP00000368304:C217X	C	+	3	2	MAGEB10	27749995	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.858000	0.04281	-0.986000	0.03498	-0.660000	0.03859	TGT	MAGEB10	-	pfam_MAGE,pfscan_MAGE	ENSG00000177689		0.483	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB10	HGNC	protein_coding	OTTHUMT00000106216.1	-	0.00	15	0	T	NM_182506		27840074	+1	tier1	-	no_errors	ENST00000356790	ensembl	human	known	74_37	nonsense	63.16	7	12	SNP	0.000	A
MAGEC1	9947	genome.wustl.edu	37	X	140993851	140993851	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:140993851A>C	ENST00000285879.4	+	4	947	c.661A>C	c.(661-663)Act>Cct	p.T221P	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	221				TQSTF -> SQRTS (in Ref. 1 and 2). {ECO:0000305}.						breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTGAGAGAACTCAGAGTAC	0.493										HNSCC(15;0.026)																																							0													116.0	122.0	120.0					X																	140993851		2202	4294	6496	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.661A>C	X.37:g.140993851A>C	ENSP00000285879:p.Thr221Pro		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.T221P	ENST00000285879.4	37	c.661	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	-	0.664	-0.804761	0.02819	.	.	ENSG00000155495	ENST00000285879	T	0.03831	3.79	.	.	.	.	.	.	.	.	T	0.02083	0.0065	N	0.08118	0	0.09310	N	1	B	0.22909	0.077	B	0.17098	0.017	T	0.47749	-0.9093	8	0.23302	T	0.38	.	2.1236	0.03731	0.5009:2.0E-4:2.0E-4:0.4988	.	221	O60732	MAGC1_HUMAN	P	221	ENSP00000285879:T221P	ENSP00000285879:T221P	T	+	1	0	MAGEC1	140821517	0.000000	0.05858	0.047000	0.18901	0.047000	0.14425	-0.549000	0.06041	0.046000	0.15833	0.046000	0.15203	ACT	MAGEC1	-	NULL	ENSG00000155495		0.493	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	109	0	A	NM_005462		140993851	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	5.81	161	10	SNP	0.069	C
MAGEC1	9947	genome.wustl.edu	37	X	140996374	140996374	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:140996374T>G	ENST00000285879.4	+	4	3470	c.3184T>G	c.(3184-3186)Tct>Gct	p.S1062A	MAGEC1_ENST00000406005.2_Missense_Mutation_p.S129A	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	1062	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					GGTGCCCAACTCTTCTCCTCC	0.512										HNSCC(15;0.026)																																							0													117.0	112.0	113.0					X																	140996374		2203	4300	6503	SO:0001583	missense	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.3184T>G	X.37:g.140996374T>G	ENSP00000285879:p.Ser1062Ala		A0PK03|O75451|Q8TCV4	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.S1062A	ENST00000285879.4	37	c.3184	CCDS35417.1	X	.	.	.	.	.	.	.	.	.	.	t	6.650	0.488422	0.12641	.	.	ENSG00000155495	ENST00000285879;ENST00000406005	T;T	0.05447	3.44;3.44	0.837	-0.76	0.11041	.	.	.	.	.	T	0.09158	0.0226	M	0.83312	2.635	0.09310	N	1	B	0.27910	0.193	B	0.19946	0.027	T	0.22800	-1.0206	8	0.87932	D	0	.	.	.	.	.	1062	O60732	MAGC1_HUMAN	A	1062;129	ENSP00000285879:S1062A;ENSP00000385500:S129A	ENSP00000285879:S1062A	S	+	1	0	MAGEC1	140824040	0.001000	0.12720	0.005000	0.12908	0.070000	0.16714	-0.016000	0.12613	-0.247000	0.09597	-1.329000	0.01275	TCT	MAGEC1	-	pfam_MAGE,pfscan_MAGE	ENSG00000155495		0.512	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	-	0.00	24	0	T	NM_005462		140996374	+1	tier1	-	no_errors	ENST00000285879	ensembl	human	known	74_37	missense	62.00	19	31	SNP	0.004	G
MAGI1	9223	genome.wustl.edu	37	3	65425560	65425560	+	Missense_Mutation	SNP	T	T	G	rs113903140|rs35698502|rs142043619	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:65425560T>G	ENST00000497477.2	-	9	1263	c.1264A>C	c.(1264-1266)Aca>Cca	p.T422P	MAGI1_ENST00000470990.1_5'UTR|MAGI1_ENST00000483466.1_Missense_Mutation_p.T422P|MAGI1_ENST00000402939.2_Missense_Mutation_p.T422P|MAGI1_ENST00000330909.8_Missense_Mutation_p.T422P			Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	422					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		CAACCTTCTGTctgctgctgc	0.562											OREG0015658	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													62.0	64.0	63.0					3																	65425560		2203	4300	6503	SO:0001583	missense	0			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000497477.2:c.1264A>C	3.37:g.65425560T>G	ENSP00000424369:p.Thr422Pro	1084	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.T422P	ENST00000497477.2	37	c.1264		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.21|11.21	1.571435|1.571435	0.28003|0.28003	.|.	.|.	ENSG00000151276|ENSG00000151276	ENST00000460329|ENST00000402939;ENST00000330909;ENST00000422949;ENST00000463103;ENST00000483466;ENST00000497477;ENST00000472257;ENST00000479287	.|T;T;T;T;T;T;T	.|0.74209	.|-0.82;-0.82;-0.82;-0.82;-0.82;-0.82;2.55	4.83|4.83	-1.66|-1.66	0.08265|0.08265	.|.	.|1.555390	.|0.03879	.|N	.|0.276867	T|T	0.37679|0.37679	0.1012|0.1012	N|N	0.00707|0.00707	-1.245|-1.245	0.21256|0.21256	N|N	0.999745|0.999745	.|B;B;B;B;B	.|0.02656	.|0.0;0.0;0.0;0.0;0.0	.|B;B;B;B;B	.|0.06405	.|0.0;0.0;0.0;0.001;0.002	T|T	0.20538|0.20538	-1.0272|-1.0272	5|10	.|0.21014	.|T	.|0.42	11.3497|11.3497	1.3113|1.3113	0.02098|0.02098	0.2577:0.2486:0.3547:0.1389|0.2577:0.2486:0.3547:0.1389	.|.	.|422;422;422;422;422	.|Q96QZ7-6;Q96QZ7-4;Q96QZ7-3;Q96QZ7-2;Q96QZ7-5	.|.;.;.;.;.	S|P	302|422;422;318;297;422;422;208;172	.|ENSP00000385450:T422P;ENSP00000331157:T422P;ENSP00000418177:T297P;ENSP00000420323:T422P;ENSP00000424369:T422P;ENSP00000420796:T208P;ENSP00000418044:T172P	.|ENSP00000331157:T422P	R|T	-|-	3|1	2|0	MAGI1|MAGI1	65400600|65400600	0.000000|0.000000	0.05858|0.05858	0.247000|0.247000	0.24249|0.24249	0.504000|0.504000	0.33889|0.33889	0.074000|0.074000	0.14662|0.14662	-0.196000|-0.196000	0.10366|0.10366	0.528000|0.528000	0.53228|0.53228	AGA|ACA	MAGI1	-	NULL	ENSG00000151276		0.562	MAGI1-007	NOVEL	basic|exp_conf	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349132.2		0.00	82	0	T	NM_004742		65425560	-1			no_errors	ENST00000402939	ensembl	human	known	74_37	missense	6.98	40	3	SNP	0.208	G
MAP4K4	9448	genome.wustl.edu	37	2	102503719	102503719	+	Intron	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:102503719C>A	ENST00000347699.4	+	27	3336				MAP4K4_ENST00000324219.4_Intron|MAP4K4_ENST00000350878.4_Intron|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000350198.4_Missense_Mutation_p.S1038Y|MAP4K4_ENST00000413150.2_Intron|MAP4K4_ENST00000425019.1_Intron	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4						intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						AACCCACACTCTATGGTTGGT	0.428																																																	0													117.0	108.0	111.0					2																	102503719		1889	4129	6018	SO:0001627	intron_variant	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.3336+20C>A	2.37:g.102503719C>A			O75172|Q9NST7	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.S1038Y	ENST00000347699.4	37	c.3113	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410217	0.42715	.	.	ENSG00000071054	ENST00000350198	T	0.04862	3.54	5.08	3.13	0.36017	.	.	.	.	.	T	0.05456	0.0144	N	0.14661	0.345	0.80722	D	1	P;P	0.49447	0.924;0.924	P;P	0.44811	0.461;0.461	T	0.53830	-0.8383	8	.	.	.	.	14.4421	0.67325	0.0:0.7196:0.2804:0.0	.	1037;1038	O95819-4;G3XAA2	.;.	Y	1038	ENSP00000281111:S1038Y	.	S	+	2	0	MAP4K4	101870151	0.878000	0.30173	1.000000	0.80357	0.997000	0.91878	0.893000	0.28336	1.102000	0.41551	0.563000	0.77884	TCT	MAP4K4	-	pfam_Citron,smart_Citron	ENSG00000071054		0.428	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	-	0.00	88	0	C	NM_004834		102503719	+1	tier1	-	no_errors	ENST00000350198	ensembl	human	known	74_37	missense	17.97	105	23	SNP	0.993	A
MCF2	4168	genome.wustl.edu	37	X	138678769	138678769	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:138678769C>T	ENST00000370576.4	-	19	2425	c.2216G>A	c.(2215-2217)cGt>cAt	p.R739H	MCF2_ENST00000520602.1_Missense_Mutation_p.R799H|MCF2_ENST00000414978.1_Missense_Mutation_p.R799H|MCF2_ENST00000519895.1_Missense_Mutation_p.R815H|AL033403.1_ENST00000401295.2_RNA|MCF2_ENST00000370578.4_Missense_Mutation_p.R884H|MCF2_ENST00000536274.1_Missense_Mutation_p.R700H|MCF2_ENST00000338585.6_Missense_Mutation_p.R755H|MCF2_ENST00000370573.4_Missense_Mutation_p.R739H	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	739	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					ACTTTCAACACGCCTTTTGCA	0.383																																																	0													107.0	88.0	94.0					X																	138678769		2203	4300	6503	SO:0001583	missense	0				CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.2216G>A	X.37:g.138678769C>T	ENSP00000359608:p.Arg739His		B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R884H	ENST00000370576.4	37	c.2651	CCDS14667.1	X	.	.	.	.	.	.	.	.	.	.	C	28.8	4.948071	0.92593	.	.	ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585	T;T;T;T;T;T;T;T;T	0.56611	0.99;0.88;0.79;0.99;0.99;0.45;1.05;0.9;0.95	5.67	5.67	0.87782	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.80401	0.4616	M	0.93197	3.39	0.48830	D	0.999716	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;D;P;P;P;P;D;P	0.87578	0.834;0.994;0.886;0.834;0.886;0.834;0.998;0.834	D	0.85413	0.1138	10	0.66056	D	0.02	.	17.6181	0.88073	0.0:1.0:0.0:0.0	.	815;884;700;739;739;884;755;739	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911	.;.;.;.;.;.;.;MCF2_HUMAN	H	799;739;700;884;799;342;815;739;755	ENSP00000427745:R799H;ENSP00000359608:R739H;ENSP00000438155:R700H;ENSP00000359610:R884H;ENSP00000397055:R799H;ENSP00000405848:R342H;ENSP00000430276:R815H;ENSP00000359605:R739H;ENSP00000342204:R755H	ENSP00000342204:R755H	R	-	2	0	MCF2	138506435	1.000000	0.71417	0.719000	0.30619	0.940000	0.58332	6.066000	0.71185	2.376000	0.81061	0.600000	0.82982	CGT	MCF2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000101977		0.383	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	HGNC	protein_coding	OTTHUMT00000058560.1	-	0.00	39	0	C	NM_005369		138678769	-1	tier1	-	no_errors	ENST00000370578	ensembl	human	known	74_37	missense	87.50	7	49	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47351260	47351260	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:47351260C>T	ENST00000399232.2	-	11	2560	c.2196G>A	c.(2194-2196)gtG>gtA	p.V732V	MDGA2_ENST00000399222.3_5'UTR|MDGA2_ENST00000426342.1_Silent_p.V503V|MDGA2_ENST00000439988.3_Silent_p.V801V|MDGA2_ENST00000357362.3_Silent_p.V503V	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	732	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TATATTTGATCACACGAATTG	0.308																																																	0													42.0	38.0	39.0					14																	47351260		1815	4075	5890	SO:0001819	synonymous_variant	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2196G>A	14.37:g.47351260C>T			F6W3S7|J3KPX6	Silent	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.V801	ENST00000399232.2	37	c.2403		14																																																																																			MDGA2	-	superfamily_Fibronectin_type3	ENSG00000272781		0.308	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	31	0	C	NM_182830		47351260	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	silent	13.51	32	5	SNP	1.000	T
MDN1	23195	genome.wustl.edu	37	6	90463816	90463816	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr6:90463816G>T	ENST00000369393.3	-	21	3065	c.2950C>A	c.(2950-2952)Cgc>Agc	p.R984S	MDN1_ENST00000428876.1_Missense_Mutation_p.R984S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	984					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TAGAGTGAGCGCTGAATGTTG	0.517																																																	0													77.0	77.0	77.0					6																	90463816		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.2950C>A	6.37:g.90463816G>T	ENSP00000358400:p.Arg984Ser		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R984S	ENST00000369393.3	37	c.2950	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	15.00	2.704743	0.48412	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.21543	3.51;3.51;2.0	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.50188	0.1601	M	0.89715	3.055	0.58432	D	0.999993	D;D	0.76494	0.986;0.999	P;D	0.83275	0.795;0.996	T	0.58306	-0.7659	10	0.54805	T	0.06	.	19.4868	0.95032	0.0:0.0:1.0:0.0	.	911;984	Q5T795;Q9NU22	.;MDN1_HUMAN	S	984;984;911	ENSP00000358400:R984S;ENSP00000413970:R984S;ENSP00000409664:R911S	ENSP00000358400:R984S	R	-	1	0	MDN1	90520537	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	7.469000	0.80959	2.598000	0.87819	0.563000	0.77884	CGC	MDN1	-	superfamily_P-loop_NTPase,pirsf_Midasin	ENSG00000112159		0.517	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2		0.00	61	0	G			90463816	-1			no_errors	ENST00000369393	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
MEF2D	4209	genome.wustl.edu	37	1	156452378	156452378	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:156452378C>T	ENST00000348159.4	-	3	589	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	MEF2D_ENST00000464356.2_Missense_Mutation_p.V37M|MEF2D_ENST00000340875.5_Missense_Mutation_p.V37M|MEF2D_ENST00000360595.3_Missense_Mutation_p.V37M|MEF2D_ENST00000368240.2_Missense_Mutation_p.V37M|Y_RNA_ENST00000383924.1_RNA|MEF2D_ENST00000353795.3_Missense_Mutation_p.V37M	NM_005920.2	NP_005911.1	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	37	MADS-box. {ECO:0000255|PROSITE- ProRule:PRU00251}.				adult heart development (GO:0007512)|apoptotic process (GO:0006915)|chondrocyte differentiation (GO:0002062)|endochondral ossification (GO:0001958)|muscle organ development (GO:0007517)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|histone deacetylase binding (GO:0042826)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	15	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCACATAGCACGCTCAGCTCA	0.542																																																	0													335.0	275.0	295.0					1																	156452378		2203	4300	6503	SO:0001583	missense	0			BC054520	CCDS1143.1, CCDS60304.1	1q12-q23	2008-02-05	2007-04-24		ENSG00000116604	ENSG00000116604		"""Myocyte enhancer factors"""	6997	protein-coding gene	gene with protein product		600663				8269842	Standard	NM_005920		Approved		uc001fpb.4	Q14814	OTTHUMG00000033095	ENST00000348159.4:c.109G>A	1.37:g.156452378C>T	ENSP00000271555:p.Val37Met		D3DVC0|Q14815|Q5T9U5|Q5T9U6	Missense_Mutation	SNP	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.V37M	ENST00000348159.4	37	c.109	CCDS1143.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.088532	0.76756	.	.	ENSG00000116604	ENST00000348159;ENST00000340875;ENST00000368240;ENST00000353795;ENST00000360595;ENST00000541336;ENST00000454816	D;D;D;D;D;D	0.88201	-2.35;-2.35;-2.35;-2.35;-2.35;-2.35	4.94	4.02	0.46733	Transcription factor, MADS-box (6);	0.000000	0.85682	D	0.000000	D	0.93713	0.7991	M	0.89095	3.005	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79784	0.975;0.993;0.985	D	0.94230	0.7475	10	0.87932	D	0	-14.5788	11.4351	0.50064	0.0:0.9109:0.0:0.0891	.	42;37;37	Q4LE66;Q14814;Q14814-4	.;MEF2D_HUMAN;.	M	37	ENSP00000271555:V37M;ENSP00000343159:V37M;ENSP00000357223:V37M;ENSP00000344705:V37M;ENSP00000353803:V37M;ENSP00000388505:V37M	ENSP00000343159:V37M	V	-	1	0	MEF2D	154719002	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	6.081000	0.71309	2.298000	0.77334	0.555000	0.69702	GTG	MEF2D	-	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	ENSG00000116604		0.542	MEF2D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MEF2D	HGNC	protein_coding	OTTHUMT00000080562.2	-	0.00	91	0	C	NM_005920		156452378	-1	tier1	-	no_errors	ENST00000348159	ensembl	human	known	74_37	missense	17.65	56	12	SNP	1.000	T
MITF	4286	genome.wustl.edu	37	3	70014297	70014297	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:70014297C>T	ENST00000448226.2	+	10	1606	c.1479C>T	c.(1477-1479)gtC>gtT	p.V493V	MITF_ENST00000314557.6_Silent_p.V380V|MITF_ENST00000394351.3_Silent_p.V386V|MITF_ENST00000531774.1_Silent_p.V324V|MITF_ENST00000394355.2_Silent_p.V462V|MITF_ENST00000328528.6_Silent_p.V486V|MITF_ENST00000352241.4_Silent_p.V487V|MITF_ENST00000314589.5_Silent_p.V471V|MITF_ENST00000472437.1_Silent_p.V435V			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	493					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		TTTCTCCCGTCGGTGTCACTG	0.542			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														Melanoma(29;269 969 31479 41502 42961)			Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	0													129.0	117.0	121.0					3																	70014297		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.1479C>T	3.37:g.70014297C>T			B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Silent	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.V493	ENST00000448226.2	37	c.1479		3																																																																																			MITF	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000187098		0.542	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	MITF	HGNC	protein_coding	OTTHUMT00000313947.1	-	0.00	27	0	C	NM_198159		70014297	+1	tier1	-	no_errors	ENST00000448226	ensembl	human	known	74_37	silent	50.00	9	9	SNP	0.000	T
MT-ND1	4535	genome.wustl.edu	37	M	1393	1393	+	5'Flank	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrM:1393G>T	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AAAACTACGATAGCCCTTATG	0.483																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1393G>T	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.483	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	147	0	G	YP_003024026		1393	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	16.67	10	2	SNP	NULL	T
MYT1L	23040	genome.wustl.edu	37	2	1842952	1842952	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:1842952G>T	ENST00000399161.2	-	21	3796	c.3049C>A	c.(3049-3051)Cac>Aac	p.H1017N	MYT1L_ENST00000471668.1_5'UTR|MYT1L_ENST00000407844.1_Missense_Mutation_p.H13N|MYT1L_ENST00000428368.2_Missense_Mutation_p.H1015N	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1017					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CCGCTGACGTGGCCTGAGCCG	0.657																																																	0													23.0	28.0	26.0					2																	1842952		2044	4188	6232	SO:0001583	missense	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3049C>A	2.37:g.1842952G>T	ENSP00000382114:p.His1017Asn		A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.H1017N	ENST00000399161.2	37	c.3049		2	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989191	0.93106	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T	0.63255	-0.02;-0.03	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.82476	0.5045	M	0.85041	2.73	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.87578	0.987;0.998;0.996	D	0.84843	0.0809	10	0.87932	D	0	-48.0615	19.5365	0.95255	0.0:0.0:1.0:0.0	.	13;1017;1015	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	N	1017;963;13;71;1015	ENSP00000382114:H1017N;ENSP00000396103:H1015N	ENSP00000295067:H963N	H	-	1	0	MYT1L	1821959	1.000000	0.71417	0.969000	0.41365	0.782000	0.44232	9.780000	0.99024	2.618000	0.88619	0.563000	0.77884	CAC	MYT1L	-	pfam_Znf_C2HC	ENSG00000186487		0.657	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	-	0.00	41	0	G	NM_015025		1842952	-1	tier1	-	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	T
NAA16	79612	genome.wustl.edu	37	13	41894803	41894803	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr13:41894803G>T	ENST00000379406.3	+	4	569	c.245G>T	c.(244-246)tGt>tTt	p.C82F	NAA16_ENST00000403412.3_Splice_Site_p.C82F|NAA16_ENST00000379367.3_Splice_Site_p.C82F	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	82					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						AACTTAATAGGTTGGCATGTA	0.318																																																	0													74.0	76.0	76.0					13																	41894803		2203	4300	6503	SO:0001630	splice_region_variant	0			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.245-1G>T	13.37:g.41894803G>T			B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	pfam_TPR_2,pfam_NatA_aux_su,pfam_TPR_1,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.C82F	ENST00000379406.3	37	c.245	CCDS9379.1	13	.	.	.	.	.	.	.	.	.	.	G	21.6	4.173513	0.78452	.	.	ENSG00000172766	ENST00000379367;ENST00000379406;ENST00000403412	T;T;T	0.73469	0.68;0.68;-0.75	4.9	4.9	0.64082	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	D	0.90150	0.6922	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	0.967;0.992;1.0	D;D;D	0.77557	0.911;0.956;0.99	D	0.92912	0.6348	9	.	.	.	.	18.2536	0.90012	0.0:0.0:1.0:0.0	.	82;82;82	Q6N069;Q6N069-4;Q6N069-5	NAA16_HUMAN;.;.	F	82	ENSP00000368674:C82F;ENSP00000368716:C82F;ENSP00000386103:C82F	.	C	+	2	0	NAA16	40792803	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.010000	0.93611	2.533000	0.85409	0.655000	0.94253	TGT	NAA16	-	pfam_TPR_2,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000172766		0.318	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	HGNC	protein_coding	OTTHUMT00000044672.2		0.00	83	0	G	NM_018527	Missense_Mutation	41894803	+1			no_errors	ENST00000379406	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
NAA50	80218	genome.wustl.edu	37	3	113464831	113464831	+	De_novo_Start_OutOfFrame	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:113464831T>C	ENST00000240922.3	-	0	290				NAA50_ENST00000493900.1_De_novo_Start_OutOfFrame|ATP6V1A_ENST00000538620.1_5'Flank|NAA50_ENST00000477813.1_De_novo_Start_OutOfFrame|NAA50_ENST00000467022.1_5'UTR|NAA50_ENST00000497255.1_De_novo_Start_OutOfFrame|NAA50_ENST00000497525.1_5'Flank|ATP6V1A_ENST00000273398.3_5'Flank|RP11-271C24.2_ENST00000492981.1_lincRNA	NM_025146.2	NP_079422.1	Q9GZZ1	NAA50_HUMAN	N(alpha)-acetyltransferase 50, NatE catalytic subunit						histone H4 acetylation (GO:0043967)|mitotic sister chromatid cohesion, centromeric (GO:0071962)|N-terminal protein amino acid acetylation (GO:0006474)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	H4 histone acetyltransferase activity (GO:0010485)|peptide alpha-N-acetyltransferase activity (GO:0004596)|peptidyl-lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0052858)			large_intestine(2)|lung(2)|skin(1)	5						TTACCACCGATATCAACGCCG	0.687											OREG0015718	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													32.0	28.0	29.0					3																	113464831		2203	4300	6503			0			AK023256	CCDS2975.1	3q13.31	2010-05-07	2010-01-14	2010-01-14	ENSG00000121579	ENSG00000121579	2.3.1.-	"""N(alpha)-acetyltransferase subunits"""	29533	protein-coding gene	gene with protein product		610834	"""Mak3 homolog (S. cerevisiae)"", ""N-acetyltransferase 13"", ""N-acetyltransferase 13 (GCN5-related)"""	MAK3, NAT13		16507339, 17502424, 19660095	Standard	NM_025146		Approved	FLJ13194, NAT5, San	uc003ean.2	Q9GZZ1	OTTHUMG00000159294	ENST00000240922.3:c.-35A>G	3.37:g.113464831T>C		1450	D3DN74|Q68DQ1	RNA	SNP	-	NULL	ENST00000240922.3	37	NULL	CCDS2975.1	3																																																																																			NAA50	-	-	ENSG00000121579		0.687	NAA50-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA50	HGNC	protein_coding	OTTHUMT00000354446.2	-	0.00	99	0	T	NM_025146		113464831	-1	tier1	-	no_errors	ENST00000467022	ensembl	human	putative	74_37	rna	50.68	36	37	SNP	0.874	C
NKAIN4	128414	genome.wustl.edu	37	20	61878933	61878933	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr20:61878933G>A	ENST00000370316.3	-	4	557	c.468C>T	c.(466-468)atC>atT	p.I156I	NKAIN4_ENST00000466885.1_5'UTR|NKAIN4_ENST00000370313.1_Silent_p.I94I|NKAIN4_ENST00000370307.2_Silent_p.I94I	NM_152864.3	NP_690603.3	Q8IVV8	NKAI4_HUMAN	Na+/K+ transporting ATPase interacting 4	156						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|lung(1)|ovary(1)	4	all_cancers(38;2.72e-09)					CGCTCACCGCGATCAGGATCT	0.701																																																	0																																										SO:0001819	synonymous_variant	0			BC041812	CCDS13514.1	20q13.33	2007-10-04	2007-10-04	2007-10-04	ENSG00000101198	ENSG00000101198		"""Na+/K+ transporting ATPase interacting"""	16191	protein-coding gene	gene with protein product		612873	"""chromosome 20 open reading frame 58"""	C20orf58		17606467	Standard	NM_152864		Approved	bA261N11.2, FAM77A	uc002yek.3	Q8IVV8	OTTHUMG00000032959	ENST00000370316.3:c.468C>T	20.37:g.61878933G>A			Q4VXQ6|Q9BQU8|Q9BQU9	Silent	SNP	pfam_Na/K-Atpase_Interacting	p.I156	ENST00000370316.3	37	c.468	CCDS13514.1	20																																																																																			NKAIN4	-	pfam_Na/K-Atpase_Interacting	ENSG00000101198		0.701	NKAIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN4	HGNC	protein_coding	OTTHUMT00000080117.3	-	0.00	106	0	G	NM_152864		61878933	-1	tier1	-	no_errors	ENST00000370316	ensembl	human	known	74_37	silent	17.72	65	14	SNP	0.722	A
NME8	51314	genome.wustl.edu	37	7	37907377	37907377	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:37907377A>C	ENST00000199447.4	+	11	1067	c.695A>C	c.(694-696)aAa>aCa	p.K232T	NME8_ENST00000440017.1_Missense_Mutation_p.K232T|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	232	NDK 1.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CAAGGAAGTAAACACAATCCT	0.418																																																	0													139.0	125.0	130.0					7																	37907377		2203	4300	6503	SO:0001583	missense	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.695A>C	7.37:g.37907377A>C	ENSP00000199447:p.Lys232Thr		Q9NZH1	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.K232T	ENST00000199447.4	37	c.695	CCDS5452.1	7	.	.	.	.	.	.	.	.	.	.	A	7.985	0.752116	0.15778	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.44482	0.92;0.92	4.53	3.35	0.38373	.	1.160520	0.06392	N	0.717303	T	0.27663	0.0680	N	0.14661	0.345	0.09310	N	1	B	0.15473	0.013	B	0.25759	0.063	T	0.30268	-0.9984	10	0.13108	T	0.6	-1.3044	8.6236	0.33875	0.8057:0.1943:0.0:0.0	.	232	Q8N427	TXND3_HUMAN	T	232	ENSP00000199447:K232T;ENSP00000397063:K232T	ENSP00000199447:K232T	K	+	2	0	TXNDC3	37873902	0.002000	0.14202	0.011000	0.14972	0.040000	0.13550	1.187000	0.32090	0.833000	0.34828	0.460000	0.39030	AAA	NME8	-	superfamily_Nucleoside_diP_kinase	ENSG00000086288		0.418	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1	-	0.00	58	0	A	NM_016616		37907377	+1	tier1	-	no_errors	ENST00000199447	ensembl	human	known	74_37	missense	26.67	33	12	SNP	0.021	C
NPM2	10361	genome.wustl.edu	37	8	21892020	21892021	+	Splice_Site	INS	-	-	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:21892020_21892021insA	ENST00000397940.1	+	7	1546_1547		c.e7-1		NPM2_ENST00000381530.5_Splice_Site|snoU13_ENST00000459495.1_RNA|NPM2_ENST00000289820.6_Splice_Site|NPM2_ENST00000521157.1_Splice_Site|NPM2_ENST00000518119.1_Splice_Site			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2						chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		TTGGTTCCCAGAAAAAAAAGCT	0.406																																																	0																																										SO:0001630	splice_region_variant	0			AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.532-1->A	8.37:g.21892028_21892028dupA			B3KSU0|D3DSQ8|Q6NVH6	Frame_Shift_Ins	INS	superfamily_Nucleoplasmin_core_dom	p.L181fs	ENST00000397940.1	37	c.533_532	CCDS6018.1	8																																																																																			NPM2	-	NULL	ENSG00000158806		0.406	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM2	HGNC	protein_coding	OTTHUMT00000253810.2		0.00	44	0	-	NM_182795	Intron	21892021	+1	tier1		no_errors	ENST00000397940	ensembl	human	known	74_37	frame_shift_ins	75.68	9	28	INS	1.000:1.000	A
NR4A1	3164	genome.wustl.edu	37	12	52448812	52448812	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:52448812G>C	ENST00000243050.1	+	3	1014	c.700G>C	c.(700-702)Gca>Cca	p.A234P	NR4A1_ENST00000550082.1_Missense_Mutation_p.A247P|NR4A1_ENST00000360284.3_Missense_Mutation_p.A247P|NR4A1_ENST00000394824.2_Missense_Mutation_p.A234P|NR4A1_ENST00000545748.1_Missense_Mutation_p.A288P|NR4A1_ENST00000394825.1_Missense_Mutation_p.A234P|NR4A1_ENST00000548232.1_Missense_Mutation_p.A234P	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	234					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		CCCAGGTTTGGCACCCACTTC	0.647																																																	0													85.0	95.0	91.0					12																	52448812		2203	4300	6503	SO:0001583	missense	0			L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.700G>C	12.37:g.52448812G>C	ENSP00000243050:p.Ala234Pro		B4DML7|Q15627|Q53Y00|Q6IBU8	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Nuc_orp_HMR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.A288P	ENST00000243050.1	37	c.862	CCDS8818.1	12	.	.	.	.	.	.	.	.	.	.	G	9.992	1.231057	0.22626	.	.	ENSG00000123358	ENST00000360284;ENST00000545748;ENST00000550082;ENST00000243050;ENST00000394825;ENST00000394824;ENST00000548232	D;D;D;D;D;D;D	0.93133	-3.14;-3.16;-3.14;-3.13;-3.13;-3.13;-3.17	4.93	4.03	0.46877	.	1.627630	0.02623	N	0.103450	D	0.87038	0.6078	N	0.08118	0	0.39471	D	0.967722	B;B;B	0.09022	0.0;0.0;0.002	B;B;B	0.06405	0.0;0.002;0.001	T	0.70970	-0.4727	10	0.45353	T	0.12	.	8.7785	0.34776	0.0:0.2739:0.5729:0.1532	.	247;234;234	B4DML7;P22736;Q15627	.;NR4A1_HUMAN;.	P	247;288;247;234;234;234;234	ENSP00000353427:A247P;ENSP00000440864:A288P;ENSP00000449539:A247P;ENSP00000243050:A234P;ENSP00000378302:A234P;ENSP00000378301:A234P;ENSP00000449587:A234P	ENSP00000243050:A234P	A	+	1	0	NR4A1	50735079	1.000000	0.71417	0.902000	0.35471	0.242000	0.25591	3.185000	0.50934	1.426000	0.47256	0.561000	0.74099	GCA	NR4A1	-	prints_Nuc_orp_HMR_rcpt	ENSG00000123358		0.647	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NR4A1	HGNC	protein_coding	OTTHUMT00000317922.2	-	0.00	58	0	G			52448812	+1	tier1	-	no_errors	ENST00000545748	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.636	C
OR10G7	390265	genome.wustl.edu	37	11	123909177	123909177	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:123909177A>T	ENST00000330487.5	-	1	540	c.532T>A	c.(532-534)Tgt>Agt	p.C178S		NM_001004463.1	NP_001004463.1	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G, member 7	178						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(6)|lung(20)|ovary(2)|prostate(2)|stomach(3)|urinary_tract(1)	47		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		GGTGCGTCACAGAAGTAGTGC	0.547																																																	0													204.0	198.0	200.0					11																	123909177		2200	4296	6496	SO:0001583	missense	0			AB065754	CCDS31705.1	11q24.1	2012-08-09			ENSG00000182634	ENSG00000182634		"""GPCR / Class A : Olfactory receptors"""	14842	protein-coding gene	gene with protein product							Standard	NM_001004463		Approved		uc001pzq.1	Q8NGN6	OTTHUMG00000165969	ENST00000330487.5:c.532T>A	11.37:g.123909177A>T	ENSP00000329689:p.Cys178Ser		Q6IFE8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C178S	ENST00000330487.5	37	c.532	CCDS31705.1	11	.	.	.	.	.	.	.	.	.	.	A	19.79	3.892721	0.72524	.	.	ENSG00000182634	ENST00000330487	T	0.62364	0.03	3.24	3.24	0.37175	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000102	D	0.84759	0.5543	H	0.97214	3.96	0.47183	D	0.999348	D	0.89917	1.0	D	0.91635	0.999	D	0.88826	0.3302	10	0.87932	D	0	.	11.6893	0.51505	1.0:0.0:0.0:0.0	.	178	Q8NGN6	O10G7_HUMAN	S	178	ENSP00000329689:C178S	ENSP00000329689:C178S	C	-	1	0	OR10G7	123414387	1.000000	0.71417	0.995000	0.50966	0.930000	0.56654	4.525000	0.60559	1.490000	0.48466	0.374000	0.22700	TGT	OR10G7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000182634		0.547	OR10G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G7	HGNC	protein_coding	OTTHUMT00000387271.1	-	0.00	235	0	A	NM_001004463		123909177	-1	tier1	-	no_errors	ENST00000330487	ensembl	human	known	74_37	missense	31.05	151	68	SNP	1.000	T
OR10Z1	128368	genome.wustl.edu	37	1	158576495	158576495	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:158576495C>G	ENST00000361284.1	+	1	267	c.267C>G	c.(265-267)gaC>gaG	p.D89E		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					CTGGGGGGGACCAGGCTATCT	0.542																																																	0													183.0	190.0	188.0					1																	158576495		2203	4300	6503	SO:0001583	missense	0			AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.267C>G	1.37:g.158576495C>G	ENSP00000354707:p.Asp89Glu		Q5VYL0|Q6IFR7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D89E	ENST00000361284.1	37	c.267	CCDS30901.1	1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.828137	0.00584	.	.	ENSG00000198967	ENST00000361284	T	0.02916	4.11	5.36	-2.62	0.06152	GPCR, rhodopsin-like superfamily (1);	1.747910	0.03416	N	0.205631	T	0.00468	0.0015	N	0.17379	0.485	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.48068	-0.9067	10	0.13470	T	0.59	.	0.0034	0.00000	0.2962:0.2036:0.2111:0.2891	.	89	Q8NGY1	O10Z1_HUMAN	E	89	ENSP00000354707:D89E	ENSP00000354707:D89E	D	+	3	2	OR10Z1	156843119	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.559000	0.05971	-0.379000	0.07906	-0.136000	0.14681	GAC	OR10Z1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198967		0.542	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Z1	HGNC	protein_coding	OTTHUMT00000051853.1	-	0.00	104	0	C	NM_001004478		158576495	+1	tier1	-	no_errors	ENST00000361284	ensembl	human	known	74_37	missense	48.33	62	58	SNP	0.000	G
OR2M5	127059	genome.wustl.edu	37	1	248308731	248308731	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:248308731G>A	ENST00000366476.1	+	1	282	c.282G>A	c.(280-282)atG>atA	p.M94I		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			CCATTTCTATGGCTGGTTGTG	0.468																																																	0													310.0	304.0	306.0					1																	248308731		2203	4300	6503	SO:0001583	missense	0				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.282G>A	1.37:g.248308731G>A	ENSP00000355432:p.Met94Ile			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M94I	ENST00000366476.1	37	c.282	CCDS31105.1	1	.	.	.	.	.	.	.	.	.	.	g	8.866	0.948049	0.18356	.	.	ENSG00000162727	ENST00000366476	T	0.00380	7.64	3.28	-1.25	0.09405	GPCR, rhodopsin-like superfamily (1);	1.727540	0.04219	U	0.333209	T	0.00210	0.0006	N	0.16098	0.37	0.09310	N	1	B	0.10296	0.003	B	0.14578	0.011	T	0.40421	-0.9564	10	0.62326	D	0.03	.	1.6991	0.02868	0.1157:0.1944:0.2367:0.4532	.	94	A3KFT3	OR2M5_HUMAN	I	94	ENSP00000355432:M94I	ENSP00000355432:M94I	M	+	3	0	OR2M5	246375354	0.000000	0.05858	0.000000	0.03702	0.096000	0.18686	-1.782000	0.01772	0.034000	0.15491	0.492000	0.49549	ATG	OR2M5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000162727		0.468	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	-	0.00	159	0	G	NM_001004690		248308731	+1	tier1	-	no_errors	ENST00000366476	ensembl	human	known	74_37	missense	51.14	107	112	SNP	0.000	A
OR51M1	390059	genome.wustl.edu	37	11	5410768	5410768	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:5410768A>G	ENST00000328611.3	+	1	162	c.140A>G	c.(139-141)tAc>tGc	p.Y47C	HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004756.2	NP_001004756.2	Q9H341	O51M1_HUMAN	olfactory receptor, family 51, subfamily M, member 1	47					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|upper_aerodigestive_tract(1)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTCTTTATGTACATGGTTGCC	0.428																																																	0													174.0	160.0	165.0					11																	5410768		1922	4136	6058	SO:0001583	missense	0			BK004382	CCDS53596.1	11p15.4	2012-08-09			ENSG00000184698	ENSG00000184698		"""GPCR / Class A : Olfactory receptors"""	14847	protein-coding gene	gene with protein product							Standard	NM_001004756		Approved		uc010qzc.2	Q9H341	OTTHUMG00000066680	ENST00000328611.3:c.140A>G	11.37:g.5410768A>G	ENSP00000333196:p.Tyr47Cys		Q6IF80	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y47C	ENST00000328611.3	37	c.140	CCDS53596.1	11	.	.	.	.	.	.	.	.	.	.	A	11.49	1.653644	0.29425	.	.	ENSG00000184698	ENST00000328611	T	0.08807	3.05	5.01	5.01	0.66863	.	0.000000	0.31323	U	0.007859	T	0.28134	0.0694	H	0.95850	3.73	0.39066	D	0.960613	P	0.42375	0.778	P	0.45195	0.473	T	0.48186	-0.9057	10	0.87932	D	0	.	13.6825	0.62493	1.0:0.0:0.0:0.0	.	36	Q9H341	O51M1_HUMAN	C	47	ENSP00000333196:Y47C	ENSP00000333196:Y47C	Y	+	2	0	OR51M1	5367344	0.995000	0.38212	0.997000	0.53966	0.021000	0.10359	3.338000	0.52128	2.101000	0.63845	0.528000	0.53228	TAC	OR51M1	-	prints_GPCR_Rhodpsn	ENSG00000184698		0.428	OR51M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51M1	HGNC	protein_coding	OTTHUMT00000142981.1	-	0.00	70	0	A	NM_001004756		5410768	+1	tier1	-	no_errors	ENST00000328611	ensembl	human	known	74_37	missense	37.97	49	30	SNP	0.999	G
OR4C3	256144	genome.wustl.edu	37	11	48346896	48346896	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:48346896T>G	ENST00000319856.4	+	1	425	c.404T>G	c.(403-405)gTt>gGt	p.V135G		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TTGGGAGGTGTTGAGATCATT	0.483																																																	0													259.0	243.0	249.0					11																	48346896		2201	4298	6499	SO:0001583	missense	0			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.404T>G	11.37:g.48346896T>G	ENSP00000321419:p.Val135Gly		B2RNF2|Q6IFB3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V135G	ENST00000319856.4	37	c.404	CCDS31489.1	11	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959648	0.34565	.	.	ENSG00000176547	ENST00000319856	T	0.01185	5.21	5.78	-5.09	0.02920	GPCR, rhodopsin-like superfamily (1);	1.881030	0.02539	N	0.094430	T	0.01353	0.0044	L	0.31578	0.945	0.09310	N	1	B	0.19706	0.038	B	0.23150	0.044	T	0.48115	-0.9063	10	0.87932	D	0	.	9.7621	0.40539	0.0:0.264:0.0992:0.6368	.	108	Q8NH37	OR4C3_HUMAN	G	135	ENSP00000321419:V135G	ENSP00000321419:V135G	V	+	2	0	OR4C3	48303472	0.000000	0.05858	0.000000	0.03702	0.900000	0.52787	-0.977000	0.03782	-0.914000	0.03827	0.391000	0.25812	GTT	OR4C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176547		0.483	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	HGNC	protein_coding	OTTHUMT00000390557.1	-	0.00	145	0	T	NM_001004702		48346896	+1	tier1	-	no_errors	ENST00000319856	ensembl	human	known	74_37	missense	17.81	120	26	SNP	0.000	G
OR8H3	390152	genome.wustl.edu	37	11	55890583	55890583	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:55890583C>T	ENST00000313472.3	+	1	735	c.735C>T	c.(733-735)ctC>ctT	p.L245L		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	245						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					TCTCTCATCTCTTGGGAGTCA	0.388																																																	0													116.0	111.0	113.0					11																	55890583		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.735C>T	11.37:g.55890583C>T			Q6IFB7	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L245	ENST00000313472.3	37	c.735	CCDS31519.1	11																																																																																			OR8H3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181761		0.388	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	60	0	C	NM_001005201		55890583	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	silent	25.88	63	22	SNP	0.003	T
OR5B2	390190	genome.wustl.edu	37	11	58189836	58189836	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:58189836T>G	ENST00000302581.2	-	1	950	c.899A>C	c.(898-900)aAg>aCg	p.K300T		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	300						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CAACACTTTCTTGAATGCATT	0.393																																																	0													64.0	63.0	64.0					11																	58189836		2201	4295	6496	SO:0001583	missense	0			AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.899A>C	11.37:g.58189836T>G	ENSP00000303076:p.Lys300Thr		B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K300T	ENST00000302581.2	37	c.899	CCDS31550.1	11	.	.	.	.	.	.	.	.	.	.	t	8.928	0.962771	0.18583	.	.	ENSG00000172365	ENST00000302581	T	0.42131	0.98	3.5	-5.19	0.02832	.	.	.	.	.	T	0.34832	0.0911	M	0.79475	2.455	0.09310	N	1	B	0.16396	0.017	B	0.16289	0.015	T	0.47484	-0.9114	9	0.52906	T	0.07	.	1.6232	0.02717	0.1326:0.3066:0.1348:0.426	.	300	Q96R09	OR5B2_HUMAN	T	300	ENSP00000303076:K300T	ENSP00000303076:K300T	K	-	2	0	OR5B2	57946412	0.000000	0.05858	0.219000	0.23793	0.118000	0.20060	-1.942000	0.01541	-0.649000	0.05430	-0.361000	0.07541	AAG	OR5B2	-	NULL	ENSG00000172365		0.393	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B2	HGNC	protein_coding	OTTHUMT00000394887.2	-	0.00	51	0	T	NM_001005566		58189836	-1	tier1	-	no_errors	ENST00000302581	ensembl	human	known	74_37	missense	26.32	42	15	SNP	0.005	G
ORC6	23594	genome.wustl.edu	37	16	46727054	46727054	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:46727054A>G	ENST00000219097.2	+	4	469	c.409A>G	c.(409-411)Agg>Ggg	p.R137G	ORC6_ENST00000568364.2_Missense_Mutation_p.R137G|ORC6_ENST00000566860.1_Missense_Mutation_p.R88G	NM_014321.3	NP_055136.1	Q9Y5N6	ORC6_HUMAN	origin recognition complex, subunit 6	137					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	8						TGACTTATCCAGGCCACTTTT	0.378																																																	0													112.0	104.0	107.0					16																	46727054		2203	4300	6503	SO:0001583	missense	0			AF139658	CCDS10722.1	16q12	2010-10-12	2010-10-12	2010-10-12	ENSG00000091651	ENSG00000091651			17151	protein-coding gene	gene with protein product		607213	"""origin recognition complex, subunit 6 homolog-like (yeast)"", ""origin recognition complex, subunit 6 like (yeast)"""	ORC6L		10945994	Standard	NM_014321		Approved		uc002eeh.3	Q9Y5N6	OTTHUMG00000132539	ENST00000219097.2:c.409A>G	16.37:g.46727054A>G	ENSP00000219097:p.Arg137Gly		B3KN89	Missense_Mutation	SNP	pfam_ORC6	p.R137G	ENST00000219097.2	37	c.409	CCDS10722.1	16	.	.	.	.	.	.	.	.	.	.	A	19.04	3.750923	0.69533	.	.	ENSG00000091651	ENST00000219097	T	0.65916	-0.18	5.98	5.98	0.97165	.	0.161638	0.52532	D	0.000069	T	0.61763	0.2373	M	0.69823	2.125	0.39529	D	0.968634	P;B	0.34462	0.454;0.04	B;B	0.29598	0.104;0.013	T	0.67546	-0.5643	10	0.72032	D	0.01	.	15.4522	0.75282	1.0:0.0:0.0:0.0	.	137;137	B3KMP9;Q9Y5N6	.;ORC6_HUMAN	G	137	ENSP00000219097:R137G	ENSP00000219097:R137G	R	+	1	2	ORC6	45284555	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.365000	0.79537	2.289000	0.77006	0.482000	0.46254	AGG	ORC6	-	NULL	ENSG00000091651		0.378	ORC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC6	HGNC	protein_coding	OTTHUMT00000255739.3	-	0.00	24	0	A			46727054	+1	tier1	-	no_errors	ENST00000219097	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	G
PABPC4	8761	genome.wustl.edu	37	1	40029381	40029381	+	Missense_Mutation	SNP	G	G	A	rs141523814		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:40029381G>A	ENST00000372857.3	-	12	2317	c.1525C>T	c.(1525-1527)Cgc>Tgc	p.R509C	PABPC4_ENST00000372856.3_Missense_Mutation_p.R496C|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372858.3_Missense_Mutation_p.R525C|PABPC4_ENST00000372862.3_Missense_Mutation_p.R480C	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	509					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ACAGCAGCGCGTGGCGCTAAG	0.562																																																	0								G	CYS/ARG,CYS/ARG,CYS/ARG	0,4406		0,0,2203	52.0	58.0	56.0		1573,1486,1525	4.6	1.0	1	dbSNP_134	56	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	PABPC4	NM_001135653.1,NM_001135654.1,NM_003819.3	180,180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	525/661,496/632,509/645	40029381	1,13005	2203	4300	6503	SO:0001583	missense	0			U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1525C>T	1.37:g.40029381G>A	ENSP00000361948:p.Arg509Cys		B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.R525C	ENST00000372857.3	37	c.1573	CCDS438.1	1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.064282	0.55432	0.0	1.16E-4	ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856	T;T;T;T	0.42900	0.96;2.44;2.46;2.37	5.58	4.62	0.57501	Polyadenylate-binding protein/Hyperplastic disc protein (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	L	0.56769	1.78	0.80722	D	1	D;D;P	0.56968	0.978;0.978;0.955	P;P;P	0.51999	0.512;0.687;0.608	T	0.42310	-0.9459	10	0.38643	T	0.18	.	14.2149	0.65786	0.0:0.0:0.7448:0.2552	.	509;496;525	Q13310;Q13310-2;Q4VC03	PABP4_HUMAN;.;.	C	480;525;509;496	ENSP00000361953:R480C;ENSP00000361949:R525C;ENSP00000361948:R509C;ENSP00000361947:R496C	ENSP00000361947:R496C	R	-	1	0	PABPC4	39801968	1.000000	0.71417	0.967000	0.41034	0.245000	0.25701	5.166000	0.64965	2.789000	0.95967	0.655000	0.94253	CGC	PABPC4	-	superfamily_PABP_HYD,tigrfam_PABP_1234	ENSG00000090621		0.562	PABPC4-001	KNOWN	basic|CCDS	protein_coding	PABPC4	HGNC	protein_coding	OTTHUMT00000025220.1	-	0.00	39	0	G	NM_001135653		40029381	-1	tier1	rs141523814	no_errors	ENST00000372858	ensembl	human	known	74_37	missense	38.24	21	13	SNP	0.998	A
PAQR3	152559	genome.wustl.edu	37	4	79856348	79856348	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:79856348G>T	ENST00000512733.1	-	2	488	c.275C>A	c.(274-276)aCa>aAa	p.T92K	PAQR3_ENST00000295462.3_Intron|PAQR3_ENST00000380645.4_Missense_Mutation_p.T92K	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III	92					negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						TAACACAGATGTCATGTCATA	0.358																																																	0													120.0	123.0	122.0					4																	79856348		2203	4300	6503	SO:0001583	missense	0			AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.275C>A	4.37:g.79856348G>T	ENSP00000421981:p.Thr92Lys		A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	Missense_Mutation	SNP	pfam_HlyIII-related	p.T92K	ENST00000512733.1	37	c.275	CCDS34020.1	4	.	.	.	.	.	.	.	.	.	.	G	13.20	2.166298	0.38217	.	.	ENSG00000163291	ENST00000512733;ENST00000380645	T;T	0.30714	1.52;1.52	5.32	5.32	0.75619	.	0.281808	0.39615	N	0.001302	T	0.27313	0.0670	L	0.52011	1.625	0.80722	D	1	B	0.17038	0.02	B	0.27380	0.079	T	0.05468	-1.0883	10	0.07644	T	0.81	-10.5498	12.3553	0.55171	0.0774:0.0:0.9226:0.0	.	92	Q6TCH7	PAQR3_HUMAN	K	92	ENSP00000421981:T92K;ENSP00000370019:T92K	ENSP00000344203:T92K	T	-	2	0	PAQR3	80075372	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	3.501000	0.53325	2.497000	0.84241	0.563000	0.77884	ACA	PAQR3	-	pfam_HlyIII-related	ENSG00000163291		0.358	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR3	HGNC	protein_coding	OTTHUMT00000363442.1	-	0.00	36	0	G	NM_177453		79856348	-1	tier1	-	no_errors	ENST00000511594	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.995	T
PARVG	64098	genome.wustl.edu	37	22	44602215	44602215	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr22:44602215delC	ENST00000444313.3	+	14	1389	c.905delC	c.(904-906)gccfs	p.A302fs	PARVG_ENST00000415224.1_Frame_Shift_Del_p.A302fs|PARVG_ENST00000422871.1_Frame_Shift_Del_p.A302fs	NM_022141.5	NP_071424.1	Q9HBI0	PARVG_HUMAN	parvin, gamma	302	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell-matrix adhesion (GO:0007160)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)	17		Ovarian(80;0.024)|all_neural(38;0.0299)				AACAAGGATGCCAAGAGCACA	0.602																																																	0													82.0	76.0	78.0					22																	44602215		2203	4300	6503	SO:0001589	frameshift_variant	0			AF237772	CCDS14057.1	22q13.31	2013-01-24			ENSG00000138964	ENSG00000138964		"""Parvins"""	14654	protein-coding gene	gene with protein product		608122				11171322	Standard	NM_022141		Approved		uc003bep.4	Q9HBI0	OTTHUMG00000150473	ENST00000444313.3:c.905delC	22.37:g.44602215delC	ENSP00000391583:p.Ala302fs		B4DDW5|E7EVM6|Q9BQX5|Q9NSG1	Frame_Shift_Del	DEL	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.K303fs	ENST00000444313.3	37	c.905	CCDS14057.1	22																																																																																			PARVG	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000138964		0.602	PARVG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARVG	HGNC	protein_coding	OTTHUMT00000318238.4		0.00	51	0	C	NM_022141		44602215	+1	tier1		no_errors	ENST00000415224	ensembl	human	known	74_37	frame_shift_del	19.44	29	7	DEL	0.993	-
PCMTD1	115294	genome.wustl.edu	37	8	52733121	52733121	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:52733121G>A	ENST00000360540.5	-	7	1270	c.864C>T	c.(862-864)taC>taT	p.Y288Y	PCMTD1_ENST00000544451.1_Silent_p.Y212Y|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Silent_p.Y288Y	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	288						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CCACAAATACGTAAGTGTTAA	0.388																																																	0													192.0	190.0	191.0					8																	52733121		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.864C>T	8.37:g.52733121G>A			Q96FK9	Silent	SNP	pfam_PCMT	p.Y288	ENST00000360540.5	37	c.864	CCDS6148.1	8																																																																																			PCMTD1	-	NULL	ENSG00000168300		0.388	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	HGNC	protein_coding	OTTHUMT00000377909.2	-	0.00	136	0	G	NM_052937		52733121	-1	tier1	rs147382324	no_errors	ENST00000360540	ensembl	human	known	74_37	silent	5.24	181	10	SNP	0.744	A
PCSK5	5125	genome.wustl.edu	37	9	78790172	78790172	+	Intron	SNP	G	G	C	rs77249767		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:78790172G>C	ENST00000545128.1	+	14	2438				PCSK5_ENST00000376767.3_Missense_Mutation_p.W676S|PCSK5_ENST00000376752.4_Intron	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ggaatggaatggaatggaatg	0.378																																																	0																																										SO:0001627	intron_variant	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1900+127G>C	9.37:g.78790172G>C			F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.W676S	ENST00000545128.1	37	c.2027	CCDS55320.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.187|0.187	-1.057087|-1.057087	0.01965|0.01965	.|.	.|.	ENSG00000099139|ENSG00000099139	ENST00000396108|ENST00000376767	.|T	.|0.74421	.|-0.84	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.56262|0.56262	0.1973|0.1973	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.43081|0.43081	-0.9413|-0.9413	4|7	0.27082|0.44086	T|T	0.32|0.13	.|.	2.6487|2.6487	0.04992|0.04992	0.5:0.0:0.5:0.0|0.5:0.0:0.5:0.0	.|.	.|676	.|B1AMG5	.|.	I|S	674|676	.|ENSP00000365958:W676S	ENSP00000379415:M674I|ENSP00000365958:W676S	M|W	+|+	3|2	0|0	PCSK5|PCSK5	77979992|77979992	0.031000|0.031000	0.19500|0.19500	0.119000|0.119000	0.21687|0.21687	0.120000|0.120000	0.20174|0.20174	-0.197000|-0.197000	0.09518|0.09518	-0.000000|-0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	ATG|TGG	PCSK5	-	NULL	ENSG00000099139		0.378	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		-	0.00	9	0	G			78790172	+1	tier1	rs77249767	no_errors	ENST00000376767	ensembl	human	known	74_37	missense	77.78	2	7	SNP	0.005	C
PGGT1B	5229	genome.wustl.edu	37	5	114572128	114572128	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:114572128T>A	ENST00000419445.1	-	5	591	c.571A>T	c.(571-573)Atg>Ttg	p.M191L	PGGT1B_ENST00000379615.3_Missense_Mutation_p.M191L	NM_005023.3	NP_005014.2	P53609	PGTB1_HUMAN	protein geranylgeranyltransferase type I, beta subunit	191					negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|protein geranylgeranylation (GO:0018344)|response to cytokine (GO:0034097)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)	CAAX-protein geranylgeranyltransferase activity (GO:0004662)|protein geranylgeranyltransferase activity (GO:0004661)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6		all_cancers(142;0.000523)|all_epithelial(76;6.45e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		Epithelial(69;2.95e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.98e-08)|all cancers(49;3.1e-06)		TTCATATCCATGCCTGACCAG	0.383																																																	0													138.0	127.0	131.0					5																	114572128		2202	4300	6502	SO:0001583	missense	0				CCDS4116.1	5q23.1	2008-02-05			ENSG00000164219	ENSG00000164219			8895	protein-coding gene	gene with protein product		602031				8106351	Standard	NM_005023		Approved	GGTI, BGGI	uc003kqw.4	P53609	OTTHUMG00000128893	ENST00000419445.1:c.571A>T	5.37:g.114572128T>A	ENSP00000404676:p.Met191Leu		Q5MJP9	Missense_Mutation	SNP	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	p.M191L	ENST00000419445.1	37	c.571	CCDS4116.1	5	.	.	.	.	.	.	.	.	.	.	T	17.48	3.400606	0.62177	.	.	ENSG00000164219	ENST00000419445;ENST00000379615	T;T	0.28255	1.62;1.62	5.27	5.27	0.74061	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.000000	0.85682	D	0.000000	T	0.28001	0.0690	L	0.39147	1.195	0.58432	D	0.999996	B;B	0.21606	0.058;0.009	B;B	0.24974	0.039;0.057	T	0.04427	-1.0952	10	0.26408	T	0.33	-14.1738	15.1979	0.73108	0.0:0.0:0.0:1.0	.	191;191	P53609-2;P53609	.;PGTB1_HUMAN	L	191	ENSP00000404676:M191L;ENSP00000368935:M191L	ENSP00000368935:M191L	M	-	1	0	PGGT1B	114600027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.979000	0.88103	1.989000	0.58080	0.482000	0.46254	ATG	PGGT1B	-	pfam_Prenyltrans,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000164219		0.383	PGGT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGGT1B	HGNC	protein_coding	OTTHUMT00000250855.2	-	0.00	50	0	T	NM_005023		114572128	-1	tier1	-	no_errors	ENST00000419445	ensembl	human	known	74_37	missense	23.21	43	13	SNP	1.000	A
PLCL1	5334	genome.wustl.edu	37	2	198949120	198949120	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:198949120A>C	ENST00000428675.1	+	2	1277	c.879A>C	c.(877-879)aaA>aaC	p.K293N	PLCL1_ENST00000437704.2_Missense_Mutation_p.K195N	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	293					gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	GCAAGGAAAAACTAACCACCC	0.393																																																	0													102.0	104.0	104.0					2																	198949120		2203	4300	6503	SO:0001583	missense	0			D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.879A>C	2.37:g.198949120A>C	ENSP00000402861:p.Lys293Asn		Q3MJ90|Q53SD3|Q7Z3S3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.K293N	ENST00000428675.1	37	c.879	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	A	10.08	1.251734	0.22880	.	.	ENSG00000115896	ENST00000428675;ENST00000437704	T;T	0.17691	2.26;2.27	6.04	2.3	0.28687	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.10680	0.0261	L	0.34521	1.04	0.47407	D	0.999411	B;B	0.29716	0.255;0.255	B;B	0.23419	0.046;0.046	T	0.19877	-1.0292	9	.	.	.	.	8.5487	0.33438	0.7008:0.0:0.2992:0.0	.	293;219	Q15111;B4DYZ4	PLCL1_HUMAN;.	N	293;195	ENSP00000402861:K293N;ENSP00000414138:K195N	.	K	+	3	2	PLCL1	198657365	0.994000	0.37717	1.000000	0.80357	0.957000	0.61999	1.525000	0.35953	0.478000	0.27488	0.459000	0.35465	AAA	PLCL1	-	NULL	ENSG00000115896		0.393	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	-	0.00	24	0	A	NM_006226		198949120	+1	tier1	-	no_errors	ENST00000428675	ensembl	human	known	74_37	missense	44.00	14	11	SNP	1.000	C
PLD2	5338	genome.wustl.edu	37	17	4711597	4711597	+	Missense_Mutation	SNP	G	G	T	rs373143377		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:4711597G>T	ENST00000263088.6	+	4	400	c.269G>T	c.(268-270)cGc>cTc	p.R90L	PLD2_ENST00000572940.1_Missense_Mutation_p.R90L|RP11-81A22.5_ENST00000571067.1_lincRNA	NM_001243108.1|NM_002663.4	NP_001230037.1|NP_002654.3	O14939	PLD2_HUMAN	phospholipase D2	90	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				cytoskeleton organization (GO:0007010)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor internalization (GO:0002031)|glycerophospholipid biosynthetic process (GO:0046474)|innate immune response (GO:0045087)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)	31					Choline(DB00122)	TATTCTGTCCGCTTGACTCAC	0.552																																																	0													184.0	173.0	177.0					17																	4711597		2203	4300	6503	SO:0001583	missense	0			AF035483	CCDS11057.1, CCDS58507.1	17p13.3	2008-04-14			ENSG00000129219	ENSG00000129219	3.1.4.4		9068	protein-coding gene	gene with protein product	"""choline phosphatase 2"""	602384				9858823, 9582313	Standard	NM_002663		Approved		uc002fzc.3	O14939	OTTHUMG00000090779	ENST00000263088.6:c.269G>T	17.37:g.4711597G>T	ENSP00000263088:p.Arg90Leu		I3L2C9|O43540|O43579|O43580|Q6PGR0|Q96BY3	Missense_Mutation	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.R90L	ENST00000263088.6	37	c.269	CCDS11057.1	17	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378982	0.42207	.	.	ENSG00000129219	ENST00000263088	T	0.39997	1.05	5.07	0.716	0.18191	Phox homologous domain (5);	0.941035	0.09029	N	0.858973	T	0.32285	0.0824	L	0.43152	1.355	0.26036	N	0.981678	B;B	0.23058	0.023;0.079	B;B	0.24394	0.041;0.053	T	0.36040	-0.9764	10	0.59425	D	0.04	-4.9428	3.9771	0.09479	0.2493:0.0:0.4675:0.2833	.	90;90	O14939-2;O14939	.;PLD2_HUMAN	L	90	ENSP00000263088:R90L	ENSP00000263088:R90L	R	+	2	0	PLD2	4658561	0.245000	0.23899	0.603000	0.28903	0.858000	0.48976	0.925000	0.28791	0.246000	0.21394	-0.258000	0.10820	CGC	PLD2	-	pfam_Phox,superfamily_Phox,smart_Phox,pirsf_PLipase_D_euk,pfscan_Phox	ENSG00000129219		0.552	PLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD2	HGNC	protein_coding	OTTHUMT00000207561.3		0.00	35	0	G	NM_002663		4711597	+1			no_errors	ENST00000263088	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.060	T
PLXNB1	5364	genome.wustl.edu	37	3	48462114	48462114	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:48462114T>A	ENST00000358536.4	-	10	2257	c.1988A>T	c.(1987-1989)aAg>aTg	p.K663M	PLXNB1_ENST00000456774.1_Missense_Mutation_p.K663M|PLXNB1_ENST00000296440.6_Missense_Mutation_p.K663M|PLXNB1_ENST00000358459.4_Missense_Mutation_p.K663M|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	663					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACACGAGGCCTTGTGGGTGCA	0.632																																																	0													64.0	56.0	59.0					3																	48462114		2203	4300	6503	SO:0001583	missense	0			X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1988A>T	3.37:g.48462114T>A	ENSP00000351338:p.Lys663Met		A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.K663M	ENST00000358536.4	37	c.1988	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	T	19.48	3.836446	0.71373	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000456774	T;T;T;T	0.03524	3.9;3.92;3.9;3.92	5.24	4.09	0.47781	.	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.68765	0.956;0.96	T	0.00451	-1.1731	10	0.52906	T	0.07	.	10.1914	0.43028	0.0:0.0784:0.0:0.9216	.	663;663	O43157;O43157-2	PLXB1_HUMAN;.	M	663	ENSP00000296440:K663M;ENSP00000351242:K663M;ENSP00000351338:K663M;ENSP00000414199:K663M	ENSP00000296440:K663M	K	-	2	0	PLXNB1	48437118	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	4.802000	0.62539	0.850000	0.35239	0.459000	0.35465	AAG	PLXNB1	-	superfamily_Plexin-like_fold,smart_Plexin-like_fold	ENSG00000164050		0.632	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	HGNC	protein_coding	OTTHUMT00000344454.1	-	0.00	53	0	T	NM_002673		48462114	-1	tier1	-	no_errors	ENST00000296440	ensembl	human	known	74_37	missense	29.63	38	16	SNP	1.000	A
PODNL1	79883	genome.wustl.edu	37	19	14044255	14044255	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:14044255G>A	ENST00000339560.5	-	8	1075	c.802C>T	c.(802-804)Ctt>Ttt	p.L268F	PODNL1_ENST00000254320.3_Missense_Mutation_p.L186F|PODNL1_ENST00000538371.2_Missense_Mutation_p.L266F|PODNL1_ENST00000538517.2_Missense_Mutation_p.L177F	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	268	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			AGGTATTCAAGGCTATGCAGC	0.642																																																	0													22.0	25.0	24.0					19																	14044255		2203	4296	6499	SO:0001583	missense	0			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.802C>T	19.37:g.14044255G>A	ENSP00000345175:p.Leu268Phe		B7Z564|Q9H5G9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L268F	ENST00000339560.5	37	c.802	CCDS12300.1	19	.	.	.	.	.	.	.	.	.	.	G	17.83	3.484573	0.63962	.	.	ENSG00000132000	ENST00000538371;ENST00000538517;ENST00000339560;ENST00000545071;ENST00000254320	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	4.91	2.78	0.32641	.	0.000000	0.36444	N	0.002599	D	0.92296	0.7556	H	0.95780	3.72	0.29985	N	0.817342	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.998	D	0.87859	0.2663	10	0.87932	D	0	.	8.2433	0.31673	0.1891:0.0:0.8108:0.0	.	266;186;177;268	F5H7F9;B7Z3M0;G3V1J6;Q6PEZ8	.;.;.;PONL1_HUMAN	F	266;177;268;118;186	ENSP00000442553:L266F;ENSP00000440080:L177F;ENSP00000345175:L268F;ENSP00000254320:L186F	ENSP00000254320:L186F	L	-	1	0	PODNL1	13905255	1.000000	0.71417	0.093000	0.20910	0.947000	0.59692	4.479000	0.60236	0.487000	0.27698	0.579000	0.79373	CTT	PODNL1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000132000		0.642	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	PODNL1	HGNC	protein_coding	OTTHUMT00000457967.1	-	0.00	68	0	G	NM_024825		14044255	-1	tier1	-	no_errors	ENST00000339560	ensembl	human	known	74_37	missense	30.69	70	31	SNP	0.998	A
POLQ	10721	genome.wustl.edu	37	3	121208513	121208513	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:121208513T>G	ENST00000264233.5	-	16	3393	c.3265A>C	c.(3265-3267)Acg>Ccg	p.T1089P		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	1089					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CTAAATTCCGTTTTCTTCTCA	0.368								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0													48.0	55.0	53.0					3																	121208513		2166	4280	6446	SO:0001583	missense	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.3265A>C	3.37:g.121208513T>G	ENSP00000264233:p.Thr1089Pro		O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.T1089P	ENST00000264233.5	37	c.3265	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	T	5.309	0.242415	0.10077	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.50001	0.76	4.97	-3.87	0.04218	.	1.751750	0.02272	N	0.068588	T	0.24736	0.0600	N	0.19112	0.55	0.09310	N	1	P;P	0.37864	0.475;0.61	B;B	0.31686	0.063;0.134	T	0.07083	-1.0791	10	0.28530	T	0.3	.	1.767	0.03004	0.1288:0.3001:0.1332:0.4379	.	1089;261	O75417;O75417-2	DPOLQ_HUMAN;.	P	712;1089;1225	ENSP00000264233:T1089P	ENSP00000264233:T1089P	T	-	1	0	POLQ	122691203	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.170000	0.09897	-0.901000	0.03891	0.379000	0.24179	ACG	POLQ	-	NULL	ENSG00000051341		0.368	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	-	0.00	46	0	T	NM_199420		121208513	-1	tier1	-	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	36.36	21	12	SNP	0.000	G
PPP1R12C	54776	genome.wustl.edu	37	19	55614912	55614912	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:55614912C>T	ENST00000263433.3	-	4	611	c.596G>A	c.(595-597)cGg>cAg	p.R199Q	PPP1R12C_ENST00000376393.2_Missense_Mutation_p.R199Q|PPP1R12C_ENST00000435544.2_Missense_Mutation_p.R125Q	NM_001271618.1|NM_017607.2	NP_001258547.1|NP_060077.1			protein phosphatase 1, regulatory subunit 12C											central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	22			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CTCTTCTGCCCGCTTGGCTGC	0.622																																																	0													47.0	39.0	41.0					19																	55614912		2203	4299	6502	SO:0001583	missense	0			AF312028	CCDS12916.1	19q13.42	2013-01-10	2011-10-04		ENSG00000125503	ENSG00000125503		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14947	protein-coding gene	gene with protein product	"""myosin-binding subunit 85"""	613245	"""leukocyte receptor cluster (LRC) member 3"", ""protein phosphatase 1, regulatory (inhibitor) subunit 12C"""	LENG3		11399775	Standard	NM_017607		Approved	DKFZP434D0412, p84, MBS85, p85	uc002qix.4	Q9BZL4		ENST00000263433.3:c.596G>A	19.37:g.55614912C>T	ENSP00000263433:p.Arg199Gln			Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R199Q	ENST00000263433.3	37	c.596	CCDS12916.1	19	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435420	0.43224	.	.	ENSG00000125503	ENST00000263433;ENST00000376393;ENST00000435544	T;T;T	0.52983	0.64;0.64;0.64	5.25	4.2	0.49525	Ankyrin repeat-containing domain (3);	0.069829	0.56097	D	0.000038	T	0.56804	0.2010	L	0.45051	1.395	0.42256	D	0.991998	D;D;D	0.76494	0.999;0.999;0.999	P;P;D	0.63703	0.863;0.864;0.917	T	0.56733	-0.7930	10	0.41790	T	0.15	.	13.2966	0.60301	0.1598:0.8402:0.0:0.0	.	125;199;199	B4DME2;Q9BZL4-3;Q9BZL4	.;.;PP12C_HUMAN	Q	199;199;125	ENSP00000263433:R199Q;ENSP00000365573:R199Q;ENSP00000387833:R125Q	ENSP00000263433:R199Q	R	-	2	0	PPP1R12C	60306724	0.903000	0.30736	0.995000	0.50966	0.002000	0.02628	1.769000	0.38522	1.330000	0.45394	-0.188000	0.12872	CGG	PPP1R12C	-	pirsf_Pase-1_reg_su_12A/B/C_euk,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000125503		0.622	PPP1R12C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12C	HGNC	protein_coding	OTTHUMT00000451814.2		0.00	52	0	C	NM_017607		55614912	-1			no_errors	ENST00000263433	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.995	T
PRDM16	63976	genome.wustl.edu	37	1	3328688	3328688	+	Missense_Mutation	SNP	G	G	T	rs554385722		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:3328688G>T	ENST00000270722.5	+	9	1976	c.1927G>T	c.(1927-1929)Gcc>Tcc	p.A643S	PRDM16_ENST00000378398.3_Missense_Mutation_p.A644S|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.A643S|PRDM16_ENST00000442529.2_Missense_Mutation_p.A643S|PRDM16_ENST00000511072.1_Missense_Mutation_p.A644S|PRDM16_ENST00000514189.1_Missense_Mutation_p.A644S|PRDM16_ENST00000441472.2_Missense_Mutation_p.A643S			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	643					brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GGGCAAGTCCGCCGAGGGCCA	0.687			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0													40.0	50.0	47.0					1																	3328688		2066	4173	6239	SO:0001583	missense	0			AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1927G>T	1.37:g.3328688G>T	ENSP00000270722:p.Ala643Ser		A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A643S	ENST00000270722.5	37	c.1927	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	G	0.483	-0.879118	0.02550	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.05382	3.47;3.49;3.51;3.5;3.49;3.49;3.51;3.46;3.45	4.89	2.98	0.34508	.	0.870676	0.09629	N	0.776444	T	0.05273	0.0140	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.33583	0.003;0.327;0.095;0.418	B;B;B;B	0.28849	0.007;0.095;0.052;0.044	T	0.40831	-0.9542	10	0.23302	T	0.38	.	10.0167	0.42018	0.2393:0.0:0.7607:0.0	.	643;643;643;643	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	S	644;644;643;643;643;644;643;459;459;452	ENSP00000426975:A644S;ENSP00000367651:A644S;ENSP00000407968:A643S;ENSP00000405253:A643S;ENSP00000367643:A643S;ENSP00000421400:A644S;ENSP00000270722:A643S;ENSP00000422504:A459S;ENSP00000425796:A452S	ENSP00000270722:A643S	A	+	1	0	PRDM16	3318548	0.001000	0.12720	0.032000	0.17829	0.043000	0.13939	0.819000	0.27308	1.056000	0.40484	0.603000	0.83216	GCC	PRDM16	-	NULL	ENSG00000142611		0.687	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	HGNC	protein_coding	OTTHUMT00000001382.3	-	0.00	99	0	G	NM_022114		3328688	+1	tier1	-	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	41.98	47	34	SNP	0.088	T
PREX2	80243	genome.wustl.edu	37	8	68930087	68930087	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr8:68930087T>G	ENST00000288368.4	+	2	425	c.148T>G	c.(148-150)Tta>Gta	p.L50V	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	50	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)	p.L50V(2)		NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GCAGGCATTCTTACACAGAAT	0.378																																																	2	Substitution - Missense(2)	large_intestine(2)											125.0	105.0	112.0					8																	68930087		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.148T>G	8.37:g.68930087T>G	ENSP00000288368:p.Leu50Val		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L50V	ENST00000288368.4	37	c.148	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	19.50	3.839866	0.71488	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.63417	-0.04	5.85	5.85	0.93711	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000007	T	0.71617	0.3361	L	0.56769	1.78	0.52099	D	0.999941	P;P	0.41232	0.683;0.743	P;P	0.53593	0.73;0.547	T	0.72465	-0.4285	10	0.52906	T	0.07	.	14.1993	0.65690	0.0:0.0:0.0:1.0	.	50;50	Q70Z35;Q70Z35-3	PREX2_HUMAN;.	V	50	ENSP00000288368:L50V	ENSP00000288368:L50V	L	+	1	2	PREX2	69092641	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.657000	0.46724	2.238000	0.73509	0.533000	0.62120	TTA	PREX2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000046889		0.378	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	52	0	T	NM_025170		68930087	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	9.09	80	8	SNP	1.000	G
PRICKLE4	29964	genome.wustl.edu	37	6	41752707	41752707	+	Missense_Mutation	SNP	G	G	A	rs200826892		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr6:41752707G>A	ENST00000394260.1	+	2	155	c.155G>A	c.(154-156)cGg>cAg	p.R52Q	PRICKLE4_ENST00000394259.1_Missense_Mutation_p.R52Q|PRICKLE4_ENST00000359201.5_Missense_Mutation_p.R92Q|TOMM6_ENST00000398881.3_5'Flank|PRICKLE4_ENST00000458694.1_Missense_Mutation_p.R92Q|PRICKLE4_ENST00000463606.1_3'UTR|PRICKLE4_ENST00000394263.1_Missense_Mutation_p.R92Q|TOMM6_ENST00000398884.3_5'Flank			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	52	PET. {ECO:0000255|PROSITE- ProRule:PRU00636}.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			GAGGAGGAGCGGGCCGAGCTG	0.597																																																	0													57.0	64.0	62.0					6																	41752707		2203	4300	6503	SO:0001583	missense	0			AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.155G>A	6.37:g.41752707G>A	ENSP00000377803:p.Arg52Gln		A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.R92Q	ENST00000394260.1	37	c.275		6	.	.	.	.	.	.	.	.	.	.	G	11.44	1.639130	0.29157	.	.	ENSG00000124593	ENST00000458694;ENST00000359201;ENST00000394263;ENST00000394259;ENST00000394260	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	4.47	-3.84	0.04256	.	0.972993	0.08330	N	0.962440	T	0.61874	0.2382	L	0.49778	1.585	0.09310	N	0.999996	B	0.32051	0.354	B	0.29524	0.103	T	0.53222	-0.8469	10	0.27082	T	0.32	-1.0443	9.0123	0.36148	0.2167:0.0:0.5958:0.1875	.	92	Q2TBC4-3	.	Q	92;92;92;52;52	ENSP00000404911:R92Q;ENSP00000352128:R92Q;ENSP00000377806:R92Q;ENSP00000377802:R52Q;ENSP00000377803:R52Q	ENSP00000335185:R92Q	R	+	2	0	PRICKLE4	41860685	0.990000	0.36364	0.380000	0.26093	0.943000	0.58893	0.926000	0.28804	-0.373000	0.07979	-0.704000	0.03662	CGG	PRICKLE4	-	pfam_PET_domain	ENSG00000124593		0.597	PRICKLE4-007	KNOWN	basic	protein_coding	PRICKLE4	HGNC	protein_coding	OTTHUMT00000303948.1	-	0.00	78	0	G	NM_013397		41752707	+1	tier1	rs200826892	no_errors	ENST00000335515	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.048	A
PRRX1	5396	genome.wustl.edu	37	1	170699423	170699423	+	Intron	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:170699423C>T	ENST00000239461.6	+	3	912				PRRX1_ENST00000367760.3_Missense_Mutation_p.S202L|PRRX1_ENST00000476867.2_Intron	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1						artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.S202*(1)		large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AATAGATCCTCGTCCCTCCCA	0.483																																																	1	Substitution - Nonsense(1)	lung(1)											235.0	233.0	234.0					1																	170699423		2203	4300	6503	SO:0001627	intron_variant	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.599+3881C>T	1.37:g.170699423C>T			B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S202L	ENST00000239461.6	37	c.605	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	C	16.96	3.266118	0.59540	.	.	ENSG00000116132	ENST00000367760;ENST00000495280	D	0.90900	-2.75	5.67	5.67	0.87782	.	.	.	.	.	D	0.88127	0.6353	.	.	.	0.28635	N	0.907446	D	0.61697	0.99	D	0.66847	0.947	T	0.78874	-0.2032	8	0.07030	T	0.85	.	16.4923	0.84205	0.0:1.0:0.0:0.0	.	202	P54821-2	.	L	202;47	ENSP00000356734:S202L	ENSP00000239461:S202L	S	+	2	0	PRRX1	168966047	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.094000	0.50227	2.677000	0.91161	0.655000	0.94253	TCG	PRRX1	-	NULL	ENSG00000116132		0.483	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	-	0.00	88	0	C	NM_006902		170699423	+1	tier1	-	no_errors	ENST00000367760	ensembl	human	known	74_37	missense	7.37	88	7	SNP	1.000	T
PRSS1	5644	genome.wustl.edu	37	7	142457375	142457375	+	Splice_Site	SNP	C	C	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:142457375C>G	ENST00000311737.7	+	1	46	c.40C>G	c.(40-42)Ctt>Gtt	p.L14V	PRSS1_ENST00000486171.1_Splice_Site_p.L14V	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	14					cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	GGCAGCTGCTCGTGAGTATCA	0.557																																																	0													178.0	128.0	145.0					7																	142457375		2203	4300	6503	SO:0001630	splice_region_variant	0			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.40+1C>G	7.37:g.142457375C>G			A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L14V	ENST00000311737.7	37	c.40	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.545730	0.00142	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243	D;D	0.93189	-3.18;-3.18	3.32	2.43	0.29744	Peptidase cysteine/serine, trypsin-like (1);	0.498441	0.20574	N	0.089679	D	0.83211	0.5205	N	0.13168	0.305	0.22378	N	0.999154	B	0.02656	0.0	B	0.01281	0.0	T	0.63765	-0.6563	10	0.02654	T	1	.	11.8777	0.52556	0.0:0.1794:0.8206:0.0	.	14	P07477	TRY1_HUMAN	V	14	ENSP00000417854:L14V;ENSP00000308720:L14V	ENSP00000308720:L14V	L	+	1	0	PRSS1	142136949	0.999000	0.42202	1.000000	0.80357	0.007000	0.05969	1.840000	0.39230	0.685000	0.31468	-0.528000	0.04320	CTT	PRSS1	-	superfamily_Trypsin-like_Pept_dom	ENSG00000204983		0.557	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	-	0.00	123	0	C		Missense_Mutation	142457375	+1	tier1	-	no_errors	ENST00000311737	ensembl	human	known	74_37	missense	30.00	84	36	SNP	1.000	G
PTCHD2	57540	genome.wustl.edu	37	1	11561653	11561653	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:11561653C>T	ENST00000294484.6	+	2	742	c.604C>T	c.(604-606)Cga>Tga	p.R202*	PTCHD2_ENST00000389575.3_Nonsense_Mutation_p.R202*	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	202					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TCGGAGCGGGCGACTTCGGCG	0.687																																																	0													11.0	15.0	14.0					1																	11561653		1961	4145	6106	SO:0001587	stop_gained	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.604C>T	1.37:g.11561653C>T	ENSP00000294484:p.Arg202*		Q5VTU9|Q9UJD6	Nonsense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.R202*	ENST00000294484.6	37	c.604	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074621	0.76415	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	.	.	.	5.53	2.42	0.29668	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.4959	8.3801	0.32466	0.4459:0.4097:0.1444:0.0	.	.	.	.	X	202	.	ENSP00000294484:R202X	R	+	1	2	PTCHD2	11484240	0.064000	0.20934	0.094000	0.20943	0.305000	0.27757	0.810000	0.27183	0.674000	0.31244	-0.268000	0.10319	CGA	PTCHD2	-	NULL	ENSG00000204624		0.687	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2		0.00	16	0	C	XM_052561		11561653	+1			no_errors	ENST00000294484	ensembl	human	known	74_37	nonsense	60.00	4	6	SNP	0.005	T
PTGES3	10728	genome.wustl.edu	37	12	57057823	57057823	+	3'UTR	SNP	T	T	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:57057823T>A	ENST00000262033.6	-	0	1223				PTGES3_ENST00000537473.1_5'UTR|PTGES3_ENST00000414274.3_3'UTR	NM_006601.5	NP_006592.3	Q15185	TEBP_HUMAN	prostaglandin E synthase 3 (cytosolic)						arachidonic acid metabolic process (GO:0019369)|cell proliferation (GO:0008283)|chaperone cofactor-dependent protein refolding (GO:0070389)|cyclooxygenase pathway (GO:0019371)|glucocorticoid receptor signaling pathway (GO:0042921)|glycogen biosynthetic process (GO:0005978)|lung saccule development (GO:0060430)|prostaglandin biosynthetic process (GO:0001516)|RNA-dependent DNA replication (GO:0006278)|signal transduction (GO:0007165)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	prostaglandin-E synthase activity (GO:0050220)|telomerase activity (GO:0003720)|unfolded protein binding (GO:0051082)			large_intestine(1)|lung(1)	2						GAATAGCAGGTTACCAGTAAG	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC003005	CCDS31836.1, CCDS61158.1, CCDS61159.1, CCDS61160.1, CCDS73485.1	12q13.13	2012-03-14			ENSG00000110958	ENSG00000110958			16049	protein-coding gene	gene with protein product		607061				8114727, 12077419	Standard	XR_245889		Approved	p23, TEBP, cPGES	uc001slu.4	Q15185	OTTHUMG00000170217	ENST00000262033.6:c.*440A>T	12.37:g.57057823T>A			A8K7D0|B4DHP2|B4DP11|B4DP21|Q8WU70	RNA	SNP	-	NULL	ENST00000262033.6	37	NULL	CCDS31836.1	12																																																																																			PTGES3	-	-	ENSG00000110958		0.333	PTGES3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGES3	HGNC	protein_coding	OTTHUMT00000408054.1	-	0.00	35	0	T	NM_006601		57057823	-1	tier1	-	no_errors	ENST00000537473	ensembl	human	known	74_37	rna	40.54	22	15	SNP	0.984	A
RAB11FIP4	84440	genome.wustl.edu	37	17	29848204	29848204	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:29848204C>G	ENST00000325874.8	+	5	813	c.584C>G	c.(583-585)tCc>tGc	p.S195C	RAB11FIP4_ENST00000394744.2_Missense_Mutation_p.S93C|RN7SL45P_ENST00000578050.1_RNA	NM_032932.3	NP_116321.2	Q86YS3	RFIP4_HUMAN	RAB11 family interacting protein 4 (class II)	195	Necessary for interaction with RAB11A, subcellular location, homo- or heterooligomerization.				cytokinesis (GO:0000910)|transport (GO:0006810)|viral process (GO:0016032)	cleavage furrow (GO:0032154)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|midbody (GO:0030496)|recycling endosome membrane (GO:0055038)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(10;3.62e-13)|all_epithelial(10;0.000387)|all_lung(9;0.0132)|Breast(31;0.014)|all_hematologic(16;0.015)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0259)|Ovarian(249;0.0423)|Lung NSC(157;0.066)				CACACTCCATCCATGACGACC	0.587																																																	0													170.0	153.0	158.0					17																	29848204		2203	4300	6503	SO:0001583	missense	0			AB058724	CCDS11267.1	17q11.2	2013-01-10			ENSG00000131242	ENSG00000131242		"""EF-hand domain containing"""	30267	protein-coding gene	gene with protein product		611999				11347906, 11468690	Standard	NM_032932		Approved	RAB11-FIP4, KIAA1821, MGC11316, FLJ00131	uc002hgn.1	Q86YS3	OTTHUMG00000132787	ENST00000325874.8:c.584C>G	17.37:g.29848204C>G	ENSP00000312837:p.Ser195Cys		Q52LI1|Q8N829|Q8NDT7|Q969D8	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfscan_EF_hand_dom	p.S195C	ENST00000325874.8	37	c.584	CCDS11267.1	17	.	.	.	.	.	.	.	.	.	.	C	6.935	0.542257	0.13250	.	.	ENSG00000131242	ENST00000325874;ENST00000394744	.	.	.	5.74	5.74	0.90152	.	0.245511	0.43416	D	0.000564	T	0.48277	0.1491	L	0.42245	1.32	0.37399	D	0.912757	P;P	0.45348	0.739;0.856	B;B	0.42555	0.391;0.371	T	0.52403	-0.8580	8	.	.	.	-14.0459	15.4191	0.74997	0.0:1.0:0.0:0.0	.	93;195	Q86YS3-2;Q86YS3	.;RFIP4_HUMAN	C	195	.	.	S	+	2	0	RAB11FIP4	26872324	1.000000	0.71417	0.514000	0.27761	0.074000	0.17049	6.411000	0.73298	2.707000	0.92482	0.655000	0.94253	TCC	RAB11FIP4	-	NULL	ENSG00000131242		0.587	RAB11FIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11FIP4	HGNC	protein_coding	OTTHUMT00000256195.2	-	0.00	99	0	C	NM_032932		29848204	+1	tier1	-	no_errors	ENST00000325874	ensembl	human	known	74_37	missense	13.73	88	14	SNP	0.691	G
RGPD3	653489	genome.wustl.edu	37	2	107073461	107073461	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:107073461A>T	ENST00000409886.3	-	4	458	c.371T>A	c.(370-372)cTt>cAt	p.L124H	RGPD3_ENST00000304514.7_Missense_Mutation_p.L124H	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	124					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCCTGGGAAAAGTTTTGCTGC	0.333																																																	0													137.0	122.0	126.0					2																	107073461		692	1591	2283	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.371T>A	2.37:g.107073461A>T	ENSP00000386588:p.Leu124His		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.L124H	ENST00000409886.3	37	c.371	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	13.03	2.114445	0.37339	.	.	ENSG00000153165	ENST00000409886;ENST00000304514;ENST00000440524	T;T	0.49720	0.77;0.77	2.59	2.59	0.31030	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.63873	0.2548	M	0.72894	2.215	0.31333	N	0.684548	D	0.71674	0.998	D	0.83275	0.996	T	0.65344	-0.6191	9	0.87932	D	0	-16.4748	8.687	0.34243	1.0:0.0:0.0:0.0	.	124	A6NKT7	RGPD3_HUMAN	H	124;124;67	ENSP00000386588:L124H;ENSP00000303659:L124H	ENSP00000303659:L124H	L	-	2	0	RGPD3	106439893	1.000000	0.71417	1.000000	0.80357	0.399000	0.30720	3.992000	0.56980	1.181000	0.42912	0.156000	0.16432	CTT	RGPD3	-	NULL	ENSG00000153165		0.333	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	-	0.00	288	0	A	XM_929931		107073461	-1	tier1	-	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	19.27	351	84	SNP	1.000	T
RHBG	57127	genome.wustl.edu	37	1	156347811	156347811	+	Silent	SNP	C	C	T	rs76801898		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:156347811C>T	ENST00000368249.1	+	3	443	c.405C>T	c.(403-405)gcC>gcT	p.A135A	RHBG_ENST00000451864.2_Silent_p.A66A|RHBG_ENST00000255013.3_Silent_p.A66A|RHBG_ENST00000400992.2_Silent_p.A66A|RHBG_ENST00000537040.1_Intron|RHBG_ENST00000368246.2_Silent_p.A135A	NM_001256396.1|NM_020407.4	NP_001243325.1|NP_065140.3	Q9H310	RHBG_HUMAN	Rh family, B glycoprotein (gene/pseudogene)	135					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	anchored component of plasma membrane (GO:0046658)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|spectrin-associated cytoskeleton (GO:0014731)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(3)|skin(2)|stomach(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GTGCGGGGGCCGTGCTCATCT	0.612																																																	0								C		0,4122		0,0,2061	65.0	68.0	67.0		405	-6.1	0.4	1	dbSNP_131	67	2,8414		0,2,4206	no	coding-synonymous	RHBG	NM_020407.3		0,2,6267	TT,TC,CC		0.0238,0.0,0.016		135/459	156347811	2,12536	2061	4208	6269	SO:0001819	synonymous_variant	0			AF193807		1q22	2013-05-22	2009-01-22		ENSG00000132677	ENSG00000132677		"""Solute carriers"""	14572	protein-coding gene	gene with protein product		607079	"""Rhesus blood group, B glycoprotein"""			10852913	Standard	NM_020407		Approved	SLC42A2	uc010pho.3	Q9H310	OTTHUMG00000024057	ENST00000368249.1:c.405C>T	1.37:g.156347811C>T			A8K475|Q5SZW4|Q5SZW6|Q5SZW7|Q6P193|Q6YJI2|Q6YJI3	Silent	SNP	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	p.A135	ENST00000368249.1	37	c.405		1																																																																																			RHBG	-	pfam_NH4_transpt_AmtB-like_dom,superfamily_NH4_transpt_AmtB-like_dom,prints_RhesusRHD	ENSG00000132677		0.612	RHBG-001	NOVEL	basic	protein_coding	RHBG	HGNC	protein_coding	OTTHUMT00000060589.2	-	0.00	72	0	C	NM_001256395		156347811	+1	tier1	-	no_errors	ENST00000368246	ensembl	human	known	74_37	silent	21.43	55	15	SNP	0.473	T
RNF113A	7737	genome.wustl.edu	37	X	119005267	119005267	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:119005267G>A	ENST00000371442.2	-	1	524	c.310C>T	c.(310-312)Cgt>Tgt	p.R104C	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	104							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						TTCGCCGAACGGGTGGATTTA	0.557																																																	0													164.0	166.0	166.0					X																	119005267		2203	4300	6503	SO:0001583	missense	0			X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.310C>T	X.37:g.119005267G>A	ENSP00000360497:p.Arg104Cys		B2RBR7	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.R104C	ENST00000371442.2	37	c.310	CCDS14589.1	X	.	.	.	.	.	.	.	.	.	.	G	23.7	4.445913	0.84101	.	.	ENSG00000125352	ENST00000371442	T	0.35789	1.29	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.73817	-0.3863	10	0.87932	D	0	0.3625	15.7553	0.78018	0.0:0.0:1.0:0.0	.	104	O15541	R113A_HUMAN	C	104	ENSP00000360497:R104C	ENSP00000360497:R104C	R	-	1	0	RNF113A	118889295	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.896000	0.56266	2.318000	0.78349	0.600000	0.82982	CGT	RNF113A	-	NULL	ENSG00000125352		0.557	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF113A	HGNC	protein_coding	OTTHUMT00000058071.1	-	0.00	21	0	G	NM_006978		119005267	-1	tier1	-	no_errors	ENST00000371442	ensembl	human	known	74_37	missense	59.09	9	13	SNP	1.000	A
RNFT2	84900	genome.wustl.edu	37	12	117187991	117187991	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:117187991C>T	ENST00000257575.4	+	4	662	c.429C>T	c.(427-429)gaC>gaT	p.D143D	RNFT2_ENST00000407967.3_Silent_p.D143D|RNFT2_ENST00000319176.7_Silent_p.D143D|RNFT2_ENST00000392549.2_Silent_p.D143D			Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2	143						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AGGGAGGCGACGAGCAGCCTG	0.697																																																	0													19.0	13.0	15.0					12																	117187991		2198	4293	6491	SO:0001819	synonymous_variant	0			AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000257575.4:c.429C>T	12.37:g.117187991C>T			E9PAM7|Q96SU5	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.D143	ENST00000257575.4	37	c.429	CCDS44987.1	12																																																																																			RNFT2	-	NULL	ENSG00000135119		0.697	RNFT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	HGNC	protein_coding	OTTHUMT00000320417.1	-	0.00	72	0	C	NM_032814		117187991	+1	tier1	-	no_errors	ENST00000257575	ensembl	human	known	74_37	silent	29.63	38	16	SNP	0.891	T
ROBO2	6092	genome.wustl.edu	37	3	77681664	77681664	+	Intron	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:77681664A>G	ENST00000461745.1	+	24	4660				ROBO2_ENST00000487694.3_Intron|ROBO2_ENST00000332191.8_Missense_Mutation_p.D1267G	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TCTGATGAGGATCGTAACTTT	0.423																																																	0																																										SO:0001627	intron_variant	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3761-2357A>G	3.37:g.77681664A>G			O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D1267G	ENST00000461745.1	37	c.3800	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126321	0.56721	.	.	ENSG00000185008	ENST00000332191	T	0.66995	-0.24	5.49	5.49	0.81192	.	.	.	.	.	T	0.62514	0.2434	.	.	.	0.09310	N	0.999995	P	0.40731	0.728	B	0.41764	0.366	T	0.68074	-0.5505	7	0.30078	T	0.28	.	15.887	0.79258	1.0:0.0:0.0:0.0	.	1267	F8W703	.	G	1267	ENSP00000327536:D1267G	ENSP00000327536:D1267G	D	+	2	0	ROBO2	77764354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.055000	0.76656	2.208000	0.71279	0.533000	0.62120	GAT	ROBO2	-	NULL	ENSG00000185008		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	-	0.00	84	0	A	XM_031246		77681664	+1	tier1	-	no_errors	ENST00000332191	ensembl	human	novel	74_37	missense	32.20	40	19	SNP	1.000	G
RPL10L	140801	genome.wustl.edu	37	14	47120380	47120380	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:47120380T>C	ENST00000298283.3	-	1	648	c.560A>G	c.(559-561)aAg>aGg	p.K187R		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	187					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						GAGGCACTTCTTGGCCACCAT	0.507																																																	0													97.0	92.0	94.0					14																	47120380		2203	4300	6503	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.560A>G	14.37:g.47120380T>C	ENSP00000298283:p.Lys187Arg		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.K187R	ENST00000298283.3	37	c.560	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	T	6.449	0.450912	0.12223	.	.	ENSG00000165496	ENST00000298283	T	0.72505	-0.66	4.57	-2.3	0.06785	.	1.060260	0.07296	N	0.873259	T	0.52885	0.1762	N	0.16656	0.425	0.09310	N	0.999995	B	0.06786	0.001	B	0.13407	0.009	T	0.45396	-0.9264	10	0.59425	D	0.04	-2.1675	9.1049	0.36692	0.0:0.08:0.5456:0.3744	.	187	Q96L21	RL10L_HUMAN	R	187	ENSP00000298283:K187R	ENSP00000298283:K187R	K	-	2	0	RPL10L	46190130	0.730000	0.28100	0.008000	0.14137	0.013000	0.08279	1.271000	0.33098	-0.364000	0.08088	-0.316000	0.08728	AAG	RPL10L	-	pirsf_Ribosomal_L10e	ENSG00000165496		0.507	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	-	0.00	64	0	T			47120380	-1	tier1	-	no_errors	ENST00000298283	ensembl	human	known	74_37	missense	25.29	65	22	SNP	0.188	C
RPLP1	6176	genome.wustl.edu	37	15	69745321	69745321	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:69745321T>C	ENST00000260379.6	+	1	199	c.34T>C	c.(34-36)Tcg>Ccg	p.S12P	RPLP1_ENST00000357790.5_Missense_Mutation_p.S12P|RPLP1_ENST00000560274.1_Missense_Mutation_p.S12P	NM_001003.2	NP_000994.1	P05386	RLA1_HUMAN	ribosomal protein, large, P1	12					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			ovary(1)	1						CTGCATCTACTCGGCCCTCAT	0.692																																																	0													12.0	10.0	11.0					15																	69745321		2189	4278	6467	SO:0001583	missense	0				CCDS10233.1, CCDS10234.1	15q22	2011-07-29			ENSG00000137818	ENSG00000137818		"""L ribosomal proteins"""	10372	protein-coding gene	gene with protein product		180520					Standard	NM_001003		Approved	LP1	uc002asd.1	P05386	OTTHUMG00000133359	ENST00000260379.6:c.34T>C	15.37:g.69745321T>C	ENSP00000346037:p.Ser12Pro		A6NIB2	Missense_Mutation	SNP	pfam_Ribosomal_L10/L12	p.S12P	ENST00000260379.6	37	c.34	CCDS10233.1	15	.	.	.	.	.	.	.	.	.	.	T	17.33	3.363308	0.61513	.	.	ENSG00000137818	ENST00000260379;ENST00000357790	.	.	.	4.67	4.67	0.58626	.	0.063404	0.64402	D	0.000004	T	0.61899	0.2384	M	0.85542	2.76	0.26966	N	0.965706	P;B	0.51791	0.948;0.03	P;B	0.51487	0.671;0.067	T	0.63102	-0.6712	9	0.87932	D	0	.	12.1136	0.53854	0.0:0.0:0.0:1.0	.	12;12	A6NIB2;P05386	.;RLA1_HUMAN	P	12	.	ENSP00000346037:S12P	S	+	1	0	RPLP1	67532375	1.000000	0.71417	0.998000	0.56505	0.375000	0.29983	2.797000	0.47877	1.956000	0.56807	0.455000	0.32223	TCG	RPLP1	-	NULL	ENSG00000137818		0.692	RPLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPLP1	HGNC	protein_coding	OTTHUMT00000257195.2	-	0.00	57	0	T	NM_001003		69745321	+1	tier1	-	no_errors	ENST00000260379	ensembl	human	known	74_37	missense	18.33	49	11	SNP	1.000	C
SCN3A	6328	genome.wustl.edu	37	2	165948863	165948863	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:165948863T>G	ENST00000360093.3	-	27	5199	c.4708A>C	c.(4708-4710)Act>Cct	p.T1570P	SCN3A_ENST00000465043.1_5'UTR|SCN3A_ENST00000283254.7_Missense_Mutation_p.T1570P|SCN3A_ENST00000409101.3_Missense_Mutation_p.T1521P|SCN3A_ENST00000540861.1_Missense_Mutation_p.T53P|AC013463.2_ENST00000431341.1_RNA	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	1570					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATTCTCCAGTGAACAGAACA	0.468																																																	0													162.0	133.0	143.0					2																	165948863		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.4708A>C	2.37:g.165948863T>G	ENSP00000353206:p.Thr1570Pro		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.T1570P	ENST00000360093.3	37	c.4708		2	.	.	.	.	.	.	.	.	.	.	T	27.2	4.811735	0.90707	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000540861	D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.99619	0.9861	H	0.98664	4.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.996;0.997;0.975	D	0.97567	1.0102	10	0.87932	D	0	.	16.4053	0.83662	0.0:0.0:0.0:1.0	.	1521;1521;1570	Q9NY46-2;Q9NY46-4;Q9NY46-3	.;.;.	P	1570;1570;1521;53	ENSP00000353206:T1570P;ENSP00000283254:T1570P;ENSP00000386726:T1521P;ENSP00000439920:T53P	ENSP00000283254:T1570P	T	-	1	0	SCN3A	165657109	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.997000	0.88414	2.333000	0.79357	0.482000	0.46254	ACT	SCN3A	-	pfam_Ion_trans_dom	ENSG00000153253		0.468	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	82	0	T	NM_006922		165948863	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	34.91	69	37	SNP	1.000	G
SDCCAG3	10807	genome.wustl.edu	37	9	139299575	139299575	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:139299575G>T	ENST00000357365.3	-	7	1102	c.973C>A	c.(973-975)Cag>Aag	p.Q325K	SDCCAG3_ENST00000371725.3_Missense_Mutation_p.Q252K|SDCCAG3_ENST00000461693.1_5'UTR|SDCCAG3_ENST00000298537.7_Missense_Mutation_p.Q302K	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	325						cytoplasm (GO:0005737)				NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		TCCACCTGCTGAACCACCGAC	0.532																																																	0													99.0	101.0	100.0					9																	139299575		1980	4159	6139	SO:0001583	missense	0			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.973C>A	9.37:g.139299575G>T	ENSP00000349929:p.Gln325Lys		A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Missense_Mutation	SNP	NULL	p.Q325K	ENST00000357365.3	37	c.973	CCDS43904.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.83|18.83	3.707876|3.707876	0.68615|0.68615	.|.	.|.	ENSG00000165689|ENSG00000165689	ENST00000417512|ENST00000357365;ENST00000298537;ENST00000371725	.|T;T;T	.|0.75154	.|1.91;-0.91;1.91	4.53|4.53	4.53|4.53	0.55603|0.55603	.|.	.|0.137350	.|0.49305	.|D	.|0.000148	D|D	0.83083|0.83083	0.5177|0.5177	M|M	0.72894|0.72894	2.215|2.215	0.48762|0.48762	D|D	0.999704|0.999704	.|D;D;D	.|0.62365	.|0.991;0.984;0.991	.|P;P;P	.|0.58820	.|0.846;0.846;0.846	D|D	0.85372|0.85372	0.1114|0.1114	5|10	.|0.59425	.|D	.|0.04	-23.343|-23.343	16.6255|16.6255	0.84969|0.84969	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|252;302;325	.|Q96C92-4;Q96C92-2;Q96C92	.|.;.;SDCG3_HUMAN	L|K	65|325;302;252	.|ENSP00000349929:Q325K;ENSP00000298537:Q302K;ENSP00000360790:Q252K	.|ENSP00000298537:Q302K	F|Q	-|-	3|1	2|0	SDCCAG3|SDCCAG3	138419396|138419396	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.310000|0.310000	0.27922|0.27922	5.924000|5.924000	0.70054|0.70054	2.218000|2.218000	0.71995|0.71995	0.563000|0.563000	0.77884|0.77884	TTC|CAG	SDCCAG3	-	NULL	ENSG00000165689		0.532	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCCAG3	HGNC	protein_coding	OTTHUMT00000055060.2	-	0.00	52	0	G	NM_006643		139299575	-1	tier1	-	no_errors	ENST00000357365	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.997	T
SDK1	221935	genome.wustl.edu	37	7	4188896	4188896	+	Missense_Mutation	SNP	C	C	T	rs368261349		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:4188896C>T	ENST00000404826.2	+	30	4565	c.4426C>T	c.(4426-4428)Cgg>Tgg	p.R1476W	SDK1_ENST00000389531.3_Missense_Mutation_p.R1476W	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1476					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GGTTGCAGAGCGGCCGGCACC	0.667																																																	0								C	TRP/ARG	0,4406		0,0,2203	19.0	23.0	22.0		4426	3.0	1.0	7		22	1,8599		0,1,4299	no	missense	SDK1	NM_152744.3	101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1476/2214	4188896	1,13005	2203	4300	6503	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4426C>T	7.37:g.4188896C>T	ENSP00000385899:p.Arg1476Trp		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1476W	ENST00000404826.2	37	c.4426	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977856	0.53720	0.0	1.16E-4	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.55234	0.53;0.53	5.06	3.03	0.35002	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000007	T	0.69771	0.3148	M	0.72118	2.19	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.971	T	0.71374	-0.4612	10	0.72032	D	0.01	.	13.4538	0.61187	0.3524:0.6476:0.0:0.0	.	1476;1476	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	W	1476	ENSP00000385899:R1476W;ENSP00000374182:R1476W	ENSP00000374182:R1476W	R	+	1	2	SDK1	4155422	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	3.672000	0.54583	0.358000	0.24211	0.563000	0.77884	CGG	SDK1	-	superfamily_Fibronectin_type3	ENSG00000146555		0.667	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	96	0	C	NM_152744		4188896	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	33.77	51	26	SNP	1.000	T
SEMG2	6407	genome.wustl.edu	37	20	43851408	43851408	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr20:43851408G>A	ENST00000372769.3	+	2	1225	c.1135G>A	c.(1135-1137)Gaa>Aaa	p.E379K		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	379	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				GATCCAAACTGAAGAGCAAAT	0.383																																																	0													77.0	73.0	74.0					20																	43851408		2203	4300	6503	SO:0001583	missense	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1135G>A	20.37:g.43851408G>A	ENSP00000361855:p.Glu379Lys		Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.E379K	ENST00000372769.3	37	c.1135	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922811	0.33908	.	.	ENSG00000124157	ENST00000372769	T	0.12984	2.63	1.05	-0.0612	0.13786	.	.	.	.	.	T	0.28067	0.0692	M	0.80616	2.505	0.09310	N	1	D;D;P	0.59767	0.975;0.986;0.951	P;P;P	0.59595	0.682;0.86;0.766	T	0.08932	-1.0698	9	0.46703	T	0.11	.	4.828	0.13427	0.0:0.3972:0.6028:0.0	.	379;379;379	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	K	379	ENSP00000361855:E379K	ENSP00000361855:E379K	E	+	1	0	SEMG2	43284822	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.069000	0.11542	-0.010000	0.14271	-0.688000	0.03733	GAA	SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.383	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	-	0.00	21	0	G	NM_003008		43851408	+1	tier1	-	no_errors	ENST00000372769	ensembl	human	known	74_37	missense	50.00	20	20	SNP	0.000	A
SHISA9	729993	genome.wustl.edu	37	16	12996200	12996200	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:12996200C>T	ENST00000424107.3	+	1	724	c.279C>T	c.(277-279)ggC>ggT	p.G93G	SHISA9_ENST00000558318.1_Silent_p.G134G|SHISA9_ENST00000558583.1_Silent_p.G134G|SHISA9_ENST00000423335.2_Silent_p.G93G			B4DS77	SHSA9_HUMAN	shisa family member 9	93					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						GCAGCTCGGGCGACTTCATCT	0.647																																																	0													34.0	34.0	34.0					16																	12996200		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.279C>T	16.37:g.12996200C>T			C9J314|C9JCE9	Silent	SNP	NULL	p.G134	ENST00000424107.3	37	c.402	CCDS45417.2	16																																																																																			SHISA9	-	NULL	ENSG00000237515		0.647	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	-	0.00	63	0	C	NM_001145204		12996200	+1	tier1	-	no_errors	ENST00000558583	ensembl	human	known	74_37	silent	32.08	36	17	SNP	1.000	T
SI	6476	genome.wustl.edu	37	3	164712164	164712164	+	Silent	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:164712164A>C	ENST00000264382.3	-	41	4784	c.4722T>G	c.(4720-4722)acT>acG	p.T1574T		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1574	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTTCAGCAAAAGTTTCATTCC	0.318										HNSCC(35;0.089)																																							0													105.0	110.0	109.0					3																	164712164		2203	4300	6503	SO:0001819	synonymous_variant	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4722T>G	3.37:g.164712164A>C			A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.T1574	ENST00000264382.3	37	c.4722	CCDS3196.1	3																																																																																			SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.318	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	47	0	A	NM_001041		164712164	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	silent	48.28	15	14	SNP	0.064	C
SIAE	54414	genome.wustl.edu	37	11	124530643	124530643	+	Nonsense_Mutation	SNP	C	C	A	rs375087861		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:124530643C>A	ENST00000263593.3	-	3	458	c.286G>T	c.(286-288)Gaa>Taa	p.E96*	SIAE_ENST00000545756.1_Nonsense_Mutation_p.E61*			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	96					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)	p.E96K(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		GCCATCACTTCGAAAGGTCCT	0.438																																																	1	Substitution - Missense(1)	large_intestine(1)											208.0	199.0	202.0					11																	124530643		2201	4299	6500	SO:0001587	stop_gained	0			AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.286G>T	11.37:g.124530643C>A	ENSP00000263593:p.Glu96*		B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Nonsense_Mutation	SNP	pfam_DUF303_acetylest	p.E96*	ENST00000263593.3	37	c.286	CCDS8449.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.688842	0.96784	.	.	ENSG00000110013	ENST00000263593;ENST00000545756	.	.	.	5.94	3.77	0.43336	.	0.593501	0.18116	N	0.151200	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	-16.6786	5.1604	0.15058	0.1625:0.6164:0.0:0.221	.	.	.	.	X	96;61	.	ENSP00000263593:E96X	E	-	1	0	SIAE	124035853	0.001000	0.12720	0.903000	0.35520	0.936000	0.57629	-0.032000	0.12266	1.522000	0.49001	0.591000	0.81541	GAA	SIAE	-	NULL	ENSG00000110013		0.438	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAE	HGNC	protein_coding	OTTHUMT00000387070.1	-	0.00	51	0	C	NM_170601		124530643	-1	tier1	-	no_errors	ENST00000263593	ensembl	human	known	74_37	nonsense	33.33	42	21	SNP	0.342	A
SLC27A6	28965	genome.wustl.edu	37	5	128302146	128302146	+	Missense_Mutation	SNP	G	G	A	rs376879906		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:128302146G>A	ENST00000262462.4	+	1	1326	c.316G>A	c.(316-318)Gac>Aac	p.D106N	SLC27A6_ENST00000395266.1_Missense_Mutation_p.D106N|SLC27A6_ENST00000506176.1_Missense_Mutation_p.D106N			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	106					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GAAAAAGGGGGACACGGTGGC	0.537																																																	0													81.0	68.0	73.0					5																	128302146		2203	4300	6503	SO:0001583	missense	0			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.316G>A	5.37:g.128302146G>A	ENSP00000262462:p.Asp106Asn		Q6IAM5|Q7Z6E6|Q86YF6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.D106N	ENST00000262462.4	37	c.316	CCDS4145.1	5	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387634	0.82902	.	.	ENSG00000113396	ENST00000262462;ENST00000395266;ENST00000506176	T;T;T	0.59906	0.23;0.23;0.23	4.18	4.18	0.49190	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.82365	0.5021	H	0.94698	3.57	0.58432	D	0.999999	D	0.76494	0.999	D	0.79784	0.993	D	0.87143	0.2204	10	0.56958	D	0.05	-5.8783	17.8141	0.88625	0.0:0.0:1.0:0.0	.	106	Q9Y2P4	S27A6_HUMAN	N	106	ENSP00000262462:D106N;ENSP00000378684:D106N;ENSP00000421024:D106N	ENSP00000262462:D106N	D	+	1	0	SLC27A6	128330045	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	8.984000	0.93482	2.623000	0.88846	0.561000	0.74099	GAC	SLC27A6	-	pfam_AMP-dep_Synth/Lig	ENSG00000113396		0.537	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A6	HGNC	protein_coding	OTTHUMT00000250980.1		0.00	79	0	G	NM_014031		128302146	+1			no_errors	ENST00000262462	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	A
SLC4A9	83697	genome.wustl.edu	37	5	139740344	139740344	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:139740344C>T	ENST00000230993.6	+	2	285	c.250C>T	c.(250-252)Ctg>Ttg	p.L84L	CTC-329D1.3_ENST00000520443.1_RNA|SLC4A9_ENST00000506545.1_Intron|SLC4A9_ENST00000506757.2_Intron|SLC4A9_ENST00000432095.2_Intron|SLC4A9_ENST00000507527.1_Silent_p.L84L	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	84					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCTCTGCTCCTGGACATGGG	0.582																																																	0																																										SO:0001819	synonymous_variant	0			AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.250C>T	5.37:g.139740344C>T			B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Silent	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.L84	ENST00000230993.6	37	c.250	CCDS58973.1	5																																																																																			SLC4A9	-	superfamily_PTrfase/Anion_transptr	ENSG00000113073		0.582	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	HGNC	protein_coding	OTTHUMT00000372823.1	-	0.00	79	0	C	NM_031467		139740344	+1	tier1	-	no_errors	ENST00000230993	ensembl	human	known	74_37	silent	37.50	45	27	SNP	0.000	T
SLC6A11	6538	genome.wustl.edu	37	3	10979946	10979946	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:10979946A>G	ENST00000254488.2	+	14	1823	c.1757A>G	c.(1756-1758)aAg>aGg	p.K586R		NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	586					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	AAACTCCAGAAGTTGACGACC	0.562																																																	0													101.0	94.0	96.0					3																	10979946		2203	4300	6503	SO:0001583	missense	0			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.1757A>G	3.37:g.10979946A>G	ENSP00000254488:p.Lys586Arg		B2R6U6|Q8IYC9	Missense_Mutation	SNP	pfam_Na/ntran_symport,superfamily_S-AdoMet_deCO2ase_core,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT3	p.K586R	ENST00000254488.2	37	c.1757	CCDS2602.1	3	.	.	.	.	.	.	.	.	.	.	A	5.236	0.228978	0.09916	.	.	ENSG00000132164	ENST00000254488	T	0.74632	-0.86	4.81	3.64	0.41730	.	0.000000	0.85682	D	0.000000	T	0.59238	0.2179	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.49551	-0.8928	10	0.25106	T	0.35	.	10.7275	0.46077	0.6938:0.3062:0.0:0.0	.	586	P48066	S6A11_HUMAN	R	586	ENSP00000254488:K586R	ENSP00000254488:K586R	K	+	2	0	SLC6A11	10954946	1.000000	0.71417	0.987000	0.45799	0.086000	0.17979	3.836000	0.55813	0.694000	0.31654	-0.291000	0.09656	AAG	SLC6A11	-	NULL	ENSG00000132164		0.562	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A11	HGNC	protein_coding	OTTHUMT00000251927.1	-	0.00	47	0	A	NM_014229		10979946	+1	tier1	-	no_errors	ENST00000254488	ensembl	human	known	74_37	missense	28.26	33	13	SNP	1.000	G
SLC9A7P1	121456	genome.wustl.edu	37	12	98849120	98849120	+	RNA	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:98849120G>A	ENST00000554295.1	-	0	1803					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		CTGTACCACCGCCTGAATATC	0.547																																																	0																																												0					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98849120G>A				RNA	SNP	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-	ENSG00000227825		0.547	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	-	0.00	79	0	G			98849120	-1	tier1	-	no_errors	ENST00000554295	ensembl	human	putative	74_37	rna	36.59	52	30	SNP	0.752	A
SLIT3	6586	genome.wustl.edu	37	5	168149269	168149269	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr5:168149269C>T	ENST00000519560.1	-	23	2894	c.2475G>A	c.(2473-2475)ctG>ctA	p.L825L	SLIT3_ENST00000332966.8_Silent_p.L825L|SLIT3_ENST00000404867.3_Silent_p.L825L|CTC-558O2.1_ENST00000522615.1_RNA	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	825					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ACAGCACTCGCAGGGACCGCA	0.562																																					Ovarian(29;311 847 10864 17279 24903)												0													148.0	126.0	134.0					5																	168149269		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2475G>A	5.37:g.168149269C>T			A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L825	ENST00000519560.1	37	c.2475	CCDS4369.1	5																																																																																			SLIT3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000184347		0.562	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	-	0.00	129	0	C	NM_003062		168149269	-1	tier1	-	no_errors	ENST00000519560	ensembl	human	known	74_37	silent	31.25	77	35	SNP	0.998	T
SMCO2	341346	genome.wustl.edu	37	12	27648657	27648657	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:27648657G>T	ENST00000535986.1	+	7	702	c.702G>T	c.(700-702)atG>atT	p.M234I	SMCO2_ENST00000538647.1_3'UTR|SMCO2_ENST00000298876.4_Missense_Mutation_p.M184I|SMCO2_ENST00000416383.1_Missense_Mutation_p.M234I			A6NFE2	SMCO2_HUMAN	single-pass membrane protein with coiled-coil domains 2	234						integral component of membrane (GO:0016021)											AGCTAAGGATGTATCAAATGG	0.428																																																	0													87.0	82.0	83.0					12																	27648657		682	1590	2272	SO:0001583	missense	0				CCDS44852.1	12p11.23	2013-03-11	2013-03-11	2013-03-11	ENSG00000165935	ENSG00000165935			34448	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 70"""	C12orf70			Standard	NM_001145010		Approved	LOC341346	uc010sjq.2	A6NFE2	OTTHUMG00000169205	ENST00000535986.1:c.702G>T	12.37:g.27648657G>T	ENSP00000441688:p.Met234Ile			Missense_Mutation	SNP	NULL	p.M234I	ENST00000535986.1	37	c.702	CCDS44852.1	12	.	.	.	.	.	.	.	.	.	.	G	9.671	1.146798	0.21288	.	.	ENSG00000165935	ENST00000298876;ENST00000416383;ENST00000535986	.	.	.	3.45	1.6	0.23607	.	0.447028	0.19568	N	0.111149	T	0.16385	0.0394	L	0.32530	0.975	0.09310	N	0.999997	P	0.38677	0.642	B	0.32149	0.141	T	0.10730	-1.0617	9	0.38643	T	0.18	-3.6096	4.2849	0.10850	0.1196:0.0:0.6564:0.2239	.	234	A6NFE2	CL070_HUMAN	I	184;234;234	.	ENSP00000298876:M184I	M	+	3	0	C12orf70	27539924	0.000000	0.05858	0.214000	0.23707	0.046000	0.14306	-0.109000	0.10840	0.448000	0.26722	-0.140000	0.14226	ATG	SMCO2	-	NULL	ENSG00000165935		0.428	SMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO2	HGNC	protein_coding	OTTHUMT00000402867.1	-	0.00	60	0	G	NM_001145010		27648657	+1	tier1	-	no_errors	ENST00000416383	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.344	T
SNURF	8926	genome.wustl.edu	37	15	25213158	25213158	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:25213158T>G	ENST00000577949.1	+	3	253	c.190T>G	c.(190-192)Tta>Gta	p.L64V	SNRPN_ENST00000390687.4_5'UTR|SNURF_ENST00000338094.6_Missense_Mutation_p.L64V|SNURF_ENST00000551312.2_Missense_Mutation_p.L64V|SNRPN_ENST00000346403.6_5'UTR|SNRPN_ENST00000400098.1_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNRPN_ENST00000400100.1_5'UTR|SNURF_ENST00000338327.4_Missense_Mutation_p.L64V|SNRPN_ENST00000577565.1_5'UTR			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	64						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		GCAGGCATTCTTAGCTGAGAC	0.468																																																	0													117.0	106.0	110.0					15																	25213158		2203	4300	6503	SO:0001583	missense	0				CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.190T>G	15.37:g.25213158T>G	ENSP00000463201:p.Leu64Val		A6NCW2	Missense_Mutation	SNP	pfam_SNURF	p.L64V	ENST00000577949.1	37	c.190	CCDS10016.1	15	.	.	.	.	.	.	.	.	.	.	T	13.95	2.390910	0.42410	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.52	2.41	0.29592	.	.	.	.	.	T	0.49490	0.1560	.	.	.	0.25147	N	0.990457	P	0.51057	0.941	P	0.60415	0.874	T	0.27706	-1.0066	7	0.33940	T	0.23	-1.632	5.5149	0.16900	0.0:0.1262:0.0:0.8738	.	64	Q9Y675	SNURF_HUMAN	V	64	.	ENSP00000336543:L64V	L	+	1	2	SNURF	22764251	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	1.136000	0.31467	0.725000	0.32318	0.533000	0.62120	TTA	SNURF	-	pfam_SNURF	ENSG00000273173		0.468	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SNURF	Uniprot_gn	protein_coding	OTTHUMT00000446300.1	-	0.00	82	0	T	NM_005678		25213158	+1	tier1	-	no_errors	ENST00000338094	ensembl	human	known	74_37	missense	42.05	51	37	SNP	0.999	G
SNHG14	104472715	genome.wustl.edu	37	15	25432688	25432688	+	RNA	SNP	G	G	A	rs372092312		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:25432688G>A	ENST00000424208.1	+	0	761				SNORD115-10_ENST00000365073.1_RNA|SNORD115-11_ENST00000363616.1_RNA|SNHG14_ENST00000414175.1_RNA|SNORD115-9_ENST00000362912.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GGGTTGGGTCGATGATGAGAA	0.537																																																	0								A		0,1752		0,0,876	363.0	362.0	362.0			-3.3	0.0	15		362	1,3981		0,1,1990	no	intergenic				0,1,2866	AA,AG,GG		0.0251,0.0,0.0174			25432688	1,5733	876	1991	2867			0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25432688G>A				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNORD115-10	-	-	ENSG00000201943		0.537	SNHG14-002	KNOWN	basic	antisense	SNORD115-10	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	157	0	G			25432688	+1	tier1	-	no_errors	ENST00000365073	ensembl	human	known	74_37	rna	33.53	111	56	SNP	0.000	A
SNX19	399979	genome.wustl.edu	37	11	130780030	130780030	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:130780030T>G	ENST00000265909.4	-	4	2486	c.1917A>C	c.(1915-1917)caA>caC	p.Q639H	SNX19_ENST00000533214.1_Missense_Mutation_p.Q639H|SNX19_ENST00000545537.1_5'UTR|SNX19_ENST00000534726.1_5'Flank|SNX19_ENST00000528555.1_Missense_Mutation_p.Q19H|SNX19_ENST00000533318.1_5'UTR|SNX19_ENST00000539184.1_Missense_Mutation_p.Q82H|SNX19_ENST00000530356.1_Missense_Mutation_p.Q19H	NM_014758.2	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	639	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(8)|ovary(3)|prostate(1)|skin(6)|urinary_tract(1)	35	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TGGCACAGAGTTGCTGCAAAA	0.463																																																	0													91.0	87.0	88.0					11																	130780030		2201	4297	6498	SO:0001583	missense	0			D87443	CCDS31721.1, CCDS73416.1	11q25	2010-04-20			ENSG00000120451	ENSG00000120451		"""Sorting nexins"""	21532	protein-coding gene	gene with protein product							Standard	NM_014758		Approved	KIAA0254, CHET8	uc001qgk.4	Q92543	OTTHUMG00000165663	ENST00000265909.4:c.1917A>C	11.37:g.130780030T>G	ENSP00000265909:p.Gln639His		E9PKB9|Q8IV55	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,superfamily_Phox,smart_PX_assoc_Snx13,smart_Phox,pfscan_Phox,pfscan_Phox_assoc	p.Q639H	ENST00000265909.4	37	c.1917	CCDS31721.1	11	.	.	.	.	.	.	.	.	.	.	T	21.5	4.156702	0.78114	.	.	ENSG00000120451	ENST00000265909;ENST00000528555;ENST00000530356;ENST00000539184;ENST00000533214	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.9	5.9	0.94986	Phox homologous domain (5);	0.147342	0.64402	D	0.000006	T	0.48223	0.1488	N	0.25245	0.725	0.80722	D	1	P;P;D	0.53312	0.887;0.929;0.959	B;P;P	0.59825	0.395;0.721;0.864	T	0.47983	-0.9074	10	0.49607	T	0.09	-16.3247	16.3317	0.83023	0.0:0.0:0.0:1.0	.	82;639;639	F5H5D1;E9PKB9;Q92543	.;.;SNX19_HUMAN	H	639;19;19;82;639	ENSP00000265909:Q639H;ENSP00000435122:Q19H;ENSP00000432307:Q19H;ENSP00000443480:Q82H;ENSP00000435390:Q639H	ENSP00000265909:Q639H	Q	-	3	2	SNX19	130285240	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.685000	0.54678	2.264000	0.75181	0.533000	0.62120	CAA	SNX19	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000120451		0.463	SNX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX19	HGNC	protein_coding	OTTHUMT00000385649.1	-	0.00	59	0	T	NM_014758		130780030	-1	tier1	-	no_errors	ENST00000265909	ensembl	human	known	74_37	missense	35.48	40	22	SNP	1.000	G
SPEG	10290	genome.wustl.edu	37	2	220315877	220315877	+	Silent	SNP	C	C	T	rs371768029		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:220315877C>T	ENST00000312358.7	+	5	2265	c.2133C>T	c.(2131-2133)taC>taT	p.Y711Y	SPEG_ENST00000396698.1_Silent_p.Y607Y|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396695.2_5'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	711					cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ATGACTCCTACGTGTCCGCTG	0.597																																																	0								C		0,3940		0,0,1970	109.0	111.0	111.0		2133	-0.9	1.0	2		111	1,8283		0,1,4141	no	coding-synonymous	SPEG	NM_005876.4		0,1,6111	TT,TC,CC		0.0121,0.0,0.0082		711/3268	220315877	1,12223	1970	4142	6112	SO:0001819	synonymous_variant	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2133C>T	2.37:g.220315877C>T			A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Y711	ENST00000312358.7	37	c.2133	CCDS42824.1	2																																																																																			SPEG	-	NULL	ENSG00000072195		0.597	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	-	0.00	75	0	C	NM_005876		220315877	+1	tier1	-	no_errors	ENST00000312358	ensembl	human	novel	74_37	silent	28.79	47	19	SNP	0.991	T
SREBF1	6720	genome.wustl.edu	37	17	17718011	17718011	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:17718011G>A	ENST00000261646.5	-	15	2837	c.2653C>T	c.(2653-2655)Cac>Tac	p.H885Y	SREBF1_ENST00000395757.1_Missense_Mutation_p.H631Y|SREBF1_ENST00000338854.5_Missense_Mutation_p.H885Y|SREBF1_ENST00000355815.4_Missense_Mutation_p.H915Y|MIR33B_ENST00000385104.1_RNA	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	885					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CGCAGCCAGTGGATCACCACA	0.677																																																	0													17.0	17.0	17.0					17																	17718011		2190	4296	6486	SO:0001583	missense	0			BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2653C>T	17.37:g.17718011G>A	ENSP00000261646:p.His885Tyr		B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.H915Y	ENST00000261646.5	37	c.2743	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.45|14.45	2.537833|2.537833	0.45176|0.45176	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161|ENST00000395751	T;T;T;T|.	0.16897|.	2.31;2.31;2.31;2.31|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	0.055071|.	0.64402|.	D|.	0.000001|.	T|T	0.60379|0.60379	0.2264|0.2264	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	P;P;B|.	0.39352|.	0.539;0.669;0.203|.	B;B;B|.	0.38056|.	0.135;0.264;0.09|.	T|T	0.55742|0.55742	-0.8093|-0.8093	10|5	0.18710|.	T|.	0.47|.	-30.5452|-30.5452	14.1829|14.1829	0.65586|0.65586	0.0:0.0:0.8502:0.1498|0.0:0.0:0.8502:0.1498	.|.	885;915;504|.	P36956;P36956-4;A8MTU8|.	SRBP1_HUMAN;.;.|.	Y|L	885;915;885;631;504;722;811|892	ENSP00000345822:H885Y;ENSP00000348069:H915Y;ENSP00000261646:H885Y;ENSP00000379106:H631Y|.	ENSP00000261646:H885Y|.	H|P	-|-	1|2	0|0	SREBF1|SREBF1	17658736|17658736	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	3.874000|3.874000	0.56101|0.56101	2.658000|2.658000	0.90341|0.90341	0.550000|0.550000	0.68814|0.68814	CAC|CCA	SREBF1	-	NULL	ENSG00000072310		0.677	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	-	0.00	37	0	G	NM_004176		17718011	-1	tier1	-	no_errors	ENST00000355815	ensembl	human	known	74_37	missense	75.00	4	12	SNP	1.000	A
SRRM2	23524	genome.wustl.edu	37	16	2814390	2814390	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:2814390C>T	ENST00000301740.8	+	11	4410	c.3861C>T	c.(3859-3861)agC>agT	p.S1287S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1287	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TTGATCAGAGCCAGTCACAGG	0.438																																																	0													118.0	124.0	122.0					16																	2814390		2198	4300	6498	SO:0001819	synonymous_variant	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3861C>T	16.37:g.2814390C>T			A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	pfam_mRNA_splic_Cwf21	p.S1287	ENST00000301740.8	37	c.3861	CCDS32373.1	16																																																																																			SRRM2	-	NULL	ENSG00000167978		0.438	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	25	0	C			2814390	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	silent	37.84	23	14	SNP	0.000	T
SRRM3	222183	genome.wustl.edu	37	7	75915131	75915131	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:75915131C>T	ENST00000326382.8	+	0	2139				SRRM3_ENST00000388802.4_Missense_Mutation_p.R645W|RN7SL212P_ENST00000583729.1_RNA	NM_001110199.1	NP_001103669.1	A6NNA2	SRRM3_HUMAN	serine/arginine repetitive matrix 3											NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)	8						CTACCACAGCCGGAGCAGCTC	0.716																																																	0													5.0	9.0	8.0					7																	75915131		1357	3205	4562	SO:0001624	3_prime_UTR_variant	0			AK092590		7q11.23	2014-02-12			ENSG00000177679	ENSG00000177679			26729	protein-coding gene	gene with protein product							Standard	NM_001291831		Approved	FLJ37078	uc010ldi.2	A6NNA2	OTTHUMG00000130489	ENST00000326382.8:c.*138C>T	7.37:g.75915131C>T			A6ND75	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R645W	ENST00000326382.8	37	c.1933		7	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150491	0.37923	.	.	ENSG00000177679	ENST00000388802	.	.	.	4.1	3.2	0.36748	.	0.000000	0.38720	N	0.001598	T	0.69967	0.3170	.	.	.	0.46478	D	0.999063	D	0.71674	0.998	P	0.62491	0.903	T	0.71935	-0.4442	8	0.66056	D	0.02	.	10.1537	0.42809	0.2006:0.7994:0.0:0.0	.	645	F5GYC8	.	W	645	.	ENSP00000373454:R645W	R	+	1	2	SRRM3	75753067	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.006000	0.29847	0.911000	0.36747	0.462000	0.41574	CGG	SRRM3	-	NULL	ENSG00000177679		0.716	SRRM3-001	KNOWN	basic	protein_coding	SRRM3	HGNC	protein_coding	OTTHUMT00000252889.2	-	0.00	59	0	C	NM_001110199		75915131	+1	tier1	-	no_errors	ENST00000388802	ensembl	human	known	74_37	missense	37.84	46	28	SNP	1.000	T
STAMBP	10617	genome.wustl.edu	37	2	74071769	74071769	+	Intron	SNP	G	G	A	rs138606897	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:74071769G>A	ENST00000394070.2	+	3	706				STAMBP_ENST00000339566.3_Intron|STAMBP_ENST00000536064.1_Intron|STAMBP_ENST00000409707.1_Intron|STAMBP_ENST00000394073.1_Intron	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein						JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						GGCTCTTTAGGGGGATAGAGA	0.473																																																	0																																										SO:0001627	intron_variant	0			BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.204-171G>A	2.37:g.74071769G>A			B5M0B6|D6W5H7|Q3MJE7	RNA	SNP	-	NULL	ENST00000394070.2	37	NULL	CCDS1929.1	2																																																																																			STAMBP	-	-	ENSG00000124356		0.473	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBP	HGNC	protein_coding	OTTHUMT00000252048.2	-	0.00	21	0	G	NM_006463		74071769	+1	tier1	-	no_errors	ENST00000478946	ensembl	human	putative	74_37	rna	30.77	9	4	SNP	0.000	A
STARD9	57519	genome.wustl.edu	37	15	42981481	42981481	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:42981481G>T	ENST00000290607.7	+	23	7762	c.7705G>T	c.(7705-7707)Gtg>Ttg	p.V2569L		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	2569					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TCATGACTTTGTGGCCAGGGG	0.517																																																	0													54.0	51.0	52.0					15																	42981481		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.7705G>T	15.37:g.42981481G>T	ENSP00000290607:p.Val2569Leu		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V2569L	ENST00000290607.7	37	c.7705	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	G	13.15	2.149852	0.37923	.	.	ENSG00000159433	ENST00000290607	T	0.66638	-0.22	5.66	0.134	0.14771	.	0.756565	0.11621	N	0.545739	T	0.60157	0.2247	L	0.46157	1.445	0.09310	N	1	.	.	.	.	.	.	T	0.55648	-0.8108	8	0.72032	D	0.01	.	4.9335	0.13928	0.2502:0.2894:0.4604:0.0	.	.	.	.	L	2569	ENSP00000290607:V2569L	ENSP00000290607:V2569L	V	+	1	0	STARD9	40768773	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.828000	0.27435	0.328000	0.23435	0.557000	0.71058	GTG	STARD9	-	NULL	ENSG00000159433		0.517	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1		0.00	41	0	G			42981481	+1			no_errors	ENST00000290607	ensembl	human	known	74_37	missense	11.76	30	4	SNP	0.000	T
STARD9	57519	genome.wustl.edu	37	15	42987387	42987387	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr15:42987387T>G	ENST00000290607.7	+	25	13069	c.13012T>G	c.(13012-13014)Ttg>Gtg	p.L4338V		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	4338					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						TGACATAGAGTTGATGCTGCA	0.582																																																	0													110.0	92.0	98.0					15																	42987387		692	1590	2282	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.13012T>G	15.37:g.42987387T>G	ENSP00000290607:p.Leu4338Val		Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L4338V	ENST00000290607.7	37	c.13012	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889795	0.52014	.	.	ENSG00000159433	ENST00000290607	T	0.46819	0.86	5.77	1.29	0.21616	.	.	.	.	.	T	0.33498	0.0865	L	0.39566	1.225	0.33001	D	0.52623	B	0.32653	0.379	B	0.26517	0.07	T	0.40942	-0.9536	9	0.52906	T	0.07	.	7.8114	0.29232	0.1074:0.593:0.2325:0.0671	.	4252	Q9P2P6	STAR9_HUMAN	V	4338	ENSP00000290607:L4338V	ENSP00000290607:L4338V	L	+	1	2	STARD9	40774679	1.000000	0.71417	0.915000	0.36163	0.752000	0.42762	1.661000	0.37408	0.331000	0.23511	-0.232000	0.12228	TTG	STARD9	-	NULL	ENSG00000159433		0.582	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	-	0.00	43	0	T			42987387	+1	tier1	-	no_errors	ENST00000290607	ensembl	human	known	74_37	missense	62.96	10	17	SNP	1.000	G
STOX2	56977	genome.wustl.edu	37	4	184932575	184932575	+	Splice_Site	SNP	C	C	T	rs201760642		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr4:184932575C>T	ENST00000308497.4	+	3	4019	c.2584C>T	c.(2584-2586)Cgt>Tgt	p.R862C	STOX2_ENST00000438269.1_Splice_Site_p.R862W	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	862					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		CAACTCCCCACGGTAGGGAGA	0.552																																																	0								C	CYS/ARG	0,4298		0,0,2149	54.0	61.0	59.0		2584	5.7	1.0	4		59	5,8503		0,5,4249	yes	missense-near-splice	STOX2	NM_020225.1	180	0,5,6398	TT,TC,CC		0.0588,0.0,0.039	probably-damaging	862/927	184932575	5,12801	2149	4254	6403	SO:0001630	splice_region_variant	0			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.2585+1C>T	4.37:g.184932575C>T			A6H8U4|Q9NPS8	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.R862C	ENST00000308497.4	37	c.2584	CCDS47167.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.6|27.6	4.846559|4.846559	0.91277|0.91277	0.0|0.0	5.88E-4|5.88E-4	ENSG00000173320|ENSG00000173320	ENST00000308497|ENST00000438269	D|D	0.83335|0.85258	-1.71|-1.96	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	D|D	0.89399|0.89399	0.6704|0.6704	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	D|D	0.89917|0.89917	1.0|1.0	D|D	0.80764|0.83275	0.994|0.996	D|D	0.89827|0.89827	0.3993|0.3993	10|10	0.87932|0.87932	D|D	0|0	-20.3885|-20.3885	19.9142|19.9142	0.97043|0.97043	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	862|862	Q9P2F5|Q9P2F5-2	STOX2_HUMAN|.	C|W	862|862	ENSP00000311257:R862C|ENSP00000390127:R862W	ENSP00000311257:R862C|ENSP00000390127:R862W	R|R	+|+	1|1	0|2	STOX2|STOX2	185169569|185169569	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	4.561000|4.561000	0.60809|0.60809	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	CGT|CGG	STOX2	-	NULL	ENSG00000173320		0.552	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX2	HGNC	protein_coding	OTTHUMT00000361433.3	-	0.00	80	0	C	NM_020225	Missense_Mutation	184932575	+1	tier1	rs201760642	no_errors	ENST00000308497	ensembl	human	known	74_37	missense	56.76	16	21	SNP	1.000	T
TAF1L	138474	genome.wustl.edu	37	9	32631964	32631964	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:32631964C>T	ENST00000242310.4	-	1	3703	c.3614G>A	c.(3613-3615)cGa>cAa	p.R1205Q	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1205					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGCTGGTTTTCGGACTGTCTC	0.423																																																	0													201.0	173.0	183.0					9																	32631964		2203	4298	6501	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3614G>A	9.37:g.32631964C>T	ENSP00000418379:p.Arg1205Gln		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1205Q	ENST00000242310.4	37	c.3614	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096652	0.56075	.	.	ENSG00000122728	ENST00000242310	T	0.17691	2.26	0.479	0.479	0.16796	.	0.000000	0.85682	D	0.000000	T	0.14874	0.0359	M	0.64404	1.975	0.50171	D	0.999852	B	0.30727	0.292	B	0.26416	0.069	T	0.06481	-1.0824	10	0.66056	D	0.02	.	6.6915	0.23174	0.0:0.9998:0.0:2.0E-4	.	1205	Q8IZX4	TAF1L_HUMAN	Q	1205	ENSP00000418379:R1205Q	ENSP00000418379:R1205Q	R	-	2	0	TAF1L	32621964	1.000000	0.71417	0.993000	0.49108	0.847000	0.48162	4.928000	0.63447	0.507000	0.28148	0.195000	0.17529	CGA	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.423	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	-	0.00	68	0	C			32631964	-1	tier1	-	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	28.57	45	18	SNP	1.000	T
TAOK1	57551	genome.wustl.edu	37	17	27844497	27844497	+	Silent	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr17:27844497C>A	ENST00000261716.3	+	16	2250	c.1731C>A	c.(1729-1731)ccC>ccA	p.P577P	TAOK1_ENST00000536202.1_Intron	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	577					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			AGAGTACCCCCAAAAAAGAAA	0.443																																																	0													105.0	110.0	109.0					17																	27844497		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1731C>A	17.37:g.27844497C>A			A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P577	ENST00000261716.3	37	c.1731	CCDS32601.1	17																																																																																			TAOK1	-	superfamily_Kinase-like_dom	ENSG00000160551		0.443	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1		0.00	8	0	C	NM_020791		27844497	+1			no_errors	ENST00000261716	ensembl	human	known	74_37	silent	9.09	20	2	SNP	0.263	A
TBC1D20	128637	genome.wustl.edu	37	20	418414	418414	+	3'UTR	DEL	T	T	-			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr20:418414delT	ENST00000354200.4	-	0	2175				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				ATGAGAACTATTTTTTTTTCC	0.294																																																	0										41,1781		9,23,879	37.0	33.0	34.0			-1.8	0.0	20		34	133,3693		23,87,1803	no	utr-3	TBC1D20	NM_144628.2		32,110,2682	A1A1,A1R,RR		3.4762,2.2503,3.0807			418414	174,5474	692	1590	2282	SO:0001624	3_prime_UTR_variant	0			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.*816A>-	20.37:g.418414delT			A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	RNA	DEL	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			TBC1D20	-	-	ENSG00000125875		0.294	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2		0.00	41	0	T	NM_144628		418414	-1	tier1		no_errors	ENST00000461188	ensembl	human	known	74_37	rna	6.45	58	4	DEL	0.004	-
TBX15	6913	genome.wustl.edu	37	1	119427940	119427940	+	Silent	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:119427940A>G	ENST00000369429.3	-	8	1233	c.1224T>C	c.(1222-1224)gcT>gcC	p.A408A	TBX15_ENST00000207157.3_Silent_p.A302A			Q96SF7	TBX15_HUMAN	T-box 15	408					embryonic cranial skeleton morphogenesis (GO:0048701)	Tle3-Aes complex (GO:0070722)	RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(19)|ovary(1)|pancreas(1)|skin(5)	37	all_neural(166;0.117)	all_cancers(81;0.000692)|all_lung(203;3.05e-06)|Lung NSC(69;2.13e-05)|all_epithelial(167;0.000237)		Lung(183;0.044)|LUSC - Lung squamous cell carcinoma(189;0.141)		TCTGCAAGGCAGCCATGTTGC	0.537																																																	0													48.0	46.0	47.0					1																	119427940		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127536	CCDS30816.1	1p11.1	2008-02-05	2004-10-05		ENSG00000092607	ENSG00000092607		"""T-boxes"""	11594	protein-coding gene	gene with protein product		604127	"""T-box 14"""	TBX14		9693034	Standard	XM_005271162		Approved		uc001ehl.1	Q96SF7	OTTHUMG00000012263	ENST00000369429.3:c.1224T>C	1.37:g.119427940A>G			Q08E76|Q5JT54|Q5T9S7	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A302	ENST00000369429.3	37	c.906		1																																																																																			TBX15	-	NULL	ENSG00000092607		0.537	TBX15-002	PUTATIVE	not_organism_supported|upstream_ATG|basic|appris_principal	protein_coding	TBX15	HGNC	protein_coding	OTTHUMT00000034351.1	-	0.00	38	0	A	NM_152380		119427940	-1	tier1	-	no_errors	ENST00000207157	ensembl	human	known	74_37	silent	35.14	24	13	SNP	0.985	G
TEX40	25858	genome.wustl.edu	37	11	64068305	64068305	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:64068305C>T	ENST00000328404.6	+	2	218	c.198C>T	c.(196-198)caC>caT	p.H66H	TEX40_ENST00000539943.1_Silent_p.H24H|RP11-783K16.10_ENST00000539086.1_RNA	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	66					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											GCGGGTGGCACAGCCCGGGGC	0.682											OREG0021050	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													8.0	10.0	9.0					11																	64068305		1965	4081	6046	SO:0001819	synonymous_variant	0					11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.198C>T	11.37:g.64068305C>T		1073		Silent	SNP	NULL	p.H66	ENST00000328404.6	37	c.198		11																																																																																			TEX40	-	NULL	ENSG00000219435		0.682	TEX40-201	KNOWN	basic|appris_principal	protein_coding	TEX40	HGNC	protein_coding		-	0.00	33	0	C	NM_001039496		64068305	+1	tier1	-	no_errors	ENST00000328404	ensembl	human	known	74_37	silent	15.91	37	7	SNP	0.002	T
TNC	3371	genome.wustl.edu	37	9	117825202	117825202	+	Missense_Mutation	SNP	C	C	T	rs145446426		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:117825202C>T	ENST00000350763.4	-	13	4438	c.4027G>A	c.(4027-4029)Gtc>Atc	p.V1343I	TNC_ENST00000542877.1_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.V1343I|TNC_ENST00000535648.1_Intron|TNC_ENST00000341037.4_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000346706.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1343	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ATACCTGTGACGACCTCTACA	0.552																																																	0								C	ILE/VAL	0,4406		0,0,2203	36.0	32.0	33.0		4027	1.4	1.0	9	dbSNP_134	33	2,8598	2.2+/-6.3	0,2,4298	no	missense	TNC	NM_002160.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1343/2202	117825202	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4027G>A	9.37:g.117825202C>T	ENSP00000265131:p.Val1343Ile		C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.V1343I	ENST00000350763.4	37	c.4027	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	c	1.254	-0.617607	0.03663	0.0	2.33E-4	ENSG00000041982	ENST00000350763;ENST00000423613	T;T	0.04454	3.62;3.62	5.16	1.42	0.22433	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.716164	0.14203	N	0.334580	T	0.02727	0.0082	N	0.19112	0.55	0.80722	D	1	B;B	0.15141	0.012;0.0	B;B	0.09377	0.004;0.0	T	0.47368	-0.9123	10	0.15499	T	0.54	.	4.1831	0.10385	0.1481:0.1656:0.0:0.6863	.	1343;1343	E9PC84;P24821	.;TENA_HUMAN	I	1343	ENSP00000265131:V1343I;ENSP00000411406:V1343I	ENSP00000265131:V1343I	V	-	1	0	TNC	116865023	0.033000	0.19621	0.979000	0.43373	0.168000	0.22595	0.532000	0.23067	0.043000	0.15746	-0.285000	0.09966	GTC	TNC	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.552	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	72	0	C	NM_002160		117825202	-1	tier1	rs145446426	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	10.00	81	9	SNP	1.000	T
TNC	3371	genome.wustl.edu	37	9	117849341	117849341	+	Silent	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:117849341G>A	ENST00000350763.4	-	3	1080	c.669C>T	c.(667-669)agC>agT	p.S223S	TNC_ENST00000542877.1_Silent_p.S223S|TNC_ENST00000340094.3_Silent_p.S223S|TNC_ENST00000423613.2_Silent_p.S223S|TNC_ENST00000535648.1_Silent_p.S223S|TNC_ENST00000341037.4_Silent_p.S223S|TNC_ENST00000537320.1_Silent_p.S223S|TNC_ENST00000345230.3_Silent_p.S223S|TNC_ENST00000346706.3_Silent_p.S223S	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	223	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CATTGCAGTCGCTGGGGCAAG	0.612																																																	0													87.0	73.0	77.0					9																	117849341		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.669C>T	9.37:g.117849341G>A			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.S223	ENST00000350763.4	37	c.669	CCDS6811.1	9																																																																																			TNC	-	pfam_EGF_extracell,smart_EG-like_dom	ENSG00000041982		0.612	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	-	0.00	49	0	G	NM_002160		117849341	-1	tier1	-	no_errors	ENST00000350763	ensembl	human	known	74_37	silent	22.22	42	12	SNP	0.002	A
TOX3	27324	genome.wustl.edu	37	16	52484428	52484428	+	Silent	SNP	G	G	T	rs573103587		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:52484428G>T	ENST00000219746.9	-	4	723	c.439C>A	c.(439-441)Cgg>Agg	p.R147R	TOX3_ENST00000407228.3_Silent_p.R142R	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	147					apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						GGATCCTGCCGGTACTGGGAC	0.532																																																	0													79.0	83.0	82.0					16																	52484428		2046	4189	6235	SO:0001819	synonymous_variant	0			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.439C>A	16.37:g.52484428G>T			B4DRD0|B5MCW4	Silent	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R147	ENST00000219746.9	37	c.439	CCDS54009.1	16																																																																																			TOX3	-	NULL	ENSG00000103460		0.532	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1		0.00	51	0	G	XM_049037		52484428	-1			no_errors	ENST00000219746	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.998	T
TRIM49B	283116	genome.wustl.edu	37	11	49055833	49055833	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr11:49055833A>C	ENST00000332682.7	+	4	671	c.643A>C	c.(643-645)Agt>Cgt	p.S215R		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	215						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						ACTTCATTTAAGTAAAGCCAA	0.383																																																	0																																										SO:0001583	missense	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.643A>C	11.37:g.49055833A>C	ENSP00000330216:p.Ser215Arg			Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S215R	ENST00000332682.7	37	c.643	CCDS55762.1	11	.	.	.	.	.	.	.	.	.	.	A	6.043	0.376254	0.11466	.	.	ENSG00000182053	ENST00000332682	T	0.09630	2.96	0.689	0.689	0.18033	.	.	.	.	.	T	0.22282	0.0537	M	0.83118	2.625	0.09310	N	1	.	.	.	.	.	.	T	0.08289	-1.0729	6	0.51188	T	0.08	.	.	.	.	.	.	.	.	R	215	ENSP00000330216:S215R	ENSP00000330216:S215R	S	+	1	0	AC084851.1	49012409	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	1.352000	0.34033	0.539000	0.28788	0.155000	0.16302	AGT	TRIM49B	-	NULL	ENSG00000182053		0.383	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		-	0.00	411	0	A			49055833	+1	tier1	-	no_errors	ENST00000332682	ensembl	human	known	74_37	missense	33.25	279	139	SNP	0.002	C
TSC22D2	9819	genome.wustl.edu	37	3	150127665	150127665	+	Silent	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:150127665A>G	ENST00000361875.3	+	1	1544	c.528A>G	c.(526-528)agA>agG	p.R176R	TSC22D2_ENST00000361136.2_Silent_p.R176R	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	176					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGCCCTATAGACGCGGCCGAT	0.572																																																	0													92.0	93.0	92.0					3																	150127665		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.528A>G	3.37:g.150127665A>G			D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Silent	SNP	pfam_TSC-22_Dip_Bun	p.R176	ENST00000361875.3	37	c.528	CCDS3149.1	3																																																																																			TSC22D2	-	NULL	ENSG00000196428		0.572	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	-	0.00	48	0	A	NM_014779		150127665	+1	tier1	-	no_errors	ENST00000361875	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.650	G
TSPAN33	340348	genome.wustl.edu	37	7	128807245	128807245	+	Silent	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:128807245G>T	ENST00000289407.4	+	7	703	c.594G>T	c.(592-594)gtG>gtT	p.V198V	RP11-286H14.6_ENST00000498745.1_RNA|Y_RNA_ENST00000363759.1_RNA	NM_178562.3	NP_848657.1	Q86UF1	TSN33_HUMAN	tetraspanin 33	198					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14						CCCAGGCAGTGATCAACACTA	0.468																																																	0													168.0	166.0	167.0					7																	128807245		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5810.1	7q32.3	2013-02-14			ENSG00000158457	ENSG00000158457		"""Tetraspanins"""	28743	protein-coding gene	gene with protein product		610120				16213355, 16242907	Standard	XM_006715960		Approved	MGC50844, Penumbra	uc003vop.2	Q86UF1	OTTHUMG00000158420	ENST00000289407.4:c.594G>T	7.37:g.128807245G>T				Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V198	ENST00000289407.4	37	c.594	CCDS5810.1	7																																																																																			TSPAN33	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000158457		0.468	TSPAN33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN33	HGNC	protein_coding	OTTHUMT00000350983.1		0.00	45	0	G	NM_178562		128807245	+1			no_errors	ENST00000289407	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.993	T
TTC3	7267	genome.wustl.edu	37	21	38460488	38460489	+	Intron	INS	-	-	A	rs113343952|rs2835585	byFrequency	TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr21:38460488_38460489insA	ENST00000399017.2	+	4	2934				TTC3_ENST00000540756.1_Intron|TTC3_ENST00000479930.1_Intron|TTC3_ENST00000355666.1_Intron|TTC3_ENST00000399010.1_Intron|TTC3_ENST00000354749.2_Intron	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				actttttttttaattaaGAATT	0.297																																					Ovarian(38;194 1649 35661)												0																																										SO:0001627	intron_variant	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.188-7->A	21.37:g.38460490_38460490dupA			A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	RNA	INS	-	NULL	ENST00000399017.2	37	NULL	CCDS13651.1	21																																																																																			TTC3	-	-	ENSG00000182670		0.297	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1		0.00	27	0	-			38460489	+1	tier1		no_errors	ENST00000484047	ensembl	human	known	74_37	rna	40.74	16	11	INS	0.276:0.200	A
TTN	7273	genome.wustl.edu	37	2	179411395	179411395	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:179411395T>C	ENST00000591111.1	-	291	90061	c.89837A>G	c.(89836-89838)aAg>aGg	p.K29946R	TTN_ENST00000460472.2_Missense_Mutation_p.K22522R|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K22647R|TTN_ENST00000342175.6_Missense_Mutation_p.K22714R|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.K29019R|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K31587R|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA			Q8WZ42	TITIN_HUMAN	titin	29946	Fibronectin type-III 118. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCTGCATTCTTGGCTAACAC	0.453																																																	0													76.0	73.0	74.0					2																	179411395		1976	4172	6148	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.89837A>G	2.37:g.179411395T>C	ENSP00000465570:p.Lys29946Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K29019R	ENST00000591111.1	37	c.87056		2	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472475	0.63737	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55413	0.52;0.52;0.52;0.52	6.03	6.03	0.97812	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.42720	0.1215	N	0.20610	0.595	0.46458	D	0.999054	B;B;B;B	0.25235	0.121;0.121;0.121;0.121	B;B;B;B	0.26416	0.069;0.069;0.069;0.069	T	0.37337	-0.9710	9	0.87932	D	0	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	22522;22647;22714;29946	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	29019;22522;22714;22647;22519	ENSP00000343764:K29019R;ENSP00000434586:K22522R;ENSP00000340554:K22714R;ENSP00000352154:K22647R	ENSP00000340554:K22714R	K	-	2	0	TTN	179119641	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.909000	0.63314	2.302000	0.77476	0.533000	0.62120	AAG	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	29	0	T	NM_133378		179411395	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179486721	179486721	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:179486721T>G	ENST00000591111.1	-	194	40229	c.40005A>C	c.(40003-40005)aaA>aaC	p.K13335N	TTN_ENST00000460472.2_Missense_Mutation_p.K5911N|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K6036N|TTN_ENST00000342175.6_Missense_Mutation_p.K6103N|TTN_ENST00000342992.6_Missense_Mutation_p.K12408N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K14976N|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000604956.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13335	Ig-like 89.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCACCATCTTTAAACCACT	0.348																																																	0													118.0	103.0	108.0					2																	179486721		1843	4084	5927	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.40005A>C	2.37:g.179486721T>G	ENSP00000465570:p.Lys13335Asn		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K12408N	ENST00000591111.1	37	c.37224		2	.	.	.	.	.	.	.	.	.	.	T	11.44	1.640695	0.29157	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	6.06	4.9	0.64082	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64182	0.2575	H	0.94698	3.57	0.42570	D	0.99317	B;B;B;B	0.31459	0.324;0.324;0.324;0.117	B;B;B;B	0.35813	0.211;0.211;0.211;0.211	T	0.67971	-0.5532	9	0.87932	D	0	.	7.3903	0.26905	0.1298:0.0734:0.0:0.7968	.	5911;6036;6103;13335	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	12408;5911;6103;6036;5911	ENSP00000343764:K12408N;ENSP00000434586:K5911N;ENSP00000340554:K6103N;ENSP00000352154:K6036N	ENSP00000340554:K6103N	K	-	3	2	TTN	179194966	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	0.469000	0.22067	1.086000	0.41228	0.528000	0.53228	AAA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.348	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	73	0	T	NM_133378		179486721	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	22.58	48	14	SNP	1.000	G
TUBB3	10381	genome.wustl.edu	37	16	90002059	90002059	+	Silent	SNP	C	C	T	rs144689076		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:90002059C>T	ENST00000315491.7	+	4	1323	c.1200C>T	c.(1198-1200)ggC>ggT	p.G400G	TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000556922.1_Silent_p.G747G|TUBB3_ENST00000304984.5_Silent_p.G328G|TUBB3_ENST00000554444.1_Silent_p.G328G	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	400					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	GGTACACGGGCGAGGGCATGG	0.622																																																	0													91.0	89.0	90.0					16																	90002059		2197	4277	6474	SO:0001819	synonymous_variant	0			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.1200C>T	16.37:g.90002059C>T			A8K854|Q9BTZ0|Q9BW10	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.G400	ENST00000315491.7	37	c.1200	CCDS10988.1	16																																																																																			TUBB3	-	superfamily_Tub_FtsZ_C,prints_Delta_tubulin	ENSG00000258947		0.622	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB3	Uniprot_gn	protein_coding	OTTHUMT00000272874.1		0.00	105	0	C	NM_006086		90002059	+1			no_errors	ENST00000315491	ensembl	human	known	74_37	silent	9.09	90	9	SNP	0.999	T
TUBGCP6	85378	genome.wustl.edu	37	22	50656356	50656356	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr22:50656356G>T	ENST00000248846.5	-	24	5463	c.5359C>A	c.(5359-5361)Ctc>Atc	p.L1787I	TUBGCP6_ENST00000439308.2_3'UTR|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1787					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CCTTTGAAGAGAAAGTGGGAG	0.662																																																	0													22.0	24.0	23.0					22																	50656356		2197	4292	6489	SO:0001583	missense	0			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.5359C>A	22.37:g.50656356G>T	ENSP00000248846:p.Leu1787Ile		Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	pfam_TUBGCP	p.L1787I	ENST00000248846.5	37	c.5359	CCDS14087.1	22	.	.	.	.	.	.	.	.	.	.	G	22.7	4.321212	0.81580	.	.	ENSG00000128159	ENST00000248846;ENST00000425018	T;T	0.47177	2.33;0.85	4.89	4.89	0.63831	.	0.000000	0.85682	D	0.000000	T	0.64204	0.2577	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.994;0.996;0.998	T	0.67003	-0.5780	10	0.72032	D	0.01	.	12.0013	0.53232	0.0923:0.0:0.9077:0.0	.	1779;1787;1770	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	I	1787;456	ENSP00000248846:L1787I;ENSP00000405979:L456I	ENSP00000248846:L1787I	L	-	1	0	TUBGCP6	48998483	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	6.230000	0.72301	2.244000	0.73946	0.455000	0.32223	CTC	TUBGCP6	-	NULL	ENSG00000128159		0.662	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	-	0.00	73	0	G	NM_020461		50656356	-1	tier1	-	no_errors	ENST00000248846	ensembl	human	known	74_37	missense	39.22	31	20	SNP	1.000	T
UBA7	7318	genome.wustl.edu	37	3	49851333	49851333	+	5'UTR	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:49851333A>G	ENST00000333486.3	-	0	46				UBA7_ENST00000494212.1_5'UTR	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7						cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AACAGGAACCAAGGCCAAGCG	0.542																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.-113T>C	3.37:g.49851333A>G			Q9BRB2	RNA	SNP	-	NULL	ENST00000333486.3	37	NULL	CCDS2805.1	3																																																																																			UBA7	-	-	ENSG00000182179		0.542	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA7	HGNC	protein_coding	OTTHUMT00000350503.1	-	0.00	43	0	A	NM_003335		49851333	-1	tier1	-	no_errors	ENST00000494212	ensembl	human	known	74_37	rna	46.34	22	19	SNP	0.000	G
UNC80	285175	genome.wustl.edu	37	2	210685242	210685242	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:210685242A>C	ENST00000439458.1	+	13	2250	c.2170A>C	c.(2170-2172)Agt>Cgt	p.S724R	UNC80_ENST00000272845.6_Missense_Mutation_p.S724R	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	724	Gly-rich.				ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGTATCTGGAAGTTCCACCTG	0.493																																																	0													87.0	84.0	85.0					2																	210685242		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.2170A>C	2.37:g.210685242A>C	ENSP00000391088:p.Ser724Arg		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.S724R	ENST00000439458.1	37	c.2170	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360950	0.41801	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.77489	-1.1;-1.1	5.81	4.67	0.58626	.	.	.	.	.	T	0.56761	0.2007	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.56135	-0.8029	9	0.52906	T	0.07	-4.6573	6.9557	0.24570	0.7897:0.0:0.2103:0.0	.	724	Q8N2C7	UNC80_HUMAN	R	724	ENSP00000391088:S724R;ENSP00000272845:S724R	ENSP00000272845:S724R	S	+	1	0	UNC80	210393487	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.004000	0.57068	2.218000	0.71995	0.377000	0.23210	AGT	UNC80	-	NULL	ENSG00000144406		0.493	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	83	0	A	NM_182587		210685242	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	35.35	64	35	SNP	1.000	C
USP15	9958	genome.wustl.edu	37	12	62749183	62749183	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr12:62749183G>A	ENST00000280377.5	+	8	900	c.842G>A	c.(841-843)aGa>aAa	p.R281K	USP15_ENST00000393654.3_Missense_Mutation_p.R256K|USP15_ENST00000353364.3_Missense_Mutation_p.R252K	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	281					BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		GAACCTGGAAGAAACAATGAA	0.363																																					Melanoma(181;615 2041 39364 49691 50001)												0													93.0	88.0	90.0					12																	62749183		2203	4300	6503	SO:0001583	missense	0			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.842G>A	12.37:g.62749183G>A	ENSP00000280377:p.Arg281Lys		Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.R281K	ENST00000280377.5	37	c.842	CCDS58251.1	12	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037192	0.75617	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.19532	2.14;2.15;2.14	5.6	5.6	0.85130	.	0.100701	0.64402	D	0.000003	T	0.17408	0.0418	N	0.22421	0.69	0.58432	D	0.999997	B;B	0.34161	0.439;0.42	B;B	0.34093	0.165;0.175	T	0.05068	-1.0908	9	.	.	.	-16.8722	19.6137	0.95619	0.0:0.0:1.0:0.0	.	281;252	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	K	252;281;256	ENSP00000258123:R252K;ENSP00000280377:R281K;ENSP00000377264:R256K	.	R	+	2	0	USP15	61035450	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.916000	0.92745	2.650000	0.89964	0.557000	0.71058	AGA	USP15	-	NULL	ENSG00000135655		0.363	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	-	0.00	73	0	G	NM_006313		62749183	+1	tier1	-	no_errors	ENST00000280377	ensembl	human	known	74_37	missense	34.78	45	24	SNP	1.000	A
USP26	83844	genome.wustl.edu	37	X	132161204	132161205	+	Frame_Shift_Ins	INS	-	-	A	rs61758857		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chrX:132161204_132161205insA	ENST00000511190.1	-	6	1513_1514	c.1044_1045insT	c.(1042-1047)tttaaafs	p.K349fs	USP26_ENST00000370832.1_Frame_Shift_Ins_p.K349fs|USP26_ENST00000406273.1_Frame_Shift_Ins_p.K349fs	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	349	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)	p.F348fs*7(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					TAGGTATCTTTAAAAAAAAGTA	0.386																																					NSCLC(104;342 1621 36940 47097 52632)												1	Deletion - Frameshift(1)	large_intestine(1)	GRCh37	CM077651	USP26	M	rs61758857																																			SO:0001589	frameshift_variant	0			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.1045dupT	X.37:g.132161212_132161212dupA	ENSP00000423390:p.Lys349fs		B9WRT6|Q5H9H4	Frame_Shift_Ins	INS	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.K348fs	ENST00000511190.1	37	c.1045_1044	CCDS14635.1	X																																																																																			USP26	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000134588		0.386	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1		0.00	48	0	-	NM_031907		132161205	-1	tier1		no_errors	ENST00000370832	ensembl	human	known	74_37	frame_shift_ins	65.45	19	36	INS	0.813:0.541	A
VPS36	51028	genome.wustl.edu	37	13	52997736	52997736	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr13:52997736G>T	ENST00000378060.4	-	10	840	c.813C>A	c.(811-813)tgC>tgA	p.C271*		NM_001282168.1|NM_001282169.1|NM_016075.2	NP_001269097.1|NP_001269098.1|NP_057159.2	Q86VN1	VPS36_HUMAN	vacuolar protein sorting 36 homolog (S. cerevisiae)	271					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	17		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.14e-08)		GGTTTACTAAGCAGTACACCT	0.318																																																	0													119.0	121.0	120.0					13																	52997736		2203	4300	6503	SO:0001587	stop_gained	0			AF151903	CCDS9434.1, CCDS73577.1	13q14.13	2008-02-05	2007-01-12	2005-08-02	ENSG00000136100	ENSG00000136100			20312	protein-coding gene	gene with protein product		610903	"""chromosome 13 open reading frame 9"", ""vacuolar protein sorting 36 homolog (yeast)"""	C13orf9		11278625, 15755741	Standard	NM_016075		Approved	CGI-145, Eap45	uc001vgs.3	Q86VN1	OTTHUMG00000016964	ENST00000378060.4:c.813C>A	13.37:g.52997736G>T	ENSP00000367299:p.Cys271*		A8K125|Q3ZCV7|Q5H9S1|Q5VXB6|Q9H8Z5|Q9Y3E3	Nonsense_Mutation	SNP	pfam_EAP30,pfam_VPS36_GLUE	p.C271*	ENST00000378060.4	37	c.813	CCDS9434.1	13	.	.	.	.	.	.	.	.	.	.	.	25.2	4.609243	0.87258	.	.	ENSG00000136100	ENST00000378060	.	.	.	5.91	2.25	0.28309	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2124	9.1347	0.36866	0.621:0.0:0.379:0.0	.	.	.	.	X	271	.	ENSP00000367299:C271X	C	-	3	2	VPS36	51895737	0.997000	0.39634	0.999000	0.59377	0.988000	0.76386	0.664000	0.25068	0.161000	0.19458	-0.302000	0.09304	TGC	VPS36	-	pfam_EAP30	ENSG00000136100		0.318	VPS36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS36	HGNC	protein_coding	OTTHUMT00000045059.3	-	0.00	27	0	G			52997736	-1	tier1	-	no_errors	ENST00000378060	ensembl	human	known	74_37	nonsense	13.79	25	4	SNP	1.000	T
WDR78	79819	genome.wustl.edu	37	1	67301382	67301382	+	Missense_Mutation	SNP	C	C	T	rs375562160		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr1:67301382C>T	ENST00000371026.3	-	11	1715	c.1660G>A	c.(1660-1662)Gtt>Att	p.V554I	WDR78_ENST00000431318.1_Missense_Mutation_p.V300I	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	554					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TGATAGCCAACGGCTAAAAGG	0.363																																																	0								C	ILE/VAL	1,4405	2.1+/-5.4	0,1,2202	104.0	103.0	103.0		1660	4.4	1.0	1		103	0,8600		0,0,4300	no	missense	WDR78	NM_024763.4	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	554/849	67301382	1,13005	2203	4300	6503	SO:0001583	missense	0			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1660G>A	1.37:g.67301382C>T	ENSP00000360065:p.Val554Ile		A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V554I	ENST00000371026.3	37	c.1660	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597193	0.66332	2.27E-4	0.0	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	T;T;T	0.67865	1.44;-0.29;-0.29	5.35	4.43	0.53597	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.162824	0.53938	D	0.000052	T	0.48114	0.1482	L	0.46157	1.445	0.41589	D	0.988782	P;P	0.40534	0.72;0.599	B;B	0.37833	0.259;0.133	T	0.55717	-0.8097	10	0.44086	T	0.13	-9.4496	14.3454	0.66658	0.0:0.9272:0.0:0.0728	.	300;554	Q5VTH9-3;Q5VTH9	.;WDR78_HUMAN	I	554;300;320	ENSP00000360065:V554I;ENSP00000393182:V300I;ENSP00000433682:V320I	ENSP00000360065:V554I	V	-	1	0	WDR78	67073970	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	3.904000	0.56325	2.514000	0.84764	0.644000	0.83932	GTT	WDR78	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000152763		0.363	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	-	0.00	44	0	C	NM_024763		67301382	-1	tier1	-	no_errors	ENST00000371026	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
ZFYVE26	23503	genome.wustl.edu	37	14	68228075	68228075	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr14:68228075T>G	ENST00000555452.1	-	35	6732	c.6596A>C	c.(6595-6597)cAt>cCt	p.H2199P	ZFYVE26_ENST00000557306.1_Intron|ZFYVE26_ENST00000347230.4_Intron			Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	0					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCTGTGTCCATGTCCCACCTT	0.537																																																	0													106.0	83.0	91.0					14																	68228075		2203	4300	6503	SO:0001583	missense	0			AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000555452.1:c.6596A>C	14.37:g.68228075T>G	ENSP00000450603:p.His2199Pro		B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.H2199P	ENST00000555452.1	37	c.6596		14	.	.	.	.	.	.	.	.	.	.	T	2.427	-0.331728	0.05314	.	.	ENSG00000072121	ENST00000555452	T	0.27256	1.68	3.7	-7.4	0.01397	.	.	.	.	.	T	0.10380	0.0254	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17107	-1.0380	7	.	.	.	.	2.0296	0.03527	0.1892:0.1589:0.1468:0.5051	.	2199	G3V2D8	.	P	2199	ENSP00000450603:H2199P	.	H	-	2	0	ZFYVE26	67297828	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-6.275000	0.00073	-3.300000	0.00192	-0.248000	0.11899	CAT	ZFYVE26	-	NULL	ENSG00000072121		0.537	ZFYVE26-002	PUTATIVE	basic	protein_coding	ZFYVE26	HGNC	protein_coding	OTTHUMT00000412740.1	-	0.00	76	0	T	NM_015346		68228075	-1	tier1	-	no_errors	ENST00000555452	ensembl	human	putative	74_37	missense	15.48	71	13	SNP	0.000	G
ZIC4	84107	genome.wustl.edu	37	3	147105967	147105967	+	3'UTR	SNP	C	C	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:147105967C>G	ENST00000383075.3	-	0	2196				ZIC4_ENST00000425731.3_3'UTR|ZIC4_ENST00000525172.2_3'UTR|ZIC4_ENST00000472749.2_5'UTR|ZIC4-AS1_ENST00000462168.1_RNA	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AAGCAAAGGTCAGCGCAAATG	0.522																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*679G>C	3.37:g.147105967C>G			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.522	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	24	0	C			147105967	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	43.75	9	7	SNP	1.000	G
ZKSCAN7	55888	genome.wustl.edu	37	3	44598919	44598919	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:44598919C>A	ENST00000273320.3	+	2	809	c.380C>A	c.(379-381)gCt>gAt	p.A127D	ZKSCAN7_ENST00000341840.3_Missense_Mutation_p.A127D|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000431636.1_Missense_Mutation_p.A127D|ZKSCAN7_ENST00000426540.1_Missense_Mutation_p.A127D	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	127	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAGGCTGTGGCTGTGGTGGAG	0.582																																																	0													75.0	79.0	78.0					3																	44598919		2203	4300	6503	SO:0001583	missense	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.380C>A	3.37:g.44598919C>A	ENSP00000273320:p.Ala127Asp		A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.A127D	ENST00000273320.3	37	c.380	CCDS2715.1	3	.	.	.	.	.	.	.	.	.	.	.	21.1	4.092857	0.76756	.	.	ENSG00000196345	ENST00000431636;ENST00000426540;ENST00000341840;ENST00000273320	T;T;T;T	0.05925	3.37;3.37;3.37;3.37	4.9	4.9	0.64082	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.32952	N	0.005442	T	0.21427	0.0516	M	0.63169	1.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.993;0.999	T	0.00123	-1.2025	10	0.49607	T	0.09	-8.9479	13.9699	0.64233	0.0:1.0:0.0:0.0	.	127;127	Q9P0L1;Q9P0L1-2	ZN167_HUMAN;.	D	127	ENSP00000416681:A127D;ENSP00000395524:A127D;ENSP00000345404:A127D;ENSP00000273320:A127D	ENSP00000273320:A127D	A	+	2	0	ZNF167	44573923	0.981000	0.34729	0.999000	0.59377	0.997000	0.91878	2.510000	0.45468	2.436000	0.82500	0.655000	0.94253	GCT	ZKSCAN7	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000196345		0.582	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN7	HGNC	protein_coding	OTTHUMT00000256752.4	-	0.00	42	0	C	NM_018651		44598919	+1	tier1	-	no_errors	ENST00000273320	ensembl	human	known	74_37	missense	14.63	35	6	SNP	0.997	A
ZIC4	84107	genome.wustl.edu	37	3	147121771	147121771	+	5'UTR	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr3:147121771T>G	ENST00000484399.1	-	0	300				ZIC4_ENST00000473123.1_Intron|ZIC4_ENST00000425731.3_Intron|ZIC4_ENST00000525172.2_Missense_Mutation_p.N39H|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000383075.3_Intron			Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						AGGGTATTATTATTTTCAATT	0.468																																																	0													42.0	35.0	37.0					3																	147121771		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000484399.1:c.-36A>C	3.37:g.147121771T>G			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N39H	ENST00000484399.1	37	c.115	CCDS43160.1	3	.	.	.	.	.	.	.	.	.	.	T	9.289	1.050097	0.19827	.	.	ENSG00000174963	ENST00000525172	T	0.12569	2.67	4.79	4.79	0.61399	.	.	.	.	.	T	0.10035	0.0246	N	0.08118	0	0.80722	D	1	B	0.31790	0.34	B	0.39617	0.305	T	0.23976	-1.0173	9	0.87932	D	0	.	10.905	0.47076	0.0:0.0:0.0:1.0	.	39	B7Z2L2	.	H	39	ENSP00000435509:N39H	ENSP00000435509:N39H	N	-	1	0	ZIC4	148604461	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	3.387000	0.52501	2.149000	0.67028	0.533000	0.62120	AAT	ZIC4	-	NULL	ENSG00000174963		0.468	ZIC4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355507.1	-	0.00	57	0	T			147121771	-1	tier1	-	no_errors	ENST00000525172	ensembl	human	known	74_37	missense	58.62	12	17	SNP	0.999	G
ZNF208	7757	genome.wustl.edu	37	19	22156000	22156000	+	Missense_Mutation	SNP	T	T	G	rs553606877		TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:22156000T>G	ENST00000397126.4	-	4	1984	c.1836A>C	c.(1834-1836)gaA>gaC	p.E612D	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGCCACATTCTTCACATTTGT	0.373													t|||	1	0.000199681	0.0	0.0	5008	,	,		22333	0.0		0.0	False		,,,				2504	0.001																0													62.0	66.0	65.0					19																	22156000		2106	4244	6350	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1836A>C	19.37:g.22156000T>G	ENSP00000380315:p.Glu612Asp			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E612D	ENST00000397126.4	37	c.1836	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	T	8.969	0.972505	0.18736	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.16897	2.31	2.8	-5.59	0.02505	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10594	0.0259	.	.	.	0.09310	N	1	P	0.50710	0.938	P	0.50825	0.651	T	0.05402	-1.0887	8	0.11485	T	0.65	.	1.2207	0.01923	0.204:0.2679:0.102:0.4261	.	512	O43345	ZN208_HUMAN	D	612;512	ENSP00000380315:E612D	ENSP00000380315:E612D	E	-	3	2	ZNF208	21947840	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	-6.555000	0.00061	-1.675000	0.01459	0.254000	0.18369	GAA	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.373	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	70	0	T	NM_007153		22156000	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	15.19	67	12	SNP	0.000	G
ZNF267	10308	genome.wustl.edu	37	16	31925958	31925958	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:31925958G>C	ENST00000300870.10	+	4	597	c.388G>C	c.(388-390)Gat>Cat	p.D130H	ZNF267_ENST00000394846.3_3'UTR	NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	130					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TGGATGTTATGATGAAAAGAC	0.353																																																	0													120.0	120.0	120.0					16																	31925958		2197	4300	6497	SO:0001583	missense	0			X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.388G>C	16.37:g.31925958G>C	ENSP00000300870:p.Asp130His		A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D130H	ENST00000300870.10	37	c.388	CCDS32440.1	16	.	.	.	.	.	.	.	.	.	.	.	8.782	0.928495	0.18131	.	.	ENSG00000185947	ENST00000300870;ENST00000394846	T	0.06371	3.31	0.458	0.458	0.16670	.	.	.	.	.	T	0.03136	0.0092	L	0.34521	1.04	0.09310	N	1	P	0.47034	0.889	B	0.28385	0.089	T	0.43015	-0.9417	9	0.46703	T	0.11	.	2.8152	0.05454	0.3857:0.0:0.6143:0.0	.	130	Q14586	ZN267_HUMAN	H	130;97	ENSP00000300870:D130H	ENSP00000300870:D130H	D	+	1	0	ZNF267	31833459	0.000000	0.05858	0.034000	0.17996	0.034000	0.12701	-0.321000	0.08018	0.482000	0.27582	0.484000	0.47621	GAT	ZNF267	-	NULL	ENSG00000185947		0.353	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF267	HGNC	protein_coding	OTTHUMT00000432446.2	-	0.00	58	0	G	NM_003414		31925958	+1	tier1	-	no_errors	ENST00000300870	ensembl	human	known	74_37	missense	28.30	38	15	SNP	0.000	C
ZNF23	7571	genome.wustl.edu	37	16	71482989	71482989	+	Silent	SNP	A	A	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr16:71482989A>G	ENST00000393539.2	-	6	1752	c.939T>C	c.(937-939)tgT>tgC	p.C313C	ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000417828.1_Silent_p.C313C|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000357254.4_Silent_p.C313C|ZNF23_ENST00000428724.2_Silent_p.C255C|ZNF23_ENST00000358700.2_3'UTR|ZNF23_ENST00000564528.1_Silent_p.C255C|AC010547.9_ENST00000561908.1_3'UTR	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		ACGCTTTCCCACAGTCATTAC	0.393																																																	0													70.0	69.0	69.0					16																	71482989		2198	4300	6498	SO:0001819	synonymous_variant	0			X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.939T>C	16.37:g.71482989A>G			Q8NDP5|Q96IT3|Q9UG42	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C313	ENST00000393539.2	37	c.939	CCDS10900.1	16																																																																																			ZNF23	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167377		0.393	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF23	HGNC	protein_coding	OTTHUMT00000268985.23	-	0.00	90	0	A	NM_145911		71482989	-1	tier1	-	no_errors	ENST00000357254	ensembl	human	known	74_37	silent	38.46	32	20	SNP	1.000	G
ZNF43	7594	genome.wustl.edu	37	19	22034809	22034809	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:22034809C>T	ENST00000594012.1	-	0	10				ZNF43_ENST00000595461.1_5'UTR|ZNF43_ENST00000598381.1_5'Flank|ZNF43_ENST00000599414.1_5'UTR	NM_001256649.1|NM_001256651.1|NM_001256653.1|NM_001256654.1	NP_001243578.1|NP_001243580.1|NP_001243582.1|NP_001243583.1	P17038	ZNF43_HUMAN	zinc finger protein 43						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CGGGGATTCCCGAGTTGGAGA	0.612																																																	0																																										SO:0001623	5_prime_UTR_variant	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000594012.1:c.-505G>A	19.37:g.22034809C>T			A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	RNA	SNP	-	NULL	ENST00000594012.1	37	NULL	CCDS59367.1	19																																																																																			ZNF43	-	-	ENSG00000198521		0.612	ZNF43-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000464250.1	-	0.00	11	0	C	NM_003423		22034809	-1	tier1	-	no_errors	ENST00000594312	ensembl	human	known	74_37	rna	37.50	10	6	SNP	0.004	T
ZNF649	65251	genome.wustl.edu	37	19	52399785	52399785	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:52399785A>C	ENST00000354957.3	-	4	462	c.178T>G	c.(178-180)Ttg>Gtg	p.L60V	ZNF649_ENST00000600738.1_Missense_Mutation_p.L60V|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		CCTTGTTCCAACTTGGTGAGG	0.517																																																	0													179.0	137.0	151.0					19																	52399785		2203	4300	6503	SO:0001583	missense	0			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.178T>G	19.37:g.52399785A>C	ENSP00000347043:p.Leu60Val		A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L60V	ENST00000354957.3	37	c.178	CCDS12843.1	19	.	.	.	.	.	.	.	.	.	.	A	12.37	1.917616	0.33815	.	.	ENSG00000198093	ENST00000354957	T	0.00958	5.5	1.95	-0.359	0.12571	Krueppel-associated box (3);	.	.	.	.	T	0.02047	0.0064	M	0.78916	2.43	0.09310	N	1	D	0.56968	0.978	P	0.49829	0.623	T	0.41574	-0.9501	9	0.87932	D	0	.	2.4618	0.04543	0.5191:0.2955:0.1854:0.0	.	60	Q9BS31	ZN649_HUMAN	V	60	ENSP00000347043:L60V	ENSP00000347043:L60V	L	-	1	2	ZNF649	57091597	0.000000	0.05858	0.008000	0.14137	0.005000	0.04900	-0.542000	0.06091	-0.159000	0.11021	0.443000	0.29094	TTG	ZNF649	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198093		0.517	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF649	HGNC	protein_coding	OTTHUMT00000461097.1	-	0.00	101	0	A	NM_023074		52399785	-1	tier1	-	no_errors	ENST00000354957	ensembl	human	known	74_37	missense	29.29	70	29	SNP	0.010	C
ZNF804A	91752	genome.wustl.edu	37	2	185800768	185800768	+	Silent	SNP	T	T	G			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr2:185800768T>G	ENST00000302277.6	+	4	1239	c.645T>G	c.(643-645)tcT>tcG	p.S215S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	215							metal ion binding (GO:0046872)	p.S215S(1)		NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TCGGCTTTTCTTTTGCATTTC	0.433																																																	1	Substitution - coding silent(1)	large_intestine(1)											66.0	67.0	66.0					2																	185800768		2203	4300	6503	SO:0001819	synonymous_variant	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.645T>G	2.37:g.185800768T>G			A7E253|Q6ZN26	Silent	SNP	pfam_Znf_C2H2_jaz	p.S215	ENST00000302277.6	37	c.645	CCDS2291.1	2																																																																																			ZNF804A	-	NULL	ENSG00000170396		0.433	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	35	0	T	NM_194250		185800768	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	silent	38.18	34	21	SNP	0.998	G
ZNF883	169834	genome.wustl.edu	37	9	115760206	115760206	+	lincRNA	SNP	G	G	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr9:115760206G>T	ENST00000427548.1	-	0	1607							P0CG24	ZN883_HUMAN	zinc finger protein 883						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TGATTTCTAAGGGATGACCTA	0.388																																																	0													68.0	73.0	71.0					9																	115760206		2159	4286	6445			0			AK095843		9q32	2010-07-23			ENSG00000228623	ENSG00000228623		"""Zinc fingers, C2H2-type"""	27271	protein-coding gene	gene with protein product							Standard	NM_001101338		Approved		uc011lwy.2	P0CG24	OTTHUMG00000020514		9.37:g.115760206G>T				RNA	SNP	-	NULL	ENST00000427548.1	37	NULL		9																																																																																			ZNF883	-	-	ENSG00000228623		0.388	ZNF883-001	KNOWN	basic	lincRNA	ZNF883	HGNC	lincRNA	OTTHUMT00000053704.1		0.00	44	0	G	NM_001101338		115760206	-1			no_errors	ENST00000427548	ensembl	human	known	74_37	rna	6.00	47	3	SNP	0.463	T
ZNF98	148198	genome.wustl.edu	37	19	22575670	22575670	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr19:22575670T>C	ENST00000357774.5	-	4	488	c.367A>G	c.(367-369)Aga>Gga	p.R123G		NM_001098626.1	NP_001092096.1	A6NK75	ZNF98_HUMAN	zinc finger protein 98	123					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				CAGTATTTTCTTAACTGTAAA	0.333																																																	0													64.0	55.0	58.0					19																	22575670		1981	4191	6172	SO:0001583	missense	0				CCDS46031.1	19p12	2014-02-14	2010-04-20	2008-06-12	ENSG00000197360	ENSG00000197360		"""Zinc fingers, C2H2-type"", ""-"""	13174	protein-coding gene	gene with protein product	"""zinc finger protein 739"""	603980					Standard	NM_001098626		Approved	ZNF739, F7175	uc002nqt.2	A6NK75	OTTHUMG00000182940	ENST00000357774.5:c.367A>G	19.37:g.22575670T>C	ENSP00000350418:p.Arg123Gly			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R123G	ENST00000357774.5	37	c.367	CCDS46031.1	19	.	.	.	.	.	.	.	.	.	.	.	4.251	0.045638	0.08196	.	.	ENSG00000197360	ENST00000357774	T	0.07114	3.22	0.916	-1.37	0.09056	.	.	.	.	.	T	0.10035	0.0246	M	0.79343	2.45	0.09310	N	1	B	0.18863	0.031	B	0.19946	0.027	T	0.35574	-0.9783	9	0.39692	T	0.17	.	3.5855	0.07969	0.3347:0.0:0.0:0.6653	.	123	A6NK75	ZNF98_HUMAN	G	123	ENSP00000350418:R123G	ENSP00000350418:R123G	R	-	1	2	ZNF98	22367510	0.000000	0.05858	0.038000	0.18304	0.037000	0.13140	-0.758000	0.04766	0.257000	0.21650	0.254000	0.18369	AGA	ZNF98	-	NULL	ENSG00000197360		0.333	ZNF98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF98	HGNC	protein_coding	OTTHUMT00000464398.1	-	0.00	86	0	T	NM_001098626		22575670	-1	tier1	-	no_errors	ENST00000357774	ensembl	human	known	74_37	missense	33.33	50	25	SNP	0.080	C
ZNHIT1	10467	genome.wustl.edu	37	7	100865991	100865991	+	Silent	SNP	C	C	T			TCGA-L5-A4OX-01A-21D-A28B-09	TCGA-L5-A4OX-11A-13D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a0100a84-b16a-432c-935b-67a81d52dbb4	de784953-ec41-44ff-bd65-be7385844fca	g.chr7:100865991C>T	ENST00000305105.2	+	2	657	c.129C>T	c.(127-129)gaC>gaT	p.D43D	ZNHIT1_ENST00000492315.1_3'UTR	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1	43					negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					TCCAGGATGACCCCCACGCGG	0.672																																																	0													55.0	55.0	55.0					7																	100865991		2203	4300	6503	SO:0001819	synonymous_variant	0			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.129C>T	7.37:g.100865991C>T			Q6IB12	Silent	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.D43	ENST00000305105.2	37	c.129	CCDS5716.1	7																																																																																			ZNHIT1	-	NULL	ENSG00000106400		0.672	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT1	HGNC	protein_coding	OTTHUMT00000347488.1	-	0.00	105	0	C	NM_006349		100865991	+1	tier1	-	no_errors	ENST00000305105	ensembl	human	known	74_37	silent	34.83	58	31	SNP	1.000	T
